WO2025262002A2

WO2025262002A2 - Antisense oligonucleotides for treating alzheimer's disease

Info

Publication number: WO2025262002A2
Application number: PCT/EP2025/066815
Authority: WO
Inventors: Olav Michael Andersen; Emilie DAM ROSENBERG; Mads FUGLSANG KJØLBY
Original assignee: Aarhus Universitet
Current assignee: Aarhus Universitet
Priority date: 2024-06-17
Filing date: 2025-06-17
Publication date: 2025-12-26
Anticipated expiration: 2026-12-17
Also published as: WO2025262002A3

Abstract

The present disclosure concerns antisense oligonucleotides (ASO) binding to a target site on exon 23 of the pre-mRNA of SORL1. The present invention further concerns a composition comprising said ASO. The present invention further concerns an ASO for use as a medicament. The present invention further concerns an ASO for use in the prevention, treatment and/or alleviation of e.g. Alzheimer's Disease (AD). The present invention further concerns a method for mediating exon skipping of exon 23 in SORL1 transcripts, a method of determining the efficiency of ASO mediated SORL1 exon 23 skipping, a method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon 23 skipping, and a method of producing an ASO suitable for treatment of a patient with Alzheimer's Disease.

Description

Antisense oligonucleotides for treating Alzheimer’s Disease

Technical field

Disclosed herein are compounds, compositions and methods for modulating splicing of SORL1 mRNA in a cell, tissue or animal. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders, including Alzheimer’s disease. Specifically, the present invention relates to antisense oligonucleotides (ASOs) causing exon skipping of exon 23 in a SORL1 transcript.

Background

SORLA is important for Amyloid Precursor Protein (APP) transport out of the endosomes where, if not counteracted by SORLA, amyloidogenic processing of APP into pathogenic fragments (i.e. the Amyloid p-peptide (A )) occurs. This SORLA- assisted transport of APP ensures a decreased cleavage of APP by the p-secretase, thereby reducing the production of the p-C-terminal fragment (CTF) that can subsequently be further processed to generate amyloid beta (Ap) peptides.

In Alzheimer’s disease (AD), Ap accumulates in amyloid plaques within the brain, and is the most important pathological hallmark of the disease. However, the etiology of the disease is rather linked to the level of P-CTF, and other cargo proteins, that in AD cannot be recycled out of the endosome, leading to endosomal swelling and dysfunctional endosomal activity (i.e. the Endosomal Traffic Jam hypothesis for Alzheimer’s disease).

The ability of SORLA to engage in endosomal recycling is linked to a motif in its cytoplasmic tail (i.e. the FANSHY motif) that is important for interaction with the retromer complex and which assists to traffic cargo out of endosomes.

The SORL1 gene - encoding the endosomal sorting receptor SORLA - has been associated with the development of Alzheimer’s disease during the last 15 years. More recently, large whole-exome sequencing studies have identified how SORL1 is the gene harbouring the most genetic variation across the human genome in groups of AD patients.

The combined group of “loss-of-function” (LOF) variants located in SORL1 is linked with a 36-fold increased Odds Ratio (OR=36) risk of early-onset AD and 7-fold increased risk of late-onset AD. The overall group of missense variants has been found to be associated with a 2.7-fold and 1.9-fold increased risk of early-onset and late- onset AD, respectively.

Interestingly, SORL1 variants from patients with Alzheimer’s disease spread across the entire SORL1 gene, and thus >25% of all variants locate to the genomic region encoding the eleven complement-type repeat (CR) domains. CR-domains represent the main ligand-binding site in all known receptors that contain clusters of CR-domains. Also the cluster of CR-domains of SORLA is involved in binding to ligands, incl. APP. Consequently, mutations in CR-domains can have grave consequences on the functionality of SORLA, both with regard to ligand binding but also with regard to misfolding and ER retention of the protein.

While knowledge has been gained regarding genetic markers predicting a risk or causal connection for developing AD, no approved treatment for AD is available to date and AD remains to be an immense burden to patients and the health care system.

Summary

CR-domains represent the main ligand-binding site in most receptors that contain clusters of CR-domains. Also the cluster of CR-domains of SORLA is involved in binding to ligands, incl. APP. However, the typical binding of any ligand does not depend on any isolated CR-domain, but many studies have rather shown how binding is achieved by combined interaction of a number of CR-domains with several sites on their ligand.

The inventors of the present invention have, by carefully studying SORLA domains and their functionality in physiology and pathology, realized that it is a feasible approach to target a single or more SORLA CR-domains with the aim to remove CR-domains that are non-functional due to mutations and are detrimental to the entire protein. The presence or absence of individual CR-domains has only subtle effects on the affinity for SORLA ligands. As disclosed herein, a mutated CR-domain is removed from SORLA by employing an exon-skipping approach, where specifically designed antisense oligonucleotides (ASOs) are used to remove exon 23 carrying mutations. As a consequence, a functional SORLA protein, lacking the specific CR-domain encoded by exon 23, can be produced. This approach has several advantages. Firstly, ASO’s delivered to the brain of AD patients can restore functional SORLA protein in vivo. AD patients carrying genetic variants that lead to mutations in CR-domains are producing SORLA protein, however, due to the mutation this protein is not functional. This mutated SORLA protein misfolds and gets pathologically retained in the endoplasmatic reticulum (ER). By removing the mutated CR-domain by ASO- induced exon skipping, functional SORLA protein can be produced that retains its functionality with regard to ligand binding, translocation out of the ER, as well as ensuring that SORLA, comprising many important domains, can proceed through the endosomal pathway in a physiological manner. In summary, instead of a mutated protein that completely abolishes the functionality of the whole protein, an isoform lacking a CR-domain can be produced, this isoform being able to function physiologically. The use of an ASO to induce exon-skipping is a reversible method compared to CRISPR-cas mediated genomic editing that is an irreversible process.

Secondly, mutated SORLA protein can have a dominant negative effect on non-mutated SORLA (produced from a non-affected allele) due to SORLA dimer formation. The mutated SORLA will lead to misfolding and retention of the non-mutated SORLA in the dimer. As such, the level of functional SORLA will be even more reduced, and as a consequence amyloidogenic processing of APP into pathogenic fragments cannot be counteracted any longer. However, by using the present invention, i.e. ASO mediated exon-skipping of mutated a SORLA CR-domain, SORLA protein lacking a CR-domain will be produced in the cell, and this variant will not induce misfolding.

In a main aspect of the invention, the present invention concerns an antisense oligonucleotide (ASO) comprising or consisting of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity, wherein binding of the antisense oligonucleotide to a target site causes exon skipping of exon 23 encoding a complement-type repeat (CR) domain of SORLA. In a further aspect, the present disclosure is directed to an antisense oligonucleotide (ASO) binding or capable of binding to a target site comprising or consisting of a target polynucleotide sequence having at least 80% sequence identity to a target polynucleotide sequence selected from the group consisting of: SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID

NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID

NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID

NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, such as at least 85%, 90%, 95%, 98%,

99% or 100% sequence identity, wherein binding to the target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA.

In a further aspect, the present disclosure is directed to a composition comprising the antisense oligonucleotide, such as a pharmaceutical composition.

In a further aspect, the present disclosure is directed to an antisense oligonucleotide (ASO) and/or the composition, for use as a medicament.

In a further aspect, the present disclosure is directed to an antisense oligonucleotide (ASO) and/or the composition, for use in the prevention, treatment and/or alleviation of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies, or a disease or disorder associated with Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies.

In a further aspect, the present disclosure is directed to use of an antisense oligonucleotide in the manufacture of a medicament for treatment of Alzheimer’s Disease, Parkinson’s Disease, and/or Dementia with Lewy bodies.

In a further aspect, the present disclosure is directed to a method for treatment of Alzheimer’s Disease, Parkinson’s Disease, and/or Dementia with Lewy bodies comprising administration of a therapeutically effective amount of an antisense oligonucleotide to a subject in need thereof. In a further aspect, the present disclosure is directed to a method for mediating exon skipping in SORL1 transcripts in a cell, tissue or organ, wherein the method comprises the step of contacting said cell, tissue or organ with the antisense oligonucleotide and/or the composition, wherein the exon is exon 23 of SORL1.

In a further aspect, the present disclosure is directed to a method of determining the efficiency of ASO mediated SORL1 exon skipping in a subject, the method comprising the following steps: a) analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in a first sample comprising cerebrospinal fluid derived from a patient, obtained before treatment with an ASO, such as any ASO as defined herein, b) analyzing the levels of SORLA lacking the complement-type repeat encoded by exon 23 in a second sample comprising cerebrospinal fluid derived from the same patient as in a), obtained after treatment with an ASO, c) comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the samples of a) and b), and d) determining exon skipping if the level of SORLA lacking the complement-type repeat encoded by exon 23 in b) is higher than in a).

In a further aspect, the present disclosure is directed to a method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, such as any ASO as defined herein, d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in the first and the second aliquot, f. comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first aliquot is higher than in the second aliquot.

In a further aspect, the present disclosure is directed to a method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, such as any ASO as defined herein, d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of endoplasmic reticulum-resident SORLA in the first and the second aliquot, f. comparing the level of endoplasmic reticulum-resident SORLA in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of endoplasmic reticulum-resident SORLA in the second aliquot is higher than in the first aliquot.

In a further aspect, the present disclosure is directed to a method of producing an ASO suitable for treatment of a patient with Alzheimer’s Disease, wherein the patient carries a mutation in an exon encoding a complement-type repeat (OR) domain of SORLA, the method comprising the following steps: a. identifying an ASO, such as any ASO as defined herein, b. determining if the target site of the ASO comprises the mutation, or if the target size of the ASO does not comprise the mutation, and c. determining that the ASO that binds to a target site not comprising the mutation is suitable for treatment of a patient with Alzheimer’s Disease. Description of Drawings

Figure 1 Establishment of RT-PCR detection method for the skipping of exon 23 from the SORL1 transcripts

Agarose gels with PCR-products from reactions carried out using annealing temperatures from 42 to 71 Celsius. The ladder shows DNA bands of the indicated lengths. All PCR reactions were performed with RNA isolated from transfected HEK293 cells. FL indicates that the HEK293 cells have been transfected with a plasmid overexpressing full length SORL1 transcript, whereas A23 indicates transfection with a plasmid resulting in cells overexpressing the delta exon 23 transcript of SORL1. Box indicates annealing temperature of 66 as most efficient condition.

Figure 2 Identification and Validation of A SOs for skipping of SORL1 Exon 23 using the eSkip-finder tool

Panels A), C) and E) display agarose gels with PCR-products from reactions using samples from HEK293 cells transfected with ASO 23.17, ASO 23.54, and ASO 23.63, respectively, at concentrations at 100, 200, and 400nM. All three ASOs were tested using MOE and O-Me backbone chemistry as indicated. The amplified product for transcripts with exon 23 were 382 nt in length, while transcripts without exon 23 were 268 nt in length. The ladder shows DNA bands of the indicated lengths.

Panels B), D) and F) display graphs showing the percentage of transcripts with skipping of SORL1 exon 23 relative to the full-length transcript for the six tested ASO compounds each at tested at three different concentrations.

Figure 3 Sanger sequencing of exon 23 skipped SORL1 transcript

The PCR products from HEK293 cells transfected with 200 nM of ASO 23.63 (O’Me) were analyzed by agarose gel analysis, and the band migrating corresponding to 268 nt was excised from the gel, purified following standard protocols and sequenced by Sanger sequencing. The shown sequence corresponds to the junction between exon 22 (SEQ ID NO: 90) and exon 24 (SEQ ID NO: 91) that arise from the skipping of the SORL1 exon 23. Figure 4 Identification and Validation of ASOs for skipping of Exon 23 using Exon-Walk

A)-C) display the target sequences of the 30 ASOs that were included in the exon-walk experiments (EW1-EW30 (SEQ ID NOs:27, 31-32, 40-48, 72-89)), targeted by the 30 ASOs (EW1-EW30 (SEQ ID NOs: 3, 7-8, 16-24, 54-71)), on top of the SORL1 exon 23 sequence (Capital letters) and flanking intronic sequences (lower case letters) (SEQ ID NO: 92) displayed in the three parts (SEQ ID NOs: 109-111). Below the SORL1 sequence is indicated the position and target sequence of the three tool-designed ASOs (TD.17/ASO23.17 (SEQ ID NO: 39); TD.54/ASO23.54 (SEQ ID NO: 38);

TD.63/ASO23.63 (SEQ ID NO: 26)).

D) displays a schematic representation of the above ASO sequences used for skipping of SORL1 exon 23.

E-F) display representative images of agarose gel analysis from one biological replicate (out of three) demonstrating the effect on exon 23 skipping by the 30 ASOs designed for the Exon-Walk (EW) strategy.

G) displays a bar graph showing the percentage of SORL1 transcript that have been deleted of exon 23 by the three biological replicate experiments that measured the effect on exon 23 skipping by the 30 ASOs designed for the Exon-Walk (EW) strategy.

Figure 5 ASO shortening to avoid overlap with the codon for Arg-1080

The agarose gel image show products for RT-PCR analysis of transcripts isolated from HEK293 cells treated with the indicated ASOs at 12 nM. The migration of the amplicons generated from transcript including (FL) or excluding SORL1 exon 23 (Aex23) are indicated with arrows. The amplified product for transcripts with exon 23 were 377 nt in length, while transcripts without exon 23 were 267 nt in length.

Figure 6 Validation that ASO23.63 does not lead to lower SORL1 protein expression

Representative WB analysis of lysates from HEK293 cells treated with ASOs that induced skipping of SORL1 exon 23 to investigate if unwanted site-effect on protein levels occurred.

The upper panel show SORL1 protein as detected with the LR11 antibody that bind to both full-length SORL1 as well as the truncated receptor form deleted of CR1 (as the epitope for the monoclonal LR11 resides in CR7). The bottom panel represent a loading control with detection of beta-Actin.

Figure 7 EC50 determination for three ASOs using concentration series in HEK293 cells by RT-PCR agarose gels

Agarose gel images showing PCR products from RT-PCR analysis of transcripts isolated from HEK293 cells treated with A) ASO23.63, B) ASO23.63.10, or C) ASO EW.09 at concentrations from 0.1 nM to 400nM. Cells transfected with Lipofectamine without any ASO content (Lipo; Onm) is set as negative control. The migration of the amplicons generated from transcript including (FL) or excluding SORL1 exon 23 (Aex23) are indicated with arrows.

Figure 8 EC50 determination for three ASOs using concentration series in HEK293 cells and qPCR quantifications

A) Bar graph showing the relative level of SORL1 transcripts that contain exon 23 after treatment of HEK293 cells with an increasing dose of the three different ASOs as compared to non-treated cells.

ASO23.63 (SEQ ID NO: 2), ASO23.63.10 (SEQ ID NO: 1) or ASO EW.09 (SEQ ID NO: 3) as also tested by RT-PCR. The qPCR results depicted in the graph were normalized to the expression of housekeeping gene HPRT and the total level of SORL1 (determined with a taq-man assay specific for the exon3-exon4 boundary) and are displayed as relative percentage to non-treated cells corresponding to 0 nM ASO.

B) Bar graph showing the level of SORL1 transcript without exon 23 after treatment of HEK293 cells with an increasing dose of the three different ASOs ASO23.63, ASO23.63.10 or ASO EW.09 as also tested by RT-PCR. The qPCR results depicted in the graph were normalized to the expression of housekeeping gene HPRT and the total level of SORL1 (determined with a taq-man assay specific for the exon3-exon4 boundary) and are displayed as relative percentage to non-treated cells corresponding to 0 nM ASO.

