WO2025235643A1 - Profiling of gene therapy agents - Google Patents

Profiling of gene therapy agents

Info

Publication number
WO2025235643A1
WO2025235643A1 PCT/US2025/028187 US2025028187W WO2025235643A1 WO 2025235643 A1 WO2025235643 A1 WO 2025235643A1 US 2025028187 W US2025028187 W US 2025028187W WO 2025235643 A1 WO2025235643 A1 WO 2025235643A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene therapy
cells
capsid
aav
immediately preceding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/US2025/028187
Other languages
French (fr)
Inventor
Sourav Roy CHOUDHURY
Margaret HENNESSY
Eugenia LYASHENKO
Rachna MANEK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genzyme Corp
Original Assignee
Genzyme Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genzyme Corp filed Critical Genzyme Corp
Publication of WO2025235643A1 publication Critical patent/WO2025235643A1/en
Pending legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • C12N2750/14152Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • This disclosure provides a method of profiling gene therapy agents, comprising administering one or more gene therapy agents (e.g., a library) to a non-human subject or an ex vivo or in vitro cell population, wherein the one or more gene therapy agents comprise an identifying sequence operably linked to an RNA polymerase III promoter and/or a capture sequence.
  • one or more gene therapy agents e.g., a library
  • the one or more gene therapy agents comprise an identifying sequence operably linked to an RNA polymerase III promoter and/or a capture sequence.
  • ocular gene therapy can also target specific cell types in complex tissues, such as those in the eye and nervous system.
  • the eye is easily accessible via local administration which reduces potential complications associated with gene therapies and requires only small quantities of the drug.
  • ocular gene therapy also presents some challenges. While subretinal injection of most AAVs results in efficient transduction of retinal pigment epithelial cells (RPEs) there is considerable variation in their ability to transduce photoreceptors.
  • RPEs retinal pigment epithelial cells
  • subretinal administration while efficient, involves a transient local macular detachment and its associated risks. Intravitreal delivery is less invasive and more widely performed, but the presence of the inner limiting membrane can limit transduction of cells in the outer retina.
  • Ocular diseases are heterogeneous and affect specific cell types, as are diseases affecting other organs. Therefore, understanding the cell type specificity of AAV transduction is of great interest. As such, a method to effectively profile gene therapy agents at single nuclei or single cell resolution is needed.
  • Embodiment 1 A method of profiling gene therapy agents, comprising: administering one or more gene therapy agents to a non-human subject, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the subject are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify
  • Embodiment 2 The method of the immediately preceding embodiment, wherein the subject is a non-human mammal.
  • Embodiment 3 The method of the immediately preceding embodiment, wherein the subject is a non-human primate.
  • Embodiment 4 The method of the immediately preceding embodiment, wherein the subject is a monkey.
  • Embodiment 5 The method of any one of the preceding embodiments, wherein the subject is treated with an anti-inflammatory agent and/or an immunosuppressive agent before administration of the one or more gene therapy agents.
  • Embodiment 6 The method of the immediately preceding embodiment, wherein the anti-inflammatory agent and/or immunosuppressive agent comprises an immunosuppressive steroid and/or an IgG-degrading enzyme.
  • Embodiment 7 The method of the immediately preceding embodiment, wherein the immunosuppressive steroid comprises prednisolone and/or the IgG-degrading enzyme comprises IdeS, optionally wherein the IdeS is Streptococcus IdeS.
  • Embodiment 8 The method of any one of the preceding embodiments, further comprising isolating a sample from the subject comprising a plurality of transduced nuclei or transduced cells.
  • Embodiment 9 A method of profiling gene therapy agents, comprising: contacting an ex vivo or in vitro cell population with one or more gene therapy agents, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the cell population are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single
  • Embodiment 10 The method of the immediately preceding embodiment, wherein the cell population comprises mammalian cells.
  • Embodiment 11 The method of the immediately preceding embodiment, wherein the cell population comprises primate cells.
  • Embodiment 12 The method of the immediately preceding embodiment, wherein the cell population comprises non-human primate cells.
  • Embodiment 13 The method of the immediately preceding embodiment, wherein the cell population comprises monkey cells.
  • Embodiment 14 The method of embodiment 10 or 11, wherein the cell population comprises human cells.
  • Embodiment 15 The method of any one of the preceding embodiments, further comprising isolating a sample from cell population comprising a plurality of transduced nuclei or transduced cells.
  • Embodiment 16 The method of any one of the preceding embodiments, wherein the one or more gene therapy agents comprise a library comprising at least two distinct subpopulations of gene therapy agents.
  • Embodiment 17 The method of the immediately preceding embodiment, wherein each agent in the library comprises a distinct identifying sequence.
  • Embodiment 18 The method of the immediately preceding embodiment, wherein each distinct identifying sequence is a barcode.
  • Embodiment 19 The method of any one of embodiments 16-18, wherein the library comprises at least three distinct subpopulations of gene therapy agents.
  • Embodiment 20 The method of the immediately preceding embodiment, wherein the library comprises at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 30 distinct subpopulations of gene therapy agents.
  • Embodiment 21 The method of any one of the preceding embodiments, wherein the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced nuclei; performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei.
  • Embodiment 22 The method of any one of the preceding embodiments, wherein the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced cells; performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells.
  • Embodiment 23 The method of any one of the preceding embodiments, wherein the capture sequence is operably linked to the identifying sequence.
  • Embodiment 24 The method of any one of the preceding embodiments, wherein the identifying sequence comprises a barcode.
  • Embodiment 25 The method of any one of the preceding embodiments, wherein both mRNA and RNA comprising the capture sequence are captured.
  • Embodiment 26 The method of any one of the preceding embodiments, wherein the capture sequence comprises a unique sequence that is not present in endogenous RNA of the cell population or subject.
  • Embodiment 27 The method of any one of the preceding embodiments, wherein the capture sequence comprises SEQ ID NO: 1 (gctttaaggccggtcctagcaa).
  • Embodiment 28 The method of any one of embodiments 1-26, wherein the capture sequence comprises an aptamer sequence.
  • Embodiment 29 The method of the immediately preceding embodiment, wherein RNA comprising the capture sequence is captured using a bead coated with a target specifically bound by the aptamer sequence.
  • Embodiment 30 The method of any one of embodiments 1-26, wherein the capture sequence comprises a recognition sequence.
  • Embodiment 31 The method of the immediately preceding embodiment, wherein RNA comprising the capture sequence is captured using a sequence-specific binding protein that specifically binds the recognition sequence.
  • Embodiment 32 The method of any one of the preceding embodiments, wherein the identifying sequences are operably linked to a promoter.
  • Embodiment 33 The method of any one of the preceding embodiments, wherein the capture sequence is operably linked to a promoter.
  • Embodiment 34 The method of any one of the two immediately preceding embodiments, wherein the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
  • Embodiment 35 The method of the immediately preceding embodiment, wherein the promoter comprises a RNAP I promoter, RNAP II promoter, or RNAP III promoter.
  • Embodiment 36 The method of the immediately preceding embodiment, wherein the promoter comprises a RNAP III promoter.
  • Embodiment 37 The method of the immediately preceding embodiment, wherein the RNAP III promoter comprises a U6, 7SK, Hl, or small tRNA promoter.
  • Embodiment 38 The method of any one of the preceding embodiments, wherein the transduced cells are identified based on expression of a plurality of markers.
  • Embodiment 39 The method of the immediately preceding embodiment, wherein the plurality of markers comprise one or more of: AGLN3, ALBI, APOE, ARR3, ATP1B1, B2M, BCC3, BRN3A, CABP5, CALB1, CD14, CD164, CD37, CD44, CD74, CHAT, CHX10, CLDN5, CLU, CNGA1, CNGB1, COL4A1, CRABP1, CRYM, CTSB, CTSS, DKK3, DST, EPHB6, FCER1G, FXYD5, GABRD, GAD1, GAD2, GAP43, GFAP, GLUL, GNAT1, GNAT2, GNB1, GNGT1, GNGT2, GPR37, GRIK1, GRIN2A, GRM6, GUCA1A, GUCA1C, GYPC, HES1, HEXB, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRA, HLA- DRA, I
  • Embodiment 40 The method of any one of the preceding embodiments, wherein the single nuclei sequencing comprises isolating RNA from the transduced cells or nuclei.
  • Embodiment 41 The method of the immediately preceding embodiment, wherein the single nuclei sequencing further comprises subjecting the RNA to reverse transcription to obtain cDNA.
  • Embodiment 42 The method of the immediately preceding embodiment, wherein about 1 attogram of RNA is subjected to reverse transcription.
  • Embodiment 43 The method of any one of embodiments 40-42, further comprising tagging the RNA.
  • Embodiment 44 The method of the immediately preceding embodiment, wherein the RNA is tagged.
  • Embodiment 45 The method of the immediately preceding embodiment, wherein the RNA is tagged with a plurality of barcodes or UMIs.
  • Embodiment 46 The method of the immediately preceding embodiment, wherein the plurality of barcodes or UMIs corresponds to individual cells or nucleic.
  • Embodiment 47 The method of any one of embodiments 41-46, further comprising pooling cDNA from different cells or nuclei prior to sequencing.
  • Embodiment 48 The method of any one of the preceding embodiments, wherein the transduced cells comprise eye cells, kidney cells, brain cells, or muscle cells.
  • Embodiment 49 The method of the immediately preceding embodiment, wherein the transduced cells comprise eye cells.
  • Embodiment 50 The method of the immediately preceding embodiment, wherein the eye cells comprise retinal cells.
  • Embodiment 51 The method of the immediately preceding embodiment, wherein the retinal cells comprise amacrine cells, astrocytes, bipolar cells, cone cells, endothelial cells, horizontal cells, microglia, Muller cells, pericytes, Retinal ganglion cells (RGCs), and/or rod cells.
  • the retinal cells comprise amacrine cells, astrocytes, bipolar cells, cone cells, endothelial cells, horizontal cells, microglia, Muller cells, pericytes, Retinal ganglion cells (RGCs), and/or rod cells.
  • Embodiment 52 The method of any one of the preceding embodiments, wherein the one or more gene therapy agents comprises a viral vector.
  • Embodiment 53 The method of the immediately preceding embodiment, wherein the viral vector is an adeno-associated viral (AAV) particle.
  • AAV adeno-associated viral
  • Embodiment 54 The method of the immediately preceding embodiment, wherein the AAV particle comprises an AAV1 capsid, an AAV2 capsid, an AAV3 capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid, an AAV7 capsid, an AAV8 capsid, an AAVrh8 capsid, an AAV9 capsid, an AAV 10 capsid, an AAVrhlO capsid, an AAV11 capsid, an AAV12 capsid, an AAVrh32.33 capsid, an AAV-XL32 capsid, an AAV-XL32.1 capsid, an AAV LK03 capsid, an AAV2R471 A capsid, an AAV2/2-7m8 capsid, an AAV DJ capsid, an AAV DJ8 capsid, an AAV2 N587A capsid, an AAV2 E548A capsid, an AAV1 capsi
  • Embodiment 55 The method of the immediately preceding embodiment, wherein the AAV capsid comprises a tyrosine mutation, a heparin binding mutation, or an HBKO mutation.
  • Embodiment 56 The method of any one of embodiments 53-55, wherein the AAV viral particle comprises an AAV genome comprising one or more inverted terminal repeats (ITRs), wherein the one or more ITRs is an AAV1 ITR, an AAV2 ITR, an AAV3 ITR, an AAV4 ITR, an AAV5 ITR, an AAV6 ITR, an AAV7 ITR, an AAV8 ITR, an AAVrh8 ITR, an AAV9 ITR, an AAV10 ITR, an AAVrhlO ITR, an AAV11 ITR, or an AAV12 ITR.
  • ITRs inverted terminal repeats
  • Embodiment 57 The method of the immediately preceding embodiment, wherein the one or more ITRs and the capsid of the AAV particle are derived from the same AAV serotype.
  • Embodiment 58 The method of the immediately preceding embodiment, wherein the one or more ITRs and the capsid of the AAV particles are derived from different AAV serotypes.
  • Embodiment 59 The method of embodiment 52, wherein the viral vector is an adenoviral particle.
  • Embodiment 60 The method of the immediately preceding embodiment, wherein the adenoviral particle comprises a capsid from Adenovirus serotype 2, 1, 5, 6, 19, 3, 11, 7, 14, 16, 21, 12, 18, 31, 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24-30, 37, 40, 41, AdHu2, AdHu 3, AdHu4, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6, AdC7, AdC69, bovine Ad type 3, canine Ad type 2, ovine Ad, or porcine Ad type 3, or a functional variant thereof.
  • AdHu2, AdHu 3, AdHu4, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6, AdC7, AdC69, bovine Ad type 3, canine Ad type 2, ovine Ad, or porcine Ad type 3, or a functional variant thereof.
  • Embodiment 61 The method of embodiment 52, wherein the viral vector is a lentiviral particle.
  • Embodiment 62 The method of the immediately preceding embodiment, wherein the lentiviral particle is pseudotyped with vesicular stomatitis virus (VSV), lymphocytic choriomeningitis virus (LCMV), Ross river virus (RRV), Ebola virus, Marburg virus, Mokala virus, Rabies virus, RD114, or a functional variant thereof.
  • VSV vesicular stomatitis virus
  • LCMV lymphocytic choriomeningitis virus
  • RRV Ross river virus
  • Ebola virus Marburg virus
  • Mokala virus Rabies virus
  • RD114 a functional variant thereof.
  • Embodiment 63 The method of embodiment 52, wherein the viral vector is a Herpes simplex virus (HSV) particle.
  • HSV Herpes simplex virus
  • Embodiment 64 The method of the immediately preceding embodiment, wherein the HSV particle is an HSV-1 particle or an HSV-2 particle, or a functional variant thereof.
  • Embodiment 65 The method of any one of embodiments 1-51, wherein at least one of the one or more gene therapy agents comprises a lipid nanoparticle.
  • Embodiment 66 The method of the immediately preceding embodiment, wherein the lipid nanoparticle comprises an expression cassette encoding an RNA comprising a capture sequence and an identifying sequence.
  • Embodiment 67 The method of the immediately preceding embodiment, wherein the expression cassette encoding an RNA comprising a capture sequence and an identifying sequence is operably linked to an RNAP III promoter.
  • Embodiment 68 The method of any one of the two immediately preceding embodiments, wherein the lipid nanoparticles comprises multiple expression cassettes.
  • Embodiment 69 The method of any one of the preceding embodiments, wherein the one or more gene therapy agents each comprise a nucleic acid encoding a heterologous transgene.
  • Embodiment 70 The method of the immediately preceding embodiment, wherein the heterologous transgene is operably linked to a promoter.
  • Embodiment 71 The method of the immediately preceding embodiment, wherein the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
  • Embodiment 72 The method of any one of embodiments 69-71, wherein the heterologous transgene encodes a marker protein.
  • Embodiment 73 The method of the immediately preceding embodiment, wherein the marker protein is a fluorescent protein, optionally wherein the fluorescent protein is a GFP, YFP, RFP, BFP, CFP, or VFP.
  • Embodiment 74 The method of any one of embodiments 79-71, wherein the heterologous transgene encodes a gene therapy product, vaccine antigen, or microRNA.
  • Embodiment 75 The method of any one of embodiments 79-74, wherein the nucleic acid comprises closed-end DNA (ceDNA).
  • Embodiment 76 The method of any one of embodiments 79 or 72-74, wherein the nucleic acid comprises mRNA.
  • Embodiment 77 The method of any one of the preceding embodiments, wherein the one or more gene therapy agents is administered locally.
  • Embodiment 78 The method of the immediately preceding embodiment, wherein the one or more gene therapy agent are administered intravitreally, intracamerally, retinally, intrathecally, intramuscularly, intrarenally, intramuscularly, intracranially, intra-CSF, intra- DRG, intracerebroventricularly, intraocularly, intracisterna magna, intrahepatically, intravitreally, or intracamerally.
  • Embodiment 79 The method of the immediately preceding embodiment, wherein the one or more gene therapy agents are administered bilaterally or unilaterally.
  • Embodiment 80 The method of any one of the preceding embodiments, wherein the one or more gene therapy agents are administered systemically.
  • Embodiment 81 The method of the immediately preceding embodiment, wherein the one or more gene therapy agent are administered intravenously, intraperitoneally, intraarterially, or subcutaneously.
  • FIG. 1A provides schematics of exemplary custom plasmids for both AAV packaging and transgene expression.
  • Figure IB provides an exemplary workflow for SNAC (Single Nuclei Atlas of Capsid Distribution) methodology, to screen and select AAV capsids, e.g., targeting specific cell type populations in NHP retinas.
  • SNAC Single Nuclei Atlas of Capsid Distribution
  • FIG. 2A provides a schematic illustration of an exemplary transgene plasmid with the comprising a U6 promoter (“U6”) expressing a unique barcode (“BC2”) and a 10X genomics platform based capture sequence (“10X capture seq”).
