WO2025255572A1 - Compositions and methods for crispr/cas9 rna-guided editing of the chloroplast genome - Google Patents
Compositions and methods for crispr/cas9 rna-guided editing of the chloroplast genomeInfo
- Publication number
- WO2025255572A1 WO2025255572A1 PCT/US2025/032880 US2025032880W WO2025255572A1 WO 2025255572 A1 WO2025255572 A1 WO 2025255572A1 US 2025032880 W US2025032880 W US 2025032880W WO 2025255572 A1 WO2025255572 A1 WO 2025255572A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pegrna
- plant
- plastid
- nucleic acid
- cas9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1276—RNA-directed DNA polymerase (2.7.7.49), i.e. reverse transcriptase or telomerase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
- C12N9/222—Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
- C12N9/226—Class 2 CAS enzyme complex, e.g. single CAS protein
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
Definitions
- Plastids are DNA containing organelles in plant cells.
- the plastid genome 30 of crop plants is relatively small, 120-kb to 150-kb in size, and is present in hundreds to thousands of copies per cell.
- Engineering of the plastid genomes is a promising new technology, 1
- TALE-repeat based 10 technology enables editing of nucleotides in a 12 to 24 nucleotide window.
- TALE mediated RNA-guided editing of specific nucleotides lacks precision.
- SUMMARY OF THE INVENTION 15 In accordance with the present invention, a system for introducing mutations into targeted sites in a plant plastid genome are disclosed.
- An exemplary system comprises a first a nucleic acid construct encoding a prime editor guide RNA (pegRNA) harboring a primer binding site, a reverse transcriptase template, a spacer sequence and scaffold sequence operably linked to a nucleic acid encoding a selectable marker and plastid targeting sequences for introduction into 20 the plastid genome of said plant, said spacer sequences in said pegRNA directing a prime editor complex to the DNA harboring said targeted site in said plastid genome, and said reverse transcriptase template facilitating nick repair.
- pegRNA prime editor guide RNA
- the system also comprises a second nucleic acid construct encoding a prime editor (PE) comprising a Cas9 nickase variant operably linked to an engineered polymerase, and a plastid transit peptide (TP), into the nucleus of said plant; wherein 25 said TP-PE is translated on cytoplasmic ribosomes and imported to the plastid, said PE forming a complex with said pegRNA and binding said targeted site and nicking said DNA, followed by gap repair mediated by said engineered polymerase, wherein said repair introduces said mutation at said targeted site.
- the mutation is an insertion or a deletion into said plastid DNA.
- the construct of step a) can comprises at least one riboswitch sequence.
- the construct of step a) can be introduced using a shuttle vector. In another embodiment of the 2
- the nucleic acid construct of step a) encodes a dicistronic, transcript of pegRNA which initiates from an rbcL promoter and a 3’ end is generated by processing upstream of tRNA.
- the dicistronic transcript is encoded by SEQ ID NOS: 33 to 44.
- the Cas9 in the PE is a variant having nickase activity. 5
- introduction of said mutation increases photosynthesis in said plant, or confers resistance to commercial herbicides or confers abiotic resistance.
- the mutation can confer a growth advantage to the plant.
- the mutation could also confer a growth disadvantage in a weed plant for example.
- an alternative method for introducing mutations into targeted sites in a plant plastid genome is provided using the system described above and herein below.
- the pegRNA may be present on a chloroplast shuttle plasmid, or from a nuclear gene wherein said ELVd viroid leader is operably linked to pegRNA.
- transplastomic maternal parent plants 15 harboring pegRNA and a nucleic acid of interest comprising said target site in plant chloroplasts can be crossed with a pollen parent plant having high editing efficiency which harbors PE operably linked to an egg-cell specific promoter wherein transplastomic progeny plants resulting from such crosses comprise readily identifiable edited target sites.
- a kit for practicing the methods described above are also provided.
- FIG. 1A Traditional “one-vector-one mutation” protocol (12). The mutation is introduced in the cloned fragment and linked to the selectable marker gene. The mutation is introduced into the plastid genome by homologous 25 recombination.
- FIG. 1B Prime editing, the test system version. The pegRNA gene is incorporated in the plastid genome; the primary transcript is processed into pegRNA. PE gene is in the nucleus, translated on cytoplasmic ribosomes and is imported to the plastid from the cytoplasm. PE combines with the pegRNA, identifies the target site to be modified and edits the nicked DNA using the template. 30 3
- FIG. 3A Agrobacterium 5 nuclear transformation vector for introduction of Cas9 gene.
- the Pt-Cas9 is in a P35S/T35S cassette and is fused with the Rubisco small subunit transit peptide (TP).
- the Pt-Cas9 coding region is included in an NcoI-XbaI DNA fragment.
- SEQ ID NO: 1 aacCI is a gentamycin- resistant marker gene and LB and RB are the T-DNA left and right borders in a pPZP221(20).
- Fig. 3B Accumulation of Cas9 protein in the leaves of transgenic tobacco plants. Cas9 protein 10 (164 kDa) is detected at high levels in three out of 55 independent transgenic lines (#12, #13, and #35) using Cas9 monoclonal antibody.
- Figure 4. The schematic outline of the sgRNA constructs targeting the ndhA and ndhK coding regions. 15 Figure 5. sgRNA processing efficiency determined by qRT-PCR in RNA isolated from the leaves of pDiA1 plants (pCB101).
- Seed progeny derived from the cross of sgRNA DiA1 maternal parent (SEQ ID NO: 3) and PT-Cas9 pollen parent (SEQ ID NO: 1) has pigment deficient sectors indicating deletion of essential genes.
- Fig. 7A Germinating tobacco seedlings on antibiotic medium to identify progeny carrying PT-Cas9 gene. Picture taken 30 days post planting.
- Fig. 7B Seedling transferred to a plate 7-days post planting where it grew larger than its sibs. 30 4
- Figure 8 PCR analyses reveal deletions flanking the Cas9 target site in the ndhA gene.
- the wild type fragment is 4.9 kb; major products repaired by microhomology-mediated end joining (MMEJ) are 1.3 kb (via microrepeat #1; SEQ ID NO: 22) and 0.7 kb (via micorepeat #2; SEQ ID NO: 23), respectively.
- Minor products are 1.4 kb (microrepeat #3; SEQ ID NO: 24) and 1.6 5 kb (microrepeat #4, SEQ ID NO: 25).
- PCR primers were MM47/MM48. For primer positions see Figure 9A.
- FIG. 9A The map of ndhH operon in the tobacco plastid genome flanked by the 10 essential ycf1 and ycf5 plastid genes. The position of target site (spacer sequence) in the ndhA gene is marked by vertical arrow; the position of short repeat sequences involved in MMEJ in the ptDNA is numbered 1-4.
- FIG. 9B Junction sequences created by MMEJ.
- FIG. 11A PE guided by pegRNA expressed from a NICE shuttle plasmid activates dgfp gene.
- FIG. 11A PE is encoded in the nucleus (SEQ ID NO: 2) and dgfp in the plastid genome. No 20 GFP accumulation.
- FIG. 11B pegRNA gene (SEQ ID NO: 29, 30, 31, 32) introduced on shuttle plasmid (15, 16) and PE, guided by the pegRNA, substitutes T for an A removing the stop codon. GFP accumulates in chloroplasts.
- Horizontal arrows indicate transcription initiation sites and direction, wavy lines represent RNA transcripts.
- Vertical lines indicate expected RNA processing points. The arrow with an X is not processed at the expected site.
- Figure 13 RNA-Seq data for each sgRNA transplastomic line.
- Y axis represent the coverage 30 (read depth).
- X axis shows the distance from the SacI site in the sgRNA minigene cassette (nt).
- First grey bar represent the promotor; slanted line pattern, sgRNA genes; lighter grey box, 5
- tRNA Gly gene dark gray, His/Thr attenuator. All samples were prepared using the Takara small RNA sequencing kit, with the exception of pCB101 and pCB113, which were prepared with the NEB small RNA sequencing kit. 5 Figure 14. 5’ ends determined by RNA sequencing. Bold nucleotides identify transcription start sites (TSS) determined by primer extension, grey nucleotides indicate the first two nucleotides of the gRNA. Figure 15. 3’ ends determined by RNA sequencing. Grey nucleotides indicate the last two 10 nucleotides of the sgRNA. The HDV first nucleotide is underlined. Figure 16. Identification of PE pollen parents with high-efficiency editing capacity in fertilized egg cells. 15 Figure 17.
- Vectors for testing PE function by visual observation of GFP fluorescence Vector pMM130, inactive dgfp, Nt-atpH wt (SEQ ID NO: 29). pMM131, dgfp, Zm-atpH AA . Note editing of TAA stop codon by A to T substitution (TAA is replaced by TAT codon) (SEQ ID NO: 30).
- the construct is in a TVV1 plastid transformation vector (26).
- PegRNA minigene in a TVV1 plastid transformation vector derivative For TVV1 vector see (26).
- the minigene is transcribed from a rRNA operon promoter (Prrn), has the spacer sequence targeting the PE, the reverse transcriptase template (RTT, typically 13 nt) and the primer binding site (PBS, typically 13 nt).
- RTT reverse transcriptase template
- PBS primer binding site
- 25 Constant parts of the pegRNA Zea mays rRNA operon PEP promoter (Prrn Zm ): (SEQ ID NO: 46); Hepatitis delta virus (hdv) ribozyme (SEQ ID NO: 47) or tRNA Gly (SEQ ID NO: 48).
- Prime editing tools for precise editing of the chloroplast genomes (exemplified using 30 Nicotiana tabacum (tobacco), and a model system of plastid genome engineering (11)) are described herein.
- the advantage of prime editing over base editing is not only precision but also 6
- Prime editing is a versatile and precise genome editing method that directly writes new genetic information into a specified DNA site using a nucleic acid programmable DNA binding protein (“napDNAbp”) working in association with a polymerase (i.e., in the form of a fusion protein or otherwise provided in trans, e.g., on a shuttle vector, with the napDNAbp), wherein the 10 prime editing system is programmed with a prime editing (PE) guide RNA (“pegRNA”) (or as in the instant disclosure, programmed with an engineered pegRNA) that both specifies the target site and templates the synthesis of the desired edit in the form of a replacement DNA strand by way of an extension (either DNA or RNA) engineered onto a guide RNA (e
- PE prime editing
- pegRNA prime editing guide RNA
- the replacement strand containing the desired edit 15 (e.g., a single nucleobase substitution, deletion, or insertion) shares the same sequence as the endogenous strand of the target site to be edited (with the exception that it includes the desired edit).
- the endogenous strand of the target site is replaced by the newly synthesized replacement strand containing the desired edit.
- prime editing may be thought of as a “search-and-replace” genome editing technology 20 since the prime editors, as described herein, not only search and locate the desired target site to be edited, but at the same time, encode a replacement strand containing a desired edit which is installed in place of the corresponding target site endogenous DNA strand.
- prime editing operates by contacting a target DNA molecule (for which a change in the nucleotide sequence is desired to be introduced) with a nucleic acid 25 programmable DNA binding protein (napDNAbp) complexed with a pegRNA.
- a target DNA molecule for which a change in the nucleotide sequence is desired to be introduced
- a nucleic acid 25 programmable DNA binding protein napDNAbp
- the pegRNA comprises an extension at the 3′ or 5′ end of the guide RNA, or at an intramolecular location in the guide RNA and encodes the desired nucleotide change (e.g., single nucleotide change, insertion, or deletion).
- the data shown here demonstrate efficacy using guide strands at the 3’ end of the pegRNA.
- Cas9 or “Cas9 nuclease” refers to an RNA-guided nuclease comprising a Cas9 domain, or a fragment thereof (e.g., a protein comprising an active or inactive DNA 7
- a “Cas9 domain” as used herein, is a protein fragment comprising an active or inactive cleavage domain of Cas9 and/or the gRNA binding domain of Cas9.
- a “Cas9 protein” is a full length Cas9 protein.
- a Cas9 nuclease is also referred to sometimes as a casn1 nuclease or a CRISPR (Clustered Regularly Interspaced 5 Short Palindromic Repeat)-associated nuclease.
- CRISPR is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements, and conjugative plasmids).
- CRISPR clusters contain spacers, sequences complementary to antecedent mobile elements, and target invading nucleic acids. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). In type II CRISPR systems, correct processing of 10 pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (mc), and a Cas9 domain. The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre- crRNA. Subsequently, Cas9/crRNA/tracrRNA endonucleolytically cleaves a linear or circular dsDNA target complementary to the spacer.
- tracrRNA trans-encoded small RNA
- mc endogenous ribonuclease 3
- Cas9 domain The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre- crRNA.
- sgRNA single guide RNAs
- gRNA single guide RNAs
- Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or 20 protospacer adjacent motif) to help distinguish self versus non-self.
- Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., “Complete genome sequence of an M1 strain of Streptococcus pyogenes.” Ferretti et al., J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y., Jia H.
- Cas9 nuclease comprises one or more mutations that partially impair or inactivate the DNA cleavage domain.
- a nuclease-inactivated Cas9 domain may interchangeably be referred to as a “dCas9” protein (for nuclease-“dead” Cas9).
- Methods for generating a Cas9 domain (or a fragment 10 thereof) having an inactive DNA cleavage domain are known (see, e.g., Jinek et al., Science. 337:816-821(2012); Qi et al., “Repurposing CRISPR as an RNA-Guided Platform for Sequence- Specific Control of Gene Expression” (2013) Cell. 28; 152(5):1173-83, the entire contents of each of which are incorporated herein by reference).
- the DNA cleavage domain of Cas9 is known to include two subdomains, the HNH nuclease subdomain and the RuvC1 15 subdomain.
- the HNH subdomain cleaves the strand complementary to the gRNA, whereas the RuvC1 subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9.
- the mutations D10A and H840A completely inactivate the nuclease activity of S. pyogenes Cas9 (Jinek et al., Science. 337:816- 821(2012); Qi et al., Cell. 28; 152(5):1173-83 (2013)).
- proteins 20 comprising fragments of Cas9 are provided.
- a protein comprises one of two Cas9 domains: (1) the gRNA binding domain of Cas9; or (2) the DNA cleavage domain of Cas9.
- proteins comprising Cas9 or fragments thereof are referred to as “Cas9 variants.”
- a Cas9 variant shares homology to Cas9, or a fragment thereof.
- a Cas9 variant is at least about 70% identical, at least about 80% identical, 25 at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, at least about 99.8% identical, or at least about 99.9% identical to wild type Cas9.
- the Cas9 variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 30 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more amino acid changes compared to wild type Cas9.
- the Cas9 variant comprises a fragment of Cas9 (e.g., a gRNA binding 9
- fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the corresponding 5 fragment of wild type Cas9.
- the fragment is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid length of a corresponding wild type Cas9.
- cDNA refers to a strand of DNA copied from an RNA template. cDNA is complementary to the RNA template.
- CRISPR is a family of DNA sequences (i.e., CRISPR clusters) in bacteria and archaea that represent snippets of prior infections by a virus that have invaded the prokaryote.
- the snippets of DNA are used by the prokaryotic cell to detect and destroy DNA from subsequent 15 attacks by similar viruses and effectively compose, along with an array of CRISPR-associated proteins (including Cas9 and homologs thereof) and CRISPR-associated RNA, a prokaryotic immune defense system.
- CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA).
- tracrRNA trans-encoded small RNA
- mc endogenous 20 ribonuclease 3
- Cas9 protein a trans-encoded small RNA
- the tracrRNA serves as a guide for ribonuclease 3-aided processing of pre-crRNA.
- Cas9/crRNA/tracrRNA endonucleolytically cleaves a linear or circular dsDNA target complementary to the RNA.
- the target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3′-5′ exonucleolytically.
- RNA-binding and cleavage typically requires protein and both RNAs.
- single 25 guide RNAs (“sgRNA”, or simply “gRNA”) can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA species—the guide RNA.
- sgRNA single 25 guide RNAs
- Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or protospacer adjacent motif) to help distinguish self 30 versus non-self.
- CRISPR biology, as well as Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., “Complete genome sequence of an M1 strain of 10
- Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermophilus. Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, “The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” 15 (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference.
- CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. 20 tracrRNA or an active partial tracrRNA), a tracr mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
- a tracr trans-activating CRISPR
- a tracr mate sequence encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system
- guide sequence also referred to as a “spacer” in the context of an endogenous CRIS
- the tracrRNA of the system is complementary (fully or partially) to the tracr mate sequence present on the guide RNA.
- DNA synthesis template refers to the region or portion of the extension arm of a pegRNA that is utilized as a template strand by a polymerase of a prime editor to encode a 3′ single-strand DNA flap that contains the desired edit and which then, through the mechanism of prime editing, replaces the corresponding endogenous strand of DNA at the target site.
- the term “effective amount,” as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, 11
- an effective amount of a prime editor may refer to the amount of the editor that is sufficient to edit a target site nucleotide sequence, e.g., a genome.
- an effective amount of a prime editor (PE) provided herein, e.g., of a fusion protein comprising a nickase Cas9 domain and a reverse transcriptase may refer to the amount of the fusion protein that is 5 sufficient to induce editing of a target site specifically bound and edited by the fusion protein.
- an agent e.g., a fusion protein, a nuclease, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide
- an agent e.g., a fusion protein, a nuclease, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide
- the term “linker,” as used herein, refers to a molecule linking two other molecules or moieties. The linker can be an amino acid sequence in the case of a linker joining two fusion proteins.
- a Cas9 can be fused to a polymerase (e.g., reverse transcriptase) by an amino acid linker sequence.
- the linker can also be a nucleotide sequence in the case of joining 15 two nucleotide sequences together.
- the traditional guide RNA is linked via a spacer or linker nucleotide sequence to the RNA extension of a prime editing guide RNA which may comprise a RT template sequence and an RT primer binding site.
- the linker is an organic molecule, group, polymer, or chemical moiety.
- the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13,20 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50- 60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated.
- nucleic acid programmable DNA binding protein or “napDNAbp,” of which Cas9 is an example, refers to a protein that uses RNA:DNA 25 hybridization to target and bind to specific sequences in a DNA molecule.
- Each napDNAbp is associated with at least one guide nucleic acid (e.g., guide RNA), which localizes the napDNAbp to a DNA sequence that comprises a DNA strand (i.e., a target strand in the chloroplast genome) that is complementary to the guide nucleic acid, or a portion thereof (e.g., the protospacer of a guide RNA).
- guide nucleic acid e.g., guide RNA
- the guide nucleic-acid “programs” the napDNAbp (e.g., Cas9 or 30 equivalent) to localize and bind to a complementary sequence.
- T-DNA is meant the T-DNA of an Agrobacterium tumefaciens Ti plasmid or from an Agrobacterium rhizogenes Ri plasmid, or a derivative thereof.
- the T-DNA may comprise an entire T-DNA, but need only comprise the minimal sequences required in cis for transfer (i.e., the right and the left T-DNA border sequences).
- T-DNA delivery to germline cells would enable 5 chloroplast transformation in all crops in which direct transformation of germline cells is feasible by the floral dip protocol.
- a “vector” of the present invention may comprise at least one of Agrobacterium Ti plasmid right border or left border region.
- the vectors may comprise at least one pair of borders.
- the vectors can include four pairs of borders, but the vector often comprise one or two pairs.
- the vectors of the present invention may further comprise a coding region for a selectable marker for the maintenance in bacterial hosts. Coding regions for selectable markers include Spec/Strp that encodes for Shigella flexneri aminoglycoside adenyltransferase (aadA) conferring resistance to spectinomycin or streptomycin (Chinault et al. 1986), or a gentamycin (Gm, Gent) selectable marker gene from a Tn21-like multiresistance transposon (Wohlleben et al., 1989). 15 Other resistance genes include carbenecillin, ampicillin, and kanamycin resistance genes.
