WO2025245481A1 - Methods and materials for treating cardiac conditions - Google Patents
Methods and materials for treating cardiac conditionsInfo
- Publication number
- WO2025245481A1 WO2025245481A1 PCT/US2025/030830 US2025030830W WO2025245481A1 WO 2025245481 A1 WO2025245481 A1 WO 2025245481A1 US 2025030830 W US2025030830 W US 2025030830W WO 2025245481 A1 WO2025245481 A1 WO 2025245481A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- myh7
- myh6
- subject
- nucleic acid
- promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4716—Muscle proteins, e.g. myosin, actin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0657—Cardiomyocytes; Heart cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
- A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0375—Animal model for cardiovascular diseases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/45—Artificially induced pluripotent stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the present disclosure relates to methods and materials for treating cardiac conditions in a subject in need thereof.
- this document relates to modulating the antithetical expression of MYH6 and MYH7 in a subject (e.g., a mammal).
- Cardiac conditions such as heart failure is a common disorder worldwide with a high mortality and morbidity rate.
- Heart failure is a complex clinical syndrome that results from any structural or functional impairment of ventricular filing or ejection of blood.
- efficacy of many therapies for treating cardiac conditions such as heart failure their prevalence is increasing, especially in the aging population. Thus, novel interventions are needed to treat cardiac conditions.
- the present disclosure provides methods and materials for modulating the antithetical expression of MYH6 and MYH7 to treat cardiac conditions (e.g., heart failure or cardiomyopathy) in a subject (e.g., a human).
- cardiac conditions e.g., heart failure or cardiomyopathy
- compositions including at least one nucleic molecule that is complementary to anMYH6 promoter region. anMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), where the at least one nucleic acid molecule includes a nucleic acid sequence including any one of SEQ ID NOs: 1- 392.
- CRE cardiomyocyte-specific cis-regulatory element
- genetically modified cells including at least one genetic modification within an MYH gene operably linked to a cMYH Locus Control Region (LCR), where the at least one genetic modification increases MYH6 expression.
- the at least one genetic modification reduces MYH7 expression.
- the at least one genetic modification includes one or more nucleic acid molecules that bind to an MYH6 promoter region, an MY H7 promoter region, and/or a CRE.
- the one or more nucleic acid molecules include a nucleic acid sequence of any one of SEQ ID NOs: 1-392.
- the genetically modified cell is derived from a human pluripotent stem cell (hPSCs).
- the at least one genetic modification includes insertion, deletion, or mutation.
- the at least one or more genetic modification is introduced using a genetic modulation system selected from the group consisting of a CRISPR activating system, a CRISPR inactivating system, a CRISPR/Cas gene KO system, a CRISPR gene KI system, a Zinc Finger Protein (ZNF) system, a Transcription Activator-like Effector Nuclease (TALEN) system, RNA interference (RNAi), guide RNA (gRNA), antisense oligonucleotides (ASOs), micro RNA (miRNA), RNA Aptamer, short hairpin RNA (shRNA), and small interfering RNA (siRNA).
- the CRISPR activating system is a synergistic activation mediator (SAM) system.
- the vector is a viral vector or a non- viral vector.
- the viral vector includes a lentiviral vector, an adenoviral vector, an adeno-associated viral vector (AAV), a retroviral vector, or a herpes viral vector.
- the non-viral vector includes a nanoparticle, a liposome, a polymer, an exosome, a peptide, an extracellular vesicle, a lipid nanoparticle (LNP), or a dendrimer.
- the vector includes a constitutive promoter, an inducible promoter, or a tissue-specific promoter.
- compositions including a composition described herein and pharmaceutically acceptable carrier. Also provided herein are pharmaceutical compositions including the genetically modified cell described herein and pharmaceutically acceptable carrier. Also provided herein are pharmaceutical compositions including the vector of described herein and pharmaceutically acceptable carrier.
- this document provides methods of gene editing, the method including introducing the composition described herein and the genetic modulation system of described herein into a cell. Also provided herein are methods for increasing MYH6 expression in a subject, the method including administering to the subject a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator. Also provided herein are methods for treating a cardiac condition in a subj ect, the method including administering to the subj ect a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby treating the cardiac condition in the subject.
- Also provided herein are methods for improving cardiac contractility in a subject the method including administering to the subject a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator, thereby improving cardiac contractility in the subject.
- methods for modulating a ratio of cardiac MYH6 and MYH7 in a subject the method including administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby modulating the ratio of cardiac MYH6 and MYH7 in the subject.
- Also provided herein are methods of ameliorating at least one symptom of heart failure in a subject the method including administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby ameliorating at least one symptom of heart failure in the subject.
- methods of reducing the risk of developing a cardiac condition in a subject the method including administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby reducing the risk of developing a cardiac condition in the subject.
- the MYH7 inhibitor includes an inhibitory nucleic acid molecule, a CRISPR-based system, a Zinc Finger protein (ZNF), a Transcription Activator-like Effector Nuclease (TALEN), or a small molecule inhibitor.
- ZNF Zinc Finger protein
- TALEN Transcription Activator-like Effector Nuclease
- the inhibitory nucleic acid molecule includes at least one antisense nucleic acid molecule that targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hgl9).
- the inhibitory nucleic acid molecule is an RNA molecule or a DNA molecule.
- the inhibitory nucleic acid molecule includes a gRNA, an siRNA, an shRNA, a miRNA, an ASO, an antagomir, a ribozyme, a long noncoding RNA (IncRNA), a locked nucleic acid (LNA), a synthetic RNA molecule, a synthetic DNA molecule, a DNAzyme, or a triple-forming oligonucleotide (TFO).
- the inhibitory nucleic acid molecule targets an MYH6 promoter region, wMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element.
- the inhibitory nucleic acid molecule includes about 5 nucleotides to about 50 nucleotides. In some embodiments, the inhibitory nucleic acid molecule includes about 20 nucleotides. In some embodiments, the inhibitory nucleic acid molecule includes a nucleic acid sequence set forth in any one of SEQ ID NOs: 1- 392. In some embodiments, the inhibitor c MYH7 expression includes the pharmaceutical composition described herein.
- this document provides pharmaceutical compositions including the inhibitor oiMYH7 expression described herein and a pharmaceutically acceptable carrier.
- MYH6 activator includes a small molecule agent, a CRISPR-based system, a transcriptional activator, an mRNA-based therapeutic, or a therapeutic polypeptide.
- the cardiac condition is cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure.
- the cis-regulatory element is CRE1, CRE2. and/or CRE3.
- methods described herein further includes administering to the subject one or more additional therapeutic agents for treating the cardiac condition.
- the one or more additional therapeutic agents include an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin-2 receptor blocker (ARB), an ARB and neprilysin inhibitor, a beta blocker, a digoxin, a diuretic, a hydralazine and isosorbide dinitrate, an 1(f) channel inhibitor, a mineralocorticoid receptor antagonist (MRA), and/or a sodium-glucose cotransporter 2 (SGLT 2) inhibitor.
- ACE angiotensin-converting enzyme
- ARB angiotensin-2 receptor blocker
- ARB ARB
- neprilysin inhibitor neprilysin inhibitor
- beta blocker neprilysin inhibitor
- digoxin a digoxin
- diuretic a diuretic
- a hydralazine and isosorbide dinitrate an 1(f) channel inhibitor
- MRA mineralocorticoid receptor antagonist
- the ACE inhibitor includes captopril, enalapril, fosinopril, lisinopril, perindopril, quinapril, ramipril, or trandolapril.
- the ARB includes candesartan, losartan, telmisartan. or valsartan.
- the ARB and neprilysin inhibitor includes sacubitril-valsartan.
- the beta blocker includes bisoprolol, carvedilol, metoprolol succinate, or nebivolol.
- the diuretic includes bumetanide, chlorothiazide, hydrochlorothiazide, indapamide, furosemide, metolazone, or torsemide.
- the 1(f) channel inhibitor includes ivabradine.
- the MRA includes eplerenone or spironolactone.
- the SGLT 2 inhibitor includes dapagliflozin or empagliflozin.
- the administering includes oral administration, intravenous administration, intradermal administration, subcutaneous administration, intramuscular administration, or transdermal administration.
- the subject is a mammal.
- FIGs. 1A-1G MYH6 and MYH7 were located in a topologically associating domain (TAD) that contained dynamically interacting cis-regulatory elements (CREs) which regulated antithetical MYH6 and MYH7 expression.
- FIG. 1A Single-nuclei RNA (snRNA-seq) and ATAC-sequencing (snATAC-seq) datasets from the atrial and ventricular cardiac chambers of adult human hearts revealed antithetical expression and regulation o MYH6 and MYH7 specifically in atrial (A-CM) and ventricular (V- CM) cardiomyocytes.
- IB An in situ Hi-C assay showed a unique TAD on chromosome 14 containing MYH6 and MY H 7 (triangle).
- CTCF ChlP-seq at CM stage showed that this TAD was delineated by two CTCF binding sites. The arrows underneath the CTCF peaks indicate forward and reverse CTCF motifs.
- ATAC-seq and ChlP-seq across six key stages of human pluripotent stem cell (hPSC) cardiomyocyte differentiation revealed the dynamic transcriptomic profiles and epigenomic landscape of the MYH6/MYH7 locus. The six stages included pluripotent stem cells (PSC).
- PSC pluripotent stem cells
- FIG. 1C Bar graph shows MYH6, MY HR MYL2 and TNNT2 gene expression in CPs, CMs and vCMs.
- FIG. ID The percentage of each MYH isoform (MYH6. MYH7) versus the total amount of cardiac MYH isoform was determined for CPs, CMs and vCMs. Total cardiac MYH includes MYH6 and MYH7 in cardiomyocytes.
- FIG. IF Heatmap ofHi- C a.MYH6M' YH7 locus viewed from CRE1 and CRE2 enhancers (“eye” symbol) revealed dynamic interactions between MYH6 and MYH7 promoters and enhancers across the stages of cardiomyocyte differentiation.
- FIG. IF 4C-seq experiments showed the interactions between ⁇ e MYH6 promoter and CRE1, CRE2 enhancers in CMs and vCMs as viewed from the MYH6 promoter (“eye” symbol).
- FIG. 1G Schematic showing a model of how CRE1 and CRE2 enhancers may together interact with the MYH6 promoter at the CP and CM stage to enhance MYH6 expression, and with the MYH7 promoter at the vCM stage to promote MYH7 expression.
- A-CM atrial cardiomyocyte in FIG. 1A
- V-CM ventricular cardiomyocyte in FIG. 1A
- SMC smooth muscle cell in FIG. 1A
- CRE c/.s-regulatory element
- TAD topologically associated domain
- LCR locus control region.
- FIGs. 2A-2G MYH6/MYH7 CRE1 and CRE2 super-enhancer functioned as a cardiac MYH (cMYH) LCR that can control the expression of coding and non-coding RNAs in the TAD-defined MYH6/MYH7 locus.
- FIG. 2A Schematic outlines the double knockout (DKO) strategy for deleting both CRE1 and CRE2 enhancers in hPSCs.
- FIG. 2B qPCR analysis revealed MYH 6. MYH7 and TNNT2 RNA expression levels in wild-type (WT) and CRE1/CRE2 DKO hPSC-CPs, CMs and vCMs.
- FIG. 2C Western blot showed MYH6 and MYH7 protein levels in WT and CRE1/CRE2 DKO hPSC-CPs, CMs and vCMs. -actin was used as a loading control.
- FIG. 2D RNA-seq and ATAC-seq analyses revealed the transcriptomic and chromatin accessibility' differences between WT and CRE1/CRE2 DKO hPSC-CMs at the MYH6/MYH 7 locus and adjacent genomic regions.
- FIG. 2C Western blot showed MYH6 and MYH7 protein levels in WT and CRE1/CRE2 DKO hPSC-CPs, CMs and vCMs. -actin was used as a loading control.
- FIG. 2D RNA-seq and ATAC-seq analyses revealed the transcriptomic and chromatin accessibility' differences between WT and CRE1/CRE2 DKO hPSC-CMs at the MYH6/MYH
- FIG. 2F Volcano plot shows differentially accessible regions from ATAC-seq studies between WT and CRE1/CRE2 DKO hPSC-CMs (adj. p-value ⁇ 0.05 and absolute log2 fold change > 1). Chromatin accessible regions residing in the MYH6/MYH7 locus exhibited reduced chromatin accessibility in CRE1/CRE2 DKO hPSC-CMs.
- FIG. 2G 4C-seq studies showed that the interactions between the MYH6 promoter and CRE1, CRE2 enhancers in WT hPSC-CMs were lost in CRE1/CRE2 DKO hPSC-CMs. 4C-seq studies were viewed from the MYH6 promoter (“eye” symbol).
- MYH7p MYH7 promoter in FIG. 2F.
- Norm. Gene Expr. normalized gene expression. *P ⁇ 0.05, **P ⁇ 0.01; ***P ⁇ 0.001; ****P ⁇ 0.0001; ns, not significant by two-tailed Student’s t-test.
- FIGs. 3A-3H MYH6 and MYH7 promoter competitively interacted with the cMYH LCR to antithetically regulate MYH6 and MYH7 expression.
- FIGs. 3A and 3B Schematic shows MYH6 promoter (MYH6p) (FIG. 3A) and MYH7 promoter (MYH7p) (FIG. 3B) knockout (KO) strategy.
- FIGs. 3C and 3D MYH6 and MYH7 gene expression was measured by qPCR in wild-type (WT) versus MYH6p KO hPSC-CPs, CMs (FIG.
- FIG. 3C Western blot showing MYH6 and MYH7 protein expression in WT versus MYH6p KO hPSC-CMs (FIG. 3E) and WT versus MYH7p KO hPSC-vCMs (FIG. 3F). P-actin was used as a loading control.
- FIG. 3G Schematic outlining the MYH7 promoter CRISPR-based activation strategy.
- qPCR shows the MYH6 and MYH7 gene expression levels in hPSC-CMs after activating the MYH7 promoter using a CRISPR- based activation system.
- FIG. 3H Schematic outlining the MYH7 promoter CRISPR- based interference strategy.
- qPCR shows the MYH6 wAMYH7 gene expression levels in hPSC-vCMs after inhibiting the MYH7 promoter using a CRISPR-based inhibition system.
- Two gRNAs targeting different region of the MYH7 promoter were used for CRISPR activation and inhibition studies (sgMYH7-a/i-l and 2), respectively.
- a nontargeting control sgRNA (sgNC) was used as a negative control for comparison.
- FIGs. 4A-4G Interrogating genomic regions of the MYH7 promoter revealed key sequences directing gene regulation between MYH6 andMYH7.
- FIG. 4A Schematic illustrating how the dual luciferase MYH6 and MYH7 reporter construct (bottom diagram) was generated based on the endogenous MYH6/MYH7 locus (top diagram).
- FIG. 4B Luciferase reporter constructs generated and used for luciferase reporter assays are outlined.
- NCI was a negative control construct which contained a ⁇ 1.2 kb deletion (-772 to +386) of the MYH7 promoter.
- FIG. 4C Schematic showing luciferase reporter constructs containing a series of 40 bp deletions (Al -10), which were used to identify regions of promoter regulator ' activity' in the 400 bp MYH7 promoter region (- 286 to +114).
- NC2 was a negative control construct which contained a 400 bp MYH7 (-286 to +114) deletion.
- FIG. 4D The annotated MYH7 promoter sequence from -286 to +114 contained two TEAD1 binding sites, a TATA box and TSS/Exonl as labeled.
- FIG. 4E A5 (-133 to -88) MYH7 promoter KO hPSC line was generated by deleting -133 to -88 MYH7 promoter sequences and confirmed by Sanger sequencing. Two gRNAs (gRNAl and gRNA2) as shown in FIG. 4D were used to target this region for deletion (region flanked by two arrows). Sequence regions labeled ‘"a” and “b” in FIG. 4D flank the deleted region.
- FIG. 4E A5 (-133 to -88) MYH7 promoter KO hPSC line was generated by deleting -133 to -88 MYH7 promoter sequences and confirmed by Sanger sequencing. Two gRNAs (gRNAl and gRNA2) as shown in FIG. 4D were used to target this region for deletion (region
- FIG. 4F MYH6 and MYH7 expression was measured by qPCR in WT and A5 (-133 to -88) MYH7 promoter KO hPSC-CMs and vCMs. Three independent clonal lines (KO 1-3) were analyzed.
- FIG. 4G The percentage of each MYH isoform (MYH6, MYH7) versus the total amount of MYH isoform was determined in WT and A5 (-133 to -88) MYH7 promoter KO hPSC-CMs and vCMs. The arrow indicates the transcription start site (TSS) in FIGs. 4B and 4C. LCR, locus control region; MYH6p. MYH6 promoter; MYH7p.
- FIGs. 5A-5E MYH7 promoter A5 region contained evolutionary divergent DNA sequences that are crucial for controlling the antithetical expression of human MYH6 W MYH7.
- FIG. 5A Alignment of syntenic genomic sequences revealed regions of conservation of the MYH7 promoter region across several mammalian species (green regions). Within the A5 MYH7 promoter region (-126 to -87), which displayed promoter activity, there were sequences that specifically diverged between rodent species and most other mammals, particularly a ⁇ 10 bp region (-126 to -117) (outlined with box).
- FIG. 5C shows reporter deletion constructs used to analyze the activity of the A5 MYH7 promoter region.
- FIG. 5C -133 to -117 MYH7 promoter sequences were deleted using CRISPR/Cas9 to generate a hPSC KO line that included deletion of the A5. 1 sequences, which was confirmed by Sanger sequencing.
- FIG. 5D MYH6 and MYH7 expression was analyzed by qPCR in wild-type (WT) and A5.1 (-133 to -117) MYH7 promoter KO hPSC-CMs and vCMs. Three independent KO clonal lines (KOI -3) were analyzed.
- FIG. 5C -133 to -117 MYH7 promoter sequences were deleted using CRISPR/Cas9 to generate a hPSC KO line that included deletion of the A5. 1 sequences, which was confirmed by Sanger sequencing.
- FIG. 5D MYH6 and MYH7 expression was analyzed by qPCR
- FIGs. 6A-6G Evolutionary divergent DNA sequences in the A5 MYH7 promoter region regulated the opposing MYH6 and MY H7 expression differences in the ventricles between rodent and other mammalian species.
- FIG. 6A Comparing the A5 MYH7 promoter regions across different mammals uncovered divergent promoter sequences between rodent and non-rodent mammalian species. Left panel shows the phylogenetic tree constructed using MYH7 promoter genomic sequences. Right panel shows the sequences of A5 MYH7 promoter region (indicated by a line above) in selected mammals. Shown are the nucleotides sequences that differ between some mammalian species.
- FIG. 6B qPCR analyses showed the expression levels o MYH6 and MYH 7 in both the atria and ventricles across several mammalian species (n > 3).
- FIG. 6C Analyzing the percentage &YMYH6 and MYH7 versus the total amount of both MYH isoforms in these hearts revealed that the ventricles of rodent-related species predominantly expressed MYH6 whereas those from non-rodent mammals mainly expressed MYH7 however, MYH6 was expressed primarily in the atria across all analyzed mammals.
- FIG. 6D The syntenic sequences of the mouse A5.
- FIG. 6E qPCR revealed that in contrast to wild-type (WT) control hPSC-vCMs.
- WT wild-type
- FIG. 6F The percentage of each MYH isoform (MYH6, MYH7) versus the total amount of MYH isoform was determined in WT versus A5.1 M-to-H MYH7 promoter KI hPSC-vCMs.
- FIG. 6G Schematic models showing how the cMYH CR competitively interacts with MYH6 and MYH7 promoters in ventricular CMs and how key sequences in the MYH7 promoter regulate this competitive interaction to control the antithetical expression of MYH6 and MYH7.
- FIGs. 7A-7E MYH7 promoter CRISPR interference (CRISPRi) modified cardiac disease phenotype of MYH7 mutant ventricular cardiomyocytes (vCM).
- FIGs. 7A and 7B a-Actinin immunostaining (FIG. 7A) and quantitation of sarcomere organization (FIG. 7B) showed that sarcomeres oiMYHY Exon 13-deleted (Ex 13 KO) hPSC-vCMs were disorganized, whereas sarcomeres of MYH1 promoter-deleted (MYH7p KO) hPSC-vCMs were well organized as similarly observed in wild- type (WT) vCMs.
- WT wild- type
- CRISPRi targeting YsMYH7 promoter (sgMYH7-l# or 2# sgRNAs), which reduced MYH7 expression but increased MYH6 expression, significantly improved the disorganized sarcomere phenotype mMYH7 Ex 13 KO vCMs.
- CRISPRi using a negative control sgRNA did not affect the disorganized sarcomere phenotype.
- the outlined areas in each image were magnified and shown on the right. Top diagrams above each image illustrate the MYH6 and MY H7 promoter interactions with the LCR and the MYH gene isoform expression under each condition.
- FIG. 7C Bright-field images revealed that MYH7 Exl3 KO but not MYH7 promoter KO vCMs formed fibrotic aggregates, and CRISPRi treatment with sgMYH7-l# or 2# (but not sgNC control) reduced these aggregates m MYH7 Ex 13 KO vCMs (Exl3-KO sgMYH7-l# & 2#).
- FIG. 7D Cardiomyocyte (CM) contractility was reduced in MYH7 Ex 13 KO vCMs compared to WT or MYH7 promoter KO vCMs.
- CM Cardiomyocyte
- FIG. 7E MYH7 and MY H 6 gene expression was quantitated by qRT-PCR analysis for each treated hPSC 1 ; ***P ⁇ 0.001; ****P ⁇ 0.0001; ns, not significant by two-tailed Student’s t-test.
- FIGs. 8A-8E CRE1 and CRE2 cA-regulatory elements (CREs) displayed enhancer reporter activity, but not CRE3.
- FIGs. 8A and 8C UCSC genome browser view of MYH6/MYH7 locus showed that CRE1, CRE2 (FIG. 8A) and CRE3 (FIG. 8C) sequences were relatively conserved across vertebrate species as calculated by PhyloP of 100 vertebrate species. The length of each element was defined by ATAC-seq peaks.
- FIGs. 8B and 8D Luciferase reporter assays revealed that CRE1 and CRE2 displayed enhancer activity (FIG. 8B), but CRE3 did not (FIG. 8D).
- FIG. 8D Based on ATAC-seq peaks and conservation, two different lengths of the CRE3 (600 bp and 1.2 kb) were tested in the luciferase reporter assay (FIG. 8D). Schematic diagrams of luciferase reporter assay strategies are shown above the bar graphs.
- FIG. 8E H3K27ac ChlP-seq profiles are show n across the MYH6/MYH7 locus for each indicated cardiac developmental stage during human and mouse PSC-CM differentiation. Mouse data was lifted-over and mapped onto the human genome.
- CRE -regulatory element
- TK human thymidine kinase.
- FIGs. 9A-9I CRE1 and CRE2 cA-regulatory elements (CREs) functioned as enhancers that regulated both MYH6 and MYH1 expression.
- FIGs. 9A, 9D, and 9G Schematic showing a CRE knockout (KO) strategy for CRE1 (FIG. 9A), CRE2 (FIG. 9D) and CRE3 (FIG. 9G).
- UCSC genome browser view' of each CRE show ing the two gRNAs that were designed according to the ATAC-seq peaks to delete the CRE1, CRE2 or CRE3 in hPSCs using CRISPR/Cas9.
- FIG. 9B, 9E, and 9H PCR genotyping confirmed the generation of three independent clonal lines (KO1-KO3) for each CREs. Four pairs of primers were used for genotyping as shown in FIG. 9B inset.
- FIGs. 9C, 9F, and 91 qPCR analysis showing the expression levels o MYH6, MYH7. and TNNT2 in wild-type (WT) versus CRE1 (FIG. 9C).
- WT wild type
- M DNA marker.
- FIGs. 10A-10J CRE1/CRE2 double knockout (DKO) human CMs displayed cellular, molecular, and functional defects.
- FIG. 10A Schematic showing a CRE1/CRE2 double knockout (DKO) strategy. PCR genotyping confirmed that two independent CRE1/CRE2 DKO clonal lines (DKO1, DKO2) were generated.
- FIG. 10C Schematic illustrating the strategy of 3D cardiac tissue assay.
- Top panel illustrates 3D schematic of a full 3D cardiac tissue-measuring scaffold.
- FIGs. 10G and 10H ot-ACTININ immunostaining (FIG. 10G) and quantitation of sarcomeric organization (FIG.
- FIG. 10H revealed that sarcomeres of CRE1/CRE2 DKO hPSC-CMs were significantly less organized than that of WT hPSC-CMs. Boxed areas shown in FIG. 10G were magnified.
- Sarcomeric organization index (FIG. 10H) was assessed based on sarcomeric measurements from a- ACTININ immunostaining studies (n 20 individual cardiomyocytes for each group).
- the center line in the box and whisker plots denotes the median value while the box contains the 25 lh to 75 th percentiles of dataset. The whiskers mark the minimum and maximum values. Scale bars, 20 pm.
- FIG. 10J GREAT-term analysis is shown for differentially accessible chromatin regions between WT and CRE1/CRE2 DKO hPSC-CMs.
- LCR locus control region
- Pro promoter
- WT wild type
- M DNA marker
- BPM beats per minute.
- FIGs. 11A-11H MYH6 promoter knockout (KO) hPSC-CMs display reduced contractility and disorganized sarcomeres compared to wild-type (WT) hPSC-CMs.
- FIG. 11A Schematic illustrating MYH6 promoter (MYH6p) hPSC knockout (KO) strategy'.
- UCSC genome browser view of MYH6 promoter region shows the two gRNAs that were used based on ATAC-seq peaks to delete MYH6 promoter in hPSCs using CRISPR/Cas9.
- FIG. 11B PCR genotyping confirmed the generation of three MYH6p KO clonal lines (KOI -3).
- FIG. HE Single cardiomyocyte traction force microscopy (TFM) studies showed that MYH6p KO hPSC-CMs exhibited reduced contractility compared to WT hPSC-CMs as measured by peak strain energy analyses (WT.
- TBM peak strain energy analyses
- FIGs. 11G and 11H a- ACTININ immunostaining (FIG. 11G) and quantitation of the sarcomeric organization (FIG. 11H) revealed that sarcomeres oYMYH6p KO hPSC-CMs exhibited heterogeneously organized sarcomeres.
- FIG. 11G Shows well-organized sarcomeres or disorganized sarcomeres.
- Sarcomeric organization index (FIG. 11H) was assessed based on sarcomeric measurements from a-ACTININ immunostaining studies (n > 30 individual cardiomyocytes for each group).
- the center line in the box and whisker plots (FIG. 11H) denotes the median value while the box contains the 25 th to 75th percentiles of dataset. The whiskers mark the minimum and maximum values. Scale bars, 20 pm.
- LCR locus control region
- Pro promoter
- MYH6p MYH6 promoter
- WT wild type
- M DNA marker
- BPM beats per minute.
- FIGs. 12A-12H MYH7 promoter knockout (KO) and wild-type (WT) hPSC-vCMs exhibited similar contractility and sarcomeric organization.
- FIG. 12A Schematic illustrating MYH7 promoter (MYH7p) hPSC knockout (KO) strategy.
- UCSC genome browser view of MYH7 promoter region shows the two gRNAs that were selected based on ATAC-seq peaks to generate ⁇ he MYH7 promoter KO hPSC line by CRISPR/Cas9.
- FIG. 12B PCR genotyping confirmed the generation of three MYH7p KO clonal lines (KO 1-3).
- FIGs. 12G and 12H a-ACTININ immunostaining (FIG. 12G) and quantitation of the sarcomeric organization (FIG.
- FIG. 12H showed that WT and MYHlp KO hPSC-vCMs displayed similar sarcomeric organization. Boxed regions shown in FIG. 12G were magnified and shown on the right.
- Sarcomeric organization index (FIG. 12H) was assessed based on sarcomeric measurements from a-ACTININ immunostaining studies (n > 30 individual cardiomyocytes for each group).
- the center line in the box and whisker plots denotes the median value while the box contains the 25*10 75 th percentiles of dataset. The whiskers mark the minimum and maximum values.
- Anti-a-ACTININ, DAPI, and MYL2-H2B-EGFP were used to stain the cells. Scale bars, 20 pm.
- LCR locus control region
- Pro promoter
- MYH7p wild ty pe
- WT wild ty pe
- M DNA marker
- BPM beats per minute, ns, not significant, two-tailed Student's t-test.
- FIGs. 13A-13C Transgenic fluorescent reporter assays revealed that cardiac MYH6/MYH7 (cMYH) LCR can enhance MYH6 and MYH7 promoter activity 7 .
- FIG. 13A Schematic showing the genomic regions of the human MYH6/MYH7 locus that were used for examining the enhancer/promoter activity of cis-regulatory elements (CRE) in fluorescent transgenic reporter assays. These regions included the -7.7 kb cMYH LCR containing the CRE1 and CRE2 enhancers, a -2.7 kb region containing the MYH7 promoter (MYH7p) with the region used for further interrogation in FIG.
- CRE cis-regulatory elements
- FIGs. 13B and 13C Fluorescent transgenic reporter assays revealed that MYH6 but not MYH7 promoter displayed basal promoter activity 7 (FIG. 13B), and the cMYH LCR was able to enhance the activity 7 of both MYH6 and MYH7 promoter (FIG. 13C). LCR, locus control region.
- FIG. 14 Comparative genomic analyses revealed conserved and divergent sequences within syntenic regions of the l’7/7 promoter region across several vertebrate species.
- MYH7 promoter sequences were relatively conserved across vertebrate species as calculated by PhyloP of 100 vertebrate species.
- the 400 bp region of the MYH7 promoter and the region within this 400 bp sequence that displayed relatively low conservation of sequences compared to other regions are shown.
- Detailed interrogation of the 400 bp region of the MF/77 promoter uncovered specific genomic regions that were conserved or diverged across specific mammalian species. Regions that were conserved as well as those not conserved are shown.
- Al -10 (-286 to +114 ) correspond to MYH7 promoter regions that were deleted for the luciferase reporter assays. Rodent species are labeled as Squirrel.
- FIGs. 15A and 15B Human LCR-MYH7 promoter drove mCherry reporter in Tg(hLCR-MYH7p-mCherry, MYH6p-TagBFP2) mouse ventricles postnatally. recapitulating the expression of human MYH7 in human ventricles.
- FIG. 15A Schematic showing the human construct that was used for generating the Tgfhl.CR- MYH7p-mCherry / MYH6p-TagBFP2) mouse transgenic line.
- the construct was created using genomic regions of the MYH6/MYH7 locus including a -7.7 kb LCR containing CRE1 and CRE2 enhancers, a -2.7 kb region containing the MYH7 promoter (MYH7p), a ⁇ 1.8 kb region containing the MYH6 promoter (MYH6p) and a -3.8 kb region containing CRE3.
- Fluorescence images show the expression of MYH7p-mChcrry and MYH6p-TagBFP2 in the heart of embryonic day 12 (E12), postnatal day 1 (Pl) and postnatal day 15 (Pl 5) Tg(lLCR-MYH7p-mCherry/MYH6p- TagBFP2) mice.
- Atria (A) and Ventricle (V) are indicated in bright field images.
- Cardiac conditions such as heart failure is a common disorder worldwide with a high mortality and morbidity rate.
- Heart failure is a complex clinical syndrome that results from any structural or functional impairment of ventricular filing or ejection of blood.
- Sarcomeres are the fundamental functional unit of contractility in myocytes and consists of two major contractile myofilament protein complexes, which are a thick myosin filament and a thin actin filament.
- Myosin heavy chain (MYH) proteins function as the molecular motors that produce sliding between the thick and the thin myofilaments, thus resulting in sarcomere contractility.
- MYH Myosin heavy chain
- MYH6 and MYH7 also known as a-MHC and [3-MHC, respectively, serve as the primary myosin heavy chain proteins.
- MYH6 and MYH7 are antithetically expressed at different ratios according to the cardiomyocyte cell ty pe and state (e.g., developmental or disease states) as well as across diverse mammalian species.
- atrial cardiomyocytes primarily express MYH6, whereas ventricular cardiomyocytes exhibit species-specific MYH6 and MYH7 expression.