  • FIG. 2B illustrates barcode detection, with each dot representing a detected nucleus. Each dot is shaded according to the abundance of the read counts of an AAV capsid (AAV1, AAV2, or AAV6 as indicated) detected in that nuclei’s transcriptome either by single nuclei sequencing (FIG. 2B, bottom row) or by polyA 3’ barcode sequencing (FIG. 2B, top row).
  • AAV capsid AAV1, AAV2, or AAV6 as indicated
  • FIG. 3 shows results from a library of AAV Natural Isolates. 24 AAV natural isolates were individually prepared. The bar graph on the right represents total vector genomes (vg)/prep.
  • FIG. 4 provides a plot of t-distributed stochastic neighbor embedding parameters (tSNE l and tSNE_2) for the major cell types in NHP retina (macula and periphery) identified with 10X chromium single nuclei sequencing. Data are from 55,974 nuclei sequenced from 7 NHP samples (4 central/macula, 3 peripheral).
  • FIG. 5 provides a bar graph showing that the relative abundance per sample of the cells identified in FIG. 4 is concordant with sample anatomy (peripheral vs central/macula).
  • FIG. 6 provides a plot showing the proportions per sample of the cells identified in FIG. 4 via SNAC sample annotation/processing generally agree with previously reported studies of NHP retina (Pearson: 0.7).
  • FIG. 7 provides quantification of expression of the top three capsids of an AAV natural isolate library in individual cell types in NHP retina using the SNAC workflow. Expression is quantified as % of cell type with at least 1 read count of a SN capsid barcode detected.
  • FIG. 8A and 8B provide pie graphs quantifying the ranked capsids abundance in indicated ocular tissues (Ciliary Body OS, Ciliary Body OD and Iris (FIG. 8A) and Ciliary Body and Iris (FIG. 8B)) analyzed by sequencing barcodes at bulk tissue resolution.
  • FIG. 9 provides bar graphs showing percentages of cells with detected BC1 (polymRNA fraction) or BC2 (U6 RNA fraction) barcodes across three treatments: negative control, lower dose (le3), higher dose of the AAV1, AAV2, AAV6 viral pool 354 (le4).
  • FIG. 10 provides a graph showing cell type proportions in the macula and peripheral retina. Relative abundance by sample is shown.
  • profiling refers to obtaining information about one or more properties of the gene therapy agent, such its tropism in one or more cell or tissue types or its biodistribution.
  • An “expression profile” comprises a set of values representing the expression levels for a plurality of gene products, e.g., from one or more gene therapy agents and/or cells or nuclei.
  • isolated refers to a biological component (such as a nucleic acid molecule, protein, or cell) that has been substantially separated, produced apart from, or purified away from other components (for example, other components in a sample, cell, or organism in which the component naturally occurs).
  • Nucleic acid molecules, proteins, or cells that have been “isolated” include those purified using standard purification methods.
  • the term “isolated” or “purified” does not require absolute purity; rather, it is intended as a relative term.
  • an isolated biological component is one in which the biological component is more enriched in a preparation than the biological component is in its natural environment within a cell, organism, sample, or production vessel (for example, a cell culture system).
  • an isolated biological component can represent at least 50%, such as at least 70%, at least 80%, at least 90%, at least 95%, or greater, of the total biological component content of the preparation.
  • subject refers to an animal, such as a member of a mammalian species (e.g., human) or avian (e.g., bird) species, or other organism, such as a plant. More specifically, a subject can be a vertebrate, e.g., a mammal such as a mouse, a primate, a simian or a human. Animals include farm animals (e.g., production cattle, dairy cattle, poultry, horses, pigs, and the like), sport animals, and companion animals (e.g., pets or support animals).
  • farm animals e.g., production cattle, dairy cattle, poultry, horses, pigs, and the like
  • companion animals e.g., pets or support animals.
  • a subject can be a healthy individual, an individual that has or is suspected of having a disease or a predisposition to the disease, or an individual in need of therapy or suspected of needing therapy.
  • the terms “individual” or “patient” are intended to be interchangeable with “subject”.
  • the subject can be an individual who is in need of gene therapy, e.g., due to having a disease such as an autoimmune disease or a developmental, neurological, or other genetic disorder.
  • the subject can be a female individual who is pregnant or who is planning on becoming pregnant, who may have been diagnosed of or suspected of having a disease, e.g., a cancer, an auto-immune disease.
  • operably linked and “in functional connection with” with respect to a regulatory sequence (e.g., a promoter, enhancer or other transcriptional regulatory sequence) and another sequence element, means that expression of the sequence element is regulated, or controlled by, the promoter, enhancer or other transcriptional regulatory sequence.
  • the terms “operably linked” and “in functional connection with” with respect to sequence elements that are not promoters, enhancers or other transcriptional regulatory sequences means that expression of the sequence elements are linked such that they are included in the same transcript upon transcription. Examples of sequence elements that are not promoters, enhancers or other transcriptional regulatory sequences include ORFs, identifying sequences such as barcodes, and capture sequences.
  • operably linked and “in functional connection with” are utilized interchangeably herein with respect to promoters and other sequence elements.
  • the term “gene therapy agent” refers to a nucleic acid (e.g., expression construct, miRNA, antisense, shRNA, siRNA, mRNA) or a nucleic acid in combination with an agent used to deliver the nucleic acid to an individual or a cell to modify or manipulate the expression of one or more nucleic acids (e.g., gene, mRNA) in an individual or a cell to alter the biological propertied of living cells.
  • a nucleic acid e.g., expression construct, miRNA, antisense, shRNA, siRNA, mRNA
  • an agent used to deliver the nucleic acid to an individual or a cell to modify or manipulate the expression of one or more nucleic acids (e.g., gene, mRNA) in an individual or a cell to alter the biological propertied of living cells.
  • gene therapy agents include, but are not limited to, viral vectors (e.g., adeno-associated virus, adenovirus, lentivirus, Herpes simples virus, baculovirus), bacterial vectors, and non-viral vectors (e.g., lipid nanoparticles encapsulating a therapeutic nucleic acid or plasmid DNAs (e.g., close ended DNA) comprising a therapeutic nucleic acid and/or encoding a therapeutic polypeptide).
  • viral vectors e.g., adeno-associated virus, adenovirus, lentivirus, Herpes simples virus, baculovirus
  • non-viral vectors e.g., lipid nanoparticles encapsulating a therapeutic nucleic acid or plasmid DNAs (e.g., close ended DNA) comprising a therapeutic nucleic acid and/or encoding a therapeutic polypeptide.
  • a “vector” refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo.
  • polynucleotide or “nucleic acid” as used herein refers to a polymeric form of nucleotides of any length, comprising ribonucleotides or deoxyribonucleotides.
  • this term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
  • the backbone of the nucleic acid can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
  • the backbone of the nucleic acid can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P- NH2) or a mixed phosphoramidate- phosphodiester oligomer.
  • a double-stranded nucleic acid can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
  • polypeptide and protein are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by the definition.
  • the terms also include post-translational modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like.
  • a “polypeptide” refers to a protein which includes modifications, such as deletions, additions, and substitutions (which may be conservative in nature), to the native sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
  • the term “capture sequence” refers to a sequence configured to hybridize to, bind to, couple to, or otherwise interact with a capture agent, such as a capture probe, aptamer, resin, sequence-specific binding protein, or any other agent capable of specifically recognizing a particular sequence.
  • identifying sequence refers to a sequence in a gene therapy agent that is heterologous as to the subject or cell population to which the gene therapy agent is administered or is intended to be administered. Identifying sequences include, but are not limited to, barcodes.
  • barcode generally refers to an identifying sequence that can convey information about the analyte (e.g., nucleic acid molecule).
  • a barcode can be a tag attached to a nucleic acid molecule or a combination of the tag in addition to an endogenous characteristic of the analyte (e.g., size of the analyte or end sequence(s)).
  • the barcode may be unique. Barcodes can have a variety of different formats, for example, barcodes can include random and/or synthetic nucleic acid sequences.
  • a barcode can be attached to an analyte in a reversible or irreversible manner.
  • a barcode can be added to, for example, a fragment of a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sample before, during, and/or after sequencing of the sample. Barcodes can allow for identification and/or quantification of individual sequencing-reads in real time.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • a “promoter” refers to a nucleic acid sequence sufficient to direct transcription of an operably linked nucleic acid molecule. Promoters may include or be accompanied by transcription control elements (e.g., enhancers) that can render promoterdependent gene expression controllable in a cell type-specific, tissue-specific, or temporalspecific manner, or that are inducible by external signals or agents; such elements, which are well-known to skilled artisans, may be found in a 5' or 3' region of a gene or within an intron.
  • transcription control elements e.g., enhancers
  • a promoter can be operably linked to a nucleic acid sequence, for example, comprising one or more of an identifying sequence such as a barcode, a capture sequence, an ORF or a gene sequence, and/or an effector RNA coding sequence, in such a way as to enable expression of the nucleic acid sequence.
  • a promoter can also be provided in an expression cassette into which a selected nucleic acid sequence to be transcribed can be conveniently inserted.
  • a “viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (a nucleic acid sequence that does not naturally occur in the virus from which the vector is derived, e.g., a sequence that is not of viral origin or from a different virus).
  • the recombinant nucleic acid is flanked by at least one, e.g., two, inverted terminal repeat sequences (ITRs).
  • ITRs inverted terminal repeat sequences
  • An “AAV vector”, (also referred to as an rAAV vector)” refers to an adeno-associated viral vector.
  • the AAV vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin, also referred to as recombinant AAVs (rAAVs)).
  • the AAV vector is replication defective.
  • the heterologous sequence replace or render ineffective AAV infectious sequences thereby rendering the rAAV replication defective.
  • the rAAV comprises heterologous sequences that are flanked by at least one, e.g., two, AAV inverted terminal repeat sequences (ITRs).
  • Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins).
  • a rAAV vector When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions.
  • a rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and, in embodiments, encapsidated in a viral particle, particularly an AAV particle.
  • a rAAV vector can be packaged into an AAV virus capsid to generate a “adeno-associated viral particle (AAV particle)”.
  • An “AAV viral particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated AAV vector genome.
  • a “adenoviral vector” refers to a polynucleotide vector comprising one or more sequences of adenoviral origin.
  • the adenoviral vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of adenovirus origin, also referred to as recombinant adenoviral vectors).
  • the adenoviral vector is replication defective.
  • the heterologous sequence replace or render ineffective adenoviral vector infectious sequences thereby rendering the adenoviral vector replication defective.
  • the rAAV comprises heterologous sequences that are flanked by at least one adenovirus inverted terminal repeat sequence (ITR).
  • the recombinant nucleic acid is flanked by two inverted terminal repeat sequences (ITRs).
  • ITRs inverted terminal repeat sequences
  • Such recombinant viral vectors can be replicated and packaged into infectious viral particles when present in a host cell that is expressing essential adenovirus genes deleted from the recombinant viral genome (e.g., El genes, E2 genes, E4 genes, etc.).
  • a recombinant viral vector When a recombinant viral vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the recombinant viral vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of adenovirus packaging functions.
  • a recombinant viral vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, for example, an adenovirus particle.
  • a viral vector can be packaged into an adenovirus virus capsid to generate an “adenoviral particle.”
  • a “lentivirus vector” refers to a polynucleotide vector comprising one or more sequences of lentiviral origin.
  • the lentivirus vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of lentivirus origin, also referred to as recombinant lentivirus vectors).
  • the lentivirus vector is replication defective.
  • the heterologous sequence replace or render ineffective lentiviral infectious sequences thereby rendering the recombinant lentivirus vectors replication defective.
  • the recombinant lentivirus vectors comprises heterologous sequences that are flanked by at least one lentivirus terminal repeat sequences (LTRs).
  • the heterologous nucleic acid is flanked by two lentiviral terminal repeat sequences (LTRs).
  • LTRs lentiviral terminal repeat sequences
  • Such viral vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper function.
  • a lentiviral vector can be packaged into a lentivirus capsid to generate a “lentiviral particle.”
  • a “herpes simplex vector (HSV vector)” refers to a polynucleotide vector comprising one or more sequences of herpes simplex viral origin.
  • the HSV vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of HSV origin, also referred to as recombinant HSV vectors).
  • the HSV vector is replication defective.
  • the heterologous sequence replace or render ineffective HSV infectious sequences thereby rendering the recombinant HSV vectors replication defective.
  • the recombinant HSV vectors comprise heterologous sequences that are flanked by HSV terminal repeat sequences.
  • Such recombinant viral vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper functions.
  • a recombinant viral vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection)
  • the recombinant viral vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of HSV packaging functions.
  • a recombinant viral vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, for example, an HSV particle.
  • a recombinant viral vector can be packaged into an HSV capsid to generate a “herpes simplex viral particle.”
  • Solid lipid nanoparticles (SLNs, sLNPs), or “lipid nanoparticles” (LNPs) as used herein refer to nanoparticles comprising lipids that can contain a payload.
  • the lipid nanoparticle is a liposome, which comprises a lipid bilayer and may comprise a hydrophilic or aqueous interior comprising a payload.
  • the LNP is a targeted LNP which comprises a targeting moiety.
  • Heterologous means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated.
  • a nucleic acid introduced by genetic engineering techniques into a different cell type is a heterologous nucleic acid (and, when expressed, can encode a heterologous polypeptide).
  • a cellular sequence e.g., a gene or portion thereof
  • transgene refers to a nucleic acid that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and/or expressed under appropriate conditions. In some embodiments, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. In another aspect, it may be transcribed into a molecule that mediates RNA interference, such as siRNA.
  • gene particles refer to the number of virions containing the recombinant AAV DNA genome, regardless of infectivity or functionality.
  • the number of genome particles in a particular vector preparation can be measured by procedures such as described in the Examples herein, or for example, in Clark et al. (1999) Hum. Gene Then, 10: 1031- 1039; Veldwijk et al. (2002) Mol. Then, 6:272-278.
  • infection unit (iu), “infectious particle,” or “replication unit,” as used in reference to a viral titer, refer to the number of infectious and replication-competent recombinant AAV vector particles as measured by the infectious center assay, also known as replication center assay, as described, for example, in McLaughlin et al. (1988) J. Virol., 62: 1963-1973.
  • transducing unit (tu) refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product as measured in functional assays such as described in Examples herein, or for example, in Xiao et al. (1997) Exp. Neurobiol., 144:113-124; or in Fisher et al. (1996) J. Virol., 70:520-532 (LFU assay).
  • ITR inverted terminal repeat
  • An “AAV inverted terminal repeat (ITR)” sequence is an approximately 145 -nucleotide sequence that is present at both termini of the native single-stranded AAV genome.
  • the outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome.
  • the outermost 125 nucleotides also contains several shorter regions of self-complementarity (designated A, A', B, B', C, C and D regions), allowing intrastrand base-pairing to occur within this portion of the ITR.
  • a “terminal resolution sequence” or “trs” is a sequence in the D region of the AAV ITR that is cleaved by AAV rep proteins during viral DNA replication.
  • a mutant terminal resolution sequence is refractory to cleavage by AAV rep proteins.
  • AAV helper functions refer to functions that allow AAV to be replicated and packaged by a host cell.
  • AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents.
  • AAV helper functions refer to functions that allow AAV to be replicated and packaged by a host cell.
  • AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents.
  • a “helper virus” for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell.
  • helper viruses have been identified, including adenoviruses, herpesviruses, poxviruses such as vaccinia, and baculovirus.
  • the adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most commonly used.
  • Adenovirus type 5 of subgroup C Ad5
  • Numerous adenoviruses of human, non-human mammalian and avian origin are known and are available from depositories such as the ATCC.
  • Viruses of the herpes family which are also available from depositories such as ATCC, include, for example, herpes simplex viruses (HSV), Epstein- Barr viruses (EBV), cytomegaloviruses (CMV) and pseudorabies viruses (PRV).
  • HSV herpes simplex viruses
  • EBV Epstein- Barr viruses
  • CMV cytomegaloviruses
  • PRV pseudorabies viruses
  • Baculoviruses available from depositories include Autographa californica nuclear polyhedrosis virus.
  • Percent (%) sequence identity with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid or nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software programs, for example, those described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp.
  • the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows: 100 times the fraction X/Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A.
  • the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows: 100 times the fraction W/Z, where W is the number of nucleotides scored as identical matches by the sequence alignment program in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C.
  • an “effective amount” of an agent refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result.
  • an effective amount of a gene therapy agent refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired gene therapeutic result.
  • an effective amount of an IL-2 conjugate may refer to an amount effective, at dosages and for periods of time necessary, to achieve the desired result of improved gene therapy.
  • a “therapeutically effective amount” of a substance/molecule of the invention may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance/molecule, agonist or antagonist to elicit a desired response in the individual.