- reporter gene In addition to a plant selectable marker, in some embodiments it may be desirable to use a reporter gene. In some instances, a reporter gene may be used with or without a selectable marker. Reporter genes are genes that are typically not present in the recipient organism or tissue and 20 typically encode for proteins resulting in some phenotypic change or enzymatic property. Preferred reporter genes include the beta-glucuronidase (GUS) of the uidA locus of E. coli, the chloramphenicol acetyl transferase gene from Tn9 of E.
- GUS beta-glucuronidase
- operably linked includes reference to a functional linkage between two sequences in a nucleic acid construct, for example, a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding 30 to the second sequence. Generally, operably linked means that the nucleic acid sequences being 13
- promoter includes reference to a region of DNA involved in recognition and binding of RNA polymerase and other proteins to initiate transcription.
- chloroplast “transit peptides” include, without limitation, the chloroplast small subunit of ribulose-1,5-bisphosphate carboxylase (Rubisco); 5-enolpyruvyl)shikimate-3-phosph- ate synthase (EPSPS); tryptophan synthase; plastocyanin; chorismate synthase; and the light harvesting chlorophyll a/b binding protein (LHBP).
- the present invention may be used for delivery of proteins to any plant species, 10 including, but not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus 15 tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut
- Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), 25 green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), 30 poinsettia (Euphorbia pulcherrima), and chrysanthemum.
- Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), 14
- plants of the present invention are crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.), more preferably corn and soybean plants, yet more preferably corn plants.
- crop plants for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.
- the following examples are provided to facilitate the practice of the invention. They are 10 not intended to limit the invention in any way.
- EXAMPLE 1 DEVELOPMENT OF CRISPR CAS SYSTEM FOR MODIFICATION OF THE CHLORPLAST GENOME 15
- Introduction of point mutations in the plastid genome is currently accomplished by the one-vector-one mutation protocol (Figure 1A) (12).
- the point mutation is introduced into a cloned fragment of the target gene, in this case psbA.
- the psbA gene encodes the D1 protein, a Photosystem II core protein, which is the target of commercial herbicides (13).
- the mutant gene is physically linked to a spectinomycin resistance (aadA) gene in the chloroplast transformation 20 vector, which is then introduced into plastids by the biolistic gun.
- aadA spectinomycin resistance
- the mutant gene integrates in the ptDNA by homologous recombination, replacing the target gene with the mutant version in the transformed T-ptDNA.
- PE prime editor
- PE is a fusion protein of the nCas9 25 endonuclease (nicking Casd9) and an engineered reverse transcriptase, programmed by the pegRNA that has the target specificity and serves as repair template (14) ( Figure 2).
- the pegRNA is expressed from a mini gene and acts in trans.
- the pegRNA can be provided using at least two different approaches. While developing the system, we shall permanently incorporate the pegRNA gene in the plastid genome ( Figure 1B). This way we can 30 conveniently characterize the pegRNA.
- the pegRNA will be expressed from a replicating shuttle plasmid ( Figure 11). The shuttle plasmid will be introduced 15
- RNA-guided DNA mutagenesis in the plastid genome can be achieved using the following steps. (1) Expression of Cas9 from a nuclear gene and verification of chloroplast localization. (2) Expression of sgRNAs from chloroplast mini genes and characterizing the processed sgRNAs by RNA sequencing. 15 (3) Demonstration of Pt-Cas9 function by cleavage of the target sequence in the plastid genome.
- the plastid Cas9 (Pt-Cas9) coding sequence was cloned into a cauliflower mosaic virus 35S promoter/terminator cassette (19) and the cassette was inserted in 25 the pPZP222 binary vector (20) ( Figure 3A).
- the Pt-Cas9 gene was introduced into the tobacco nuclear genome by selection for gentamycin resistance by standard protocols.
- Pt-Cas9 is constitutively transcribed in the nucleus, the mRNA is translated on cytoplasm ribosomes and the enzyme is imported into chloroplasts.
- PI proposes testing to alternative approaches to generate properly trimmed single guide RNA (sgRNA) and prime editing gRNA (pegRNA): the native tRNA enzymatic machinery processing the pre-tRNA into the mature tRNA, by the RNase P and RNase Z enzymes (22) and riboswitches (HH and HDV) (23) derived from heterologous systems. 15 sgRNA by processing with RNase P and/or RNase Z We have chosen two designs.
- a dicistronic design where transcription of sgRNA initiates from the rbcL promote (24), and the 3’ end is generated by processing upstream of tRNA by RNase P (SEQ ID NOS:3 and 6 in Figure 4).
- RNase P SEQ ID NOS:3 and 6 in Figure 4
- the sgRNA is sandwiched between two tRNAs and the 5’ and 3’ ends are generated by RNase P and RNase Z, respectively 20 ( Figure 4, SEQ ID NOS: 4, 5, 7 and 8).
- the mini genes shown in Figure 4 were introduced in the plastid genome by standard protocols.
- Plants were obtained by transformation with each of the constructs, except pTriA1 (SEQ ID NO: 4).
- the RNA isolated from young leaves of transplastomic plants was then tested 25 for splicing of sgRNAs using quantitative RT-PCR (Figure 5). Out of the five plant lines, significant processing was observed only in No.1, the dicistronic DiA1 plant.
- the PCR assay tested the cleavage between the sgRNA and the downstream tRNA GlyGGC . We have chosen tRNA Gly , because detailed information was available 17
- RNA preparation for sequencing to the Rutgers Genomics Center at the Rutgers Medical School in 5 Newark, NJ.
- the small RNAs have been size-selected ( ⁇ 300 nt) and sequenced directly. Transcription of the rbcL gene in tobacco initiates on an A nucleotide (24). In the sequenced RNA population very few transcripts initiate from the A. In four cases a slightly longer transcript is present, a TG is added on the A.
- sgRNA by processing with ribozymes
- An alternative approach to obtain sgRNAs is self ⁇ processing of ribozyme flanked RNAs into guide RNAs ( Figure 6).
- the sgRNAs are processed by the hammer head (HH) and hepatitis delta virus (HDV) ribozymes (23). Ribozymes have been used to produce precisely cleaved multiplexed gRNAs in human cells and plants (33,34).
- sgRNAs uniform single guide RNAs
- total cellular RNA was extracted 5 from transplastomic tobacco leaves, and small RNAs were sequenced using either the Takara SMARTer smRNA-seq Library Prep Kit or the NEBNext Small RNA Library Prep Kit.
- RNA-guided cleavage of the plastid genome Plastids do not have the non-homologous end joining enzymatic machinery to repair double-stranded DNA breaks as it is the case in E. coli. As the result, double-stranded breaks are 19
- MMEJ microhomology-mediated end joining
- Our goal is to determine DNA cleavage as an indication of Cas9 activity guided by sgRNAs in the ndhA and ndhK genes and the rpoB operon as a functional assay, to verify plastid localization of Pt-Cas9 and the functionality of the 5 sgRNAs.
- the ndhA and ndhK genes were chosen for targeted cleavage because deletion of the ndh genes does not have a readily detectable phenotype.
- the tobacco chloroplast genome encodes 11 NDH subunits, with the genes organized in four transcription units: ndhF, ndhB, ndhH/A/I/H/E/D and ndhC/K/J (36).
- the ndhC/K/J and ndhB genes have been deleted (37, 38) 10 and in the ndhB knockout plants only a moderate phenotype was found under extreme conditions (39). If deletion is relatively small and impacts only ndh genes, we expect to obtain plants with a wild type / green phenotype. If the deletions are larger and involve deletion of essential genes, Pt-Cas9 activity will yield variegated plants with small pigment deficient sectors in the leaves.
- the tobacco plastid ndhH operon including the ndhA gene, is 7.5 kb in size and is 15 localized in the small single copy region of the ptDNA.
- the sgRNA targets intron 1 of the ndhA gene.
- the genes flanking the ndhH operon are essential: ycf5 (ccsA) gene is on the right and rps15/ycf1 on the left.
- the gene ccsA (ycf5) encodes a protein mediating the attachment of heme to c-type cytochromes during cytochrome biogenesis (40).
- Rps15 encodes a non-essential small plastid ribosomal subunit protein RNA (41).
- the ycf1 reading frame encodes a component of a 20 translocon in the inner chloroplast membrane and is an essential gene (42).
- the map of ndhH operon, flanked by the essential genes ycf1 and ycf5, is shown in Figure 9.
- Plants expressing the DiA1 sgRNA and Pt-Cas9 were obtained by crossing. 32 out of 32 seedlings have pigment deficient sectors ( Figure 7). No pigment deficient sectors were observed on the maternal DiA1 plants, the maternal parent in the cross, derived from 3 independent 25 transgenic events grown in the greenhouse.
- the rpoB operon contains the rpoB, rpoC1 and rpoC2 reading frames encoding the ⁇ , ⁇ ’ and ⁇ ” subunits of the plastid-encoded multi subunit RNA polymerase (PEP) (45,46).
- PEP plastid-encoded multi subunit RNA polymerase
- the coding 20 region of three genes spans over 10.3 kb. Deletion of any of the PEP subunits in tobacco yields the same non-photosynthetic, pigment deficient phenotype.
- the plants can be maintained as grafts on wild type plants or on sucrose-containing medium (47-49).
- the rpoB deletion mutants will be characterized when we obtain a suitably processed sgRNA and will use it as maternal parent in a cross to document activity by target site cleavage. In contrast to the pigment deficient 25 ndhA mutants, the pigment deficient rpoB mutants will be viable, as long as grown on sucrose.
- pegRNA will have the prerequisite 20-nt spacer, scaffold, reverse transcriptase template (RTT) and primer binding site (PBS) domains (50) expressed from a 10 chloroplast gene.
- RTT reverse transcriptase template
- PBS primer binding site
- the defective gfp (dgfp) gene will not be expressed in chloroplasts, because the coding region has an in-frame TAA stop codon.
- the T nucleotide at position 198 is part of the stop codon ( Figure 10).
- the dgfp mRNA will be activated when the plastid prime editor (Pt-PE) 15 removes the stop codon.
- Pt-PE is targeted to chloroplasts where it will incorporate the pegRNA expressed from a pegRNA gene in the plastid genome.
- Pt-PE will substitute A with a T using the RTT domain of the pegRNA as template.
- Activation of the defective dgfp gene will verify the functionality of the Pt-PE gene by GFP accumulation in plastids.
- the pegRNA and defective dgfp will be introduced in the chloroplast gnome as a dicistronic operon (SEQ ID NO 26, Figure 10).
- the DNA sequence of PE coding region is SEQ ID NO: 2.
- the coding region will be cloned in the CaMV 35S Promoter/Terminator cassette in which Pt-Cas9 gene is expressed (SEQ ID NO: 1).
- the most efficient strategy to recover plants with edited plastid genomes is to edit all plastids in the egg cell.
- PE prime editor
- Figure 6 Editing the gfp genes will be used to identify prime editor (PE) pollen parents, which edit the mutations at a high efficiency in the fertilized egg cells ( Figure 6).
- PE will be expressed from the (EC1.2e1.1p) egg-cell specific promoter (SEQ ID NO: 45) (59).
- the pegRNAs (SEQ ID NOS: 29, 30, 31 and 32) will be introduced in tobacco 30 chloroplasts by standard protocols and will be pollinated by PE expressed from the EC1.2e1.1p promoter.
- the strength and specificity of the egg-cell specific promoter depends on the insertion 22
- Atrazine resistance will be introduced into the tobacco psbA gene by transforming the plastid genome with pegRNAatr1_hdv mini gene, and pollination with the PE2 prime editor expressed from the egg-cell specific promoter.
- PE2 has the 5 mutations in the M-MLV reverse transcriptase which make prime editing efficient (14, 56, 50). Seedlings carrying 15 the Ser-264-Asn (G791C) mutation are resistant to atrazine and can be identified by green cotyledons when germinated on a selective medium (53).
- rps12 is another plastid gene in which editing yields a selectable phenotype, streptomycin resistance. Streptomycin resistance based on mutations in rps12 plastid gene Nicotiana species 20 have been described (55, 58). SEQ ID. NO: 34, 35 and 36 describe pegRNAs that are suitable to introduce editing events yielding streptomycin resistance. Again, germinating seedlings on streptomycin medium allows ready identification of streptomycin resistant editing event, because the seedlings turn green when germinated on streptomycin-containing (1,000 mg/L) medium.
- the pegRNA str1 encodes a selectable streptomycin resistance mutation 25 (C271T); str2 and str3, in addition, a silent A270G and T276A silent mutation, respectively.
- C271T selectable streptomycin resistance mutation 25
- str2 and str3 in addition, a silent A270G and T276A silent mutation, respectively.
- Yamori et al. (61) described that the M309I (Met-309-Ile) improves Rubisco carboxylation rate (VC). Selection of the Met309 codon for mutagenesis was 30 based on (60). The D397N substitution also boosts photosynthesis and plant growth in Arabidopsis (61). Methionine at position 309 and Aspartic acid at position 397 is highly 23
- variable sequences spacer-scaffold-reverse transcriptase template (RTT)-primer binding site (PBS) sequences for the construction of pegRNAs to edit the M309I and D397N codons in the Arabidopsis, tobacco and soybean rbcL genes (Table 2).
- RTT reverse transcriptase template
- PBS primary binding site
- the nuclear PE gene can be segregated away and the pegRNA with the linked aadA marker gene can be excised using pre-planted site specific target sites (Figure 18) that can be excised by expressing a plastid-targeted recombinase from a nuclear gene (57).
- Figure 18 pre-planted site specific target sites
- Figure 18 can be excised by expressing a plastid-targeted recombinase from a nuclear gene (57).
- Table 2 Targets of mutagenesis in rbcL genes Name 309 pegRNA 397 pegRNA (MtoI) (DtoN) 24
- Prime editing with pegRNA expressed from a shuttle vector Incorporation of the pegRNA gene in the plastid genome enables testing PE function, as discussed above.
- To avoid the need to obtain a stable transplastomic line and then excise marker gene with a site-specific recombinase we propose to express the pegRNA gene from a shuttle 5 plasmid.
- the NICE shuttle plasmid will be introduced into the plastid genome by the biolistic protocol and maintained by selection for the marker gene on the shuttle plasmid (15).
- the shuttle plasmid will carry a pegRNA gene and express it in chloroplasts.
- the PE is expressed from a nuclear transgene and its product is targeted to chloroplasts.
- the defective dgfp is already present in the plastid genome. 10 However, no GFP accumulates because the gfp gene is defective.
- the shuttle plasmid is introduced PE, guided by the pegRNA from the shuttle vector will substitute A198T (or delete 198T) enabling GFP accumulation.
- selection for the shuttle marker is dropped, the shuttle plasmid will be lost in the absence of selection (15).
- EXAMPLE 2 15 Prime editing to obtain herbicide resistant crops Mutations in the psbA gene confer resistance to commercial herbicides which are inhibitors of Photosystem II electron transport flow (13).
- Atrazine resistance will be indicated by maintaining green pigmentation when germinating seedlings on atrazine-containing medium (53).
- EXAMPLE 3 25 Viroids to Target pegRNAs to Chloroplasts To extend plastid genome editing to all crops requires that plastid DNA editing be dependent only on nuclear genome transformation.
- the Prime Editor (PE2) variant of nCas9 is already encoded in a nuclear gene.
- PE2 Prime Editor
- nCas9 is already encoded in a nuclear gene.
- Viroids are small, single-stranded, circular RNAs infecting plants. Composed of only a few hundred nucleotides and not encoding any proteins, viroids represent the lowest level of 5 complexity for an infectious agent. Despite the relatively small size, viroids contain RNA structural elements required to interact with host factors involved in their infectious cycle. Viroids are specifically targeted to nuclei (family Pospiviroidae) or chloroplasts (family Avsunviroidae), where replication is based on symmetric rolling-circle mechanisms that involves a self-cleaving hammerhead motif (65).
- nuclei family Pospiviroidae
- chloroplasts family Avsunviroidae
- the linear monomers are then circularized by the 10 eggplant tRNA ligase in chloroplasts (71). It was shown that members of the Avsunviroidae family probably first enter the nucleus prior to their delivery to the chloroplast of the infected cell (66, 68). Viroids move locally and systemically through plasmodesmata and phloem, respectively, and may elicit symptoms in the infected host, with pathogenic pathways linked to RNA silencing and other plant defense responses (72, 69).
- the eggplant latent viroid (ELVd) is 15 apparently an exception because it does not causing symptoms on its host (64)
- ELVd 67
- ChMVD Chrysanthemum Chlorotic Mottle Viroid
- pegRNAs suitable for testing PE activity are listed in Figure 18 and plants with improved photosynthesis and growth will be obtained in all species, the nucleus of which can be transformed, including maize, wheat, rice and wheat. If necessary, the nuclear plant 10 transformation markers will be changed to accommodate species specific protocols, such as resistance to hygromycin, kanamycin, and glyphosate. If the presence of viroid sequences interferes with PE activity, the viroid sequences will be removed after import into chloroplasts by a suitable RNase.
- Alternative approaches for the introduction of pegRNA can include linkage to other 15 RNAs such as the tRNAs of Selaginella kraussiana, known to be encoded by nuclear genes and imported from the cytoplasm into chloroplasts (63).
- Customized RNAs expressed from a nuclear transgene and driven by a transfer RNA-like (tRNA-like) moiety was taken up by mitochondria in plant cells (73).
- the tRNAs of Selaginella can be reengineered for the import of chimeric mRNAs into chloroplasts.
- Another alternative is linking the pegRNA to the translation initiation 20 factor 4E, reportedly imported into chloroplasts (70).
- These nuclear pegRNA genes can be segregated away as the nuclear PE gene.
- Expression of the pegRNA from a replicating shuttle vector is another option, as discussed above. Table 3. Listing of constructs and DNA sequences with SEQ ID NOS: useful for practicing the 25 methods of the invention.
- AAC pegRNA part Spacer-scaffold-RTT-PBS tgctctgaccgagatctttgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCgaatTatccccaaagatctcggtcagagca SEQ ID NO: 43 Gm-rbcL_397_1 AAT pegRNA part: Spacer-scaffold-RTT-PBS 5 tgctctgaccgagatctttgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCgaatTatccccaaagatctcggtcagagca SEQ ID NO: 44 Gm-rbcL_397_2 AAC pegRNA part: Spacer-scaffold-RTT-PBS tgctctgaccg
- SEQ ID NO: 47 Hepatitis delta virus (hdv) ribozyme, with HindIII restriction site TTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggcgaatgggacaAG CTT SEQ ID NO: 48 trnG / tRNA Gly 5 aacaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaa SEQ ID NO: 49 P35S:ELVd-gfp:T35S HindIII/EcoRI AAGCTTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGG CTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCA CTTCAT
- Plant dicistronic tRNA-snoRNA genes a new mode of expression of the small nucleolar RNAs processed by RNase Z. EMBO J., 22, 621-632.
- the chloroplast gene encoding a proteolytic subunit of ATP-dependent protease, is indispensable for chloroplast development in tobacco. Plant Cell Physiol, 42, 264-273. 10 45. Hu, J. and Bogorad, L. (1990) Maize chloroplast RNA polymerase: the 180-, 120-, and 38-kilodalton polypeptides are encoded in chloroplast genes. Proc. Natl. Acad. Sci. USA, 87, 1531-1535. 46.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Compositions and methods for introducing targeted mutations into the plastid genome are provided.