C) Bar graph showing the total level of SORL1 transcript as determined with a taq-man assay specific for the exon3-exon4 boundary (thus independent on whether transcripts are with or without exon 23) after treatment of HEK293 cells with an increasing dose of the three different ASOs ASO23.63, ASO23.63.10 or ASO EW.09 as also tested by RT-PCR. The qPCR results depicted in the graph were normalized to the expression of housekeeping gene HPRT and are displayed as relative percentage to non-treated cells corresponding to 0 nM ASO.

D-F) Two different ways to estimate the relative ability of tested ASOs to induce skipping of SORL1 exon 23. Top panels show fitting of the data from the level of transcripts that contain exon 23, and where the treatment with ASO led to inhibition of including exon 23. IC50 values were estimated using PRISM software. The ASO23.63 trended better inhibitory abilities than the other two ASO compounds, although not statistically significant. The bottom panels depict the data from the levels of transcripts that does not contain exon 23, and thus where treatment with ASO led to induction of the transcript.

Figure 9 ASO shortening according to overlap in identified sequences

A) The target sequences (SEQ ID NOs: 25, 28-30, 33-37) of shorter ASOs (SEQ ID NOs: 1, 4-6, 9-13), compared to the target sequences of ASO23.63 (SEQ ID NO: 26), EW.9 (SEQ ID NO: 27), TD.54 (SEQ ID NO: 38), and TD.17 (SEQ ID NO: 39), and shown below the SORL1 exonic sequence (SEQ ID NO: 93).

B) Agarose gel analysis of RT-PCR product from cells treated with the different ASO compounds tested at 12nM.

Figure 10 Establishing RT-PCR protocols for detection of exon-exclusion of flanking exons in the human SORL1

Agarose gels with PCR-products from reactions carried out using annealing temperatures from 46 to 68 Celsius. The ladder shows DNA bands of the indicated lengths. All PCR reactions was performed with RNA isolated from HEK293 cells. “%” indicate that the HEK293 cells have been transfected with a plasmid overexpressing full length SORL1 transcript, whereas “A” indicates transfection with a plasmid overexpressing a transcript of SORL1 lacking the indicated exon. (A) The amplified product for transcripts with exon 24 were 351 nt in length, while transcripts without exon 24 were 228 nt in length, (B) the amplified product for transcripts with exon 30 were 326 nt in length, while transcripts without exon 30 were 198 nt in length, (C) the amplified product for transcripts with exon 25 were 342 nt in length, while transcripts without exon 25 were 222 nt in length, (D) the amplified product for transcripts with exon 26 were 324 nt in length, while transcripts without exon 26 were 198 nt in length, (E) the amplified product for transcripts with exon 33 were 360 nt in length, while transcripts without exon 33 were 220 nt in length, and (F) the amplified product for transcripts with exon 31 were 358 nt in length, while transcripts without exon 31 were 202 nt in length.

Figure 11 Testing for off-target effects of most promising ASOs for effects on splicing of exons 25 and 30

Off-target response in A) exon 25 and B) exon 30 of ASO candidates EW.19, EW.21, TD.54 and TD.63. The agarose gels contain PCR-products from reactions carried out using annealing temperatures A) 54 °C and b) 58 °C. The ladders show DNA bands of the indicated lengths. All PCR reactions was performed with RNA isolated from HEK293 cells. The HEK293 cells was transfected with 400 nM of the ASO candidates EW.19, EW.21 , TD.54 or TD.6348 hours prior to harvest of RNA. FL indicate the full- length transcripts a) the amplified product of full-length transcript for exon 25 should be 342 nt in length and b) the amplified product of full-length transcript for exon 30 should 326 nt in length. A) A25 indicate the amplified products of transcripts without exon 25 were 222 nt in length, while B) A30 indicate the amplified products of transcripts without exon 30 were 198 nt in length

Figure 12 Testing for off-target effects of most promising ASOs for effects on splicing of exons 31 and 24

Off-target response in A) exon 31 and B) exon 24 of ASO candidates EW.19, EW.21, TD.54 and TD.63. The agarose gels contain PCR-products from reactions carried out using annealing temperatures a) 58 °C and b) 60 °C. The ladders show DNA bands of the indicated lengths. All PCR reactions was performed with RNA isolated from HEK293 cells. The HEK293 cells was transfected with 400 nM of the ASO candidates EW.19, EW.21 , TD.54 or TD.6348 hours prior to harvest of RNA. FL indicate the full- length transcripts a) the amplified product of full-length transcript for exon 31 should be 358 nt in length and b) the amplified product of full-length transcript for exon 24 should be 351 nt in length. A) A31 indicate the amplified products of transcripts without exon 31 were 202 nt in length, while B) A24 indicate the amplified products of transcripts without exon 24 were 228 nt in length Figure 13 Testing for off-target effects of most promising ASOs for effects on splicing of exon 26

Off-target response in exon 26 of ASO candidates EW.19, EW.21, TD.54 and TD.63. The agarose gels contain PCR-products from reactions carried out using annealing temperatures of 60 °C. The ladder shows DNA bands of the indicated lengths. All PCR reactions were performed with RNA isolated from HEK293 cells. The HEK293 cells were transfected with 400 nM of the ASO candidates EW.19, EW.21, TD.54 or TD.63 48 hours prior to harvest of RNA. FL indicates the full-length transcripts and the amplified product of full-length transcript for exon 26 should be 324 nt in length. A26 indicate the amplified products of transcripts without exon 26 were 198 nt in length.

Figure 14 Comparison of ASOs with previously described ASOs

A) Bargraph showing the total level of SORL1 transcript as determined with a taq-man assay specific for the exon3-exon4 boundary and normalized based on taq-man assay specific for HPRT 1 (thus independent on whether transcripts are with or without exon 23) B) Bargraph showing the total level of SORL1 with exon 23 transcript determined with a taq-man assay specific for the exon22-exon23 boundary and normalized based on taq-man assay specific for HPRT1 and the total SORL1 transcript. C) Bargraph showing the total level of SORL1 A23 transcript determined with a taq-man assay designed as described in example 8 specific for the exon22-exon24 boundary in the SORL1 A23 variant and normalized based on taq-man assay specific for HPRT1 and the total SORL1 transcript. D) agarose gel visualizing samples with using RT-PCR.

Detailed description

Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in art to which the subject matter herein belongs. As used herein, the following definitions are supplied to facilitate the understanding of the present invention.

The term “comprise” is generally used in the sense of include, that is to say permitting the presence of one or more features or components. In addition, as used in the specification and claims, the language "comprising" can include analogous embodiments described in terms of “consisting of’ and/or “consisting essentially of”. As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly states otherwise.

As used herein "sequence identity" refers to the extent to which two optimally aligned polynucleotide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. An "identity fraction" for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in reference sequence segment, i.e. , the entire reference sequence or a smaller defined part of the reference sequence. As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference polynucleotide molecule (or its complementary strand) as compared to a test polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totalling less than 20 percent of the reference sequence over the window of comparison). Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and preferably by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, CA). An "identity fraction" for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction times 100. The comparison of one or more polynucleotide sequences refer to a full-length polynucleotide sequence.

The term “some embodiments” can include one, or more than one embodiment. The use of the word “a” or “an” when used throughout the text or in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Thus, for example, reference to “ASO” includes a plurality of such ASOs, such as one or more ASOs, at least one ASOs, or two or more ASOs.

The term "exon skipping" is herein defined as inducing, producing or increasing production within a cell of a mature mRNA that does not contain a particular exon that would be present in the mature mRNA without exon skipping.

As used herein, the term “exons” are coding sections of an RNA transcript, or the DNA encoding it, that may be translated into protein. Exons can be separated by intervening sections of DNA that do not code for proteins, known as introns. Following transcription, new, immature strands of messenger RNA, called pre-mRNA, may contain both introns and exons. These pre-mRNA molecules may undergo a modification process in the nucleus called splicing during which the noncoding introns are cut out and only the coding exons remain. Splicing produces a mature messenger RNA molecule that may be translated into a protein.

As used herein, "GC content" and its derivatives, refers generally to the cytosine and guanine content of a nucleic acid molecule.

The term “SORLA” as used herein is synonymous to the terms SORLA, Sortilin-related receptor, sortilin related receptor 1 , SORL1 , Low-density lipoprotein receptor relative with 11 ligand-binding repeats, LDLR relative with 11 ligand-binding repeats, LR11 , SorLA-1 , Sorting protein-related receptor containing LDLR class A repeats and gp250. Human sorLA is annotated in UniProt under the accession number Q92673.

The term “tool-designed” (TD) refers to ASOs designed using the eSkip-finder online tool. The TD ASOs are interchangeable referred to with the prefix “23.”. Thus, the terms “TD.63” and “23.63” are used interchangeably. The term “TD.17” and “23.17” are used interchangeably. The term “TD.54” and “23.54” are used interchangeably. “CA” is interchangeable referred to with the prefix “23.63”. CA.1 and 23.63.1 are used interchangeably herein. CA.2 and 23.63.2 are used interchangeably herein. CA.3 and 23.63.3 are used interchangeably herein. CA.4 and 23.63.4 are used interchangeably herein. CA.5 and 23.63.5 are used interchangeably herein. CA.6 and 23.63.6 are used interchangeably herein. CA.7 and 23.63.7 are used interchangeably herein. CA.8 and 23.63.8 are used interchangeably herein. CA.9 and 23.63.9 are used interchangeably herein. CA.10 and 23.63.10 are used interchangeably herein.

The term "modified nucleotide" or “nucleotide modification” or “modification” refers to a nucleotide the basic structural unit of nucleic acids, RNA or DNA that has been chemically modified, but still functions as a nucleotide. As used herein “modification” refers modifications of the nucleic acid backbone, the nucleobase, the ribose sugar and/or 2'-ribose substitutions, wherein the polynucleotide sequence remains unaltered.

The term used herein "antisense oligonucleotide" encompasses nucleic acids-based molecules complementary to a target mRNA, particularly a seed sequence of the target mRNA to form duplex with the target mRNA.

Real-time polymerase chain reaction (PCR)" (also referred to as "RT-PCR") refers to a type of PCR that amplifies and simultaneously quantify a target DNA molecule. Its key feature is that the amplified DNA is detected as the reaction progresses in real time. The term qPCR (or qRT-PCR) refers to a quantitative approach for transcript measurements.

Antisense Oligonucleotides

The present invention takes advantage of antisense oligonucleotides for inducing exonskipping in the pre-mRNA transcripts (also referred to as precursor mRNA). This type of antisense-mediated splicing modulation uses antisense oligonucleotides (ASOs) to manipulate the splicing. Without being bound by theory, ASOs may induce exon skipping by sterically blocking the binding of splicing factors to pre-mRNA transcripts (also referred to as precursor mRNA).

The Antisense Oligonucleotides described herein may, in some embodiments, be further characterized by the modifications, and/or properties described in the sections “Modifications of the ASOs” and section “Properties of the ASOs” of the present disclosure.

In one aspect, the present disclosure concerns an antisense oligonucleotide (ASO) comprising or consisting of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity, wherein binding of the antisense oligonucleotide to a target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA. In some embodiments, the antisense oligonucleotide binds or is capable of binding to a target site on the pre-mRNA of SORL1 .

In one aspect, the present disclosure concerns an antisense oligonucleotide (ASO) comprising or consisting of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity, wherein binding of the antisense oligonucleotide to a target site causes exon skipping of exon 23 encoding a single complement-type repeat (CR) domain of SORLA. In some embodiments, the antisense oligonucleotide binds or is capable of binding to a target site on the pre-mRNA of SORL1.

In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, and SEQ ID NO: 13 In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 14 or SEQ ID NO: 17

In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 1. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 2. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 3. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 4. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 5. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 6. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 7. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 8. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 9. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 10. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 11. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 13. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 14. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 15. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 16. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 17. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 18. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 19. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 20. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 21. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 22. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 23. In some embodiments, the ASO comprises or consists of a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 24.

Analogously, the ASOs of the present invention may be defined by the polynucleotide sequence to which the ASOs bind or are capable of binding. The polynucleotide sequence to which the ASOs bind or are capable of binding may be referred to as target sites or target polynucleotide sequences. In another aspect, the present disclosure concerns an antisense oligonucleotide (ASO) binding or capable of binding to a target site comprising or consisting of a target polynucleotide sequence having at least 80% sequence identity to a target polynucleotide sequence selected from the group consisting of: SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33,

SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38,

SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43,

SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity, wherein binding to the target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA. In some embodiments, the antisense oligonucleotide is targeted to a 5’ splice site, a 3’ splice site and/or an exonic splice enhancer site (ESE).

In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 25. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 26. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 27. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 28. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 29. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 30. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 31. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 32. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 33. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 34. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 35. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 36. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 37. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 38. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 39. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 40. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 41. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 42. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 43. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 44. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 45. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 46. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 47. In some embodiments, the (ASO) binding or capable of binding to a target site comprises or consists of a target polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 48

As described above, the antisense oligonucleotides may induce exon skipping. Without being bound by theory, the exon skipping mediated by the ASOs may be induced by sterically blocking the binding of splicing factors to pre-mRNA transcripts (also referred to as precursor mRNA). The ASOs may be used for inducing skipping of exon 23 that comprises a mutation. In some embodiments, binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (CR) domain of SORLA, wherein exon 23 comprises or consists of a polynucleotide sequence of SEQ ID NO: 49, or a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 49, such as at least 85%, 90%, 95%, 98% or 99% sequence identity. In some embodiments, binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (CR) domain of SORLA, wherein exon 23 comprises or consists of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107 such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity. In some embodiments, binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA, wherein exon 23 comprises a mutation selected from the list consisting of: p.C1078R (T>C), p.R1080C (C>T), p.R1084C (C>T), p.W1095C (G>C), P.W1096C (G>C), p.D1102N (G>A), p.C1103Y (G>A), p.D1105H (G>C), p.D1108N (G>A), and p.C1112Y (G>A).

Modifications of the ASOs

The oligonucleotides of the present invention described herein, such as in the sections of the present disclosure “Antisense Oligonucleotides” or “Properties of the ASOs”, may comprise one or more modifications, for example to increase stability of the antisense oligonucleotides.

In some embodiments, the antisense oligonucleotide further comprises one or more modifications at at least one nucleotide position, or at each nucleotide position. In some embodiments, the modifications are modifications of the nucleic acid backbone, the nucleobase, the ribose sugar and/or 2'-ribose substitutions.

In some embodiments, the antisense oligonucleotide comprises one or more modifications, such as two or more, such as three or more modifications, selected from the group consisting of: Peptide nucleic acid (PNA), Serinol nucleic acid (SNA), Phosphorodiamidate morpholino oligomer (PMO), Thiomorpholino oligonucleotide (TMO), and Morpholino nucleic acid (MNA). In some embodiments, the antisense oligonucleotide comprises a Peptide nucleic acid (PNA) modification. In some embodiments, the antisense oligonucleotide comprises a Serinol nucleic acid (SNA) modification. In some embodiments, the antisense oligonucleotide comprises a Phosphorodiamidate morpholino oligomer (PMO) modification. In some embodiments, the antisense oligonucleotide comprises a Thiomorpholino oligonucleotide (TMO) modification. In some embodiments, the antisense oligonucleotide comprises a Morpholino nucleic acid (MNA) modification.