  • a therapeutically effective amount is also one in which any toxic or detrimental effects of the substance/molecule are outweighed by the therapeutically beneficial effects.
  • suitable control as it refers to a cytokine signature is the expression of the cytokines in the cytokine signature from adaptive immune cells that are not incubated with the gene therapy agent or the expression of the cytokines in the cytokine signature from adaptive immune cells prior to incubation with the gene therapy agent.
  • Administration “in combination with” as it related to a gene therapy agent and a modulator of an adaptive immune response includes simultaneous (concurrent), consecutive or sequential administration in any order of the gene therapy agent and the modulator of an adaptive immune response (e.g., an IL-2 conjugate).
  • concurrent administration includes a dosing regimen when the administration of a gene therapy agent or a modulator of an adaptive immune response (e.g., an IL-2 conjugate) continues after discontinuing the administration of the other agent/modulator.
  • conjunction with refers to administration of one treatment modality in addition to another treatment modality.
  • in conjunction with refers to administration of one treatment modality (a gene therapy agent or a modulator of an adaptive immune response (e.g., an IL-2 conjugate)) before, during or after administration of the other treatment modality to the individual.
  • a combination thereof and “or combinations thereof’ as used herein refers to any and all permutations and combinations of the listed terms preceding the term.
  • A, B, C, or combinations thereof is intended to include at least one of A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, ACB, CBA, BCA, BAC, or CAB.
  • expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CAB ABB, and so forth.
  • BB Biller Identifier
  • the present disclosure provides a method of profiling gene therapy agents, comprising: administering one or more gene therapy agents to a non-human subject, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the subject are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei and; performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify cell types
  • the present disclosure also provides a method of profiling gene therapy agents, comprising: contacting an ex vivo or in vitro cell population with one or more gene therapy agents, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the cell population are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the
  • the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced nuclei; performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and differential barcodes from the one or more gene therapy agents in at least a portion of the transduced nuclei.
  • the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced cells; performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and differential barcodes from the one or more gene therapy agents in at least a portion of the transduced cells.
  • the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a monkey.
  • the subject is suffering from a neurodegenerative ocular disease.
  • the cell population comprises mammalian cells. In some embodiments, the cell population comprises primate cells. In some embodiments, the cell population comprises non-human primate cells. In some embodiments, the cell population comprises monkey cells. In some embodiments, the cell population comprises human cells. [0149] In some embodiments, the transduced cells are identified based on expression of a plurality of markers. Exemplary human cortical cell type markers are disclosed in Zemke, et al (2023) Nature, 624(7991), 390-402. Exemplary human kidney cell type markers are disclosed in Muto, et al (2021) Nature Communications, 12(1), 2190. Other markers for multiple human tissues single cell/nuclei RNAseq and markers are known in the art and are, e.g., available at humancellatlas.org (last accessed April 29, 2024).
  • the plurality of markers comprise one or more of: AGLN3, ALBI, APOE, ARR3, ATP1B1, B2M, BCC3, BRN3A, CABP5, CALB1, CD14, CD164, CD37, CD44, CD74, CHAT, CHX10, CLDN5, CLU, CNGA1, CNGB1, COL4A1, CRABP1, CRYM, CTSB, CTSS, DKK3, DST, EPHB6, FCER1G, FXYD5, GABRD, GAD1, GAD2, GAP43, GFAP, GLUL, GNAT1, GNAT2, GNB1, GNGT1, GNGT2, GPR37, GRIK1, GRIN2A, GRM6, GUCA1A, GUCA1C, GYPC, HES1, HEXB, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRA, HLA-DRA, IBA1, IGFBP7, ISL1, ITR
  • the transduced cells comprise eye cells, kidney cells, brain cells, or muscle cells. In some embodiments, the transduced cells comprise eye cells. In some embodiments, the eye cells comprise retinal cells. In some embodiments, the retinal cells comprise amacrine cells, astrocytes, bipolar cells, cone cells, endothelial cells, horizontal cells, microglia, Muller cells, pericytes, Retinal ganglion cells (RGCs), and/or rod cells.
  • the retinal cells comprise amacrine cells, astrocytes, bipolar cells, cone cells, endothelial cells, horizontal cells, microglia, Muller cells, pericytes, Retinal ganglion cells (RGCs), and/or rod cells.
  • the transduced cells are identified as amacrine cells, cone photoreceptor cells, horizontal cells, Muller glia cells, retinal ganglion cells, astrocyte, microglia, and/or endothelial cells based on one or more, two or more or three or more markers.
  • amacrine cells express one or more of the following markers: ATP1B1, PAX6, GAD1, GAD2, SLC6A1, EPHB6, SLC5A7, GABRD, KCNJ12, PTPRF, GRIN2A, TFAP2A, TFAP2B, TFAP2C, SLC6A9, CALB1, and/ or CHAT.
  • bipolar cells express one or more of the following markers: VSX2, ISL1, GRM6, OTX2, TRPM1, CHX10, PRKCA, GIRK1, VSX1, CABP5, and/or NET01.
  • cone photoreceptor cells express one or more of the following markers: ARR3, GUCA1C, PDE6C, PDE6H, OPN1LW, SLC23A2, DST, TTR, RCVRN, GNAT2, GNGT2, OPN1SW, 0PN1MW, and/or GUCA1A.
  • horizontal cells express one or more of the following markers: ONECUT1, SEPT4, TPM3, NDRG1, SEPT7, CNTNAP2, PTN, NDRG4, TAGLN3, LHX, ONECUT2, and/or CALB1.
  • Muller glia cells express one or more of the following markers: RLBP1, HES1, SLC1A3, GLUL, CLU, RGR, GPR37, NCAM1, CD164, APOE, CRABP1, DKK3, and/or CRYM.
  • retina ganglion cells express one or more of the following markers: NEFL, RBPMS, TUBB3, POU4F1, SLC17A6, RTN1, NDRG4, UCHL1, YWHAH, POU4F2, POU4F3, THY1, NEFM. SNCG, BRN3A, and/or GAP43.
  • rod photoreceptor cells express one or more of the following markers: PDE6A, SLC24A1, RHO, CNGB1, GNAT1, PDC, NRL, SAG, GNGT1, NR2E3, GNB1, PDE6B, CNGA1, R0M1, PRPH2, and/or MFGE8.
  • astrocytes express one or more of the following markers: GYPC, SERPINA5, CD44, SLC4A4, AQP4, ABCC3, NGFR, and/or GFAP.
  • microglia express one or more of the following markers: CD74, HLA-DRA, HA-DPA1, TYROBP, FCER1G, LAPTMS, CD14, HLA-DQA1, FXYD5, CTSB, CD37, HEXB, CTSS, P2RY12, TMEM, B2M, UBA1, HLADPB1, and/or HLA-DRA.
  • pericytes express one or more of the following markers: RGC5, MGP, KCNJ8, MYL9 and/or COL4A1.
  • endothelial cells express one or more of the following markers: CLDN5, IGFBP7, and/or COL4A1.
  • the capture sequence is operably linked to the identifying sequence.
  • the identifying sequence comprises a barcode.
  • the capture sequence and at least one of the differential barcodes are configured to be transcribed in a single RNA. In some embodiments, both mRNA and RNA comprising the capture sequence are captured.
  • the capture sequence comprises a sequence that is not present in endogenous RNA of the cell population or subject.
  • the capture sequence comprises SEQ ID NO: 1 (gctttaaggccggtcctagcaa).
  • the capture sequence comprises an aptamer sequence. In some embodiments, RNA comprising the capture sequence is captured using a bead coated with a target specifically bound by the aptamer sequence. In some embodiments, the capture sequence comprises a recognition sequence. In some embodiments, RNA comprising the capture sequence is captured using a sequence-specific binding protein that specifically binds the recognition sequence.
  • the differential barcodes are operably linked to a promoter.
  • the capture sequence is operably linked to a promoter.
  • the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
  • the promoter comprises a RNAP I promoter, RNAP II promoter, or RNAP III promoter.
  • the promoter comprises a RNAP III promoter.
  • the RNAP III promoter comprises a U6 promoter.
  • the RNAP III promoter comprises a 7SK promoter.
  • the RNAP III promoter comprises a Hl promoter.
  • the RNAP III promoter comprises a small tRNA promoter.
  • a capture sequence includes a nucleic acid sequence that is complementary to or substantially complementary to the capture domain of a capture probe such that the analyte capture sequence hybridizes to the capture domain of the capture probe.
  • a capture sequence comprises a poly(A) nucleic acid sequence that hybridizes to a capture domain that comprises a poly(T) nucleic acid sequence.
  • a capture sequence comprises a poly(T) nucleic acid sequence that hybridizes to a capture domain that comprises a poly(A) nucleic acid sequence.
  • the single nuclei sequencing comprises isolating RNA from the transduced cells or nuclei. In some embodiments, the single nuclei sequencing comprises lOx genomics sequencing. In some embodiments, the single nuclei sequencing comprises Smart-seq2, CEL-Seq2, Drop-seq, Seq-Well, inDrops, sci-RNA-seq, DRONC-seq, Cl (SMART er), MATQ-seq, MARS-seq, or SPLIT-seq.
  • the single nuclei sequencing further comprises subjecting the RNA to reverse transcription to obtain cDNA.
  • RNA is subjected to reverse transcription.
  • the method further comprises tagging the RNA.
  • in the RNA is tagged.
  • the RNA is tagged with a plurality of barcodes or UMIs.
  • UMIs Unique molecular indices
  • UMIs are sequences of nucleotides applied to or identified in DNA molecules that may be used to distinguish individual nucleic acid molecules from one another. Since UMIs are used to identify nucleic acid molecules, they are also referred to as unique molecular identifiers. See, e.g., Kivioja, Nature Methods 9, 72-74 (2012).
  • UMIs may be sequenced along with the nucleic acid molecules with which they are associated to determine whether the read sequences are those of one source nucleic acid molecule or another.
  • the term “UMI” is used herein to refer to both the sequence information of a polynucleotide and the physical polynucleotide per se.
  • UMIs are similar to bar codes, which are commonly used to distinguish reads of one sample from reads of other samples, but UMIs are instead used to distinguish one source nucleic acid molecule from another when many nucleic acid molecules are sequenced together. Because there may be many more nucleic acid molecules in a sample than samples in a sequencing run, there are typically many more distinct UMIs than distinct barcodes in a sequencing run.
  • the plurality of barcodes or UMIs corresponds to individual cells or nucleic.
  • the method further comprises pooling cDNA from different cells or nuclei prior to sequencing.
  • Sequencing of polynucleotides can be performed by various commercial systems. More generally, sequencing can be performed using nucleic acid amplification, polymerase chain reaction (PCR) (e.g., digital PCR and droplet digital PCR (ddPCR), quantitative PCR, real time PCR, multiplex PCR, PCR-based singleplex methods, emulsion PCR), and/or isothermal amplification.
  • PCR polymerase chain reaction
  • ddPCR digital PCR and droplet digital PCR
  • quantitative PCR real time PCR
  • multiplex PCR multiplex PCR
  • PCR-based singleplex methods emulsion PCR
  • methods for sequencing genetic material include, but are not limited to, DNA hybridization methods (e.g., Southern blotting), restriction enzyme digestion methods, Sanger sequencing methods, next-generation sequencing methods (e.g., singlemolecule real-time sequencing, nanopore sequencing, and Polony sequencing), ligation methods, and microarray methods.
  • DNA hybridization methods e.g., Southern blotting
  • restriction enzyme digestion methods e.g., restriction enzyme digestion methods
  • Sanger sequencing methods e.g., next-generation sequencing methods (e.g., singlemolecule real-time sequencing, nanopore sequencing, and Polony sequencing)
  • ligation methods e.g., ligation methods, and microarray methods.
  • sequencing methods include targeted sequencing, single molecule real-time sequencing, exon sequencing, electron microscopy-based sequencing, panel sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, whole-genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, gel electrophoresis, duplex sequencing, cycle sequencing, single-base extension sequencing, solid-phase sequencing, high-throughput sequencing, massively parallel signature sequencing, co-amplification at lower denaturation temperature-PCR (COLD-PCR), sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, singlemolecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse-terminator sequencing, nanopore sequencing, MS-PET sequencing, and any combinations thereof.
  • COLD-PCR denaturation temperature-PCR
  • sequence analysis substrate (which can be viewed as the molecule which is subjected to the sequence analysis step or process) can be the barcoded nucleic acid molecule or it can be a molecule which is derived therefrom (e.g., a complement thereof).
  • the sequencing template can be the barcoded nucleic acid molecule or it can be a molecule derived therefrom.
  • a first and/or second strand DNA molecule can be directly subjected to sequence analysis (e.g., sequencing), i.e., can directly take part in the sequence analysis reaction or process (e.g., the sequencing reaction or sequencing process, or be the molecule which is sequenced or otherwise identified).
  • sequence analysis e.g., sequencing
  • process e.g., the sequencing reaction or sequencing process, or be the molecule which is sequenced or otherwise identified.
  • the barcoded nucleic acid molecule can be subjected to a step of second strand synthesis or amplification before sequence analysis (e.g., sequencing or identification by another technique).
  • sequence analysis substrate e.g., template
  • the sequence analysis substrate can thus be an amplicon or a second strand of a barcoded nucleic acid molecule.
  • both strands of a double stranded molecule can be subjected to sequence analysis (e.g., sequenced).
  • sequence analysis e.g., sequenced
  • single stranded molecules e.g., barcoded nucleic acid molecules
  • sequenced e.g., sequenced
  • the one or more gene therapy agents may be administered to a particular tissue of interest, or may be administered systemically.
  • an effective amount of the one or more gene therapy agents may be administered to the subject.
  • an effective amount of the one or more gene therapy agents may be administered parenterally.
  • Parenteral routes of administration may include without limitation intravenous, intraperitoneal, intraosseous, intra-arterial, intracerebral, intramuscular, intrathecal, subcutaneous, intracerebroventricular, intrahepatic, intracranial, intra-cerebrospinal fluid (CSF), intra-dorsal root ganglia (DRG), intraocular, intracisterna magna, and so forth.
  • an effective amount of the one or more gene therapy agents may be administered through one route of administration.
  • an effective amount of the one or more gene therapy agents may be administered through a combination of or multiple routes of administration (e.g., two, three etc.).
  • an effective amount of the one or more gene therapy agents is administered to one location.
  • an effective amount of the one or more gene therapy agents may be administered to more than one location.
  • the one or more gene therapy agents comprise a library comprising at least two distinct subpopulations of gene therapy agents.
  • each agent in the library comprises a distinct identifying sequence, e.g., a barcode, such as a unique barcode.
  • at least one of the gene therapy agents comprises a viral vector.
  • the one or more gene therapy agents comprises a nucleic acid encoding a heterologous transgene.
  • the heterologous transgene is operably linked to a promoter.
  • the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
  • the heterologous transgene encodes a marker protein.
  • the marker protein is a fluorescent protein, optionally wherein the fluorescent protein is a GFP, YFP, RFP, BFP, CFP, or VFP.
  • the heterologous transgene encodes a gene therapy product, vaccine antigen, or microRNA.
  • the nucleic acid comprises closed-end DNA (ceDNA). In some embodiments, the nucleic acid comprises mRNA.
  • the library comprises at least three distinct subpopulations of gene therapy agents. In some embodiments, the library comprises at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 30 distinct subpopulations of gene therapy agents.
  • An effective amount of gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • an AAV particle e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • the objective of treatment is generally to meet or exceed this level of transduction or transfection.
  • this level of transduction or transfection can be achieved by transduction or transfection of only about 1 to 5% of the target cells of the desired tissue type, in some embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type.
  • the gene therapy agent may be administered by one or more administrations, either during the same procedure or spaced apart by days, weeks, months, or years. One or more of any of the routes of administration described herein may be used. In some embodiments, multiple gene therapy agents may be used; for example, an AAV vector and a lentiviral vector.
  • an effective amount of gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • an effective amount of the gene therapy agent is administered to more than one location simultaneously or sequentially.
  • an effective amount of the gene therapy agent is administered to a single location more than once (e.g., repeated).
  • multiple injections of the gene therapy agent are no more than one hour, two hours, three hours, four hours, five hours, six hours, nine hours, twelve hours or 24 hours apart.
  • the methods comprise administering an effective amount of a pharmaceutical composition comprising a gene therapy agent to treat an individual in need of gene therapy treatment.
  • the viral titer of the viral particles e.g., rAAV particles
  • the viral titer of the viral particles is at least about any of 5 * 10 12 , 6 x 10 12 , 7 x 10 12 , 8 x 10 12 , 9 x 10 12 , 10 x 10 12 , 11 x 10 12 , 15 x 10 12 , 20 x 10 12 , 25 x 10 12 , 30 x 10 12 , or 50 x 10 12 genome copies/mL.