Description
COMPOSITIONS AND METHODS FOR CRISPR/CAS9 RNA-GUIDED EDITING OF THE CHLOROPLAST GENOME By Pal Maliga 5 Malihe Mirzaee Corinne Best CROSS-REFERENCE TO RELATED APPLICATION This application claims priority to US Provisional Application No. 63/657,752, filed June 7, 2024, which is incorporated by reference as though set forth in full. 10 INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED IN ELECTRONIC FORM The contents of the electronic sequence listing (RUT-119-PCT.xml; Size: 83,160 bytes; and Date of Creation: June 9, 2025) is herein incorporated by reference in its entirety. 15 GOVERNMENT INTEREST STATEMENT This invention was made with government support under grant number 2224861 awarded by the National Science Foundation. The government has certain rights in the invention. 20 FIELD OF THE INVENTION This invention relates the fields of transgenic plants and targeted modification of the chloroplast genome. More specifically, compositions and methods are provided which mediate CRISPR/CAS RNA guided editing of the chloroplast genome, thereby beneficially altering the phenotype of said plant. 25 BACKGROUND OF THE INVENTION Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full. Plastids (chloroplasts) are DNA containing organelles in plant cells. The plastid genome 30 of crop plants is relatively small, 120-kb to 150-kb in size, and is present in hundreds to thousands of copies per cell. Engineering of the plastid genomes is a promising new technology, 1
enabling improvement of photosynthetic efficiency and introduction of new metabolic pathways in crops (1-3). Because there are many copies of the plastid genome (ptDNA) in each plastid, the challenge is to obtain a uniform population of transformed plastid genome copies. Engineering the plastid genome includes introduction of point mutations, targeted gene deletion and gene 5 insertion. Manipulation of the plastid genome based on homologous recombination has been available since 1990 (4,5). However, this technology can be applied to only a relatively small number of crops (6,7). TALE-repeat based engineering, first reported in 2019, removed this bottleneck (8). For the first time, this protein-based technology is equally applicable to engineering the plastid and mitochondrial genomes (6, 9, 10). The TALE-repeat based 10 technology enables editing of nucleotides in a 12 to 24 nucleotide window. Thus, TALE mediated RNA-guided editing of specific nucleotides lacks precision. Clearly a need exists in the art for new prime editing tools for precise RNA-guided DNA editing of the plastid genome. SUMMARY OF THE INVENTION 15 In accordance with the present invention, a system for introducing mutations into targeted sites in a plant plastid genome are disclosed. An exemplary system comprises a first a nucleic acid construct encoding a prime editor guide RNA (pegRNA) harboring a primer binding site, a reverse transcriptase template, a spacer sequence and scaffold sequence operably linked to a nucleic acid encoding a selectable marker and plastid targeting sequences for introduction into 20 the plastid genome of said plant, said spacer sequences in said pegRNA directing a prime editor complex to the DNA harboring said targeted site in said plastid genome, and said reverse transcriptase template facilitating nick repair. The system also comprises a second nucleic acid construct encoding a prime editor (PE) comprising a Cas9 nickase variant operably linked to an engineered polymerase, and a plastid transit peptide (TP), into the nucleus of said plant; wherein 25 said TP-PE is translated on cytoplasmic ribosomes and imported to the plastid, said PE forming a complex with said pegRNA and binding said targeted site and nicking said DNA, followed by gap repair mediated by said engineered polymerase, wherein said repair introduces said mutation at said targeted site. In certain embodiment, the mutation is an insertion or a deletion into said plastid DNA. 30 In other embodiments, the construct of step a) can comprises at least one riboswitch sequence. The construct of step a) can be introduced using a shuttle vector. In another embodiment of the 2
system, the nucleic acid construct of step a) encodes a dicistronic, transcript of pegRNA which initiates from an rbcL promoter and a 3’ end is generated by processing upstream of tRNA. In a preferred approach, the dicistronic transcript is encoded by SEQ ID NOS: 33 to 44. The Cas9 in the PE is a variant having nickase activity. 5 In certain aspects, introduction of said mutation increases photosynthesis in said plant, or confers resistance to commercial herbicides or confers abiotic resistance. The mutation can confer a growth advantage to the plant. The mutation could also confer a growth disadvantage in a weed plant for example. Also within the scope of the invention are plants transformed with the system described above. 10 In yet another aspect, an alternative method for introducing mutations into targeted sites in a plant plastid genome is provided using the system described above and herein below. The pegRNA may be present on a chloroplast shuttle plasmid, or from a nuclear gene wherein said ELVd viroid leader is operably linked to pegRNA. To facilitate recovering transplastomic events, transplastomic maternal parent plants 15 harboring pegRNA and a nucleic acid of interest comprising said target site in plant chloroplasts can be crossed with a pollen parent plant having high editing efficiency which harbors PE operably linked to an egg-cell specific promoter wherein transplastomic progeny plants resulting from such crosses comprise readily identifiable edited target sites. Also provided is a kit for practicing the methods described above. 20 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Methods for introduction of point mutations. (Fig. 1A) Traditional “one-vector-one mutation” protocol (12). The mutation is introduced in the cloned fragment and linked to the selectable marker gene. The mutation is introduced into the plastid genome by homologous 25 recombination. (Fig. 1B) Prime editing, the test system version. The pegRNA gene is incorporated in the plastid genome; the primary transcript is processed into pegRNA. PE gene is in the nucleus, translated on cytoplasmic ribosomes and is imported to the plastid from the cytoplasm. PE combines with the pegRNA, identifies the target site to be modified and edits the nicked DNA using the template. 30 3
Figure 2. Cleavage by Cas9 guided by the sgRNA and introduction of a point mutation by PE guided by the pegRNA. Edited from (54). Figure 3. Expression of Cas9 protein in the nucleus of tobacco plants. (Fig. 3A) Agrobacterium 5 nuclear transformation vector for introduction of Cas9 gene. The Pt-Cas9 is in a P35S/T35S cassette and is fused with the Rubisco small subunit transit peptide (TP). The Pt-Cas9 coding region is included in an NcoI-XbaI DNA fragment. SEQ ID NO: 1 aacCI is a gentamycin- resistant marker gene and LB and RB are the T-DNA left and right borders in a pPZP221(20). (Fig. 3B) Accumulation of Cas9 protein in the leaves of transgenic tobacco plants. Cas9 protein 10 (164 kDa) is detected at high levels in three out of 55 independent transgenic lines (#12, #13, and #35) using Cas9 monoclonal antibody. Figure 4. The schematic outline of the sgRNA constructs targeting the ndhA and ndhK coding regions. 15 Figure 5. sgRNA processing efficiency determined by qRT-PCR in RNA isolated from the leaves of pDiA1 plants (pCB101). (1.8 and 1.4), pDiK1 (2.6), pTriK1.5 (5.1 and 5.5) plants. The 1.4 plants carry the DiA1 sgRNA mini-gene and had more free sgRNA (cleaved) than uncleaved sgRNA. Cleaved sgRNA = total sgRNA - non-cleaved sgRNA. 20 Figure 6. sgRNA by processing with ribozymes. The sgRNAs are processed by the hammer head (HH) and hepatitis delta virus (HDV) ribozymes. The example here is the ndhA956 sgRNA gene in plasmid pCB110. SEQ ID NO: 16. For details see also Table 1. 25 Figure 7. Seed progeny derived from the cross of sgRNA DiA1 maternal parent (SEQ ID NO: 3) and PT-Cas9 pollen parent (SEQ ID NO: 1) has pigment deficient sectors indicating deletion of essential genes. (Fig. 7A) Germinating tobacco seedlings on antibiotic medium to identify progeny carrying PT-Cas9 gene. Picture taken 30 days post planting. (Fig. 7B) Seedling transferred to a plate 7-days post planting where it grew larger than its sibs. 30 4
Figure 8. PCR analyses reveal deletions flanking the Cas9 target site in the ndhA gene. The wild type fragment is 4.9 kb; major products repaired by microhomology-mediated end joining (MMEJ) are 1.3 kb (via microrepeat #1; SEQ ID NO: 22) and 0.7 kb (via micorepeat #2; SEQ ID NO: 23), respectively. Minor products are 1.4 kb (microrepeat #3; SEQ ID NO: 24) and 1.6 5 kb (microrepeat #4, SEQ ID NO: 25). PCR primers were MM47/MM48. For primer positions see Figure 9A. Figure 9. Pt-Cas9 cleaves dsDNA in the ndhA gene at the target site, repaired by MMEJ in the ptDNA. (Fig. 9A) The map of ndhH operon in the tobacco plastid genome flanked by the 10 essential ycf1 and ycf5 plastid genes. The position of target site (spacer sequence) in the ndhA gene is marked by vertical arrow; the position of short repeat sequences involved in MMEJ in the ptDNA is numbered 1-4. (Fig. 9B) Junction sequences created by MMEJ. Figure 10. Dicistronic pegRNA gene with defective dgfp gene (SEQ ID NO: 26) for testing PE 15 function. Note editing of TAA stop codon by A to T substitution (TAA is replaced by TAT codon). The construct is in a TVV1 plastid transformation vector (26). Figure 11. PE guided by pegRNA expressed from a NICE shuttle plasmid activates dgfp gene. (Fig. 11A) PE is encoded in the nucleus (SEQ ID NO: 2) and dgfp in the plastid genome. No 20 GFP accumulation. (Fig. 11B) pegRNA gene (SEQ ID NO: 29, 30, 31, 32) introduced on shuttle plasmid (15, 16) and PE, guided by the pegRNA, substitutes T for an A removing the stop codon. GFP accumulates in chloroplasts. Figure 12. Chloroplast sgRNA mini genes. Chloroplast sgRNA mini gene designs cloned by 25 SacI-HindIII in a chloroplast transformation vector. Horizontal arrows indicate transcription initiation sites and direction, wavy lines represent RNA transcripts. Vertical lines indicate expected RNA processing points. The arrow with an X is not processed at the expected site. Figure 13. RNA-Seq data for each sgRNA transplastomic line. Y axis represent the coverage 30 (read depth). X axis shows the distance from the SacI site in the sgRNA minigene cassette (nt). First grey bar represent the promotor; slanted line pattern, sgRNA genes; lighter grey box, 5
tRNAGly gene; dark gray, His/Thr attenuator. All samples were prepared using the Takara small RNA sequencing kit, with the exception of pCB101 and pCB113, which were prepared with the NEB small RNA sequencing kit. 5 Figure 14. 5’ ends determined by RNA sequencing. Bold nucleotides identify transcription start sites (TSS) determined by primer extension, grey nucleotides indicate the first two nucleotides of the gRNA. Figure 15. 3’ ends determined by RNA sequencing. Grey nucleotides indicate the last two 10 nucleotides of the sgRNA. The HDV first nucleotide is underlined. Figure 16. Identification of PE pollen parents with high-efficiency editing capacity in fertilized egg cells. 15 Figure 17. Vectors for testing PE function by visual observation of GFP fluorescence. Vector pMM130, inactive dgfp, Nt-atpHwt (SEQ ID NO: 29). pMM131, dgfp, Zm-atpHAA. Note editing of TAA stop codon by A to T substitution (TAA is replaced by TAT codon) (SEQ ID NO: 30). The construct is in a TVV1 plastid transformation vector (26). Controls: pMM128, active gfp, Nt-atpHwt (SEQ ID NO: 27); pMM129, active gfp, Zm-atpHAA (SEQ ID NO: 28). 20 Figure 18. PegRNA minigene in a TVV1 plastid transformation vector derivative. For TVV1 vector see (26). The minigene is transcribed from a rRNA operon promoter (Prrn), has the spacer sequence targeting the PE, the reverse transcriptase template (RTT, typically 13 nt) and the primer binding site (PBS, typically 13 nt). For the gene design see Anzalone et al. 2019 (14). 25 Constant parts of the pegRNA: Zea mays rRNA operon PEP promoter (PrrnZm): (SEQ ID NO: 46); Hepatitis delta virus (hdv) ribozyme (SEQ ID NO: 47) or tRNAGly (SEQ ID NO: 48). DETAILED DESCRIPTION OF THE INVENTION Prime editing tools for precise editing of the chloroplast genomes, (exemplified using 30 Nicotiana tabacum (tobacco), and a model system of plastid genome engineering (11)) are described herein. The advantage of prime editing over base editing is not only precision but also 6
enables targeted insertion and deletion of nucleotides. Prime editing will enable base editing in the absence of stable genetic transformation of plastid genomes. This will be particularly useful in monocots such as maize and wheat, in which selection for antibiotic resistance is inefficient. 5 DEFINITIONS “Prime editing” is a versatile and precise genome editing method that directly writes new genetic information into a specified DNA site using a nucleic acid programmable DNA binding protein (“napDNAbp”) working in association with a polymerase (i.e., in the form of a fusion protein or otherwise provided in trans, e.g., on a shuttle vector, with the napDNAbp), wherein the 10 prime editing system is programmed with a prime editing (PE) guide RNA (“pegRNA”) (or as in the instant disclosure, programmed with an engineered pegRNA) that both specifies the target site and templates the synthesis of the desired edit in the form of a replacement DNA strand by way of an extension (either DNA or RNA) engineered onto a guide RNA (e.g., at the 5′ or 3′ end, or at an internal portion of a guide RNA). The replacement strand containing the desired edit 15 (e.g., a single nucleobase substitution, deletion, or insertion) shares the same sequence as the endogenous strand of the target site to be edited (with the exception that it includes the desired edit). Through DNA repair and/or replication machinery, the endogenous strand of the target site is replaced by the newly synthesized replacement strand containing the desired edit. In some cases, prime editing may be thought of as a “search-and-replace” genome editing technology 20 since the prime editors, as described herein, not only search and locate the desired target site to be edited, but at the same time, encode a replacement strand containing a desired edit which is installed in place of the corresponding target site endogenous DNA strand. In various embodiments, prime editing operates by contacting a target DNA molecule (for which a change in the nucleotide sequence is desired to be introduced) with a nucleic acid 25 programmable DNA binding protein (napDNAbp) complexed with a pegRNA. In reference to Figures 1 and 2, the pegRNA comprises an extension at the 3′ or 5′ end of the guide RNA, or at an intramolecular location in the guide RNA and encodes the desired nucleotide change (e.g., single nucleotide change, insertion, or deletion). The data shown here demonstrate efficacy using guide strands at the 3’ end of the pegRNA. 30 The term “Cas9” or “Cas9 nuclease” refers to an RNA-guided nuclease comprising a Cas9 domain, or a fragment thereof (e.g., a protein comprising an active or inactive DNA 7
cleavage domain of Cas9, and/or the gRNA binding domain of Cas9). A “Cas9 domain” as used herein, is a protein fragment comprising an active or inactive cleavage domain of Cas9 and/or the gRNA binding domain of Cas9. A “Cas9 protein” is a full length Cas9 protein. A Cas9 nuclease is also referred to sometimes as a casn1 nuclease or a CRISPR (Clustered Regularly Interspaced 5 Short Palindromic Repeat)-associated nuclease. CRISPR is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements, and conjugative plasmids). CRISPR clusters contain spacers, sequences complementary to antecedent mobile elements, and target invading nucleic acids. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). In type II CRISPR systems, correct processing of 10 pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (mc), and a Cas9 domain. The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre- crRNA. Subsequently, Cas9/crRNA/tracrRNA endonucleolytically cleaves a linear or circular dsDNA target complementary to the spacer. The target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3′-5′ exonucleolytically. In nature, DNA-binding and 15 cleavage typically requires protein and both RNAs. However, single guide RNAs (“sgRNA”, or simply “gRNA”) can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA species. See, e.g., Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of which are hereby incorporated by reference. Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or 20 protospacer adjacent motif) to help distinguish self versus non-self. Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., “Complete genome sequence of an M1 strain of Streptococcus pyogenes.” Ferretti et al., J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y., Jia H. G., Najar F. Z., Ren Q., Zhu H., Song L., White J., Yuan X., Clifton S. W., Roe B. 25 A., McLaughlin R. E., Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663(2001); “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.” Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y., Pirzada Z. A., Eckert M. R., Vogel J., Charpentier E., Nature 471:602-607(2011); and “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.” Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., 30 Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference). Cas9 orthologs have been described in various species, including, but not 8
limited to, S. pyogenes and S. thermophilus. Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, “The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” 5 (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference. In some embodiments, a Cas9 nuclease comprises one or more mutations that partially impair or inactivate the DNA cleavage domain. A nuclease-inactivated Cas9 domain may interchangeably be referred to as a “dCas9” protein (for nuclease-“dead” Cas9). Methods for generating a Cas9 domain (or a fragment 10 thereof) having an inactive DNA cleavage domain are known (see, e.g., Jinek et al., Science. 337:816-821(2012); Qi et al., “Repurposing CRISPR as an RNA-Guided Platform for Sequence- Specific Control of Gene Expression” (2013) Cell. 28; 152(5):1173-83, the entire contents of each of which are incorporated herein by reference). For example, the DNA cleavage domain of Cas9 is known to include two subdomains, the HNH nuclease subdomain and the RuvC1 15 subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, whereas the RuvC1 subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, the mutations D10A and H840A completely inactivate the nuclease activity of S. pyogenes Cas9 (Jinek et al., Science. 337:816- 821(2012); Qi et al., Cell. 28; 152(5):1173-83 (2013)). In some embodiments, proteins 20 comprising fragments of Cas9 are provided. For example, in some embodiments, a protein comprises one of two Cas9 domains: (1) the gRNA binding domain of Cas9; or (2) the DNA cleavage domain of Cas9. In some embodiments, proteins comprising Cas9 or fragments thereof are referred to as “Cas9 variants.” A Cas9 variant shares homology to Cas9, or a fragment thereof. For example, a Cas9 variant is at least about 70% identical, at least about 80% identical, 25 at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, at least about 99.8% identical, or at least about 99.9% identical to wild type Cas9. In some embodiments, the Cas9 variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 30 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more amino acid changes compared to wild type Cas9. In some embodiments, the Cas9 variant comprises a fragment of Cas9 (e.g., a gRNA binding 9