- mature ventricular cardiomyocytes in human and larger mammals e.g., dogs and pigs
- ventricular cardiomyocytes in rodent-specific species predominantly express MYH6 and negligible MYH7 in adulthood but express relatively high MYH7 and low- MYH6 during embryogenesis.
- adult mammalian ventricular cardiomyocytes respond by decreasing the expression of MYH6 while increasing the expression of MYH7. Since MYH6 displays greater ATPase activity and actin sliding velocity compared to MYH7, decreasing the expression of MYH6 and increasing the expression of MYH7 in cardiac conditions can have significant effects on cardiac contractility resulting in the decline in cardiac performances.
- MYH6 and MYH7 are located together on a topological activating domain (TAD)-defmed genomic locus, which contains a super-enhancer upstream of MYH7 that serves as a locus control region (LCR).
- TAD topological activating domain
- LCR locus control region
- the LCR dynamically regulates the antithetical expression of MYH6 W MYH7. as well as the expression of other genes within this TAD, including mir- 208a, mir-208b, and Myosin Heavy Chain- Associated RNA Transcript (MHRT).
- the present methods show that MYH6 and MYH7 promoters competitively interact with a shared cardiac MYH (cMYH) LCR to control the expression of specific MYH isoform ( . ., MYH 6 or MYH7) in cardiomyocytes.
- cMYH shared cardiac MYH
- the present methods demonstrate the genetic regulatory mechanism that controls the antithetical expression of MYH6 and MYH7 in a cell-state and species-specific manner.
- methods and materials for modulating the antithetical expression of MYH6 and MYH7 to treat cardiac conditions e.g., heart failure or cardiomyopathy.
- compositions comprising at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, or a cardiomyocyte-specific cis- regulatory element (CRE).
- CRE cardiomyocyte-specific cis- regulatory element
- a CRE can be CRE1, CRE2, and/or CRE3.
- the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten.
- compositions provided herein comprises at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary' to an MYH7 promoter region.
- the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary 7 to a cardiomyocyte-specific cis-regulatoiy element (CRE).
- CRE cardiomyocyte-specific cis-regulatoiy element
- the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary' to an MYH6 promoter region and an MYH7 promoter region.
- the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region and a CRE. In some embodiments, the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH7 promoter region and a CRE.
- compositions provided herein comprises at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary' to an MYH6 promoter region, an MYH7 promoter region, and a CRE.
- the compositions provided herein include a nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392.
- the nucleic acid molecule present in a composition provided herein is a guide RNA (gRNA) or an oligonucleotide (e.g.. an RNA molecule or a DNA molecule).
- the nucleic acid molecule present in a composition provided herein is an inhibitory nucleic acid molecule (e.g., anMYH7 inhibitor).
- the nucleic acid molecule provided herein can be a gRNA, an siRNA, an shRNA, a miRNA, an ASO. an antagomir, a ribozyme, a long noncoding RNA (IncRNA). a locked nucleic acid (LNA), a synthetic RNA molecule, a synthetic DNA molecule, a DNAzyme, or a triple-forming oligonucleotide (TFO).
- the nucleic acid molecule present in a composition provided herein is an activating nucleic acid molecule (e.g., wMYH6 activator).
- the nucleic acid molecule provided herein can be a CRISPR-based system, a transcriptional activator, or an mRNA-based therapeutic.
- the nucleic acid molecule provided herein includes a nucleic acid sequence that is from about 5 to about 50 nucleotides in length (e.g., from about 5 nucleotides to about 10 nucleotides, from about 10 nucleotides to about 13 nucleotides, from about 13 nucleotides to about 15 nucleotides, from about 15 nucleotides to about 20 nucleotides, from about 20 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30 nucleotides to about 35 nucleotides, from about 35 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 45 nucleotides, or from about 45 nucleotides to about 50 nucleotides).
- a nucleic acid sequence that is from about 5 to about 50 nucleotides in length (e.g., from about 5 nucleotides to about 10 nucleo
- the nucleic acid molecule provided herein includes a nucleic acid sequence that is about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49. or 50 nucleotides in length. In some embodiments, the nucleic acid molecule provided herein comprises about 20 nucleotides.
- the nucleic acid molecule e.g., anMYH7 inhibiting nucleic acid molecule or an MYH6 activating nucleic acid molecule
- the nucleic acid molecule present in a composition provided herein targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hgl9).
- the nucleic acid molecule e.g., gRNA or an oligonucleotide
- present in a composition provided herein is designed based on a sequence of nucleic acid encoding an MYH7 promoter region that is well known in the art.
- compositions provided herein include a nucleic acid molecule that is complementary to wMYH7 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-4, 9-13, and 210-392.
- the nucleic acid molecule that is complementary to anMYH7 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 1 -4, 9- 13, and 210-392.
- the nucleic acid molecule e.g., gRNA or an oligonucleotide
- the compositions provided herein include a nucleic acid molecule that is complementary to an MYH6 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 5-8, 14, 15, and 22-209.
- the nucleic acid molecule that is complementary to an MYH6 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 5-8, 14, 15, and 22-209.
- the nucleic acid molecule e.g., gRNA or an oligonucleotide
- present in a composition provided herein is designed based on a sequence of nucleic acid encoding a CRE1 polypeptide that is well known in the art.
- compositions provided herein include a nucleic acid molecule that is complementary' to CRE1 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 16 and 17.
- the nucleic acid molecule that is complementary- to CRE1 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 16 and 17.
- the nucleic acid molecule e.g., gRNA or an oligonucleotide
- the compositions provided herein include a nucleic acid molecule that is complementary- to CRE2 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 18 and 19.
- the nucleic acid molecule that is complementary- to CRE2 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 18 and 19.
- the nucleic acid molecule (e.g., gRNA or an oligonucleotide) present in a composition provided herein is designed based on a sequence of nucleic acid encoding a CRE3 polypeptide that is yvell known in the art.
- the compositions provided herein include a nucleic acid molecule that is complementary to CRE3 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 20 and 21.
- the nucleic acid molecule that is complementary to CRE3 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 20 and 21.
- the nucleic acid molecules provided herein can be used to make a genetically modified cell comprising at least one genetic modification (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) within mMYH gene that is operably linked to a cMYH LCR.
- the genetic modification targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hgl9).
- the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) that bind (e.g., complementary) to anMYH6 promoter region, mMYH7 promoter region, or a CRE.
- the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary) to anMYH6 promoter region.
- the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary) to anMYH7 promoter region.
- the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary ) to a CRE. In some embodiments, the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary’) to an MYH6 promoter region, an MYH7 promoter region, and a CRE.
- the one or more nucleic acid molecule described herein to make a genetically modified cell includes a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392.
- the genetically modified cells include a nucleic acid molecule that binds to an MYH7 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-4, 9-13, and 210-392.
- the nucleic acid molecule that binds to an MYH7 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 1-4, 9-13, and 210-392.
- the genetically modified cells include a nucleic acid molecule that binds to an MYH6 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 5-8, 14, 15, and 22-209.
- the nucleic acid molecule that binds to an MYH6 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 5-8, 14, 15, and 22-209.
- the genetically modified cells include a nucleic acid molecule that binds to CRE1 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 16 and 17.
- the nucleic acid molecule that binds to CRE1 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 16 and 17.
- the genetically modified cells include a nucleic acid molecule that binds to CRE2 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 18 and 19.
- the nucleic acid molecule that binds to CRE2 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 18 and 19.
- the genetically modified cells include a nucleic acid molecule that is complementary to CRE3 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 20 and 21.
- the nucleic acid molecule that binds to CRE3 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 20 and 21.
- the genetic modification reduces MYH7 expression in a genetically modified cell described herein.
- the level of MYH7 polypeptide can be lower in the genetically modified cell as compared to the level of MYH7 polypeptide in pre-engineered cells (e.g., untreated cell or control cell).
- the genetic modification reduces MYH7 expression in a genetically modified cell by at least 3% (e.g., (e.g., at least 5%, at least 7%.
- the genetic modification increases MYH6 expression in the genetically modified cell described herein.
- the level of MYH6 polypeptide can be higher in the genetically modified cell as compared to the level of MYH6 polypeptide in pre-engineered cells (e.g., untreated cell or control cell).
- the genetic modification increases MYH6 expression in a genetically modified cell by at least 3% (e.g., (e.g., at least 5%, at least 7%.
- the genetic modification reduces MYH7 expression while increasing MYH6 expression in a genetically modified cell described herein.
- Any appropriate gene editing methods can be used to introduce a genetic modification comprising at least one genetic modification (e.g.. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) within an MYH gene that is operably linked to a cMYH LCR.
- methods of gene editing that comprises introducing one or more nucleic acid molecules or compositions provided herein into a cell. Any appropriate gene editing methods well known in the art can be used to introduce one or more nucleic acid molecules provided herein into a cell.
- the genetic modifications described herein are introduced into a cell (e.g., an hPSC) using genetic modulation systems or techniques well known in the art.
- genetic modulation system or technique that can be used to introduce a genetic modification into a cell include, without limitation, a CRISPR-based system (e.g., CRISPR activating system, CRISPR inactivating system, CRISPR/Cas gene KO system, or CRISPR gene KI system), a Zinc Finger Protein (ZNF) system, a Transcription Activator-like Effector Nuclease (TALEN) system, RNA interference (RNAi), guide RNA (gRNA), antisense oligonucleotides (ASOs), micro RNA (miRNA), RNA Aptamer, short hairpin RNA (shRNA), or small interfering RNA (siRNA).
- the genetic modification described herein comprises an insertion, a deletion, or one or more mutations (e.g.. one or
- a CRISPR-based system including CRISPR activating system (CRISPRa), CRISPR interference system (CRISPRi), CRISPR/Cas gene KO system, or CRISPR gene KI system, can use any nucleic acid molecule or composition provided herein to introduce at least one genetic modification into a cell (e.g., hPSCs).
- the CRISPR-based system includes any appropriate Cas nuclease. Examples of Cas nucleases include, w ithout limitation, Casl. Cas2, Cas3, Cas9, CaslO, Cpfl, Cas 12. or Cas 12a.
- a Cas component of a CRISPR/Cas system is a Cas9 nuclease.
- a Cas9 nuclease can be an active Cas9 nuclease or a dead Cas9 (dCas9).
- Components of CRISPR-based system described herein can be in any appropriate format.
- a component of a CRISPR-based system is introduced into one or more cells (e.g., iPSC) as a nucleic acid molecule provided herein (e.g., a gRNA) and/or a nucleic acid encoding a Cas nuclease (e.g., Cas9).
- a nucleic acid molecule provided herein and a nucleic acid encoding at least one Cas nuclease can be introduced into one or more cells.
- a component of a CRISPR- based system is introduced into one or more T cells as a gRNA and/or as a Cas nuclease.
- at least nucleic acid molecule provided herein and at least one Cas nuclease e.g., a Cas9 nuclease
- the CRISPR-based system includes a synergistic activation mediator (SAM) system.
- SAM synergistic activation mediator
- the SAM system can include an enzymatically inactive Cas 9 (e.g., dCas9) fused to transcriptional activator (e.g., VP64), one or more nucleic acid molecules or compositions provided herein engineered to contain MS2 RNA aptamer loops, and an MS2 coat polypeptide fused to activation domains (e.g., p65 and HSF1).
- an enzymatically inactive Cas 9 e.g., dCas9 fused to transcriptional activator (e.g., VP64)
- transcriptional activator e.g., VP64
- nucleic acid molecules or compositions provided herein engineered to contain MS2 RNA aptamer loops e.g., p65 and HSF1
- a ZFN system is used to introduce one or more genetic modification comprising at least one nucleic acid molecule or composition provided herein into a cell (e.g., hPSC).
- a ZFN system can include a polypeptide including a DNA-binding domain (e.g., zinc fingers) that is complementary to a target nucleic acid (e.g., nucleic acid encoding an MYH6 polypeptide, an MYH7 polypeptide, and/or CRE1/CRE2/CRE3 polypeptide), and a nuclease domain (e.g., a nuclease domain that can created double-strand breaks).
- the ZFN system includes any appropriate nuclease domain.
- a nuclease domain of a ZFN system can be a Fokl nuclease domain.
- a TALEN system is used to introduce one or more genetic modification comprising at least one nucleic acid molecule or compositions provided herein into a cell (e.g., hPSC).
- a TALEN system can include a polypeptide including a transcription activator-like (TAL) effector DNA-binding domain directing a nuclease to a target nucleic acid (e g., nucleic acid encoding anMYH6 polypeptide, an MYH7 polypeptide, and/or CRE1/CRE2/CRE3 polypeptide), and a nuclease domain (e.g., a nuclease domain that can created double-strand breaks).
- the TALEN system can include any appropriate nuclease.
- a nuclease can be a non-specific nuclease.
- a nuclease can function as a dimer.
- a nuclease of a TALEN system can be a Fokl nuclease.
- an RNA-based system e.g., RNA interference (RNAi) system
- RNAi RNA interference
- a cell e.g., hPSC
- an RNAi system is a post-transcriptional gene silencing process mediated by small RNA molecules.
- Non-limiting examples of RNA molecules that can be used in an RNA-based system include antisense oligonucleotides (ASOs), micro RNA (miRNA), RNA Aptamer, short hairpin RNA (shRNA), and small interfering RNA (siRNA).
- ASOs antisense oligonucleotides
- miRNA micro RNA
- RNA Aptamer RNA Aptamer
- shRNA short hairpin RNA
- siRNA small interfering RNA
- components of a gene modulation system can be introduced into one or more cells (e.g., hPSCs) using any appropriate method.
- a method of introducing components of a gene modulation system into a cell can be a physical method.
- a method of introducing components of a gene-editing system into a cell can be a chemical method.
- a method of introducing components of a gene modulation system into a cell can be a particlebased method.
- Examples of methods that can be used to introduce components of a gene modulation system into one or more cells include, without limitation, electroporation, transfection (e.g., lipofection), transduction (e.g., viral vector mediated transduction), microinjection, or nucleofection.
- the compositions provided herein is in the form of a vector (e.g., a viral vector or a non-viral vector).
- a vector e.g., a viral vector or a non-viral vector. Any appropriate method known in the art can be used to design and construct a vector comprising the composition provided herein.
- a viral vector can be any appropriate viral vector know n in the art.
- a viral vector can be derived from a negative-strand virus or a positive-strand virus, or a viral vector can be derived from a virus with an RNA genome or a DNA genome.
- Nonlimiting examples of viral vectors include a lentiviral vector (e.g.. e.g., derived from SIV, HIV-1, BIV, HIV-2, or FIV), an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a herpes viral vector (e.g., a herpes simplex viral vector), a group B adenovirus enadenotucirev vector, an Epstein-Barr virus vector, a simian virus 40 (SV-40) vector, a Harvey murine sarcoma vims vector, a bovine papilloma virus vector, a vaccinia virus vector, a murine mammary tumor virus vector, a polio virus vector, a parvovirus vector, a Rous sarcoma virus vector, a maraba virus vector, or a vesicular stomatitis virus vector.
- a lentiviral vector e.g.. e.g
- a non-viral vector can be any appropriate non-viral vector known in the art.
- a non-viral vector can be an expression plasmid (e.g., a cDNA expression vector).
- a non-viral vector is a cosmid. a liposome, an exosome, an extracellular vesicle, a polymer, a nanoparticle, a peptide, or a dendrimer, or a lipid nanoparticle (LNP).
- the vectors provided herein comprise a constitutive promoter (e.g., a cytomegalovirus promoter, a simian virus 40 promoter, an elongation factor 1 a (EFl a) promoter, a P-actin promoter, or a phosphoglycerate kinase (PGK) promoter), an inducible promoter (e.g., tetracycline response element (TRE) promoter, doxycycline-inducible promoter, or lac-inducible promoter), or a tissue-specific promoter (e.g., cardiac-specific promoters such as a- MYH promoter, NKX2.5 promoter, or troponin T (TnT) promoter).
- a constitutive promoter e.g., a cytomegalovirus promoter, a simian virus 40 promoter, an elongation factor 1 a (EFl a) promoter, a P-actin promoter, or a
- the genetically modified cells provided herein are derived from human pluripotent stem cells (hPSCs).
- a human pluripotent stem cell can be a human embryonic stem cell (ESC) or an induced pluripotent stem cell (iPSC).
- the genetically modified cells provided herein are derived from an iPSC.
- An iPSC is a reprogrammed somatic cell capable of differentiating into a wide range of different cell types. Reprogramming can involve alteration such as condensation, reversal of heritable patterns of nucleic acid modification (e.g., methylation), genomic imprinting, chromatin epigenetic changes, or other events that occur during cellular differentiation. Any appropriate method well known in the art can be used to reprogram somatic cells to generate iPSCs.
- compositions e g., a composition including at least one nucleic molecule that is complementary to anMYH6 promoter region, anMYH7 promoter region, and/or a CRE
- anMYH7 inhibitor or an MYH6 activator provided herein is formulated as a pharmaceutical composition.
- Pharmaceutical compositions typically include a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier can include solvents, saline, antibacterial and antifungal agents, coatings, dispersion media, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
- Pharmaceutical compositions can be formulated to be compatible with its intended route of administration.
- the pharmaceutical composition provided herein are administered by any appropriate routes of administration.
- routes of administration include oral or parenteral (e.g., intravenous, intradermal, subcutaneous, intratumoral, intramuscular or subcutaneous) administration.
- the pharmaceutical composition provided herein is administered intrathecally, intraperitoneal, intramuscular, intratumoral, subcutaneous, rectal, intraarticular, vaginal, infusion, intravenous, or intrastemal.
- the pharmaceutical composition provided herein can be formulated in an ingestible form or a topical form.
- the pharmaceutical composition can be in the form of a liquid, solution, suspension, tablet, pow der, granule, pill, capsule, gel, cream, mist, atomized vapor, aerosol, soft gelatin capsule, or hard gelatin capsule.
- tablets or capsules can be prepared by conventional means with pharmaceutically acceptable excipients such as binding agents, fillers, lubricants, disintegrants, or wetting agents.
- the tablets can be coated by methods known in the art.
- Liquid preparations for oral administration can take the form of, for example, suspension, syrups, solutions, or they can be presented as a dry product for constitution with saline or other suitable liquid vehicle before use.
- Liquid preparations also can contain pharmaceutically acceptable additives such as emulsifying agents, suspending agents, non-aqueous vehicles, buffer salts, preservatives, coloring agents, flavoring agents, and sweetening agents as appropriate.
- Preparations for oral administration can be suitably formulated to give controlled release of the pharmaceutical composition.
- the pharmaceutical compositions provided herein can be administered to a subject (e g., a mammal) by regional delivery directly to a target tissue (e.g.. cardiac tissue) in the subject.
- a target tissue e.g.. cardiac tissue
- the pharmaceutical compositions provided herein can be administered intraperitoneally (IP) to the abdomen or peritoneal cavity of the subject.
- IP administration can be performed via a port or pre-existing port placed for delivery' of other therapeutic agents (e.g., therapeutic agents for the treatment of a cardiac condition).
- Non-limiting examples of regional administration include hepatic artery infusion, catheter infusion into resection cavity, intrapleural delivery, or ultrasound guided injection.
- Table 1 Exemplary nucleic acid sequences AAGTTCCCCCTGACACAAGG TGTGGAACCTCCTTGTGTCA TGAGGGTCACCTTCTCCTGC CTTCACCAGGAGTGGGGTGC GAGTACCAGGTCCAGTCACT AGCTAGGAAACAATTGGAAG GCCCCTTCCCAGCTTCCAGT 372 TGCTGCTCTCAGGTAGGAGC
- one or more pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to anMYH6 promoter region, anMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, wMYH7 inhibitor and/or anMYH6 activator described herein
- a subject e.g., a mammal having a cardiac condition to treat the cardiac condition.
- methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g.. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to anMYH6 promoter region, anMYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e.g. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more
- methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1- 392) provided herein to the subject.
- methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of W.MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) aZNF, a TALEN, or a small molecule inhibitor provided herein to the subject.
- W.MYH7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) aZNF, a TALEN, or a small molecule inhibitor provided herein to the subject.
- methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, mRNA-based therapeutics, or a therapeutic polypeptide) provided herein to the subject.
- methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
- a subject e.g., a mammal having a cardiac condition
- one or more pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g.. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MYH6 promoter region, anMYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e.g. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more
- methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject.
- methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non- viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI sy stem) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- MYH7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI sy stem) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of anA/EHri activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject.
- methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of W.MYH7 inhibitor and an MYH6 activator provided herein to the subject.
- methods of increasing MYH6 expression in a subject includes increasing mRNA expression and/or polypeptide expression of MYH6.
- methods and materials described herein are effective to increase MYH6 expression by, for example, 10, 20, 30, 40. 50. 60. 70. 80 or more percent.
- a subject e.g., a mammal having a cardiac condition
- one or more pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to anMYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, wMYH7 inhibitor and/or an MYH6 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more
- methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject.
- methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a vector (e.g.. a viral or a non- viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of anMYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, aTALEN, or a small molecule provided herein to the subject.
- anMYH7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, aTALEN, or a small molecule provided herein to the subject.
- methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR- based system (e.g.. a CRISPRa system), a transcriptional activator, or an mRNA- based therapeutic provided herein to the subject.
- methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
- methods of reducing MYH7 expression in a subject includes increasing mRNA expression and/or polypeptide expression of MYH6.
- methods and materials described herein are effective to reduce MYH7 expression by, for example, 10, 20, 30, 40, 50, 60, 70, 80 or more percent.
- a subject e.g., a mammal having a cardiac condition
- one or more pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, m X/1YH7 inhibitor and/or wMYH6 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a genetically modified cell (e g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- MYH7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
- a subject e.g., a mammal having a cardiac condition
- one or more pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, anMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, anMYH7 inhibitor and/or wMYH6 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more
- methods provided herein for improving cardiac contractility' in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for improving cardiac contractility' in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- an MYH7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of an MY H 6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject.
- methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of wMYH7 inhibitor and an MY H 6 activator provided herein to the subject.
- methods as described herein can improve the cardiac contractility in the subject by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%, at least 20% or at least 25%).
- a ratio of cardiac MYH6 and MYH7 in a subject e.g., a mammal having a cardiac condition.
- a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to anMYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more
- methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a genetically modified cell (e g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject.
- methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non- viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of an MY H7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- an MY H7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject.
- methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
- methods of modulating a ratio of cardiac MYH6 and MYH7 in a subject includes increasing the cardiac MYH6MYH7 expression ratio by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or more) compared to a ratio of cardiac MYH6 and MYH7 in an untreated subject (e.g., a subject not administered with the pharmaceutical compositions provided herein or a subject treated with a control).
- an untreated subject e.g., a subject not administered with the pharmaceutical compositions provided herein or a subject treated with a control.
- methods of modulating a ratio of cardiac MYH6 and MYH7 in a subject includes decreasing the cardiac MYH7.MYH6 expression ratio by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or more) compared to a ratio of cardiac MYH6 and MYH7 in an untreated subject (e.g., a subject not administered with the pharmaceutical compositions provided herein or a subject treated with a control).
- an untreated subject e.g., a subject not administered with the pharmaceutical compositions provided herein or a subject treated with a control.
- provided herein are methods for ameliorating at least one (e.g.. at least two, at least three, at least four, at least five, at least six. at least seven, at least eight, at least nine, at least ten, or more) symptom of heart failure in a subject (e.g., a mammal having a cardiac condition).
- a subject e.g., a mammal having a cardiac condition.
- one or more pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, wMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein
- a cardiac condition e.g., heart failure
- methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MY H 6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more
- methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject.
- methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) aZNF, aTALEN, or a small molecule provided herein to the subject.
- an MYH7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system)
- aZNF e.g., a ZNF, aTALEN, or a small molecule provided herein to the subject.
- methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject.
- methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
- symptoms of heart failure that can be ameliorated bymethods described herein include shortness of breath or dyspnea (e.g., paroxysmal nocturnal dyspnea), fatigue and weakness, edema, tachycardia, arrhythmia, nocturia, vasoconstriction, coughing, wheezing, swelling of the belly area, chest pain, reduced ability to exercise, nausea, and/or lack of appetite.
- methods as described herein can ameliorate at least one symptom of failure in the subject by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%, at least 20%, or at least 25%).
- provided herein are methods for reducing the risk of developing a cardiac condition in a subject (e.g., a mammal).
- the methods and materials described herein can be effective to reduce the severity of a cardiac condition (e.g., heart failure) and/or a condition associated with a cardiac condition in a subject.
- one or more pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, wMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, anMYH7 inhibitor and/or an MYH6 activator described herein
- a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, wMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, anMYH7 inhibitor and/or an MYH6 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g.. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject.
- at least one e.g. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more
- methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g.. at least two, at least three, at least four, at least five, at least six. at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- a composition including at least one (e.g.. at least two, at least three, at least four, at least five, at least six. at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject.
- methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject.
- methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject.
- methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- an MYH7 inhibitor e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject.
- methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor).
- MYH6 activator e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor.
- CRISPR-based system e.g.. a CRISPRa system
- a transcriptional activator e.g. a CRISPRa system
- an mRNA-based therapeutic provided herein to the subject.
- methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
- methods as described herein can reduce the risk of a developing a cardiac condition or reduce the severity of a cardiac condition in the subject by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%, at least 20%, or at least 25%).
- methods described herein can improve the survival of a subject (e.g., a subject having a cardiac condition) by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%. at least 20% or at least 25%). In some cases, methods described herein can improve the quality of life in a subject. In some cases, methods described herein can reduce the risk of developing other cardiac-related conditions in a subject.
- anMYH7 inhibitor and/or an MYH6 activator e.g., a nucleic acid molecule that inhibits the expression of MYH7 and/or increases the expression of MYH6
- anMYH7 inhibitor and/or an MYH6 activator can comprise at least one antisense nucleic acid molecule that targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hg 19).
- the nucleic acid molecule described herein includes a gRNA, an siRNA, an shRNA, a miRNA, an ASO, an antagomir, a ribozy me, a long noncoding RNA (IncRNA), a locked nucleic acid (LNA), a synthetic RNA molecule, a synthetic DNA molecule, a DNAzyme, or a triple-forming oligonucleotide (TFO).
- the nucleic acid molecule used in methods described herein is an inhibitory nucleic acid molecule (e.g., MYH7 inhibitor).
- the nucleic acid molecule used in methods described herein is an activating nucleic acid molecule (e.g., MYH6 activator).
- the nucleic acid molecule described herein e.g., a nucleic acid molecule that increases or activates the expression of MYH6 includes a small molecule agent, a CRISPR-based system, a transcriptional activator, an mRNA- based therapeutic, or a therapeutic polypeptide.
- the pharmaceutical compositions provided herein can be used as the sole active agent for use in methods described herein.
- the pharmaceutical compositions e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MY H 7 inhibitor and/or an MYI 16 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- one or more pharmaceutical compositions provided herein can be administered to a subj ect together with one or more additional pharmaceutical compositions provided herein.
- a pharmaceutical composition comprising an MY H7 inhibitor can be administered with an M H 6 activator, a genetically modified cell, a vector, a nucleic acid molecule described herein, or any combinations thereof.
- one or more pharmaceutical compositions described herein can be administered to a subject together with one or more additional therapies used to treat a cardiac condition (e.g., cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure).
- additional therapies that can be used to treat a cardiac condition can include an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin-2 receptor blocker (ARB), an ARB and neprilysin inhibitor, a beta blocker, a digoxin, a diuretic, a hydralazine and isosorbide dinitrate, an 1(f) channel inhibitor, a mineralocorticoid receptor antagonist (MRA), or a sodiumglucose cotransporter 2 (SGLT 2) inhibitor.
- ACE angiotensin-converting enzyme
- ARB angiotensin-2 receptor blocker
- ARB ARB
- neprilysin inhibitor e.g., neprilysin inhibitor
- beta blocker e.g., ag
- an ACE inhibitor comprises captopril, enalapril, fosinopril, lisinopril, perindopril, quinapril, ramipril, or trandolapril.
- an ARB comprises candesartan, losartan, telmisartan, or valsartan.
- an ARB and neprilysin inhibitor comprises sacubitril- valsartan.
- a beta blocker comprise bisoprolol, carvedilol, metoprolol succinate, or nebivolol.
- a diuretic comprises bumetanide, chlorothiazide, hydrochlorothiazide, indapamide, furosemide, metolazone, or torsemide.
- an 1(f) channel inhibitor comprises ivabradine.
- an MRA comprises eplerenone or spironolactone.
- an SGLT 2 inhibitor comprises dapagliflozin or empagliflozin.
- methods and materials provided herein can be used to improve the efficacy of the second pharmaceutical composition or the additional therapies provided herein in a subject having a cardia condition described herein.
- a subject in need thereof e.g., a mammal having a cardia condition
- methods and materials provided herein can be used to improve the efficacy of the second pharmaceutical composition or the additional therapies provided herein by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.
- methods and materials provided herein can be used to reduce the severity of the adverse effects of the second pharmaceutical composition or the additional therapies provided herein in a subject having a cardia condition described herein.
- a subject in need thereof e.g., a mammal having a cardia condition
- methods and materials provided herein can be used to reduce the severity of the adverse effects of the second pharmaceutical composition or the additional therapies provided herein by, for example, 10, 20, 30, 40, 50. 60. 70, 80, 90, 95, or more percent.
- the one or more pharmaceutical compositions as described herein or additional therapies provided herein can be administered at the same time (e g, in a single composition comprising the pharmaceutical compositions described herein and the additional therapy) or independently.
- one or more pharmaceutical compositions described herein can be administered first, and the additional therapies can be administered second, or vice versa.
- the one or more additional therapies can be performed at the same time or independently of the administration of pharmaceutical compositions described herein.
- one or more one or more pharmaceutical compositions described herein can be administered before, during, or after the one or more additional therapies are performed.
- the subject is a mammal. Any appropriate mammal having a cardiac condition can be administered a therapeutically effective amount of a pharmaceutical composition provided herein.
- mammals that can be treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, or rats.
- a subject that can be administered the pharmaceutical composition provided herein is at high risk of developing a cardiac condition (e.g., cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure).
- the subject expresses higher levels of MYH7 compared to a control sample (e.g., a sample derived from a healthy subject). In some embodiments, the subject expresses lower levels of MYH6 compared to a control sample (e.g., a sample derived from a healthy subject). In some embodiments, the subject expresses a higher ratio of MYH7:MYH6 expression compared to a control sample (e.g., a sample derived from a healthy subject). In some embodiments, the subject expresses a lower ratio of MYH6:MYH7 expression compared to a control sample (e.g., a sample derived from a healthy subject).
- methods provided herein can include determining that a subject (e.g., a human) has or is at risk of developing a cardiac condition.
- a cardiac condition can be cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure.
- methods provided herein are administered to a subject having cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure. Any appropriate method can be used to determine that a subject has a cardiac condition. For example, imaging techniques (e.g., CT scans, positron emission tomography (PET) scans, ultrasound imaging.
- PET positron emission tomography
- MRI scans, and/or X rays can be used to determine that the subject has a cardiac condition.
- biomarker detection e.g., blood, urine, serum, and/or spinal fluid tests
- electrocardiograms e.g., echocardiographs
- exercise stress tests e.g., whole genome sequencing and/or whole exome sequencing
- genetic tests e.g., whole genome sequencing and/or whole exome sequencing
- coronary angiograms can be used to determine that the subject has a cardiac condition.
- a “therapeutically effective amount’’ is an amount sufficient to effect beneficial or desired results.
- an effective amount is an amount that achieves a desired therapeutic effect, e.g., an amount sufficient to treat (e g., reduce the extent or severity of) a disease and/or to reduce risk of development of disease or disease symptoms (also referred to as a prophylactically effective amount).
- a therapeutically effective amount can be administered in one or more administrations, applications, or dosages.
- a therapeutically effective amount of a therapeutic compound e.g., an effective dosage of a pharmaceutical composition provided herein depends on the therapeutic compounds selected.