  • the viral titer of the viral particles is about any of 5 x 10 12 to 6 x 10 12 , 6 x 10 12 to 7 x 10 12 , 7 x 10 12 to 8 x 10 12 , 8 x 10 12 to 9 x 10 12 , 9 x 10 12 to 10 x 10 12 , 10 x 10 12 to 11 x 10 12 , 11 x io 12 to 15 x 10 12 , 15 x 10 12 to 20 x 10 12 , 20 x 10 12 to 25 x 10 12 , 25 x 10 12 to 30 x 10 12 , 30 x 10 12 to 50 x 10 12 , or 50 x 10 12 to 100 x 10 12 genome copies/mL.
  • the viral titer of the viral particles is about any of 5 x 10 12 to 10 x 10 12 , 10 x 10 12 to 25 x 10 12 , or 25 x 10 12 to 50 x 10 12 genome copies/mL.
  • the viral titer of the viral particles is at least about any of 5 x 10 9 , 6 x 10 9 , 7 x 10 9 , 8 x 10 9 , 9 x 10 9 , 10 x 10 9 , 11 x 10 9 , 15 x 10 9 , 20 x 10 9 , 25 x 10 9 , 30 x 10 9 , or 50 x 10 9 transducing units /mL.
  • the viral titer of the viral particles is about any of 5 x 10 9 to 6 x 10 9 , 6 x 10 9 to 7 x 10 9 , 7 x 10 9 to 8 x 10 9 , 8 x 10 9 to 9 x 10 9 , 9 x 10 9 to 10 x 10 9 , 10 x 10 9 to 11 x 10 9 , 11 x io 9 to 15 x 10 9 , 15 x 10 9 to 20 x 10 9 , 20 x 10 9 to 25 x 10 9 , 25 x 10 9 to 30 x 10 9 , 30 x 10 9 to 50 x 10 9 or 50 x 10 9 to 100 x 10 9 transducing units/mL.
  • the viral titer of the viral particles is about any of 5 x 10 9 to 10 x 10 9 , 10 x 10 9 to 15 x 10 9 , 15 x 10 9 to 25 x 10 9 , or 25 x 10 9 to 50 x 10 9 transducing units /mL.
  • the viral titer of the viral particles is at least any of about 5 x IO 10 , 6 x IO 10 , 7 x IO 10 , 8 x IO 10 , 9 x IO 10 , 10 x IO 10 , 11 x IO 10 , 15 x IO 10 , 20 x IO 10 , 25 x IO 10 , 30 x 1O 10 , 40 x 1O 10 , or 50 x IO 10 infectious units/mL.
  • the viral titer of the viral particles is at least any of about 5 x 10 10 to 6 x io 10 , 6 x 10 10 to 7 x IO 10 , 7 x 10 10 to 8 x IO 10 , 8 x 10 10 to 9 x IO 10 , 9 x 10 10 to 10 x IO 10 , 10 x 10 10 to 11 x io 10 , 11 x io 10 to 15 x 1O 10 , 15 x 10 10 to 20 x 1O 10 , 20 x 10 10 to 25 x 1O 10 , 25 x 10 10 to 30 x 1O 10 , 30 x 10 10 to 40 x 1O 10 , 40 x 10 10 to 50 x 1O 10 , or 50 x 10 10 to 100 x IO 10 infectious units/mL.
  • the viral titer of the viral particles is at least any of about 5 x 10 10 to 10 x 1O 10 , 10 x 10 10 to 15 x 1O 10 , 15 x 10 10 to 25 x 1O 10 , or 25 x 10 10 to 50 x IO 10 infectious units/mL.
  • the dose of gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) administered to the individual is at least about any of 1 x 10 8 to about 6 x io 13 genome copies/kg of body weight. In some embodiments, the dose of gene therapy agent administered to the individual is about any of 1 x 10 8 to about 6 x io 13 genome copies/kg of body weight.
  • the total amount of the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) administered to the individual is at least about any of 1 x io 9 to about 1 x io 14 genome copies. In some embodiments, the total amount of the gene therapy agent administered to the individual is about any of 1 x 10 9 to about 1 x io 14 genome copies.
  • compositions of the disclosure comprising the gene therapy (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) can be used either alone or in combination with one or more additional therapeutic agents in addition to the IL-2 conjugate.
  • the interval between sequential administration can be in terms of at least (or, alternatively, less than) minutes, hours, or days.
  • the gene therapy agent can be delivered to a cell of a subject.
  • the gene therapy agent can be administered to the subject before an IL-2 conjugate, concurrently with an IL-2 conjugate, or after an IL-2 conjugate.
  • the gene therapy agent is administered to a subject at least about 1 second, about 5 seconds, about 10 seconds, about 15 seconds, about 30 seconds, about 45 seconds, about 1 minute, about 2 minutes, about 5 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 3 hours, about 4 hours, or about 6 hours before the administration of the IL-2 conjugate.
  • the gene therapy agent is administered to a subject at least about 1 second, about 5 seconds, about 10 seconds, about 15 seconds, about 30 seconds, about 45 seconds, about 1 minute, about 2 minutes, about 5 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 3 hours, about 4 hours, or about 6 hours after the administration of the IL-2 conjugate.
  • the disclosure provides methods for using IL-2 conjugates with gene therapy agents for improved gene therapy by inhibiting an adaptive immune response to the gene therapy agent.
  • the gene therapy agent is a viral particle or a lipid nanoparticle.
  • the gene therapy agent is an adeno-associated virus (AAV) particle, an adenovirus particle, a lentivirus particle, or a herpes simplex virus (HAV) particle.
  • the gene therapy agent is a lipid nanoparticle or a liposome.
  • the immune response to the gene therapy agent is an immune response to the viral particle (e.g., viral capsid proteins, viral envelopes, etc.).
  • the immune response to the gene therapy agent is an immune response to an LNP (e.g., one or more lipids used to produce the LNP).
  • the immune response to the gene therapy agent is an immune response to the gene therapy payload; e.g., nucleic acid encoding the therapeutic transgene (a viral genome, a plasmid, a closed ended DNA, an mRNA, an antisense nucleic acid, a siRNA, a shRNA and the like).
  • the immune response to the gene therapy agent is an immune response to the transgene product (e.g., a therapeutic polypeptide or therapeutic nucleic acid).
  • the transgene product (e.g., a therapeutic polypeptide or therapeutic nucleic acid) can be expressed and/or synthesized in a subject for at least about 1 week. In some embodiments, the transgene product (e.g., a therapeutic polypeptide or therapeutic nucleic acid) can be expressed and/or synthesized in a subject for at least about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 22 weeks, about 24 weeks, or about 26 weeks.
  • a transgene product may, e.g., supply a polypeptide and/or enzymatic activity that is absent or present at a reduced level in a cell or organism.
  • a transgene product may supply a polypeptide and/or enzymatic activity that indirectly counteracts an imbalance in a cell or organism.
  • a change in expression of the transgene product comprises changes in expression levels of a therapeutic nucleic acid and/or an endogenous nucleic acid in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control).
  • a change in synthesis of a transgene product comprises changes in synthesis levels of a therapeutic polypeptide encoded by a transgene product and/or an endogenous polypeptide in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control).
  • the one or more gene therapy agents comprise one or more AAV particles, e.g., a plurality of AAV particles, such as a library of AAV particles.
  • a recombinant AAV (rAAV) genome encoding a heterologous nucleic acid e.g., a therapeutic transgene
  • the viral genome comprises a heterologous nucleic acid and/or one or more of the following components, operatively linked in the direction of transcription, control sequences including transcription initiation and termination sequences, thereby forming an expression cassette.
  • the rAAV genome comprises one or more AAV inverted terminal repeat (ITR) sequences (typically two AAV ITR sequences).
  • ITR inverted terminal repeat
  • an expression cassette may be flanked on the 5' and 3' end by at least one functional AAV ITR sequence.
  • functional AAV ITR sequences it is meant that the ITR sequences function as intended for the rescue, replication and packaging of the AAV virion. See Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16: 10-16, all of which are incorporated herein in their entirety by reference.
  • the recombinant viral genomes comprise at least all of the sequences of AAV essential for encapsidation into the AAV capsid and the physical structures for infection by the AAV particle.
  • AAV ITRs for use in the vectors of the disclosure need not have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801), and may be altered by the insertion, deletion or substitution of nucleotides or the AAV ITRs may be derived from any of several AAV serotypes. More than 40 serotypes of AAV are currently known, and new serotypes and variants of existing serotypes continue to be identified.
  • a rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV LK03, AAV2R471 A, AAV DJ, AAV DJ8, a goat AAV, bovine AAV, or mouse AAV ITRs or the like.
  • the AAV nucleic acid (e.g., an rAAV vector) comprises one or more (e.g., in some embodiments two) ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV LK03, AAV2R471 A, AAV DJ, AAV DJ8, a goat AAV, bovine AAV, or mouse AAV ITRs or the like.
  • the AAV particle comprises an AAV vector encoding a heterologous transgene flanked by one or more AAV ITRs.
  • the AAV viral particle comprises an AAV genome comprising one or more inverted terminal repeats (ITRs), wherein the one or more ITRs is an AAV1 ITR, an AAV2 ITR, an AAV3 ITR, an AAV4 ITR, an AAV5 ITR, an AAV6 ITR, an AAV7 ITR, an AAV8 ITR, an AAVrh8 ITR, an AAV9 ITR, an AAV10 ITR, an AAVrhlO ITR, an AAV1 1 ITR, or an AAV12 ITR.
  • the one or more ITRs and the capsid of the AAV particle are derived from the same AAV serotype.
  • the one or more ITRs and the capsid of the AAV particles are derived from different AAV serotypes.
  • the AAV particle comprises a capsid protein selected from an AAV1 capsid, an AAV2 capsid, an AAV3 capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid, an AAV7 capsid, an AAV8 capsid, an AAVrh8 capsid, an AAV9 capsid, an AAV10 capsid, an AAVrhlO capsid, an AAV11 capsid, an AAV12 capsid, an AAVrh32.33 capsid, An AAV-XL32 capsid, an AAV-XL32.1 capsid, an AAV LK03 capsid, an AAV2R471 A capsid, an AAV2/2-7m8 capsid, an AAV DJ capsid, an AAV DJ8
  • the AAV capsid comprises a tyrosine mutation, a heparin binding mutation, or an HBKO mutation.
  • a rAAV particle comprises capsid proteins of an AAV serotype from Clades A-F.
  • the disclosure provides AAV particles comprising a recombinant self-complementing genome (e.g., a self-complementary or self-complimenting AAV vector).
  • AAV viral particles with self-complementing vector genomes and methods of use of self- complementing rAAV genomes are described in US Patent Nos. 6,596,535;
  • An AAV particle comprising a self-complementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a heterologous nucleic acid).
  • the vector comprises a first nucleic acid sequence encoding a heterologous nucleic acid and a second nucleic acid sequence encoding a complement of the nucleic acid, where the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.
  • the first heterologous nucleic acid sequence and a second heterologous nucleic acid sequence are linked by a mutated ITR (e.g., the right ITR).
  • the ITR comprises the polynucleotide sequence 5’- CACTCCCTCTCTGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3’ (SEQ ID NO: 2).
  • the mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence.
  • a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR.
  • An AAV particle can comprise viral proteins and viral nucleic acids of the same serotype or a mixed serotype.
  • an AAV particle may contain one or more ITRs and capsid derived from the same AAV serotype, or an AAV particle may contain one or more ITRs derived from a different AAV serotype than capsid of the AAV particle.
  • the AAV capsid comprises a mutation, e.g., the capsid comprises a mutant capsid protein.
  • the mutation is a tyrosine mutation or a heparin binding mutation.
  • a mutant capsid protein maintains the ability to form an AAV capsid.
  • the AAV particle comprises an AAV2 or AAV5 tyrosine mutant capsid (see, e.g., Zhong L. et al., (2008) Proc Natl Acad Sci U S A 105(22):7827-7832), such as a mutation in Y444 or Y730 (numbering according to AAV2).
  • the AAV particle comprises capsid proteins of an AAV serotype from Clades A-F (Gao, et al., J. Virol. 2004, 78(12):6381).
  • AAV particles for gene therapy Numerous methods are known in the art for production of AAV particles for gene therapy including transfection stable cell line production and infectious hybrid virus production systems which include adenovirus-AAV hybrids, herpesvirus- AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789) and baculovirus-AAV hybrids (Urabe, M. et al., (2002) Human Gene Therapy 13(16): 1935-1943; Kotin, R. (2011) Hum Mol Genet. 2O(R1): R2-R6).
  • AAV production cultures for the production of AAV particles all require; 1) suitable host cells, 2) suitable helper virus function, 3) AAV rep and cap genes and gene products; 4) a nucleic acid (such as a therapeutic nucleic acid) flanked by at least one AAV ITR sequences; and 5) suitable media and media components to support AAV production.
  • the suitable host cell is a primate host cell.
  • the suitable host cell is a human-derived cell lines such as HeLa, A549, 293, or Perc.6 cells.
  • the suitable helper virus function is provided by wildtype or mutant adenovirus (such as temperature sensitive adenovirus), herpes virus (HSV), baculovirus, or a plasmid construct providing helper functions.
  • the AAV rep and cap gene products may be from any AAV serotype.
  • the AAV rep gene product is of the same serotype as the ITRs of the rAAV genome as long as the rep gene products may function to replicated and package the rAAV genome. Suitable media known in the art may be used for the production of AAV particles.
  • the AAV helper functions are provided by adenovirus or HSV.
  • the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).
  • AAV particles One method for producing AAV particles is the triple transfection method. Briefly, a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid, may be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and virus may be collected and optionally purified.
  • a cell line e.g., HEK-293 cells
  • the AAV particle was produced by triple transfection of a nucleic acid encoding the AAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions into a host cell, wherein the transfection of the nucleic acids to the host cells generates a host cell capable of producing AAV particles.
  • AAV particles may be produced by a producer cell line method (see Martin et al., (2013) Human Gene Therapy Methods 24:253-269; U.S. PG Pub. No. US2004/0224411; and Liu, X.L. et al. (1999) Gene Ther.6:293-299).
  • a cell line e.g., a HeLa, 293, A549, or Perc.6 cell line
  • Cell lines may be screened to select a lead clone for AAV production, which may then be expanded to a production bioreactor and infected with a helper virus (e.g., an adenovirus or HSV) to initiate AAV production.
  • a helper virus e.g., an adenovirus or HSV
  • Virus may subsequently be harvested, adenovirus may be inactivated (e.g., by heat) and/or removed, and the AAV particles may be purified.
  • the AAV particle was produced by a producer cell line comprising one or more of nucleic acid encoding the rAAV genome, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions.
  • nucleic acid encoding AAV rep and cap genes and/or the AAV viral genome are stably maintained in the producer cell line.
  • nucleic acid encoding AAV rep and cap genes and/or the rAAV genome is introduced on one or more plasmids into a cell line to generate a producer cell line.
  • the AAV rep, AAV cap, and AAV genome are introduced into a cell on the same plasmid.
  • the AAV rep, AAV cap, and rAAV genome are introduced into a cell on different plasmids.
  • a cell line stably transfected with a plasmid maintains the plasmid for multiple passages of the cell line (e.g., 5, 10, 20, 30, 40, 50 or more than 50 passages of the cell).
  • the plasmid(s) may replicate as the cell replicates, or the plasmid(s) may integrate into the cell genome.
  • a variety of sequences that enable a plasmid to replicate autonomously in a cell have been identified (see, e.g., Krysan, P.J. et al. (1989) Mol. Cell Biol.9: 1026-1033).
  • the plasmid(s) may contain a selectable marker (e.g., an antibiotic resistance marker) that allows for selection of cells maintaining the plasmid.
  • selectable markers commonly used in mammalian cells include without limitation blasticidin, G418, hygromycin B, zeocin, puromycin, and derivatives thereof.
  • Methods for introducing nucleic acids into a cell include without limitation viral transduction, cationic transfection (e.g., using a cationic polymer such as DEAE- dextran or a cationic lipid such as lipofectamine), calcium phosphate transfection, microinjection, particle bombardment, electroporation, and nanoparticle transfection (for more details, see e.g., Kim, T.K. and Eberwine, J.H. (2010) Anal. Bioanal. Chem.397:3173-3178).
  • cationic transfection e.g., using a cationic polymer such as DEAE- dextran or a cationic lipid such as lipofectamine
  • calcium phosphate transfection e.g., using a cationic polymer such as DEAE- dextran or a cationic lipid such as lipofectamine
  • calcium phosphate transfection e.g., using a cationic polymer such as DEAE- dextran or
  • the producer cell line is derived from a primate cell line (e.g., a non-human primate cell line, such as a Vero or FRhL-2 cell line).
  • the cell line is derived from a human cell line.
  • the producer cell line is derived from HeLa, 293, A549, or PERC.6® (Crucell) cells.