domain or a DNA-cleavage domain), such that the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the corresponding 5 fragment of wild type Cas9. In some embodiments, the fragment is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid length of a corresponding wild type Cas9. 10 The term “cDNA” refers to a strand of DNA copied from an RNA template. cDNA is complementary to the RNA template. CRISPR is a family of DNA sequences (i.e., CRISPR clusters) in bacteria and archaea that represent snippets of prior infections by a virus that have invaded the prokaryote. The snippets of DNA are used by the prokaryotic cell to detect and destroy DNA from subsequent 15 attacks by similar viruses and effectively compose, along with an array of CRISPR-associated proteins (including Cas9 and homologs thereof) and CRISPR-associated RNA, a prokaryotic immune defense system. In nature, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). In certain types of CRISPR systems (e.g., type II CRISPR systems), correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous 20 ribonuclease 3 (mc) and a Cas9 protein. The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre-crRNA. Subsequently, Cas9/crRNA/tracrRNA endonucleolytically cleaves a linear or circular dsDNA target complementary to the RNA. Specifically, the target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3′-5′ exonucleolytically. In nature, DNA-binding and cleavage typically requires protein and both RNAs. However, single 25 guide RNAs (“sgRNA”, or simply “gRNA”) can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA species—the guide RNA. See, e.g., Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of which is hereby incorporated by reference. Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or protospacer adjacent motif) to help distinguish self 30 versus non-self. CRISPR biology, as well as Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., “Complete genome sequence of an M1 strain of 10
Streptococcus pyogenes.” Ferretti et al., J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y., Jia H. G., Najar F. Z., Ren Q., Zhu H., Song L., White J., Yuan X., Clifton S. W., Roe B. A., McLaughlin R. E., Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663(2001); “CRISPR RNA 5 maturation by trans-encoded small RNA and host factor RNase III.” Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y., Pirzada Z. A., Eckert M. R., Vogel J., Charpentier E., Nature 471:602-607(2011); and “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.” Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated 10 herein by reference). Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermophilus. Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, “The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” 15 (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference. In general, a “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. 20 tracrRNA or an active partial tracrRNA), a tracr mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. The tracrRNA of the system is complementary (fully or partially) to the tracr mate sequence present on the guide RNA. 25 As used herein, the term “DNA synthesis template” refers to the region or portion of the extension arm of a pegRNA that is utilized as a template strand by a polymerase of a prime editor to encode a 3′ single-strand DNA flap that contains the desired edit and which then, through the mechanism of prime editing, replaces the corresponding endogenous strand of DNA at the target site. 30 The term “effective amount,” as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, 11
an effective amount of a prime editor (PE) may refer to the amount of the editor that is sufficient to edit a target site nucleotide sequence, e.g., a genome. In some embodiments, an effective amount of a prime editor (PE) provided herein, e.g., of a fusion protein comprising a nickase Cas9 domain and a reverse transcriptase may refer to the amount of the fusion protein that is 5 sufficient to induce editing of a target site specifically bound and edited by the fusion protein. As will be appreciated by the skilled artisan, the effective amount of an agent, e.g., a fusion protein, a nuclease, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide, may vary depending on various factors as, for example, on the desired biological response, e.g., on the specific allele, genome, or target site to be edited, on 10 the cell or tissue being targeted, and on the agent being used. The term “linker,” as used herein, refers to a molecule linking two other molecules or moieties. The linker can be an amino acid sequence in the case of a linker joining two fusion proteins. For example, a Cas9 can be fused to a polymerase (e.g., reverse transcriptase) by an amino acid linker sequence. The linker can also be a nucleotide sequence in the case of joining 15 two nucleotide sequences together. For example, in the instant case, the traditional guide RNA is linked via a spacer or linker nucleotide sequence to the RNA extension of a prime editing guide RNA which may comprise a RT template sequence and an RT primer binding site. In other embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13,20 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50- 60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated. As used herein, the term “nucleic acid programmable DNA binding protein” or “napDNAbp,” of which Cas9 is an example, refers to a protein that uses RNA:DNA 25 hybridization to target and bind to specific sequences in a DNA molecule. Each napDNAbp is associated with at least one guide nucleic acid (e.g., guide RNA), which localizes the napDNAbp to a DNA sequence that comprises a DNA strand (i.e., a target strand in the chloroplast genome) that is complementary to the guide nucleic acid, or a portion thereof (e.g., the protospacer of a guide RNA). In other words, the guide nucleic-acid “programs” the napDNAbp (e.g., Cas9 or 30 equivalent) to localize and bind to a complementary sequence. 12
By "T-DNA" is meant the T-DNA of an Agrobacterium tumefaciens Ti plasmid or from an Agrobacterium rhizogenes Ri plasmid, or a derivative thereof. The T-DNA may comprise an entire T-DNA, but need only comprise the minimal sequences required in cis for transfer (i.e., the right and the left T-DNA border sequences). T-DNA delivery to germline cells would enable 5 chloroplast transformation in all crops in which direct transformation of germline cells is feasible by the floral dip protocol. A “vector” of the present invention may comprise at least one of Agrobacterium Ti plasmid right border or left border region. The vectors may comprise at least one pair of borders. The vectors can include four pairs of borders, but the vector often comprise one or two pairs. 10 The vectors of the present invention may further comprise a coding region for a selectable marker for the maintenance in bacterial hosts. Coding regions for selectable markers include Spec/Strp that encodes for Shigella flexneri aminoglycoside adenyltransferase (aadA) conferring resistance to spectinomycin or streptomycin (Chinault et al. 1986), or a gentamycin (Gm, Gent) selectable marker gene from a Tn21-like multiresistance transposon (Wohlleben et al., 1989). 15 Other resistance genes include carbenecillin, ampicillin, and kanamycin resistance genes. Others are known and may be readily used in the present invention by those of skill in the art.\ In addition to a plant selectable marker, in some embodiments it may be desirable to use a reporter gene. In some instances, a reporter gene may be used with or without a selectable marker. Reporter genes are genes that are typically not present in the recipient organism or tissue and 20 typically encode for proteins resulting in some phenotypic change or enzymatic property. Preferred reporter genes include the beta-glucuronidase (GUS) of the uidA locus of E. coli, the chloramphenicol acetyl transferase gene from Tn9 of E. coli, the green fluorescent protein from the bioluminescent jellyfish Aequorea victoria, and the luciferase genes from firefly Photinus pyralis or mScarlet. An assay for detecting reporter gene expression may then be performed at a 25 suitable time after said gene has been introduced into recipient cells. A preferred such assay entails the use of split GFP. As used herein "operably linked" includes reference to a functional linkage between two sequences in a nucleic acid construct, for example, a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding 30 to the second sequence. Generally, operably linked means that the nucleic acid sequences being 13
linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. As used herein "promoter" includes reference to a region of DNA involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. 5 Known chloroplast “transit peptides” include, without limitation, the chloroplast small subunit of ribulose-1,5-bisphosphate carboxylase (Rubisco); 5-enolpyruvyl)shikimate-3-phosph- ate synthase (EPSPS); tryptophan synthase; plastocyanin; chorismate synthase; and the light harvesting chlorophyll a/b binding protein (LHBP). The present invention may be used for delivery of proteins to any plant species, 10 including, but not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus 15 tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea 20 americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers. Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), 25 green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), 30 poinsettia (Euphorbia pulcherrima), and chrysanthemum. Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), 14
slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pin us radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red 5 cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). Preferably, plants of the present invention are crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.), more preferably corn and soybean plants, yet more preferably corn plants. The following examples are provided to facilitate the practice of the invention. They are 10 not intended to limit the invention in any way. EXAMPLE 1 DEVELOPMENT OF CRISPR CAS SYSTEM FOR MODIFICATION OF THE CHLORPLAST GENOME 15 Introduction of point mutations in the plastid genome is currently accomplished by the one-vector-one mutation protocol (Figure 1A) (12). The point mutation is introduced into a cloned fragment of the target gene, in this case psbA. The psbA gene encodes the D1 protein, a Photosystem II core protein, which is the target of commercial herbicides (13). The mutant gene is physically linked to a spectinomycin resistance (aadA) gene in the chloroplast transformation 20 vector, which is then introduced into plastids by the biolistic gun. The mutant gene integrates in the ptDNA by homologous recombination, replacing the target gene with the mutant version in the transformed T-ptDNA. We are developing a simplified protocol, that requires the introduction of only one constitutively expressed nuclear gene, the prime editor (PE). PE is a fusion protein of the nCas9 25 endonuclease (nicking Casd9) and an engineered reverse transcriptase, programmed by the pegRNA that has the target specificity and serves as repair template (14) (Figure 2). The pegRNA is expressed from a mini gene and acts in trans. In the plastid system, the pegRNA can be provided using at least two different approaches. While developing the system, we shall permanently incorporate the pegRNA gene in the plastid genome (Figure 1B). This way we can 30 conveniently characterize the pegRNA. In the fully developed system, the pegRNA will be expressed from a replicating shuttle plasmid (Figure 11). The shuttle plasmid will be introduced 15
into the plastid by the biolistic process and maintained in the plastids by selection for a plastid marker, such as spectinomycin resistance or kanamycin resistance. When the desired mutation has been introduced into the target gene, selection will be terminated promptly followed by the spontaneous loss of the shuttle plasmid. Description of a shuttle plastid with the required 5 properties has been described from this laboratory (15,16). Prime editing will be developed in Nicotiana tabacum (tobacco) chloroplasts, the model system for chloroplast genome engineering (6). Cas9 activity in plant chloroplasts (plastids) is easier to detect than PE activity, therefore the plant Cas9 will be tested for expression, subcellular targeting, and in vivo cleavage of the target DNA in tobacco plastids. Prime editing 10 will then be tested as described below. RNA-guided DNA mutagenesis in the plastid genome can be achieved using the following steps. (1) Expression of Cas9 from a nuclear gene and verification of chloroplast localization. (2) Expression of sgRNAs from chloroplast mini genes and characterizing the processed sgRNAs by RNA sequencing. 15 (3) Demonstration of Pt-Cas9 function by cleavage of the target sequence in the plastid genome. (4) Prime editing of a stop codon in a gfp gene. The pegRNA will be expressed from a mini gene incorporated in the plastid genome. (5) Prime editing of a stop codon in a gfp gene. pegRNA for prime editing will be expressed from a shuttle plasmid. 20 We obtained a codon optimized Cas9 gene that was originally designed for mutagenesis in Arabidopsis thaliana (17,18). We removed the nuclear localization signals from both ends of the peptide and translationally fused the Rubisco small subunit transit peptide at the N terminus for chloroplast targeting. The plastid Cas9 (Pt-Cas9) coding sequence was cloned into a cauliflower mosaic virus 35S promoter/terminator cassette (19) and the cassette was inserted in 25 the pPZP222 binary vector (20) (Figure 3A). The Pt-Cas9 gene was introduced into the tobacco nuclear genome by selection for gentamycin resistance by standard protocols. Pt-Cas9 is constitutively transcribed in the nucleus, the mRNA is translated on cytoplasm ribosomes and the enzyme is imported into chloroplasts. We tested 55 independently transformed lines and found only three accumulating the Pt-Cas9 protein in leaves (Figure 3B). The Pt-Cas9 protein (164.8 16
kDa) could be readily detected on immunoblots in the leaf extract of lines #12, #13, and #35 (Figure 3B). The Pt-Cas9 protein is relatively large, 164 kDa. The Rubisco small subunit, the source of the plastid targeting sequence (TP) is small. We shall test, if fusing the TP of a larger protein with 5 Cas9 improves the efficiency of Pt-Cas9 localization, measured by the efficiency of prime editing in germline cells. Expression of sgRNAs from chloroplast mini genes The perceived bottleneck of RNA-guided editing of plastid genomes has been the lack of RNA import into plastids (21). Generating the properly sized small RNAs by processing plastid 10 transcripts so far has not been considered as an option. PI proposes testing to alternative approaches to generate properly trimmed single guide RNA (sgRNA) and prime editing gRNA (pegRNA): the native tRNA enzymatic machinery processing the pre-tRNA into the mature tRNA, by the RNase P and RNase Z enzymes (22) and riboswitches (HH and HDV) (23) derived from heterologous systems. 15 sgRNA by processing with RNase P and/or RNase Z We have chosen two designs. A dicistronic design, where transcription of sgRNA initiates from the rbcL promote (24), and the 3’ end is generated by processing upstream of tRNA by RNase P (SEQ ID NOS:3 and 6 in Figure 4). In the tricistronic design the sgRNA is sandwiched between two tRNAs and the 5’ and 3’ ends are generated by RNase P and RNase Z, respectively 20 (Figure 4, SEQ ID NOS: 4, 5, 7 and 8). We stabilized the primary transcript with the his and thr attenuators which are efficient terminators of transcription in vitro (25) and in vivo (26). The mini genes shown in Figure 4 were introduced in the plastid genome by standard protocols. Plants were obtained by transformation with each of the constructs, except pTriA1 (SEQ ID NO: 4). The RNA isolated from young leaves of transplastomic plants was then tested 25 for splicing of sgRNAs using quantitative RT-PCR (Figure 5). Out of the five plant lines, significant processing was observed only in No.1, the dicistronic DiA1 plant. The PCR assay tested the cleavage between the sgRNA and the downstream tRNAGlyGGC. We have chosen tRNAGly, because detailed information was available 17
about processing tRNAGly-snoRNA dicistronic precursors (27, 28) and tRNAs have been used to process sgRNAs in the nucleus (29, 30). To obtain more precise information about the processed ends, we sent an RNA preparation for sequencing to the Rutgers Genomics Center at the Rutgers Medical School in 5 Newark, NJ. The small RNAs have been size-selected (<300 nt) and sequenced directly. Transcription of the rbcL gene in tobacco initiates on an A nucleotide (24). In the sequenced RNA population very few transcripts initiate from the A. In four cases a slightly longer transcript is present, a TG is added on the A. This is primer-dependent transcription initiation with a dinucleotide described for RNA polymerase II in mammalian cells (31) and for the multisubunit 10 RNAP in E. coli (32). To our knowledge these are the first instances of transcription initiation by dinucleotides in chloroplasts. The processed ends generated by the processing RNase at the 3’ end are one to three nucleotides longer than predicted. A slightly longer sgRNA on the 5’ and/or 3’ end is expected to be fully functional to guide the cleavage of the target site in ndhA. Plastids harboring the small 15 RNA population and Pt-Cas9 are expected to carry plastid genomes with large deletions causing pigment deficiency. Indeed, 32 out of 32 seedlings derived from the cross have pigment deficient sectors and their ptDNA has large deletions flanking the target site in the ndhA gene suggesting Pt-Cas9-guided DNA cleavage activity. 20 sgRNA by processing with ribozymes An alternative approach to obtain sgRNAs is self‐processing of ribozyme flanked RNAs into guide RNAs (Figure 6). The sgRNAs are processed by the hammer head (HH) and hepatitis delta virus (HDV) ribozymes (23). Ribozymes have been used to produce precisely cleaved multiplexed gRNAs in human cells and plants (33,34). Our goal is to test the efficiency and 25 precision of sgRNA processing in chloroplasts. The constructs to be tested are listed in Table 1. Transplastomic tobacco will be generated and systematically tested for processing and testing the sgRNA for biological activity. Table 1. Chloroplast mini genes to test processing and sgRNA activity in vector pQY3. SEQ ID Construct Promoter 5’ proc sgRNA 3’ proc This/thr
18
NO: 10 DiA3 pMM51 Prrn NtS ndhA 956 trnG - NO: 11 DiRC1 pMM48 Prrn NtS rpoC148 trnG -
The minigenes listed in Table 1 were introduced into tobacco plastids. For efficient guidance of Cas9 to the target site, uniform single guide RNAs (sgRNAs) with well-defined 5’ and 3’ ends are desirable. To characterize sgRNA sequences, total cellular RNA was extracted 5 from transplastomic tobacco leaves, and small RNAs were sequenced using either the Takara SMARTer smRNA-seq Library Prep Kit or the NEBNext Small RNA Library Prep Kit. Sequencing was performed using the Illumina platform with 2 × 150 bp paired-end reads (20 million total reads; 10 million per end). The resulting sgRNA sequences were aligned with the corresponding minigene sequences, as shown in Fig. 13. The maps of mini genes are provided in 10 Figure 12. The nucleotides at the 5’- and 3’-ends of sgRNAs are shown in Fig. 14 and Fig. 15. We find the maize rRNA operon PEP promoter is the most suitable to produce well-defined 5’ ends and the trnG (tRNAGly) and HDV to produce suitable processed 3’- ends. In mini gene pMM51 (SEQ ID No. 10) there is an 11 nt linker between the scaffold and trnG. The same minigene was inserted in the plastid genome without the 11 nt linker. The sgRNA 15 was properly processed at the 3’ end, with either no additional nucleotides at the 3’ end of the sgRNA, or at most 4 additional nucleotides. RNA-guided cleavage of the plastid genome (ptDNA) Plastids do not have the non-homologous end joining enzymatic machinery to repair double-stranded DNA breaks as it is the case in E. coli. As the result, double-stranded breaks are 19