- the pharmaceutical composition e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein
- a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein
- CRE cardiomyocyte-specific cis-regulatory element
- the pharmaceutical composition provided herein can be administered one or more times per week (e.g., one time per week, two times per week, three times per week, four times per week, five times per week, six times per week, seven times per week, or more than seven times per week).
- treatment of a subject with a therapeutically effective amount of the pharmaceutical compositions described herein can include a single treatment or a series of treatments.
- Various factors can influence the actual amount used for a particular application. For example, the frequency of administration, duration of treatment, combination of other agents, site of administration, stage of disease (if present), and the anatomical configuration of the treated area may require an increase or decrease in the actual amount administered.
- An effective duration for administering a pharmaceutical composition provided herein can be any duration that reduces the symptoms related to a cardiac condition, increases MYH6 expression, reduces MYH7 expression, improves cardiac contractility, and/or increases the expression ratio of MYH6:MYH7 in a subject without producing significant toxicity to the subject.
- the effective duration can vary from several days to several weeks, to several months, or longer. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the effective amount, frequency of administration, use of route of administration, and severity of the subject’s condition.
- Dosage, toxicity and therapeutic efficacy of the pharmaceutical composition provided herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- Compositions that exhibit high therapeutic indices are advantageous. While compositions that exhibit toxic side effects may be used, care should be taken to minimize and reduce side effects.
- the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models. Such information can be used to more accurately determine useful doses in humans.
- Example 1 Modulation of the antithetical expression of MYH6 and MYH7 could treat cardiac conditions
- hPSCs Human pluripotent stem cells
- hPSC cardiac studies an engineered hPSC YY2-MYL2-H2B- GFP reporter transgenic line that specifically expressed H2B-GFP (the human histone H2B fused to green fluorescent protein) in differentiated MYL2+ D80 ventricular cardiomyocytes (vCM) was used as previously described 28 ’ 29 ’ 37 . All hPSC lines were differentiated into cardiomyocytes and their corresponding developmental stages utilizing a well-established WNT-based cardiomyocyte differentiation protocol 56 ’ 57 . For vCMs, the cells were sorted and purified based on MYL2-H2B-GFP before their processing and analyses.
- H2B-GFP the human histone H2B fused to green fluorescent protein
- RNA-seq studies ⁇ 2 million dissociated cells were washed in phosphate buffered saline (PBS), lysed in TRIzol and then stored at -80°C until further processing.
- PBS phosphate buffered saline
- ATAC-seq 2 x 10 5 cells were slow-frozen overnight (O/N) in freezing media (E8 medium or differentiation medium supplemented with 10% DMSO) at -80°C and stored in liquid nitrogen until further processing.
- freezing media E8 medium or differentiation medium supplemented with 10% DMSO
- gRNAs specific guide RNAs targeting sequences surrounding the region to be edited were designed using the online software tool CRISPOR 58 , which generated gRNA sequences for optimal targeting of regions of interest while minimizing potential off-target effects.
- a gRNA and a single-strand DNA donor oligo were cotransfected, followed by clonal line isolation and genotyping by Sanger sequencing. For all genotypes, at least two successfully targeted clonal lines were selected for further studies. All gRNA sequences are listed in Table 1.
- Donor oligo nucleotide sequence used for knock-in experiment includes CTGGAGAGGCGGGGAGGGGAGCACTGTTTGGGAAGGGGGGGAGAGTCGG GGGAAATGCTTCTAGTGACAACAGCCCTTTCTAAATCCGGC (SEQ ID NO: 393).
- a control plasmid was constructed by replacing the minimal promoter in the pGL4.23 plasmid (Promega E8411) with a 752 bp thymidine kinase (TK) promoter.
- TK thymidine kinase
- a ⁇ 1.5 kb region containing CRE1 and a -1.4 kb region containing CRE2 were PCR- amplified and cloned individually upstream of the TK promoter in the pGL4.23-TK plasmid using NEBuilder HiFi DNA assembly (New England Biolabs E5520S).
- 2 x io 5 hPSC-CMs were dissociated and re-plated in a Geltrex-coated 24- well plate.
- luciferase reporter assay 500 ng of the dual luciferase reporter construct LCR-MYH7p-Luc2 / MYH6p-Rluc harboring either the WT MYH7 promoter or a series of mutant MYH7 promoters was transfected into D20 CMs. Three days after transfection, firefly luciferase (Luc2) and renilla luciferase (Rluc) activities were measured by following the manufacturer’s protocol. Relative luciferase activity for each construct was calculated as the ratio of MYH7p-Amsn Luc2 activity versus MYH6p-driven Rluc activity. The WT relative luciferase activity was set to 1.
- Proteins from cell lysates were prepared using RIPA Lysis and Extraction Buffer (Invitrogen) supplemented with proteinase inhibitor cocktail (Roche). 20 pg of lysate was run on a 4-12% NuPAGE gradient gel (Invitrogen) for western blot analysis. Gels were transferred to a nitrocellulose membrane using standard procedures. After blocking using Pierce Clear Milk blocking Buffer (Thermo), the membranes were stained with antibodies for MYH6 (ProteinTech) and MYH7 (ProteinTech). Anti-fyActin antibody (Cell Signaling) was used as a loading control.
- CMs and vCMs were dissociated with collagenase IV (Invitrogen) followed by Accutase (Gibco). The cells were then fixed and permeabilized using Fixation/Permeabilization solution (BD Biosciences). After washing with Perm/Wash buffer (BD Biosciences), CM differentiation efficiency was assessed using an antibody against TNNT2 (Invitrogen). vCM differentiation efficiency was examined based on MYL2-H2B-GFP fluorescence. Analyses were conducted using FlowJo Software (BD Biosciences). To purify vCMs for downstream studies. MYL2-H2B-GFP positive vCMs were sorted without fixation. Sarcomere organization analysis using immunofluorescence
- cardiomyocytes were dissociated three days before each indicated day: CRE1/CRE2 DKO CMs at D15, MYH6 promoter KO CMs at D15, MYH7 promoter KO vCMs at D80.
- Dissociated cardiomyocytes were seeded at a density of 100,000 cells/well on Geltrex-coated four- well chamber slides (Thermo). Three days later, the cells were fixed with 4% formaldehyde in PBS for 10 minutes (min), then blocked and permeabilized in PBS containing 5% goat serum and 0.1% Triton-XlOO for 30 minutes.
- CRISPR activation (CRISPRa) studies the Synergistic Activation Mediator (SAM) system was used. Two gRNAs were designed to target the MYH7 promoter region using the online tool CRISPick 6L62 and cloned individually into the lenti-SAM v2 plasmid (Addgene ID: 75112). A non-targeting control gRNA was also cloned into the same plasmid as a negative control. H9 MYL2-H2B-GFP hPSCs were first infected with lentiMPH v2 (Addgene ID: 89308) virus and then selected by 50 pg/mL hygromycin for 1 w eek.
- SAM Synergistic Activation Mediator
- Survivor cells w ere further infected with gRNA lentivirus and selected by 1 pg/ mL puromycin for 5 days and then expanded for further use.
- CRISPR interference CRISPR interference
- the dCas9-KRAB system was used. Two gRNAs and a non- targeting control gRNA were cloned individually into lentiGuide-puro plasmid (Addgene ID: #52963). H9 MYL2-H2B-GFP hPSCs were first infected with lenti-dCas9-KRAB- blast (Addgene ID: 89567) virus and then selected by 5 pg/ mL blasticidin for 1 week. Surviving cells were then infected with gRNA lentivirus and selected using 1 pg/ mL puromycin for 5 days and then expanded for further use.
- Methacrylated coverslips and Bioink composition were prepared as described elsewhere 41 .
- the 3D printed micro-tissue construct was fabricated using an in-house digital light processing (DLP)-based bioprinter, which comprised the following components: (i) a 365 nm UV LED light source; (ii) a digital micromirror array device (DMD) for light projection; (iii) projection optics responsible for focusing optical patterns from the DMD chip onto the fabrication plane; (iv) a motorized x-y-z stage; and (v) a computer control unit.
- DLP digital light processing
- DMD digital micromirror array device
- PDMS poly dimethylsiloxane spacers
- a PDMS-coated coverslip was then placed on top of the set-up, and the relevant prepolymer solution heated to 37°C, was carefully pipetted between the spacers. The entire set-up was positioned on the motorized stage, and the prepolymer solution was polymerized by the projected light pattern. Between each layer printing, warmed lx PBS was used to wash away any excess prepolymer solution, ensuring precision in the layer-by-layer construction process. Following the completion of the initial two layers (the base and pillar layers), the subsequent step involved the addition of cells to the GelMA prepolymer solution for the printing of the line scaffold encapsulating the cells.
- PDMS poly dimethylsiloxane
- the supernatant comprising a mixture of cardiomyocytes and human cardiac fibroblasts (9: 1). was diluted to a concentration of 50 million cells/mL by gently combining it with the GelMA prepolymer solution. This diluted cell-containing mixture was directly introduced into the set-up, aiming to minimize the duration during which the cells were exposed to the prepolymer solution.
- the displacement of the small pillar was quantified utilizing a Leica DMI 6000B fluorescent microscope equipped with a 10X objective lens, focused on the top of the pillar. To track the average weighted mean of bead fluorescence and subsequently calculate displacement and beating rate, a custom MATLAB script was developed in-house.
- Equations (1) and (2) were employed for this calculation, incorporating the modulus of the relaxed cellular scaffolds. It is assumed that all printed samples possess the same size and modulus, providing a consistent basis for the force calculations.
- the modulus T was measured by a mechanical tester (Cellscale).
- the contractility of individual cardiomyocytes was measured using a traction force microscopy (TFM) by following established protocols 64 .
- Cardiomyocytes were dissociated five days before each indicated day: CRE1/CRE2 DKO hPSC-CMs at D15, MYH6 promoter KO hPSC-CMs at D15, and MYH7 promoter KO hPSC-vCMs at D80.
- TFM was conducted using a Nikon Eclipse Ti- S inverted fluorescence microscope with a BD Carv II camera and a stage-top incubator system (Pathology Devices). Videos capturing fluorescent bead movement were recorded at a rate of 9.5 frames per second for a total of 120 frames using a 60x objective.
- Subsequent analysis of the bead movement during cardiomyocyte contraction utilized particle image velocimetry, as described elsewhere. Cardiomyocyte contractility was quantified by calculating the mean peak strain energy across all beats recorded in each video.
- a -7.7 kb region containing CRE1 and CRE2 enhancers was PCR amplified and cloned upstream of the MYH7 promoter or MYH6 promoter through Sall and BamHI sites, respectively.
- a rBGpA-TagBFP2 cassette was first inserted dow nstream of mCherry of the LCR-MYH7p-mCherry plasmid through Clal and EcoRI sites to make the LCR-MYH7p-mCherry'TagBFP2 construct.
- a ⁇ 1.8 kb region containing theA/T/76 promoter was PCR amplified and inserted upstream of TagBFP2 of the LCR-MYH7p-mCherry TagBFP2 through Mlul and Aflll sites to make the LCR- MYH7p-mCherry/MYH6p-TagBFP2 construct.
- a -3.8 kb region containing CRE3 and MYH7 3’-UTR was PCR amplified and inserted downstream of mCherry ofLCR-MYH7p-mCherryM ' YH6p-TagBFP2 construct.
- a dual luciferase reporter construct LCR-MYH7p-Luc2/MYH6p- Rluc with a WT MYFF7 promoter was made by replacing mCherry in the construct LCR-MYH7p- mCherry/MYH6p-TagBFP2 with a firefly luciferase gene (Luc2) and replacing TagBFP2 with a Renilla luciferase gene (Rluc).
- NCI negative control construct 1
- a -1.5 kb downstream region of MYH7 promoter (+386 to +1929) w as PCR amplified and cloned into LCR-MYH7p- Luc2/MYH6p-Rluc through BamHI and Notl sites using NEBuilder HiFi DNA assembly.
- All the fluorescent reporter lines were made using aH9 hPSC cardiomyocyte TNNT2-EGFP reporter line background.
- 2 x 10 5 hPSCs were dissociated and re-plated on a Geltrex-coated 12-well plate.
- 1 pg of each fluorescent reporter construct and a 200 ng transposase plasmid were co-transfected into the hPSCs using Lipofectamine Stem Transfection Reagent.
- the cells were selected with 1 pg/mL puromycin for 5 days. Subsequently, the cells were then split and expanded in a Geltrex-coated 6-well plate.
- 4C assays were performed as described elsewhere 66 with some modifications.
- Formaldehyde-fixed cells were resuspended in 300 pL lysis buffer for 15 minutes on ice. Cells were centrifuged at 2500g for 5 minutes. The nuclei pellet was resuspended in 50 pL of 0.5% SDS and incubated at 62°C for 10 minutes. SDS was quenched with 170 pL of 1 .47% TritonX- 100 for 15 minutes at 37°C. Nuclei were digested in a restriction enzyme buffer using the first restriction enzyme overnight at 37°C in a thermomixer shaking at 700 RPM. The next day, the digestions were stopped by incubating at 65°C for 20 minutes.
- the samples were ligated in 1 .2 mL reactions using 5 pL of T4 DNA ligase (2000 U/pL; NEB, M0202M) for 4 hours at 21 °C in a thermomixer at 700 RPM. Then, the nuclei were centrifuged at 2500g for 5 minutes. The pellet was resuspended in 550 pL of 10 mM TRIS pH7.8 and incubated at 68°C overnight with SDS and proteinase K to digest the samples and reverse crosslink. The next day, the samples were purified using 0.8 x AMPure XP beads (Beckman A63880) and eluted in 150 pL of 10 mM TRIS pH7.8.
- the samples were allowed to digest overnight using the second restriction enzyme in a thermomixer at 700 RPM. The next day, the restriction enzyme was inactivated by incubating the samples at 65°C for 25 minutes. The samples were then diluted to a final volume of 5 mL and ligated using 50 pL of T4 DNA Ligase (NEB, M0202L) at 16°C overnight. DNA was purified using overnight isopropanol precipitation and washed using 70% ethanol. Pellets were dissolved in 200 pL of 10 mM TRIS pH 7.8. purified using 1.8x AMPure XP beads, and eluted in 150 pL of 10 mM TRIS pH 7.8.
- Viewpoint-specific primers were used to amplify 1 pg of DNA in Expand Long Template PCR (Roche, 11681842001) for 30 cycles and then purified using lx AMPure XP beads. Illumina sequencing adapters were added during a second round of PCR for 10 cycles. DNA was purified using lx AMPure XP beads and submited for sequencing. Sequencing was carried out using a HiSeq 2500/4000 (50/100 bp PE; Illumina). 4C data was processed and analyzed as described elsewhere 67 using default parameters.
- RNA-seq was performed as described elsewhere 28 .
- total RNA from hPSC-CMs was extracted and purified using TRIzol (Thermo Fisher Scientific) from three independent differentiations.
- RNA-seq libraries were prepared from a 1-2 pg total RNA using the Illumina TruSeq Stranded mRNA Library’ Prep Kit Set A (RS-122-2101; Illumina) or Set B (RS-122-2102; Illumina). Sequencing was carried out using a HiSeq 2500/4000 (50/100 bp PE; Illumina). Quality check of the raw RNA-Seq data was done using FastQC version 0.11.7.
- the paired-end reads were then mapped to the UCSC human genome (GRCh38) using the STAR aligner (2.6.0c) to generate raw counts.
- the count per gene matrix was obtained and used for downstream analyses.
- the R package DESeq2 was used to identify differentially expressed genes (DEGs) between the WT and the CRE1/CRE2 DKO groups.
- the Benjamini-Hochberg multiple testing correction was applied to estimate the FDR.
- Biological-process GO enrichment (P-value ⁇ 0.01) was performed using clusterProfiler (version 4.0.) and EnrichR (version 3.1) packages with a Benjamini-Hochberg multiple testing adjustment. Gene sets with an FDR-corrected P ⁇ 0.01 were considered to be significantly enriched.
- 200,000 hPSC-CMs were dissociated and were processed as described elsewhere 29 .
- Cell suspensions were thawed at 37°C and pelleted for 5 minutes at 500g at 4°C.
- Cell pellets were resuspended in 250 pL of permeabilization buffer (5% BSA, 0.2% IGEPAL-CA630, 1 mM DTT and complete EDTA-free protease inhibitor cocktail (Roche) in PBS) and incubated on an overhead shaker for 5 minutes at 4°C, followed by centrifugation for 5 minutes at 500 g.
- permeabilization buffer 5% BSA, 0.2% IGEPAL-CA630, 1 mM DTT and complete EDTA-free protease inhibitor cocktail (Roche) in PBS
- tagmentation 40,000 nuclei were used, and the reaction volume was adjusted to 19 pL using the tagmentation buffer.
- tagmentation was performed at 37°C for 60 minutes with shaking (500 rpm).
- the samples were purified using MinElute columns (Qiagen), PCR-amplified for 9 cycles with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, 72°C 5 min, 98°C 30 s, (98°C 10 s, 63°C 30 s, 72°C 60 s) x 9 cycles, 4°C O).
- Amplified libraries were purified using MinElute columns (Qiagen) and Ampure XP Bead (Beckman Coulter). Sequencing was carried out on aNovaSeq (100 bp paired end (PE), Illumina). The raw ATAC-seq data was aligned to the human reference genome hg!9 using Bowtie2.
- Duplicate reads were marked using Picard (worldwideweb. broadinstitute.github.io/picard) MarkDuplicates and filtered out with Samtools. Peak calling was performed using MACS2to identify regions of open chromatin per sample. Each peak set per sample was then merged together using Bedtools and converted into a peak counts matrix with feature Counts from the Subread package. DESeq2 was used to find differentially enriched peaks between the WT and the CRE1/CRE2 DKO groups. Peaks were classified as differentially accessible (DA) peaks with a Bonferroni-corrected P value ⁇ 0.05 and an absolute log2 fold change > 1 between the conditions. Gene Ontology enrichment on differential peaks was performed using rGREAT (v2.3.2).
- GRCh38/hg38 Alignments between the genomes of selected vertebrates including humans (GRCh38/hg38) were downloaded from the UCSC genome browser (worldwideweb.genome.ucsc.edu/).
- the 4/17/7 promoter region was defined as 2000 bp upstream and 100 bp downstream of the annotated transcription start site of MYH7.
- the phylogenetic tree was constructed using MEGA11.
- mice To generate transgenic mice cartying the human LCR-MYH7p- mCherry/MYH6p-TagBFP2 construct, the construct was linearized and injected into C57BL/6NHsd single cell zygotes. For genotyping, tail clips were taken for genomic DNA extraction using DNeasy Blood & Tissue Kits (Qiagen). 1 pl of genomic DNA template was used for genotyping PCR. Two independent founders were recovered, no differences were detected among these two founders. Mice were outcrossed to WT Black Swiss background mice (Charles River Labs) for at least three generations for further analysis. For evolutionary developmental studies (evo-devo), adult pigs, rats, and golden hamsters were used. Cow and sheep hearts were freshly obtained commercially. For each animal heart, ventricles and atria were collected separately.
- RNA- and ATAC-sequencing data for the WT and CRE1/CRE2 DKO samples are accessible through GEO Series accession number GSE263376 (reviewer token: ehqjsmugtzmlrqp).
- the developmental RNA- seq, ATAC-seq, ChlP-seq and Hi-C samples are available online from GEO under accession numbers GSE116862 and GSE192365 28 ’ 29 .
- the cardiac MYH6 / MYH7 locus resided exclusively in a TAD containing dynamically regulated CREs that may control MYH6 and MYH7 expression
- V- CMs human adult ventricular cardiomyocytes expressed predominantly MYH7 but less MYH6
- A-CMs human adult atrial cardiomyocytes expressed primarily MYH6 but negligible amounts of MYH7 (FIG. 1A), thus demonstrating the antithetical expression of these two MYH isoforms.
- CREs cardiomyocyte-specific cv.s-regulatory elements
- Pro putative promoters
- CRE1-3 distal CREs
- hPSC human pluripotent stem cell
- transcriptomic profiles and epigenomic landscape were examined across key cardiac developmental stages during the differentiation of a H9 hPSC MYL2-H2B- GFP ventricular cardiomyocyte reporter line at the following stages: Day (D)0 hPSCs, D2 mesoderm (Mes), D5 cardiac mesoderm (cMes), D7 cardiac progenitors (CP), D15 cardiomyocytes (CMs) and D80 ventricular cardiomyocytes (vCM).
- D Day
- Mes D2 mesoderm
- cMes D5 cardiac mesoderm
- CP D7 cardiac progenitors
- CMs D15 cardiomyocytes
- vCM ventricular cardiomyocytes
- MYH7 expression was low in CPs but increased significantly during differentiation to become the predominant MYH isoform present in vCMs (FIGs. 1B-1D).
- the corresponding ATAC-seq was analyzed, which revealed CREs within the MYH6/MYH7 locus that were similar to those detected in adult human cardiomyocyte the snATAC-seq data (FIGs. 1 A and IB).
- FIG. 8A were marked by primarily H3K27Ac but not H3K4me3 (FIG. IB). supporting their role as enhancers which were shown to be conserved in the Myh6/Myh7 mouse locus of differentiating mouse cardiomyocytes (FIG. 8E).
- CRE3 is ⁇ 1.8 kb upstream ofMYH6 (FIG. 8C) and mainly accessible in vCMs, when .W7/7 is the predominant isoform expressed (FIGs. IBID). Despite its sequence being relatively well-conserved, CRE3 exhibited no H3K27ac or H3K4me3 marks (FIG. IB) nor any significant reporter luciferase activity (FIG. 8D), suggesting that this CRE may function other than an enhancer or promoter (FIG. IB).
- CRE1 and CRE2 together can form a conserved super-enhancer cluster that may act as a cardiac MYH (cMYH) locus control region (LCR) to antithetically regulate MYH6 and MYH7 expression in cardiomyocytes through its dynamic interactions with the respective MYH isoform promoters (FIG. 1G).
- cMYH cardiac MYH locus control region
- MYH6/MYH7 CRE1 and CRE2 enhancers functioned as a cMYH LCR that controlled the expression of both MYH6 and MYH7
- CRE1 and CRE2 knockout (KO) hPSC-CMs displayed significantly decreased MYH6 wd MYH7 expression compared to the wild-type (WT) control, while TNNT2 expression was not affected ( FIGs. 9A and 9F), confirming that CRE1 and CRE2 functioned as enhancers that can individually regulate both MYH6 and MYH7 expression.
- CRE1/CRE2 DKO CRE1/CRE2 double knockout hPSC line was generated and analyzed, which exhibited loss of specifically both CRE1 and CRE2 genomic sequences (FIGs. 2A and 10A). While knocking out both CRE1/CRE2 enhancers did not appear to affect hPSC-CM differentiation and TNNT2 expression (FIGs. 1 OB and 2B), it showed a significant reduction in the expression levels oiMYH6 andMYH7 in CPs, CMs and vCMs (FIGs.
- CRE1/CRE2 DKO hPSC-CMs were examined.
- a combination of 3D-bioprinted cardiac micro-tissue ( FIG. IOC) and cardiomyocyte traction force microscopy (TFM) systems were used. Consistent with the significant reduction of both mRNA and protein levels in CRE1/CRE2 DKO CMs (FIGs. 2B-2E). the contractility of CRE1/CRE2 DKO hPSC-CMs was significantly reduced compared to WT hPSC-CMs (FIGs.
- CRE1/CRE2 may function together as a cMYH LCR that can dynamically interact with a combination of promoters in a TAD-confined self-interacting MYH6/MYH 7 genomic locus to control the expression of coding (and non-coding) genes critical for regulating cardiomyocyte sarcomeric organization and contractile function.
- MYH6-MYH7 promoter competition for the cMYH LCR regulated the antithetical expression ofMYH6 and MYH7
- hPSC knockout (KO) lines harboring deletions of either the ⁇ 1.7 kb MYH6 promoter (FIG. 3A) or -1.2 kb MYH7 promoter (FIG. 3B) were created and examined.
- RNA and protein studies revealed that MYH6 promoter KO hPSC-CPs and CMs displayed significantly reduced MYH6 but increased MYH7 gene and protein expression levels compared to the CP and CM WT controls, which typically exhibited reciprocally high and low levels cd MYH6 an Y H7. respectively (FIGs. 3C and 3E).
- MYH7 promoter KO hPSC-CMs and vCMs conversely displayed a significantly reduced MYH 7 but inversely increased MYH6 gene and protein expression levels when compared to WT controls, which usually expressed low and high levels of MYH6 and MYH7. respectively in WT vCMs (FIGs. 3D and 3F).
- knocking out either MYH6 or MYH7 promoters did not affect CM or vCM differentiation since comparable levels of CMs and vCMs were observed between the WT and MYH6 or MYH7 promoter KO hPSC lines, respectively (FIGs. 11C and 12C).
- CRISPRa CRISPR activation
- CRISPRi CRISPR interference
- CRISPRa-mediated MYH7 activation significantly increased MYH7 expression but decreased MYH6 expression in hPSC-CMs (FIG. 3G)
- CRISPRi-mediatedATK777 inhibition significantly decreased MYH7 expression but increased MYH6 expression in hPSC-vCMs (FIG. 3H) as similarly observed in MYH7 promoter KO hPSC-vCMs (FIG. 3D).
- MYH6 promoter KO hPSC-CMs which displayed a ⁇ 10-fold increase in MYH7 mRNA level compared to that of MYH6 promoter KO hPSC-CPs (FIG. 3C), exhibited detectable contractility.
- this contractility remained lower than that observed in WT control hPSC-CMs (FIGs. 1 ID and 1 IE).
- TheMYH7 promoter contained key regulatory sequences for controlling its activity and MYH6-MYH7 gene switching
- the MYH6/MYH7 promoters were interrogated to identify key regulatory 7 sequences that may mediate the gene regulator ⁇ 7 switching between MYH6 andMYH7 during cardiomyocyte differentiation.
- a hPSC MYH6/MYH7 gene regulatory reporter system was developed in the H9 hPSC TNNT2-EGFP cardiomyocyte reporter line in order to examine the activity of CREs and more specific gene regulatory sequences within the MYH6MYH 7 locus, which may control MYH6 and MYH7 expression in the TNNT2-EGFP labeled cardiomyocytes (FIG. 13 A).
- MYH6 andMYH7 promoter reporter lines directing the expression of the fluorescent mCherry gene were initially generated, differentiated into TNNT2-EGFP+ CMs, and then analyzed for reporter activity. While hPSC-CMs harboring the MYH7p-mCherry transgenic reporter displayed no detectable reporter fluorescence activity in CMs, hPSC-CMs with the MYH6p-mCherry transgenic reporter exhibited minimal reporter fluorescence activity (FIG.
- a dual luciferase reporter system was generated that contained all regulatory elements of the endogenous MYH6/MYH7 locus, including the cATFHLCR and both MYH7 and MYH6 promoters, which were cloned upstream of the firefly luciferase gene (liic2) and the renilla luciferase gene (R/uc). respectively (IX'R- MYH7p-Luc2/MYH6p-RLuc, FIG. 4A).
- the A8 (-6 to +34) and A9 (+35 to +74) regions overlapped with DNA sequences of MYH7 exon 1 including the transcription start site (TSS), and the A7 (-46 to -7) region contained a TATA box sequence.
- TATA box sequence a sequence of DNA sequences of MYH7 exon 1 including the transcription start site (TSS), and the A7 (-46 to -7) region contained a TATA box sequence.
- TSS transcription start site
- Al (-286 to -247) and A3 (-206 to -167) regions harbored DNA binding motif sequences for TEA domain family member 1 (TEAD1), which has been reported to be involved in the expression o MYH7 47 ' 49 .
- the A5 (-126 to -87) region which exhibited a similarly strong effect on promoter activity as A7-9 regions when deleted, was distal to the TATA box/core promoter, demonstrating that the A5 region may also contain key DNA sequences that allow the binding of factors participating in MYH7 transcription.
- the strong inhibitory effects of deleting the A5 region in the reporter assay its role in regulating MYH7 promoter activity was unclear.
- a hPSC knockout (KO) line harboring deletions of this region was created and examined.
- CRISPR gRNAs were identified to create a A5 (-133 to -88) MYH7 promoter KO hPSC line which contained a deletion including 39 bp of the A5 region (FIG. 4E).
- the cardiomyocytes generated from this A5 (133 to -88) MYH7 promoter KO hPSC line demonstrated not only decreased MYH7 expression in both CMs and vCMs but also increased MYH6 expression in vCMs such that MYH6 became the predominant MYH isoform expressed (FIGs. 4F and 4G).
- MYH6 expression did not increase significantly in CMs (FIG.
- MYH7 is the predominant cardiac MYH isoform expressed in adult human ventricles/ vCMs, but MYH6 is the main isoform expressed in adult mouse ventricles/vCMs 8 .
- MYH6 and MYH7 expression remained to be illuminated.
- key genomic regions controlling the MF//7 promoter activity were compared and analyzed across a broad range of mammals.
- an MYH7 promoter KO hPSC line (-133 to -117) including the deletion of this A5.1 region (FIG. 5C) displayed significantly decreased MYH7 expression when differentiated into CMs and vCMs.
- an increased MYH6 expression in vCMs (FIG. 5D) was observed where instead of MYH7, MYH6 became the main MYH isoform (FIG. 5E).
- MYH6 expression was not appreciably- increased in CMs of these KO hPSCs, presumably due to the high level of existing MYH6 promoter activity and expression at this CM stage.
- the rabbit sequence contained a 2 bp mismatch, which flanked the A5.1 MYH7 promoter sequence that primarily differed between rodent species and other mammals.
- the golden hamster and guinea pig contained a 2 and 3 bp mismatch, respectively, that resided within these divergent sequences which was ⁇ 4-5 bp in mice and rats (FIG. 6A).
- 1 MYH7 promoter region may specifically regulate the differences in the cardiac MYH isoform species-specific expression between human and mouse, which primarily express MYH7 wA MYH6 in their ventricles, respectively.
- a transgenic mouse line Tg(hLCR-MYH7p-mCherry/MYH6p-TagBFP2) expressing the human LCR-MYH7p- mCherry MYH6p-TagBFP2 reporter construct was created and analyzed (FIG. 15 A). Consistent with the endogenous expression of Myh7 in embryonic mouse ventricles (FIG.
- MYH7-mCherry was specifically expressed in the ventricles of these transgenic mouse embryonic hearts (FIG. 15A). However, in contrast to the decrease in the endogenous Myh7 expression after birth in mouse ventricles. MYH p-mCherry increased its ventricular expression postnatally (FIG. 15) as similarly observed for MYFF7 in human vCMs (FIG. 1). On the other hand, M17/6/i-TagBFP2 was observed in both the atria and ventricles of these transgenic mice and continued its expression in the atria postnatally (FIG. 15 A) as observed for MYH6 in both human and mouse hearts 36 ’ 50 . However, unlike the robust increase in postnatal expression of endogenous Myh6 in mouse ventricles, MYH6p-TagBFP2 did not display a similar increase in expression in these cardiac ventricles (FIG. 15B).
- a knock-in (KI) hPSC lines were created which contained the mouse-specific 10 bp A5. 1 MYH7 promoter sequences that replaced the corresponding human-specific sequences (FIG. 6D).
- vCMs from the KI hPSC line expressed predominantly MYH6 but low levels ⁇ F MYH7. as similarly observed in mouse ventricles (FIGs. 6E and 6F).
- MYH7 promoter sequence may contribute to the differences in the mammalian species-specific expression of MYH7 andMYH6 between human and mouse. Overall, these comparative evolutionary genomic studies showed species-specific sequences within the MYH7 promoter that may provide insights into the gene regulatory mechanisms controlling the species-divergent antithetical MYH6/MYH7 expression differences across mammals (FIG. 6G).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Environmental Sciences (AREA)
- Physics & Mathematics (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Cardiology (AREA)
- Rheumatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Provided herein are methods and materials for methods and materials for treating cardiac conditions in a subject in need thereof. In some cases, provided herein are methods and materials for modulating the antithetical expression of MYH6 and MYH7 in a subject (e.g., a mammal). For example, pharmaceutical compositions (e.g., nucleic acid molecules, genetically modified cells, vectors, or combinations thereof) provided herein can be used to treat a subject having a cardiac condition.