In some embodiments, the antisense oligonucleotide comprises one or more modifications, such as two or more, such as three or more modifications, of the nucleic acid backbone selected from the group consisting of: Phosphorothioate (PS) modifications, Mesyl phosphoramidate (MsPA) modifications, p-toluenesulfonyl phosphoramidate (Ts) modifications, and 4- (trimythylammonio)butylsulfonyl phosphoramidate (N+) modifications. In some embodiments, the antisense oligonucleotide comprises a Phosphorothioate (PS) modification of the nucleic acid backbone. In some embodiments, the antisense oligonucleotide comprises a Mesyl phosphoramidate (MsPA) modification of the nucleic acid backbone. In some embodiments, the antisense oligonucleotide comprises a p-toluenesulfonyl phosphoramidate (Ts) modification of the nucleic acid backbone. In some embodiments, the antisense oligonucleotide comprises a 4- (trimythylammonio)butylsulfonyl phosphoramidate (N+) modification of the nucleic acid backbone.

In some embodiments, the antisense oligonucleotide comprises one or more modifications of the ribose sugar selected from the group consisting of: 2’-O-methyl (2’- OMe), 2’-O-methoxyethyl (2’MOE), 2’-fluoro (2’-F), Locked nucleic acid (LNA), 2’- 0,4’C-ethylene-bridged nucleic acid (ENA), 2’,4’-constrained 2’-0-ethyl (cEt), Amidobridged nucleic acid (AmNA), Guanidine-bridged nucleic acid (GuNA), Cyclohexenyl nucleic acid (CeNA), Anhydrohexitol nucleic acid (HNA), Altritol nucleic acid (ANA), Tricyclo-DNA (tc-DNA), and 7’, 5’-alpha-bicyclo-DNA (7’5’-a-bc-DNA).

In some embodiments, the antisense oligonucleotide comprises a 2’-O-methyl (2’-OMe) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises 2’-O-methoxyethyl (2’MOE) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises a 2’-fluoro (2’-F) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises a 2’- 0,4’C-ethylene-bridged nucleic acid (ENA) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises a 2’,4’-constrained 2’-0-ethyl (cEt) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises an Amido-bridged nucleic acid (AmNA) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises a Guanidine-bridged nucleic acid (GuNA) modification of the ribose sugar. Cyclohexenyl nucleic acid (CeNA) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises an Anhydrohexitol nucleic acid (HNA) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises an Altritol nucleic acid (ANA) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises a Tricyclo-DNA (tc-DNA) modification of the ribose sugar. In some embodiments, the antisense oligonucleotide comprises a 7’, 5’-alpha- bicyclo-DNA (7’5’-a-bc-DNA) modification of the ribose sugar.

In some embodiments, the antisense oligonucleotide comprises one or more 2’, 4’- constrained 2'-0-Ethyl (cEt) modifications. In some embodiments, the antisense oligonucleotide comprises one or more 2'-O-Methylation (2’-0me) modifications. In some embodiments, the antisense oligonucleotide comprises one or more phosphorothioate modifications. In some embodiments, the antisense oligonucleotide comprises a 2’-O-methoxyethyl (2’MOE) sugar modification. In some embodiments, the antisense oligonucleotide comprises locked nucleic acid.

The ASOs may further be conjugated to moieties which may attribute properties to the ASO, non-limiting examples of such properties may be the cell-penetrance or celltargeting. In some embodiments, the antisense oligonucleotide is conjugated to a moiety or to a nanoparticle formulation. In some embodiments, the moiety is a celltargeting moiety and/or a cell-penetrating moiety. In some embodiments, the antisense oligonucleotide is conjugated to Triantennary N-acetylgalactosamine (GalNAc) moiety, TAT (SEQ ID NO: 108), and/or a peptide. In some embodiments, the antisense oligonucleotide is conjugated to a Triantennary N-acetylgalactosamine (GalNAc) moiety. In some embodiments, the antisense oligonucleotide is conjugated to TAT (SEQ ID NO: 108). In some embodiments, the antisense oligonucleotide is conjugated to a peptide.

Properties of the ASOs

The oligonucleotides of the present invention described herein, such as in the sections of the present disclosure “Antisense Oligonucleotides”, and/or in the section “Modifications of the ASOs”, may be characterized, in some embodiments, by any of the following properties.

The length and GC content of the antisense oligonucleotides of the present invention may be varied. In some embodiments, the antisense oligonucleotide is between 12 to 25 nucleotides in length, such as between 12 and 23 nucleotides, between 12 and 21 nucleotides, between 12 and 20 nucleotides, between 12 and 19 nucleotides, between 12 and 18 nucleotides, between 12 and 16 nucleotides, between 12 and 14 nucleotides, between 14 and 25 nucleotides, between 14 and 23 nucleotides, between 14 and 21 nucleotides, between 14 and 20 nucleotides, between 14 and 19 nucleotides, between 14 and 18 nucleotides, between 14 and 16 nucleotides, between 16 and 25 nucleotides, between 16 and 23 nucleotides, between 16 and 21 nucleotides, between 16 and 20 nucleotides, between 16 and 19 nucleotides, between 16 and 18 nucleotides, between 18 and 25 nucleotides, between 18 and 23 nucleotides, between 18 and 21 nucleotides, between 18 and 20 nucleotides, between 18 and 19 nucleotides, between 19 and 25 nucleotides, between 19 and 23 nucleotides, between 19 and 21 nucleotides, between 19 and 20 nucleotides, between 20 and 25 nucleotides, between 20 and 23 nucleotides, between 20 and 21 nucleotides, between 21 and 25 nucleotides, between 21 and 23 nucleotides, between 23 and 25 nucleotides. In some embodiments, the antisense oligonucleotide is between 12 and 25 nucleotides long.

In some embodiments, the antisense oligonucleotide is at least 12 nucleotides long, such as at least 14 nucleotides, and/or at least 16 nucleotides and/or at least 18 nucleotides, and/or at least 20, and/or at least 22 nucleotides, and/or at least 24 nucleotides, and/or at least 26 nucleotides, and/or at least 28 nucleotides, and/or at least 30 nucleotides long.

In some embodiments, the antisense oligonucleotide is 23 nucleotides long. In some embodiments, the antisense oligonucleotide has a GC-content of 40 to 60%, such as 45 to 55%.

Compositions

The antisense oligonucleotides of the present invention, such as those described in the sections of the present disclosure “Antisense Oligonucleotides”, “Modifications of the ASOs”, and/or “Properties of the ASOs”, may e.g. be formulated in a composition such as a pharmaceutical composition. Thus in another embodiment, the present disclosure concerns an composition comprising the antisense oligonucleotide as described herein, such as a pharmaceutical composition. Such compositions may comprise more than one of the antisense oligonucleotides of the present disclosure. In some embodiments, the composition comprises one or more of said antisense oligonucleotides. As described herein above, the ASOs of the present invention may facilitate skipping of exon 23. Without being bound by theory, mutations in exon 23 may for example cause or promote the development of e.g. Alzheimer’s disease. Thus, in another aspect, the present disclosure concerns an antisense oligonucleotide (ASO) as described herein and/or the composition as described herein, for use as a medicament.

In another aspect, the present disclosure concerns an antisense oligonucleotide (ASO) as described herein and/or the composition as described herein, for use in the prevention, treatment and/or alleviation of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies, or a disease or disorder associated with Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies.

In another aspect, the present disclosure concerns use of an antisense oligonucleotide as described herein in the manufacture of a medicament for treatment of Alzheimer’s Disease, Parkinson’s Disease, and/or Dementia with Lewy bodies.

In another aspect, the present disclosure concerns a method for treatment of Alzheimer’s Disease, Parkinson’s Disease, and/or Dementia with Lewy bodies comprising administration of a therapeutically effective amount of an antisense oligonucleotide as described herein to an subject in need thereof.

A number of different routes may be used for delivery of the antisense oligonucleotides of the present invention. In some embodiments, an effective amount of the antisense oligonucleotide is administered to the eye, to the spinal cord, to the nose, to the cerebrospinal fluid, to the brain and/or to the liver, such as wherein the antisense oligonucleotide is administered intrathecally or intranasally.

Method for mediating exon skipping

As described herein above, the present invention takes advantage of antisense oligonucleotides for inducing exon-skipping in the pre-mRNA transcripts (also referred to as precursor mRNA). This type of antisense-mediated splicing modulation uses antisense oligonucleotides (ASOs) to manipulate the splicing. Without being bound by theory, ASOs may induce exon skipping by sterically blocking the binding of splicing factors to pre-mRNA transcripts (also referred to as precursor mRNA). Thus, in another aspect, the present disclosure concerns a method for mediating exon skipping in SORL1 transcripts in a cell, tissue or organ, wherein the method comprises the step of contacting said cell, tissue or organ with the antisense oligonucleotide as described herein and/or the composition as described herein, wherein the exon is exon 23 of SORL1.

The method for mediating exon skipping may be facilitated by one ASO or more than one ASO. In some embodiments, one ASO is used. In some embodiments, more than one ASO is used, such as 2 ASOs, such as 3 ASOs, such as 4 ASOs, such as 5 ASOs, such as 6 ASOs, such as 7 ASOs, such as 8 ASOs, such as 9 ASOs, such as 10 ASOs, such as 11 ASOs, such as 12 ASOs, such as 13 ASOs, such as 14 ASOs, such as 15 ASOs, such as 16 ASOs, such as 17 ASOs, such as 18 ASOs, such as 19 ASOs, such as 20 ASOs, such as 21 ASOs, such as 22 ASOs, such as 23 ASOs, or 24 ASOs.

The skipping of exon 23 may for example be analyzed by analyzing the inhibition of inclusion of exon 23 in the spliced transcripts or by analyzing the promotion of skipping of exon 23 in the spliced transcripts and the results of these analyses may for example be presented as IC50 values or EC50 values, respectively. In general, half maximal inhibitory concentration (IC50) is a measure of the potency of a substance in inhibiting a specific biological or biochemical function. In general, half maximal effective concentration (EC50) is a measure of the concentration of a substance, such as an antisense oligonucleotide, which induces a biological response halfway between the baseline and maximum. These analyses may for example be performed using qPCR. In some embodiments, exon skipping of one exon is mediated. In some embodiments, the ASO inhibits the inclusion of exon 23 of SORL1 with an IC50 of 20 nM or less, such as 19 nM or less, such as 18 nM or less, such as 17 nM or less, such as 16 nM or less, such as 15 nM or less, such as 14 nM or less, such as 13 nM or less, such as 12 nM or less, such as 11 nM or less, such as 10 nM or less, such as 9 nM or less, such as 8 nM or less, such as 7 nM or less, such as 6 nM or less, such as 5 nM or less, such as 4 nM or less, or such as 3 nM or less. In some embodiments, the ASO inhibits the inclusion of exon 23 of SORL1 with an IC50 of 2.6 nM or less. In some embodiments, the ASO promotes skipping of exon 23 of SORL1 with an EC50 of 20 nM or less, such as 19 nM or less, such as 18 nM or less, such as 17 nM or less, such as 16 nM or less, such as 15 nM or less, such as 14 nM or less, such as 13 nM or less, such as 12 nM or less, such as 11 nM or less, such as 10 nM or less, such as 9 nM or less, such as 8 nM or less. In some instances, it may for example be desirable to decrease the inclusion of exon 23 in the SORL1 transcripts without decreasing the amount of SORL1 transcripts. Thus, in some embodiments, the amount of SORL1 transcripts in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 81%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition. In some embodiments, the amount of SORL1 transcripts in said cell, tissue or organ is determined by qPCR.

Analogously, in some instances, it may for example be desirable to decrease the inclusion of exon 23 in the SORL1 transcripts without decreasing the amount of SORLA protein. In some embodiments, the amount of SORLA protein in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 81%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition. In some embodiments, the amount of SORLA protein in said cell, tissue or organ is determined by western blotting.

Other methods

The efficiency of the ASO in mediating SORL1 exon skipping in a subject may for example be analyzed by analyzing the inclusion of exon 23 before and after treatment with said ASO.

Thus, in another aspect, the present disclosure concerns a method of determining the efficiency of ASO mediated SORL1 exon skipping in a subject, the method comprising the following steps: a) analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in a first sample comprising cerebrospinal fluid derived from a patient, obtained before treatment with an ASO, such as any ASO as defined herein, b) analyzing the levels of SORLA lacking the complement-type repeat encoded by exon 23 in a second sample comprising cerebrospinal fluid derived from the same patient as in a), obtained after treatment with an ASO, c) comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the samples of a) and b), and d) determining exon skipping if the level of SORLA lacking the complement-type repeat encoded by exon 23 in b) is higher than in a).

In some embodiments, the method optionally comprising the step of obtaining sample b) at several time points after treatment with an ASO, thus monitoring the efficiency of ASO mediated exon skipping over time.

A method to test whether a patient may benefit from treatment with an ASO mediating exon skipping, may for example involve contacting a cell comprising the mutation with an ASO and comparing exon skipping in said cell to the exon skipping in a non-treated counterpart. In another aspect, the present disclosure concerns a method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, such as any ASO as defined herein, d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in the first and the second aliquot, f. comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first aliquot is higher than in the second aliquot.

In another aspect, the present disclosure concerns a method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, such as any ASO as defined herein, d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of endoplasmic reticulum-resident SORLA in the first and the second aliquot, f. comparing the level of endoplasmic reticulum-resident SORLA in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of endoplasmic reticulum-resident SORLA in the second aliquot is higher than in the first aliquot.

In some embodiments, the method is an in-vitro method. In some embodiments, said ASO is a ASO as described herein, such as e.g. in the sections “Antisense Oligonucleotides”, “Modifications of the ASOs”, and/or “Properties of the ASOs”.

Analogously, a method of identifying an ASO suitable for treatment of a patient with Alzheimer’s Disease may for example involve the evaluation of whether the target site of the ASO comprise the mutation. Thus, in another aspect, the present disclosure concerns a method of producing an ASO suitable for treatment of a patient with Alzheimer’s Disease, wherein the patient carries a mutation in an exon encoding a complement-type repeat (OR) domain of SORLA, the method comprising the following steps: a. identifying an ASO as described herein, b. determining if the target site of the ASO comprises the mutation, or if the target site of the ASO does not comprise the mutation, and c. determining that the ASO that binds to a target site not comprising the mutation is suitable for treatment of a patient with Alzheimer’s Disease.

In some embodiments, the mutation is a calcium-cage-mutation, an asx-turn mutation or an odd-numbered cysteines-mutation. In some embodiments, the mutation is a mutation in exon 23. In some embodiments, the mutation is a substitution of cysteine to arginine at position 1078 (C1078R) of human SORL1 , wherein the mutation is a substitution of arginine to cysteine at position 1080 (R1080C) of human SORL1 , wherein the mutation is a substitution of arginine to cysteine at position 1084 (R1084C) of human SORL1 , wherein the mutation is a substitution of tryptophan to cysteine at position 1095 (W1095C) of human SORL1 , wherein the mutation is a substitution of tryptophan to cysteine at position 1096 (W1096C) of human SORL1 , wherein the mutation is a substitution of aspartic acid to asparagine at position 1102 (D1102N) of human SORL1 , wherein the mutation is a substitution of cysteine to tyrosine at position 1103 (C1103Y) of human SORL1 , wherein the mutation is a substitution of aspartic acid to histidine at position 1105 (D1105H) of human SORL1 , wherein the mutation is a substitution of aspartic acid to asparagine at position 1108 (D1108N) of human SORL1 , or wherein the mutation is a substitution of cysteine to tyrosine at position 1112 (C1112Y) of human SORL1.