repaired by microhomology-mediated end joining (MMEJ), which is accompanied by large and irregular deletions in the plastid genome (35). Our goal is to determine DNA cleavage as an indication of Cas9 activity guided by sgRNAs in the ndhA and ndhK genes and the rpoB operon as a functional assay, to verify plastid localization of Pt-Cas9 and the functionality of the 5 sgRNAs. The ndhA and ndhK genes were chosen for targeted cleavage because deletion of the ndh genes does not have a readily detectable phenotype. The tobacco chloroplast genome encodes 11 NDH subunits, with the genes organized in four transcription units: ndhF, ndhB, ndhH/A/I/H/E/D and ndhC/K/J (36). The ndhC/K/J and ndhB genes have been deleted (37, 38) 10 and in the ndhB knockout plants only a moderate phenotype was found under extreme conditions (39). If deletion is relatively small and impacts only ndh genes, we expect to obtain plants with a wild type / green phenotype. If the deletions are larger and involve deletion of essential genes, Pt-Cas9 activity will yield variegated plants with small pigment deficient sectors in the leaves. The tobacco plastid ndhH operon, including the ndhA gene, is 7.5 kb in size and is 15 localized in the small single copy region of the ptDNA. The sgRNA targets intron 1 of the ndhA gene. The genes flanking the ndhH operon are essential: ycf5 (ccsA) gene is on the right and rps15/ycf1 on the left. The gene ccsA (ycf5) encodes a protein mediating the attachment of heme to c-type cytochromes during cytochrome biogenesis (40). Rps15 encodes a non-essential small plastid ribosomal subunit protein RNA (41). The ycf1 reading frame encodes a component of a 20 translocon in the inner chloroplast membrane and is an essential gene (42). The map of ndhH operon, flanked by the essential genes ycf1 and ycf5, is shown in Figure 9. Plants expressing the DiA1 sgRNA and Pt-Cas9 were obtained by crossing. 32 out of 32 seedlings have pigment deficient sectors (Figure 7). No pigment deficient sectors were observed on the maternal DiA1 plants, the maternal parent in the cross, derived from 3 independent 25 transgenic events grown in the greenhouse. Since plastids in tobacco derive from the maternal parent, and the maternal parents did not have pigment deficient sectors, the appearance of sectors in the seed progeny can be linked to introduction of the PT-Cas9 gene via pollen. The PT-Cas9 pollen parent (3 independent transgenic events) did not have pigment deficient sectors either. The absence of pigment deficient sectors on the PT-Cas9 pollen parent suggests the cleavage of 30 ptDNA depends on the availability of sgRNA. We expect that the deletions will center on the target site in the ndhA target. Pigment deficiency in case of the ndhA target suggests the loss of 20
one of more essential plastid genes, deletion of ycf1 or ycf5 genes flanking the ndhH gene cluster. The loss of essential genes leads to pigment deficient and missing sectors resulting in irregular leaf shape, reported for the accD gene knockout plants (43) and clpP gene (44). Preliminary PCR analysis of the region containing the double strand break created by Pt- 5 Cas9 is shown in Figure 8. The DNA for the PCRs was isolated from pigment deficient sectors. The 1.3 kb and 0.7 kb fragments derive from the repair of the plastid genome via relatively long, 14 and 15 bp repeats in the plastid genome and the deletions are present in most seedlings (Figure 8). There are several fainter bands identifiable on more heavily loaded gels, likely formed by recombination via shorter repeats. The 1.4 and 1.6 kb repeats were the sites of MMEJ 10 and are shown in Figure 9. The contiguous ndhC/K/J coding region of the ndhC operon is much smaller, only 1.7 kb. The probability of small deletions that would impact only ndh genes alone, in the light of published Arabidopsis psbA data and the data in Figure 9, is small. The deletions are likely to trigger pigment deficient sectors including the loss of essential genes. A similar PCR analysis of 15 pigment deficient sectors is expected to identify deletions centered on the target site in the ndhK gene. We will carry out the analyses, pending on the identification of a suitably processed sgRNA. The rpoB operon contains the rpoB, rpoC1 and rpoC2 reading frames encoding the β, β’ and β” subunits of the plastid-encoded multi subunit RNA polymerase (PEP) (45,46). The coding 20 region of three genes spans over 10.3 kb. Deletion of any of the PEP subunits in tobacco yields the same non-photosynthetic, pigment deficient phenotype. The plants can be maintained as grafts on wild type plants or on sucrose-containing medium (47-49). The rpoB deletion mutants will be characterized when we obtain a suitably processed sgRNA and will use it as maternal parent in a cross to document activity by target site cleavage. In contrast to the pigment deficient 25 ndhA mutants, the pigment deficient rpoB mutants will be viable, as long as grown on sucrose. We first will obtain homoplastomic lines, then characterize the ptDNA by PCR and sequencing. Testing PE function by activating a gfp gene with pegRNA expressed from a mini gene in the plastid genome The goal is to deploy the prime editing (PE) technology, where point mutations can be 30 introduced by providing the pegRNA from a replicating shuttle vector. For assessing the functionality of PE, we developed a test system. Accumulation of GFP, the green fluorescent 21
protein, is a readily detectable reporter gene under UV light. The system was extensively tested in E. coli for editing by the PE, by creating a stop codon that including TAA insertion, 198T deletion and T198A substitution in an active gfp gene (50). We shall also do the opposite, creating a functional gfp gene by eliminating a stop codon. In E. coli, the most efficient was the 5 1-bp (198T) deletion and the least efficient was the (T198A) substitution (50). We shall convert PT-Cas9 into a nickase by the H840A mutation of SpyCas9, and fuse Cas9 at the C-terminus with an engineered reverse transcriptase M-MLV2 (moloney murine leukemia virus variant) via a flexible linker (14). The pegRNA will have the prerequisite 20-nt spacer, scaffold, reverse transcriptase template (RTT) and primer binding site (PBS) domains (50) expressed from a 10 chloroplast gene. pegRNA will be properly sized by the combination of using plastid promoters, tRNAs and the HH and HDV ribozymes described herein. The defective gfp (dgfp) gene will not be expressed in chloroplasts, because the coding region has an in-frame TAA stop codon. The T nucleotide at position 198 is part of the stop codon (Figure 10). However, the dgfp mRNA will be activated when the plastid prime editor (Pt-PE) 15 removes the stop codon. Pt-PE is targeted to chloroplasts where it will incorporate the pegRNA expressed from a pegRNA gene in the plastid genome. Pt-PE will substitute A with a T using the RTT domain of the pegRNA as template. Activation of the defective dgfp gene will verify the functionality of the Pt-PE gene by GFP accumulation in plastids. The pegRNA and defective dgfp will be introduced in the chloroplast gnome as a dicistronic operon (SEQ ID NO 26, Figure 10). 20 The DNA sequence of PE coding region is SEQ ID NO: 2. The coding region will be cloned in the CaMV 35S Promoter/Terminator cassette in which Pt-Cas9 gene is expressed (SEQ ID NO: 1). We shall also introduce a defective gfp gene, in which the reading frame is shifted by insertion of an extra T. Excision of the T will restore the reading frame, indicated by GFP accumulation in chloroplasts. 25 The most efficient strategy to recover plants with edited plastid genomes is to edit all plastids in the egg cell. Editing the gfp genes will be used to identify prime editor (PE) pollen parents, which edit the mutations at a high efficiency in the fertilized egg cells (Figure 6). For this purpose, PE will be expressed from the (EC1.2e1.1p) egg-cell specific promoter (SEQ ID NO: 45) (59). The pegRNAs (SEQ ID NOS: 29, 30, 31 and 32) will be introduced in tobacco 30 chloroplasts by standard protocols and will be pollinated by PE expressed from the EC1.2e1.1p promoter. The strength and specificity of the egg-cell specific promoter depends on the insertion 22
site. That is why we shall test about 100 independent insertion events to identify parental lines which edit the gfp gene at a high efficiency. Scoring GFP is convenient because visual screening enables scoring the editing efficiency. Ideally, we are looking for lines which edit all plastids in the egg cell, instantly yielding homoplastomic events, when all plastid genome copies are 5 uniformly altered. The efficiency of nucleotide substitution, deletion and insertion is likely to be different. Pollinating the maternal lines carrying the three types of gfp editing events in plastid genome of the maternal lines with the same paternal line will provide information about the editing efficiency of the different mutations. The general design of pegRNA genes is shown in Figure 17. 10 Editing efficiency will be also measured using the selectable atrazine resistance mutation in the psbA gene (ref. 51, 52). Atrazine resistance will be introduced into the tobacco psbA gene by transforming the plastid genome with pegRNAatr1_hdv mini gene, and pollination with the PE2 prime editor expressed from the egg-cell specific promoter. PE2 has the 5 mutations in the M-MLV reverse transcriptase which make prime editing efficient (14, 56, 50). Seedlings carrying 15 the Ser-264-Asn (G791C) mutation are resistant to atrazine and can be identified by green cotyledons when germinated on a selective medium (53). To distinguish the editing events from spontaneous mutants, a silent mutation is included in the pegRNA (T789A; Ala). rps12 is another plastid gene in which editing yields a selectable phenotype, streptomycin resistance. Streptomycin resistance based on mutations in rps12 plastid gene Nicotiana species 20 have been described (55, 58). SEQ ID. NO: 34, 35 and 36 describe pegRNAs that are suitable to introduce editing events yielding streptomycin resistance. Again, germinating seedlings on streptomycin medium allows ready identification of streptomycin resistant editing event, because the seedlings turn green when germinated on streptomycin-containing (1,000 mg/L) medium. The pegRNA str1 (SEQ ID NO:34) encodes a selectable streptomycin resistance mutation 25 (C271T); str2 and str3, in addition, a silent A270G and T276A silent mutation, respectively. When the paternal lines yielding efficient editing have been identified, their value will be verified by documenting editing rbcL genes, in which there is no direct selection for improved photosynthesis and plant growth. Yamori et al. (61) described that the M309I (Met-309-Ile) improves Rubisco carboxylation rate (VC). Selection of the Met309 codon for mutagenesis was 30 based on (60). The D397N substitution also boosts photosynthesis and plant growth in Arabidopsis (61). Methionine at position 309 and Aspartic acid at position 397 is highly 23
conserved in crop plants (Table 2). We provide the variable sequences (spacer-scaffold-reverse transcriptase template (RTT)-primer binding site (PBS) sequences for the construction of pegRNAs to edit the M309I and D397N codons in the Arabidopsis, tobacco and soybean rbcL genes (Table 2). The variable sequences can be inserted in promoter-HDV ribosome or promoter- 5 tRNAGly cassettes to obtain functional pegRNA genes (Figure 18). When the transplastomic plants are obtained with uniformly edited plastid genomes, the nuclear PE gene can be segregated away and the pegRNA with the linked aadA marker gene can be excised using pre-planted site specific target sites (Figure 18) that can be excised by expressing a plastid-targeted recombinase from a nuclear gene (57). 10 Table 2. Targets of mutagenesis in rbcL genes Name 309 pegRNA 397 pegRNA (MtoI) (DtoN)
24
Prime editing with pegRNA expressed from a shuttle vector Incorporation of the pegRNA gene in the plastid genome enables testing PE function, as discussed above. To avoid the need to obtain a stable transplastomic line and then excise marker gene with a site-specific recombinase, we propose to express the pegRNA gene from a shuttle 5 plasmid. The NICE shuttle plasmid will be introduced into the plastid genome by the biolistic protocol and maintained by selection for the marker gene on the shuttle plasmid (15). The shuttle plasmid will carry a pegRNA gene and express it in chloroplasts. In the system shown in Figure 11, the PE is expressed from a nuclear transgene and its product is targeted to chloroplasts. The defective dgfp is already present in the plastid genome. 10 However, no GFP accumulates because the gfp gene is defective. When the shuttle plasmid is introduced PE, guided by the pegRNA from the shuttle vector will substitute A198T (or delete 198T) enabling GFP accumulation. When selection for the shuttle marker is dropped, the shuttle plasmid will be lost in the absence of selection (15). EXAMPLE 2 15 Prime editing to obtain herbicide resistant crops Mutations in the psbA gene confer resistance to commercial herbicides which are inhibitors of Photosystem II electron transport flow (13). Well characterized are the Ser-264-Thr (AGT-264-ACT) or Ser-264-Asn (AGT-264-AAT) mutations which confer atrazine resistance in tobacco (51,52). We shall design a suitable pegRNA and express it from a shuttle plasmid to 20 obtain herbicide resistance. Because the shuttle plasmid is transmitted via seed, we shall screen the seed progeny of plants carrying both a nuclear PT-PE and a shuttle plasmid and look for atrazine tolerance in the seed progeny. Atrazine resistance will be indicated by maintaining green pigmentation when germinating seedlings on atrazine-containing medium (53). EXAMPLE 3 25 Viroids to Target pegRNAs to Chloroplasts To extend plastid genome editing to all crops requires that plastid DNA editing be dependent only on nuclear genome transformation. In our plant chloroplast system, the Prime Editor (PE2) variant of nCas9 is already encoded in a nuclear gene. We still need a solution to target the sgRNA/pegRNA from the cytoplasm to the chloroplast. Viroids have been shown to 25
target mRNAs to chloroplasts when the viroid RNA is used as the leader of chimeric mRNAs (67, 62). Viroids are small, single-stranded, circular RNAs infecting plants. Composed of only a few hundred nucleotides and not encoding any proteins, viroids represent the lowest level of 5 complexity for an infectious agent. Despite the relatively small size, viroids contain RNA structural elements required to interact with host factors involved in their infectious cycle. Viroids are specifically targeted to nuclei (family Pospiviroidae) or chloroplasts (family Avsunviroidae), where replication is based on symmetric rolling-circle mechanisms that involves a self-cleaving hammerhead motif (65). The linear monomers are then circularized by the 10 eggplant tRNA ligase in chloroplasts (71). It was shown that members of the Avsunviroidae family probably first enter the nucleus prior to their delivery to the chloroplast of the infected cell (66, 68). Viroids move locally and systemically through plasmodesmata and phloem, respectively, and may elicit symptoms in the infected host, with pathogenic pathways linked to RNA silencing and other plant defense responses (72, 69). The eggplant latent viroid (ELVd) is 15 apparently an exception because it does not causing symptoms on its host (64) Two of the Avsunviroidae viroids, ELVd (67) and Chrysanthemum Chlorotic Mottle Viroid (CChMVD) (62) have been shown to deliver mRNA to Nicotiana benthamiana chloroplasts, a non-host species. Building of the two reports, we decided to target sgRNAs to chloroplasts using the ELVd viroid leader. 20 Four constructs can be generated for this process. SEQ ID NO: a a
26
52 PAtU6-ELVd- To detect Cas9 activity in plants by cleaving the sgRNAndhA- ndhA target site in plants expressing Pt-Cas9 from a
ene. The constructs will be introduced in the tobacco (Nicotiana tabacum) nucleus, and the nuclear transgenics will be selected by regenerating plants on a kanamycin medium (20). Cleavage of the 5 ndhA target site will be recognized by formation of pigment deficient sectors. pegRNA will be delivered using a similar approach, introducing the pegRNA with the viroid as 5’ UTR. pegRNAs suitable for testing PE activity are listed in Figure 18 and plants with improved photosynthesis and growth will be obtained in all species, the nucleus of which can be transformed, including maize, wheat, rice and wheat. If necessary, the nuclear plant 10 transformation markers will be changed to accommodate species specific protocols, such as resistance to hygromycin, kanamycin, and glyphosate. If the presence of viroid sequences interferes with PE activity, the viroid sequences will be removed after import into chloroplasts by a suitable RNase. Alternative approaches for the introduction of pegRNA can include linkage to other 15 RNAs such as the tRNAs of Selaginella kraussiana, known to be encoded by nuclear genes and imported from the cytoplasm into chloroplasts (63). Customized RNAs expressed from a nuclear transgene and driven by a transfer RNA-like (tRNA-like) moiety was taken up by mitochondria in plant cells (73). The tRNAs of Selaginella can be reengineered for the import of chimeric mRNAs into chloroplasts. Another alternative is linking the pegRNA to the translation initiation 20 factor 4E, reportedly imported into chloroplasts (70). These nuclear pegRNA genes can be segregated away as the nuclear PE gene. Expression of the pegRNA from a replicating shuttle vector is another option, as discussed above. Table 3. Listing of constructs and DNA sequences with SEQ ID NOS: useful for practicing the 25 methods of the invention. SEQ ID NO: 1 Pt-Cas9 gene in a 35S Promoter/Terminator cassette. HindIII-EcoRI, in plasmid pSD7 aagcttGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTA TTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTT 27
CATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTA TCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAA AAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAACATGGTGGAGCACGACACTC TCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAA 5 GGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGA AAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGC CGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACC ACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATC CTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGAAATCACCAGTC 10 TCTCTCTACAAATCTATCTCTCTCGAGCTTTCGCAGATCTGTCGATCGACCATGGCTTCCTCAGTTCTTTC CTCCGCAGCAGTTGCCACCCGCAGCAATGTTGCTCAAGCTAACATGGTTGCACCTTTCACTGGCCTTAA GTCAGCTGCCTCATTCCCTGTTTCAAGGAAGCAAAACCTTGACATCACTTCCATTGCCAGCAACGGCGG AAGAGTGCAATGCATGCAGGTGTGGCCAGCGGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCA ACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGC 15 AACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAG CCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTA TCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGT CCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTG GCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGC 20 CGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGG CGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGC TGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGC AAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGCA ACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCC 25 AAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACC AGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAG TGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAG GACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGA CCAGAGCAAGAACGGCTACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCA 30 TCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCT GCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGGAGAGCTGCACG CCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATC CTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACC AGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCC 35 AGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCAC AGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATG AGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACC 28
GGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGA AATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAA GGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACAC TGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTG 5 ATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCA TCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCGCCAACAGAAAC TTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGG CCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCT GCAGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTG 10 ATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAG CGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCC AGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAA CTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGAC TCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCG 15 AAGAGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAG AAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCA AGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAA CACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGG TGTCCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACG 20 ACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTC GTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAA GGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCAAC GGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGG GCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAG 25 GTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAG AAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGG TGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCAC CATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAG TGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGA 30 ATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTT CCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGT TTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTG ATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGA GAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTAC 35 TTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCA CCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAATTGGGAGGCGACTGATTCTAGAG TCGATCGACAAGCTCGAGTTTCTCCATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCCT 29
ATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTAT CAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCCCCCGaattc SEQ ID NO: 2 Plastid prime editor in an NcoI-XbaI fragment. 5 CCATGGCTTCCTCAGTTCTTTCCTCCGCAGCAGTTGCCACCCGCAGCAATGTTGCTCAAGCTAACATGGT TGCACCTTTCACTGGCCTTAAGTCAGCTGCCTCATTCCCTGTTTCAAGGAAGCAAAACCTTGACATCAC TTCCATTGCCAGCAACGGCGGAAGAGTGCAATGCATGCAGGTGTGGCCAGCGGACAAGAAGTACAGCA TCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGC AAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCT 10 GTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGA CGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTT CTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCG GCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTG GTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGG 15 GGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCT GGTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCC ATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAA GAAGAATGGCCTGTTCGGCAACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACT TCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCT 20 GCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCT GCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGA GATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAG TACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTGACGGCGGAGCCAGCCA GGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGA 25 AGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGAT CCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACC GGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAAC AGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGT GGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACG 30 AGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTG AAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGG ACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAAT CGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACATACCA CGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAG 35 ATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCC ACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAG CCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCG 30
ACGGCTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATC CAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCC CGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGC ACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAA 5 CAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAA CACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGA TATGTACGTGGACCAGGAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACgccATCGTGCCTCAG AGCTTTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGA GCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGC 10 CAAGCTGATTACCCAGAGAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTG GATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGAT CCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCA CCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACA ACTACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCT 15 AAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAG CGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGAC CGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGG GAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAA TATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACA 20 GCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACC GTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGA AAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAA GCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCT GGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTG 25 CCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGAT AATGAGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAG CGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGC ACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAG CCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTG 30 CTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAatTG GGAGGCGACAGCGGTGGGTCATCCGGAGGtTCCAGCGGGTCCGAGACCCCCGGTACTTCTGAGAGTGC AACCCCTGAGAGCAGTGGCGGGAGTAGTGGCGGATCTCGTCCCACCCTCAACATCGAGGACGAGTATA GGCTTCATGAGACCTCAAAAGAGCCTGACGTTAGCCTTGGGTCCACCTGGCTTTCTGACTTTCCACAGG CCTGGGCTGAAACAGGCGGCATGGGGCTGGCAGTTCGTCAGGCACCCTTAATCATCCCCTTGAAAGCC 35 ACCAGCACCCCCGTATCCATCAAACAGTATCCAATGTCTCAGGAAGCTAGGCTGGGGATCAAACCTCAC ATTCAAAGACTTCTCGATCAGGGTATCCTGGTTCCATGTCAGAGCCCCTGGAATACCCCCCTTTTGCCTG TCAAGAAGCCTGGTACTAATGATTACAGACCAGTACAGGACTTACGAGAGGTTAACAAACGTGTAGAA 31
GACATCCATCCCACAGTTCCAAACCCTTACAACTTACTTTCAGGCTTGCCACCAAGTCATCAATGGTACA CTGTTCTCGATCTTAAAGATGCCTTCTTCTGCTTGCGTCTGCATCCCACTTCCCAACCTCTGTTCGCTTTT GAGTGGCGAGACCCAGAAATGGGTATATCCGGACAGCTGACCTGGACTAGGCTTCCACAGGGCTTCAA GAATTCTCCTACTTTATTCAACGAGGCACTGCATCGTGATCTCGCAGATTTTAGAATTCAGCACCCCGAT 5 CTGATCCTGTTGCAATACGTCGACGACCTGCTTTTAGCAGCCACTTCTGAGTTGGACTGCCAGCAGGGT ACCAGGGCATTACTCCAGACATTGGGAAACCTCGGCTACCGTGCTTCAGCCAAAAAGGCTCAGATTTGT CAAAAACAAGTTAAGTATCTGGGATATTTGCTTAAGGAGGGCCAACGATGGTTAACAGAGGCCCGAAA GGAAACAGTCATGGGACAGCCTACTCCTAAAACTCCTCGACAATTAAGAGAATTTCTCGGTAAGGCAGG TTTTTGCAGGCTGTTTATACCAGGATTCGCTGAAATGGCAGCACCACTGTATCCTCTTACAAAGCCCGGG 10 ACACTCTTTAATTGGGGGCCCGATCAACAGAAGGCATATCAGGAGATTAAACAGGCATTATTGACAGCT CCCGCACTGGGATTGCCCGATCTTACCAAACCCTTTGAACTTTTTGTCGATGAGAAACAAGGTTACGCT AAGGGTGTCTTAACACAGAAATTGGGCCCCTGGAGGCGACCTGTCGCCTATCTTAGTAAGAAATTAGAC CCTGTTGCTGCCGGTTGGCCACCTTGCTTGAGGATGGTAGCCGCAATCGCTGTTCTTACTAAGGACGCC GGCAAGTTAACtATGGGACAGCCTTTGGTCATACTGGCTCCTCACGCTGTGGAAGCTCTCGTTAAGCAGC15 CCCCCGACCGTTGGCTTTCCAATGCAAGAATGACACACTATCAGGCCTTACTTCTGGACACTGATCGAG TTCAATTTGGGCCCGTCGTAGCCCTCAATCCTGCAACTTTATTACCTTTGCCCGAAGAAGGGCTGCAGCA TAATTGCTTAGACATCCTTGCAGAAGCCCAcGGGACACGACCAGACCTCACAGATCAGCCTTTACCTGA CGCTGACCATACATGGTATACCGACGGATCATCTTTACTTCAAGAGGGTCAGCGTAAAGCCGGGGCCGC TGTCACTACCGAAACCGAGGTGATCTGGGCCAAAGCTCTTCCAGCAGGAACTAGCGCACAGAGAGCCG 20 AGCTCATCGCACTGACTCAGGCACTGAAGATGGCCGAGGGTAAAAAACTGAACGTATACACAGACAGT CGATACGCTTTTGCAACCGCCCACATTCACGGGGAAATTTACAGGAGAAGGGGGTGGCTGACCAGCGA AGGTAAGGAGATCAAGAATAAAGATGAAATATTGGCCTTACTCAAGGCTCTGTTTTTACCTAAACGACTT AGTATAATCCACTGCCCCGGCCACCAGAAAGGCCACAGCGCCGAAGCCAGAGGTAACCGAATGGCCGA TCAGGCTGCTCGTAAGGCCGCTATCACCGAAACTCCAGACACAAGTACTTTATTAATAGAAAACTCTAG 25 CCCATAATTCTAGA SEQ ID NO: 3 pDiA1 (pCB101) sgRNA gene, SacI-HindII fragment gagctcttgcgctatatatatgaaagagtatacaataatgACCATTTGATTCTTGTACATGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggt30 aaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaatctagaACGCGTTCAATTTAAACACCACCATCAT CACCATCATCCTGACTAGACTTTCAGGCGATGTGTGCTGGAAGACATTCGGATCTTCCAGTGGTGCATGA ACGCATGAGAAAGCCCCCGGAAGATCATCTTCCGGGGGCTTTTTTTTTGGCGCGTGACGCGTACAGGAA ACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAAC CATGCGCAATTCAagctt 35 SEQ ID NO: 4 pTriA1 sgRNA gene, SacI-HindIII 32
gagctcttgcgctatatatatgaaagagtatacaataatgaacaattgaagggatgtggcgcagcttggtagcgcgtttgttttgggtacaaaatgtcacaggttcaaatcct gtcatccctaACCATTTGATTCTTGTACATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTA TCAACTTGAAAAAGTGGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcg ggttcgattcccgctatccgcccaagatccaatctagaACGCGTTCAATTTAAACACCACCATCATCACCATCATCCTGACTAG 5 ACTTTCAGGCGATGTGTGCTGGAAGACATTCGGATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCC CGGAAGATCATCTTCCGGGGGCTTTTTTTTTGGCGCGTGACGCGTACAGGAAACACAGAAAAAAGCCC GCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGCAATTCAagctt SEQ ID NO: 5 pTriA1.5 sgRNA gene 10 gagctcttgcgctatatatatgaaagagtatacaataatgaacaattgaagggatgtggcgcagcttggtagcgcgtttgttttgggtacaaaatgtcacaggttcaaatcct gtcatccctacctatACCATTTGATTCTTGTACATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaag atgcgggttcgattcccgctatccgcccaagatccaatctagaACGCGTTCAATTTAAACACCACCATCATCACCATCATCCTGAC TAGACTTTCAGGCGATGTGTGCTGGAAGACATTCGGATCTTCCAGTGGTGCATGAACGCATGAGAAAGC 15 CCCCGGAAGATCATCTTCCGGGGGCTTTTTTTTTGGCGCGTGACGCGTACAGGAAACACAGAAAAAAG CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGCAATTCAa gctt SEQ ID NO: 6 pDiK1 sgRNA gene 20 gagctcttgcgctatatatatgaaagagtatacaataatgagtttatggccgcttctctaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctcttt gccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaatctagaACGCGTTCAATTTAAACACCACCATCATCACCATC ATCCTGACTAGACTTTCAGGCGATGTGTGCTGGAAGACATTCGGATCTTCCAGTGGTGCATGAACGCAT GAGAAAGCCCCCGGAAGATCATCTTCCGGGGGCTTTTTTTTTGGCGCGTGACGCGTACAGGAAACACA 25 GAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGC GCAATTCAagctt SEQ ID NO: 7 pTriK1 sgRNA gene SacI-HindIII gagctcttgcgctatatatatgaaagagtatacaataatgaacaattgaagggatgtggcgcagcttggtagcgcgtttgttttgggtacaaaatgtcacaggttcaaatcct gtcatccctaagtttatggccgcttctctaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT30 GAAAAAGTGGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattccc gctatccgcccaagatccaatctagaACGCGTTCAATTTAAACACCACCATCATCACCATCATCCTGACTAGACTTTCAG GCGATGTGTGCTGGAAGACATTCGGATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCCCGGAAGAT CATCTTCCGGGGGCTTTTTTTTTGGCGCGTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGA CAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGCAATTCAagctt 35 SEQ ID NO: 8 pTriK1.5 sgRNA gene gagctcttgcgctatatatatgaaagagtatacaataatgaacaattgaagggatgtggcgcagcttggtagcgcgtttgttttgggtacaaaatgtcacaggttcaaatcct gtcatccctacctatagtttatggccgcttctctaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAA 33
CTTGAAAAAGTGGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcga ttcccgctatccgcccaagatccaatctagaACGCGTTCAATTTAAACACCACCATCATCACCATCATCCTGACTAGACTTT CAGGCGATGTGTGCTGGAAGACATTCGGATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCCCGGA AGATCATCTTCCGGGGGCTTTTTTTTTGGCGCGTGACGCGTACAGGAAACACAGAAAAAAGCCCGCAC 5 CTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGCAATTCAagctt SEQ ID NO: 9 DiA2, pMM34 GAATTCGAGCTCtactcccccaccacgatcgaacgggaatggataggaggcttgtgggattgacgtgatagggtagggttggctatactgctggtgaccattt gattcttgtacatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG10 CACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagat ccaaAAGCTT SEQ ID NO: 10 DiA3, pMM51 GAGCTCgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaaccatttgattctt15 gtacatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaaA AGCTT SEQ ID NO: 11 DiRC1, pMM48 20 GAGCTCgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgacccactttcttac gattacgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC CGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaa AAGCTT 25 SEQ ID NO: 12 DiRC2, pMM49 GAGCTCgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaatagtcctttgtg gctccggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC CGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaa AAGCTT 30 SEQ ID NO: 13 DiK3, 1 pCB107 gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaagtttatggccgcttct ctaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaaaagc 35 tt SEQ ID NO: 14 DiK3.2, pCB108 34
gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaTCTATAACCG CTTCCGGTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT GGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaa gatccaaaagctt 5 SEQ ID NO: 15 DiK3.3, pCB109 gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaTCCGGTTTAG GTGGGCAACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG TGGCACCGAGTCGGTGCaacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgccca agatccaaaagctt 10 SEQ ID NO: 16 pCB110 SacI-HindIII gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaaGCACGCTGA TGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCACCATTTGATTCTTGTACATGttTTAGAGCTAGAAATA GCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCgaGTCGGTGCTTTTGGCCGGC 15 ATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggcgaatgggacaAGCTT SEQ ID NO: 17 pCB111 gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaaGCACGCTGA TGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCcccactttcttacgattacgGttTTAGAGCTAGAAATAGCAAGTT20 AAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCgaGTCGGTGCTTTTGGCCGGCATGGTCCC AGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggcgaatgggacaAGCTT SEQ ID NO: 18 pCB112 gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaaGCACGCTGA25 TGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCatagtcctttgtggctccggGttTTAGAGCTAGAAATAGCAAGTT AAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCgaGTCGGTGCTTTTGGCCGGCATGGTCCC AGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggcgaatgggacaAGCTT SEQ ID NO: 19 pCB113 30 gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaACCATTTGAT TCTTGTACATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT GGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCT TCggcatggcgaatgggacaAGCTT 35 SEQ ID NO: 20 pCB114 gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgacccactttcttacgatt acgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG 35
AGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggc gaatgggacaAGCTT SEQ ID NO: 21 pCB115 5 gagctcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaatagtcctttgtggctc cggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggc gaatgggacaAGCTT 10 SEQ ID NO: 22 Microrepeat #1 tagagAATTGAGAATTCGAggttg SEQ ID NO: 23 Microrepeat #2 caaatTTTGAATTTGATAAATgcatt 15 SEQ ID NO: 24 Microrepeat #3 tgatgAACTTCTTTtCACTGTaaaag SEQ ID NO: 25 Microrepeat #4 20 aaaggAATCAACAAAgaaaa SEQ ID NO: 26 pMM84 - Dicistronic pegRNA gene with defective dgfp TONG gene GAGCTcgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagcgaaGCACGCT GATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCtCTTGTCACTACTCTGACCTAGTTTTAGAGCTAGA25 AATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGAACA CCaTAGGTCAGAGTAGTGATTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACAT GCTTCggcatggcgaatgggacAACCCAAATAATGTTTTAAAATTTTAAAAATAATGTAGGAGGAAAAATTatcatggc tagcAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGC ACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAACTCACCCTTAAATTTATTTG 30 CACTACTGGAAAACTACCTGTTCCtTGGCCAACACTTGTCACTACTCTGACCTAAGGTGTTCAATGCTTT TCCCGTTATCCGGATCAtATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTAcGTACAGG AACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATA CCCTTGTTAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACT AGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAA 35 CTTCAAAATTCGCCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCA ATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCcACACAATCTGCCCTTTCGAAAGATC CCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGG 36
ATGAaCTgTACAAAtaaatctagaAAACAGTAGACATTAGCAGATAAATTAGCAGGAAATAAAGAAGGATAAG GAGAAAGAACTCAAGTAATTATCCTTCGTTCTCTTAATTGAATTGCAATTAAACTCGGCCCAATCTTTTAC TAAAAGGATTGAGCCGAATACAACAAAGATTCTATTGCATATATTTTGACTAAGTATATACTTACCTAGAT ATACAAGATTTGAAATACAAAATCTAaAGCTT 5 SEQ ID NO:27 pMM128 Dicistronic pegRNA-gfp active; Nt-atpHwt leader ~ 15% GFP GAGCTCGCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCA GGGATGGCTATATTTCTGGGAGCGATCTTGTCACTACTCTGACCTAGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGAACACCATAGGTCA 10 GAGTAGTGAAACAAAAAAATGCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCG GGTTCGATTCCCGCTATCCGCCCAAGATCCAATCGACTGGATGAGTCCTAGCGAGGGAATAATTAAGTCA TAACTCATTGGTTGATTGTATCATTAACCATTTCTTTTTTTTGGTACGAGGAACTTATCATGGctagcAAAGG AGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTT TCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAACTCACCCTTAAATTTATTTGCACTACTG 15 GAAAACTACCTGTTCCtTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTAT CCGGATCAtATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTAcGTACAGGAACGCACTA TATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTA ATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTAGAGTACA ACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAA 20 TTCGCCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGA TGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCcACACAATCTGCCCTTTCGAAAGATCCCAACGAA AAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAaCTgT ACAAAtaaatctagaAAACAGTAGACATTAGCAGATAAATTAGCAGGAAATAAAGAAGGATAAGGAGAAAGA ACTCAAGTAATTATCCTTCGTTCTCTTAATTGAATTGCAATTAAACTCGGCCCAATCTTTTACTAAAAGGA 25 TTGAGCCGAATACAACAAAGATTCTATTGCATATATTTTGACTAAGTATATACTTACCTAGATATACAAGAT TTGAAATACAAAATCTAaAGCTT SEQ ID NO:28 pMM129 Dicistronic pegRNA-gfp active; Zm-atpHAA GAGCTCGCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCA 30 GGGATGGCTATATTTCTGGGAGCGATCTTGTCACTACTCTGACCTAGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGAACACCATAGGTCA GAGTAGTGAAACAAAAAAATGCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCG GGTTCGATTCCCGCTATCCGCCCAAGATCCAATTACTTCTACCCGATAGAGCTTAGAAGTTGGAAGTAAT AATTTCTTGGTTGATTGTAAACTTAACCATTTCTTTTTTTTTGACACGAGGAACTCATCATGGctagcAAAG35 GAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATT TTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAACTCACCCTTAAATTTATTTGCACTACT GGAAAACTACCTGTTCCtTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTA 37
TCCGGATCAtATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTAcGTACAGGAACGCACT ATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTAGAGTAC AACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAA 5 ATTCGCCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCG ATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCcACACAATCTGCCCTTTCGAAAGATCCCAACGA AAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAaCTg TACAAAtaaatctagaAAACAGTAGACATTAGCAGATAAATTAGCAGGAAATAAAGAAGGATAAGGAGAAAG AACTCAAGTAATTATCCTTCGTTCTCTTAATTGAATTGCAATTAAACTCGGCCCAATCTTTTACTAAAAGG 10 ATTGAGCCGAATACAACAAAGATTCTATTGCATATATTTTGACTAAGTATATACTTACCTAGATATACAAGA TTTGAAATACAAAATCTAaAGCTT SEQ ID NO:29 pMM130 Dicistronic pegRNA-dgfp inactive; activation byA to T substitution; Nt-atpHwt leader – no gfp 15 GAGCTCGCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCA GGGATGGCTATATTTCTGGGAGCGATCTTGTCACTACTCTGACCTAGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGAACACCATAGGTCA GAGTAGTGAAACAAAAAAATGCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCG GGTTCGATTCCCGCTATCCGCCCAAGATCCAATCGACTGGATGAGTCCTAGCGAGGGAATAATTAAGTCA 20 TAACTCATTGGTTGATTGTATCATTAACCATTTCTTTTTTTTGGTACGAGGAACTTATCATGGctagcAAAGG AGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTT TCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAACTCACCCTTAAATTTATTTGCACTACTG GAAAACTACCTGTTCCtTGGCCAACACTTGTCACTACTCTGACCTAAGGTGTTCAATGCTTTTCCCGTTAT CCGGATCAtATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTAcGTACAGGAACGCACTA25 TATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTA ATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTAGAGTACA ACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAA TTCGCCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGA TGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCcACACAATCTGCCCTTTCGAAAGATCCCAACGAA30 AAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAaCTgT ACAAAtaaatctagaAAACAGTAGACATTAGCAGATAAATTAGCAGGAAATAAAGAAGGATAAGGAGAAAGA ACTCAAGTAATTATCCTTCGTTCTCTTAATTGAATTGCAATTAAACTCGGCCCAATCTTTTACTAAAAGGA TTGAGCCGAATACAACAAAGATTCTATTGCATATATTTTGACTAAGTATATACTTACCTAGATATACAAGAT TTGAAATACAAAATCTAaAGCTT 35 SEQ ID NO:30 pMM131 Dicistronic pegRNA-dgfp inactive; Zm-atpHAA ; activation byA to T substitution; – no GFP 38
GAGCTCGCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCA GGGATGGCTATATTTCTGGGAGCGATCTTGTCACTACTCTGACCTAGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGAACACCATAGGTCA GAGTAGTGAAACAAAAAAATGCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCG 5 GGTTCGATTCCCGCTATCCGCCCAAGATCCAATTACTTCTACCCGATAGAGCTTAGAAGTTGGAAGTAAT AATTTCTTGGTTGATTGTAAACTTAACCATTTCTTTTTTTTTGACACGAGGAACTCATCATGGctagcAAAG GAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATT TTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAACTCACCCTTAAATTTATTTGCACTACT GGAAAACTACCTGTTCCtTGGCCAACACTTGTCACTACTCTGACCTAAGGTGTTCAATGCTTTTCCCGTT10 ATCCGGATCAtATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTAcGTACAGGAACGCAC TATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGT TAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTAGAGTAC AACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAA ATTCGCCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCG 15 ATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCcACACAATCTGCCCTTTCGAAAGATCCCAACGA AAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAaCTg TACAAAtaaatctagaAAACAGTAGACATTAGCAGATAAATTAGCAGGAAATAAAGAAGGATAAGGAGAAAG AACTCAAGTAATTATCCTTCGTTCTCTTAATTGAATTGCAATTAAACTCGGCCCAATCTTTTACTAAAAGG ATTGAGCCGAATACAACAAAGATTCTATTGCATATATTTTGACTAAGTATATACTTACCTAGATATACAAGA 20 TTTGAAATACAAAATCTAaAGCTT SEQ ID NO:31 pMM143 Dicistronic pegRNA-dgfp inactive; activation by T deletion; Nt-atpHwt leader – no GFP GAGCTCGCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCA GGGATGGCTATATTTCTGGGAGCGATCTTGTCACTACTCTGACCTAGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGAACACCATAGGTCA 25 GAGTAGTGAAACAAAAAAATGCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCG GGTTCGATTCCCGCTATCCGCCCAAGATCCAATCGACTGGATGAGTCCTAGCGAGGGAATAATTAAGTCA TAACTCATTGGTTGATTGTATCATTAACCATTTCTTTTTTTTGGTACGAGGAACTTATCATGGctagcAAAGG AGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTT TCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAACTCACCCTTAAATTTATTTGCACTACTG 30 GAAAACTACCTGTTCCtTGGCCAACACTTGTCACTACTCTGACCTATtGGTGTTCAATGCTTTTCCCGTTAT CCGGATCAtATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTAcGTACAGGAACGCACTA TATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTA ATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTAGAGTACA ACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAA 35 TTCGCCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGA TGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCcACACAATCTGCCCTTTCGAAAGATCCCAACGAA 39
AAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAaCTgT ACAAAtaaatctagaAAACAGTAGACATTAGCAGATAAATTAGCAGGAAATAAAGAAGGATAAGGAGAAAGA ACTCAAGTAATTATCCTTCGTTCTCTTAATTGAATTGCAATTAAACTCGGCCCAATCTTTTACTAAAAGGA TTGAGCCGAATACAACAAAGATTCTATTGCATATATTTTGACTAAGTATATACTTACCTAGATATACAAGAT 5 TTGAAATACAAAATCTAaAGCTT SEQ ID NO:32 pMM144 Dicistronic pegRNA-dgfp inactive; activation by TA insertion; Nt-atpHwt leader – no GFP GAGCTCGCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCA GGGATGGCTATATTTCTGGGAGCGATCTTGTCACTACTCTGACCTAGTTTTAGAGCTAGAAATAGCAAGT 10 TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGAACACCATAGGTCA GAGTAGTGAAACAAAAAAATGCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCG GGTTCGATTCCCGCTATCCGCCCAAGATCCAATCGACTGGATGAGTCCTAGCGAGGGAATAATTAAGTCA TAACTCATTGGTTGATTGTATCATTAACCATTTCTTTTTTTTGGTACGAGGAACTTATCATGGctagcAAAGG AGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTT 15 TCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAACTCACCCTTAAATTTATTTGCACTACTG GAAAACTACCTGTTCCtTGGCCAACACTTGTCACTACTCTGACCTGGTGTTCAATGCTTTTCCCGTTATCC GGATCAtATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTAcGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAAT CGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTAGAGTACAAC 20 TATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATT CGCCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATG GCCCTGTCCTTTTACCAGACAACCATTACCTGTCcACACAATCTGCCCTTTCGAAAGATCCCAACGAAAA GCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAaCTgTAC AAAtaaatctagaAAACAGTAGACATTAGCAGATAAATTAGCAGGAAATAAAGAAGGATAAGGAGAAAGAAC25 TCAAGTAATTATCCTTCGTTCTCTTAATTGAATTGCAATTAAACTCGGCCCAATCTTTTACTAAAAGGATT GAGCCGAATACAACAAAGATTCTATTGCATATATTTTGACTAAGTATATACTTACCTAGATATACAAGATTT GAAATACAAAATCTAaAGCTT SEQ ID NO: 33 pegRNAatr1_hdv minigene, SacI-HindIII 30 GAGCTCtactcccccaccacgatcgaacgggaatggataggaggcttgtgggattgacgtgatagggtagggttggctatactgctggtgGTAGCCGCTC ATGGTTATTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT GGCACCGAGTCGGTGCGTTGTTGAAAGTTGCATATTGGAAGATCAATCGGCCAAAATAACCATGAGCGG TTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggcgaatgggacaAG CTT 35 SEQ ID NO:34 pegRNAstr1_hdv.dna SacI-HindIII 40
GAGCTCtactcccccaccacgatcgaacgggaatggataggaggcttgtgggattgacgtgatagggtagggttggctatactgctggtgggaagggttaaggatt taccGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCtctcacaccggAtaaatccttaacccTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGG CAACATGCTTCggcatggcgaatgggacaAGCTT 5 SEQ ID NO: 35 pegRNAstr2_hdv.dna SacI-HindIII GAGCTCtactcccccaccacgatcgaacgggaatggataggaggcttgtgggattgacgtgatagggtagggttggctatactgctggtgggaagggttaaggatt taccGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCtctcacaccggACaaatccttaacccTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGG 10 GCAACATGCTTCggcatggcgaatgggacaAGCTT SEQ ID NO: 36 pegRNAstr3_hdv.dna SacI-HindIII GAGCTCtactcccccaccacgatcgaacgggaatggataggaggcttgtgggattgacgtgatagggtagggttggctatactgctggtgggaagggttaaggatt taccGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG15 AGTCGGTGCtgtgatatctcacTccggAtaaatccttaacccTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGG CTGGGCAACATGCTTCggcatggcgaatgggacaAGCTT SEQ ID NO: 37 At-rbcL_309_1 ATA pegRNA part: Spacer-scaffold-RTT-PBS attgatagacagaagaatcaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCgtgTataccatgattcttctgtctat 20 SEQ ID NO: 38 Gm_rbcL_309_1 ATA pegRNA part: Spacer-scaffold-RTT-PBS atcgacagacaaaagaatcaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGCgtgcataccatgattcttttgtctgt SEQ ID NO: 39 At-rbcL_397_1 AAT pegRNA part: Spacer-scaffold-RTT-PBS cctgctttgaccgagatcttGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA 25 GTGGCACCGAGTCGGTGCacagaatTatctccaaagatctcggtcaaag SEQ ID NO: 40 At-rbcL_397_2 AAC pegRNA part: Spacer-scaffold-RTT-PBS cctgctttgaccgagatcttGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGCACCGAGTCGGTGCacagaGtTatctccaaagatctcggtcaaag SEQ ID NO: 41 Nt-rbcL_397_1 AAT pegRNA part: Spacer-scaffold-RTT-PBS 30 tgctctgaccgagatctttgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCgaatTatccccaaagatctcggtcagagca 41
SEQ ID NO: 42 Nt-rbcL_397_2 AAC pegRNA part: Spacer-scaffold-RTT-PBS tgctctgaccgagatctttgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCgaatTatccccaaagatctcggtcagagca SEQ ID NO: 43 Gm-rbcL_397_1 AAT pegRNA part: Spacer-scaffold-RTT-PBS 5 tgctctgaccgagatctttgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCgaatTatccccaaagatctcggtcagagca SEQ ID NO: 44 Gm-rbcL_397_2 AAC pegRNA part: Spacer-scaffold-RTT-PBS tgctctgaccgagatctttgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCgaatTatccccaaagatctcggtcagagca 10 SEQ ID NO: 45 Arabidopsis thaliana egg cell-specific enhancer and promoter (EC1.2e1.1p); HindIII/NcoI fragment - Wang et al. Genome Biol 16: 144, 2015 AGCTTGAATAAAAGCATTTGCGTTTGGTTTATCATTGCGTTTATACAAGGACAGAGATCCACTGAGCTGG AATAGCTTAAAACCATTATCAGAACAAAATAAACCATTTTTTGTTAAGAATCAGAGCATAGTAAACAACA GAAACAACCTAAGAGAGGTAACTTGTCCAAGAAGATAGCTAATTATATCTATTTTATAAAAGTTATCATAG 15 TTTGTAAGTCACAAAAGATGCAAATAACAGAGAAACTAGGAGACTTGAGAATATACATTCTTGTATATTT GTATTCGAGATTGTGAAAATTTGACCATAAGTTTAAATTCTTAAAAAGATATATCTGATCTAGGTGATGGT TATAGACTGTAATTTTACCACATGTTTAATGATGGATAGTGACACACATGACACATCGACAACACTATAGC ATCTTATTTAGATTACAACATGAAATTTTTCTGTAATACATGTCTTTGTACATAATTTAAAAGTAATTCCTA AGAAATATATTTATACAAGGAGTTTAAAGAAAACATAGCATAAAGTTCAATGAGTAGTAAAAACCATATA 20 CAGTATATAGCATAAAGTTCAATGAGTTTATTACAAAAGCATTGGTTCACTTTCTGTAACACGACGTTAA ACCTTCGTCTCCAATAGGAGCGCTACTGATTCAACATGCCAATATATACTAAATACGTTTCTACAGTCAAA TGCTTTAACGTTTCATGATTAAGTGACTATTTACCGTCAATCCTTTCCCATTCCTCCCACTAATCCAACTTT TTAATTACTCTTAAATCACCACTAAGCTAGTAACGCCTATCATGAATTAGCTCTACTAAATCTAGCAACCT TTCAAATTTGCAGTATTGCAGGTGTCTCTGTGTCTTTAAAATAGTTGCCTTATGATTTCTTCGGTTTCAAG 25 ATGATCAAATAGTTATAGATTTCATGCTCACACATGCTCATTAGATGTGTACATACTTTACTTACCCAAATC TATTTTCTCGCAAAGATTTTGATGGTAAAGCTGATTTGGTTCTATTGAACTAAATCAAACGAGTTTCAGA CTGAGTGATTCTAATCCGGCCCATTAGCCCCTAAACAGACCCACTAATTACGCAGCTTTTAATAGAGTAA TTACACCTAGTTTACCCACTAAACCACTAAGCACTAATTATCTCACAATCTAATGAGCTTCCCTCGTAATT ACTTGGGCTTTCACTCTACCATTTATTTGTAACAGTCAAGTCTCTACTGTCTCTATATAAACTCTCTAAAG 30 TTAACACACAATTCTCATCACAAACAAATCAACCAAAGCAACTTCTACTCTTTCTTCTTTCGACCTTATC AATCTGTTGAGAACCATGG SEQ ID NO: 46 Zea mays rRNA operon PEP promoter (PrrnZm), with SacI site GAGCTCtactcccccaccacgatcgaacgggaatggataggaggcttgtgggattgacgtgatagggtagggttggctatactgctggtg 42
SEQ ID NO: 47 Hepatitis delta virus (hdv) ribozyme, with HindIII restriction site TTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCggcatggcgaatgggacaAG CTT SEQ ID NO: 48 trnG / tRNAGly 5 aacaaaaaaatgcggatatggtcgaatggtaaaatttctctttgccaaggagaagatgcgggttcgattcccgctatccgcccaagatccaa SEQ ID NO: 49 P35S:ELVd-gfp:T35S HindIII/EcoRI AAGCTTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGG CTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCA CTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGG 10 CTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGG AAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAACATGGTGGAGCACGACAC TCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACA AAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTA GAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCT 15 GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAA CCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACT ATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAGGATCGGTACCTTGGC GAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGGCACACACCACCCTATGGGGAGAGGTCGTCCT CTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTACACCCACCCATGGGTCGGGACTTTAAATTC 20 GGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTTACTTTGTAAGTGTGGTTCG GCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTTCCGACGGTGGGTTCGTCG ACACCTCTCCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCCATGGCTAGCAGTAAAGGAGAAG AACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTC AGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAA 25 CTACCTGTTCCTTGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGA TCACATGAAGCGGCACGACTTCTTCAAGAGCGCCATGCCTGAGGGATACGTGCAGGAGAGGACCATCT CTTTCAAGGACGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAGGGAGACACCCTCGTCAAC AGGATCGAGCTTAAGGGAATCGATTTCAAGGAGGACGGAAACATCCTCGGCCACAAGTTGGAATACAA CTACAACTCCCACAACGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAAT 30 TAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCTATTGGCGAT GGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAA AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTG TACAAATAATTCTAGAGTCGATCGACAAGCTCGAGTTTCTCCATAATAATGTGTGAGTAGTTCCCAGATA AGGGAATTAGGGTTCCTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTA 43
TTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCCC CCGAATTC SEQ ID NO: 50 P35S:ELVd-sgRNAndhA:T35S HindIII/EcoRI AAGCTTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGG 5 CTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCA CTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGG CTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGG AAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAACATGGTGGAGCACGACAC TCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACA 10 AAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTA GAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCT GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAA CCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACT ATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAGGATCGGTACCTTGGC 15 GAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGGCACACACCACCCTATGGGGAGAGGTCGTCCT CTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTACACCCACCCATGGGTCGGGACTTTAAATTC GGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTTACTTTGTAAGTGTGGTTCG GCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTTCCGACGGTGGGTTCGTCG ACACCTCTCCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCCACCATTTGATTCTTGTACATGTT 20 TTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG GTGCTTCTAGAGTCGATCGACAAGCTCGAGTTTCTCCATAATAATGTGTGAGTAGTTCCCAGATAAGGGA ATTAGGGTTCCTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTA AAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCCCCCGAAT TC 25 SEQ ID NO: 51 PAtU6:ELVd-sgRNAndhA:TTTTTTTTTT HindIII/EcoRI AAGCTTCGACTTGCCTTCCGCACAATACATCATTTCTTCTTAGCTTTTTTTCTTCTTCTTCGTTCATACAGT TTTTTTTTGTTTATCAGCTTACATTTTCTTGAACCGTAGCTTTCGTTTTCTTCTTTTTAACTTTCCATTCGG AGTTTTTGTATCTTGTTTCATAGTTTGTCCCAGGATTAGAATGATTAGGCATCGAACCTTCAAGAATTTGA TTGAATAAAACATCTTCATTCTTAAGATATGAAGATAATCTTCAAAAGGCCCCTGGGAATCTGAAAGAAG 30 AGAAGCAGGCCCATTTATATGGGAAAGAACAATAGTATTTCTTATATAGGCCCATTTAAGTTGAAAACAA TCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTA GTGGGATCGGTACCTTGGCGAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGGCACACACCACCC TATGGGGAGAGGTCGTCCTCTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTACACCCACCCAT GGGTCGGGACTTTAAATTCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTT 35 ACTTTGTAAGTGTGGTTCGGCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTT CCGACGGTGGGTTCGTCGACACCTCTCCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCCACCA 44
TTTGATTCTTGTACATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGCTTTTTTTTTTGAATTC SEQ ID NO: 52 PAtU6:ELVd-sgRNAndhA:GGGGTTTTTTTTTT HindIII/EcoRI AAGCTTCGACTTGCCTTCCGCACAATACATCATTTCTTCTTAGCTTTTTTTCTTCTTCTTCGTTCATACAGT 5 TTTTTTTTGTTTATCAGCTTACATTTTCTTGAACCGTAGCTTTCGTTTTCTTCTTTTTAACTTTCCATTCGG AGTTTTTGTATCTTGTTTCATAGTTTGTCCCAGGATTAGAATGATTAGGCATCGAACCTTCAAGAATTTGA TTGAATAAAACATCTTCATTCTTAAGATATGAAGATAATCTTCAAAAGGCCCCTGGGAATCTGAAAGAAG AGAAGCAGGCCCATTTATATGGGAAAGAACAATAGTATTTCTTATATAGGCCCATTTAAGTTGAAAACAA TCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTA 10 GTGGGATCGGTACCTTGGCGAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGGCACACACCACCC TATGGGGAGAGGTCGTCCTCTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTACACCCACCCAT GGGTCGGGACTTTAAATTCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTT ACTTTGTAAGTGTGGTTCGGCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTT CCGACGGTGGGTTCGTCGACACCTCTCCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCCACCA 15 TTTGATTCTTGTACATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGCGGGGTTTTTTTTTTGAATTC REFERENCES 1. Jensen, P.E. and Scharff, L.B. (2019) Engineering of plastids to optimize the production 20 of high-value metabolites and proteins. Curr Opin Biotechnol, 59, 8-15. 2. Martin-Avila, E., Lim, Y.L., Birch, R., Dirk, L.M.A., Buck, S., Rhodes, T., Sharwood, R.E., Kapralov, M.V. and Whitney, S.M. (2020) Modifying Plant Photosynthesis and Growth via Simultaneous Chloroplast Transformation of Rubisco Large and Small Subunits. Plant Cell, 32, 2898-2916. 25 3. Hanson, M.R., Lin, M.T., Carmo-Silva, A.E. and Parry, M.A. (2016) Towards engineering carboxysomes into C3 plants. Plant J., 87, 38-50. 4. Svab, Z., Hajdukiewicz, P. and Maliga, P. (1990) Stable transformation of plastids in higher plants. Proc. Natl. Acad. Sci. USA, 87, 8526-8530. 5. Svab, Z. and Maliga, P. (1993) High-frequency plastid transformation in tobacco by 30 selection for a chimeric aadA gene. Proc. Natl. Acad. Sci. USA, 90, 913-917. 6. Maliga, P. (2021) Engineering the plastid and mitochondrial genomes of flowering plants. Nat Plants, 8, 996-1006. 7. Bock, R. (2015) Engineering Plastid Genomes: Methods, Tools, and Applications in Basic Research and Biotechnology. Annu. Rev. Plant. Biol., 66, 211-241. 35 8. Kazama, T., Okuno, M., Watari, Y., Yanase, S., Koizuka, C., Tsuruta, Y., Sugaya, H., Toyoda, A., Itoh, T., Tsutsumi, N. et al. (2019) Curing cytoplasmic male sterility via TALEN- mediated mitochondrial genome editing. Nat Plants, 5, 722-730. 9. Arimura, S.-i. and Nakazato, I. (2023) Genome Editing of Plant Mitochondrial and Chloroplast Genomes. Plant Cell Physiol. 45
10. Kang, B.C., Bae, S.J., Lee, S., Lee, J.S., Kim, A., Lee, H., Baek, G., Seo, H., Kim, J. and Kim, J.S. (2021) Chloroplast and mitochondrial DNA editing in plants. Nat Plants, 7, 899-905. 11. Maliga, P., Tungsuchat-Huang, T. and Lutz, K.A. (2021) Transformation of the Plastid Genome in Tobacco: The Model System for Chloroplast Genome Engineering. Methods Mol 5 Biol, 2317, 135-153. 12. Zhang, Y., Ananyev, G., Matsuoka, A., Dismukes, G.C. and Maliga, P. (2023) Cyanobacterial photosystem II reaction center design in tobacco chloroplasts increases biomass in low light. Plant Physiol., 191, 2229-2244. 13. Oettmeier, W. (1999) Herbicide resistance and supersensitivity in photosystem II. Cell 10 Mol Life Sci, 55, 1255-1277. 14. Anzalone, A.V., Randolph, P.B., Davis, J.R., Sousa, A.A., Koblan, L.W., Levy, J.M., Chen, P.J., Wilson, C., Newby, G.A., Raguram, A. et al. (2019) Search-and-replace genome editing without double-strand breaks or donor DNA. Nature, 576, 149-157. 15. Staub, J.M. and Maliga, P. (1994) Extrachromosomal elements in tobacco plastids. Proc. 15 Natl. Acad. Sci. USA, 91, 7468-7472. 16. Staub, J.M. and Maliga, P. (1995) Marker rescue from the Nicotiana tabacum plastid genome using a plastid Escherichia coli shuttle vector. Mol. Gen. Genet., 249, 37-42. 17. Liu, W.S., Zhu, X.H., Lei, M.G., Xia, Q.Y., Botella, J.R., Zhu, J.K. and Mao, Y.F. (2015) A detailed procedure for CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana. Sci Bull, 20 60, 1332-1347. 18. Feng, Z., Mao, Y., Xu, N., Zhang, B., Wei, P., Yang, D.L., Wang, Z., Zhang, Z., Zheng, R., Yang, L. et al. (2014) Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc. Natl. Acad. Sci. USA, 111, 4632-4637. 25 19. Timmermans, M.C.P., Maliga, P., Vieira, J. and Messing, J.C. (1990) The pFF Plasmids - Cassettes Utilizing CaMV Sequences for Expression of Foreign Genes in Plants. J Biotechnol, 14, 333-344. 20. Hajdukiewicz, P., Svab, Z. and Maliga, P. (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol., 25, 989-994. 30 21. Son, S. and Park, S.R. (2022) Challenges Facing CRISPR/Cas9-Based Genome Editing in Plants. Front Plant Sci, 13. 22. Canino, G., Bocian, E., Barbezier, N., Echeverria, M., Forner, J., Binder, S. and Marchfelder, A. (2009) Arabidopsis encodes four tRNase Z enzymes. Plant Physiol., 150, 1494- 1502. 35 23. Gao, Y.B. and Zhao, Y.D. (2014) Self- processing of ribozyme- flanked RNAs into guide RNAs in vitro and in vivo for CRISPR- mediated genome editing. Journal of Integrative Plant Biology, 56, 343-349. 24. Shiina, T., Allison, L. and Maliga, P. (1998) rbcL transcript levels in tobacco plastids are independent of light: reduced dark transcription rate is compensated by increased mRNA 40 stability. Plant Cell, 10, 1713-1722. 25. Liere, K. and Maliga, P. (1999) In vitro characterization of the tobacco rpoB promoter reveals a core sequence motif conserved between phage-type plastid and plant mitochondrial promoters. EMBO J., 18, 249-257. 26. Lamanna, L., Chou, C.H., Lei, H.Q., Barton, E.R. and Maliga, P. (2023) Chloroplast 45 transformation for bioencapsulation and oral delivery using the immunoglobulin G fragment crystallizable (Fc) domain. Sci Rep-Uk, 13. 46