Description
METHODS AND MATERIALS FOR TREATING CARDIAC CONDITIONS
CLAIM OF PRIORITY
This application claims the benefit of U.S. Provisional Application Serial No. 63/651,905, filed on May 24, 2024. The entire contents of the foregoing are incorporated herein by reference.
SEQUENCE LISTING
This application contains a Sequence Listing that has been submitted electronically as an XML file named “15670-0409W01.XML.” The XML file, created on May 22, 2025, is 347.286 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
TECHNICAL FIELD
The present disclosure relates to methods and materials for treating cardiac conditions in a subject in need thereof. For example, this document relates to modulating the antithetical expression of MYH6 and MYH7 in a subject (e.g., a mammal).
BACKGROUND
Cardiac conditions such as heart failure is a common disorder worldwide with a high mortality and morbidity rate. Heart failure is a complex clinical syndrome that results from any structural or functional impairment of ventricular filing or ejection of blood. Despite the efficacy of many therapies for treating cardiac conditions such as heart failure, their prevalence is increasing, especially in the aging population. Thus, novel interventions are needed to treat cardiac conditions.
SUMMARY
The present disclosure provides methods and materials for modulating the antithetical expression of MYH6 and MYH7 to treat cardiac conditions (e.g., heart failure or cardiomyopathy) in a subject (e.g., a human).
Provided herein are compositions including at least one nucleic molecule that is complementary to anMYH6 promoter region. anMYH7 promoter region, and/or a
cardiomyocyte-specific cis-regulatory element (CRE), where the at least one nucleic acid molecule includes a nucleic acid sequence including any one of SEQ ID NOs: 1- 392. Also provided herein are genetically modified cells including at least one genetic modification within an MYH gene operably linked to a cMYH Locus Control Region (LCR), where the at least one genetic modification increases MYH6 expression.
In some embodiments, the at least one genetic modification reduces MYH7 expression. In some embodiments, the at least one genetic modification includes one or more nucleic acid molecules that bind to an MYH6 promoter region, an MY H7 promoter region, and/or a CRE. In some embodiments, the one or more nucleic acid molecules include a nucleic acid sequence of any one of SEQ ID NOs: 1-392. In some embodiments, the genetically modified cell is derived from a human pluripotent stem cell (hPSCs). In some embodiments, the at least one genetic modification includes insertion, deletion, or mutation. In some embodiments, the at least one or more genetic modification is introduced using a genetic modulation system selected from the group consisting of a CRISPR activating system, a CRISPR inactivating system, a CRISPR/Cas gene KO system, a CRISPR gene KI system, a Zinc Finger Protein (ZNF) system, a Transcription Activator-like Effector Nuclease (TALEN) system, RNA interference (RNAi), guide RNA (gRNA), antisense oligonucleotides (ASOs), micro RNA (miRNA), RNA Aptamer, short hairpin RNA (shRNA), and small interfering RNA (siRNA). In some embodiments, the CRISPR activating system is a synergistic activation mediator (SAM) system.
Also provided herein are vectors including a composition described herein. In some embodiments, the vector is a viral vector or a non- viral vector. In some embodiments, the viral vector includes a lentiviral vector, an adenoviral vector, an adeno-associated viral vector (AAV), a retroviral vector, or a herpes viral vector. In some embodiments, the non-viral vector includes a nanoparticle, a liposome, a polymer, an exosome, a peptide, an extracellular vesicle, a lipid nanoparticle (LNP), or a dendrimer. In some embodiments, the vector includes a constitutive promoter, an inducible promoter, or a tissue-specific promoter.
Also provided herein are pharmaceutical compositions including a composition described herein and pharmaceutically acceptable carrier. Also provided herein are pharmaceutical compositions including the genetically modified cell described herein and pharmaceutically acceptable carrier. Also provided herein are
pharmaceutical compositions including the vector of described herein and pharmaceutically acceptable carrier.
In another aspect, this document provides methods of gene editing, the method including introducing the composition described herein and the genetic modulation system of described herein into a cell. Also provided herein are methods for increasing MYH6 expression in a subject, the method including administering to the subject a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator. Also provided herein are methods for treating a cardiac condition in a subj ect, the method including administering to the subj ect a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby treating the cardiac condition in the subject. Also provided herein are methods for improving cardiac contractility in a subject, the method including administering to the subject a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator, thereby improving cardiac contractility in the subject. Also provided herein are methods for modulating a ratio of cardiac MYH6 and MYH7 in a subject, the method including administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby modulating the ratio of cardiac MYH6 and MYH7 in the subject. Also provided herein are methods of ameliorating at least one symptom of heart failure in a subject, the method including administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby ameliorating at least one symptom of heart failure in the subject. Also provided herein are methods of reducing the risk of developing a cardiac condition in a subject, the method including administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby reducing the risk of developing a cardiac condition in the subject.
In some embodiments, the MYH7 inhibitor includes an inhibitory nucleic acid molecule, a CRISPR-based system, a Zinc Finger protein (ZNF), a Transcription Activator-like Effector Nuclease (TALEN), or a small molecule inhibitor.
In some embodiments, the inhibitory nucleic acid molecule includes at least one antisense nucleic acid molecule that targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hgl9). In some embodiments, the inhibitory nucleic acid molecule is an RNA molecule or a DNA molecule. In some embodiments, the inhibitory nucleic acid molecule includes a
gRNA, an siRNA, an shRNA, a miRNA, an ASO, an antagomir, a ribozyme, a long noncoding RNA (IncRNA), a locked nucleic acid (LNA), a synthetic RNA molecule, a synthetic DNA molecule, a DNAzyme, or a triple-forming oligonucleotide (TFO). In some embodiments, the inhibitory nucleic acid molecule targets an MYH6 promoter region, wMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element.
In some embodiments, the inhibitory nucleic acid molecule includes about 5 nucleotides to about 50 nucleotides. In some embodiments, the inhibitory nucleic acid molecule includes about 20 nucleotides. In some embodiments, the inhibitory nucleic acid molecule includes a nucleic acid sequence set forth in any one of SEQ ID NOs: 1- 392. In some embodiments, the inhibitor c MYH7 expression includes the pharmaceutical composition described herein.
In another aspect, this document provides pharmaceutical compositions including the inhibitor oiMYH7 expression described herein and a pharmaceutically acceptable carrier. In some embodiments, MYH6 activator includes a small molecule agent, a CRISPR-based system, a transcriptional activator, an mRNA-based therapeutic, or a therapeutic polypeptide. In some embodiments, the cardiac condition is cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure. In some embodiments, the cis-regulatory element is CRE1, CRE2. and/or CRE3. In some embodiments, methods described herein further includes administering to the subject one or more additional therapeutic agents for treating the cardiac condition.
In some embodiments, the one or more additional therapeutic agents include an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin-2 receptor blocker (ARB), an ARB and neprilysin inhibitor, a beta blocker, a digoxin, a diuretic, a hydralazine and isosorbide dinitrate, an 1(f) channel inhibitor, a mineralocorticoid receptor antagonist (MRA), and/or a sodium-glucose cotransporter 2 (SGLT 2) inhibitor. In some embodiments, the ACE inhibitor includes captopril, enalapril, fosinopril, lisinopril, perindopril, quinapril, ramipril, or trandolapril. In some embodiments, the ARB includes candesartan, losartan, telmisartan. or valsartan. In some embodiments, the ARB and neprilysin inhibitor includes sacubitril-valsartan. In some embodiments, the beta blocker includes bisoprolol, carvedilol, metoprolol succinate, or nebivolol. In some embodiments, the diuretic includes bumetanide, chlorothiazide, hydrochlorothiazide, indapamide, furosemide, metolazone, or
torsemide. In some embodiments, the 1(f) channel inhibitor includes ivabradine. In some embodiments, the MRA includes eplerenone or spironolactone. In some embodiments, the SGLT 2 inhibitor includes dapagliflozin or empagliflozin.
In some embodiments, the administering includes oral administration, intravenous administration, intradermal administration, subcutaneous administration, intramuscular administration, or transdermal administration. In some embodiments, the subject is a mammal.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
DESCRIPTION OF DRAWINGS
FIGs. 1A-1G. MYH6 and MYH7 were located in a topologically associating domain (TAD) that contained dynamically interacting cis-regulatory elements (CREs) which regulated antithetical MYH6 and MYH7 expression. FIG. 1A: Single-nuclei RNA (snRNA-seq) and ATAC-sequencing (snATAC-seq) datasets from the atrial and ventricular cardiac chambers of adult human hearts revealed antithetical expression and regulation o MYH6 and MYH7 specifically in atrial (A-CM) and ventricular (V- CM) cardiomyocytes. FIG. IB: An in situ Hi-C assay showed a unique TAD on chromosome 14 containing MYH6 and MY H 7 (triangle). CTCF ChlP-seq at CM stage showed that this TAD was delineated by two CTCF binding sites. The arrows underneath the CTCF peaks indicate forward and reverse CTCF motifs. RNA-seq. ATAC-seq and ChlP-seq across six key stages of human pluripotent stem cell (hPSC) cardiomyocyte differentiation revealed the dynamic transcriptomic profiles and epigenomic landscape of the MYH6/MYH7 locus. The six stages included pluripotent stem cells (PSC). mesoderm (Mes), cardiac mesoderm (cMes), cardiac progenitor
(CP), cardiomyocyte (CM) and ventricular cardiomyocyte (vCM). FIG. 1C: Bar graph shows MYH6, MY HR MYL2 and TNNT2 gene expression in CPs, CMs and vCMs. FIG. ID: The percentage of each MYH isoform (MYH6. MYH7) versus the total amount of cardiac MYH isoform was determined for CPs, CMs and vCMs. Total cardiac MYH includes MYH6 and MYH7 in cardiomyocytes. FIG. IE: Heatmap ofHi- C a.MYH6M' YH7 locus viewed from CRE1 and CRE2 enhancers (“eye” symbol) revealed dynamic interactions between MYH6 and MYH7 promoters and enhancers across the stages of cardiomyocyte differentiation. FIG. IF: 4C-seq experiments showed the interactions between \ e MYH6 promoter and CRE1, CRE2 enhancers in CMs and vCMs as viewed from the MYH6 promoter (“eye” symbol). FIG. 1G: Schematic showing a model of how CRE1 and CRE2 enhancers may together interact with the MYH6 promoter at the CP and CM stage to enhance MYH6 expression, and with the MYH7 promoter at the vCM stage to promote MYH7 expression. A-CM, atrial cardiomyocyte in FIG. 1A; V-CM, ventricular cardiomyocyte in FIG. 1A; SMC, smooth muscle cell in FIG. 1A; CRE, c/.s-regulatory element; TAD, topologically associated domain; LCR, locus control region.
FIGs. 2A-2G. MYH6/MYH7 CRE1 and CRE2 super-enhancer functioned as a cardiac MYH (cMYH) LCR that can control the expression of coding and non-coding RNAs in the TAD-defined MYH6/MYH7 locus. FIG. 2A: Schematic outlines the double knockout (DKO) strategy for deleting both CRE1 and CRE2 enhancers in hPSCs. FIG. 2B: qPCR analysis revealed MYH 6. MYH7 and TNNT2 RNA expression levels in wild-type (WT) and CRE1/CRE2 DKO hPSC-CPs, CMs and vCMs. Two independent DKO clonal lines (DK01, DK02) were analyzed. FIG. 2C: Western blot showed MYH6 and MYH7 protein levels in WT and CRE1/CRE2 DKO hPSC-CPs, CMs and vCMs. -actin was used as a loading control. FIG. 2D: RNA-seq and ATAC-seq analyses revealed the transcriptomic and chromatin accessibility' differences between WT and CRE1/CRE2 DKO hPSC-CMs at the MYH6/MYH 7 locus and adjacent genomic regions. FIG. 2E: Volcano plot shows differentially expressed genes from RNA-seq studies between WT and CRE1/CRE2 DKO hPSC- CMs (adj. p-value < 0.05 and absolute log2 fold change > 1). Genes residing in the MYH6/MYH7 TAD locus including MYH6. MYH7. MHRT. MIR208A. MIR208B were significantly reduced in CRE1/CRE2 DKO hPSC-CMs. However, nearby genes
outside this TAD including CMTM5, NGDN as well as CM marker genes including NKX2.5, GA TA4. GA7A6. TBX5, TNNT2 and TTN were not significantly changed. FIG. 2F: Volcano plot shows differentially accessible regions from ATAC-seq studies between WT and CRE1/CRE2 DKO hPSC-CMs (adj. p-value < 0.05 and absolute log2 fold change > 1). Chromatin accessible regions residing in the MYH6/MYH7 locus exhibited reduced chromatin accessibility in CRE1/CRE2 DKO hPSC-CMs. FIG. 2G: 4C-seq studies showed that the interactions between the MYH6 promoter and CRE1, CRE2 enhancers in WT hPSC-CMs were lost in CRE1/CRE2 DKO hPSC-CMs. 4C-seq studies were viewed from the MYH6 promoter (“eye” symbol). MYH7p. MYH7 promoter in FIG. 2F. For qPCR studies, data were normalized to corresponding TBP expression and were represented as the mean ± SEM (n = 3 biological replicates). Norm. Gene Expr., normalized gene expression. *P < 0.05, **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant by two-tailed Student’s t-test.
FIGs. 3A-3H. MYH6 and MYH7 promoter competitively interacted with the cMYH LCR to antithetically regulate MYH6 and MYH7 expression. FIGs. 3A and 3B: Schematic shows MYH6 promoter (MYH6p) (FIG. 3A) and MYH7 promoter (MYH7p) (FIG. 3B) knockout (KO) strategy. FIGs. 3C and 3D: MYH6 and MYH7 gene expression was measured by qPCR in wild-type (WT) versus MYH6p KO hPSC-CPs, CMs (FIG. 3C) and WT versus MYH7p KO hPSC-CMs, vCMs (FIG. 3D). Three independent hPSC KO clonal lines (KO 1-3) were analyzed. FIGs. 3E and 3F: Western blot showing MYH6 and MYH7 protein expression in WT versus MYH6p KO hPSC-CMs (FIG. 3E) and WT versus MYH7p KO hPSC-vCMs (FIG. 3F). P-actin was used as a loading control. FIG. 3G: Schematic outlining the MYH7 promoter CRISPR-based activation strategy. qPCR shows the MYH6 and MYH7 gene expression levels in hPSC-CMs after activating the MYH7 promoter using a CRISPR- based activation system. FIG. 3H: Schematic outlining the MYH7 promoter CRISPR- based interference strategy. qPCR shows the MYH6 wAMYH7 gene expression levels in hPSC-vCMs after inhibiting the MYH7 promoter using a CRISPR-based inhibition system. Two gRNAs targeting different region of the MYH7 promoter were used for CRISPR activation and inhibition studies (sgMYH7-a/i-l and 2), respectively. A nontargeting control sgRNA (sgNC) was used as a negative control for comparison. LCR,
locus control region; Pro, promoter. qPCR data were normalized to corresponding TBP expression and were represented as the mean ± SEM (n = 3 biological replicates). Norm. Gene Expr., normalized gene expression. *P < 0.05; **P < 0.01; ***P < o.OOl; ****p < 0.0001; ns, not significant by two-tailed Student’s t-test.
FIGs. 4A-4G. Interrogating genomic regions of the MYH7 promoter revealed key sequences directing gene regulation between MYH6 andMYH7. FIG. 4A: Schematic illustrating how the dual luciferase MYH6 and MYH7 reporter construct (bottom diagram) was generated based on the endogenous MYH6/MYH7 locus (top diagram). FIG. 4B: Luciferase reporter constructs generated and used for luciferase reporter assays are outlined. Luciferase reporter assay showed that deletions in a 400 bp region of the MYH7 promoter (-286 to +114) significantly reduced MYH7 promoter activity (outlined in a box), whereas deletions upstream (-772 to -186) or dow nstream of this region (+114 to +386) displayed less effect on MYH7 promoter activity (n = 3 biological replicates). NCI was a negative control construct which contained a ~1.2 kb deletion (-772 to +386) of the MYH7 promoter. FIG. 4C: Schematic showing luciferase reporter constructs containing a series of 40 bp deletions (Al -10), which were used to identify regions of promoter regulator ' activity' in the 400 bp MYH7 promoter region (- 286 to +114). NC2 was a negative control construct which contained a 400 bp MYH7 (-286 to +114) deletion. Bottom bar graph shows the relative luciferase activity of hPSC-CMs containing control (WT, NC2) or deleted MYH7 promoter reporter constructs (n = 4 biological replicates). FIG. 4D: The annotated MYH7 promoter sequence from -286 to +114 contained two TEAD1 binding sites, a TATA box and TSS/Exonl as labeled. FIG. 4E: A5 (-133 to -88) MYH7 promoter KO hPSC line was generated by deleting -133 to -88 MYH7 promoter sequences and confirmed by Sanger sequencing. Two gRNAs (gRNAl and gRNA2) as shown in FIG. 4D were used to target this region for deletion (region flanked by two arrows). Sequence regions labeled ‘"a” and “b” in FIG. 4D flank the deleted region. FIG. 4F: MYH6 and MYH7 expression was measured by qPCR in WT and A5 (-133 to -88) MYH7 promoter KO hPSC-CMs and vCMs. Three independent clonal lines (KO 1-3) were analyzed. FIG. 4G: The percentage of each MYH isoform (MYH6, MYH7) versus the total amount of MYH isoform was determined in WT and A5 (-133 to -88) MYH7 promoter KO hPSC-CMs and vCMs.
The arrow indicates the transcription start site (TSS) in FIGs. 4B and 4C. LCR, locus control region; MYH6p. MYH6 promoter; MYH7p. MYH7 promoter; I.uc2. firefly luciferase gene; Rluc, Renilla luciferase gene; WT, wild-type. qPCR data were normalized to corresponding TBP expression and are represented as the mean ± SEM (n = 3 biological replicates). Norm. Gene Expr., normalized gene expression. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant by two-tailed Student’s t-test.
FIGs. 5A-5E. MYH7 promoter A5 region contained evolutionary divergent DNA sequences that are crucial for controlling the antithetical expression of human MYH6 W MYH7. FIG. 5A: Alignment of syntenic genomic sequences revealed regions of conservation of the MYH7 promoter region across several mammalian species (green regions). Within the A5 MYH7 promoter region (-126 to -87), which displayed promoter activity, there were sequences that specifically diverged between rodent species and most other mammals, particularly a ~10 bp region (-126 to -117) (outlined with box). Rodent species are labeled as squirrel, Chinese_hamster, golden_hamster, mouse, rat, naked_mole-rat, guinea pig, chinchilla, and brush-tailed _rat. The conservation of this region calculated by PhyloP of 100 vertebrate species is shown below. FIG. 5B: Serially interrogating promoter activity across the A5 MYH7 promoter region (-126 to -87) using luciferase reporter assays uncovered key sequences regulating MYH7 promoter activity including the evolutionary divergent A5.1 DNA sequences (-126 to -117 sequences) (n = 3 biological replicates).
Schematic above shows reporter deletion constructs used to analyze the activity of the A5 MYH7 promoter region. FIG. 5C: -133 to -117 MYH7 promoter sequences were deleted using CRISPR/Cas9 to generate a hPSC KO line that included deletion of the A5. 1 sequences, which was confirmed by Sanger sequencing. FIG. 5D: MYH6 and MYH7 expression was analyzed by qPCR in wild-type (WT) and A5.1 (-133 to -117) MYH7 promoter KO hPSC-CMs and vCMs. Three independent KO clonal lines (KOI -3) were analyzed. FIG. 5E: The percentage of each MYH isoform (MYH6, MYH7) versus the total amount of MYH isoform is shown for WT and A5.1 (-133 to - 1 VT)MYH7 promoter KO hPSC-CMs and vCMs. qPCR data were normalized to corresponding TBP expression and were represented as the mean ± SEM (n = 3
biological replicates). *P < 0.05; **P < 0.01; ***P < 0.001; ****p < 0.0001 by two- tailed Student’s t-test.
FIGs. 6A-6G: Evolutionary divergent DNA sequences in the A5 MYH7 promoter region regulated the opposing MYH6 and MY H7 expression differences in the ventricles between rodent and other mammalian species. FIG. 6A: Comparing the A5 MYH7 promoter regions across different mammals uncovered divergent promoter sequences between rodent and non-rodent mammalian species. Left panel shows the phylogenetic tree constructed using MYH7 promoter genomic sequences. Right panel shows the sequences of A5 MYH7 promoter region (indicated by a line above) in selected mammals. Shown are the nucleotides sequences that differ between some mammalian species. The box outlines genomic sequences that particularly diverged among mammals in the A5 MYH7 promoter region. FIG. 6B: qPCR analyses showed the expression levels o MYH6 and MYH 7 in both the atria and ventricles across several mammalian species (n > 3). FIG. 6C: Analyzing the percentage &YMYH6 and MYH7 versus the total amount of both MYH isoforms in these hearts revealed that the ventricles of rodent-related species predominantly expressed MYH6 whereas those from non-rodent mammals mainly expressed MYH7 however, MYH6 was expressed primarily in the atria across all analyzed mammals. FIG. 6D: The syntenic sequences of the mouse A5. 1 Myh7 promoter region (10 bp) was knocked into the human MYH7 promoter (-126 to -1 17) to create a hPSC knock-in (KI) line that harbors the divergent mouse A5.1 MYH7 promoter DNA sequences (A5.1 Mouse-to-Human MYH7 promoter KI). FIG. 6E: qPCR revealed that in contrast to wild-type (WT) control hPSC-vCMs. A5.1 Mouse-to-Human (M-to-H) MYH7 promoter KI hPSC- vCMs expressed higher levels oYMYH6 than MYH7. Two independent KI clonal lines (KI-1, 2) were analyzed. FIG. 6F: The percentage of each MYH isoform (MYH6, MYH7) versus the total amount of MYH isoform was determined in WT versus A5.1 M-to-H MYH7 promoter KI hPSC-vCMs. FIG. 6G: Schematic models showing how the cMYH CR competitively interacts with MYH6 and MYH7 promoters in ventricular CMs and how key sequences in the MYH7 promoter regulate this competitive interaction to control the antithetical expression of MYH6 and MYH7. qPCR data in (FIG. 6E) were normalized to corresponding TBP expression and were represented as
the mean ± SEM (n = 3 biological replicates). **P < 0.01: ***P < 0.001; ****P < 0.0001 by two-tailed Student's t-test.
FIGs. 7A-7E. MYH7 promoter CRISPR interference (CRISPRi) modified cardiac disease phenotype of MYH7 mutant ventricular cardiomyocytes (vCM). FIGs. 7A and 7B: a-Actinin immunostaining (FIG. 7A) and quantitation of sarcomere organization (FIG. 7B) showed that sarcomeres oiMYHY Exon 13-deleted (Ex 13 KO) hPSC-vCMs were disorganized, whereas sarcomeres of MYH1 promoter-deleted (MYH7p KO) hPSC-vCMs were well organized as similarly observed in wild- type (WT) vCMs. CRISPRi targeting YsMYH7 promoter (sgMYH7-l# or 2# sgRNAs), which reduced MYH7 expression but increased MYH6 expression, significantly improved the disorganized sarcomere phenotype mMYH7 Ex 13 KO vCMs. However, CRISPRi using a negative control sgRNA (sgNC) did not affect the disorganized sarcomere phenotype. The outlined areas in each image were magnified and shown on the right. Top diagrams above each image illustrate the MYH6 and MY H7 promoter interactions with the LCR and the MYH gene isoform expression under each condition. FIG. 7C: Bright-field images revealed that MYH7 Exl3 KO but not MYH7 promoter KO vCMs formed fibrotic aggregates, and CRISPRi treatment with sgMYH7-l# or 2# (but not sgNC control) reduced these aggregates m MYH7 Ex 13 KO vCMs (Exl3-KO sgMYH7-l# & 2#). FIG. 7D: Cardiomyocyte (CM) contractility was reduced in MYH7 Ex 13 KO vCMs compared to WT or MYH7 promoter KO vCMs. CRISPRi targeting the MYH7 promoter with either sgMYH7-l# or 2# but not sgNC control significantly improved the contractility' of MYH7 Exl3 KO vCMs. FIG. 7E: MYH7 and MY H 6 gene expression was quantitated by qRT-PCR analysis for each treated hPSC 1 ; ***P < 0.001; ****P < 0.0001; ns, not significant by two-tailed Student’s t-test.
FIGs. 8A-8E. CRE1 and CRE2 cA-regulatory elements (CREs) displayed enhancer reporter activity, but not CRE3. FIGs. 8A and 8C: UCSC genome browser view of MYH6/MYH7 locus showed that CRE1, CRE2 (FIG. 8A) and CRE3 (FIG. 8C) sequences were relatively conserved across vertebrate species as calculated by PhyloP of 100 vertebrate species. The length of each element was defined by ATAC-seq peaks. FIGs. 8B and 8D: Luciferase reporter assays revealed that CRE1 and CRE2
displayed enhancer activity (FIG. 8B), but CRE3 did not (FIG. 8D). Based on ATAC-seq peaks and conservation, two different lengths of the CRE3 (600 bp and 1.2 kb) were tested in the luciferase reporter assay (FIG. 8D). Schematic diagrams of luciferase reporter assay strategies are shown above the bar graphs. FIG. 8E: H3K27ac ChlP-seq profiles are show n across the MYH6/MYH7 locus for each indicated cardiac developmental stage during human and mouse PSC-CM differentiation. Mouse data was lifted-over and mapped onto the human genome. CRE, -regulatory element; TK, human thymidine kinase. ***P < 0.001; ns, not significant by two-tailed Student’s t-test.
FIGs. 9A-9I. CRE1 and CRE2 cA-regulatory elements (CREs) functioned as enhancers that regulated both MYH6 and MYH1 expression. FIGs. 9A, 9D, and 9G: Schematic showing a CRE knockout (KO) strategy for CRE1 (FIG. 9A), CRE2 (FIG. 9D) and CRE3 (FIG. 9G). UCSC genome browser view' of each CRE show ing the two gRNAs that were designed according to the ATAC-seq peaks to delete the CRE1, CRE2 or CRE3 in hPSCs using CRISPR/Cas9. FIGs. 9B, 9E, and 9H: PCR genotyping confirmed the generation of three independent clonal lines (KO1-KO3) for each CREs. Four pairs of primers were used for genotyping as shown in FIG. 9B inset. FIGs. 9C, 9F, and 91; qPCR analysis showing the expression levels o MYH6, MYH7. and TNNT2 in wild-type (WT) versus CRE1 (FIG. 9C). CRE2 (FIG. 9F) KO hPSC-CMs, and WT versus CRE3 (FIG. 91) hPSC-vCMs. WT, wild type; M, DNA marker. qPCR data w ere normalized to corresponding TBP expression and w ere represented as the mean ± SEM (n = 3 biological replicates). *P < 0.05. **P < 0.01, ***P < 0.001; ns, not significant by two-tailed Student’s t-test.
FIGs. 10A-10J. CRE1/CRE2 double knockout (DKO) human CMs displayed cellular, molecular, and functional defects. FIG. 10A; Schematic showing a CRE1/CRE2 double knockout (DKO) strategy. PCR genotyping confirmed that two independent CRE1/CRE2 DKO clonal lines (DKO1, DKO2) were generated. FIG. 10B: Flow cytometry analyses by TNNT2 immunostaining showed that CM differentiation efficiency w as similar between the wild-type (WT) and the CRE1/CRE2 DKO hPSC lines (n = 3 biological replicates). FIG. 10C; Schematic illustrating the strategy of 3D cardiac tissue assay. Top panel illustrates 3D schematic
of a full 3D cardiac tissue-measuring scaffold. Bottom panel shows merged fluorescent and brightfield images of fully printed representative sample with encapsulated cells (scale bar = 500 pm). FIG. 10D: CM contractility measured by 3D cardiac tissue assay showed that beating force is reduced in CRE1/CRE2 DKO hPSC- CMs compared to WT hPSC-CMs (n = 5 biological replicates). FIG. 10E: Single cardiomyocyte traction force microscopy (TFM) studies showed that CRE1/CRE2 DKO hPSC-CMs exhibited reduced contractility compared to WT hPSC-CMs as detected by peak strain energy analyses (WT, n = 16; DKO1, n = 18; DKO2, n =17 individual cardiomyocytes). FIG. 10F: Beating rate measured in 3D cardiac tissue showed no significant difference in CRE1/CRE2 DKO hPSC-CMs compared to WT hPSC-CMs (n = 5 biological replicates). FIGs. 10G and 10H: ot-ACTININ immunostaining (FIG. 10G) and quantitation of sarcomeric organization (FIG. 10H) revealed that sarcomeres of CRE1/CRE2 DKO hPSC-CMs were significantly less organized than that of WT hPSC-CMs. Boxed areas shown in FIG. 10G were magnified. Sarcomeric organization index (FIG. 10H) was assessed based on sarcomeric measurements from a- ACTININ immunostaining studies (n
20 individual cardiomyocytes for each group). The center line in the box and whisker plots (FIG. 10H) denotes the median value while the box contains the 25lhto 75th percentiles of dataset. The whiskers mark the minimum and maximum values. Scale bars, 20 pm. FIG. 101: Gene ontology (GO) term analysis is shown for differentially expressed genes between WT and CRE1/CRE2 DKO hPSC-CMs. FIG. 10J: GREAT-term analysis is shown for differentially accessible chromatin regions between WT and CRE1/CRE2 DKO hPSC-CMs. LCR, locus control region; Pro, promoter; WT, wild type; M, DNA marker; BPM, beats per minute. ****P < 0.0001 ; ns, not significant by two-tailed Student’s t-test.
FIGs. 11A-11H. MYH6 promoter knockout (KO) hPSC-CMs display reduced contractility and disorganized sarcomeres compared to wild-type (WT) hPSC-CMs. FIG. 11A: Schematic illustrating MYH6 promoter (MYH6p) hPSC knockout (KO) strategy'. UCSC genome browser view of MYH6 promoter region shows the two gRNAs that were used based on ATAC-seq peaks to delete MYH6 promoter in hPSCs using CRISPR/Cas9. FIG. 11B: PCR genotyping confirmed the generation of three MYH6p KO clonal lines (KOI -3). FIG. 11C: Flow cytometry analyses by TNNT2
immunostaining showed CM differentiation efficiency was similar between wild-type (WT) and MYH6p KO hPSC lines (n = 3 biological replicates). FIG. 11D: 3D cardiac tissue assay showed that MYH6p KO hPSC-CMs displayed reduced contractility compared to that of WT hPSC-CMs (n = 5 biological replicates). FIG. HE: Single cardiomyocyte traction force microscopy (TFM) studies showed that MYH6p KO hPSC-CMs exhibited reduced contractility compared to WT hPSC-CMs as measured by peak strain energy analyses (WT. n = 17: KOI, n = 17; KO2, n =18: KO3. n = 17 individual cardiomyocytes). FIG. HF: Beating rate measured in 3D cardiac tissue showed no significant difference between MYH6p KO hPSC-CMs and WT hPSC- CMs (n = 5 biological replicates). FIGs. 11G and 11H: a- ACTININ immunostaining (FIG. 11G) and quantitation of the sarcomeric organization (FIG. 11H) revealed that sarcomeres oYMYH6p KO hPSC-CMs exhibited heterogeneously organized sarcomeres. Arrows point to regions displaying well- organized sarcomeres, whereas arrowheads point to areas displaying disorganized sarcomeres. Boxes in FIG. 11G show well-organized sarcomeres or disorganized sarcomeres. Sarcomeric organization index (FIG. 11H) was assessed based on sarcomeric measurements from a-ACTININ immunostaining studies (n > 30 individual cardiomyocytes for each group). The center line in the box and whisker plots (FIG. 11H) denotes the median value while the box contains the 25 th to 75th percentiles of dataset. The whiskers mark the minimum and maximum values. Scale bars, 20 pm. LCR, locus control region; Pro, promoter; MYH6p, MYH6 promoter; WT, wild type; M, DNA marker; BPM, beats per minute. ***P < 0.001; ****P < 0.0001; ns, not significant by two-tailed Student’s t- test.