  • the cell line Prior to introduction and/or stable maintenance/integration of nucleic acid encoding AAV rep and cap genes and/or the rAAV genome into a cell line to generate a producer cell line, the cell line is a HeLa, 293, A549, or PERC.6® (Crucell) cell line, or a derivative thereof.
  • the cell line is a HeLa, 293, A549, or PERC.6® (Crucell) cell line, or a derivative thereof.
  • the producer cell line is adapted for growth in suspension.
  • anchorage-dependent cells are typically not able to grow in suspension without a substrate, such as microcarrier beads.
  • Adapting a cell line to grow in suspension may include, for example, growing the cell line in a spinner culture with a stirring paddle, using a culture medium that lacks calcium and magnesium ions to prevent clumping (and optionally an antifoaming agent), using a culture vessel coated with a siliconizing compound, and selecting cells in the culture (rather than in large clumps or on the sides of the vessel) at each passage.
  • AAV particles of the disclosure may be harvested from AAV production cultures by lysis of the host cells of the production culture or by harvest of the spent media from the production culture, provided the cells are cultured under conditions known in the art to cause release of AAV particles into the media from intact cells, as described more fully in U.S. Patent No.6, 566,118).
  • Suitable methods of lysing cells are also known in the art and include for example multiple freeze/thaw cycles, sonication, microfluidization, and treatment with chemicals, such as detergents and/or proteases.
  • the AAV particles are purified.
  • purified includes a preparation of AAV particles devoid of at least some of the other components that may also be present where the AAV particles naturally occur or are initially prepared from.
  • isolated AAV particles may be prepared using a purification technique to enrich it from a source mixture, such as a culture lysate or production culture supernatant.
  • Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase-resistant particles (DRPs) or genome copies (gc) present in a solution, or by infectivity, or it can be measured in relation to a second, potentially interfering substance present in the source mixture, such as contaminants, including production culture contaminants or in-process contaminants, including helper virus, media components, and the like.
  • DNase-resistant particles DNase-resistant particles
  • gc genome copies
  • the AAV production culture harvest is clarified to remove host cell debris.
  • the production culture harvest is clarified by filtration through a series of depth filters including for example a grade DOHC Millipore Millistak+ HC Pod Filter, a grade A1HC Millipore Millistak+ HC Pod Filter, and a 0.2 pm Filter Opticap XL 10 Millipore Express SHC Hydrophilic Membrane filter. Clarification can also be achieved by a variety of other standard techniques known in the art, such as, centrifugation or filtration through any cellulose acetate filter of 0.2 pm or greater pore size known in the art.
  • the AAV production culture harvest is further treated with Benzonase® to digest any high molecular weight DNA present in the production culture.
  • the Benzonase® digestion is performed under standard conditions known in the art including, for example, a final concentration of 1-2.5 units/ml of Benzonase® at a temperature ranging from ambient to 37°C for a period of 30 minutes to several hours.
  • AAV particles may be isolated or purified using one or more of the following purification steps: equilibrium centrifugation; flow-through anionic exchange filtration; tangential flow filtration (TFF) for concentrating the AAV particles; AAV capture by apatite chromatography; heat inactivation of helper virus; AAV capture by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and AAV capture by anionic exchange chromatography, cationic exchange chromatography, or affinity chromatography. These steps may be used alone, in various combinations, or in different orders. In some embodiments, the method comprises all the steps in the order as described below.
  • the transgene product e.g., a therapeutic polypeptide or therapeutic nucleic acid
  • the transgene product can be expressed and/or synthesized in a subject for at least about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 22 weeks, about 24 weeks, or about 26 weeks.
  • a transgene product may, e.g., supply a polypeptide and/or enzymatic activity that is absent or present at a reduced level in a cell or organism.
  • a transgene product may supply a polypeptide and/or enzymatic activity that indirectly counteracts an imbalance in a cell or organism.
  • a change in expression of the transgene product comprises changes in expression levels of a therapeutic nucleic acid and/or an endogenous nucleic acid in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control).
  • a change in synthesis of a transgene product comprises changes in synthesis levels of a therapeutic polypeptide encoded by a transgene product and/or an endogenous polypeptide in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control).
  • the one or more gene therapy agents comprise one or more adenovirus particles, e.g., a plurality of adenovirus particles, such as a library of adenovirus particles.
  • Adenoviral vectors for gene therapy are typically adenoviral particles with a recombinant adenovirus (rAd) genome comprising one or more heterologous sequences (i.e., nucleic acid sequence not of adenoviral origin) between two adenoviral ITRs encapsidated into an adenoviral capsid.
  • the heterologous sequence encodes a therapeutic transgene.
  • the rAd genome lacks or contains a defective copy of one or more El genes, which renders the adenovirus replication- defective.
  • Adenoviruses include a linear, double-stranded DNA genome within a large ( ⁇ 950A), nonenveloped icosahedral capsid.
  • Adenoviruses have a large genome that can incorporate more than 30kb of heterologous sequence (e.g., in place of the El and/or E3 region) making them uniquely suited for use with larger heterologous genes. They are also known to infect dividing and non-dividing cells and do not naturally integrate into the host genome (although hybrid variants may possess this ability).
  • the adenoviral vector may be a first generation adenoviral vector with a heterologous sequence in place of El. In some embodiments, the adenoviral vector may be a second generation adenoviral vector with additional mutations or deletions in E2A, E2B, and/or E4. In some embodiments, the adenoviral vector may be a third generation or gutted adenoviral vector that lacks all viral coding genes, retaining only the ITRs and packaging signal and requiring a helper adenovirus in trans for replication, and packaging. Adenoviral particles have been investigated for use as vectors for transient transfection of mammalian cells as well as gene therapy vectors.
  • the adenoviral particle comprises a rAd genome comprising a therapeutic transgene.
  • adenovirus serotype Use of any adenovirus serotype is considered within the scope of the present disclosure.
  • the adenoviral particle is derived from an adenovirus serotype, including without limitation, AdHu2, AdHu 3, AdHu4, AdHu5, AdHu7, AdHul l, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6, AdC7, AdC69, bovine Ad type 3, canine Ad type 2, ovine Ad, and porcine Ad type 3, or a functional variant thereof.
  • the adenoviral particle also comprises capsid proteins.
  • the adenoviral particle includes one or more foreign viral capsid proteins. Such combinations may be referred to as pseudotyped adenoviral particles.
  • foreign viral capsid proteins used in pseudotyped adenoviral particles are derived from a foreign virus or from another adenovirus serotype.
  • the foreign viral capsid proteins are derived from, including without limitation, reovirus type 3. Examples of vector and capsid protein combinations used in pseudotyped adenovirus particles can be found in the following references (Tatsis, N. et al. (2004) Mol. Ther.10(4):616-629 and Ahi, Y. et al.
  • adenovirus serotypes can be used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue).
  • Tissues or cells targeted by specific adenovirus serotypes include without limitation, lung (e.g. HuAd3), spleen and liver (e.g. HuAd37), smooth muscle, synoviocytes, dendritic cells, cardiovascular cells, tumor cell lines (e.g. HuAdl 1), and dendritic cells (e.g. HuAd5 pseudotyped with reovirus type 3, HuAd30, or HuAd35).
  • lung e.g. HuAd3
  • spleen and liver e.g. HuAd37
  • smooth muscle e.g. HuAd37
  • synoviocytes e.g. HuAd5 pseudotyped with reovirus type 3, HuAd30, or HuAd35
  • the adenoviral vector genome and a helper adenovirus genome may be transfected into a packaging cell line (e.g., a 293 cell line).
  • the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes may be transfected into a packaging cell line that expresses a recombinase (e.g., the Cre/loxP system may be used), such that the adenoviral vector of interest is packaged more efficiently than the helper adenovirus (see, e.g., Alba, R. et al. (2005) Gene Ther. 12 Suppl 1 : S 18-27).
  • Adenoviral vectors may be harvested and purified using standard methods, such as those described herein.
  • the one or more gene therapy agents comprise one or more lentivirus particles, e.g., a plurality of lentivirus particles, such as a library of lentivirus particles.
  • Lentiviral vectors for gene therapy are typically lentiviral particles with a recombinant lentivirus genome comprising one or more heterologous sequences (i.e., nucleic acid sequence not of lentiviral origin) between two long terminal repeats (LTRs).
  • the heterologous sequence encodes a therapeutic transgene.
  • Lentiviruses are positive-sense, ssRNA retroviruses with a genome of approximately 10 kb.
  • Lentiviruses integrate into the genome of dividing and non-dividing cells.
  • Lentiviral particles may be produced, for example, by transfecting multiple plasmids (typically the lentiviral genome and the genes required for replication and/or packaging are separated to prevent viral replication) into a packaging cell line, which packages the modified lentiviral genome into lentiviral particles.
  • a lentiviral particle may refer to a first generation vector that lacks the envelope protein.
  • a lentiviral particle may refer to a second- generation vector that lacks all genes except the gag/pol and tat/rev regions.
  • a lentiviral particle may refer to a third generation vector that only contains the endogenous rev, gag, and pol genes and has a chimeric LTR for transduction without the tat gene (see Dull, T. et al. (1998) J. Virol. 72:8463-71). For further description, see Durand, S. and Cimarelli, A. (2011) Viruses 3:132-59.
  • the lentiviral particle is pseudotyped with vesicular stomatitis virus (VSV), lymphocytic choriomeningitis virus (LCMV), Ross river virus (RRV), Ebola virus, Marburg virus, Mokala virus, Rabies virus, RD114, or a functional variant thereof.
  • VSV vesicular stomatitis virus
  • LCMV lymphocytic choriomeningitis virus
  • RRV Ross river virus
  • Ebola virus Marburg virus
  • Mokala virus Rabies virus
  • RD114 Reliable virus
  • the lentiviral vector is derived from a lentivirus including, without limitation, human immunodeficiency virus-1 (HIV-1), human immunodeficiency virus-2 (HIV- 2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), visna virus (VV), and caprine arthritis encephalitis virus (CAEV).
  • the lentiviral particle also comprises capsid proteins.
  • the lentivirus particles include one or more foreign viral capsid proteins. Such combinations may be referred to as pseudotyped lentiviral particles.
  • foreign viral capsid proteins used in pseudotyped lentiviral particles are derived from a foreign virus.
  • the foreign viral capsid protein used in pseudotyped lentiviral particles is Vesicular stomatitis virus glycoprotein (VSV-GP).
  • VSV-GP interacts with a ubiquitous cell receptor, providing broad tissue tropism to pseudotyped lentiviral particles.
  • VSV- GP is thought to provide higher stability to pseudotyped lentiviral particles.
  • the foreign viral capsid proteins are derived from, including without limitation, Chandipura virus, Rabies virus, Mokola virus, Lymphocytic choriomeningitis virus (LCMV), Ross River virus (RRV), Sindbis virus, Semliki Forest virus (SFV), Venezuelan equine encephalitis virus, Ebola virus Reston, Ebola virus Zaire, Marburg virus, Lassa virus, Avian leukosis virus (ALV), Jaagsiekte sheep retrovirus (JSRV), Moloney Murine leukemia virus (MLV), Gibbon ape leukemia virus (GALV), Feline endogenous retrovirus (RD114), Human T-lymphotropic virus 1 (HTLV-1), Human foamy virus, Maedi-visna virus (MW), SARS- CoV, Sendai virus, Respiratory syncytia virus (RSV), Human parainfluenza virus type 3, Hepatitis C virus (HCV), Influenza virus, Fowl plague virus
  • pseudotyped lentivirus particles examples include without limitation, liver (e.g. pseudotyped with a VSV-G, LCMV, RRV, or SeV F protein), lung (e.g.
  • pancreatic islet cells e.g. pseudotyped with an LCMV protein
  • central nervous system e.g. pseudotyped with a VSV-G, LCMV, Rabies, or Mokola protein
  • retina e.g. pseudotyped with a VSV-G or Mokola protein
  • monocytes or muscle e.g. pseudotyped with a Mokola or Ebola protein
  • hematopoietic system e.g. pseudotyped with an RD114 or GALV protein
  • cancer cells e.g. pseudotyped with a GALV or LCMV protein.
  • lentiviral particles Numerous methods are known in the art for production of lentiviral particles.
  • a vector containing the recombinant lentiviral genome of interest with gag and pol genes may be co-transfected into a packaging cell line (e.g., a 293 cell line) along with a vector containing a rev gene.
  • the recombinant lentiviral genome of interest also contains a chimeric LTR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. 72:8463-71).
  • Lentiviral vectors may be harvested and purified using methods (e.g., Segura MM, et al., (2013) Expert Opin Biol Ther.13(7):987-1011) described herein.
  • the one or more gene therapy agents comprise one or more HSV particles, e.g., a plurality of HSV particles, such as a library of HSV particles.
  • HSV vectors for gene therapy are typically HSV particles with a recombinant HSV genome comprising one or more heterologous sequences (i.e., nucleic acid sequence not of HSV origin) between two terminal repeats (TRs).
  • the heterologous sequence encodes a therapeutic transgene.
  • HSV is an enveloped, double-stranded DNA virus with a genome of approximately 152 kb.
  • approximately half of its genes are nonessential and may be deleted to accommodate heterologous sequence.
  • HSV particles infect non-dividing cells.
  • the HSV particle may be replication- defective or replication-competent (e.g., competent for a single replication cycle through inactivation of one or more late genes).
  • replication-competent e.g., competent for a single replication cycle through inactivation of one or more late genes.
  • the HSV particle is an HSV-1 particle or an HSV-2 particle, or a functional variant thereof.
  • the HSV particle comprises a recombinant HSV genome comprising a transgene.
  • the HSV vector is derived from a HSV serotype, including without limitation, HSV-1 and HSV-2.
  • the HSV particle also comprises capsid proteins.
  • the HSV particles include one or more foreign viral capsid proteins. Such combinations may be referred to as pseudotyped HSV particles.
  • foreign viral capsid proteins used in pseudotyped HSV particles are derived from a foreign virus or from another HSV serotype.
  • the foreign viral capsid protein used in a pseudotyped HSV particle is a Vesicular stomatitis virus glycoprotein (VSV-GP).
  • VSV-GP interacts with a ubiquitous cell receptor, providing broad tissue tropism to pseudotyped HSV particles.
  • VSV-GP is thought to provide higher stability to pseudotyped HSV particles.
  • the foreign viral capsid protein may be from a different HSV serotype.
  • an HSV-1 vector may contain one or more HSV-2 capsid proteins. Different HSV serotypes can be used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue).
  • Tissues or cells targeted by specific adenovirus serotypes include without limitation, central nervous system and neurons (e.g. HSV-1).
  • central nervous system and neurons e.g. HSV-1
  • HSV-1 central nervous system 1
  • HSV vectors may be harvested and purified using standard methods, such as those described herein.
  • an HSV genome of interest that lacks all of the immediate early (IE) genes may be transfected into a complementing cell line that provides genes required for virus production, such as ICP4, ICP27, and ICP0 (see, e.g., Samaniego, L.A. et al. (1998) J. Virol.72:3307-20).
  • HSV vectors may be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology 1144:63-79). 5.
  • the one or more gene therapy agents comprise one or more non-viral gene therapy agent, e.g., a plurality of non-viral gene therapy agents, such as a library of non-viral gene therapy agents.
  • a non-viral gene therapy agent may comprise a non- viral vector delivery system.
  • Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed to a delivery system.
  • the vector may be complexed to a lipid (e.g., a cationic or neutral lipid, and/or a targeted lipid), a liposome, a polycation, a lipid nanoparticle, or an agent that enhances the cellular uptake of nucleic acid.
  • the nucleic acid may be complexed to an agent suitable for any of the delivery methods described herein.
  • the nucleic acid encodes a therapeutic transgene.
  • the one or more gene therapy agents comprise one or more lipid nanoparticles, e.g., a plurality of lipid nanoparticles.
  • the one or more lipid nanoparticles each comprise an expression cassette encoding an RNA comprising a capture sequence and a differential barcode.
  • the expression cassette encoding an RNA comprising a capture sequence and an identifying sequence is operably linked to an RNAP III promoter.
  • the one or more lipid nanoparticles each comprise multiple expression cassettes.
  • Lipid nanoparticles for gene therapy typically comprise a vector genome encapsulated in a lipid particle or a vector genome complexed with a lipid.
  • the heterologous sequence encodes a therapeutic transgene.
  • the vector genome is formulated in a lipoplex nanoparticle or liposome.
  • a lipoplex nanoparticle formulation for the gene therapy agent comprises the synthetic cationic lipid (R)-N,N,N-trimethyl-2,3-dioleyloxy-l-propanaminium chloride (DOTMA) and the phospholipid l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE).
  • DOTMA/DOPE liposomal component is optimized for delivery and targeting of cells in the individual.
  • nucleic acid comprising the vector genome is mixed with a pharmaceutical composition comprising one or more cationic lipids, including, e.g., (R)- N,N,N-trimethyl-2,3-dioleyloxy-l-propanaminium chloride (DOTMA) and the phospholipid l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE).