27. Kruszka, K., Barneche, F., Guyot, R., Ailhas, J., Meneau, I., Schiffer, S., Marchfelder, A. and Echeverria, M. (2003) Plant dicistronic tRNA-snoRNA genes: a new mode of expression of the small nucleolar RNAs processed by RNase Z. EMBO J., 22, 621-632. 28. Barbezier, N., Canino, G., Rodor, J., Jobet, E., Saez-Vasquez, J., Marchfelder, A. and 5 Echeverria, M. (2009) Processing of a dicistronic tRNA-snoRNA precursor: combined analysis in vitro and in vivo reveals alternate pathways and coupling to assembly of snoRNP. Plant Physiol., 150, 1598-1610. 29. Xie, K., Minkenberg, B. and Yang, Y. (2015) Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc. Natl. Acad. Sci. USA, 112, 3570- 10 3575. 30. Xie, K. and Yang, Y. (2019) A Multiplexed CRISPR/Cas9 Editing System Based on the Endogenous tRNA Processing. Methods Mol Biol, 1917, 63-73. 31. Samuels, M., Fire, A. and Sharp, P.A. (1984) Dinucleotide Priming of Transcription Mediated by Rna Polymerase-Ii. Journal of Biological Chemistry, 259, 2517-2525. 15 32. Skalenko, K.S., Li, L.T., Zhang, Y.C., Vvedenskaya, I.O., Winkelman, J.T., Cope, A.L., Taylor, D.M., Shah, P., Ebright, R.H., Kinney, J.B. et al. (2021) Promoter-sequence determinants and structural basis of primer-dependent transcription initiation in. Proc. Natl. Acad. Sci. USA, 118. 33. Zhang, Y.X., Ren, Q.R., Tang, X., Liu, S.S., Malzahn, A.A., Zhou, J.P., Wang, J.H., Yin, 20 D.S., Pan, C.T., Yuan, M.Z. et al. (2021) Expanding the scope of plant genome engineering with Cas12a orthologs and highly multiplexable editing systems. Nat Commun, 12. 34. Tang, X., Lowder, L.G., Zhang, T., Malzahn, A.A., Zheng, X.L., Voytas, D.F., Zhong, Z.H., Chen, Y.Y., Ren, Q.R., Li, Q. et al. (2017) A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants (vol 3, 17018, 2017). Nat Plants, 3. 25 35. Kwon, T., Huq, E. and Herrin, D.L. (2010) Microhomology-mediated and nonhomologous repair of a double-strand break in the chloroplast genome of Arabidopsis. Proc. Natl. Acad. Sci. USA, 107, 13954-13959. 36. Suorsa, M., Sirpiö, S. and Aro, E.M. (2009) Towards Characterization of the Chloroplast NAD(P)H Dehydrogenase Complex. Molecular Plant, 2, 1127-1140. 30 37. Burrows, P.A., Sazanov, L.A., Svab, Z., Maliga, P. and Nixon, P.J. (1998) Identification of a functional respiratory complex in chloroplasts through analysis of tobacco mutants containing disrupted plastid ndh genes. EMBO J., 17, 868-876. 38. Shikanai, T., Endo, T., Hashimoto, T., Yamada, Y., Asada, K. and Yokota, A. (1998) Directed disruption of the tobacco ndhB gene impairs cyclic electron flow around photosystem I. 35 Proc. Natl. Acad. Sci. USA, 95, 9705-9709. 39. Horvath, E.M., Peter, S.O., Joët, T., Rumeau, D., Cournac, L., Horvath, G.V., Kavanagh, T.A., Schäfer, C., Peltier, G. and Medgyesy, P. (2000) Target inactivation of the plastid ndhB gene in tobacco results in an enhanced sensitivity of photosynthesis to moderate stomatal closure. Plant Physiol., 123, 1337-1350. 40 40. Xie, Z.Y. and Merchant, S. (1996) The plastid-encoded ccsA gene is required for heme attachment to chloroplast c-type cytochromes. Journal of Biological Chemistry, 271, 4632-4639. 41. Fleischmann, T.T., Scharff, L.B., Alkatib, S., Hasdorf, S., Schöttler, M.A. and Bock, R. (2011) Nonessential Plastid-Encoded Ribosomal Proteins in Tobacco: A Developmental Role for Plastid Translation and Implications for Reductive Genome Evolution. Plant Cell, 23, 3137- 45 3155. 47
42. Kikuchi, S., Bédard, J., Hirano, M., Hirabayashi, Y., Oishi, M., Imai, M., Takase, M., Ide, T. and Nakai, M. (2013) Uncovering the Protein Translocon at the Chloroplast Inner Envelope Membrane. Science, 339, 571-574. 43. Kode, V., Mudd, E., Iamtham, S. and Day, A. (2005) The tobacco accD gene is essential 5 and is required for leaf development. Plant J., 44, 237-244. 44. Shikanai, T., Shimizu, K., Ueda, K., Nishimura, Y., Kuroiwa, T. and Hashimoto, T. (2001) The chloroplast gene, encoding a proteolytic subunit of ATP-dependent protease, is indispensable for chloroplast development in tobacco. Plant Cell Physiol, 42, 264-273. 10 45. Hu, J. and Bogorad, L. (1990) Maize chloroplast RNA polymerase: the 180-, 120-, and 38-kilodalton polypeptides are encoded in chloroplast genes. Proc. Natl. Acad. Sci. USA, 87, 1531-1535. 46. Toyoshima, Y., Onda, Y., Shiina, T. and Nakahira, Y. (2005) Plastid transcription in higher plants. Critical Reviews in Plant Sciences, 24, 59-81. 15 47. Allison, L.A., Simon, L.D. and Maliga, P. (1996) Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants. EMBO J., 15, 2802-2809. 48. Serino, G. and Maliga, P. (1998) RNA polymerase subunits encoded by the plastid rpo genes are not shared with the nucleus-encoded plastid enzyme. Plant Physiol., 117, 1165-1170. 49. Hajdukiewicz, P.T.J., Allison, L.A. and Maliga, P. (1997) The two RNA polymerases 20 encoded by the nuclear and the plastid compartments transcribe distinct groups of genes in tobacco plastids. EMBO J., 16, 4041-4048. 50. Tong, Y.J., Jorgensen, T.S., Whitford, C.M., Weber, T. and Lee, S.Y. (2021) A versatile genetic engineering toolkit for E. coli based on CRISPR-prime editing. Nat Commun, 12. 51. Sigematsu, Y., Sato, F. and Yamada, Y. (1989) The Mechanism of Herbicide Resistance in 25 Tobacco Cells with a New Mutation in the Qb Protein. Plant Physiol., 89, 986-992. 52. Pay, A., Smith, M.A., Nagy, F. and Marton, L. (1988) Sequence of the Psba Gene from Wild-Type and Triazin-Resistant Nicotiana-Plumbaginifolia. Nucleic Acids Res., 16, 8176-8176. 53. Cséplö, A., Medgyesy, P., Hideg, E., Demeter, S., Marton, L. and Maliga, P. (1985) Triazine-resistant Nicotiana mutants from photomixotrophic cell cultures. Mol. Gen. Genet., 200, 30 508-510. 54. Anzalone, A.V., Koblan, L.W. and Liu, D.R. (2020) Genome editing with CRISPR-Cas nucleases, base editors, transposases and prime editors. Nat. Biotechnol., 38, 824-844. 55. Galili S, Fromm H, Aviv D, Edelman M, Galun E (1989) Ribosomal protein S12 as a site for streptomycin resistance in Nicotiana chloroplasts. Mol Gen Genet 218 (2):289-292 35 56. Lin QP, Zong Y, Xue CX, Wang SX, Jin S, Zhu ZX, Wang YP, Anzalone AV, Raguram A, Doman JL, Liu DVR, Gao CX (2020) Prime genome editing in rice and wheat. Nat Biotechnol 38 (5):582-+. doi:10.1038/s41587-020-0455-x 57. Lutz KA, Svab Z, Maliga P (2006) Construction of marker-free transplastomic tobacco using the Cre-loxP site-specific recombination system. Nat Protocols 1:900-910. 40 doi:10.1038/nprot.2006.118 58. Staub JM, Maliga P (1992) Long regions of homologous DNA are incorporated into the tobacco plastid genome by transformation. Plant Cell 4 (1):39-45 59. Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ (2015) Egg cell- specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for 45 multiple target genes in Arabidopsis in a single generation. Genome Biol 16:144. doi:10.1186/s13059-015-0715-0 48
60. Whitney SM, Sharwood RE, Orr D, White SJ, Alonso H, Galmes J (2011) Isoleucine 309 acts as a C4 catalytic switch that increases ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) carboxylation rate in Flaveria. Proc Natl Acad Sci USA 108 (35):14688-14693. doi:10.1073/pnas.1109503108 5 61. Yamori W, Nakazato I, Yuchen Q, Sanga Y, Miyata T, Uehara R, Noto Y, Namba K, Fukayama H, Matsumura H, Arimura S-i (2025) Chloroplast genome editing of Rubisco boosts photosynthesis and plant growth. bioRxiv:2025.2001.2002.631008. doi:10.1101/2025.01.02.631008 62. Baek, E., Park, M., Yoon, J.-Y. and Palukaitis, P. (2017) Chrysanthemum chlorotic mottle 10 viroid-mediated trafficking of foreign mRNA into chloroplasts. Research in Plant Disease, 23, 288-293. 63. Berrissou, C., Cognat, V., Koechler, S., Bergdoll, M., Duchene, A. M. and Drouard, L. (2024) Extensive import of nucleus-encoded tRNAs into chloroplasts of the photosynthetic lycophyte, Selaginella kraussiana. Proc. Natl. Acad. Sci. USA, 121, e2412221121. 15 64. Daròs, J. A. (2016): a friendly experimental system in the family. Mol Plant Pathol, 17, 1170-1177. 65. Giguère, T., Adkar-Purushothama, C. R., Bolduc, F. and Perreault, J. P. (2014) Elucidation of the structures of all members of the family. Mol Plant Pathol, 15, 767-779. 66. Gómez, G. and Pallas, V. (2012) Studies on Subcellular Compartmentalization of Plant 20 Pathogenic Noncoding RNAs Give New Insights into the Intracellular RNA-Traffic Mechanisms. Plant Physiol., 159, 558-+. 67. Gómez, G. and Pallás, V. (2010) Noncoding RNA Mediated Traffic of Foreign mRNA into Chloroplasts Reveals a Novel Signaling Mechanism in Plants. Plos One, 5. 68. Gómez, G. and Pallás, V. (2012) A pathogenic non coding RNA that replicates and 25 accumulates in chloroplasts traffics to this organelle through a nuclear-dependent step. Plant Signaling & Behavior, 7, 882-884. 69. Navarro, B., Flores, R. and Di Serio, F. (2021) Advances in Viroid-Host Interactions. Annual Review of Virology, Vol 8, 8, 305-325. 70. Nicolai, M., Duprat, A., Sormani, R., Rodriguez, C., Roncato, M. A., Rolland, N., et al. 30 (2007) Higher plant chloroplasts import the mRNA coding for the eucaryotic translation initiation factor 4E. FEBS letters, 581, 3921-3926. 71. Nohales, M. A., Molina-Serrano, D., Flores, R. and Daròs, J. A. (2012) Involvement of the Chloroplastic Isoform of tRNA Ligase in the Replication of Viroids Belonging to the Family. J Virol, 86, 8269-8276. 35 72. Palukaitis, P. (2014) What has been happening with viroids? Virus Genes, 49, 175-184. 73. Val, R., Wyszko, E., Valentin, C., Szymanski, M., Cosset, A., Alioua, M., et al. (2011) Organelle trafficking of chimeric ribozymes and genetic manipulation of mitochondria. Nucleic Acids Res., 39, 9262-9274. 40 While certain features of the invention have been described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention. 49
Claims
WHAT IS CLAIMED IS: 1. A system for introducing mutations into targeted sites in a plant plastid genome, comprising; a) a nucleic acid construct encoding a prime editor guide RNA (pegRNA) harboring a primer binding site, a reverse transcriptase template, a spacer sequence and scaffold operably 5 linked to a nucleic acid encoding a selectable marker and plastid targeting sequences for introduction into the plastid genome of said plant, said spacer sequences in said pegRNA directing a prime editor complex to the DNA harboring said targeted site in said plastid genome, and said reverse transcriptase template facilitating nick repair; b) a nucleic acid construct encoding a prime editor (PE) comprising a Cas9 nickase variant 10 operably linked to an engineered polymerase, and a plastid transit peptide (TP), into the nucleus of said plant; wherein said TP-PE is translated on cytoplasmic ribosomes and imported to the plastid, said PE forming a complex with said pegRNA and binding said targeted site and nicking said DNA, followed by gap repair mediated by said engineered polymerase, wherein said repair introduces said mutation at said targeted site. 15
2. The system of claim 1, for introducing an insertion or a deletion into said plastid DNA.
3. The system of claim 1, wherein said nucleic acid construct of step a) encodes a dicistronic transcript of pegRNA which initiates from a plastid promoter, selected from a rbcL promoter, an rRNA operon promoter, said transcript having a 5’ and 3’ end, wherein said 3’ end is generated by upstream processing of a tRNA. 20
4. The system of claim 1, wherein said nucleic acid construct of step a) is present in a shuttle vector.
5. The system of claim 1, wherein said the construct of step a) comprises at least one riboswitch sequence.
6. The system of claim 4, wherein said pegRNA is encoded by SEQ ID NOS: 33 to 44. 25
7. The system of claim 1, wherein said pegRNA is expressed from a minigene construct shown in Figure 12.
8. The system of any one of claims 1 to 7, wherein said mutation increases photosynthesis in said plant. 50
9. The system of any one of claims 1 to 6, wherein said Cas9 is a variant nickase.
10. The system of any one of claims 1 to 6, wherein said mutation confers resistance to commercial herbicides.
11. The system of claim 1, wherein said mutation confers abiotic resistance. 5
12. The system of claim 1, wherein a transplastomic maternal parent plant harboring pegRNA and a nucleic acid of interest comprising said target site in plant chloroplasts is crossed with a pollen parent having high editing efficiency harboring PE operably linked to an egg-cell specific promoter, and progeny plants comprising edited target sites are identified.
13. The system of claim 1 or 12, wherein said nucleic acid of interest is a selectable marker 10 gene, which when edited, provides a selectable phenotype for selection of edited progeny plants.
14. The system of claim 1 or 12, wherein said editing of said nucleic acid of interest provides a growth advantage to said progeny plant. 15. The system of claim 1 or 12, wherein said editing of said nucleic acid of interest provides a growth disadvantage to said progeny plant.
15
16. The system of claim 1, wherein said pegRNA is delivered to the chloroplasts operably linked to a viroid.
17. The system of claim 1, wherein said ELVd viroid leader is operably linked to pegRNA.
18. A plant transformed with the system of any one of claims 1 to 17.
19. The plant of claim 18, selected from corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, 20 B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana 25 tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus 51
spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum 5 spp.), oats, barley, vegetables, ornamentals, tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips 10 (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum. Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pin us radiata); Douglas-fir (Pseudotsuga menziesii); 15 Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis).
20. A method for introducing base changes into targeted sites in a nucleic acid of interest in a 20 plant plastid genome, comprising; a) a nucleic acid construct encoding a prime editor guide RNA (pegRNA) harboring one primer binding site, a reverse transcriptase template, a spacer sequence and scaffold operably linked to a nucleic acid encoding a selectable marker and plastid targeting sequences for introduction into the plastid genome of said plant, said spacer sequences in said pegRNA directing a prime editor 25 complex to the DNA harboring said targeted site in said plastid genome, and said reverse transcriptase template facilitating nick repair; b) introducing a nucleic acid construct encoding a prime editor (PE) comprising Cas9 or a nickase variant thereof, operably linked to an engineered polymerase, and a plastid transit peptide (TP), into the nucleus of said plant; wherein said TP-PE is translated on cytoplasmic 30 ribosomes and imported to the plastid, said PE forming a complex with said pegRNA and 52
binding said targeted site in said nucleic acid of interest and nicking said nucleic acid of interest, followed by gap repair mediated by said engineered polymerase, wherein said repair introduces said mutation at said targeted site.
21. The method of claim 20, wherein said PE introduces an insertion or a deletion into said 5 plastid DNA.
22. The method of claim 20, wherein said pegRNA is expressed from a minigene construct shown in Figure 12.
23. The method of claim 20, wherein said mutation increases photosynthesis in said plant.
24. The method of claim 20, wherein said Cas9 is a variant nickase. The system of any one of 10 claims 1 to 6, wherein said mutation confers resistance to commercial herbicides.
25. The method of claim 20, wherein said mutation confers abiotic resistance.
26. The method of claim 20, wherein a transplastomic maternal parent plant harboring pegRNA and a nucleic acid of interest comprising said target site in plant chloroplasts is crossed with a pollen parent having high editing efficiency harboring PE operably linked to an egg-cell specific 15 promoter, and progeny plants comprising edited target sites are identified.
27. The method of claim 20, wherein said nucleic acid of interest is a selectable marker gene, which when edited, provides a selectable phenotype for selection of edited progeny plants.
28. The method of claim 20, wherein said editing of said nucleic acid of interest provides a growth advantage to said progeny plant. 20
29. The method of claim 20, wherein said editing of said nucleic acid of interest provides a growth disadvantage to said progeny plant.
30. The method of claim 20, wherein said pegRNA is delivered to the chloroplasts operably linked to a viroid.
31. The method of claim 20, wherein said ELVd viroid leader is operably linked to pegRNA. 25
32. A plant transformed obtained by the method of any one of claims 20 to 31. 53
33. A kit for practicing the method of claim 20. 5 54
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202463657752P | 2024-06-07 | 2024-06-07 | |
| US63/657,752 | 2024-06-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2025255572A1 true WO2025255572A1 (en) | 2025-12-11 |
Family
ID=97961349
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2025/032880 Pending WO2025255572A1 (en) | 2024-06-07 | 2025-06-09 | Compositions and methods for crispr/cas9 rna-guided editing of the chloroplast genome |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2025255572A1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018200653A1 (en) * | 2017-04-25 | 2018-11-01 | The Johns Hopkins University | A yeast two-hybrid rna protein interaction system based on catalytically inactivated crispr-dcas9 |
| US20190259469A1 (en) * | 2017-02-16 | 2019-08-22 | Kao Corporation | Method for Evaluating Genotoxicity of Substance |
| US20230049737A1 (en) * | 2019-12-30 | 2023-02-16 | The Broad Institute, Inc. | Genome editing using reverse transcriptase enabled and fully active crispr complexes |
-
2025
- 2025-06-09 WO PCT/US2025/032880 patent/WO2025255572A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190259469A1 (en) * | 2017-02-16 | 2019-08-22 | Kao Corporation | Method for Evaluating Genotoxicity of Substance |
| WO2018200653A1 (en) * | 2017-04-25 | 2018-11-01 | The Johns Hopkins University | A yeast two-hybrid rna protein interaction system based on catalytically inactivated crispr-dcas9 |
| US20230049737A1 (en) * | 2019-12-30 | 2023-02-16 | The Broad Institute, Inc. | Genome editing using reverse transcriptase enabled and fully active crispr complexes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11952578B2 (en) | Compositions and methods for site directed genomic modification | |
| US10308947B2 (en) | Methods and compositions for multiplex RNA guided genome editing and other RNA technologies | |
| AU2012354062B2 (en) | Compositions and methods for modifying a predetermined target nucleic acid sequence | |
| US11732251B2 (en) | Anti-CRISPR polynucleotides and polypeptides and methods of use | |
| Xing et al. | The use of the two T-DNA binary system to derive marker-free transgenic soybeans | |
| WO2018202199A1 (en) | Methods for isolating cells without the use of transgenic marker sequences | |
| KR20200078685A (en) | Method for obtaining glyphosate-resistant rice by site-directed nucleotide substitution | |
| WO2014039970A1 (en) | Fluorescence activated cell sorting (facs) enrichment to generate plants | |
| US20230159943A1 (en) | Crispr systems in plants | |
| US10793867B2 (en) | Methods for targeted transgene-integration using custom site-specific DNA recombinases | |
| CN117051035A (en) | Methods for isolating cells without using transgenic marker sequences | |
| US20230272408A1 (en) | Plastid transformation by complementation of plastid mutations | |
| CA3217328A1 (en) | Plant regulatory elements and uses thereof | |
| EP2875137B1 (en) | Method for performing homologous recombination | |
| Shao et al. | Small serine recombination systems ParA‐MRS and CinH‐RS 2 perform precise excision of plastid DNA | |
| EP3606332A1 (en) | Compositions and methods for transferring cytoplasmic or nuclear traits or components | |
| WO2025255572A1 (en) | Compositions and methods for crispr/cas9 rna-guided editing of the chloroplast genome | |
| CA3149635A1 (en) | Compositions and methods for chromosome rearrangement | |
| WO2025019375A2 (en) | Replicons for precise genome editing in plants | |
| WO2025062150A1 (en) | Methods of producing homoplasmic modified plants or parts thereof | |
| WO2025122424A1 (en) | Plant regulatory elements and uses thereof | |
| JP2023545403A (en) | Directed codon rewriting via CRISPR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 25820721 Country of ref document: EP Kind code of ref document: A1 |