FIGs. 12A-12H. MYH7 promoter knockout (KO) and wild-type (WT) hPSC-vCMs exhibited similar contractility and sarcomeric organization. FIG. 12A: Schematic illustrating MYH7 promoter (MYH7p) hPSC knockout (KO) strategy. UCSC genome browser view of MYH7 promoter region shows the two gRNAs that were selected based on ATAC-seq peaks to generate \he MYH7 promoter KO hPSC line by CRISPR/Cas9. FIG. 12B: PCR genotyping confirmed the generation of three MYH7p KO clonal lines (KO 1-3). FIG. 12C: Flow' cytometry analyses by MYL2-H2B-GFP showed that the ventricular CM differentiation efficiency was similar between w ild- type (WT) and MYH7p KO hPSC lines (n = 3 biological replicates). FIG. 12D: 3D
cardiac tissue assay revealed that cardiomyocyte contractility was similar between WT and MYH7p KO hPSC-vCM (n = 5 biological replicates). FIG. 12E: Single cardiomyocyte traction force microscopy (TFM) studies showed that cardiomyocyte contractility as measured by peak strain energy was similar between WT and MYH7p KO hPSC-vCM (WT, n = 17; KOI, n = 18; KO2, n =19; KO3, n = 18 individual cardiomyocytes). FIG. 12F: Beating rate measured in 3D cardiac tissue showed no significant difference between WT and MYH7p KO hPSC-vCM (n = 5 biological replicates). FIGs. 12G and 12H: a-ACTININ immunostaining (FIG. 12G) and quantitation of the sarcomeric organization (FIG. 12H) showed that WT and MYHlp KO hPSC-vCMs displayed similar sarcomeric organization. Boxed regions shown in FIG. 12G were magnified and shown on the right. Sarcomeric organization index (FIG. 12H) was assessed based on sarcomeric measurements from a-ACTININ immunostaining studies (n > 30 individual cardiomyocytes for each group). The center line in the box and whisker plots (FIG. 12H) denotes the median value while the box contains the 25*10 75th percentiles of dataset. The whiskers mark the minimum and maximum values. Anti-a-ACTININ, DAPI, and MYL2-H2B-EGFP were used to stain the cells. Scale bars, 20 pm. LCR, locus control region; Pro, promoter; MYH7p. MYH7 promoter; WT, wild ty pe; M, DNA marker; BPM, beats per minute, ns, not significant, two-tailed Student's t-test.
FIGs. 13A-13C. Transgenic fluorescent reporter assays revealed that cardiac MYH6/MYH7 (cMYH) LCR can enhance MYH6 and MYH7 promoter activity7. FIG. 13A: Schematic showing the genomic regions of the human MYH6/MYH7 locus that were used for examining the enhancer/promoter activity of cis-regulatory elements (CRE) in fluorescent transgenic reporter assays. These regions included the -7.7 kb cMYH LCR containing the CRE1 and CRE2 enhancers, a -2.7 kb region containing the MYH7 promoter (MYH7p) with the region used for further interrogation in FIG. 4B (shaded box), a ~1.8 kb region containing theMYH6 promoter (MYH6p) and a -3.8 kb region containing the CRE3. FIGs. 13B and 13C: Fluorescent transgenic reporter assays revealed that MYH6 but not MYH7 promoter displayed basal promoter activity7 (FIG. 13B), and the cMYH LCR was able to enhance the activity7 of both MYH6 and MYH7 promoter (FIG. 13C). LCR, locus control region.
FIG. 14. Comparative genomic analyses revealed conserved and divergent sequences within syntenic regions of the l’7/7 promoter region across several vertebrate species. MYH7 promoter sequences were relatively conserved across vertebrate species as calculated by PhyloP of 100 vertebrate species. The 400 bp region of the MYH7 promoter and the region within this 400 bp sequence that displayed relatively low conservation of sequences compared to other regions are shown. Detailed interrogation of the 400 bp region of the MF/77 promoter uncovered specific genomic regions that were conserved or diverged across specific mammalian species. Regions that were conserved as well as those not conserved are shown. Al -10 (-286 to +114 ) correspond to MYH7 promoter regions that were deleted for the luciferase reporter assays. Rodent species are labeled as Squirrel. Leser Egyptian Jerboa, Prairie vole, Chinese_hamster, Golden_hamster, Mouse, Rat, Naked_mole-rat, Guinea_pig, Chinchilla, and brush-tailed_rat. Shown are the DNA sequences within the A5 MYH7 promoter region that diverged specifically in rodent species. Also shown are the DNA sequences within the A4 MYH7 promoter region that were generally less well conserved across mammals.
FIGs. 15A and 15B. Human LCR-MYH7 promoter drove mCherry reporter in Tg(hLCR-MYH7p-mCherry, MYH6p-TagBFP2) mouse ventricles postnatally. recapitulating the expression of human MYH7 in human ventricles. FIG. 15A: Schematic showing the human construct that was used for generating the Tgfhl.CR- MYH7p-mCherry/MYH6p-TagBFP2) mouse transgenic line. The construct was created using genomic regions of the MYH6/MYH7 locus including a -7.7 kb LCR containing CRE1 and CRE2 enhancers, a -2.7 kb region containing the MYH7 promoter (MYH7p), a ~1.8 kb region containing the MYH6 promoter (MYH6p) and a -3.8 kb region containing CRE3. Fluorescence images show the expression of MYH7p-mChcrry and MYH6p-TagBFP2 in the heart of embryonic day 12 (E12), postnatal day 1 (Pl) and postnatal day 15 (Pl 5) Tg(lLCR-MYH7p-mCherry/MYH6p- TagBFP2) mice. Atria (A) and Ventricle (V) are indicated in bright field images.
FIG. 15B: qPCR analysis showing the expression of Myh6, Myh7, MYH7p-mCherry andMYH6p-TagBFP2 in the ventricles of E12 (n = 4), Pl (n = 3) and P15 (n = 3) transgenic mice.
DETAILED DESCRIPTION
Cardiac conditions such as heart failure is a common disorder worldwide with a high mortality and morbidity rate. Heart failure is a complex clinical syndrome that results from any structural or functional impairment of ventricular filing or ejection of blood. At the cellular level, several factors have been implicated in the decline of cardiac performance, including changes in cardiac contractility. Sarcomeres are the fundamental functional unit of contractility in myocytes and consists of two major contractile myofilament protein complexes, which are a thick myosin filament and a thin actin filament. Myosin heavy chain (MYH) proteins function as the molecular motors that produce sliding between the thick and the thin myofilaments, thus resulting in sarcomere contractility. In mammalian hearts. MYH6 and MYH7 also known as a-MHC and [3-MHC, respectively, serve as the primary myosin heavy chain proteins. MYH6 and MYH7 are antithetically expressed at different ratios according to the cardiomyocyte cell ty pe and state (e.g., developmental or disease states) as well as across diverse mammalian species. As such, atrial cardiomyocytes primarily express MYH6, whereas ventricular cardiomyocytes exhibit species-specific MYH6 and MYH7 expression. For example, mature ventricular cardiomyocytes in human and larger mammals (e.g., dogs and pigs) predominantly express MYH7 with low expression of MYH6. In contrast, ventricular cardiomyocytes in rodent-specific species predominantly express MYH6 and negligible MYH7 in adulthood but express relatively high MYH7 and low- MYH6 during embryogenesis. Under cardiac stress and pathological conditions, adult mammalian ventricular cardiomyocytes respond by decreasing the expression of MYH6 while increasing the expression of MYH7. Since MYH6 displays greater ATPase activity and actin sliding velocity compared to MYH7, decreasing the expression of MYH6 and increasing the expression of MYH7 in cardiac conditions can have significant effects on cardiac contractility resulting in the decline in cardiac performances. However, the fundamental basis of how gene regulatory systems establish and control the antithetical expression oiMYH6 and MYH7. and the reasons for their divergent expression of their expression across different mammals, particularly in the ventricles, remain unclear.
Provided herein are the foundational discoveries that MYH6 and MYH7 are located together on a topological activating domain (TAD)-defmed genomic locus, which contains a super-enhancer upstream of MYH7 that serves as a locus control
region (LCR). The LCR dynamically regulates the antithetical expression of MYH6 W MYH7. as well as the expression of other genes within this TAD, including mir- 208a, mir-208b, and Myosin Heavy Chain- Associated RNA Transcript (MHRT). The present methods show that MYH6 and MYH7 promoters competitively interact with a shared cardiac MYH (cMYH) LCR to control the expression of specific MYH isoform ( . ., MYH 6 or MYH7) in cardiomyocytes.
In summan; the present methods demonstrate the genetic regulatory mechanism that controls the antithetical expression of MYH6 and MYH7 in a cell-state and species-specific manner. Thus, described herein are methods and materials for modulating the antithetical expression of MYH6 and MYH7 to treat cardiac conditions (e.g., heart failure or cardiomyopathy).
Composition
Nucleic Acid Molecules
Provided herein are compositions comprising at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, or a cardiomyocyte-specific cis- regulatory element (CRE). For example, a CRE can be CRE1, CRE2, and/or CRE3. In some embodiments, the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region. In some embodiments, the compositions provided herein comprises at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary' to an MYH7 promoter region. In some embodiments, the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary7 to a cardiomyocyte-specific cis-regulatoiy element (CRE). In some embodiments, the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary' to an MYH6 promoter region and an MYH7 promoter region. In some embodiments, the compositions
provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region and a CRE. In some embodiments, the compositions provided herein comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH7 promoter region and a CRE. In some embodiments, the compositions provided herein comprises at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary' to an MYH6 promoter region, an MYH7 promoter region, and a CRE.
In some embodiments, the compositions provided herein include a nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392. In some embodiments, the nucleic acid molecule present in a composition provided herein is a guide RNA (gRNA) or an oligonucleotide (e.g.. an RNA molecule or a DNA molecule). In some embodiments, the nucleic acid molecule present in a composition provided herein is an inhibitory nucleic acid molecule (e.g., anMYH7 inhibitor). For example, the nucleic acid molecule provided herein (e.g., an inhibitory nucleic molecule) can be a gRNA, an siRNA, an shRNA, a miRNA, an ASO. an antagomir, a ribozyme, a long noncoding RNA (IncRNA). a locked nucleic acid (LNA), a synthetic RNA molecule, a synthetic DNA molecule, a DNAzyme, or a triple-forming oligonucleotide (TFO). In some embodiments, the nucleic acid molecule present in a composition provided herein is an activating nucleic acid molecule (e.g., wMYH6 activator). For example, the nucleic acid molecule provided herein (e.g., an activating nucleic molecule) can be a CRISPR-based system, a transcriptional activator, or an mRNA-based therapeutic.
In some embodiments, the nucleic acid molecule provided herein (e.g., an MYH7 inhibiting nucleic acid molecule or m MYH6 activating nucleic acid molecule) includes a nucleic acid sequence that is from about 5 to about 50 nucleotides in length (e.g., from about 5 nucleotides to about 10 nucleotides, from about 10 nucleotides to about 13 nucleotides, from about 13 nucleotides to about 15 nucleotides, from about 15 nucleotides to about 20 nucleotides, from about 20 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30
nucleotides to about 35 nucleotides, from about 35 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 45 nucleotides, or from about 45 nucleotides to about 50 nucleotides). In some cases, the nucleic acid molecule provided herein includes a nucleic acid sequence that is about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49. or 50 nucleotides in length. In some embodiments, the nucleic acid molecule provided herein comprises about 20 nucleotides.
In some embodiments, the nucleic acid molecule (e.g., anMYH7 inhibiting nucleic acid molecule or an MYH6 activating nucleic acid molecule) present in a composition provided herein targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hgl9). In some embodiments, the nucleic acid molecule (e.g., gRNA or an oligonucleotide) present in a composition provided herein is designed based on a sequence of nucleic acid encoding an MYH7 promoter region that is well known in the art. In some cases, the compositions provided herein include a nucleic acid molecule that is complementary to wMYH7 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-4, 9-13, and 210-392. In some embodiments, the nucleic acid molecule that is complementary to anMYH7 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 1 -4, 9- 13, and 210-392.
In some embodiments, the nucleic acid molecule (e.g., gRNA or an oligonucleotide) present in a composition provided herein is designed based on a sequence of nucleic acid encoding an MY H 6 promoter region that is well known in the art. In some cases, the compositions provided herein include a nucleic acid molecule that is complementary to an MYH6 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 5-8, 14, 15, and 22-209. In some embodiments, the nucleic acid molecule that is complementary to an MYH6 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 5-8, 14, 15, and 22-209.
In some embodiments, the nucleic acid molecule (e.g., gRNA or an oligonucleotide) present in a composition provided herein is designed based on a sequence of nucleic acid encoding a CRE1 polypeptide that is well known in the art. In some cases, the compositions provided herein include a nucleic acid molecule that is complementary' to CRE1 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 16 and 17. In some embodiments, the nucleic acid molecule that is complementary- to CRE1 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 16 and 17.
In some embodiments, the nucleic acid molecule (e.g., gRNA or an oligonucleotide) present in a composition provided herein is designed based on a sequence of nucleic acid encoding a CRE2 polypeptide that is well known in the art. In some cases, the compositions provided herein include a nucleic acid molecule that is complementary- to CRE2 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 18 and 19. In some embodiments, the nucleic acid molecule that is complementary- to CRE2 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 18 and 19.
In some embodiments, the nucleic acid molecule (e.g., gRNA or an oligonucleotide) present in a composition provided herein is designed based on a sequence of nucleic acid encoding a CRE3 polypeptide that is yvell known in the art. In some embodiments, the compositions provided herein include a nucleic acid molecule that is complementary to CRE3 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 20 and 21. In some embodiments, the nucleic acid molecule that is complementary to CRE3 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 20 and 21.
Genetically Modified Cells
The nucleic acid molecules provided herein can be used to make a genetically modified cell comprising at least one genetic modification (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) within mMYH gene that is operably linked to a cMYH LCR. In
some embodiments, the genetic modification targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hgl9). In some embodiments, the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) that bind (e.g., complementary) to anMYH6 promoter region, mMYH7 promoter region, or a CRE. In some embodiments, the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary) to anMYH6 promoter region. In some embodiments, the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary) to anMYH7 promoter region. In some embodiments, the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary ) to a CRE. In some embodiments, the genetic modification in a genetically modified cell described herein includes one or more nucleic acid molecules that bind (e.g., complementary’) to an MYH6 promoter region, an MYH7 promoter region, and a CRE.
In some embodiments, the one or more nucleic acid molecule described herein to make a genetically modified cell includes a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392. In some embodiments, the genetically modified cells include a nucleic acid molecule that binds to an MYH7 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-4, 9-13, and 210-392. In some embodiments, the nucleic acid molecule that binds to an MYH7 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 1-4, 9-13, and 210-392.
In some embodiments, the genetically modified cells include a nucleic acid molecule that binds to an MYH6 promoter region and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 5-8, 14, 15, and 22-209. In some embodiments, the nucleic acid molecule that binds to an MYH6 promoter region includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 5-8, 14, 15, and 22-209.
In some embodiments, the genetically modified cells include a nucleic acid molecule that binds to CRE1 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 16 and 17. In some embodiments, the nucleic acid molecule that binds to CRE1 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 16 and 17.
In some cases, the genetically modified cells include a nucleic acid molecule that binds to CRE2 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 18 and 19. In some embodiments, the nucleic acid molecule that binds to CRE2 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 18 and 19.
In some embodiments, the genetically modified cells include a nucleic acid molecule that is complementary to CRE3 and comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 20 and 21. In some embodiments, the nucleic acid molecule that binds to CRE3 includes a nucleic acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 20 and 21.
In some embodiments, the genetic modification reduces MYH7 expression in a genetically modified cell described herein. For example, the level of MYH7 polypeptide can be lower in the genetically modified cell as compared to the level of MYH7 polypeptide in pre-engineered cells (e.g., untreated cell or control cell). In some embodiments, the genetic modification reduces MYH7 expression in a genetically modified cell by at least 3% (e.g., (e.g., at least 5%, at least 7%. at least 12%, at least 17%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%).
In some embodiments, the genetic modification increases MYH6 expression in the genetically modified cell described herein. For example, the level of MYH6 polypeptide can be higher in the genetically modified cell as compared to the level of MYH6 polypeptide in pre-engineered cells (e.g., untreated cell or control cell). In some embodiments, the genetic modification increases MYH6 expression in a genetically modified cell by at least 3% (e.g., (e.g., at least 5%, at least 7%. at least
12%, at least 17%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%). In some embodiments, the genetic modification reduces MYH7 expression while increasing MYH6 expression in a genetically modified cell described herein.
Any appropriate gene editing methods can be used to introduce a genetic modification comprising at least one genetic modification (e.g.. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) within an MYH gene that is operably linked to a cMYH LCR. Also provided herein are methods of gene editing that comprises introducing one or more nucleic acid molecules or compositions provided herein into a cell. Any appropriate gene editing methods well known in the art can be used to introduce one or more nucleic acid molecules provided herein into a cell. In some embodiments, the genetic modifications described herein are introduced into a cell (e.g., an hPSC) using genetic modulation systems or techniques well known in the art. Examples of genetic modulation system or technique that can be used to introduce a genetic modification into a cell include, without limitation, a CRISPR-based system (e.g., CRISPR activating system, CRISPR inactivating system, CRISPR/Cas gene KO system, or CRISPR gene KI system), a Zinc Finger Protein (ZNF) system, a Transcription Activator-like Effector Nuclease (TALEN) system, RNA interference (RNAi), guide RNA (gRNA), antisense oligonucleotides (ASOs), micro RNA (miRNA), RNA Aptamer, short hairpin RNA (shRNA), or small interfering RNA (siRNA). In some embodiments, the genetic modification described herein comprises an insertion, a deletion, or one or more mutations (e.g.. one or more substitution of nucleotides or any appropriate mutations).
In some embodiments, a CRISPR-based system, including CRISPR activating system (CRISPRa), CRISPR interference system (CRISPRi), CRISPR/Cas gene KO system, or CRISPR gene KI system, can use any nucleic acid molecule or composition provided herein to introduce at least one genetic modification into a cell (e.g., hPSCs). In some embodiments, the CRISPR-based system includes any appropriate Cas nuclease. Examples of Cas nucleases include, w ithout limitation, Casl. Cas2, Cas3, Cas9, CaslO, Cpfl, Cas 12. or Cas 12a. n some embodiments, a Cas component of a CRISPR/Cas system is a Cas9 nuclease. For example, a Cas9
nuclease can be an active Cas9 nuclease or a dead Cas9 (dCas9). Components of CRISPR-based system described herein can be in any appropriate format. In some embodiments, a component of a CRISPR-based system is introduced into one or more cells (e.g., iPSC) as a nucleic acid molecule provided herein (e.g., a gRNA) and/or a nucleic acid encoding a Cas nuclease (e.g., Cas9). For example, a nucleic acid molecule provided herein and a nucleic acid encoding at least one Cas nuclease can be introduced into one or more cells. In some embodiments, a component of a CRISPR- based system is introduced into one or more T cells as a gRNA and/or as a Cas nuclease. For example, at least nucleic acid molecule provided herein and at least one Cas nuclease (e.g., a Cas9 nuclease) can be introduced into one or more T cells. In some embodiments, the CRISPR-based system includes a synergistic activation mediator (SAM) system. In some cases, the SAM system can include an enzymatically inactive Cas 9 (e.g., dCas9) fused to transcriptional activator (e.g., VP64), one or more nucleic acid molecules or compositions provided herein engineered to contain MS2 RNA aptamer loops, and an MS2 coat polypeptide fused to activation domains (e.g., p65 and HSF1).
In some embodiments, a ZFN system is used to introduce one or more genetic modification comprising at least one nucleic acid molecule or composition provided herein into a cell (e.g., hPSC). A ZFN system can include a polypeptide including a DNA-binding domain (e.g., zinc fingers) that is complementary to a target nucleic acid (e.g., nucleic acid encoding an MYH6 polypeptide, an MYH7 polypeptide, and/or CRE1/CRE2/CRE3 polypeptide), and a nuclease domain (e.g., a nuclease domain that can created double-strand breaks). In some embodiments, the ZFN system includes any appropriate nuclease domain. For example, a nuclease domain of a ZFN system can be a Fokl nuclease domain.
In some embodiments, a TALEN system is used to introduce one or more genetic modification comprising at least one nucleic acid molecule or compositions provided herein into a cell (e.g., hPSC). A TALEN system can include a polypeptide including a transcription activator-like (TAL) effector DNA-binding domain directing a nuclease to a target nucleic acid (e g., nucleic acid encoding anMYH6 polypeptide, an MYH7 polypeptide, and/or CRE1/CRE2/CRE3 polypeptide), and a nuclease domain (e.g., a nuclease domain that can created double-strand breaks). The TALEN system can include any appropriate nuclease. For example, a nuclease can be a non-
specific nuclease. In some embodiments, a nuclease can function as a dimer. In some cases, a nuclease of a TALEN system can be a Fokl nuclease.
In some embodiments, an RNA-based system (e.g., RNA interference (RNAi) system) is used to introduce one or more genetic modification comprising at least one nucleic acid molecule or compositions provided herein into a cell (e.g., hPSC). In some embodiments, an RNAi system is a post-transcriptional gene silencing process mediated by small RNA molecules. Non-limiting examples of RNA molecules that can be used in an RNA-based system include antisense oligonucleotides (ASOs), micro RNA (miRNA), RNA Aptamer, short hairpin RNA (shRNA), and small interfering RNA (siRNA).
In some embodiments, components of a gene modulation system (e.g., a CRISPR/Cas system) provided herein can be introduced into one or more cells (e.g., hPSCs) using any appropriate method. A method of introducing components of a gene modulation system into a cell can be a physical method. A method of introducing components of a gene-editing system into a cell can be a chemical method. A method of introducing components of a gene modulation system into a cell can be a particlebased method. Examples of methods that can be used to introduce components of a gene modulation system into one or more cells include, without limitation, electroporation, transfection (e.g., lipofection), transduction (e.g., viral vector mediated transduction), microinjection, or nucleofection.
In some embodiments, the compositions provided herein (e.g., a composition comprising at least one nucleic molecule that is complementary' to an MYH6 promoter region, an MYH7 promoter region, and/or CRE) is in the form of a vector (e.g., a viral vector or a non-viral vector). Any appropriate method known in the art can be used to design and construct a vector comprising the composition provided herein. A viral vector can be any appropriate viral vector know n in the art. For example, a viral vector can be derived from a negative-strand virus or a positive-strand virus, or a viral vector can be derived from a virus with an RNA genome or a DNA genome. Nonlimiting examples of viral vectors include a lentiviral vector (e.g.. e.g., derived from SIV, HIV-1, BIV, HIV-2, or FIV), an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a herpes viral vector (e.g., a herpes simplex viral vector), a group B adenovirus enadenotucirev vector, an Epstein-Barr virus vector, a simian virus 40 (SV-40) vector, a Harvey murine sarcoma vims vector, a bovine papilloma
virus vector, a vaccinia virus vector, a murine mammary tumor virus vector, a polio virus vector, a parvovirus vector, a Rous sarcoma virus vector, a maraba virus vector, or a vesicular stomatitis virus vector.
A non-viral vector can be any appropriate non-viral vector known in the art. In some embodiments, a non-viral vector can be an expression plasmid (e.g., a cDNA expression vector). In some embodiments, a non-viral vector is a cosmid. a liposome, an exosome, an extracellular vesicle, a polymer, a nanoparticle, a peptide, or a dendrimer, or a lipid nanoparticle (LNP). In some embodiments, the vectors provided herein comprise a constitutive promoter (e.g., a cytomegalovirus promoter, a simian virus 40 promoter, an elongation factor 1 a (EFl a) promoter, a P-actin promoter, or a phosphoglycerate kinase (PGK) promoter), an inducible promoter (e.g., tetracycline response element (TRE) promoter, doxycycline-inducible promoter, or lac-inducible promoter), or a tissue-specific promoter (e.g., cardiac-specific promoters such as a- MYH promoter, NKX2.5 promoter, or troponin T (TnT) promoter).
In some embodiments, the genetically modified cells provided herein are derived from human pluripotent stem cells (hPSCs). For example, a human pluripotent stem cell can be a human embryonic stem cell (ESC) or an induced pluripotent stem cell (iPSC). In some embodiments, the genetically modified cells provided herein are derived from an iPSC. An iPSC is a reprogrammed somatic cell capable of differentiating into a wide range of different cell types. Reprogramming can involve alteration such as condensation, reversal of heritable patterns of nucleic acid modification (e.g., methylation), genomic imprinting, chromatin epigenetic changes, or other events that occur during cellular differentiation. Any appropriate method well known in the art can be used to reprogram somatic cells to generate iPSCs.
Pharmaceutical composition
Also provided herein are compositions (e g., a composition including at least one nucleic molecule that is complementary to anMYH6 promoter region, anMYH7 promoter region, and/or a CRE), genetically modified cells, or vectors described herein that can be formulated as a pharmaceutical composition. In some embodiments, anMYH7 inhibitor or an MYH6 activator provided herein is formulated as a pharmaceutical composition. Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. For example, a pharmaceutically acceptable
carrier can include solvents, saline, antibacterial and antifungal agents, coatings, dispersion media, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Pharmaceutical compositions can be formulated to be compatible with its intended route of administration. In some embodiments, the pharmaceutical composition provided herein are administered by any appropriate routes of administration. Examples of routes of administration include oral or parenteral (e.g., intravenous, intradermal, subcutaneous, intratumoral, intramuscular or subcutaneous) administration. In some embodiments, the pharmaceutical composition provided herein is administered intrathecally, intraperitoneal, intramuscular, intratumoral, subcutaneous, rectal, intraarticular, vaginal, infusion, intravenous, or intrastemal.
In some embodiments, the pharmaceutical composition provided herein can be formulated in an ingestible form or a topical form. For example, the pharmaceutical composition can be in the form of a liquid, solution, suspension, tablet, pow der, granule, pill, capsule, gel, cream, mist, atomized vapor, aerosol, soft gelatin capsule, or hard gelatin capsule. In some embodiments, for oral administration, tablets or capsules can be prepared by conventional means with pharmaceutically acceptable excipients such as binding agents, fillers, lubricants, disintegrants, or wetting agents. The tablets can be coated by methods known in the art. Liquid preparations for oral administration can take the form of, for example, suspension, syrups, solutions, or they can be presented as a dry product for constitution with saline or other suitable liquid vehicle before use. Liquid preparations also can contain pharmaceutically acceptable additives such as emulsifying agents, suspending agents, non-aqueous vehicles, buffer salts, preservatives, coloring agents, flavoring agents, and sweetening agents as appropriate. Preparations for oral administration can be suitably formulated to give controlled release of the pharmaceutical composition.
In some embodiments, the pharmaceutical compositions provided herein can be administered to a subject (e g., a mammal) by regional delivery directly to a target tissue (e.g.. cardiac tissue) in the subject. For example, the pharmaceutical compositions provided herein can be administered intraperitoneally (IP) to the abdomen or peritoneal cavity of the subject. The IP administration can be performed via a port or pre-existing port placed for delivery' of other therapeutic agents (e.g., therapeutic agents for the treatment of a cardiac condition). Non-limiting examples of
regional administration include hepatic artery infusion, catheter infusion into resection cavity, intrapleural delivery, or ultrasound guided injection.
Table 1: Exemplary nucleic acid sequences
AAGTTCCCCCTGACACAAGG
TGTGGAACCTCCTTGTGTCA
TGAGGGTCACCTTCTCCTGC
CTTCACCAGGAGTGGGGTGC
GAGTACCAGGTCCAGTCACT
AGCTAGGAAACAATTGGAAG
GCCCCTTCCCAGCTTCCAGT
372 TGCTGCTCTCAGGTAGGAGC
Methods of use
Provided herein are methods of using one or more pharmaceutical compositions described herein. In some embodiment, provided herein are methods for treating a cardiac condition. For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to anMYH6 promoter region, anMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, wMYH7 inhibitor and/or anMYH6 activator described herein) provided herein can be administered to a subject (e.g., a mammal) having a cardiac condition to treat the cardiac condition. In some embodiments, methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g.. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to anMYH6 promoter region, anMYH7 promoter
region, and/or a CRE described herein to the subject. In some embodiments, methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1- 392) provided herein to the subject. In some embodiments, methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject. In some embodiments, methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of W.MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) aZNF, a TALEN, or a small molecule inhibitor provided herein to the subject. In some embodiments, methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, mRNA-based therapeutics, or a therapeutic polypeptide) provided herein to the subject. In some embodiments, methods provided herein for treating a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
In some embodiment, provided herein are methods for increasing MYH6 expression in a subject (e.g., a mammal having a cardiac condition). For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory
element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein) provided herein can be administered to a subject having a cardiac condition to increase MYH6 expression in a subject. In some embodiments, methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g.. at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MYH6 promoter region, anMYH7 promoter region, and/or a CRE described herein to the subject. In some embodiments, methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject. In some embodiments, methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non- viral vector that includes a composition described herein) provided herein to the subject. In some embodiments, methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI sy stem) a ZNF, a TALEN, or a small molecule provided herein to the subject. In some embodiments, methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of anA/EHri activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the
subject. In some embodiments, methods provided herein for increasing MYH6 expression in a subject can include administering a therapeutically effective amount of W.MYH7 inhibitor and an MYH6 activator provided herein to the subject. In some embodiments, methods of increasing MYH6 expression in a subject includes increasing mRNA expression and/or polypeptide expression of MYH6. In some embodiments, methods and materials described herein are effective to increase MYH6 expression by, for example, 10, 20, 30, 40. 50. 60. 70. 80 or more percent.
In some embodiment, provided herein are methods for reducing MYH7 expression in a subject (e.g., a mammal having a cardiac condition). For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to anMYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, wMYH7 inhibitor and/or an MYH6 activator described herein) provided herein can be administered to a subject having a cardiac condition to reduce MYH7 expression in a subject. In some embodiments, methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject. In some embodiments, methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject. In some embodiments, methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of a vector (e.g.. a viral or a non-
viral vector that includes a composition described herein) provided herein to the subject. In some embodiments, methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of anMYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, aTALEN, or a small molecule provided herein to the subject. In some embodiments, methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR- based system (e.g.. a CRISPRa system), a transcriptional activator, or an mRNA- based therapeutic provided herein to the subject. In some embodiments, methods provided herein for reducing MYH7 expression in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject. In some embodiments, methods of reducing MYH7 expression in a subject includes increasing mRNA expression and/or polypeptide expression of MYH6. In some embodiments, methods and materials described herein are effective to reduce MYH7 expression by, for example, 10, 20, 30, 40, 50, 60, 70, 80 or more percent.
In some embodiment, provided herein are methods for improving cardiac contractility in a subject (e.g., a mammal having a cardiac condition). For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, m X/1YH7 inhibitor and/or wMYH6 activator described herein) provided herein can be administered to a subject having a cardiac condition to improve cardiac contractility in a subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described
herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a genetically modified cell (e g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
In some embodiment, provided herein are methods for improving cardiac contractility in a subject (e.g., a mammal having a cardiac condition). For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, anMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector
described herein, anMYH7 inhibitor and/or wMYH6 activator described herein) provided herein can be administered to a subject having a cardiac condition to improve cardiac contractility in a subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility' in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility' in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject. In some embodiments, methods provided herein for improving cardiac contractility in a subject can include administering a therapeutically effective amount of an MY H 6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject. In some embodiments, methods provided herein for improving cardiac
contractility in a subject can include administering a therapeutically effective amount of wMYH7 inhibitor and an MY H 6 activator provided herein to the subject. In some cases, methods as described herein can improve the cardiac contractility in the subject by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%, at least 20% or at least 25%).