  • DOTMA N,N,N-trimethyl-2,3-dioleyloxy-l-propanaminium chloride
  • DOPE phospholipid l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine
  • the pharmaceutical composition comprises at least one lipid.
  • the pharmaceutical composition comprises at least one cationic lipid.
  • the cationic lipid can be monocationic or poly cationic.
  • any cationic amphiphilic molecule e.g., a molecule which comprises at least one hydrophilic and lipophilic moiety is a cationic lipid within the meaning of the present disclosure.
  • the positive charges are contributed by the at least one cationic lipid and the negative charges are contributed by the nucleic acid.
  • the pharmaceutical composition comprises at least one helper lipid.
  • the helper lipid may be a neutral or an anionic lipid.
  • the helper lipid may be a natural lipid, such as a phospholipid or an analogue of a natural lipid, or a fully synthetic lipid, or lipid-like molecule, with no similarities with natural lipids.
  • the cationic lipid and/or the helper lipid is a bilayer forming lipid.
  • helper lipids include, but are not limited to, 1,2-di- (9Z-octadecenoyl)-sn-glycero-3 -phosphoethanolamine (DOPE) or analogs or derivatives thereof, cholesterol (Choi) or analogs or derivatives thereof and/or 1,2-di oleoyl-sn-glycero-3- phosphocholine (DOPC) or analogs or derivatives thereof.
  • DOPE 1,2-di- (9Z-octadecenoyl)-sn-glycero-3 -phosphoethanolamine
  • DOPC 1,2-di oleoyl-sn-glycero-3- phosphocholine
  • the molar ratio of the at least one cationic lipid to the at least one helper lipid is from 10:0 to 3:7, preferably 9: 1 to 3:7, 4: 1 to 1 :2, 4: 1 to 2:3, 7:3 to 1 : 1, or 2: 1 to 1 : 1, preferably about 1 : 1.
  • the molar amount of the cationic lipid results from the molar amount of the cationic lipid multiplied by the number of positive charges in the cationic lipid.
  • the lipid is comprised in a vesicle encapsulating the vector genome.
  • the vesicle may be a multilamellar vesicle, an unilamellar vesicle, or a mixture thereof.
  • the vesicle may be a liposome.
  • the one or more gene therapy agents comprise one or more therapeutic transgenes, e.g., a plurality of therapeutic transgenes, such as a library of therapeutic transgenes. In some embodiments, the one or more gene therapy agents comprise one or more vector genome for delivery and expression of the therapeutic transgene in the desired target in the individual.
  • the present disclosure contemplates the use of one or more gene therapy agents for the introduction of one or more nucleic acid sequences encoding a therapeutic polypeptide and/or nucleic acid for packaging into a viral particle (for viral gene therapy agents).
  • the vector genome may include any element to establish the expression of the therapeutic polypeptide and/or nucleic acid, for example, a promoter, an ITR of the present disclosure, a ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal, and/or origin of replication.
  • the therapeutic transgene encodes a therapeutic polypeptide.
  • a therapeutic polypeptide may, e.g., supply a polypeptide and/or enzymatic activity that is absent or present at a reduced level in a cell or organism.
  • a therapeutic polypeptide may supply a polypeptide and/or enzymatic activity that indirectly counteracts an imbalance in a cell or organism.
  • a therapeutic polypeptide for a disorder related to buildup of a metabolite caused by a deficiency in a metabolic enzyme or activity may supply a missing metabolic enzyme or activity, or it may supply an alternate metabolic enzyme or activity that leads to reduction of the metabolite.
  • a therapeutic polypeptide may also be used to reduce the activity of a polypeptide (e.g., one that is overexpressed, activated by a gain-of-function mutation, or whose activity is otherwise misregulated) by acting, e.g., as a dominant-negative polypeptide.
  • a polypeptide e.g., one that is overexpressed, activated by a gain-of-function mutation, or whose activity is otherwise misregulated
  • the vector genomes of the disclosure may encode polypeptides that are intracellular proteins, anchored in the cell membrane, remain within the cell, or are secreted by the cell transduced with the vectors of the disclosure.
  • the polypeptide can be soluble (i.e., not attached to the cell).
  • soluble polypeptides are devoid of a transmembrane region and are secreted from the cell. Techniques to identify and remove nucleic acid sequences which encode transmembrane domains are known in the art.
  • the vector genome of the disclosure encodes polypeptides used to treat a disease or disorder in an individual.
  • Diseases and disorders treated by the gene therapy agent of the disclosure include but are not limited to Huntington disease (HD), progressive supranuclear palsy (PSP), multiple system atrophy (MSA), metachromatic leukodystrophy (MLD), amyotrophic lateral sclerosis (ALS), age-related macular degeneration (AMD), congenital muscular dystrophy (CMD), phenylketonuria (PKU), muscular dystrophy (MD), Al AT deficiency, focal segmental glomerulosclerosis (FSGS), cystinuria, hemophilia A, hemophilia B, Gaucher disease (GBA), Parkinson’s disease (PD), and Pompe disease.
  • HD Huntington disease
  • PSP progressive supranuclear palsy
  • MSA multiple system atrophy
  • MLD metachromatic leukodystrophy
  • ALS amyotrophic lateral sclerosis
  • AMD age-related
  • the therapeutic polypeptide is huntingtin (HTT), tau, amyloid precursor protein, alpha-synuclein, pseudoarylsulfatase (ARSA), superoxide dismutase 1 (SOD1), phenylalanine hydroxylase (PAH), dystrophin, alpha- 1 -antitrypsin (A1AT), cysteine transporter, Factor VIII (FVIII), Factor IX (FIX), acid beta-glucosidase, glial-derived growth factor (GDNF), brain-derived growth factor (BDNF), tyrosine hydroxlase (TH), GTP- cyclohydrolase (GTPCH), and/or amino acid decarboxylase (AADC), or alpha glucosidase.
  • a heterologous transgene may include without limitation an DNA, mRNA, closed-end DNA (ceDNA), siRNA, an shRNA, an RNAi, a miRNA,
  • the heterologous nucleic acid encodes a therapeutic nucleic acid e.g. that can be used to replace, or knock down, one or more defective genes.
  • a therapeutic nucleic acid may include without limitation an DNA, siRNA, an shRNA, an RNAi, a miRNA, an antisense RNA, a ribozyme or a DNAzyme.
  • a therapeutic nucleic acid may encode an RNA that when transcribed from the nucleic acids of the vector can treat a disorder by interfering with translation or transcription of an abnormal or excess protein associated with a disorder of the disclosure.
  • the nucleic acids of the disclosure may encode for an RNA which treats a disorder by highly specific elimination or reduction of mRNA encoding the abnormal and/or excess proteins.
  • Therapeutic RNA sequences include RNAi, small inhibitory RNA (siRNA), micro RNA (miRNA), and/or ribozymes (such as hammerhead and hairpin ribozymes) that can treat disorders by highly specific elimination or reduction of mRNA encoding the abnormal and/or excess proteins.
  • the therapeutic polypeptide or therapeutic nucleic acid is used to treat a disorder of the CNS.
  • a therapeutic polypeptide or therapeutic nucleic acid may be used to replace a mutated gene with a wild type or improved gene, reduce or eliminate the expression and/or activity of a polypeptide whose gain-of-function has been associated with a disorder, or to enhance the expression and/or activity of a polypeptide to complement a deficiency that has been associated with a disorder (e.g., a mutation in a gene whose expression shows similar or related activity).
  • Non-limiting examples of disorders of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure include stroke (e.g., caspase-3, Beclinl, Askl, PARI, HIFla, PUMA, and/or any of the genes described in Fukuda, A.M. and Badaut, J. (2013) Genes (Basel) 4:435-456), Huntington’s disease (mutant HTT), epilepsy (e.g., SCN1A, NMD AR, ADK, and/or any of the genes described in Boison, D.
  • stroke e.g., caspase-3, Beclinl, Askl, PARI, HIFla, PUMA, and/or any of the genes described in Fukuda, A.M. and Badaut, J. (2013) Genes (Basel) 4:435-456
  • Huntington’s disease mutant HTT
  • epilepsy e.g., SCN1A, NMD AR, ADK, and
  • Parkinson’s disease alpha-synuclein
  • Lou Gehrig’s disease also known as amyotrophic lateral sclerosis; SOD1
  • Alzheimer’s disease tau, amyloid precursor protein
  • SOD1 amyotrophic lateral sclerosis
  • AD amyotrophic lateral sclerosis
  • Alzheimer’s disease tau, amyloid precursor protein
  • disorders of the disclosure may include those that involve large areas of the cortex, e.g., more than one functional area of the cortex, more than one lobe of the cortex, and/or the entire cortex.
  • Other non-limiting examples of disorders of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure include traumatic brain injury, enzymatic dysfunction disorders, psychiatric disorders (including post-traumatic stress syndrome), neurodegenerative diseases, and cognitive disorders (including dementias, autism, and depression).
  • Enzymatic dysfunction disorders include without limitation leukodystrophies (including Canavan’s disease) and any of the lysosomal storage diseases described below.
  • the therapeutic polypeptide or therapeutic nucleic acid is used to treat a lysosomal storage disease.
  • lysosomal storage diseases are rare, inherited metabolic disorders characterized by defects in lysosomal function. Such disorders are often caused by a deficiency in an enzyme required for proper mucopolysaccharide, glycoprotein, and/or lipid metabolism, leading to a pathological accumulation of lysosomally stored cellular materials.
  • Non-limiting examples of lysosomal storage diseases of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure (exemplary genes that may be targeted or supplied are provided in parenthesis for each disorder) include Gaucher disease type 2 or type 3 (acid beta-glucosidase, GBA), GM1 gangliosidosis (beta-galactosidase- 1, GLB1), Hunter disease (iduronate 2-sulfatase, IDS), Krabbe disease (galactosylceramidase, GALC), a mannosidosis disease (a mannosidase, such as alpha-D- mannosidase, MAN2B1), p mannosidosis disease (beta-mannosidase, MANBA), metachromatic leukodystrophy disease (pseudoarylsulfatase A, ARSA), mucolipidosisII/III disease (N- acetylglucosamine-1
  • the therapeutic polypeptide encodes Factor VIII, Factor IX, myotubularin, survival motor neuron protein (SMN), retinoid isomerohydrolase (RPE65), NADH-ubiquinone oxidoreductase chain 4, Choroideremia protein (CHM), ornithine transcarbomylase, argininosuccinate synthetase, P-globin, y-globin, phenylalanine hydroxylase, adrenoleukodystrophy protein (ALD), dystrophin, a truncated dystrophin, an anti-VEGF agent, or a functional variant thereof.
  • SSN survival motor neuron protein
  • RPE65 retinoid isomerohydrolase
  • NADH-ubiquinone oxidoreductase chain 4 Choroideremia protein
  • ornithine transcarbomylase ornithine transcarbomylase
  • argininosuccinate synthetase P
  • the heterologous nucleic acid is operably linked to a promoter.
  • exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, the RSV LTR, the MoMLV LTR, the phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter and a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HB V promoter, an hAAT promoter, a LSP promoter, chimeric liver-specific promoters (LSPs), the E2F promoter, the telomerase (hTERT) promoter; the cytomegalovirus enhancer/chicken beta- actin/Rabbit P-globin promoter (CAG promoter; Niwa et al., Gene, 1991, 108(2): 193-
  • CMV cyto
  • the promoter comprises a human P- glucuronidase promoter or a cytomegalovirus enhancer linked to a chicken P-actin (CB A) promoter.
  • the promoter can be a constitutive, inducible or repressible promoter.
  • the disclosure provides a recombinant vector comprising nucleic acid encoding a heterologous transgene of the present disclosure operably linked to a CBA promoter. Exemplary promoters and descriptions may be found, e.g., in U.S. PG Pub.20140335054.
  • constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41 :521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13 -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen],
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • PGK phosphoglycerol kinase
  • Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only.
  • Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art.
  • inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346- 3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci.
  • MT zinc-inducible sheep metallothionine
  • Dex dexamethasone
  • MMTV mouse mammary tumor virus
  • T7 polymerase promoter system WO 98/10088
  • ecdysone insect promoter No et al., Proc. Natl. Acad. Sci. USA, 93:3346- 3351 (
  • inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.
  • the native promoter, or fragment thereof, for the transgene will be used.
  • the native promoter can be used when it is desired that expression of the transgene should mimic the native expression.
  • the native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissuespecific manner, or in response to specific transcriptional stimuli.
  • other native expression control elements such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.
  • the regulatory sequences impart tissue-specific gene expression capabilities.
  • the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner.
  • tissue-specific regulatory sequences e.g., promoters, enhancers, etc.
  • tissue-specific regulatory sequences are well known in the art.
  • the vector comprises an intron.
  • the intron is a chimeric intron derived from chicken beta-actin and rabbit betaglobin.
  • the intron is a minute virus of mice (MVM) intron.
  • the vector comprises a polyadenylation (poly A) sequence.
  • polyadenylation sequences are known in the art, such as a bovine growth hormone (BGH) Poly(A) sequence (see, e.g., accession number EF592533), an SV40 polyadenylation sequence, and an HSV TK pA polyadenylation sequence.
  • BGH bovine growth hormone
  • a gene therapy agent, pharmaceutical composition, or formulation described herein is administered to a subject by any one or more of various administration routes, including but not limited to, parenteral, oral, buccal, rectal, sublingual, or transdermal administration routes.
  • the one or more gene therapy agents are administered locally.
  • the one or more gene therapy agents are administered intravitreally, intracam erally, retinally, intrathecally, intramuscularly, intrarenally, intramuscularly, intracranially, intra-CSF, intra-DRG, intracerebroventricularly, intraocularly, intracistema magna, intrahepatically, intravitreally or intracam erally.
  • the one or more gene therapy agents are administered bilaterally or unilaterally. In some embodiments, one or more gene therapy agents are administered systemically. In some embodiments, the one or more gene therapy agent are administered intravenously, intraperitoneally, intra-arterially, or subcutaneously.
  • parenteral administration comprises intravenous, subcutaneous, intramuscular, intracerebral, intranasal, intra-arterial, intra-articular, intradermal, intravitreal, intraosseous infusion, intraperitoneal, intracranial, intra- cerebrospinal fluid (CSF), intra-dorsal root ganglia (DRG), intraocular, intracisterna magna, or intrathecal administration.
  • the pharmaceutical composition is formulated for local administration.
  • the pharmaceutical composition is formulated for systemic administration.
  • the pharmaceutical composition and formulations described herein are administered to a subject by intravenous, subcutaneous, and intramuscular administration.
  • the pharmaceutical composition and formulations described herein are administered to a subject by intravenous administration. In some embodiments, the pharmaceutical composition and formulations described herein are administered to a subject by administration. In some embodiments, the pharmaceutical composition and formulations described herein are administered to a subject by intramuscular administration.
  • the pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, dragees, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.
  • aqueous liquid dispersions self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, dragees, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.
  • the pharmaceutical formulations include a carrier or carrier materials selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form.
  • exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like.
  • Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like.
  • PVP polyvinylpyrrollidone
  • the pharmaceutical composition (e.g., comprising a gene therapy agent described herein) is formulated as an immunoliposome, which comprises an IL-2 conjugate and/or a gene therapy agent or a plurality of IL-2 conjugates and/or a plurality of gene therapy agents bound either directly or indirectly to lipid bilayer of liposomes.
  • Exemplary lipids include, but are not limited to, fatty acids; phospholipids; sterols such as cholesterols; sphingolipids such as sphingomyelin; glycosphingolipids such as gangliosides, globocides, and cerebrosides; surfactant amines such as stearyl, oleyl, and linoleyl amines.
  • the lipid comprises a cationic lipid.
  • the lipid comprises a phospholipid.
  • Exemplary phospholipids include, but are not limited to, phosphatidic acid (“PA”), phosphatidylcholine (“PC”), phosphatidylglycerol (“PG”), phophatidylethanolamine (“PE”), phophatidylinositol (“PI”), and phosphatidyl serine (“PS”), sphingomyelin (including brain sphingomyelin), lecithin, lysolecithin, lysophosphatidylethanolamine, cerebrosides, diarachidoylphosphatidylcholine (“DAPC”), didecanoyl-L-alpha-phosphatidylcholine (“DDPC”), dielaidoylphosphatidylcholine (“DEPC”), dilauroylphosphatidylcholine (“DLPC”), dilinoleoylphosphatidylcholine, dimyristoylphosphatidylcholine (“DMPC”)
  • the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) further include pH adjusting agents or buffering agents which include acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids, bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tri s-hydroxymethylaminom ethane, and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases, and buffers are included in an amount required to maintain pH of the composition in an acceptable range.
  • acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids
  • bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tri s-hydroxymethylaminom ethane
  • buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride.