In some embodiments, the mutation is a substitution of cysteine to arginine at position 1078 (C1078R) of human SORL1. In some embodiments, the mutation is a substitution of arginine to cysteine at position 1080 (R1080C) of human SORL1. In some embodiments, the mutation is a substitution of arginine to cysteine at position 1084 (R1084C) of human SORL1. In some embodiments, the mutation is a substitution of tryptophan to cysteine at position 1095 (W1095C) of human SORL1. In some embodiments, the mutation is a substitution of tryptophan to cysteine at position 1096 (W1096C) of human SORL1. In some embodiments, the mutation is a substitution of aspartic acid to asparagine at position 1102 (D1102N) of human SORL1. In some embodiments, the mutation is a substitution of cysteine to tyrosine at position 1103 (C1103Y) of human SORL1 . In some embodiments, the mutation is a substitution of aspartic acid to histidine at position 1105 (D1105H) of human SORL1. In some embodiments, the mutation is a substitution of aspartic acid to asparagine at position 1108 (D1108N) of human SORL1 . In some embodiments, the mutation is a substitution of cysteine to tyrosine at position 1112 (C1112Y) of human SORL1 .

In some embodiments, the mutation is selected from the list of mutations recited in the table below:

In some embodiments the mutation is a substitution of thymine (T) to cytosine (C) at position chr11:121570165. In some embodiments the mutation is a substitution of cytosine (C) to thymine (T) at position chr11:121570171.

In some embodiments the mutation is a substitution of cytosine (C) to thymine (T) chr11:121570183.

In some embodiments the mutation is a deletion a deletion of cytosine (C) at position chr11:121570194

In some embodiments the mutation is an insertion of guanine (G) after thymine (T) at position chr11 :121570219.

In some embodiments the mutation is: a. a substitution of guanine (G) to cytosine (C) at position chr11:121570221, b. a substitution of guanine (G) to adenine (A) at position chr11 :121570221, c. a substitution of guanine (G) to adenine (A) at position chr11:121570237, d. a substitution of thymine (T) to cytosine (C) at position chr11:121570240, e. a substitution of guanine (G) to adenine (A) at position chr11:121570241, f. a substitution of guanine (G) to cytosine (T) at position chr11:121570241, g. a substitution of guanine (G) to cytosine (C) at position chr11:121570246, h. a deletion of adenine (A) and cytosine (C) at position chr11:121570247, i. a substitution of guanine (G) to adenine (A) at position chr11:121570255, j. a substitution of guanine (G) to cytosine (C) at position chr11:121570255, k. a substitution of adenine (A) to thymine (T) at position chr11:121570256, l. a substitution of guanine (G) to adenine (A) at position chr11:121570258, m. a substitution of adenine (A) to guanine (G) at position chr11:121570259, n. a substitution of guanine (G) to adenine (A) at position chr11:121570268, o. a substitution of guanine (G) to thymine (T) at position chr11:121570268, p. a substitution of thymine (T) to cytosine (C) at position chr11:121570165, q. a substitution of cytosine (C) to thymine (T) at position chr11 : 121570171 , r. a substitution of cytosine (C) to thymine (T) chr11:121570183, s. a deletion a deletion of cytosine (C) at position chr11:121570194, or t. an insertion of guanine (G) after thymine (T) at position chr11:121570219.

In some embodiments the mutation is a substitution of guanine (G) to cytosine (C) at position chr11:121570221.

In some embodiments the mutation is a substitution of guanine (G) to adenine (A) at position chr11:121570221.

In some embodiments the mutation is a substitution of guanine (G) to adenine (A) at position chr11:121570237.

In some embodiments the mutation is a substitution of thymine (T) to cytosine (C) at position chr11:121570240.

In some embodiments the mutation is a substitution of guanine (G) to adenine (A) at position chr11:121570241.

In some embodiments the mutation is a substitution of guanine (G) to cytosine (T) at position chr11:121570241. In some embodiments the mutation is a substitution of guanine (G) to cytosine (C) at position chr11:121570246.

In some embodiments the mutation is the mutation is a deletion of adenine (A) and cytosine (C) at position chr11:121570247.

In some embodiments the mutation is a substitution of guanine (G) to adenine (A) at position chr11:121570255.

In some embodiments the mutation is a substitution of guanine (G) to cytosine (C) at position chr11:121570255

In some embodiments the mutation is a substitution of adenine (A) to thymine (T) at position chr11:121570256.

In some embodiments the mutation is a substitution of guanine (G) to adenine (A) at position chr11:121570258.

In some embodiments the mutation is a substitution of adenine (A) to guanine (G) at position chr11:121570259.

In some embodiments the mutation is a substitution of guanine (G) to adenine (A) at position chr11:121570268.

In some embodiments the mutation is a substitution of guanine (G) to thymine (T) at position chr11:121570268.

Examples

Example 001: Establishing RT-PCR detection method for the skipping of exon 23 from the SORL1 transcripts

Aim:

The aim of this example was to establish an RT-PCR based method to monitor SORL1 transcripts with and without exon 23.

Materials and Methods:

Primers were designed within the flanking regions, to cover exon-exon boundaries. Temperature optimization was done by PCR.

HEK293 cells were transfected using plasmids with cDNA that encoded either the full- length SORL1-FL or exon 23 deleted SORL1 (SORL1-Aex23) with FuGENE. 48 hrs post-transfection, RNA was harvested by standard methods (PureLink™ RNA from Invitrogen), preparation of cDNA from 1 pg of purified RNA, and PCR was performed using 1 pg of cDNA as template, and taq-man polymerase and PCR instrument to scan temperatures for the amplification step ranging from 42 to 71 Celsius. Gel Loading Dye, Purple (6X) was added to PCR products before they were run on an agarose gel (2%) with gelred, and gel bands were visualized with i Bright Imaging Systems.

The primers used in the present example were: Forward primer: CTGTGTGCCCAGGCCAT (17 nt) (SEQ ID NO: 52) Reverse Primer: GTTGTCTCCACAGTCATCCTCAAG (24 nt) (SEQ ID NO: 53)

The two DNA sequences (in bold) in Table 1 indicate where the forward and reverse primers anneals to the SORL1 transcript. The amplified product for transcripts with exon 23 were 382 nt in length, while transcripts without exon 23 were 268 nt in length

(Table 1).

Table 1 Amplicon sequence overview.

Results: Positive control samples were obtained with the full-length SORL1 or exon 23 deleted SORL1 (SORL1-Aex23) transcripts from HEK293 cells that were transfected with expression constructs for full-length SORL1 or exon 23 deleted SORL1 (SORL1- Aex23). These samples served as template for RT-PCR with primers that were chosen to reside in the flanking exon 22 and 24 to give amplicons of either 382 nt (full-length) or 268 nt (Aex23) where the difference of 114 nt corresponds to the 38 amino acids of the SORL1 CR1 -domain encoded by exon 23.

A temperature of 66 Celsius resulted in the most specific band pattern that allowed to clearly detect both SORL1 transcripts using this experimental condition (Figure 1A and Figure 1B).

Conclusion:

A protocol included control samples and primer sequences that allow for detection of SORL1 transcripts with or without exon 23 was established.

Example 002: Identification and validation of ASOs for skipping of SORL1 exon 23 using the eSkip-Finder online tool

Aim:

The aim of this example was to identify antisense oligonucleotides (ASOs) that can lead to skipping of exon 23 of SORL1 transcripts using a set of ASOs predicted by eSkip-Finder to have a strong ability to lead to skipping of exon 23.

Materials and Methods:

The eSkip-finder online tool was applied with the SORL1 exon 23 sequence (114 nt) including flanking intronic sequences (200 nt on both upstream and downstream intron).

From the provided output list of putative ASO target sequences, the following ASOs were selected: TD.63 (SEQ ID NO: 2), TD.54 (SEQ ID NO: 14) and TD.17 (SEQ ID NO: 15).

HEK293 cells were transfected with lipofectamine and 100, 200 or 400 nM of the identified ASOs.

Time for monitoring ASO effects were based on a publication testing skipping of exons from the APP gene (PMID 29628304), and 48 hrs post-transfection for harvesting cells for RNA extraction and cDNA synthesis was used. RT-PCR and agarose gels.

ASO were produced with either MOE (for DNA) or OMe (for RNA) backbone chemistry.

Results:

The eSkip-Finder was used to identify ASO sequences that could be used for skipping the human SORL1 exon 23.

Based on the output list of putative ASO target sequences, an optimization of sequences was performed according to the ASO design guide (minimize selfannealing; aiming for a GO content 40-60%; avoid potential off-targets).

From a list of optimized ASO sequences, the three top-hits in respect to predicted exon-skipping efficiency were selected (ASO 23.17; 23.54, 23.63 (SEQ ID NO: 15, 14 and 2, respectively) and with a minimal internal overlap among sequences. For each of these three ASO sequences, the inventors tested the two mostly used backbone chemistries (MOE/DNA) and (OMe/RNA) for testing their efficiency for skipping of exon 23 from the endogenous SORL1 in HEK293 cells. The inventors used each of the six ASO sequences at 100, 200, and 400 nM for transfection of HEK293 cells (in duplicate wells), and isolated RNA and prepared cDNA using protocols described previously (see Example 001). Next, the inventors did RT-PCR using optimized conditions as described above and analyzed the products by agarose gels (Figure 2 A, C, E). The intensity of bands corresponding to transcripts including exon 23 (migrating at 382 nt) or skipped for exon 23 (migrating at 268 nt) were quantified, and the average/mean percentage of skipping was depicted for each of the three ASO target sequences at the three tested concentrations with the two different backbone chemistries (Figure 2 B, D, F). Each of the selected ASOs were able to induce a significant degree of skipping of exon 23, with tool-designed ASO 23.63 (called TD.63) with O-methyl RNA backbone showing the strongest effect, with almost 80% skipping of exon 23.

Conclusion:

The inventors identified the ASO 23.63 target sequence, which can lead to skipping of >80% of exon 23 of SORL1 transcripts from transfected HEK293 cells. The backbone chemistry of OMe was the superior chemistry for screening of the skipping of exon 23 from SORL1 transcripts in HEK293 cells. 200nM was a preferred concentration for screening purposes. Example 003: Sanger sequencing of exon 23 skipped S0RL1 transcript

Aim:

To confirm the exon-exon boundary between exon 22 and exon 24 by skipping of exon 23 comprise a preserved reading frame, Sanger sequencing was performed after ASO- induced skipping of exon 23 from the SORL1 transcript.

Materials and Methods:

The PCR product from HEK293 cells transfected with 200 nM of ASO 23.63 (O’Me) was analyzed by agarose gel analysis, and the band migrating corresponding to 268 nt was excised from the gel, purified following standard protocols and sequenced by Sanger sequencing.

Results:

The inventors extracted the shorter PCR product that migrated in agarose gel corresponding to 268 nt and send for Sanger sequencing. The inventors analyzed the sequence and confirmed the presence of the expected new exon-exon boundary corresponding to exclusion of the 114 nt of exon 23, a novel exon-exon boundary corresponding to joining exons 22 and 24 (Figure 3 and Table 2).

The sequence highlighted in bold in the AExon 23 amplicon correspond to the sequence in chromatogram displayed in Figure 3.

Table 2 AExon 23 sequence

The underlined sequences corresponds to the primer sequences (SEQ ID NOs: 52-53). The bold sequences corresponds to the junction between exons 22 and 24 (SEQ ID NOs: 90-91).

Conclusion:

Application of ASO 23.63 led to 'pure skipping' of exon 23 and no cryptic splice sites were introduced. The sequence confirmed joining of exons 22 and 24 leading to a novel transcript deleted of exon 23 but with a conserved reading frame.

Example 004: Identification and validation of ASOs for skipping of SORL1 exon 23 using Exon-Walk

Aim:

The aim of this example was to identify antisense oligonucleotides (ASOs) that could lead to skipping of exon 23 of SORL1 transcripts using a set of tiling ASOs spanning the entire exonic sequence based on an experimental approach.

Materials and Methods:

The inventors tested at high (200 nM) concentration in HEK293.

48 hrs post-transfection for cell harvest and RNA extraction/cDNA synthesis. RT-PCR and agarose gels.

ASO were produced with OMe backbone chemistry

Results:

The inventors did an exon-walk experiment for the SORL1 exon 23 with overlapping ASOs tested at 200 nM in transfected HEK293 cells.

The inventors designed a set of overlapping ~25-mer ASO sequences that spanned from the upstream intron, across the entire exon 23, and into the downstream intron with an overlap of 4-6 nucleotides in order to achieve the best GO content and least ability for self-annealing/secondary structure prediction (Figure 4A-D).

Each ASO was transfected (in duplicate) into HEK293 cells at a concentration of 200nM, and RNA was isolated from cells harvested 48hrs post-transfection. As controls the inventors included untreated cells (WT), cells that were treated with lipofectamine (Lipo) but without any ASO, and cells transfected with an ASO generated for a target unrelated in sequence to SORL1 (App). The purified RNA was made into cDNA and each sample was then used as template for RT-PCR using primers designed for detection of transcripts with and without SORL1 exon 23. PCR products were tested by agarose gel analysis and signals corresponding to bands that came from transcripts either including or excluding exon 23 were quantified and the percentage of the exon 23 skipped transcripts depicted for each ASO (Figure 4E-F).

The experiments were performed in three biological replicated (BR), and the average skipping based on the duplicate samples from each experiment is shown in the bar graph (Figure 4G).

Conclusion:

The inventors identified several ASO sequences that could induce skipping of SORL1 exon 23, with EW.08 (SEQ ID NO: 7) and EW.09 (SEQ ID NO: 3) as the most efficient and that led to >80% skipping at the applied conditions.

Example 005: ASO shortening according to avoid overlap with the nucleotide substituted by p.Arg1080Cys

Aim:

The aim of the present example was to shorten the ASO23.63 to a sequence that has no overlap with the nucleotide corresponding to the pathogenic variant p.Arg1080Cys (P.R1080C).

Materials and Methods:

Based on alignment of EW09 and 23.63, the inventors designed a new version of ASO 23.63 deleted of two 3’-end nucleotides not present in EW.09, but present in 23.63, and covering the codon for Arg-1080, which is a known pathogenic variant in the SORL1 exon 23. The inventors named the new 23-mer ASO ASO23.63.10.

The ASO23.63.10 was produced with OMe backbone chemistry, and tested together with other ASO for its effect on inducing skipping of SORL1 exon 23 in HEK293 cells using the previously described herein above, with the difference that ASO was tested at a lower dose (12nM) to enhance the possibility to detect minor changes in ASO efficiencies.

Results: The inventors designed an ASO sequence being 2 nucleotides shorter than ASO23.63.10, thereby having nucleotides overlap with the codon for Arg-1084 but otherwise no overlap with any other known pathogenic variants within exon 23.

Table 3 below displays the SORL1 exon 23 sequence including the target sequence of ASO23.63 and the localization of the nucleotide that leads to substitution p.R1080C and is a known pathogenic variants causing Alzheimer’s disease within exon 23.