In some embodiment, provided herein are methods for modulating a ratio of cardiac MYH6 and MYH7 in a subject (e.g., a mammal having a cardiac condition). For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein) provided herein can be administered to a subject having a cardiac condition to modulate the ratio of cardiac MYH6 and MYH7 in a subject. In some embodiments, methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to anMYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject. In some embodiments, methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten. or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a genetically modified cell (e g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject. In some embodiments, methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non- viral vector that includes a
composition described herein) provided herein to the subject. In some embodiments, methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of an MY H7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject. In some embodiments, methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject. In some embodiments, methods provided herein for modulating a ratio of cardiac MYH6 and MYH7 in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
In some embodiments, methods of modulating a ratio of cardiac MYH6 and MYH7 in a subject (e.g., a mammal having a cardiac condition) includes increasing the cardiac MYH6MYH7 expression ratio by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or more) compared to a ratio of cardiac MYH6 and MYH7 in an untreated subject (e.g., a subject not administered with the pharmaceutical compositions provided herein or a subject treated with a control).
In some embodiments, methods of modulating a ratio of cardiac MYH6 and MYH7 in a subject (e.g., a mammal having a cardiac condition) includes decreasing the cardiac MYH7.MYH6 expression ratio by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or more) compared to a ratio of cardiac MYH6 and MYH7 in an untreated subject (e.g., a subject not administered with the pharmaceutical compositions provided herein or a subject treated with a control).
In some embodiments, provided herein are methods for ameliorating at least one (e.g.. at least two, at least three, at least four, at least five, at least six. at least
seven, at least eight, at least nine, at least ten, or more) symptom of heart failure in a subject (e.g., a mammal having a cardiac condition). For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, wMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein) provided herein can be administered to a subject having a cardiac condition (e.g., heart failure) to ameliorate at least one symptom of heart failure in a subject. In some embodiments, methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MY H 6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject. In some embodiments, methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject. In some embodiments, methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject. In some embodiments, methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) aZNF, aTALEN, or a small molecule
provided herein to the subject. In some embodiments, methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor), CRISPR-based system (e.g., a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject. In some embodiments, methods provided herein for ameliorating at least one symptom of heart failure in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor and an MYH6 activator provided herein to the subject.
In some embodiments, symptoms of heart failure that can be ameliorated bymethods described herein include shortness of breath or dyspnea (e.g., paroxysmal nocturnal dyspnea), fatigue and weakness, edema, tachycardia, arrhythmia, nocturia, vasoconstriction, coughing, wheezing, swelling of the belly area, chest pain, reduced ability to exercise, nausea, and/or lack of appetite. In some cases, methods as described herein can ameliorate at least one symptom of failure in the subject by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%, at least 20%, or at least 25%).
In some embodiment, provided herein are methods for reducing the risk of developing a cardiac condition in a subject (e.g., a mammal). In some cases, the methods and materials described herein can be effective to reduce the severity of a cardiac condition (e.g., heart failure) and/or a condition associated with a cardiac condition in a subject. For example, one or more pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, wMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, anMYH7 inhibitor and/or an MYH6 activator described herein) provided herein can be administered to a subject to reduce the risk of developing a cardiac condition or reduce the severity of a cardiac condition in a subject. In some embodiments, methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a composition comprising at least one (e.g.. at least two, at least three, at least four, at least five, at
least six, at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a CRE described herein to the subject. In some embodiments, methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a composition including at least one (e.g.. at least two, at least three, at least four, at least five, at least six. at least seven, at least eight, at least nine, at least ten, or more) nucleic acid molecule that comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392 to the subject. In some embodiments, methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a genetically modified cell (e.g., a genetically modified cell that includes one or more nucleic acid molecule comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-392) provided herein to the subject. In some embodiments, methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of a vector (e.g., a viral or a non-viral vector that includes a composition described herein) provided herein to the subject. In some embodiments, methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH7 inhibitor (e.g., a small molecule inhibitor, a CRISPR-based system (e.g., CRISPRa, CRISPRi, CRISPR/Cas gene KO system, or CRISPR gene KI system) a ZNF, a TALEN, or a small molecule provided herein to the subject. In some embodiments, methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH6 activator (e.g., a small molecule agent (e.g., a chromatin remodeling agent such as a histone deacetylase (HD AC) inhibitor and a DNA methyltransferase inhibitor). CRISPR-based system (e.g.. a CRISPRa system), a transcriptional activator, or an mRNA-based therapeutic provided herein to the subject. In some embodiments, methods provided herein for reducing the risk of a developing a cardiac condition or reducing the severity of a cardiac condition in a subject can include administering a therapeutically effective amount of an MYH7
inhibitor and an MYH6 activator provided herein to the subject. In some cases, methods as described herein can reduce the risk of a developing a cardiac condition or reduce the severity of a cardiac condition in the subject by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%, at least 20%, or at least 25%).
In some cases, methods described herein can improve the survival of a subject (e.g., a subject having a cardiac condition) by at least 3% (e.g., at least 5%, at least 7%, at least 12%, at least 17%. at least 20% or at least 25%). In some cases, methods described herein can improve the quality of life in a subject. In some cases, methods described herein can reduce the risk of developing other cardiac-related conditions in a subject.
In some embodiments, anMYH7 inhibitor and/or an MYH6 activator (e.g., a nucleic acid molecule that inhibits the expression of MYH7 and/or increases the expression of MYH6) as described herein can comprise at least one antisense nucleic acid molecule that targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hg 19). In some embodiments, the nucleic acid molecule described herein (e.g., a nucleic acid molecule that inhibits the expression of MYH7) includes a gRNA, an siRNA, an shRNA, a miRNA, an ASO, an antagomir, a ribozy me, a long noncoding RNA (IncRNA), a locked nucleic acid (LNA), a synthetic RNA molecule, a synthetic DNA molecule, a DNAzyme, or a triple-forming oligonucleotide (TFO). In some embodiments, the nucleic acid molecule used in methods described herein is an inhibitory nucleic acid molecule (e.g., MYH7 inhibitor). In some embodiments, the nucleic acid molecule used in methods described herein is an activating nucleic acid molecule (e.g., MYH6 activator). In some embodiments, the nucleic acid molecule described herein (e.g., a nucleic acid molecule that increases or activates the expression of MYH6) includes a small molecule agent, a CRISPR-based system, a transcriptional activator, an mRNA- based therapeutic, or a therapeutic polypeptide.
In some embodiments, the pharmaceutical compositions provided herein can be used as the sole active agent for use in methods described herein. In such cases, the pharmaceutical compositions (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described
herein, an MY H 7 inhibitor and/or an MYI 16 activator described herein) provided herein is not administered with a second pharmaceutical composition, where the second pharmaceutical composition is administered for the purpose of treating a cardiac condition described herein.
In some embodiments, one or more pharmaceutical compositions provided herein can be administered to a subj ect together with one or more additional pharmaceutical compositions provided herein. For example, a pharmaceutical composition comprising an MY H7 inhibitor can be administered with an M H 6 activator, a genetically modified cell, a vector, a nucleic acid molecule described herein, or any combinations thereof.
In some embodiments, one or more pharmaceutical compositions described herein can be administered to a subject together with one or more additional therapies used to treat a cardiac condition (e.g., cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure). Non-limiting examples of additional therapies that can be used to treat a cardiac condition can include an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin-2 receptor blocker (ARB), an ARB and neprilysin inhibitor, a beta blocker, a digoxin, a diuretic, a hydralazine and isosorbide dinitrate, an 1(f) channel inhibitor, a mineralocorticoid receptor antagonist (MRA), or a sodiumglucose cotransporter 2 (SGLT 2) inhibitor. In some cases, an ACE inhibitor comprises captopril, enalapril, fosinopril, lisinopril, perindopril, quinapril, ramipril, or trandolapril. In some cases, an ARB comprises candesartan, losartan, telmisartan, or valsartan. In some cases, an ARB and neprilysin inhibitor comprises sacubitril- valsartan. In some cases, a beta blocker comprise bisoprolol, carvedilol, metoprolol succinate, or nebivolol. In some cases, a diuretic comprises bumetanide, chlorothiazide, hydrochlorothiazide, indapamide, furosemide, metolazone, or torsemide. In some cases, an 1(f) channel inhibitor comprises ivabradine. In some cases, an MRA comprises eplerenone or spironolactone. In some cases, an SGLT 2 inhibitor comprises dapagliflozin or empagliflozin.
In some embodiments, methods and materials provided herein can be used to improve the efficacy of the second pharmaceutical composition or the additional therapies provided herein in a subject having a cardia condition described herein. For example, a subject in need thereof (e.g., a mammal having a cardia condition) can be administered one or more pharmaceutical compositions described herein to improve
the efficacy of the second pharmaceutical composition or the additional therapies provided herein in a subject in need thereof. For example, methods and materials provided herein can be used to improve the efficacy of the second pharmaceutical composition or the additional therapies provided herein by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.
In some embodiments, methods and materials provided herein can be used to reduce the severity of the adverse effects of the second pharmaceutical composition or the additional therapies provided herein in a subject having a cardia condition described herein. For example, a subject in need thereof (e.g., a mammal having a cardia condition) can be administered one or more pharmaceutical compositions described herein to reduce the severity of the adverse effects of the second pharmaceutical composition or the additional therapies provided herein in a subject in need thereof. For example, methods and materials provided herein can be used to reduce the severity of the adverse effects of the second pharmaceutical composition or the additional therapies provided herein by, for example, 10, 20, 30, 40, 50. 60. 70, 80, 90, 95, or more percent.
In cases where the methods and materials provided herein involve one or more pharmaceutical composition described herein are used in combination with one or more pharmaceutical compositions as described herein or additional therapies provided herein, the one or more pharmaceutical compositions as described herein or additional therapies provided herein can be administered at the same time (e g, in a single composition comprising the pharmaceutical compositions described herein and the additional therapy) or independently. For example, one or more pharmaceutical compositions described herein can be administered first, and the additional therapies can be administered second, or vice versa. In cases where one or more pharmaceutical compositions described herein are used in combination with one or more additional therapies used to treat (e.g., reduce the extent or severity of) a cardiac condition, the one or more additional therapies can be performed at the same time or independently of the administration of pharmaceutical compositions described herein. For example, one or more one or more pharmaceutical compositions described herein can be administered before, during, or after the one or more additional therapies are performed.
In some embodiments, the subject is a mammal. Any appropriate mammal having a cardiac condition can be administered a therapeutically effective amount of a pharmaceutical composition provided herein. Examples of mammals that can be treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, or rats. In some embodiments, a subject that can be administered the pharmaceutical composition provided herein is at high risk of developing a cardiac condition (e.g., cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure). In some embodiments, the subject expresses higher levels of MYH7 compared to a control sample (e.g., a sample derived from a healthy subject). In some embodiments, the subject expresses lower levels of MYH6 compared to a control sample (e.g., a sample derived from a healthy subject). In some embodiments, the subject expresses a higher ratio of MYH7:MYH6 expression compared to a control sample (e.g., a sample derived from a healthy subject). In some embodiments, the subject expresses a lower ratio of MYH6:MYH7 expression compared to a control sample (e.g., a sample derived from a healthy subject).
In some embodiments, methods provided herein can include determining that a subject (e.g., a human) has or is at risk of developing a cardiac condition. For example, a cardiac condition can be cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure. In some embodiments, methods provided herein are administered to a subject having cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure. Any appropriate method can be used to determine that a subject has a cardiac condition. For example, imaging techniques (e.g., CT scans, positron emission tomography (PET) scans, ultrasound imaging. MRI scans, and/or X rays), symptoms examination, physical examination, neurological examination, laboratory tests for biomarker detection (e.g., blood, urine, serum, and/or spinal fluid tests), electrocardiograms, echocardiographs, exercise stress tests, and/or genetic tests (e.g., whole genome sequencing and/or whole exome sequencing), and/or coronary angiograms can be used to determine that the subject has a cardiac condition.
A “therapeutically effective amount’’ is an amount sufficient to effect beneficial or desired results. For example, an effective amount is an amount that achieves a desired therapeutic effect, e.g., an amount sufficient to treat (e g., reduce the extent or severity of) a disease and/or to reduce risk of development of disease or
disease symptoms (also referred to as a prophylactically effective amount). A therapeutically effective amount can be administered in one or more administrations, applications, or dosages. A therapeutically effective amount of a therapeutic compound (e.g., an effective dosage of a pharmaceutical composition provided herein) depends on the therapeutic compounds selected. The pharmaceutical composition (e.g., a pharmaceutical composition comprising a composition of nucleic acid molecule that is complementary to an MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element (CRE), a genetically modified cell described herein, a vector described herein, an MYH7 inhibitor and/or an MYH6 activator described herein) provided herein can be administered one or more times per year (e.g.. one time per year, two times per year, three times per year, four times per year, or five times per year) to one or more times per month (e.g., one time per month, two times per month, three times per month, four times per month, five times per month), including once every other month, once every three months, or twice a month. In some embodiments, the pharmaceutical composition provided herein can be administered one or more times per week (e.g., one time per week, two times per week, three times per week, four times per week, five times per week, six times per week, seven times per week, or more than seven times per week). The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the pharmaceutical compositions described herein can include a single treatment or a series of treatments. Various factors can influence the actual amount used for a particular application. For example, the frequency of administration, duration of treatment, combination of other agents, site of administration, stage of disease (if present), and the anatomical configuration of the treated area may require an increase or decrease in the actual amount administered.
An effective duration for administering a pharmaceutical composition provided herein can be any duration that reduces the symptoms related to a cardiac condition, increases MYH6 expression, reduces MYH7 expression, improves cardiac contractility, and/or increases the expression ratio of MYH6:MYH7 in a subject without producing significant toxicity to the subject. In some cases, the effective
duration can vary from several days to several weeks, to several months, or longer. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the effective amount, frequency of administration, use of route of administration, and severity of the subject’s condition.
Dosage, toxicity and therapeutic efficacy of the pharmaceutical composition provided herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compositions that exhibit high therapeutic indices are advantageous. While compositions that exhibit toxic side effects may be used, care should be taken to minimize and reduce side effects. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compositions used in the methods described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models. Such information can be used to more accurately determine useful doses in humans.
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1: Modulation of the antithetical expression of MYH6 and MYH7 could treat cardiac conditions
Methods and Materials hPSC culture, differentiation, and collections for genomic studies.
Human pluripotent stem cells (hPSCs) were cultured in E8 medium on Geltrex
(Gibco) coated plates. For hPSC cardiac studies, an engineered hPSC YY2-MYL2-H2B-
GFP reporter transgenic line that specifically expressed H2B-GFP (the human histone H2B fused to green fluorescent protein) in differentiated MYL2+ D80 ventricular cardiomyocytes (vCM) was used as previously described28’29’37. All hPSC lines were differentiated into cardiomyocytes and their corresponding developmental stages utilizing a well-established WNT-based cardiomyocyte differentiation protocol56’57. For vCMs, the cells were sorted and purified based on MYL2-H2B-GFP before their processing and analyses. For the RNA-seq studies, ~2 million dissociated cells were washed in phosphate buffered saline (PBS), lysed in TRIzol and then stored at -80°C until further processing. For ATAC-seq, 2 x 105 cells were slow-frozen overnight (O/N) in freezing media (E8 medium or differentiation medium supplemented with 10% DMSO) at -80°C and stored in liquid nitrogen until further processing. The developmental RNA-seq, ATAC-seq, ChlP-seq and Hi-C samples and data sets were obtained as described elsewhere28-29.
CRISPR/Cas9-mediated genome editing
To generate knockout (KO) lines, selected CREs (CRE1-3, MYH6 and MY H 7 promoters), A5 (-133 to -88) /V/FH7 promoter, and A5.1 (-133 to -1Y7) MYH7 promoter were genetically deleted in H9 MYL2-H2B-GFP hPSCs using CRISPR/Cas9 genome editing technologies as described elsewhere 28. A pair of specific guide RNAs (gRNAs) targeting sequences surrounding the region to be edited were designed using the online software tool CRISPOR58, which generated gRNA sequences for optimal targeting of regions of interest while minimizing potential off-target effects. One day before transfection, 1 x I O5 H9 ATYL -^/ -G/’/’ hPSCs were seeded on Geltrex- coated 12-well plates. One day later, a pair of ribonucleoprotein complexes containing 20 pmol Cas9 protein (New England Biolabs) and 80 pmol of gRNA (Synthego) was transfected using Lipofectamine Stem Transfection Reagent (Invitrogen) according to the manufacturer’s specifications. Three days after transfection. 2 x io3 cells were seeded in a Geltrex-coated 10-cm dish and cultured for seven days. To select clonal lines, colonies were picked and transferred to 96-well plates and expanded for genotyping. For large deletion knockouts, four pairs of primers were used for PCR- based genotyping: Outer primers, designed outside of the deleted region; Internal primers, designed inside of the deleted region; 5’ primers, designed surrounding the 5’ gRNA; and 3’ primers, designed surrounding the 3’ gRNA. Sanger sequencing was
employed to genotype knockouts containing the A5 (-133 to -88) or A5.1 (-133 to - 117) deletion in the MYH7 promoter. To generate the CRE1/CRE2 double KO (DKO) lines, CRE2 was deleted in a CRE1 KO clone. To generate the A5.1 Mouse-to-Human MYH7 promoter knock-in (KI) hPSC line containing the mouse-specific A5.1 MYH7 promoter sequence, a gRNA and a single-strand DNA donor oligo (IDT) were cotransfected, followed by clonal line isolation and genotyping by Sanger sequencing. For all genotypes, at least two successfully targeted clonal lines were selected for further studies. All gRNA sequences are listed in Table 1. Donor oligo nucleotide sequence used for knock-in experiment includes CTGGAGAGGCGGGGAGGGGAGCACTGTTTGGGAAGGGGGGGAGAGTCGG GGGAAATGCTTCTAGTGACAACAGCCCTTTCTAAATCCGGC (SEQ ID NO: 393).
Luciferase reporter assays
A control plasmid was constructed by replacing the minimal promoter in the pGL4.23 plasmid (Promega E8411) with a 752 bp thymidine kinase (TK) promoter. A ~1.5 kb region containing CRE1 and a -1.4 kb region containing CRE2 were PCR- amplified and cloned individually upstream of the TK promoter in the pGL4.23-TK plasmid using NEBuilder HiFi DNA assembly (New England Biolabs E5520S). One day before transfection, 2 x io5 hPSC-CMs were dissociated and re-plated in a Geltrex-coated 24- well plate. On the following day, 500 ng pGL4.10-TK plasmid containing CRE1 or CRE2 or no CREs (as a control), and 10 ng pGL4.75 (Renilla luciferase) plasmid as an internal transfection control were co-transfected into CMs using Lipofectamine Stem Transfection Reagent (Invitrogen STEM00003). Media was replaced with fresh media 24 hours after transfection. Three days after transfection, cells were washed with DPBS and processed for luminescence assays using a Dual -Luciferase Reporter Assay System (Promega El 960) by following the manufacturer’s protocol. To measure CRE3 activity, a -600 bp or -1.2 kb region according to the ATAC-seq peaks were tested similarly but specifically in vCMs. For the dual luciferase reporter assay, 500 ng of the dual luciferase reporter construct LCR-MYH7p-Luc2/MYH6p-Rluc harboring either the WT MYH7 promoter or a series of mutant MYH7 promoters was transfected into D20 CMs. Three days after transfection, firefly luciferase (Luc2) and renilla luciferase (Rluc) activities were
measured by following the manufacturer’s protocol. Relative luciferase activity for each construct was calculated as the ratio of MYH7p-Amsn Luc2 activity versus MYH6p-driven Rluc activity. The WT relative luciferase activity was set to 1.
Real-time quantitative PCR (qPCR)
Total RNA was isolated using Trizol (Invitrogen) by following the manufacturer’s protocol. cDNA was reverse transcribed from 500 ng RNA using PrimeScript RT Master Mix (TaKaRa), and then diluted to 1:8 in UltraPure DNase/RNase-Free Distilled Water (ThermoFisher). Quantitative PCR (qPCR) was performed using PowerUp SYBR Green Master mix (ThermoFisher) and run on a CFX Connect qPCR machine (Bio- Rad). Gene expression was analyzed using 2 AACt method and was normalized to the expression of the indicated reference gene (TBP is the reference gene when no other reference gene is indicated).
Western blot
Proteins from cell lysates were prepared using RIPA Lysis and Extraction Buffer (Invitrogen) supplemented with proteinase inhibitor cocktail (Roche). 20 pg of lysate was run on a 4-12% NuPAGE gradient gel (Invitrogen) for western blot analysis. Gels were transferred to a nitrocellulose membrane using standard procedures. After blocking using Pierce Clear Milk blocking Buffer (Thermo), the membranes were stained with antibodies for MYH6 (ProteinTech) and MYH7 (ProteinTech). Anti-fyActin antibody (Cell Signaling) was used as a loading control.
Flow cytometry and sorting
For flow cytometric analysis, CMs and vCMs were dissociated with collagenase IV (Invitrogen) followed by Accutase (Gibco). The cells were then fixed and permeabilized using Fixation/Permeabilization solution (BD Biosciences). After washing with Perm/Wash buffer (BD Biosciences), CM differentiation efficiency was assessed using an antibody against TNNT2 (Invitrogen). vCM differentiation efficiency was examined based on MYL2-H2B-GFP fluorescence. Analyses were conducted using FlowJo Software (BD Biosciences). To purify vCMs for downstream studies. MYL2-H2B-GFP positive vCMs were sorted without fixation.
Sarcomere organization analysis using immunofluorescence
For immunofluorescence and sarcomere organization studies, cardiomyocytes were dissociated three days before each indicated day: CRE1/CRE2 DKO CMs at D15, MYH6 promoter KO CMs at D15, MYH7 promoter KO vCMs at D80. Dissociated cardiomyocytes were seeded at a density of 100,000 cells/well on Geltrex-coated four- well chamber slides (Thermo). Three days later, the cells were fixed with 4% formaldehyde in PBS for 10 minutes (min), then blocked and permeabilized in PBS containing 5% goat serum and 0.1% Triton-XlOO for 30 minutes. Cells were then incubated with a primary antibody against a- Actinin (ThermoFisher) at 4°C overnight. The next day, cells were washed with PBS for three times and incubated with Alexa Fluor 594 (ThermoFisher) for 1 hour (h) at room temperature. To analyze sarcomere organization of cardiomyocytes, at least 20 randomly selected cardiomyocytes for each cell line were imaged using a 60X objective. Using a custom ImageJ routine, images were background subtracted, binarized and ten random regions in the cells were assigned for analysis. Fast Fourier transform (FFT) analysis was employed to analyze sarcomere organization as described elsewhere42’59.
CRISPR activation and interference study
For CRISPR activation (CRISPRa) studies, the Synergistic Activation Mediator (SAM) system was used. Two gRNAs were designed to target the MYH7 promoter region using the online tool CRISPick6L62and cloned individually into the lenti-SAM v2 plasmid (Addgene ID: 75112). A non-targeting control gRNA was also cloned into the same plasmid as a negative control. H9 MYL2-H2B-GFP hPSCs were first infected with lentiMPH v2 (Addgene ID: 89308) virus and then selected by 50 pg/mL hygromycin for 1 w eek. Survivor cells w ere further infected with gRNA lentivirus and selected by 1 pg/ mL puromycin for 5 days and then expanded for further use. For CRISPR interference (CRISPRi) studies, the dCas9-KRAB system was used. Two gRNAs and a non- targeting control gRNA were cloned individually into lentiGuide-puro plasmid (Addgene ID: #52963). H9 MYL2-H2B-GFP hPSCs were first infected with lenti-dCas9-KRAB- blast (Addgene ID: 89567) virus and then selected by 5 pg/ mL blasticidin for 1 week. Surviving cells were then infected with
gRNA lentivirus and selected using 1 pg/ mL puromycin for 5 days and then expanded for further use.
3D bioprinted cardiac tissue model
Methacrylated coverslips and Bioink composition were prepared as described elsewhere41. The 3D printed micro-tissue construct was fabricated using an in-house digital light processing (DLP)-based bioprinter, which comprised the following components: (i) a 365 nm UV LED light source; (ii) a digital micromirror array device (DMD) for light projection; (iii) projection optics responsible for focusing optical patterns from the DMD chip onto the fabrication plane; (iv) a motorized x-y-z stage; and (v) a computer control unit. The design for each layer's pattern was created in Adobe Photoshop and subsequently converted into PNG images compatible with the printer software. For each layer, poly dimethylsiloxane (PDMS) spacers were utilized to regulate the Z-thickness. A PDMS-coated coverslip was then placed on top of the set-up, and the relevant prepolymer solution heated to 37°C, was carefully pipetted between the spacers. The entire set-up was positioned on the motorized stage, and the prepolymer solution was polymerized by the projected light pattern. Between each layer printing, warmed lx PBS was used to wash away any excess prepolymer solution, ensuring precision in the layer-by-layer construction process. Following the completion of the initial two layers (the base and pillar layers), the subsequent step involved the addition of cells to the GelMA prepolymer solution for the printing of the line scaffold encapsulating the cells. The supernatant, comprising a mixture of cardiomyocytes and human cardiac fibroblasts (9: 1). was diluted to a concentration of 50 million cells/mL by gently combining it with the GelMA prepolymer solution. This diluted cell-containing mixture was directly introduced into the set-up, aiming to minimize the duration during which the cells were exposed to the prepolymer solution. The displacement of the small pillar was quantified utilizing a Leica DMI 6000B fluorescent microscope equipped with a 10X objective lens, focused on the top of the pillar. To track the average weighted mean of bead fluorescence and subsequently calculate displacement and beating rate, a custom MATLAB script was developed in-house. The forces exerted by the aligned tissue were computed based on the measured displacements obtained from videos. Equations (1) and (2) were employed for this calculation, incorporating the modulus
of the relaxed cellular scaffolds. It is assumed that all printed samples possess the same size and modulus, providing a consistent basis for the force calculations.
„ 3Lx F x -2 -x w = 3
6YI (1) where w is the displacement, F is the force, F is the modulus, I is the 2nd moment of inertia (Cuboid), L is the height, and x is the height of force application.
Icubold ~ ~ (2) where h = length and b = width.
The modulus T was measured by a mechanical tester (Cellscale).
Traction force microscopy
The contractility of individual cardiomyocytes was measured using a traction force microscopy (TFM) by following established protocols64. Cardiomyocytes were dissociated five days before each indicated day: CRE1/CRE2 DKO hPSC-CMs at D15, MYH6 promoter KO hPSC-CMs at D15, and MYH7 promoter KO hPSC-vCMs at D80. Following a five-day recovery, TFM was conducted using a Nikon Eclipse Ti- S inverted fluorescence microscope with a BD Carv II camera and a stage-top incubator system (Pathology Devices). Videos capturing fluorescent bead movement were recorded at a rate of 9.5 frames per second for a total of 120 frames using a 60x objective. Subsequent analysis of the bead movement during cardiomyocyte contraction utilized particle image velocimetry, as described elsewhere. Cardiomyocyte contractility was quantified by calculating the mean peak strain energy across all beats recorded in each video.
Cloning of fluorescent reporter constructs
All the fluorescent reporter constructs were cloned into the PiggyBac vector pB-mCherry-EFS-Puro (designed and produced by VectorBuilder). For MYH7p- mCherry and MYH6p-mCherry constructs, a -2.7 kb region containing the MYH7 promoter and a ~1.8 kb region containing the MYH6 promoter were PCR amplified and cloned upstream of mCherry cassette of pB-mCheriy-EFS-Puro through BamHI and Notl restriction enzyme sites, respectively. To generate LCR-MYH7p-mCherry
and LCR-MYH6p- mCherry constructs, a -7.7 kb region containing CRE1 and CRE2 enhancers was PCR amplified and cloned upstream of the MYH7 promoter or MYH6 promoter through Sall and BamHI sites, respectively. To generate LCR-MYH7p- mCherry'MYH6p-TagBFP2 construct used in the transgenic mice, a rBGpA-TagBFP2 cassette was first inserted dow nstream of mCherry of the LCR-MYH7p-mCherry plasmid through Clal and EcoRI sites to make the LCR-MYH7p-mCherry'TagBFP2 construct. Then, a ~1.8 kb region containing theA/T/76 promoter was PCR amplified and inserted upstream of TagBFP2 of the LCR-MYH7p-mCherry TagBFP2 through Mlul and Aflll sites to make the LCR- MYH7p-mCherry/MYH6p-TagBFP2 construct. Finally, a -3.8 kb region containing CRE3 and MYH7 3’-UTR was PCR amplified and inserted downstream of mCherry ofLCR-MYH7p-mCherryM ' YH6p-TagBFP2 construct.
Cloning of luciferase reporter constructs
To identify key regulatory sequences in the MYH7 promoter that may activate MYH7 expression, a dual luciferase reporter construct LCR-MYH7p-Luc2/MYH6p- Rluc with a WT MYFF7 promoter was made by replacing mCherry in the construct LCR-MYH7p- mCherry/MYH6p-TagBFP2 with a firefly luciferase gene (Luc2) and replacing TagBFP2 with a Renilla luciferase gene (Rluc). Subsequently, a series of mutant MYH7 promoters were then generated to replace the WT MYH7 promoter of the LCR-MYH7p- Luc2/MYH6p-Rluc construct. For the negative control construct 1 (NCI), which lacked a -1.2 kb sequence oiMYH7 promoter (-772 to +386), a -1.5 kb downstream region of MYH7 promoter (+386 to +1929) w as PCR amplified and cloned into LCR-MYH7p- Luc2/MYH6p-Rluc through BamHI and Notl sites using NEBuilder HiFi DNA assembly. For mutants carrying various deletions in the MYH7 promoter, specific primers were designed to amplify the corresponding regions, which were then cloned into the LCR- MYH7p-\(-772 to +386 )-Luc2/MYH6p-Rluc construct through BamHI and Asci sites. For the negative control construct 2 (NC2), which lacked the 400 bp sequence in the MYH7 promoter (-286 to +114). an upstream region (-772 to -286) and a downstream region (+386 to +1929) of the MYFF7 promoter were PCR amplified and Gibson assembled into LCR-MYH7p- Luc2/MYH6p-Rluc through BamHI and Notl sites. For 40 bp deletion mutants (Al-10)
and 10 bp deletion mutants (A5.1-5.7). a series of double stranded DNA fragments for each deletion were synthesized as gBlocks (IDT) and were used as PCR templates.
Generation of fluorescent reporter lines
All the fluorescent reporter lines were made using aH9 hPSC cardiomyocyte TNNT2-EGFP reporter line background. One day before transfection, 2 x 105 hPSCs were dissociated and re-plated on a Geltrex-coated 12-well plate. On the following day, 1 pg of each fluorescent reporter construct and a 200 ng transposase plasmid were co-transfected into the hPSCs using Lipofectamine Stem Transfection Reagent. One day after the transfection, the cells were selected with 1 pg/mL puromycin for 5 days. Subsequently, the cells were then split and expanded in a Geltrex-coated 6-well plate.
4C assay
4C assays were performed as described elsewhere66 with some modifications. Formaldehyde-fixed cells were resuspended in 300 pL lysis buffer for 15 minutes on ice. Cells were centrifuged at 2500g for 5 minutes. The nuclei pellet was resuspended in 50 pL of 0.5% SDS and incubated at 62°C for 10 minutes. SDS was quenched with 170 pL of 1 .47% TritonX- 100 for 15 minutes at 37°C. Nuclei were digested in a restriction enzyme buffer using the first restriction enzyme overnight at 37°C in a thermomixer shaking at 700 RPM. The next day, the digestions were stopped by incubating at 65°C for 20 minutes. The samples were ligated in 1 .2 mL reactions using 5 pL of T4 DNA ligase (2000 U/pL; NEB, M0202M) for 4 hours at 21 °C in a thermomixer at 700 RPM. Then, the nuclei were centrifuged at 2500g for 5 minutes. The pellet was resuspended in 550 pL of 10 mM TRIS pH7.8 and incubated at 68°C overnight with SDS and proteinase K to digest the samples and reverse crosslink. The next day, the samples were purified using 0.8 x AMPure XP beads (Beckman A63880) and eluted in 150 pL of 10 mM TRIS pH7.8. The samples were allowed to digest overnight using the second restriction enzyme in a thermomixer at 700 RPM. The next day, the restriction enzyme was inactivated by incubating the samples at 65°C for 25 minutes. The samples were then diluted to a final volume of 5 mL and ligated using 50 pL of T4 DNA Ligase (NEB, M0202L) at 16°C overnight. DNA was
purified using overnight isopropanol precipitation and washed using 70% ethanol. Pellets were dissolved in 200 pL of 10 mM TRIS pH 7.8. purified using 1.8x AMPure XP beads, and eluted in 150 pL of 10 mM TRIS pH 7.8. Viewpoint-specific primers were used to amplify 1 pg of DNA in Expand Long Template PCR (Roche, 11681842001) for 30 cycles and then purified using lx AMPure XP beads. Illumina sequencing adapters were added during a second round of PCR for 10 cycles. DNA was purified using lx AMPure XP beads and submited for sequencing. Sequencing was carried out using a HiSeq 2500/4000 (50/100 bp PE; Illumina). 4C data was processed and analyzed as described elsewhere67 using default parameters.