  • acids, bases, and buffers
  • the pharmaceutical formulation includes one or more salts in an amount required to bring osmolality of the composition into an acceptable range.
  • salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions
  • suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.
  • the pharmaceutical formulations include, but are not limited to, sugars like trehalose, sucrose, mannitol, maltose, glucose, or salts like potassium phosphate, sodium citrate, ammonium sulfate and/or other agents such as heparin to increase the solubility and in vivo stability of polypeptides.
  • the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) further include diluent that are used to stabilize compounds because they can provide a more stable environment.
  • diluents that are used to stabilize compounds because they can provide a more stable environment.
  • Salts dissolved in buffered solutions (which also can provide pH control or maintenance) are utilized as diluents in the art, including, but not limited to a phosphate buffered saline solution.
  • diluents increase bulk of the composition to facilitate compression or create sufficient bulk for homogenous blend for capsule filling.
  • Such compounds can include e.g., lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel®, dibasic calcium phosphate, dicalcium phosphate dihydrate, tricalcium phosphate, calcium phosphate, anhydrous lactose, spray-dried lactose, pregelatinized starch, compressible sugar, such as Di- Pac® (Amstar), mannitol, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose-based diluents, confectioner’s sugar, monobasic calcium sulfate monohydrate, calcium sulfate dihydrate, calcium lactate trihydrate, dextrates, hydrolyzed cereal solids, amylose, powdered cellulose, calcium carbonate, glycine, kaolin, mannitol, sodium chloride, inositol, bentonite, and the like.
  • Avicel® dibas
  • the IL-2 conjugates and/or gene therapy agents disclosed herein may be used in pharmaceutical formulations comprising histidine, sorbitol, and polysorbate 80, or any combination that affords a stable formulation and can be administered to subjects in need thereof.
  • the IL-2 conjugates disclosed herein may be presented as a finished drug product in a suitable container, such as a vial, as follows: IL-2 conjugate (about 2 mg to about 10 mg); L-histidine (about 0.5 mg to about 2 mg); L-histidine hydrochloride (about 1 mg to about 2 mg); sorbitol (about 20 mg to about 80 mg); and polysorbate 80 (about 0.1 mg to about 0.2 mg); with a sufficient quantity of water for injection to provide a liquid formulation suitable for use in the disclosed methods.
  • a suitable container such as a vial
  • the pharmaceutical formulations include disintegration agents or disintegrants to facilitate the breakup or disintegration of a substance.
  • disintegrate include both the dissolution and dispersion of the dosage form when contacted with gastrointestinal fluid.
  • disintegration agents include a starch, e.g., a natural starch such as corn starch or potato starch, a pregelatinized starch such as National 1551 or Amijel®, or sodium starch glycolate such as Promogel® or Explotab®, a cellulose such as a wood product, methylcrystalline cellulose, e.g., Avicel®, Avicel® PH101, Avicel® PH102, Avicel® PH105, Elcema® P100, Emcocel®, Vivacel®, Ming Tia®, and Solka-Floc®, methylcellulose, croscarmellose, or a cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose (Ac-Di-Sol®), cross-linked carboxymethylcellulose, or cross-linked croscarmellose, a cross-linked starch such as sodium starch glycolate, a cross-linked polymer such as crospovidone, a cross-linked polyvinylpyrrolidone,
  • the pharmaceutical formulations include filling agents such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.
  • Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein (e.g., comprising a gene therapy agent described herein) for preventing, reducing or inhibiting adhesion or friction of materials.
  • Exemplary lubricants include, e.g., stearic acid, calcium hydroxide, talc, sodium stearyl fumerate, a hydrocarbon such as mineral oil, or hydrogenated vegetable oil such as hydrogenated soybean oil (Sterotex®), higher fatty acids and their alkali-metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, glycerol, talc, waxes, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol (e.g., PEG-4000) or a methoxypolyethylene glycol such as CarbowaxTM, sodium oleate, sodium benzo
  • Plasticizers include compounds used to soften the microencapsulation material or film coatings to make them less brittle. Suitable plasticizers include, e.g., polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose and triacetin. Plasticizers can also function as dispersing agents or wetting agents.
  • Solubilizers include compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium docusate, vitamin E TPGS, dimethylacetamide, N- methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide and the like.
  • Stabilizers include compounds such as any antioxidation agents, buffers, acids, preservatives and the like.
  • Exemplary stabilizers include L-arginine hydrochloride, tromethamine, albumin (human), citric acid, benzyl alcohol, phenol, disodium biphosphate dehydrate, propylene glycol, metacresol or m-cresol, zinc acetate, polysorbate-20 or Tween® 20, or trometamol.
  • Suspending agents include compounds such as polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinyl pyrrolidone/vinyl acetate copolymer (S630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxy ethylcellulose, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as,
  • Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF), and the like.
  • compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF), and the like.
  • Pluronic® Pluronic®
  • Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils, e.g., polyoxyethylene (60) hydrogenated castor oil, and polyoxyethylene alkylethers and alkylphenyl ethers, e.g., octoxynol 10, octoxynol 40. Sometimes, surfactants is included to enhance physical stability or for other purposes.
  • Viscosity enhancing agents include, e.g., methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof.
  • Wetting agents include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium docusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts and the like.
  • the disclosure is directed to a pharmaceutical composition
  • a pharmaceutical composition comprising the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) as described herein.
  • the gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • the pharmaceutical compositions may be suitable for any mode of administration described herein or known in the art.
  • the pharmaceutical composition (e.g., comprising a gene therapy agent described herein) comprising a pharmaceutically acceptable excipient.
  • pharmaceutically acceptable excipients are relatively inert substances that facilitate administration of a pharmacologically effective substance and can be supplied as liquid solutions or suspensions, as emulsions, or as solid forms suitable for dissolution or suspension in liquid prior to use.
  • an excipient can give form or consistency, or act as a diluent.
  • Suitable excipients include but are not limited to stabilizing agents wetting and emulsifying agents salts for varying osmolarity encapsulating agents, pH buffering substances, and buffers.
  • excipients include any pharmaceutical agent suitable for direct delivery to the eye which may be administered without undue toxicity.
  • Pharmaceutically acceptable excipients include, but are not limited to, sorbitol, any of the various TWEEN compounds, and liquids such as water, saline, glycerol and ethanol.
  • Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • the pharmaceutical composition comprising a rAAV particle described herein and a pharmaceutically acceptable carrier is suitable for administration to human.
  • a pharmaceutically acceptable carrier are well known in the art (see, e.g., Remington’s Pharmaceutical Sciences, 15 th Edition, pp. 1035-1038 and 1570-1580).
  • Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like. Saline solutions and aqueous dextrose, polyethylene glycol (PEG) and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • the pharmaceutical composition e.g., comprising a gene therapy agent described herein
  • compositions described herein can be packaged in single unit dosages or in multidosage forms.
  • the compositions are generally formulated as sterile and substantially isotonic solution. Kits and Articles of Manufacture
  • the gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • AAV particle an AAV particle
  • adenovirus particle e.g., an adenovirus particle
  • a lentivirus particle e.g., a HSV particle
  • a lipid nanoparticle e.g., a kit or article of manufacture, e.g., designed for use in one of the methods of the disclosure as described herein.
  • kits or articles of manufacture further include instructions for administration of the gene therapy agent.
  • the kits or articles of manufacture described herein may further include other materials desirable from a commercial and user standpoint including other buffers diluents filters needles syringes and package inserts with instructions for performing any methods described herein.
  • Suitable packaging materials may also be included and may be any packaging materials known in the art, including, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and/or sealed.
  • kits or articles of manufacture further contain one or more of the buffers and/or pharmaceutically acceptable excipients described herein (e.g., as described in REMINGTON’ S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J.1991).
  • the kits or articles of manufacture include one or more pharmaceutically acceptable excipients, carriers, solutions, and/or additional ingredients described herein.
  • the kits or articles of manufacture described herein can be packaged in single unit dosages or in multidosage forms.
  • the contents of the kits or articles of manufacture are generally formulated as sterile and can be lyophilized or provided as a substantially isotonic solution.
  • the one or more gene therapy agents are administered 1 time, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times. In some embodiments, the gene therapy agent is administered 2 times. In some embodiments, the gene therapy agent is administered 1 time. In some embodiments, the gene therapy agent is administered 3 times.
  • the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered once per day, twice per day, three times per day or more frequently.
  • pharmaceutical composition e.g., comprising a gene therapy agent described herein
  • the pharmaceutical composition (e.g., comprising a gene therapy agent described herein) is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.
  • an effective amount of the pharmaceutical composition is administered to a subject in need thereof once per week, once every two weeks, once every three weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, once every 20 weeks, once every 21 weeks, once every 22 weeks, once every 23 weeks, once every 24 weeks, once every 25 weeks, once every 26 weeks, once every 27 weeks, or once every 28 weeks.
  • the pharmaceutical composition e.g., comprising one or more gene therapy agents described herein
  • an effective amount of the pharmaceutical composition is administered to a subject in need thereof once per week. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every two weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every three weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 4 weeks.
  • an effective amount of the pharmaceutical composition is administered to a subject in need thereof once every 5 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 6 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 7 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 8 weeks.
  • an effective amount of the pharmaceutical composition is administered to a subject in need thereof once every 9 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 10 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 11 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 12 weeks.
  • an effective amount of the pharmaceutical composition is administered to a subject in need thereof once every 13 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 14 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 15 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 16 weeks.
  • an effective amount of the pharmaceutical composition is administered to a subject in need thereof once every 17 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 18 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 19 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 20 weeks.
  • an effective amount of the pharmaceutical composition is administered to a subject in need thereof once every 21 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 22 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 23 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 24 weeks.
  • the pharmaceutical compositions described herein are administered for therapeutic applications. Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, can be reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained.
  • the amount of a given agent that correspond to such an amount varies depending upon factors such as the particular compound, the severity of the disease, the identity (e.g., weight) of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, and the subject or host being treated.
  • the desired dose is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.
  • toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50.
  • Compounds exhibiting high therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies are used in formulating a range of dosage for use in human.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage varies within this range depending upon the dosage form employed and the route of administration utilized.
  • the gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • the disease or disorder is a monogenic disease or disorder.
  • the disease or disorder is a neurodegenerative ocular disease. Because the eye is a relatively small and contained anatomical structure, AAVs can be delivered locally. Therefore, ophthalmic gene therapy can potentially avoid systemic immune responses and provide therapeutic benefit at low capsid doses, making ophthalmology an excellent candidate for the gene therapy approach.
  • the gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • the gene therapy agent is useful for treating a disorder of the CNS.
  • Non-limiting disorders of the CNS include stroke, Huntington’s disease, epilepsy, Parkinson’s disease, Lou Gehrig’s disease (also known as amyotrophic lateral sclerosis), Alzheimer’s disease, corticobasal degeneration or CBD, corticogasal ganglionic degeneration or CBGD, frontotemporal dementia or FTD, progressive supranuclear palsy or PSP, multiple system atrophy or MSA, cancer of the brain, and lysosomal storage diseases (LSD).
  • stroke Huntington’s disease, epilepsy, Parkinson’s disease, Lou Gehrig’s disease (also known as amyotrophic lateral sclerosis), Alzheimer’s disease, corticobasal degeneration or CBD, corticogasal ganglionic degeneration or CBGD, frontotemporal dementia or FTD, progressive supranuclear palsy or PSP, multiple system atrophy or MSA, cancer of the brain, and lysosomal storage diseases (LSD).
  • disorders of the disclosure that may be treated by a gene therapy in conjunction with an IL-2 conjugate include traumatic brain injury, enzymatic dysfunction disorders, psychiatric disorders (including post- traumatic stress syndrome), neurodegenerative diseases, and cognitive disorders (including dementias, autism, and depression), and enzymatic dysfunction disorders include without limitation leukodystrophies (including Canavan’s disease).
  • the gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • lysosomal storage disease are rare, inherited metabolic disorders characterized by defects in lysosomal function. Such disorders are often caused by a deficiency in an enzyme required for proper mucopolysaccharide, glycoprotein, and/or lipid metabolism, leading to a pathological accumulation of lysosomally stored cellular materials.
  • Non-limiting examples of lysosomal storage diseases of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure include Gaucher disease type 2 or type 3, GM1 gangliosidosis, Hunter disease, Krabbe disease, a mannosidosis disease, mannosidosis disease, metachromatic leukodystrophy disease, mucolipidosisII/III disease, Niemann-Pick A disease, Niemann-Pick C disease, Pompe disease, Sandhoff disease, Sanfilippo A disease, Sanfilippo B disease, Sanfilippo C disease, Sanfilippo D disease, Schindler disease, Sly disease, Tay-Sachs disease, and Wolman disease.
  • Gaucher disease type 2 or type 3 GM1 gangliosidosis, Hunter disease, Krabbe disease, a mannosidosis disease, mannosidosis disease, metachromatic leukodystrophy disease, mucolipidosisII/III disease, Niemann-Pick A disease, Niemann-Pick C disease, Pompe
  • the gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • hemophilia A hemophilia B
  • age related macular degeneration diabetic retinopathy, glaucoma
  • muscular dystrophy X-Linked Myotubular Myopathy
  • spinal muscular atrophy Leber’s congenital amaurosis, choroideremia, Leber hereditary optic neuropathy, ornithine transcarbamylase (OTC) deficiency, citrullinemia type 1, phenylketonuria (PKU), adrenoleukodystrophy, sickle cell disease, muscular dystrophy, or beta thalassemia.
  • the disclosure provides a composition for use in the manufacture of a medicament for delivering nucleic acid to a cell of an individual in need thereof, wherein the composition comprises a gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle), and wherein the composition is formulated for use in combination with an IL-2 conjugate.
  • a gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle
  • the disclosure provides a composition for use in the manufacture of a medicament for delivering nucleic acid to a cell of an individual in need thereof, wherein the composition comprises an IL-2 conjugate, and wherein the composition is formulated for use in combination with a gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle).
  • a gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle.
  • the disclosure provides a composition for use in the manufacture of a medicament for treating an individual in need of gene therapy, wherein the composition comprises a gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle).
  • a gene therapy agent e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle.
  • the subject is treated with an anti-inflammatory agent and/or an immunosuppressive agent before administration of the library.
  • the anti-inflammatory agent and/or immunosuppressive agent comprises an immunosuppressive steroid and/or an IgG-degrading enzyme.
  • the immunosuppressive steroid comprises prednisolone and/or the IgG-degrading enzyme comprises IdeS, optionally wherein the IdeS is Streptococcus IdeS.
  • kits for use in the methods as described herein include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein.
  • Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers are formed from a variety of materials such as glass or plastic.
  • kits comprise one or more of the gene therapy agents disclosed herein, and optionally one or more pharmaceutical excipients described herein to facilitate the delivery of one or more of the gene therapy agents.
  • kits further optionally include an identifying description or label or instructions relating to its use in the methods described herein.
  • a kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
  • a label is on or associated with the container.
  • a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself, a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
  • a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.
  • the pharmaceutical compositions are presented in a pack or dispenser device which contains one or more unit dosage forms containing a compound provided herein.
  • the pack for example, contains metal or plastic foil, such as a blister pack.
  • the pack or dispenser device is accompanied by instructions for administration.
  • the pack or dispenser is also accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, is the labeling approved by the U.S. Food and Drug Administration for drugs, or the approved product insert.
  • compositions containing a compound provided herein formulated in a compatible pharmaceutical carrier are also prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
  • scAAV eGFP ITR plasmid (sequence provided) was digested with BsrGI and Spel and gene fragment (GF 49) encoding KASH sequence and U6 promoter was inserted using NEBuilder HIFi DNA assembly (NEB, E2621L) to generate intermediate plasmid (pscAAV- minCBA-EGFP-KASH-U6).
  • the intermediate plasmid was digested with restriction enzymes Bcul and Smil and two fragments (5075 bp and 575 bp) were gel purified using QIAquick Gel Extraction Kit (QIAGEN # 28704).
  • OL 397 contains NWNWNWNWNWNWNWN (SEQ ID NO: 3) 15 bp Bulk seq barcode while OL 396 contains 10X genomics compatible barcode sequence pool followed by 10X compatible capture sequence gctttaaggccggtcctagcaa (SEQ ID NO: 1), as shown in Figure 2 (left)
  • the linearized plasmid backbone (5075 bp) and amplicon containing barcodes (767 bp) were assembled to generate a final transgene plasmid library using NEBuilder HIFi DNA assembly (NEB, E2621L). Individual sequence verified clones containing unique bulk seq and single nuclei barcode were used for AAV manufacturing.
  • CAP gene of various natural isolates to be tested were ordered as gene fragments from IDT.
  • AAV2 rep cap plasmid was digested with Swal-HF and Sphl-HF.