The target sequence of ASO23.63.10 deleted of two nucleotides and that have no overlap with the site of variation is also indicated.

Table 3

Bold italics indicates the location of 11:121440880 C>T (p.R1080C) (SNP Id: rs376993434)

Underlined italics indicates the location of pathogenic variants.

Underlined indicates the location of the CA.63.10 target sequence (SEQ ID NO: 25) Bold underlined indicates the location of a sequence where pathogenic mutations have been identified.

The inventors tested the effect on skipping exon 23 using transfected HEK293 cells and a dose of 12 nM of different ASOs, isolated RNA, prepared cDNA, did RT-PCR, and analyzed PCR products by agarose gel analysis as outlined previously. Based on visual inspection of the image showing equal induction of the transcript deleted of exon 23, between cells treated with EW.09 (SEQ ID NO: 3), ASO23.63 (SEQ ID NO: 2), or ASQ23.63.10 (SEQ ID NO: 1), the inventors concluded that the 23-mer ASO23.63.10 could be used to remove exon 23 from SORL1 transcripts (Figure 5).

Conclusion: The inventors found that removing of the two nucleotides from the 5’end and five nucleotides from the ‘3 end did not significantly impair exon 23 skipping activity when testing in HEK293 cells.

Example 006: Validation that ASO23.63 does not lead to lower SORL1 protein expression

Aim: The aim of the present example was to demonstrate that treatment of cells with ASO23.63 has no unexpected impact on the overall SORL1 protein expression level.

Materials and Methods:

HEK293 cells were transfected with 200nM of ASO23.17 (TD.17, SEQ ID NO: 15), ASO23.54 (TD.54, SEQ ID NO: 14), ASO23.63 (TD.63, SEQ ID NO: 2), EW.08 (SEQ ID NO: 7), EW.19 (SEQ ID NO: 18), EW.21 (SEQ ID NO: 19), or the negative control ASO targeting APP using Lipofectamine. Cells were harvested 48 hrs post transfection, and cell lysates were then used for SDS-PAGE analysis followed by transfer to a nitrocellulose membrane using i Blot2.0 instrument. The membrane was blocked in standard blocking buffer, and incubated overnight in a 1 :1 ,000 dilution of the LR11 mouse monoclonal antibody or with an anti-Actin antibody. Detection was carried out using the chemiluminescence femto kit and an i Bright instrument.

Results:

The inventors wanted to test if the application of ASO23.63 to cells would have unwanted effect on overall protein expression which is the effect caused by a knockdown (ala siRNA) strategy. The inventors here tested the protein expression level by Western Blot analysis of cells treated with a panel of selected ASO molecules.

The inventors could clearly detect the endogenous SORL1 from HEK293 cells, and did not observe any significant decrease in SORL1 receptor expression by treatment with the tested ASOs (Figure 6).

The experimental conditions for running the SDS-PAGE were not optimized to enable a distinguishable migration of the full-length and the CR1-deleted SORL1 proteins.

Conclusion:

The inventors concluded that treatment of HEK293 cells with ASO23.63 did not lead to unspecific decrease of overall receptor expression. Example 007: Dose-dependent skipping of SORL1 exon 23: EC50 determination for three ASOs using concentration series in HEK293 cells by RT-PCR agarose gels

Aim:

The aim of the present example was to determine the EC50 values to better compare exon 23 skipping efficiency for ASO23.63 (SEQ ID NO: 2), ASO23.63.10 (SEQ ID NO: 1), and EW.09 (SEQ ID NO: 3) also including lower concentrations.

Materials and Methods:

HEK293 cells were transfected with ASO23.63, ASO23.63.10 or ASO EW.09 (with

OMe backbone chemistry) at different concentrations, and 48 hrs post-transfection the cells were harvested, RNA isolated using PureLink™ RNA from Invitrogen, cDNA synthesis made, and RT-PCR performed with primers as indicated in Example 001.

The RT-PCR products were analyzed by 1% agarose gels and imaged for inspection of the skipping efficiency.

Results:

The inventors used RT-PCR and analyzed product by RT-PCR from HEK293 cells transfected with increasing concentrations of ASO23.63, ASO23.63.10 or ASO EW.09 from 0 nM to 400 nM to investigate dose-dependent skipping of SORL1 exon 23.

For each of the three tested ASO compounds, the inventors observed a clear dosedependent skipping of exon 23, with an observed maximum skipping obtained at 50- 100 nM with no further effect at higher ASO doses (Figure 7A-C).

Conclusion:

The inventors concluded that each of the three tested ASOs induced skipping of SORL1 exon 23 with similar efficiency and EC50 values in the range of 1-12nM.

Example 008: Taq-man probe validation for the specific binding to exon 23 deleted transcripts of SORL1

Aim: The aim of the present example was to establish a quantitative qPCR analysis of SORL1 transcripts deleted of exon 23 using transfected SH-SY5Y cells for probe validation.

Materials and Methods:

Taq-man probes designed to span the novel boundary between exons 22 and 24 (for exon 23 deleted transcripts) and forward/reverse primers within these exons were designed using the IDT PrimerQuest™ tool and ordered from IDT.

Standard taq-man assays for full-length (probe spanning boundary between exons 3 and 4), the non-skipped transcript (probe spanning boundary between exons 22 and 23). Standard taq-man assays were purchased from IDT (Assay ID: Hs. PT.58.40327368 and Hs.PT.58.23098607).

Assay for quantification of the house keeping gene HPRT (Assay ID:

Hs. PT.58v.45621572).

SH-SY5Y cells were either untransfected or transfected with expression plasmids for SORL1 including or excluding exon 23, and 48 hrs post-transfection used for RNA isolation (PureLink™ RNA from Invitrogen), and cDNA synthesis following manufacturers procedure.

Quantitative qPCR was performed using the QuantStudio™ 7 Flex Real-Time PCR System instrument and taq-man assay reagents including nucleotides from TaqMan TM Universal PCR Master Mix from ThermoFisher Scientific (reagent cat.no 4304437).

Results:

Based on an observation that SH-SY5Y cells show no background skipping of exon 23 (thereby offering the opportunity to have a clean blank sample; data not shown), the inventors used transfected SH-SY5Y cells for establishing the taq-man qPCR assay (Table 5).

Design of primers for qPCR assay that is specific for human SORL1 deleted of exon 23.

SORL-1 AExon 23 Assay Set 1 Details:

Parameter Set: RT-qPCR (Primers with Probe)

Sequence Name: SORL-1 AExon 23

Amplicon Length: 102 The primers for amplification of a 102 bp fragment are listed as Forward (sense) and Reverse (antisense) as well as the Taq-man probe sense sequence in Table 4. The binding sites of the primers and the probe are indicated in Table 5. Table 4

Table 5

SH-SY5Y cells were transfected with pcDNA (blank) or plasmids encoding the full- length SORL1 (SORL1-FL) or exon 23 deleted SORL1 (SORL1-Aex23), and RNA/cDNA was prepared as described herein above. Then the inventors did qPCR with various conditions, optimized until the inventors only obtained a CT-value for the cells that were transfected with the SORL1-AEx23 plasmid. Table 6 below shows CT-values of qPCR assay run for SH-SY5Y with endogenous SORLA (WT SHSY5Y), or transfected with a cDNA for the SORL1 including SHSY5Y FL (transfected with plasmid overexpressing Full Length SORL1) or excluding SHSY5Y A23 (transfected with plasmid overexpressing SORL1 AEx23) exon 23. Only samples from SY5Y cells transfected with SORL1-AEx23 plasmids gave a CT-value above background which was established using water as control.

Table 6

Conclusion:

The inventors established a taq-man assay that was able to specifically detect transcripts of human SORL1 where exon 23 was deleted, while no signal was observed for transcripts that include exon 23 (i.e. non-skipped, full-length SORL1).

Example 009: IC50 determination for three ASOs using concentration series in

HEK293 cells and qPCR quantifications

Aim:

The aim of this example was to determine the EC50 values to better compare exon 23 skipping efficiency for ASO23.63 (SEQ ID NO: 2), ASO23.63.10 (SEQ ID NO: 1), and EW.09 (SEQ ID NO: 3) also including lower concentrations.

Materials and Methods: cDNA samples from cells transfected with increasing concentrations of three different ASOs were identical to those analyzed by RT-PCR approach and described in example 007.

RT-PCR and products were analyzed by qPCR with taq-man probes including a housekeeping gene (HPRT), the validated probe spanning the boundary between exons 22 and 24, the standard assays for full-length (probe spanning boundary between exons 3 and 4), and the non-skipped transcript that contain exon 23 (probe spanning boundary between exons 22 and 23). Standard taq-man assays were purchased from IDT (Hs. PT.58.40327368 and Hs.PT.58.23098607)

Assay for quantification of the house keeping gene HPRT (Assay ID: Hs.PT.58v.45621572).

Results:

The inventors used qPCR for quantification of the skipped (AEx23) as well as the nonskipped transcript, and made this relative to the total amount of SORL1 transcripts as identified by the exon3-4 boundary probe as well as relative to HPRT levels to ensure equal amount of cDNA/RNA in the qPCR. The inventors also quantified the level of all SORL1 transcripts that contain the boundary between exons 3 and 4, thus being the combined level of transcripts from the cells independent on the skipping event.

The inventors observed that each of the three ASO strongly induced skipping of the SORL1 exon 23, with ASO23.63 as the most efficient ASO tested (Figure 8). Also, none of the three tested ASO led to a decrease in total/combined SORL1 expression i.e. none of the tested ASOs showed unwanted knockdown effect (Figure 8C).

Conclusion:

The inventors conclude that the three ASOs ASO23.63, ASO23.63.10 and ASO EW.09 induced efficient skipping of SORL1 exon 23 and that the established qPCR data analysis was suitable for high-accuracy distinction between skipping efficiencies. The inventors found that ASO23.63 was the most efficient ASO with an estimated IC50 of 1.26nM.

Example 010: ASO shortening according to overlap in identified sequences

Aim:

The aim of this example was to test if shorter ASOs with a target sequence in exon 23 (15-20-mer nucleotides) could also be used for efficient skipping as in vivo applications would need to rely on cell permeability when delivered without transfection reagent and eventually for later conversion to LNA chemistry. Materials and Methods:

The inventors designed smaller ASO by removal two nucleotides by the time from either end of the ASO23.63. ASO were produced with OMe backbone chemistry, and used for transfection of HEK293 cells following protocols described above. RT-PCR and agarose gel analysis of products followed protocols already described.

Results:

The inventors designed and tested a total of 10 ASO sequences with shorter sequences than ASO23.63. The inventors evaluated their effect on SORL1 exon 23 skipping by the described RT-PCR followed by agarose gel analysis (Figure 9).

Conclusion:

The inventors conclude that not every ASO can lead to skipping of exon 23, as the tested ASO23.63.7 being only 14 nucleotides long was unable to induce the specific skipping event.

The inventors found that removing the two nucleotides from the 5’end and five nucleotides from the ‘3 end did not significantly impair exon 23 skipping activity when testing in HEK293 cells.

Example 011: Establishing RT-PCR protocols for detection of exon-exclusion of flanking exons in the human SORL1

Aim:

The aim of the present example was to establish RT-PCR assays for analysis of exonexclusion for exons flanking exon 23 in the SORL1 and which show the most sequence similarity with exon 23.

Materials and Methods:

The inventors designed primers that were suitable for amplification of fragments specific for the regions around exons 24, 25, 26, 30 or 31. And prepared cDNA for expression plasmids for said deletions constructs, which were then used for transfection of HEK293 cells following protocols described above. RT-PCR and agarose gel analysis of products were optimized for each set of the primers specific for the five splice events. Results:

The inventors determined which exons that have the highest sequence similarity to exon 23 from the human SORL1 gene, finding that exon 24, exon 25, exon 26, exon 30, and exon 31 were the five exons with the highest similarity (see Table 7).

Table 7

Next, the inventors prepared expression constructs allowing the preparation of positive control samples for cells with forced expression of SORL1 transcripts that lack each of the five different exons.

The inventors then used samples from cells either expressing full-length SORL1 (included all exons), or individually being deleted for one of the five different exons, and applied standard RT-PCR optimization protocols testing a series of temperatures for getting specific signals. The inventors evaluated the obtained PCR-products by agarose gel analysis (Figure 10).

Conclusion:

The inventors concluded that they were able to analyze the specific exclusion of exons 24, 25, 26, 30 or 31 from transcripts of the human SORL1 using RT-PCR. Example 012: Testing for off-target effects of most promising ASOs for effects on splicing of flanking exons

Aim:

The aim of the present example was to test if the ASO molecules had any impact on the inclusion of flanking exons encoding other CR-domains with high sequence similarity to SORL1 exon 23.

Materials and Methods:

The inventors transfected HEK293 cells with each of the following four ASOs (EW19, EW21m ASO23.54 or ASO23.63) at 400 nM as previously described. RT-PCR and agarose gel analysis of products followed protocols already described.

Results:

The inventors tested a total of 4 ASO sequences for their ability to induce unspecific skipping of other CR-domain encoding exons from SORL1. The inventors evaluated the effect of the ASO sequences on SORL1 exon 24, exon 25, exon 26, exon 30 and exon 31 skipping by the described RT-PCR followed by agarose gel analysis. The inventors tested the four ASOs at high concentration, 400 nM, that was able to induce strong exon23-skipping for the human SORL1 , but neither of the four ASO lead to strong skipping of the flanking exons (Figure 11-13). In particular, ASO23.63 showed no off-targets for this limited set of tested exons.

Conclusion:

The inventors concluded that neither of the four ASO induce unspecific/unintended exon skipping of the tested CR-domain encoding exons of SORL1.

Thus, each of the ASO, including ASO23.63, showed high specificity towards skipping of exon 23 with no observed off-target of flanking exons.

Example 014: Comparison of ASOs with previously described ASOs

Aim

The aim of this example was to compare the efficiency of ASOs described herein with previously described Exon 23 targeting ASOs.

Materials and Methods: The inventors transfected HEK293 cells with 12 nM of ASO TD.63, EW.09, CA.63.10, (scrambled CA.63.10) scrCA.63.10, 23.1 (previously described ASO), 23.2 (previously described ASO), 23.3 (previously described ASO), or 23.4 (previously described ASO). The inventors isolated RNA 48 h after transfection. RNA and cDNA were purified and produced according to earlier described protocols.

Results:

The results showed that none of the ASOs of the present invention decreased the total amount of SORL1 (Figure 14A). The results further demonstrated that the three tested ASOs disclosed herein where more efficient in promoting Exon23 skipping (Figure 14B-D) compared to the previously described Exon 23 targeting ASOs.

Conclusion:

The inventors concluded that the ASOs of the present invention are more efficient in promoting exon skipping of exon 23 compared to previously described ASOs.