RNA-seq
RNA-seq was performed as described elsewhere28. For CRE1/CRE2 DKO and WT control RNA-seq, total RNA from hPSC-CMs was extracted and purified using TRIzol (Thermo Fisher Scientific) from three independent differentiations. RNA-seq libraries were prepared from a 1-2 pg total RNA using the Illumina TruSeq Stranded mRNA Library’ Prep Kit Set A (RS-122-2101; Illumina) or Set B (RS-122-2102; Illumina). Sequencing was carried out using a HiSeq 2500/4000 (50/100 bp PE; Illumina). Quality check of the raw RNA-Seq data was done using FastQC version 0.11.7. The paired-end reads were then mapped to the UCSC human genome (GRCh38) using the STAR aligner (2.6.0c) to generate raw counts. The count per gene matrix was obtained and used for downstream analyses. The R package DESeq2 was used to identify differentially expressed genes (DEGs) between the WT and the CRE1/CRE2 DKO groups. The Benjamini-Hochberg multiple testing correction was applied to estimate the FDR. Biological-process GO enrichment (P-value < 0.01) was performed using clusterProfiler (version 4.0.) and EnrichR (version 3.1) packages with a Benjamini-Hochberg multiple testing adjustment. Gene sets with an FDR-corrected P < 0.01 were considered to be significantly enriched.
ATAC-seq
For CRE1/CRE2 DKO and WT control ATAC-seq, 200,000 hPSC-CMs were dissociated and were processed as described elsewhere29. Cell suspensions were thawed at 37°C and pelleted for 5 minutes at 500g at 4°C. Cell pellets were resuspended in 250 pL of permeabilization buffer (5% BSA, 0.2% IGEPAL-CA630,
1 mM DTT and complete EDTA-free protease inhibitor cocktail (Roche) in PBS) and incubated on an overhead shaker for 5 minutes at 4°C, followed by centrifugation for 5 minutes at 500 g. The cell pellet was resuspended in 25 pL tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8), 72.6 mM K-acetate, 11 mM Mg-acetate, 17.6% DMF) and counted on a hemocytometer. For tagmentation, 40,000 nuclei were used, and the reaction volume was adjusted to 19 pL using the tagmentation buffer. After addition of 1 pL of Tn5 transposases (Illumina), tagmentation was performed at 37°C for 60 minutes with shaking (500 rpm). Next, the samples were purified using MinElute columns (Qiagen), PCR-amplified for 9 cycles with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, 72°C 5 min, 98°C 30 s, (98°C 10 s, 63°C 30 s, 72°C 60 s) x 9 cycles, 4°C O). Amplified libraries were purified using MinElute columns (Qiagen) and Ampure XP Bead (Beckman Coulter). Sequencing was carried out on aNovaSeq (100 bp paired end (PE), Illumina). The raw ATAC-seq data was aligned to the human reference genome hg!9 using Bowtie2. Duplicate reads were marked using Picard (worldwideweb. broadinstitute.github.io/picard) MarkDuplicates and filtered out with Samtools. Peak calling was performed using MACS2to identify regions of open chromatin per sample. Each peak set per sample was then merged together using Bedtools and converted into a peak counts matrix with feature Counts from the Subread package. DESeq2 was used to find differentially enriched peaks between the WT and the CRE1/CRE2 DKO groups. Peaks were classified as differentially accessible (DA) peaks with a Bonferroni-corrected P value < 0.05 and an absolute log2 fold change > 1 between the conditions. Gene Ontology enrichment on differential peaks was performed using rGREAT (v2.3.2).
MYH7 promoter phylogenetic tree construction
Alignments between the genomes of selected vertebrates including humans (GRCh38/hg38) were downloaded from the UCSC genome browser (worldwideweb.genome.ucsc.edu/). The 4/17/7 promoter region was defined as 2000 bp upstream and 100 bp downstream of the annotated transcription start site of MYH7. The phylogenetic tree was constructed using MEGA11.
Animal studies
To generate transgenic mice cartying the human LCR-MYH7p- mCherry/MYH6p-TagBFP2 construct, the construct was linearized and injected into
C57BL/6NHsd single cell zygotes. For genotyping, tail clips were taken for genomic DNA extraction using DNeasy Blood & Tissue Kits (Qiagen). 1 pl of genomic DNA template was used for genotyping PCR. Two independent founders were recovered, no differences were detected among these two founders. Mice were outcrossed to WT Black Swiss background mice (Charles River Labs) for at least three generations for further analysis. For evolutionary developmental studies (evo-devo), adult pigs, rats, and golden hamsters were used. Cow and sheep hearts were freshly obtained commercially. For each animal heart, ventricles and atria were collected separately.
Statistics and reproducibility
Statistical analyses were performed using GraphPad Prism, Python and R. Replicates and statistical tests are indicated in the figure legends. No statistical methods were used to pre-determine sample size. Experiments did not use randomization or investigator blinding.
Data availability
Raw and processed RNA- and ATAC-sequencing data for the WT and CRE1/CRE2 DKO samples are accessible through GEO Series accession number GSE263376 (reviewer token: ehqjsmugtzmlrqp). The developmental RNA- seq, ATAC-seq, ChlP-seq and Hi-C samples are available online from GEO under accession numbers GSE116862 and GSE19236528’29.
Results
The cardiac MYH6/MYH7 locus resided exclusively in a TAD containing dynamically regulated CREs that may control MYH6 and MYH7 expression
To assess the gene regulation of MYH6 anA MYH7 expression in the human heart, both the transcriptomic profiles and chromatin accessibility of these cardiac MYH isoforms were tested in the specific cell types of the human heart. To this end, single-nuclear RNA and ATAC-sequencing (snRNA- seq/snATAC-seq) datasets obtained from matching cardiac samples that were isolated from the major cardiac chambers of adult human hearts were examined35. Analyses of these snRNA-seq datasets revealed that. MYH6 and MYH7. which were located tandemly in the same genomic locus on chromosome 14, were specifically expressed in
cardiomyocytes(FIG. 1A). In particular, human adult ventricular cardiomyocytes (V- CMs) expressed predominantly MYH7 but less MYH6, whereas human adult atrial cardiomyocytes (A-CMs) expressed primarily MYH6 but negligible amounts of MYH7 (FIG. 1A), thus demonstrating the antithetical expression of these two MYH isoforms. Moreover, interrogation of cognate snATAC-seq datasets further identified cardiomyocyte-specific cv.s-regulatory elements (CREs), including putative promoters (Pro) and distal CREs (CRE1-3), that may regulate MYH6 and MYH 7 expression in a cell-type specific but reciprocal manner within the cardiac MYH6/MYH 7 genomic locus (FIG. 1A).
To further investigate the control of the antithetical expression o MYH6 and MYH7 in human cardiomyocytes, a human pluripotent stem cell (hPSC) cardiomyocyte differentiation model was employed that enabled genetic interrogation of the dynamic gene regulation of MYH6 and MYH7 during human cardiomyocyte development. Specifically, the transcriptomic profiles and epigenomic landscape were examined across key cardiac developmental stages during the differentiation of a H9 hPSC MYL2-H2B- GFP ventricular cardiomyocyte reporter line at the following stages: Day (D)0 hPSCs, D2 mesoderm (Mes), D5 cardiac mesoderm (cMes), D7 cardiac progenitors (CP), D15 cardiomyocytes (CMs) and D80 ventricular cardiomyocytes (vCM). Analyzing the 3D genome topology from in situ Hi-C studies at these cardiomyocyte developmental stages identified a unique TAD, flanked by CTCF peaks with convergent motifs, on chromosome 14 that exclusively contained only two coding genes, MYH6 and MY H7. in tandem (FIG. IB), demonstrating that the expression of these MYH isoforms could be reciprocally co-regulated within this chromosomal architecturally defined genomic locus. Consistent with these findings, RNA-seq analyses further revealed that MYH6 was abundantly expressed in CPs and CMs but decreased significantly in vCMs (FIGs. 1B-1D). On the other hand, MYH7 expression was low in CPs but increased significantly during differentiation to become the predominant MYH isoform present in vCMs (FIGs. 1B-1D). To identify gene regulatory networks controlling the antithetical transcription of MYH6 and MYH7. the corresponding ATAC-seq was analyzed, which revealed CREs within the MYH6/MYH7 locus that were similar to those detected in adult human cardiomyocyte the snATAC-seq data (FIGs. 1 A and IB). Using cognate histone modification ChlP- seq data to define these CREs (H3K27Ac, H3K4me3), promoters for MYH6 and
MYH7 were identified, which displayed gain and loss of the H3K4me3 promoter mark that correlated with MYH6 and MY H 7 gene expression dynamics (FIG. IB). Additionally, three major distal CREs were identified within the MYH6/MYH7 locus that corresponded to CRE1-3 observed in adult human cardiomyocytes (FIGs. 1A and IB). CRE1 and CRE2, which are -7.8 kb and ~2.6 kb upstream oYMYH7 and displayed well-conserved genomic sequences ( FIG. 8A), were marked by primarily H3K27Ac but not H3K4me3 (FIG. IB). supporting their role as enhancers which were shown to be conserved in the Myh6/Myh7 mouse locus of differentiating mouse cardiomyocytes (FIG. 8E).
Furthermore, their co-accessibility and enhancer activity from CPs to vCMs correlated with stage-specific expression and promoter activity7 of MYH6 wA YH7 (FIG. IB), suggesting their potential involvement in transcriptional regulation of these MYH isoforms. Consistent with these findings, a dual luciferase reporter assay where CRE1 or CRE2 was cloned upstream of a human thymidine kinase (TK) promoter (FIG. 8B) revealed that both CRE1 and CRE2 exhibited significant luciferase activity7 with CRE2 displaying higher activity than CRE1 (FIG. 8B). On the other hand. CRE3 is ~1.8 kb upstream ofMYH6 (FIG. 8C) and mainly accessible in vCMs, when .W7/7 is the predominant isoform expressed (FIGs. IBID). Despite its sequence being relatively well-conserved, CRE3 exhibited no H3K27ac or H3K4me3 marks (FIG. IB) nor any significant reporter luciferase activity (FIG. 8D), suggesting that this CRE may function other than an enhancer or promoter (FIG. IB).
To investigate whether long-range chromatin interactions can regulate MYH6 and MYH7 expression within their genomic locus, in situ Hi-C data at the aforementioned hPSC cardiomyocyte developmental stages was examined. A -27 kb chromatin interaction was observ ed between the CRE1/CRE2 enhancers and .WF//6 promoter in CPs and CMs but not in vCMs (FIG. IE), supporting that CRE1 and CRE2 together may interact with the MYH6 promoter by chromatin looping at the early stages of cardiomyocyte differentiation when MYH6 is highly7 transcribed (FIGs. 1B-1E and 1G). Confirming these findings, the 4C-seq studies revealed significantly greater interactions between thsMYH6 promoter and CRE1/CRE2 enhancers in CMs than those observed in the vCMs (FIG. IF). These chromatin interaction results correlated with both the dynamic promoter activity7 and the gene
expression of MYH6 and MYH7 at corresponding cardiac developmental stages (FIGs. IB- ID). Altogether, these findings demonstrated that CRE1 and CRE2 together can form a conserved super-enhancer cluster that may act as a cardiac MYH (cMYH) locus control region (LCR) to antithetically regulate MYH6 and MYH7 expression in cardiomyocytes through its dynamic interactions with the respective MYH isoform promoters (FIG. 1G).
MYH6/MYH7 CRE1 and CRE2 enhancers functioned as a cMYH LCR that controlled the expression of both MYH6 and MYH7
To investigate the role of CRE1-3 in regulating gene expression within the TAD- confined MYH6/MYH7 locus. hPSCs harboring CRISPR- Cas9 genome- edited deletions of these CREs were created and examined (FIG. 9). Among these hPSC deletion lines, CRE1 and CRE2 knockout (KO) hPSC-CMs displayed significantly decreased MYH6 wd MYH7 expression compared to the wild-type (WT) control, while TNNT2 expression was not affected ( FIGs. 9A and 9F), confirming that CRE1 and CRE2 functioned as enhancers that can individually regulate both MYH6 and MYH7 expression. Consistent with the CRE1 and CRE2 luciferase reporter assays (FIG. 9B), it was found that both MYH6 and MYH7 expression levels were lower in CRE2 KO hPSC-CMs compared to CRE1 KO hPSC-CMs (FIGs. 9C and 9F), demonstrating that compared to CRE1, CRE2 may exhibit a greater gene regulatory effect on directing the expression of these MYH isoforms. However, CRE3 KO hPSC-vCMs, on the other hand, did not exhibit significant changes in MYH6 mA MY 117 expression compared to the WT hPSC- vCM control (FIG. 91), which was consistent with the absence of H3K27ac or H3K4me3 marks on CRE3 as well as the limited CRE3 luciferase reporter activity (FIGs. 1C and 9D).
To further examine whether CRE1 and CRE2 enhancers function cooperatively to direct MYH6 and MYH7 expression, a CRE1/CRE2 double knockout (CRE1/CRE2 DKO) hPSC line was generated and analyzed, which exhibited loss of specifically both CRE1 and CRE2 genomic sequences (FIGs. 2A and 10A). While knocking out both CRE1/CRE2 enhancers did not appear to affect hPSC-CM differentiation and TNNT2 expression (FIGs. 1 OB and 2B), it showed a significant reduction in the expression levels oiMYH6 andMYH7 in CPs, CMs and vCMs (FIGs.
2B and 2C), with MYH7 exhibiting an even greater reduction than MYH6 (FIG. 2B). In line with these findings. RNA-seq studies revealed that CRE1/CRE2 DKO hPSC- CMs exhibited significantly reduced expression in not only MYH6 and MYH7 but also in the corresponding non-coding RNAs MIR208A, MIR208B and MHRT (FIGs. 2D and 2E). However, neither genes surrounding the MYH6/MYH7 TAD such as NGDN and CMTM5. nor other cardiac differentiation genes including NKX2-5. GATA4, GATA6, TBX5. TNNT2 were appreciably affected (FIG. 2E). Thus, the results demonstrated that the CRE1/CRE2 enhancers, which were shown to be conserved ( FIG. 8 A), functioned together as a cMYH LCR that regulates the expression of RNA transcripts within the TAD-confined MYH6/MYH7 locus. Substantiating this notion, corresponding ATAC-seq studies on these CRE1/CRE2 DKO hPSC-CMs confirmed that loss of CRE1/CRE2 enhancers resulted in an overall reduced chromatin accessibility of the MYH6IMYH7 locus (FIGs. 2D and 2F). However, the chromatin accessibility7 of CREs adjacent to the TAD-confined MYH6/MYH7 locus did not appear affected (FIG. 2D). Finally, 4C-seq studies revealed that deleting both CRE1 and CRE2 enhancers abolished the long-range chromatin interaction between the MYH6 promoter and the CRE1/CRE2 enhancers in CMs, further supporting the role of the CRE1/CRE2 enhancers together functioning as a cMYH LCR for the MYH6/MYH7 locus (FIG. 2G).
To investigate how disrupting cMYH LCR regulation of the MYH6IMYH7 locus may impact CMs, the physiological function and sarcomere organization of CRE1/CRE2 DKO hPSC-CMs were examined. To measure the contractility of hPSC- CMs, a combination of 3D-bioprinted cardiac micro-tissue ( FIG. IOC) and cardiomyocyte traction force microscopy (TFM) systems were used. Consistent with the significant reduction of both mRNA and protein levels in CRE1/CRE2 DKO CMs (FIGs. 2B-2E). the contractility of CRE1/CRE2 DKO hPSC-CMs was significantly reduced compared to WT hPSC-CMs (FIGs. 10D and 1 OE). However, no significant changes in CM beating rate were observed between the WT control and CRE1/CRE2 DKO CMs (FIG. 10F). Corroborating these findings, CRE1/CRE2 DKO hPSC-CMs further exhibited significantly disrupted sarcomere organization as detected by examining a- ACTININ organization (FIGs. 10G and 10H), which may account for the reduced contractility7 of these CMs. In lines with these findings, genes and regions of chromatin accessibility particularly downregulated in CRE1/CRE2 DKO hPSC-
CMs included those participating in “Muscle contraction’' and “Regulation of heart contraction” as detected by the GO-term analysis (FIG. 101), and “Adult heart development” and “Muscle filament sliding” as detected by the GREAT ontology analysis (FIG. 10J). Overall, these results demonstrated that CRE1/CRE2 may function together as a cMYH LCR that can dynamically interact with a combination of promoters in a TAD-confined self-interacting MYH6/MYH 7 genomic locus to control the expression of coding (and non-coding) genes critical for regulating cardiomyocyte sarcomeric organization and contractile function.
MYH6-MYH7 promoter competition for the cMYH LCR regulated the antithetical expression ofMYH6 and MYH7
Given that MYH6 and MYH7 expression were shown to be antithetically coregulated by a common LCR (FIG. 2). the underlying mechanisms controlling this gene regulator}- switching process were further investigated. Since previous studies have shown that globin gene expression within the P-globin locus is regulated through promoter competition for a common upstream p-globin LCR31’43, it was explored whether a similar promoter competition between the MYH6 and MYH7 promoters for the cMYH LCR, which is also upstream of MYH6 and MYH7, may regulate the switching of gene expression between these MYH isoforms. To this end, hPSC knockout (KO) lines harboring deletions of either the ~1.7 kb MYH6 promoter (FIG. 3A) or -1.2 kb MYH7 promoter (FIG. 3B) were created and examined. RNA and protein studies revealed that MYH6 promoter KO hPSC-CPs and CMs displayed significantly reduced MYH6 but increased MYH7 gene and protein expression levels compared to the CP and CM WT controls, which typically exhibited reciprocally high and low levels cd MYH6 an Y H7. respectively (FIGs. 3C and 3E). On the other hand. MYH7 promoter KO hPSC-CMs and vCMs conversely displayed a significantly reduced MYH 7 but inversely increased MYH6 gene and protein expression levels when compared to WT controls, which usually expressed low and high levels of MYH6 and MYH7. respectively in WT vCMs (FIGs. 3D and 3F). However, knocking out either MYH6 or MYH7 promoters did not affect CM or vCM differentiation since comparable levels of CMs and vCMs were observed between the WT and MYH6 or MYH7 promoter KO hPSC lines, respectively (FIGs. 11C and 12C).
Complementing these MYH6MYH7 promoter KO hPSC studies, a CRISPR activation (CRISPRa) system and a CRISPR interference (CRISPRi) system were
used. A CRISPRa system was used to activate the MF//7 promoter in hPSC-CMs when MYH7 expression was low but MYH6 expression was high, while a CRISPR interference (CRISPRi) system was used to inhibit the MYH7 promoter in hPSC- vCMs when MYH7 expression was high but MYH6 expression was low (FIGs. 3G and H). As a result, CRISPRa-mediated MYH7 activation significantly increased MYH7 expression but decreased MYH6 expression in hPSC-CMs (FIG. 3G), whereas CRISPRi-mediatedATK777 inhibition significantly decreased MYH7 expression but increased MYH6 expression in hPSC-vCMs (FIG. 3H) as similarly observed in MYH7 promoter KO hPSC-vCMs (FIG. 3D).
To investigate how altered MYH6 and MYH7 gene regulation due to disrupted MYH6IMYH7 promoter competition for the cMYH LCR may influence cardiomyocyte function, contractility and sarcomeric organization otMYH6 promoter KO hPSC-CMs and MYH7 promoter KO hPSC-vCMs were further analyzed. Consistent with the predominant expression of MYH6 at the early stages of cardiomyocyte development, the loss oiMYH6 expression \nMYH6 promoter KO hPSC-CPs resulted in no appreciable contractility in these hPSC-CPs compared to WT control hPSC-CPs, despite an increase in MYH7 expression that was albeit still less than the ATFH6 expression typically observed in WT control hPSC-CPs (FIG. 3C).
However, MYH6 promoter KO hPSC-CMs, which displayed a ~10-fold increase in MYH7 mRNA level compared to that of MYH6 promoter KO hPSC-CPs (FIG. 3C), exhibited detectable contractility. However, this contractility remained lower than that observed in WT control hPSC-CMs (FIGs. 1 ID and 1 IE). This demonstrated that the increased MYH7 expression, which was still lower than the MYH6 mRNA expression levels typically observed in WT control hPSC-CMs (FIG. 3C), can only partially rescue the contractile deficit of MYH6 promoter KO hPSC- CMs. Consistent with this partial rescue, a- ACTININ immunostaining revealed that MYH6 promoter KO hPSC-CMs displayed heterogeneous regions of both well- organized as well as less-organized sarcomeres (FIGs. UG and 11H). However, despite these contractility and sarcomeric findings, no significant changes in CM beating rate were observed between WT control and MYH6 promoter KO CMs (FIG. 1 IF). On the other hand, MYH7 promoter KO hPSC-vCMs exhibited similar contractility as well as beating rate compared to WT hPSC-vCMs (FIGs. 12D-12F),
and displayed organized sarcomeres that were comparable to those observed in WT hPSC-vCMs (FIGs. 12G and 12H). These findings were in line with the increase in MYH6 expression observed in the MYH7 promoter KO hPSC-vCMs (FIG. 3D). However, they were in contrast to the disorganized sarcomeres observed in MYH7 gene KO hPSC- CMs as recently reported44. This demonstrated that upregulation of MYH6 in the AT1777 promoter KO hPSC-vCMs, which would likely not occur in the MYH7 gene KO. may rescue sarcomere defects due to the loss of MY 7 expression. Altogether, these results demonstrated that MYH6 and MYH7 expression is antithetically regulated through the competition of their respective promoters for the cMYH LCR, and disruption of this regulation can alter cardiomyocyte function.
TheMYH7 promoter contained key regulatory sequences for controlling its activity and MYH6-MYH7 gene switching
To understand how the MYH6/MYH7 promoter competition for the cMYH LCR is regulated, the MYH6/MYH7 promoters were interrogated to identify key regulatory7 sequences that may mediate the gene regulator}7 switching between MYH6 andMYH7 during cardiomyocyte differentiation. To this end, a hPSC MYH6/MYH7 gene regulatory reporter system was developed in the H9 hPSC TNNT2-EGFP cardiomyocyte reporter line in order to examine the activity of CREs and more specific gene regulatory sequences within the MYH6MYH 7 locus, which may control MYH6 and MYH7 expression in the TNNT2-EGFP labeled cardiomyocytes (FIG. 13 A). MYH6 andMYH7 promoter reporter lines directing the expression of the fluorescent mCherry gene (MYH6p-mCherry and Mil H7p-mC her ry), were initially generated, differentiated into TNNT2-EGFP+ CMs, and then analyzed for reporter activity. While hPSC-CMs harboring the MYH7p-mCherry transgenic reporter displayed no detectable reporter fluorescence activity in CMs, hPSC-CMs with the MYH6p-mCherry transgenic reporter exhibited minimal reporter fluorescence activity (FIG. 13B), suggesting that MYH6 promoter has some basal activity independent of the cA/TT/ LCR, which was consistent with the cMFHLCR CRE1/CRE2 DKO hPSC cardiac findings (FIG. 2B). However, when the cMYH LCR w as included with either the MYH6p-mCherry or MYH7p-mCherry reporter hPSC line (LCR-MYH6p-mCherry, LCR-MYH7p-mCherry) , MYH6 and MYH7 promoter fluorescence reporter activity w as appreciably detectable in CMs (FIG. 13C), further demonstrating that the role of cMYH LCR in MYH6 and MYH7 gene regulation and expression. These results
showed that the hPSC MYH6/MYH7 gene regulatory reporter system could be used to investigate regulatory sequences controlling the transcriptional regulation otMYH6 and MYH7.
To further identify key regulatory sequences controlling the activity and switching between the MYH6 and MYH7 promoters, a dual luciferase reporter system was generated that contained all regulatory elements of the endogenous MYH6/MYH7 locus, including the cATFHLCR and both MYH7 and MYH6 promoters, which were cloned upstream of the firefly luciferase gene (liic2) and the renilla luciferase gene (R/uc). respectively (IX'R- MYH7p-Luc2/MYH6p-RLuc, FIG. 4A). Using this dual luciferase reporter system, which allowed the direct quantitation of MYH6 and MY H 7 promoter activity in hPSC-CMs, a ~1.2 kb region of the MYH7 promoter (-772 to +386) was analyzed. Deletion of this region abolished nearly a\\ MYH7 promoter activity (FIG. 4B). To identify specific DNA regulatory sequences that may control this activity (FIG. 4B), a series of deletion mutants across the 1.2 kb region were generated and tested using the reporter assay. The results showed that deleting regions between -286 to +114 significantly reduced MYH7 promoter activity, whereas deleting regions from -772 to -286 and from +114 to +386 led to relatively minimal effects on this activity (FIG. 4B). Further sequential -40 bp deletions across this -286 to +1 \dMYH7 promoter region (i.e., Al-10) identified key sequences including Al, A3, A5 and A7-10 regions that particularly regulate this promoter activity as detected by the reporter system (FIG. 4C). Specifically, the A8 (-6 to +34) and A9 (+35 to +74) regions overlapped with DNA sequences of MYH7 exon 1 including the transcription start site (TSS), and the A7 (-46 to -7) region contained a TATA box sequence. Thus, these sequences likely regulated MYH7 promoter activity by recruiting transcriptional machinery to the MYH7 promoter (FIG. 4D). Additionally, Al (-286 to -247) and A3 (-206 to -167) regions harbored DNA binding motif sequences for TEA domain family member 1 (TEAD1), which has been reported to be involved in the expression o MYH747'49. Finally, the A5 (-126 to -87) region, which exhibited a similarly strong effect on promoter activity as A7-9 regions when deleted, was distal to the TATA box/core promoter, demonstrating that the A5 region may also contain key DNA sequences that allow the binding of factors participating in MYH7 transcription. Despite the strong inhibitory effects of deleting the A5 region in the reporter assay, its role in regulating MYH7 promoter activity was unclear. To test the functional
significance of the A5 MYH7 promoter region in controlling MYH7 expression in human cardiomyocytes, a hPSC knockout (KO) line harboring deletions of this region was created and examined. To this end, CRISPR gRNAs were identified to create a A5 (-133 to -88) MYH7 promoter KO hPSC line which contained a deletion including 39 bp of the A5 region (FIG. 4E). Compared to WT hPSC cardiomyocyte controls, the cardiomyocytes generated from this A5 (133 to -88) MYH7 promoter KO hPSC line demonstrated not only decreased MYH7 expression in both CMs and vCMs but also increased MYH6 expression in vCMs such that MYH6 became the predominant MYH isoform expressed (FIGs. 4F and 4G). However, MYH6 expression did not increase significantly in CMs (FIG. 4F), likely because MYH6 was already the predominant cardiac MYH isoform expressed in early CMs (FIG. 4G). Taken together, these analyses demonstrated key regulatory regions in the MYH7 promoter that are invovled in both the regulation otMYH7 expression as well as the switching between MYH 6 and MYH7 gene expression in human cardiomyocytes.
Evolutionary divergent DNA sequences within key genomic region controlling MYH7 promoter activity) regulated MYH6-MYH7 switching in human cardiomyocytes.
Previous studies have shown that MYH7 is the predominant cardiac MYH isoform expressed in adult human ventricles/ vCMs, but MYH6 is the main isoform expressed in adult mouse ventricles/vCMs8. However, the underlying mechanisms leading to these disparities in MYH6 and MYH7 expression remained to be illuminated. To test if the differences in the expression of the cardiac MYH isoform is due to altered gene regulatory control of the promoter activity between human and mouse, key genomic regions controlling the MF//7 promoter activity were compared and analyzed across a broad range of mammals. While the MYH7 promoter was relatively well-conserved, non-conserved sequences were identified that were particularly located in the A4, A5 MYH7 promoter regions (FIG. 14). Upon closer examination of the A5 MYH7 promoter region, which exhibited significant promoter activity (FIGs. 4C, 4F, and 4G), it w as discovered that this region contained speciesdivergent sequences including a 10 bp region (-126 to -117) that notably differed between rodent-specific species and most other examined mammalian species (FIGs. 5 A and 14). On the other hand, the species-divergent sequences within the A4 MYH7 promoter region, which displayed minimal promoter activity (FIG. 4C), varied across all mammalian species (FIG. 14).
Further functional interrogation of the A5 MYH7 promoter region using the reporter assay revealed that deletion of the first 10 bp of this A5 MYH7 promoter region (A5.1, - 126 to -117), which contained the species-divergent region, resulted in the strongest inhibitory effect on the MYH7 promoter activity compared to the other serial 10 bp deletions within the A5 MYH7 promoter region (A5.2 to A5.7, -121 to -87) (FIG. 5B). Supporting the functional significance of this A5.1 region in regulating MYH7 expression as well as the antithetical expression of MYH6, an MYH7 promoter KO hPSC line (-133 to -117) including the deletion of this A5.1 region (FIG. 5C) displayed significantly decreased MYH7 expression when differentiated into CMs and vCMs. However, an increased MYH6 expression in vCMs (FIG. 5D) was observed where instead of MYH7, MYH6 became the main MYH isoform (FIG. 5E). On the other hand, MYH6 expression was not appreciably- increased in CMs of these KO hPSCs, presumably due to the high level of existing MYH6 promoter activity and expression at this CM stage.
Species-divergent sequences in the A5.1 MYH7 promoter region regulated contrasting antithetical MYH6MYH7 expression differences between human and rodent species.
To investigate whether the species-divergent sequences in the A5.1 MYH7 promoter region might contribute to differences in the cardiac MYH isoform expression in the adult ventricles of non-rodent versus rodent-related mammals (FIG. 6A), the expression of MYH6 and MYH7 were examined in the hearts of several mammalian species. Correlating closely with their divergence of sequences in the A5.1 MYH7 promoter region (FIG. 6A), non-rodent mammals (humans, cows, sheep, pigs, rabbit) and rodent-specific mammals (e.g., mouse, rat, golden hamster, guinea pig) predominantly expressed MYH7 and MYH 6 in their ventricles, respectively (FIGs. 1, 6B, and 6C). However, the percentage of MYH7 versus MYH6 in ventricles was lower in rabbits, a non-rodent mammal that is an evolutionarily close relative of rodents (FIG. 6A), compared to that of other non-rodent mammals like cows, sheep and pigs. However, the percentage of MYH7 versus MYH6 in ventricles was higher in guinea pigs and golden hamsters when compared to that of other rodent species (FIG. 6C). In line with these findings, the A5.1 MYH7 promoter sequence in rabbits, guinea pigs and golden hamsters displayed less divergence from non-rodent mammals compared to mice and rats. In particular, the rabbit sequence contained a 2 bp mismatch, which flanked the A5.1 MYH7 promoter sequence that primarily differed
between rodent species and other mammals. The golden hamster and guinea pig contained a 2 and 3 bp mismatch, respectively, that resided within these divergent sequences which was ~4-5 bp in mice and rats (FIG. 6A).
To further investigate whether these divergent sequences within the A5. 1 MYH7 promoter region may specifically regulate the differences in the cardiac MYH isoform species-specific expression between human and mouse, which primarily express MYH7 wA MYH6 in their ventricles, respectively, a transgenic mouse line Tg(hLCR-MYH7p-mCherry/MYH6p-TagBFP2) expressing the human LCR-MYH7p- mCherry MYH6p-TagBFP2 reporter construct was created and analyzed (FIG. 15 A). Consistent with the endogenous expression of Myh7 in embryonic mouse ventricles (FIG. 15B), MYH7-mCherry was specifically expressed in the ventricles of these transgenic mouse embryonic hearts (FIG. 15A). However, in contrast to the decrease in the endogenous Myh7 expression after birth in mouse ventricles. MYH p-mCherry increased its ventricular expression postnatally (FIG. 15) as similarly observed for MYFF7 in human vCMs (FIG. 1). On the other hand, M17/6/i-TagBFP2 was observed in both the atria and ventricles of these transgenic mice and continued its expression in the atria postnatally (FIG. 15 A) as observed for MYH6 in both human and mouse hearts36’50. However, unlike the robust increase in postnatal expression of endogenous Myh6 in mouse ventricles, MYH6p-TagBFP2 did not display a similar increase in expression in these cardiac ventricles (FIG. 15B).
To investigate whether these mouse-specific sequences could alter the endogenous human MYH7 promoter activity and the regulation of both MYH7 and MYH6 expression in human cardiomyocytes, a knock-in (KI) hPSC lines were created which contained the mouse-specific 10 bp A5. 1 MYH7 promoter sequences that replaced the corresponding human-specific sequences (FIG. 6D). In contrast to WT hPSC-vCMs, it was discovered that vCMs from the KI hPSC line expressed predominantly MYH6 but low levels <F MYH7. as similarly observed in mouse ventricles (FIGs. 6E and 6F). Thus, the results demonstrated that the divergent DNA sequences that was discovered in the A5. 1 MYH7 promoter sequence may contribute to the differences in the mammalian species-specific expression of MYH7 andMYH6 between human and mouse. Overall, these comparative evolutionary genomic studies showed species-specific sequences within the MYH7 promoter that may provide
insights into the gene regulatory mechanisms controlling the species-divergent antithetical MYH6/MYH7 expression differences across mammals (FIG. 6G).
References:
1. Lehman, S. J., Crocini. C. & Leinwand, L. A. Targeting the sarcomere in inherited cardiomyopathies. Nat Rev Cardiol 19, 353-363 (2022). worldwideweb.doi.org: 10. 1038/s41569-022-00682-0
2. Weiss, A. & Leinwand, L. A. The mammalian myosin heavy chain gene family. Annu Rev Cell Dev Biol 12, 417-439 (1996). worldwideweb.doi.org: 10.1146/annurev. cellbio.12. 1.417
3. Barrick, S. K. & Greenberg, M. J. Cardiac myosin contraction and mechanotransduction in health and disease. J Biol Chem 297, 101297 (2021). world wideweb . doi . org : 10. 1016/j . j be.2021. 101297
4. Lompre, A. M. et al. Species- and age-dependent changes in the relative amounts of cardiac myosin isoenzymes in mammals. Dev Biol 84, 286-290 (1981). worl dwi deweb. doi. org: 10. 1016/0012- 1606(81 )90396- 1
5. Clark, W. A.. Jr.. Chizzonite, R. A., Everett. A. W., Rabinowitz, M. & Zak. R. Species correlations between cardiac isomyosins. A comparison of electrophoretic and immunological properties. J Biol Chem 257, 5449-5454 (1982).
6. Hamilton, N. & lanuzzo, C. D. Contractile and calcium regulating capacities of myocardia of different sized mammals scale with resting heart rate. Mol Cell Biochem 106, 133-141 (1991). worldwideweb.doi.org: 10.1007/BF00230179
7. Reiser, P. J. & Kline. W. O. Electrophoretic separation and quantitation of cardiac myosin heavy chain isoforms in eight mammalian species. Am J Physiol 274, H1048-1053 (1998). worldwideweb.doi.org:10.1152/ajpheart.l998.274.3.H1048
8. Lyons, G. E , Schiaffino, S., Sassoon, D., Barton, P. & Buckingham, M. Developmental regulation of myosin gene expression in mouse cardiac muscle. J Cell Biol UC 2427-2436 (1990). worldwideweb.doi.org: 10. 1083/jcb.1 11.6.2427
9. Lowes, B. D. et al. Changes in gene expression in the intact human heart.
Downregulation of alpha-myosin heavy chain in hypertrophied, failing ventricular myocardium. J Clin Invest 100, 2315-2324 (1997). worl dwi deweb. doi . org: 10. 1172/JCI 119770
10. Reiser, P. J., Portman, M. A., Ning, X. H. & Schomisch Moravec, C. Human cardiac myosin heavy chain isoforms in fetal and failing adult atria and ventricles. Am J Physiol Heart Circ Physiol 280, H1814-1820 (2001). worldwideweb.doi.org: 10.1152/ajpheart.2001.280.4.Hl 814
11. Seok, H. Y. et al. Loss of MicroRNA-155 protects the heart from pathological cardiac hypertrophy. Circ Res 114, 1585-1595 (2014). worldwideweb.doi'org: 10.1161/CIRCRESAHA.114.303784
12. Huang. Z. P. et al. MicroRNA-22 regulates cardiac hypertrophy and remodeling in response to stress. Circ Res 112, 1234-1243 (2013). worldwideweb.doi.org: 10. 1161/CIRCRESAHA. 112.300682
13. Leach, J. P. et al. Hippo pathway deficiency reverses systolic heart failure after infarction. Nature 550. 260-264 (2017). worldwideweb.doi.org: 10.1038/nature24045
14. Palmer. B. M. Thick filament proteins and performance in human heart failure. Heart Fail Rev 10, 187-197 (2005). worldwideweb.doi.org: 10.1007/sl0741-005- 5249-1
15. Herron, T. J. & McDonald, K. S. Small amounts of alpha-myosin heavy chain isoform expression significantly increase power output of rat cardiac myocyte fragments. Circ Res 90, 1150-1152 (2002). worldwideweb.doi.org:10. 1161/01. res.0000022879.57270.11
16. Krenz, M. & Robbins, J. Impact of beta-myosin heavy chain expression on cardiac function during stress. J Am Coll Cardiol 44, 2390-2397 (2004). worldwideweb.doi.org: 10.1016/j .j acc.2004.09.044
17. James, J. et al. Forced expression of alpha-myosin heavy chain in the rabbit ventricle results in cardioprotection under cardiomyopathic conditions. Circulation 111, 2339-2346 (2005). worldwideweb.doi.org: 10.1161/01. CIR.0000164233.09448. B 1
18. Herron, T. J. et al. Ca2+ -independent positive molecular inotropy for failing rabbit and human cardiac muscle by alpha-myosin motor gene transfer. FASEB J 24, 415-424 (2010). worldwideweb.doi.org: 10. 1096/fj.09- 140566
19. Lowes, B. D. et al. Myocardial gene expression in dilated cardiomyopathy treated with beta-blocking agents. N Engl J Med 346, 1357-1365 (2002). worldwideweb.doi.org: 10. 1056/NEJMoaO 12630
20. Locher, M. R., Razumova, M. V., Stelzer, J. E., Norman, H. S. & Moss, R. L. Effects of low-level α- myosin heavy chain expression on contractile kinetics in porcine myocardium. Am J Physiol Heart Circ Physiol 300, H869-878 (2011). worldwideweb. doi.org : 10. 1152/aj pheart.00452.2010
21. Hang, C. T. et al. Chromatin regulation by Brgl underlies heart muscle development and disease. Nature 466, 62-67 (2010). worldwideweb.doi.org: 10.1038/nature09130
22. Gacita, A. M. el al. Genetic Variation in Enhancers Modifies Cardiomyopathy Gene Expression and Progression. Circulation 143, 1302-1316 (2021). worldwideweb.doi.org: 10. 1161/CIRCULATIONAHA. 120.050432
23. van Rooij, E. et al. Control of stress-dependent cardiac growth and gene expression by a microRNA. Science 316, 575-579 (2007). worldwideweb.doi.org: 10. 1126/science. 1139089
24. Montgomery, R. L. et al. Therapeutic inhibition of miR-208a improves cardiac function and survival during heart failure. Circulation 124, 1537-1547 (2011). worldwideweb.doi.org: 10. 1161/CIRCULATIONAHA. 111.030932
25. Callis, T. E. et al. MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice. J Clin Invest 119, 2772-2786 (2009). worldwideweb.doi.org: 10. 1172/JCI36154
26. Han, P. et al. A long noncoding RNA protects the heart from pathological hypertrophy. Nature 514, 102- 106 (2014). worldwideweb ,doi.org: 10.1038/nature 13596
27. Knotts. S., RindL H. & Robbins. J. Position independent expression and developmental regulation is directed by the beta myosin heavy chain gene's 5' upstream region in transgenic mice. Nucleic Acids Res 23, 3301-3309 (1995). worldwideweb.doi.org: 10. 1093/nar/23.16.3301
28. Zhang, Y. et al. Transcriptionally active HERV-H retrotransposons demarcate topologically associating domains in human pluripotent stem cells. Nat Genet 51, 1380-1388 (2019). worldwideweb.doi.org: 10. 1038/s41588- 019-0479-7
29. Des ti ci . E. et al. Eluman-gained heart enhancers are associated with speciesspecific cardiac attributes. Nat Cardiovasc Res 1, 830-843 (2022). worldwideweb. doi. org : 10. 1038/s44161 -022-00124-7
30. Enver, T. et al. Developmental regulation of human fetal -to-adult globin gene switching in transgenic mice. Nature 344, 309-313 (1990). worldwideweb.doi.org: 10. 1038/344309a0
31. Behringer, R. R., Ryan, T. M., Palmiter, R. D., Brinster, R. L. & Townes, T. M. Human gamma- to beta- globin gene switching in transgenic mice. Genes Dev 4. 380-389 (1990). worldwideweb.doi.org: 10. 1101/gad.4.3.380
32. Liu, N. et al. Transcription factor competition at the gamma-globin promoters controls hemoglobin switching. Nat Genet 53, 511-520 (2021). worldwideweb.doi.org: 10. 1038/s41588-021-00798-y
33. Rohner, E., Yang, R., Foo, K. S., Goedel, A. & Chien, K. R. Unlocking the promise of mRNA therapeutics. Nat Biotechnol 40, 1586-1600 (2022). worldwideweb. doi. org: 10. 1038/s41587-022-01491 -z
34. Caudal. A.. Snyder, M. P. & Wu, J. C. Harnessing human genetics and stem cells for precision cardiovascular medicine. Cell Genom 4, 100445 (2024). worldwideweb. doi. org: 10. 1016/j .xgen.2023. 100445
35. Hocker, J. D. et al. Cardiac cell type-specific gene regulatory programs and disease risk association. Set Adv 7 (2021). worldwideweb.doi.org: 10. 1126/sciadv.abfl444
36. Lu, P. et al. Cardiac Myosin Heavy Chain Reporter Mice to Study Heart Development and Disease. Circ Res 131, 364-366 (2022). worldwideweb. doi. org : 10. 1161 /CIRC RES AHA.122.321461
37. Veevers, J. et al. Cell-Surface Marker Signature for Enrichment of Ventricular Cardiomyocytes Derived from Human Embryonic Stem Cells. Stem Cell Reports 11, 828-841 (2018). worldwideweb.doi.org: 10. 1016/j. stemcr.2018.07.007
38. Rao, S. S. el al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 159, 1665-1680 (2014). worldwideweb.doi.org: 10. 1016/j. cell.2014. 11.021
39. Heintzman, N. D. et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature 459, 108-112 (2009). worldwideweb.doi.org: 10.1038/nature07829
40. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F. & de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Mol Cell 10, 1453-1465 (2002). worldwideweb.doi.org:10.1016/sl097-2765(02)00781-5
41. Miller, K. L. et al. Rapid 3D BioPrinting of a human iPSC-derived cardiac microtissue for high- throughput drug testing. Organs-on-a-Chip 3, 100007 (2021).
42. Deacon, D. C. et al. Combinatorial interactions of genetic variants in human cardiomyopathy. Nat Biomed Eng 3, 147-157 (2019). worldwideweb. doi. org: 10.1038/s41551-019-0348-9
43. Liu, N. et al. Direct Promoter Repression by BCL11 A Controls the Fetal to Adult Hemoglobin Switch. Cell 173. 430-442 e417 (2018). worldwideweb.doi.org: 10. 1016/j. cell.2018.03.016
44. Chopra, A. et al. Force Generation via beta-Cardiac Myosin, Titin, and alpha- Actinin Drives Cardiac Sarcomere Assembly from Cell-Matrix Adhesions. Dev Cell 44, 87-96 e85 (2018). worldwideweb.doi.org: 10. 1016/j. devcel.2017. 12.012
45. Wrighton, P. J. et al. Signals from the surface modulate differentiation of human pluripotent stem cells through glycosaminoglycans and integrins. Proc Natl Acad
Sci U S A 111, 18126-18131 (2014). worldwideweb.doi.org: 10. 1073/pnas.1409525111
46. Haberle, V. & Stark, A. Eukary otic core promoters and the functional basis of transcription initiation. Nat Rev Mol Cell Biol 19, 621-637 (2018). worldwideweb.doi.org: 10. 1038/s41580-018-0028-8
47. Kariya, K., Farrance, I. K. & Simpson, P. C. Transcriptional enhancer factor-1 in cardiac myocytes interacts with an alpha 1-adrenergic- and beta-protein kinase C- inducible element in the rat beta-myosin heavy chain promoter. J Biol Chem 268, 26658-26662 (1993).
48. Kariya. K.. Kams, L. R. & Simpson. P. C. An enhancer core element mediates stimulation of the rat beta- myosin heavy chain promoter by an alpha 1-adrenergic agonist and activated beta-protein kinase C in hypertrophy of cardiac myocytes. J Biol Chem 269, 3775-3782 (1994).
49. Liu, R. et al. Teadl is required for maintaining adult cardiomyocyte function, and its loss results in lethal dilated cardiomyopathy. JCI Insight 2 (2017). worldwideweb.doi.org: 10. 1172/jci.insight.93343
50. Farah, E. N. et al. Spatially organized cellular communities form the developing human heart. Nature 627, 854-864 (2024). worl dwi deweb. doi. org: 10. 1038/s41586-024-07171 -z
51. Dos Santos, M. et al. A fast Myosin super enhancer dictates muscle fiber phenotype through competitive interactions with Myosin genes. Nat Commun 13, 1039 (2022). worldwideweb.doi.org: 10. 1038/s41467-022-28666- 1
52. Topfer, S. K. et al. Disrupting the adult globin promoter alleviates promoter competition and reactivates fetal globin gene expression. Blood 139, 2107-2118 (2022). worldwideweb.doi.org: 10. 1182/blood.2021014205
53. Sankaran, V. G. et al. Developmental and species-divergent globin switching are driven by BCL11A. Nature 460, 1093-1097 (2009). worldwideweb.doi.org: 10. 1038/nature08243
54. Frangoul, H. et al. CRISPR-Cas9 Gene Editing for Sickle Cell Disease and betaThalassemia. N Engl J Med 384, 252-260 (2021). worldwldeweb.doi.org: 10. 1056/NEJMoa2031054
55. Sharma, A. et al. CRISPR-Cas9 Editing of the HBG1 and HBG2 Promoters to Treat Sickle Cell Disease. N Engl J Med 389, 820-832 (2023). worldwideweb.doi.org: 10. 1056/NEJMoa2215643
56. Lian, X. et al. Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/p-catenin signaling under fully defined conditions. Nat Protoc 8, 162-175 (2013). worldwideweb.doi.org: 10. 1038/nprot.2012. 150
57. Burridge, P. W. et al. Chemically defined generation of human cardiomyocytes. Nat Methods 11, 855-860 (2014). worldwideweb.doi.org: 10.1038/nmeth.2999
58. Concordet, J. P. & Haeussler, M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res 46. W242-w245 (2018). worldwidewcb.doi.org: 10. 1093/nar/gky354
59. Hinson, J. T. et al. HEART DISEASE. Titin mutations in iPS cells define sarcomere insufficiency as a cause of dilated cardiomyopathy. Science 349, 982- 986 (2015). worldwideweb.doi.org: 10.1126/science.aaa5458
60. Konermann, S. et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 517. 583-588 (2015). worldwideweb . doi . org : 10.1038/nature 14136
61. Doench, J. G. et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol 34, 184-191 (2016). worldwideweb. doi. org : 10. 1038/nbt.3437
62. Sanson, K. R. et al. Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities. Nat Comm n 9, 5416 (2018). worldwideweb. doi. org: 10. 1038/s41467-018-07901 -8
63. Gilbert, L. A. et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451 (2013). worldwideweb. doi. org: 10. 1016/j . cell.2013.06.044
64. Wu, H. et al. Epigenetic Regulation of Phosphodiesterases 2A and 3 A Underlies Compromised beta- Adrenergic Signaling in an iPSC Model of Dilated Cardiomyopathy. Cell Stem Cell 17. 89-100 (2015). worldwideweb.doi.org: 10. 1016/j .stem.2015.04.020
65. del Alamo. J. C. et al. Three-dimensional quantification of cellular traction forces and mechanosensing of thin substrata by fouri er traction force microscopy. PLoS One 8, e69850 (2013). worldwideweb.doi.org: 10. 1371/joumal.pone.0069850
66. Splinter, E., de Wit, E., van de Werken, H. J., Klous, P. & de Laat, W.
Determining long-range chromatin interactions for selected genomic sites using 4C-seq technology: from fixation to computation. Methods 58, 221-230 (2012). worldwideweb.doi.org: 10. 1016Zj.ymeth.2012.04.009
67. van de Werken, IT. J. et al. Robust 4C-seq data analysis to screen for regulator ' DNA interactions. Nat Methods 9, 969-972 (2012). worldwideweb. doi . org: 10. 1038/nmeth.2173
68. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29. 15-21 (2013). worldwideweb.doi.org: 10. 1093/bioinformatics/bts635
69. Love. M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014). worldwideweb.doi.org: 10. 1186/sl3059-014-0550-8
70. Wu, T. el al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb) 2, 100141 (2021). worldwideweb.doi.org: 10. 1016/j. xinn.2021 . 100141
71. Chen, E. Y. et al. Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics 14, 128 (2013). worldwideweb.doi.org: 10. 1186/1471-2105-14-128
72. Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357-359 (2012). worldwideweb. doi. org: 10.1038/nmeth.l923
73. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079 (2009). worldwideweb.doi.org: 10. 1093/bioinformatics/btp352
74. Zhang, Y. et al. Model-based analysis of ChlP-Seq (MACS). Genome Biol 9, R137 (2008). worldwideweb.doi.org: 10.1186/gb-2008-9-9-rl37
75. Quinlan, A. R. & Hall. I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010). worldwideweb.doi.org: 10.1093/bioinformatics/btq033
76. Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014). worldwideweb.doi.org: 10. 1093/bioinformatics/btt656
77. Gu. Z. & Hubschmann, D. rGREAT: an R/bioconductor package for functional enrichment on genomic regions. Bioinformatics 39 (2023). worldwideweb.doi.org: 10. 1093/bioinformatics/btac745
78. Tamura, K., Stecher, G. & Kumar, S. MEGA11 : Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38, 3022-3027 (2021). worldwideweb.doi.org: 10. 1093/molbev/msabl20
OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A composition comprising at least one nucleic molecule that is complementary to w MYH6 promoter region, an MYH7 promoter region, and/or a cardiomyocytespecific cis-regulatory element (CRE). wherein the at least one nucleic acid molecule comprises a nucleic acid sequence comprising any one of SEQ ID NOs: 1-392.
2. A genetically modified cell comprising at least one genetic modification within an MYH gene operably linked to a cMYH Locus Control Region (LCR). wherein the at least one genetic modification increases MYH6 expression.
3. The genetically modified cell of claim 2, wherein the at least one genetic modification reduces MYH7 expression.
4. The genetically modified cell of claims 2 or 3, wherein the at least one genetic modification comprises one or more nucleic acid molecules that bind to an MYH6 promoter region. anMYH7 promoter region, and/or a CRE.
5. The genetically modified cell of any one of claims 2 to 4, wherein the one or more nucleic acid molecules comprise a nucleic acid sequence of any one of SEQ ID NOs: 1 -392.
6. The genetically modified cell of claims 2-5, wherein the genetically modified cell is derived from a human pluripotent stem cell (hPSCs).
7. The genetically modified cell of claims 2-5, wherein the at least one genetic modification comprises insertion, deletion, or mutation.
8. The genetically modified cell of claims 2-7, wherein the at least one or more genetic modification is introduced using a genetic modulation system selected from the group consisting of a CRISPR activating system, a CRISPR inactivating system, a CRISPR/Cas gene KO system, a CRISPR gene KI system, a Zinc Finger Protein (ZNF) system, a Transcription Activator-like Effector Nuclease (TALEN) system, RNA interference (RNAi). guide RNA (gRNA). antisense
oligonucleotides (ASOs), micro RNA (miRNA). RNA Aptamer, short hairpin RNA (shRNA), and small interfering RNA (siRNA).
9. The genetically modified cell of claim 8, wherein the CRISPR activating system is a synergistic activation mediator (SAM) system.
10. A vector comprising the composition of claim 1.
11. The vector of claim 10, wherein the vector is a viral vector or a non-viral vector.
12. The vector of claim 11, wherein the viral vector comprises a lentiviral vector, an adenoviral vector, an adeno-associated viral vector (AAV), a retroviral vector, or a herpes viral vector.
13. The vector of claim 11, wherein the non-viral vector comprises a nanoparticle, a liposome, a polymer, an exosome, a peptide, an extracellular vesicle, a lipid nanoparticle (LNP), or a dendrimer.
14. The vector of claim 10, wherein the vector comprises a constitutive promoter, an inducible promoter, or a tissue-specific promoter.
15. A pharmaceutical composition comprising the composition of claim 1 and pharmaceutically acceptable carrier.
16. A pharmaceutical composition comprising the genetically modified cell of claims 2-8 and pharmaceutically acceptable carrier.
17. A pharmaceutical composition comprising the vector of claim 10 and pharmaceutically acceptable carrier.
18. A method of gene editing, the method comprising introducing the composition of claim 1 and the genetic modulation system of claim 8 into a cell.
19. A method for increasing MYH6 expression in a subject, the method comprising administering to the subject a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator.
20. A method for treating a cardiac condition in a subject, the method comprising administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby treating the cardiac condition in the subject.
21. A method for improving cardiac contractility in a subject, the method comprising administering to the subject a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator, thereby improving cardiac contractility in the subject.
22. A method for modulating a ratio of cardiac MYH6 and MYH7 in a subj ect, the method comprising administering to the subject a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator, thereby modulating the ratio of cardiac MYH6 and MYH7 in the subject.
23. A method of ameliorating at least one symptom of heart failure in a subject, the method comprising administering to the subj ect a therapeutically effective amount of an MYH7 inhibitor and/or an MYH6 activator, thereby ameliorating at least one symptom of heart failure in the subject.
24. A method of reducing the risk of developing a cardiac condition in a subject, the method comprising administering to the subject a therapeutically effective amount of anMYH7 inhibitor and/or an MYH6 activator, thereby reducing the risk of developing a cardiac condition in the subject.
25. The method of any one of the above claims, wherein the MYH7 inhibitor comprises an inhibitory nucleic acid molecule, a CRISPR-based system, a Zinc Finger protein (ZNF), a Transcription Activator-like Effector Nuclease (TALEN), or a small molecule inhibitor.
26. The method of claim 25, wherein the inhibitory nucleic acid molecule comprises at least one antisense nucleic acid molecule that targets the region of positions 23904486 to 23905406 of chromosome 14 according to UCSC Genome Brower (hgl9).
27. The method of claim 25. wherein the inhibitory nucleic acid molecule is an RNA molecule or a DNA molecule.
28. The method of claim 25, wherein the inhibitory nucleic acid molecule comprises a gRNA, an siRNA, an shRNA, a miRNA, an ASO. an antagomir, a ribozyme, a long noncoding RNA (IncRNA), a locked nucleic acid (LNA), a synthetic RNA molecule, a synthetic DNA molecule, a DNAz me. or a triple-forming oligonucleotide (TFO).
29. The method of any one of claims 25 to 28, wherein the inhibitory nucleic acid molecule targets an MYH6 promoter region, anMYH7 promoter region, and/or a cardiomyocyte-specific cis-regulatory element.
30. The method of any one of claims 25 to 29. wherein the inhibitory nucleic acid molecule comprises about 5 nucleotides to about 50 nucleotides.
31. The method of any one of claims 25 to 29. wherein the inhibitory nucleic acid molecule comprises about 20 nucleotides.
32. The method of any one of claims 25 to 31, wherein the inhibitory nucleic acid molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1- 392.
33. The method of any one of the above claims, wherein the inhibitor of MYH7 expression comprises the pharmaceutical composition of any one of claims 15-17.
34. A pharmaceutical composition comprising the inhibitor oiMYH7 expression of any one of claims 19-32 and a pharmaceutically acceptable carrier.
35. The method of any one of the above claims, wherein MYH6 activator comprises a small molecule agent, a CRISPR-based system, a transcriptional activator, an mRNA-based therapeutic, or a therapeutic polypeptide.
36. The method of any one of the above claims, wherein the cardiac condition is cardiomyopathy, cardiac hypertrophy, cardiac stress, or heart failure.
37. The method of any one of the above claims, wherein the cis-regulatory element is CRE1, CRE2, and/or CRE3.
38. The method of any one of the above claims, further comprising administering to the subject one or more additional therapeutic agents for treating the cardiac condition.
39. The method of claim 38, wherein the one or more additional therapeutic agents comprise an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin-2 receptor blocker (ARB), an ARB and neprilysin inhibitor, a beta blocker, a digoxin, a diuretic, a hydralazine and isosorbide dinitrate, an 1(f) channel inhibitor, a mineralocorticoid receptor antagonist (MRA), and/or a sodium-glucose cotransporter 2 (SGLT 2) inhibitor.
40. The method of claim 39, wherein the ACE inhibitor comprises captopril, enalapril, fosinopril, lisinopril, perindopril, quinapril, ramipril, or trandolapril.
41. The method of claim 39, wherein the ARB comprises candesartan, losartan, telmisartan, or valsartan.
42. The method of claim 39, wherein the ARB and neprilysin inhibitor comprises sacubitril-valsartan.
43. The method of claim 39, wherein the beta blocker comprises bisoprolol, carvedilol, metoprolol succinate, or nebivolol.
44. The method of claim 39, wherein the diuretic comprises bumetanide, chlorothiazide, hydrochlorothiazide, indapamide, furosemide, metolazone, or torsemide.
45. The method of claim 39, wherein the 1(f) channel inhibitor comprises ivabradine.
46. The method of claim 39, wherein the MRA comprises eplerenone or spironolactone.
47. The method of claim 39, wherein the SGLT 2 inhibitor comprises dapagliflozin or empagliflozin.
48. The method of any of the above claims, wherein the administering comprises oral administration, intravenous administration, intradermal administration, subcutaneous administration, intramuscular administration, or transdermal administration.
49. The method of any one of the above claims, wherein the subject is a mammal.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202463651905P | 2024-05-24 | 2024-05-24 | |
| US63/651,905 | 2024-05-24 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2025245481A1 true WO2025245481A1 (en) | 2025-11-27 |
| WO2025245481A9 WO2025245481A9 (en) | 2026-01-29 |
Family
ID=97796207
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2025/030830 Pending WO2025245481A1 (en) | 2024-05-24 | 2025-05-23 | Methods and materials for treating cardiac conditions |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2025245481A1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1865440A (en) * | 2004-12-31 | 2006-11-22 | 中国医学科学院阜外心血管病医院 | Novel pathogenetic gene mutation of hypertrophic cardiomyopathy and use thereof |
| WO2008104294A1 (en) * | 2007-02-27 | 2008-09-04 | Bayer Schering Pharma Aktiengesellschaft | Myh7 as a biomarker for ppara modulators |
| US20210380977A1 (en) * | 2018-10-19 | 2021-12-09 | The Trustees Of Indiana University | Myocardial enhancer rna and methods of use |
| US20220168449A1 (en) * | 2019-04-12 | 2022-06-02 | Encoded Therapeutics, Inc. | Compositions and methods for administration of therapeutics |
-
2025
- 2025-05-23 WO PCT/US2025/030830 patent/WO2025245481A1/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1865440A (en) * | 2004-12-31 | 2006-11-22 | 中国医学科学院阜外心血管病医院 | Novel pathogenetic gene mutation of hypertrophic cardiomyopathy and use thereof |
| WO2008104294A1 (en) * | 2007-02-27 | 2008-09-04 | Bayer Schering Pharma Aktiengesellschaft | Myh7 as a biomarker for ppara modulators |
| US20210380977A1 (en) * | 2018-10-19 | 2021-12-09 | The Trustees Of Indiana University | Myocardial enhancer rna and methods of use |
| US20220168449A1 (en) * | 2019-04-12 | 2022-06-02 | Encoded Therapeutics, Inc. | Compositions and methods for administration of therapeutics |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2025245481A9 (en) | 2026-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | The complex genetics of hypoplastic left heart syndrome | |
| Parimon et al. | Syndecan-1 promotes lung fibrosis by regulating epithelial reprogramming through extracellular vesicles | |
| de Boer et al. | Targeted therapies in genetic dilated and hypertrophic cardiomyopathies: from molecular mechanisms to therapeutic targets. A position paper from the Heart Failure Association (HFA) and the Working Group on Myocardial Function of the European Society of Cardiology (ESC) | |
| Hojo et al. | Runx2 regulates chromatin accessibility to direct the osteoblast program at neonatal stages | |
| Zheng et al. | Massively parallel in vivo Perturb-seq reveals cell-type-specific transcriptional networks in cortical development | |
| Lv et al. | lncMGPF is a novel positive regulator of muscle growth and regeneration | |
| Wallace et al. | DUX4, a candidate gene for facioscapulohumeral muscular dystrophy, causes p53‐dependent myopathy in vivo | |
| Matsa et al. | Human induced pluripotent stem cells as a platform for personalized and precision cardiovascular medicine | |
| Stojic et al. | A high-content RNAi screen reveals multiple roles for long noncoding RNAs in cell division | |
| Ho et al. | Translational remodeling by RNA‐binding proteins and noncoding RNAs | |
| Cao et al. | DACH1 protects podocytes from experimental diabetic injury and modulates PTIP-H3K4Me3 activity | |
| Chan et al. | Cell type-and stage-specific expression of Otx2 is regulated by multiple transcription factors and cis-regulatory modules in the retina | |
| Zhang et al. | ATF3 induction prevents precocious activation of skeletal muscle stem cell by regulating H2B expression | |
| Li et al. | G-quadruplexes sense natural porphyrin metabolites for regulation of gene transcription and chromatin landscapes | |
| JP2022550130A (en) | Minimal arrestin domain-containing protein 1 (ARRDC1) construct | |
| Hasenson et al. | Speculating on the roles of nuclear speckles: how RNA‐protein nuclear assemblies affect gene expression | |
| Ladam et al. | TALE factors use two distinct functional modes to control an essential zebrafish gene expression program | |
| Fan et al. | CircUBE3A promotes myoblasts proliferation and differentiation by sponging miR-28-5p to enhance expression | |
| Shi et al. | Myogenic regulatory factors transactivate the Tceal7 gene and modulate muscle differentiation | |
| Fleming et al. | Alternative splicing of the neurofibromatosis type 1 pre-mRNA is regulated by the muscleblind-like proteins and the CUG-BP and ELAV-like factors | |
| Rink et al. | Concatemeric Broccoli reduces mRNA stability and induces aggregates | |
| WO2025245481A9 (en) | Methods and materials for treating cardiac conditions | |
| Guan et al. | CBX7C⋅ PHC2 interaction facilitates PRC1 assembly and modulates its phase separation properties | |
| Shi et al. | CircEPDR1 regulates proliferation and differentiation of goat skeletal muscle satellite cells through miR-345-3p/Akirin1 axis | |
| Dupas et al. | Splice isoform-perturbation coupled to single cell transcriptome profiling reveals functions of microexons in neurogenesis and autism-linked pathways |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 25808104 Country of ref document: EP Kind code of ref document: A1 |