Sequence overview

SEQ ID NO: 1 (CA.10 ASO/ 23.63.10 ASO)

GTTGCTGCAGCGATACTGGTTGC

SEQ ID NO: 2 (TD.63 ASO I 23.63 ASO)

GTTGCTGCAGCGATACTGGTTGCGA

SEQ ID NO: 3 (EW.9 ASO)

TGCAGCGATACTGGTTGC

SEQ ID NO: 4 (CA.4 ASO)

TGCAGCGATACTGGTTGCGA

SEQ ID NO: 5 (CA.2 ASO)

CAGCGATACTGGTTGCGA

SEQ ID NO: 6 (CA.1 ASO) CAGCGATACTGGTTGC

SEQ ID NO: 7 (EW.8 ASO) CAGCGATACTGGTTGCGAAGA

SEQ ID NO: 8 (EW.7 ASO) ACTGGTTGCGAAGACAGGT

SEQ ID NO: 9 (CA.5 ASO)

GCGATACTGGTTGCGA

SEQ ID NO: 10 (CA.6 ASO)

TGCAGCGATACTGGTT

SEQ ID NO: 11 (CA.7 ASO) GCGATACTGGTT

SEQ ID NO: 12 (CA.8 ASO)

GCGATACTGGTTGC

SEQ ID NO: 13 (CA.9 ASO)

CAGCGATACTGGTT

SEQ ID NO: 14 (TD.54 ASO I 23.54 ASO)

GCGAAGACAGGTGTTC

SEQ ID NO: 15 (TD.17 ASO I 23.17 ASO)

TACAGTTCCCGTTGCTGCAGC

SEQ ID NO: 16 (EW.5 ASO)

CGAAGACAGGTGTTCTCTACC

SEQ ID NO: 17 (EW.6 ASO)

GGTTGCGAAGACAGGTGTTCT SEQ ID NO: 18 (EW.19 ASO)

CAGTCGTTGTCAAAGTCACA

SEQ ID NO: 19 (EW.21 ASO) CATGTCTCCACAGTCGTTGT

SEQ ID NO: 20 (EW.25 ASO)

GCAGTTTCTCTCATCGCT

SEQ ID NO: 21 (EW.20 ASO)

CCACAGTCGTTGTCAAAG

SEQ ID NO: 22 (EW.22 ASO) TCGCTCATGTCTCCACAGTC

SEQ ID NO: 23 (EW.23 ASO)

CTCATCGCTCATGTCTCCA

SEQ ID NO: 24 (EW.24 ASO) GTTTCTCTCATCGCTCATGT

SEQ ID NO: 25 (CA.10 target / 23.63.10 target)

GCAACCAGTATCGCTGCAGCAAC

SEQ ID NO: 26 (TD.63 target 123.63 target)

TCGCAACCAGTATCGCTGCAGCAAC

SEQ ID NO: 27 (EW.9 target) GCAACCAGTATCGCTGCA

SEQ ID NO: 28 (CA.4 target)

TCGCAACCAGTATCGCTGCA SEQ ID NO: 29 (CA.2 target)

TCGCAACCAGTATCGCTG

SEQ ID NO: 30 (CA.1 target) GCAACCAGTATCGCTG

SEQ ID NO: 31 (EW.8 target) TCTTCGCAACCAGTATCGCTG

SEQ ID NO: 32 (EW.7 target)

ACCTGTCTTCGCAACCAGT

SEQ ID NO: 33 (C A.5 target)

TCGCAACCAGTATCGC

SEQ ID NO: 34 (CA.6 target) AACCAGTATCGCTGCA

SEQ ID NO: 35 (C A.7 target) AACCAGTATCGC

SEQ ID NO: 36 (CA.8 target)

GCAACCAGTATCGC

SEQ ID NO: 37 (C A.9 target) AACCAGTATCGCTG

SEQ ID NO: 38 (TD.54 target 123.54 target) GAACACCTGTCTTCGC

SEQ I D NO: 39 (TD.17 target / 23.17 target)

GCTGCAGCAACGGGAACTGTA

SEQ ID NO: 40 (EW.5 target) ggtagAGAACACCTGTCTTCG

SEQ ID NO: 41 (EW.6 target)

AGAACACCTGTCTTCGCAACC

SEQ ID NO: 42 (EW.19 target)

TGTGACTTTGACAACGACTG

SEQ ID NO: 43 (EW.21 target)

ACAACGACTGTGGAGACATG

SEQ ID NO: 44 (EW.25 target)

AGCGATGAGAGAAACTGC

SEQ ID NO: 45 (EW.20 target)

CTTTGACAACGACTGTGG

SEQ ID NO: 46 (EW.22 target)

GACTGTGGAGACATGAGCGA

SEQ ID NO: 47 (EW.23 target)

TGGAGACATGAGCGATGAG

SEQ ID NO: 48 (EW.24 target)

ACATGAGCGATGAGAGAAAC

SEQ ID NO: 49 (Exon 23 SORL1)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAAC

TGCC

SEQ ID NO: 50 (Full length amplicon)

CTGTGTGCCCAGGCCATGCAGCCTGCTGTGCCTGCCCAAGGCCAACAACAGTAG

AAGCTGCAGGTGTCCAGAGGATGTGTCCAGCAGTGTGCTTCCATCAGGGGACCT GATGTGTGACTGCCCTCAGGGCTATCAGCTCAAGAACAATACCTGTGTCAAACAA

GAGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACA

GCATTTGGTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAA

CTGCCCTACCACCATCTGTGACCTGGACACCCAGTTTCGTTGCCAGGAGTCTGGG

ACTTGTATCCCACTGTCCTATAAATGTGACCTTGAGGATGACTGTGGAGACAAC

SEQ ID NO: 51 (dExon 23 Amplicon)

CTGTGTGCCCAGGCCATGCAGCCTGCTGTGCCTGCCCAAGGCCAACAACAGTAG

AAGCTGCAGGTGTCCAGAGGATGTGTCCAGCAGTGTGCTTCCATCAGGGGACCT

GATGTGTGACTGCCCTCAGGGCTATCAGCTCAAGAACAATACCTGTGTCAAACAA

GCTACCACCATCTGTGACCTGGACACCCAGTTTCGTTGCCAGGAGTCTGGGACTT

GTATCCCACTGTCCTATAAATGTGACCTTGAGGATGACTGTGGAGACAAC

SEQ ID NO: 52 (Forward primer - Example 1)

CTGTGTGCCCAGGCCAT

SEQ ID NO: 53 (Reverse primer - Example 1)

GTTGTCTCCACAGTCATCCTCAAG

SEQ ID NO: 54 (EW.1 ASO)

ATCAGAGTGCGGCAGGGGA

SEQ ID NO: 55 (EW.2 ASO)

CTACCCATCAGAGTGCGGCA

SEQ ID NO: 56 (EW.3 ASO)

TCTACCCATCAGAGTG

SEQ ID NO: 57 (EW.4 ASO)

GGTGTTCTCTACCCATCA

SEQ ID NO: 58 (EW.10 ASO)

GTTGCTGCAGCGATACTG SEQ ID NO: 59 (EW.11 ASO) AGTTCCCGTTGCTGCAGCGA

SEQ ID NO: 60 (EW.12 ASO)

TACAGTTCCCGTTGCTGC

SEQ ID NO: 61 (EW.13 ASO)

GTTGATACAGTTCCCGTT

SEQ ID NO: 62 (EW.14 ASO) CCAAATGCTGTTGATACAGTTC

SEQ ID NO: 63 (EW.15 ASO) CCACCAAATGCTGTTGATAC

SEQ ID NO: 64 (EW.16 ASO) ACACCACCAAATGCTGTT

SEQ ID NO: 65 (EW.17 ASO) CAAAGTCACACCACCAAATG

SEQ ID NO: 66 (EW.18 ASO)

TGTCAAAGTCACACCACC

SEQ ID NO: 67 (EW.26 ASO)

TCACGGCAGTTTCTCTCA

SEQ ID NO: 68 (EW.27 ASO)

AAGACTCACGGCAGTTTC

SEQ ID NO: 69 (EW.28 ASO) AATCCAGAAGACTCACGGCA

SEQ ID NO: 70 (EW.29 ASO) GTCCAATCCAGAAGACTCA

SEQ ID NO: 71 (EW.30 ASO) TTAACGTCCAATCCAGAAG

SEQ ID NO: 72 (EW.1 Target) tcccctgccgcactctgat

SEQ ID NO: 73 (EW.2 Target) tgccgcactctgatgggtag

SEQ ID NO: 74 (EW.3 Target) cactctgatgggtagA

SEQ ID NO: 75 (EW.4 Target) tgatgggtagAGAACACC

SEQ ID NO: 76 (EW.10 Target) CAGTATCGCTGCAGCAAC

SEQ ID NO: 77 (EW.11 Target) TCGCTGCAGCAACGGGAACT

SEQ ID NO: 78 (EW.12 Target) GCAGCAACGGGAACTGTA

SEQ ID NO: 79 (EW.13 Target) AACGGGAACTGTATCAAC

SEQ ID NO: 80 (EW.14 Target) GAACTGTATCAACAGCATTTGG

SEQ ID NO: 81 (EW.15 Target) GTATCAACAGCATTTGGTGG SEQ ID NO: 82 (EW.16 Target)

AACAGCATTTGGTGGTGT

SEQ ID NO: 83 (EW.17 Target) CATTTGGTGGTGTGACTTTG

SEQ ID NO: 84 (EW.18 Target) GGTGGTGTGACTTTGACA

SEQ ID NO: 85 (EW.26 Target) TGAGAGAAACTGCCgtga

SEQ ID NO: 86 (EW.27 Target) GAAACTGCCgtgagtctt

SEQ ID NO: 87 (EW.28 Target) TGCCgtgagtcttctggatt

SEQ ID NO: 88 (EW.29 Target) tgagtcttctggattggac

SEQ ID NO: 89 (EW.30 Target) cttctggattggacgttaa

SEQ ID NO: 90 (Exon junction 5') ATACCTGTGTCAAACAAG

SEQ ID NO: 91 (Exon junction 3') CTACCACCATCTGTGACC

SEQ ID NO: 92 (SORL1 exon 23 sequence with flanking regions) tcccctgccgcactctgatgggtagagaacacctgtcttcgcaaccagtatcgctgcagcaacgggaactgtatcaacag catttggtggtgtgactttgacaacgactgtggagacatgagcgatgagagaaactgccgtgagtcttctggattggacgtt aa

SEQ ID NO: 93 (Exon 23 SORL1 ASO shortening target sites)

Gggtagagaacacctgtcttcgcaaccagtatcgctgcagcaacgggaactgtatcaacagc

SEQ ID NO: 94 (dExon 23 qPCR target)

GAAGCAATGCCTGTGTGCCCAGGCCATGCAGCCTGCTGTGCCTGCCCAAGGCCA

ACAACAGTAGAAGCTGCAGGTGTCCAGAGGATGTGTCCAGCAGTGTGCTTCCATC

AGGGGACCTGATGTGTGACTGCCCTCAGGGCTATCAGCTCAAGAACAATACCTGT

GTCAAACAAGCTACCACCATCTGTGACCTGGACACCCAGTTTCGTTGCCAGGAGT

CTGGGACTTGTATCCCACTGTCCTATAAATGTGACCTTGAGGATGACTGTGGAGA

CAACAGTGATGAAAGTCATTGTG

SEQ ID NO: 95 (qPCR forward primer)

GATGTGTGACTGCCCTCAG

SEQ ID NO: 96 (qPCR Probe)

ACCTGTGTCAAACAAGCTACCACCA

SEQ ID NO: 97 (qPCR reverse primer)

GACTCCTGGCAACGAAACT

SEQ ID NO: 98 (exon 23 with p.C1078R mutation)

AGAACACCCGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAAC TGCC

SEQ ID NO: 99 (exon 23 with p.R1080C mutation)

AGAACACCTGTCTTTGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAAC TGCC SEQ ID NO: 100 (exon 23 with p.R1084C mutation)

AGAACACCTGTCTTCGCAACCAGTATTGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAAC TGCC

SEQ ID NO: 101 (exon 23 with p.W1095C mutation)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGCTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAAC TGCC

SEQ ID NO: 102 (exon 23 with p.W1096C mutation)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGCTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAAC TGCC

SEQ ID NO: 103 (exon 23 with p.D1102N mutation)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACAACTGTGGAGACATGAGCGATGAGAGAAAC TGCC

SEQ ID NO: 104 (exon 23 with p.C1103Y mutation)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTATGGAGACATGAGCGATGAGAGAAAC TGCC

SEQ ID NO: 105 (exon 23 with p.D1105H mutation)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTGTGGACACATGAGCGATGAGAGAAAC TGCC

SEQ ID NO: 106 (exon 23 with p.D1108N mutation)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCAATGAGAGAAAC TGCC SEQ ID NO: 107 (exon 23 with p.C1112Y mutation)

AGAACACCTGTCTTCGCAACCAGTATCGCTGCAGCAACGGGAACTGTATCAACAG

CATTTGGTGGTGTGACTTTGACAACGACTGTGGAGACATGAGCGATGAGAGAAAC TACC

SEQ ID NO: 108 (TAT)

GRKKRRQRRRPQ SEQ ID NO: 109 (SORL1 exon 23 sequence with flanking regions part 1)

Tcccctgccgcactctgatgggtagagaacacctgtcttcgcaaccagtatcgctgcagcaacgggaactgta

SEQ ID NO: 110 (SORL1 exon 23 sequence with flanking regions part 2)

Agtatcgctgcagcaacgggaactgtatcaacagcatttggtggtgtgactttgacaacgactgtgg

SEQ ID NO: 111 (SORL1 exon 23 sequence with flanking regions part 3) ttgacaacgactgtggagacatgagcgatgagagaaactgccgtgagtcttctggattggacgttaa

Items

1. An antisense oligonucleotide (ASO) comprising or consisting of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity.

2. The antisense oligonucleotide according to item 1 , wherein the antisense oligonucleotide binds or is capable of binding to a target site on the pre-mRNA of SORL1.

3. An antisense oligonucleotide (ASO) binding or capable of binding to a target site comprising or consisting of a target polynucleotide sequence having at least 80% sequence identity to a target polynucleotide sequence selected from the group consisting of: SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity.

4. The antisense oligonucleotide according to any one of the preceding items, wherein binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA, wherein exon 23 comprises or consists of a polynucleotide sequence of SEQ ID NO: 49, or a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 49, such as at least 85%, 90%, 95%, 98% or 99% sequence identity. 5. The antisense oligonucleotide according to any one of the preceding items, wherein binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (CR) domain of SORLA, wherein exon 23 comprises or consists of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107 such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity.

6. The antisense oligonucleotide according to any one of the preceding items, wherein binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (CR) domain of SORLA, wherein exon 23 comprises a mutation selected from the list consisting of: p.C1078R (T>C), p.R1080C (C>T), P.R1084C (C>T), p.W1095C (G>0), p.W1096C (G>0), p.D1102N (G>A), P.C1103Y (G>A), p.D1105H (G>0), p.D1108N (G>A), and p.C1112Y (G>A).

7. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide further comprises one or more modifications at at least one nucleotide position, or at each nucleotide position.

8. The antisense oligonucleotide according to item 7, wherein the modifications are modifications of the nucleic acid backbone, the nucleobase, the ribose sugar and/or 2'-ribose substitutions.

9. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises one or more modifications selected from the group consisting of: Peptide nucleic acid (PNA), Serinol nucleic acid (SNA), Phosphorodiamidate morpholino oligomer (PMO), Thiomorpholino oligonucleotide (TMO), and Morpholino nucleic acid (MNA).

10. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises one or more modifications of the nucleic acid backbone selected from the group consisting of: Phosphorothioate (PS) modifications, Mesyl phosphoramidate (MsPA) modifications, p-toluenesulfonyl phosphoramidate (Ts) modifications, and 4- (trimythylammonio)butylsulfonyl phosphoramidate (N+) modifications.

11 . The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises one or more modifications of the ribose sugar selected from the group consisting of: 2’-O-methyl (2’-0me), 2’-O-methoxyethyl (2’MOE), 2’-fluoro (2’-F), Locked nucleic acid (LNA), 2’- 0,4’C-ethylene-bridged nucleic acid (ENA), 2’,4’-constrained 2’-0-ethyl (cEt), Amido-bridged nucleic acid (AmNA), Guanidine-bridged nucleic acid (GuNA), Cyclohexenyl nucleic acid (CeNA), Anhydrohexitol nucleic acid (HNA), Altritol nucleic acid (ANA), Tricyclo-DNA (tc-DNA), and 7’, 5’-alpha-bicyclo-DNA (7’5’- a-bc-DNA).

12. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises one or more 2’,4’-constrained 2'-0-Ethyl (cEt) modifications.

13. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises one or more 2'-O-Methylation (2’-OMe) modifications.

14. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises one or more phosphorothioate modifications.

15. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises a 2'-O-methoxyethyl (2’MOE) sugar modification.

16. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide comprises a locked nucleic acid.

17. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide is between 12 to 25 nucleotides in length, such as between 12 and 23 nucleotides, between 12 and 21 nucleotides, between 12 and 20 nucleotides, between 12 and 19 nucleotides, between 12 and 18 nucleotides, between 12 and 16 nucleotides, between 12 and 14 nucleotides, between 14 and 25 nucleotides, between 14 and 23 nucleotides, between 14 and 21 nucleotides, between 14 and 20 nucleotides, between 14 and 19 nucleotides, between 14 and 18 nucleotides, between 14 and 16 nucleotides, between 16 and 25 nucleotides, between 16 and 23 nucleotides, between 16 and 21 nucleotides, between 16 and 20 nucleotides, between 16 and 19 nucleotides, between 16 and 18 nucleotides, between 18 and 25 nucleotides, between 18 and 23 nucleotides, between 18 and 21 nucleotides, between 18 and 20 nucleotides, between 18 and 19 nucleotides, between 19 and 25 nucleotides, between 19 and 23 nucleotides, between 19 and 21 nucleotides, between 19 and 20 nucleotides, between 20 and 25 nucleotides, between 20 and 23 nucleotides, between 20 and 21 nucleotides, between 21 and 25 nucleotides, between 21 and 23 nucleotides, between 23 and 25 nucleotides. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide is between 12 and 25 nucleotides long. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide is at least 12 nucleotides long, such as at least 14 nucleotides, and/or at least 16 nucleotides and/or at least 18 nucleotides, and/or at least 20, and/or at least 22 nucleotides, and/or at least 24 nucleotides, and/or at least 26 nucleotides, and/or at least 28 nucleotides, and/or at least 30 nucleotides long. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide is 23 nucleotides long. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide has a GC-content of 40 to 60%, such as 45 to 55%. 22. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide is conjugated to a moiety or to a nanoparticle formulation.

23. The antisense oligonucleotide according to item 22, wherein the moiety is a cell-targeting moiety and/or a cell-penetrating moiety.

24. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide is conjugated to Triantennary N- acetylgalactosamine (GalNAc) moiety, TAT (SEQ ID NO: 108) and/or a peptide.

25. The antisense oligonucleotide according to any one of the preceding items, wherein the antisense oligonucleotide is targeted to a 5’ splice site, a 3’ splice site and/or an exonic splice enhancer site (ESE).

26. A composition comprising the antisense oligonucleotide according to any one of the preceding items, such as a pharmaceutical composition.

27. The composition according to item 26 comprising one or more of said antisense oligonucleotides.

28. An antisense oligonucleotide (ASO) according to any one of items 1 to 25 and/or the composition according to any one of items 26 to 27, for use as a medicament.

29. An antisense oligonucleotide (ASO) according to any one of items 1 to 25 and/or the composition according to any one of items 26 to 27, for use in the prevention, treatment and/or alleviation of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies, or a disease or disorder associated with Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies.

30. The antisense oligonucleotide and/or the composition for use according to any one of items 28 to 29, wherein an effective amount of the antisense oligonucleotide is administered to the eye, to the spinal cord, to the nose, to the cerebrospinal fluid, to the brain and/or to the liver, such as wherein the antisense oligonucleotide is administered intrathecally or intranasally. Use of an antisense oligonucleotide according to any one of items 1 to 25 in the manufacture of a medicament for treatment of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies. A method for treatment of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies comprising administration of a therapeutically effective amount of an antisense oligonucleotide according to any one of items 1 to 25 to an subject in need thereof. A method for mediating exon skipping in SORL1 transcripts in a cell, tissue or organ, wherein the method comprises the step of contacting said cell, tissue or organ with the antisense oligonucleotide according to any one of items 1 to 25 and/or the composition according to any one of items 26 to 27, wherein the exon is exon 23 of SORL1. The method according to item 33, wherein one ASO is used. The method according to any one of items 33 to 34, wherein more than one ASO is used, such as 2 ASOs, such as 3 ASOs, such as 4 ASOs, such as 5 ASOs, such as 6 ASOs, such as 7 ASOs, such as 8 ASOs, such as 9 ASOs, such as 10 ASOs, such as 11 ASOs, such as 12 ASOs, such as 13 ASOs, such as 14 ASOs, such as 15 ASOs, such as 16 ASOs, such as 17 ASOs, such as 18 ASOs, such as 19 ASOs, such as 20 ASOs, such as 21 ASOs, such as 22 ASOs, such as 23 ASOs, or 24 ASOs. The method according to any one of items 33 to 35, wherein exon skipping of one exon is mediated. The method according to any one of items 33 to 36, wherein the ASO inhibits the inclusion of exon 23 of SORL1 with an IC50 of 20 nM or less, such as 19 nM or less, such as 18 nM or less, such as 17 nM or less, such as 16 nM or less, such as 15 nM or less, such as 14 nM or less, such as 13 nM or less, such as 12 nM or less, such as 11 nM or less, such as 10 nM or less, such as 9 nM or less, such as 8 nM or less, such as 7 nM or less, such as 6 nM or less, such as 5 nM or less, such as 4 nM or less, or such as 3 nM or less.

38. The method according to any one of items 33 to 37, wherein the ASO inhibits the inclusion of exon 23 of SORL1 with an IC50 of 2.6 nM or less.

39. The method according to any one of items 33 to 38, wherein the ASO promotes skipping of exon 23 of SORL1 with an EC50 of 20 nM or less, such as 19 nM or less, such as 18 nM or less, such as 17 nM or less, such as 16 nM or less, such as 15 nM or less, such as 14 nM or less, such as 13 nM or less, such as 12 nM or less, such as 11 nM or less, such as 10 nM or less, such as 9 nM or less, such as 8 nM or less.

40. The method according to any one of items 33 to 39, wherein the amount of SORL1 transcripts in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 81%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition.

41. The method according to item 40, wherein the amount of SORL1 transcripts in said cell, tissue or organ is determined by qPCR.

42. The method according to any one of items 33 to 39, wherein the amount of SORLA protein in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 81%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition.

43. The method according to item 42, wherein the amount of SORLA protein in said cell, tissue or organ is determined by western blotting.

44. A method of determining the efficiency of ASO mediated SORL1 exon skipping in a subject, the method comprising the following steps: a) analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in a first sample comprising cerebrospinal fluid derived from a patient, obtained before treatment with an ASO, b) analyzing the levels of SORLA lacking the complement-type repeat encoded by exon 23 in a second sample comprising cerebrospinal fluid derived from the same patient as in a), obtained after treatment with an ASO, c) comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the samples of a) and b), and d) determining exon skipping if the level of SORLA lacking the complement-type repeat encoded by exon 23 in b) is higher than in a).

45. The method according to item 44, optionally comprising the step of obtaining sample b) at several time points after treatment with an ASO, thus monitoring the efficiency of ASO mediated exon skipping over time.

46. A method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in the first and the second aliquot, f. comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first aliquot is higher than in the second aliquot. A method of determining the efficiency of ASO mediated SORL1 exon skipping, the method comprising the following steps: a) analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in a first sample comprising cerebrospinal fluid, obtained before contacting with an ASO, b) analyzing the levels of SORLA lacking the complement-type repeat encoded by exon 23 in a second sample comprising cerebrospinal fluid as in a), obtained after contacting with an ASO, c) comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the samples of a) and b), and d) determining exon skipping if the level of SORLA lacking the complement-type repeat encoded by exon 23 in b) is higher than in a). A method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of endoplasmic reticulum-resident SORLA in the first and the second aliquot, f. comparing the level of endoplasmic reticulum-resident SORLA in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of endoplasmic reticulum-resident SORLA in the second aliquot is higher than in the first aliquot. The method according to any one of items 44 to 48, wherein the method is an in-vitro method. The method according to any one of items 44 to 49, wherein said ASO is an ASO according to any one of items 1 to 25. A method of producing an ASO suitable for treatment of a patient with Alzheimer’s Disease, wherein the patient carries a mutation in an exon encoding a complement-type repeat (OR) domain of SORLA, the method comprising the following steps: a. identifying an ASO according to any one of items 1 to 25, b. determining if the target site of the ASO comprises the mutation, or if the target site of the ASO does not comprise the mutation, and c. determining that the ASO that binds to a target site not comprising the mutation is suitable for treatment of a patient with Alzheimer’s Disease. The method according to item 51 , wherein the mutation is a calcium-cage- mutation, an asx-turn mutation or an odd-numbered cysteines-mutation. The method according to any one of items 50 to 52, wherein the mutation is a mutation in exon 23. The method according to any one of items 50 to 53, wherein the mutation is a substitution of cysteine to arginine at position 1078 (C1078R) of human SORL1, wherein the mutation is a substitution of arginine to cysteine at position 1080 (R1080C ) of human SORL1 , wherein the mutation is a substitution of arginine to cysteine at position 1084 (R1084C ) of human SORL1 , wherein the mutation is a substitution of tryptophan to cysteine at position 1095 (W1095C ) of human S0RL1, wherein the mutation is a substitution of tryptophan to cysteine at position 1096 (W1096C ) of human SORL1 , wherein the mutation is a substitution of aspartic acid to asparagine at position 1102 (D1102N ) of human SORL1, wherein the mutation is a substitution of cysteine to tyrosine at position 1103 (C1103Y ) of human SORL1, wherein the mutation is a substitution of aspartic acid to histidine at position 1105 (D1105H ) of human SORL1 , wherein the mutation is a substitution of aspartic acid to asparagine at position 1108 (D1108N) of human SORL1 , or wherein the mutation is a substitution of cysteine to tyrosine at position 1112 (C1112Y) of human SORL1.

Items 2

1. An antisense oligonucleotide (ASO) comprising or consisting of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24.

2. An antisense oligonucleotide (ASO) binding or capable of binding to a target site comprising or consisting of a target polynucleotide sequence having at least 80% sequence identity to a target polynucleotide sequence selected from the group consisting of: SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48.

3. The antisense oligonucleotide according to any one of the preceding claims, wherein binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA, wherein exon 23 comprises or consists of a polynucleotide sequence of SEQ ID NO: 49, or a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 49.

4. The antisense oligonucleotide according to any one of the preceding claims, wherein binding to a target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA, wherein exon 23 comprises or consists of a polynucleotide sequence having at least 80% sequence identity to a polynucleotide selected from the group consisting of: SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107. 5. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide further comprises one or more modifications at at least one nucleotide position, or at each nucleotide position, wherein the modifications are modifications of the nucleic acid backbone, the nucleobase, the ribose sugar and/or 2'-ribose substitutions.

6. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more modifications of the nucleic acid backbone selected from the group consisting of: Phosphorothioate (PS) modifications, Mesyl phosphoramidate (MsPA) modifications, p-toluenesulfonyl phosphoramidate (Ts) modifications, and 4- (trimythylammonio)butylsulfonyl phosphoramidate (N+) modifications.

7. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more modifications of the ribose sugar selected from the group consisting of: 2’-O-methyl (2’-0me), 2’-O-methoxyethyl (2’MOE), 2’-fluoro (2’-F), Locked nucleic acid (LNA), 2’- 0,4’C-ethylene-bridged nucleic acid (ENA), 2’,4’-constrained 2’-0-ethyl (cEt), Amido-bridged nucleic acid (AmNA), Guanidine-bridged nucleic acid (GuNA), Cyclohexenyl nucleic acid (CeNA), Anhydrohexitol nucleic acid (HNA), Altritol nucleic acid (ANA), Tricyclo-DNA (tc-DNA), and 7’, 5’-alpha-bicyclo-DNA (7’5’- a-bc-DNA).

8. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is between 12 to 25 nucleotides in length.

9. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is conjugated to a moiety or to a nanoparticle formulation, such as wherein the moiety is a cell-targeting moiety and/or a cell-penetrating moiety and/or wherein the antisense oligonucleotide is conjugated to Triantennary N-acetylgalactosamine (GalNAc) moiety, TAT (SEQ ID NO: 108) and/or a peptide. An antisense oligonucleotide (ASO) according to any one of claims 1 to 9, for use as a medicament. An antisense oligonucleotide (ASO) according to any one of claims 1 to 9, for use in the prevention, treatment and/or alleviation of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies. An in vitro method for mediating exon skipping in SORL1 transcripts in a cell, tissue or organ, wherein the method comprises the step of contacting said cell, tissue or organ with the antisense oligonucleotide according to any one of claims 1 to 9, wherein the exon is exon 23 of SORL1 , such as wherein one ASO is used or wherein more than one ASO is used. The method according to claim 12, wherein the amount of SORL1 transcripts in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition and/or wherein the amount of SORLA protein in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition. An in vitro method of determining the efficiency of ASO mediated SORL1 exon skipping, the method comprising the following steps: a) analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in a first sample comprising cerebrospinal fluid, obtained before contacting with an ASO, b) analyzing the levels of SORLA lacking the complement-type repeat encoded by exon 23 in a second sample comprising cerebrospinal fluid as in a), obtained after contacting with an ASO, c) comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the samples of a) and b), and d) determining exon skipping if the level of SORLA lacking the complement-type repeat encoded by exon 23 in b) is higher than in a). A method of producing an ASO suitable for treatment of a patient with Alzheimer’s Disease, wherein the patient carries a mutation in an exon encoding a complement-type repeat (CR) domain of SORLA, the method comprising the following steps: a. identifying an ASO according to any one of claims 1 to 9, b. determining if the target site of the ASO comprises the mutation, or if the target site of the ASO does not comprise the mutation, and c. determining that the ASO that binds to a target site not comprising the mutation is suitable for treatment of a patient with Alzheimer’s Disease.

Claims

1. An antisense oligonucleotide (ASO) comprising or consisting of a polynucleotide sequence having at least 80% sequence identity, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity, to a polynucleotide selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, wherein binding of the antisense oligonucleotide to a target site causes exon skipping of exon 23 encoding a complement-type repeat (OR) domain of SORLA.

2. The antisense oligonucleotide according to claim 1 , wherein the antisense oligonucleotide binds or is capable of binding to a target site on the pre-mRNA of SORL1.

3. An antisense oligonucleotide (ASO) binding or capable of binding to a target site comprising or consisting of a target polynucleotide sequence having at least 80% sequence identity, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity, to a target polynucleotide sequence selected from the group consisting of: SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, wherein binding to the target site causes exon skipping of exon 23 encoding a complement-type repeat (CR) domain of SORLA.

4. The antisense oligonucleotide according to any one of the preceding claims, wherein exon 23 comprises or consists of a polynucleotide sequence of SEQ ID NO: 49, or a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 49, such as at least 85%, 90%, 95%, 98% or 99% sequence identity.

5. The antisense oligonucleotide according to any one of the preceding claims, wherein exon 23 comprises or consists of a polynucleotide sequence having at least 80% sequence identity, such as at least 85%, 90%, 95%, 98%, 99% or 100% sequence identity, to a polynucleotide selected from the group consisting of: SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107.

6. The antisense oligonucleotide according to any one of the preceding claims, wherein exon 23 comprises a mutation selected from the list consisting of: P.C1078R (T>C), p.R1080C (C>T), p.R1084C (C>T), p.W1095C (G>C), P.W1096C (G>C), p.D1102N (G>A), p.C1103Y (G>A), p.D1105H (G>C), p.D1108N (G>A), and p.C1112Y (G>A).

7. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide further comprises one or more modifications at at least one nucleotide position, or at each nucleotide position.

8. The antisense oligonucleotide according to claim 7, wherein the modifications are modifications of the nucleic acid backbone, the nucleobase, the ribose sugar and/or 2'-ribose substitutions.

9. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more modifications selected from the group consisting of: Peptide nucleic acid (PNA), Serinol nucleic acid (SNA), Phosphorodiamidate morpholino oligomer (PMO), Thiomorpholino oligonucleotide (TMO), and Morpholino nucleic acid (MNA).

10. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more modifications of the nucleic acid backbone selected from the group consisting of: Phosphorothioate (PS) modifications, Mesyl phosphoramidate (MsPA) modifications, p-toluenesulfonyl phosphoramidate (Ts) modifications, and 4- (trimythylammonio)butylsulfonyl phosphoramidate (N+) modifications.

11 . The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more modifications of the ribose sugar selected from the group consisting of: 2’-O-methyl (2’-0me), 2’-O-methoxyethyl (2’MOE), 2’-fluoro (2’-F), Locked nucleic acid (LNA), 2’- 0,4’C-ethylene-bridged nucleic acid (ENA), 2’,4’-constrained 2’-0-ethyl (cEt), Amido-bridged nucleic acid (AmNA), Guanidine-bridged nucleic acid (GuNA), Cyclohexenyl nucleic acid (CeNA), Anhydrohexitol nucleic acid (HNA), Altritol nucleic acid (ANA), Tricyclo-DNA (tc-DNA), and 7’, 5’-alpha-bicyclo-DNA (7’5’- a-bc-DNA).

12. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more 2’,4’-constrained 2'-0-Ethyl (cEt) modifications.

13. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more 2'-O-Methylation (2’-OMe) modifications.

14. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises one or more phosphorothioate modifications.

15. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises a 2'-O-methoxyethyl (2’MOE) sugar modification.

16. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide comprises a locked nucleic acid.

17. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is between 12 to 25 nucleotides in length, such as between 12 and 23 nucleotides, between 12 and 21 nucleotides, between 12 and 20 nucleotides, between 12 and 19 nucleotides, between 12 and 18 nucleotides, between 12 and 16 nucleotides, between 12 and 14 nucleotides, between 14 and 25 nucleotides, between 14 and 23 nucleotides, between 14 and 21 nucleotides, between 14 and 20 nucleotides, between 14 and 19 nucleotides, between 14 and 18 nucleotides, between 14 and 16 nucleotides, between 16 and 25 nucleotides, between 16 and 23 nucleotides, between 16 and 21 nucleotides, between 16 and 20 nucleotides, between 16 and 19 nucleotides, between 16 and 18 nucleotides, between 18 and 25 nucleotides, between 18 and 23 nucleotides, between 18 and 21 nucleotides, between 18 and 20 nucleotides, between 18 and 19 nucleotides, between 19 and 25 nucleotides, between 19 and 23 nucleotides, between 19 and 21 nucleotides, between 19 and 20 nucleotides, between 20 and 25 nucleotides, between 20 and 23 nucleotides, between 20 and 21 nucleotides, between 21 and 25 nucleotides, between 21 and 23 nucleotides, between 23 and 25 nucleotides.

18. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is between 12 and 25 nucleotides long.

19. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is at least 12 nucleotides long, such as at least 14 nucleotides, and/or at least 16 nucleotides and/or at least 18 nucleotides, and/or at least 20, and/or at least 22 nucleotides, and/or at least 24 nucleotides, and/or at least 26 nucleotides, and/or at least 28 nucleotides, and/or at least 30 nucleotides long.

20. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is 23 nucleotides long.

21. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide has a GC-content of 40 to 60%, such as 45 to 55%.

22. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is conjugated to a moiety or to a nanoparticle formulation.

23. The antisense oligonucleotide according to claim 22, wherein the moiety is a cell-targeting moiety and/or a cell-penetrating moiety.

24. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is conjugated to Triantennary N- acetylgalactosamine (GalNAc) moiety, TAT (SEQ ID NO: 108) and/or a peptide.

25. The antisense oligonucleotide according to any one of the preceding claims, wherein the antisense oligonucleotide is targeted to a 5’ splice site, a 3’ splice site and/or an exonic splice enhancer site (ESE).

26. A composition comprising the antisense oligonucleotide according to any one of the preceding claims, such as a pharmaceutical composition.

27. The composition according to claim 26 comprising one or more of said antisense oligonucleotides.

28. An antisense oligonucleotide (ASO) according to any one of claims 1 to 25 and/or the composition according to any one of claims 26 to 27, for use as a medicament.

29. An antisense oligonucleotide (ASO) according to any one of claims 1 to 25 and/or the composition according to any one of claims 26 to 27, for use in the prevention, treatment and/or alleviation of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies, or a disease or disorder associated with Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies.

30. The antisense oligonucleotide and/or the composition for use according to any one of claims 28 to 29, wherein an effective amount of the antisense oligonucleotide is administered to the eye, to the spinal cord, to the nose, to the cerebrospinal fluid, to the brain and/or to the liver, such as wherein the antisense oligonucleotide is administered intrathecally or intranasally.

31 . Use of an antisense oligonucleotide according to any one of claims 1 to 25 in the manufacture of a medicament for treatment of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies.

32. A method for treatment of Alzheimer’s Disease, Parkinson’s Disease, or Dementia with Lewy bodies comprising administration of a therapeutically effective amount of an antisense oligonucleotide according to any one of claims 1 to 25 to an subject in need thereof.

33. A method for mediating exon skipping in SORL1 transcripts in a cell, tissue or organ, wherein the method comprises the step of contacting said cell, tissue or organ with the antisense oligonucleotide according to any one of claims 1 to 25 and/or the composition according to any one of claims 26 to 27, wherein the exon is exon 23 of SORL1.

34. The method according to claim 33, wherein one ASO is used.

35. The method according to any one of claims 33 to 34, wherein more than one ASO is used, such as 2 ASOs, such as 3 ASOs, such as 4 ASOs, such as 5 ASOs, such as 6 ASOs, such as 7 ASOs, such as 8 ASOs, such as 9 ASOs, such as 10 ASOs, such as 11 ASOs, such as 12 ASOs, such as 13 ASOs, such as 14 ASOs, such as 15 ASOs, such as 16 ASOs, such as 17 ASOs, such as 18 ASOs, such as 19 ASOs, such as 20 ASOs, such as 21 ASOs, such as 22 ASOs, such as 23 ASOs, or 24 ASOs.

36. The method according to any one of claims 33 to 35, wherein exon skipping of one exon is mediated.

37. The method according to any one of claims 33 to 36, wherein the ASO inhibits the inclusion of exon 23 of SORL1 with an IC50 of 20 nM or less, such as 19 nM or less, such as 18 nM or less, such as 17 nM or less, such as 16 nM or less, such as 15 nM or less, such as 14 nM or less, such as 13 nM or less, such as 12 nM or less, such as 11 nM or less, such as 10 nM or less, such as 9 nM or less, such as 8 nM or less, such as 7 nM or less, such as 6 nM or less, such as 5 nM or less, such as 4 nM or less, or such as 3 nM or less.

38. The method according to any one of claims 33 to 37, wherein the ASO inhibits the inclusion of exon 23 of SORL1 with an IC50 of 2.6 nM or less.

39. The method according to any one of claims 33 to 38, wherein the ASO promotes skipping of exon 23 of SORL1 with an EC50 of 20 nM or less, such as 19 nM or less, such as 18 nM or less, such as 17 nM or less, such as 16 nM or less, such as 15 nM or less, such as 14 nM or less, such as 13 nM or less, such as 12 nM or less, such as 11 nM or less, such as 10 nM or less, such as 9 nM or less, such as 8 nM or less.

40. The method according to any one of claims 33 to 39, wherein the amount of SORL1 transcripts in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 81 %, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition.

41 . The method according to claim 40, wherein the amount of SORL1 transcripts in said cell, tissue or organ is determined by qPCR.

42. The method according to any one of claims 33 to 39, wherein the amount of SORLA protein in said cell, tissue or organ is at least 80% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition, such as at least 81%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as at least 100% compared to said cell, tissue or organ without said contacting with the antisense oligonucleotide and/or the composition.

43. The method according to claim 42, wherein the amount of SORLA protein in said cell, tissue or organ is determined by western blotting.

44. A method of determining the efficiency of ASO mediated SORL1 exon skipping in a subject, the method comprising the following steps: a. analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in a first sample comprising cerebrospinal fluid derived from a patient, obtained before treatment with an ASO, b. analyzing the levels of SORLA lacking the complement-type repeat encoded by exon 23 in a second sample comprising cerebrospinal fluid derived from the same patient as in a), obtained after treatment with an ASO, such as an ASO as defined in any of claims 1 to 25, c. comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the samples of a) and b), and d. determining exon skipping if the level of SORLA lacking the complement-type repeat encoded by exon 23 in b) is higher than in a).

45. The method according to claim 44, optionally comprising the step of obtaining sample b) at several time points after treatment with an ASO, thus monitoring the efficiency of ASO mediated exon skipping over time.

46. A method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, such as an ASO as defined in any of claims 1 to 25, d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in the first and the second aliquot, f. comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of SORLA lacking the complement-type repeat encoded by exon 23 in the first aliquot is higher than in the second aliquot.

47. A method of determining the efficiency of ASO mediated SORL1 exon skipping, the method comprising the following steps: a. analyzing the levels of SORLA lacking a complement-type repeat encoded by exon 23 in a first sample comprising cerebrospinal fluid, obtained before contacting with an ASO, such as an ASO as defined in any of claims 1 to 25, b. analyzing the levels of SORLA lacking the complement-type repeat encoded by exon 23 in a second sample comprising cerebrospinal fluid as in a), obtained after contacting with an ASO, c. comparing the level of SORLA lacking the complement-type repeat encoded by exon 23 in the samples of a) and b), and d. determining exon skipping if the level of SORLA lacking the complement-type repeat encoded by exon 23 in b) is higher than in a).

48. A method for testing if a patient identified with a SORL1 mutation will benefit from treatment with an ASO mediating exon skipping, the method comprising the steps of: a. determining if the mutation is in exon 23 of SORL1 , b. if yes, obtaining a cell comprising the SORL1 mutation identified in the patient, c. selecting an ASO that targets the exon 23, such as an ASO as defined in any of claims 1 to 25 d. contacting a first aliquot of cells with medium comprising the selected ASO, and contacting a second aliquot of cells with medium not comprising an ASO, e. analyzing the levels of endoplasmic reticulum-resident SORLA in the first and the second aliquot, f. comparing the level of endoplasmic reticulum-resident SORLA in the first and the second aliquot, and g. concluding that the patient will benefit from treatment with the ASO if the level of endoplasmic reticulum-resident SORLA in the second aliquot is higher than in the first aliquot.

49. The method according to any one of claims 44 to 48, wherein the method is an in-vitro method.

50. The method according to any one of claims 44 to 49, wherein said ASO is an ASO according to any one of claims 1 to 25.

51. A method of producing an ASO suitable for treatment of a patient with Alzheimer’s Disease, wherein the patient carries a mutation in an exon encoding a complement-type repeat (OR) domain of SORLA, the method comprising the following steps: a. identifying an ASO according to any one of claims 1 to 25, b. determining if the target site of the ASO comprises the mutation, or if the target site of the ASO does not comprise the mutation, and c. determining that the ASO that binds to a target site not comprising the mutation is suitable for treatment of a patient with Alzheimer’s Disease.

52. The method according to claim 51 , wherein the mutation is a calcium-cage- mutation, an asx-turn mutation or an odd-numbered cysteines-mutation.

53. The method according to any one of claims 50 to 52, wherein the mutation is a mutation in exon 23.

54. The method according to any one of claims 50 to 53, wherein the mutation is a substitution of cysteine to arginine at position 1078 (C1078R) of human SORL1, or wherein the mutation is a substitution of arginine to cysteine at position 1080 (R1080C ) of human SORL1, or wherein the mutation is a substitution of arginine to cysteine at position 1084 (R1084C ) of human SORL1, or wherein the mutation is a substitution of tryptophan to cysteine at position 1095 (W1095C ) of human SORL1, or wherein the mutation is a substitution of tryptophan to cysteine at position 1096 (W1096C ) of human SORL1, or wherein the mutation is a substitution of aspartic acid to asparagine at position 1102 (D1102N ) of human SORL1, or wherein the mutation is a substitution of cysteine to tyrosine at position 1103 (C1103Y ) of human SORL1, or wherein the mutation is a substitution of aspartic acid to histidine at position 1105 (D1105H ) of human SORL1, or wherein the mutation is a substitution of aspartic acid to asparagine at position 1108 (D1108N) of human SORL1 , or wherein the mutation is a substitution of cysteine to tyrosine at position 1112 (C1112Y) of human SORL1.

55. The method according to any one of claims 50 to 53, wherein the mutation is: a. a substitution of guanine (G) to cytosine (C) at position chr11 :121570221 , b. a substitution of guanine (G) to adenine (A) at position chr11 :121570221 , c. a substitution of guanine (G) to adenine (A) at position chr11 :121570237, d. a substitution of thymine (T) to cytosine (C) at position chr11 :121570240, e. a substitution of guanine (G) to adenine (A) at position chr11 :121570241 , f. a substitution of guanine (G) to cytosine (T) at position chr11 :121570241 , g. a substitution of guanine (G) to cytosine (C) at position chr11 :121570246, h. a deletion of adenine (A) and cytosine (C) at position chr11 :121570247, i. a substitution of guanine (G) to adenine (A) at position chr11 :121570255, j. a substitution of guanine (G) to cytosine (C) at position chr11 :121570255, k. a substitution of adenine (A) to thymine (T) at position chr11 :121570256, l. a substitution of guanine (G) to adenine (A) at position chr11 :121570258, m. a substitution of adenine (A) to guanine (G) at position chr11 :121570259, n. a substitution of guanine (G) to adenine (A) at position chr11 :121570268, o. a substitution of guanine (G) to thymine (T) at position chr11 :121570268, p. a substitution of thymine (T) to cytosine (C) at position chr11:121570165, q. a substitution of cytosine (C) to thymine (T) at position chr11 :121570171 , r. a substitution of cytosine (C) to thymine (T) chr11 :121570183, s. a deletion a deletion of cytosine (C) at position chr11 :121570194, or t. an insertion of guanine (G) after thymine (T) at position chr11:121570219.