  • the linearized backbone and CAP gene fragments 24 natural isolates were assembled to generate AAV2 rep CAP NI (natural isolate). All the plasmids were sequence verified prior to use for AAV manufacturing.
  • AAVs were manufactured using triple transfection method.
  • HEK293T cells were plated at density of 2e7 cells per pl 50 plates.
  • Cells were transfected with sequence verified AAV2 rep CAP (natural isolate) plasmid (22.8 ug), transgene plasmid (5.7 ug) with unique barcodes and Ad helper plasmid (11.4 ug).
  • 20 pl 50 plates were used for each AAV serotype.
  • Virus was purified from the media and the cell pellet. Media was collected at 90 hours and 120 hours post transfection and 8 ml of 40% Poly Ethylene Glycol (PEG 8000 Sigma Aldrich 89510-1KG-F) was added to 40 ml of media incubated for 2 hours at 4C.
  • AAV lysis buffer 150mM NaCl, 50mM Tris pH 8.4.
  • the cells were harvested at 120 h post transfection and lysed in 14 ml of AAV lysis buffer followed by two cycles of freeze-thaw.
  • the lysate from the cells and media was combined for an additional cycle of freeze-thaw and incubated at 37C for 30 min after addition of 5.6 ul of benzonaze (Millipore Sigma E8263-25KU).
  • the gradient was centrifuged at 70,000 rpm for 70 mins in a Beckman Ultracentrifuge. 3 ml of virus was taken from the 40-60 interface and 30 ml of IX PBS 0.005% pluronic acid was added. The virus was concentrated using Amicon Ultra-4 centrifugal filters-lOOK (Millipore Sigma UFC810024).
  • T-BGH-F 5'-TCTAGTTGCCAGCCATCTGTTGT-3' (SEQ ID NO: 4)
  • T-BGH-R 5'-TGGGAGTGGCACCTTCCA-3' (SEQ ID NO: 5)
  • T-BGH-PB 5'-/56-FAM/TCCCCCGTGCCTTCCTTGACC/36-TAMNph/-3' (SEQ ID NO: 6)
  • /56-FAM/ and /36-TAMNph/ represent 5' and 3’ fluorophore oligonucleotide labels, respectively.
  • HEK293T cells were plated in a 6 well plate (5E5 cells/well) and infected with a pool of AAV1, AAV2 and AAV6 at MOI of le3 or le4 for 72h.
  • Corresponding transgene plasmid pool (lug) was transfected using lipofectamine 3000 and used as a positive control.
  • HEK293T cells were detached by 0.05%Trypsin, washed and counted by CellacaMX.
  • Single cell capture, barcoding, post GEM cDNA amplification and libraries constructions were performed using Chromium Single Cell 3 'Reagent Kits v3.1 with Feature Barcode technology for CRISPR Screening (10X Genomics, CG000316) and associated 10X Genomics protocols.
  • the fastq files were processed with similar workflow as described for the NHP samples (below), except cellranger multi was used on a custom-made human genome based on the GRCh38 assembly with GenCode v 42 annotation, and two sets of 24 AAV barcode sequences corresponding to either polyA 3’ bulk barcodes, or U6 single nuclei (sn) barcodes.
  • Seurat package was used to process the data; barcodes with more than 750 UMI/cell and 250 genes/cell and less than 15% mitochondrial expression were kept for the downstream analysis.
  • NHP tissues were transferred into 2.8 mm bead tubes (Fisher #15-340-154) and homogenized at 5.65 m/s for two cycles for 20 seconds using Omni tissue homogenizer (Fisherbrand bead mill 24 homogenizer #15-340-163).
  • Nucleic acids DNA and RNA
  • Qiagen all prep kit # 80204. Concentration of nucleic acid were measure using Quibit and RNA integrity measured using Agilent tapestation.
  • cDNA was synthesized using Superscript VILO cDNA synthesis kit followed by PCR of region with barcodes using Q5 polymerase NEB. Unique indices (New England Biolabs) were attached via PCR amplification. Samples were pooled, cleaned with Ampure XP beads (Beckman Coulter), quantified using Qubit, and paired end sequencing was performed using 160 NextSeq Pl 300 cycle reagent kit (Illumina, 20050264).
  • Ocular Dosing in non-human primates Four cynomolgus macaques (Macaca fascicularis) were dosed either intravitreally or intracamerally as shown in the table (Table 1). Two cynomolgus macaques were given bilateral intravitreal injections of 2el 1 vg/eye in 60pl. All animals received prednisolone (1 mg/kg) daily beginning 7 days prior to AAV dosing until the day of necropsy. All animals also received an intravenous dose of IgG- degrading enzyme of Streptococcus (IdeS) at 0.5 mg/kg 3 days prior to AAV administration. Group 1 animals received bilateral intravitreal injections, and Group 2 received bilateral intracam eral injections of AAV according to the table below.
  • IdeS IgG- degrading enzyme of Streptococcus
  • Intravitreal and intracameral injections Group 1 animals received a bilateral intravitreal dose of the AAV capsid library. Anesthetized animals received 2-5 drops of proparacaine (0.5%) to anesthetize both eyes. After approximately 2 minutes, 1-2 drops of Betadine® (5%) were added to the eyes and left for approximately 5 minutes. After 5 minutes, excess was rinsed with saline. The eye was held open with a speculum. For intravitreal administration, a syringe with 29-31G needle was used to inject into the eye at a 45-degree angle pointed towards the optic nerve (being careful not to hit the lens).
  • the needle was advanced 1-2 mm anterior to the limbus and parallel to the iris, then the needle was carefully inserted into the cornea with the bevel facing up. The needle was carefully withdrawn after the test material was delivered and monitored for efflux. Antibiotic ointment or drops were applied immediately post injection.
  • the resulting count matrices were processed using the standard Seurat version 5.0.1 workflow, with an additional step that included doublet removal. Barcodes with fewer than 1000 UMIs/cell and 150 genes/cell were removed. Scrublet version 0.2.3 was run to remove doublets (cutoff scrublet score 0.4).
  • ADT antibody-derived tag
  • Table 2 List of marker genes for identification of cell types in NHP retina
  • Example 2 Design and validation of a method for detection of AAV transduction at single nuclei resolution
  • Single nucleic atlas of capsid distribution was developed for screening of AAV capsid libraries at single-cell resolution (FIG. IB).
  • SNAC single nucleic atlas of capsid distribution
  • a custom transgene plasmid was developed containing both a bulk sequencing barcode and a single-nuclei (sn) sequencing barcode (FIG. 1 A).
  • this plasmid contains a CMV promoter driven EGFP transgene with a bulk sequencing barcode in its 3'UTR.
  • the plasmid also contains a U6 promoter which drives the expression of a capsid-specific single nuclei (sn) sequencing barcode and a lOx genomics compatible capture sequence. This allows us to isolate two RNA fractions, the polyA mRNA and the U6-driven fraction.
  • sn single nuclei
  • FIG. IB For screening (FIG. IB), a library was constructed by individually packaging uniquely barcoded AAVs with different cap genes (FIG. 3) and creating a pool of these AAVs using equal vector genome copy numbers. This pool was injected into animals, samples were collected, and a single nuclei suspension was created from which one may isolate two fractions, the polyA mRNA and, using the lOx capture sequence, the U6 driven fraction. The polyA mRNA fraction can determine cell identity based on the expression of known marker genes (Table 2), while the U6-driven sn barcode is used to identify cell type specific capsid enrichment. The result was a cell-type specific transduction profile for each AAV in the library.
  • Example 3 Generation of cell-type specific transduction profiles from pooled AAVs in vivo
  • FIG. 3 a barcoded AAV library of 24 natural AAV isolates was constructed (FIG. 3).
  • the library was designed to contain a broad range of capsids spanning all the common AAV clades. Individual packaging of these isolates resulted in a range of titers of 1.89xl0 9 - 3.8xl0 12 (FIG. 3), with no observable phylogenetic pattern.
  • these natural isolates were pooled in equal proportions and administered the pool into NHP retinas by intravitreal injection. Thirty-one days post dosing, animals were euthanized, eyes were collected, and the peripheral retina and macula were dissected.
  • the polyA and U6-driven RNA fractions were isolated and prepared for sequencing.
  • cell types were assigned based on a data-derived set of marker genes (Table 2) using a custom analysis pipeline.
  • the pipeline identified all seven major cell types in the NHP retina (rods, cones, Muller glia, horizontal cells, amacrine cells, bipolar cells and RGCs), plus endothelial cells, pericytes, astrocytes and microglia as expected (FIG. 4).
  • Cell type distribution varied by anatomical region with enrichment for RGCs in the central macula and photoreceptors in peripheral samples (FIG. 5).
  • Cell type proportions in the macula and peripheral retina show regional differences consistent with regional anatomy (FIG. 10). Furthermore, the cell type proportions agreed with previously reported cell fractions for the NHP retina (Pearson correlation of 0.7; FIG. 5 and FIG. 6), validating this approach to cell type assignment.
  • the U6-driven fraction was used to generate cell-type specific transduction profiles for each AAV in the library.
  • sn barcodes were quantified and normalized to sequencing depth.
  • AAV2, AAV6 and AAV1 achieved the highest transduction overall.
  • the percentage of nuclei is reported in which at least 1 count of a capsid barcode is detected (FIG. 7).
  • AAV2 transduction was highest in RGCs, followed by Muller glia, endothelial cells, and neuronal cells including amacrine, bipolar and horizontal cells.
  • AAV1 transduced microglia while AAV6 transduced primarily RGCs (Han et al., Hum Gene Ther 2020). Analysis of average cell-type specific expression showed that AAV2 expression was highest in RGCs, then Muller glia, amacrine cells, and endothelial cells (FIG. 7).
  • AAV 2 was again the top ranked capsid in both iris and ciliary body, comprising approximately half of the normalized reads in iris, and about one quarter in ciliary body.
  • AAV1 and AAV2 were also ranked highly in both samples; however, bulk RNAseq detected low levels of numerous other serotypes in ciliary body and iris. To directly compare bulk and snRNAseq, the average normalized read counts from iris and ciliary body from bulk and single nuclei sequencing was compared.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

This disclosure provides methods of profiling gene therapy agents, comprising administering a library comprising one or more gene therapy agents to a non-human subject or an ex vivo or in vitro cell population, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence.

Description

PROFILING OF GENE THERAPY AGENTS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Application No. 63/644,233, filed May 8, 2024, the entire contents of which are incorporated by reference herein for all purposes.
SEQUENCE LISING
[0002] This present application contains a Sequence Listing which has been submitted electronically in XML format. Said XML copy, created on May 2, 2025, is named “01183- 0333-00PCT.xml” and is 6,543 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
FIELD OF THE DISCLOSURE
[0003] This disclosure provides a method of profiling gene therapy agents, comprising administering one or more gene therapy agents (e.g., a library) to a non-human subject or an ex vivo or in vitro cell population, wherein the one or more gene therapy agents comprise an identifying sequence operably linked to an RNA polymerase III promoter and/or a capture sequence.
INTRODUCTION AND SUMMARY
[0004] One of the major challenges of gene therapy is providing gene therapy agents that can safely target specific tissues and cell types of interest. This is important to expand the scope of treatable disease and overcome challenges related to toxicity and cost, which can be significant impediments to successful gene therapies.
[0005] Several studies have demonstrated screening of libraries of gene therapy agents generated either from natural viral serotypes or different capsid engineering methods with a primary goal of testing multiple vectors in a single animal to identify vectors with enhanced tropism in cell types of interest. However, tropism readout of these libraries can be limited at the level of tissue and lack cell type resolution. The field currently tends to rely on labor intensive and time-consuming single vector administration for detailed cell type performance of gene therapy agents. Identifying gene therapy agents with cell-type specific tropism could reduce off-target effects, reduce cost and increase the number of diseases amenable to gene therapies. This could also improve the safety of gene therapies and contribute to understanding of cellular uptake mechanisms for novel AAVs. It can also target specific cell types in complex tissues, such as those in the eye and nervous system. For example, the eye is easily accessible via local administration which reduces potential complications associated with gene therapies and requires only small quantities of the drug. However, ocular gene therapy also presents some challenges. While subretinal injection of most AAVs results in efficient transduction of retinal pigment epithelial cells (RPEs) there is considerable variation in their ability to transduce photoreceptors. Furthermore, subretinal administration, while efficient, involves a transient local macular detachment and its associated risks. Intravitreal delivery is less invasive and more widely performed, but the presence of the inner limiting membrane can limit transduction of cells in the outer retina. Ocular diseases are heterogeneous and affect specific cell types, as are diseases affecting other organs. Therefore, understanding the cell type specificity of AAV transduction is of great interest. As such, a method to effectively profile gene therapy agents at single nuclei or single cell resolution is needed.
[0006] The following embodiments are encompassed.
[0007] Embodiment 1 : A method of profiling gene therapy agents, comprising: administering one or more gene therapy agents to a non-human subject, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the subject are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells, thereby profiling the gene therapy agents.
[0008] Embodiment 2: The method of the immediately preceding embodiment, wherein the subject is a non-human mammal.
[0009] Embodiment 3: The method of the immediately preceding embodiment, wherein the subject is a non-human primate. [0010] Embodiment 4: The method of the immediately preceding embodiment, wherein the subject is a monkey.
[0011] Embodiment 5: The method of any one of the preceding embodiments, wherein the subject is treated with an anti-inflammatory agent and/or an immunosuppressive agent before administration of the one or more gene therapy agents.
[0012] Embodiment 6: The method of the immediately preceding embodiment, wherein the anti-inflammatory agent and/or immunosuppressive agent comprises an immunosuppressive steroid and/or an IgG-degrading enzyme.
[0013] Embodiment 7: The method of the immediately preceding embodiment, wherein the immunosuppressive steroid comprises prednisolone and/or the IgG-degrading enzyme comprises IdeS, optionally wherein the IdeS is Streptococcus IdeS.
[0014] Embodiment 8: The method of any one of the preceding embodiments, further comprising isolating a sample from the subject comprising a plurality of transduced nuclei or transduced cells.
[0015] Embodiment 9: A method of profiling gene therapy agents, comprising: contacting an ex vivo or in vitro cell population with one or more gene therapy agents, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the cell population are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells, thereby profiling the gene therapy agents.
[0016] Embodiment 10: The method of the immediately preceding embodiment, wherein the cell population comprises mammalian cells.
[0017] Embodiment 11 : The method of the immediately preceding embodiment, wherein the cell population comprises primate cells. [0018] Embodiment 12: The method of the immediately preceding embodiment, wherein the cell population comprises non-human primate cells.
[0019] Embodiment 13: The method of the immediately preceding embodiment, wherein the cell population comprises monkey cells.
[0020] Embodiment 14: The method of embodiment 10 or 11, wherein the cell population comprises human cells.
[0021] Embodiment 15: The method of any one of the preceding embodiments, further comprising isolating a sample from cell population comprising a plurality of transduced nuclei or transduced cells.
[0022] Embodiment 16: The method of any one of the preceding embodiments, wherein the one or more gene therapy agents comprise a library comprising at least two distinct subpopulations of gene therapy agents.
[0023] Embodiment 17: The method of the immediately preceding embodiment, wherein each agent in the library comprises a distinct identifying sequence.
[0024] Embodiment 18: The method of the immediately preceding embodiment, wherein each distinct identifying sequence is a barcode.
[0025] Embodiment 19: The method of any one of embodiments 16-18, wherein the library comprises at least three distinct subpopulations of gene therapy agents.
[0026] Embodiment 20: The method of the immediately preceding embodiment, wherein the library comprises at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 30 distinct subpopulations of gene therapy agents.
[0027] Embodiment 21 : The method of any one of the preceding embodiments, wherein the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced nuclei; performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei.
[0028] Embodiment 22: The method of any one of the preceding embodiments, wherein the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced cells; performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells.
[0029] Embodiment 23 : The method of any one of the preceding embodiments, wherein the capture sequence is operably linked to the identifying sequence.
[0030] Embodiment 24: The method of any one of the preceding embodiments, wherein the identifying sequence comprises a barcode.
[0031] Embodiment 25: The method of any one of the preceding embodiments, wherein both mRNA and RNA comprising the capture sequence are captured.
[0032] Embodiment 26: The method of any one of the preceding embodiments, wherein the capture sequence comprises a unique sequence that is not present in endogenous RNA of the cell population or subject.
[0033] Embodiment 27: The method of any one of the preceding embodiments, wherein the capture sequence comprises SEQ ID NO: 1 (gctttaaggccggtcctagcaa).
[0034] Embodiment 28: The method of any one of embodiments 1-26, wherein the capture sequence comprises an aptamer sequence.
[0035] Embodiment 29: The method of the immediately preceding embodiment, wherein RNA comprising the capture sequence is captured using a bead coated with a target specifically bound by the aptamer sequence.
[0036] Embodiment 30: The method of any one of embodiments 1-26, wherein the capture sequence comprises a recognition sequence.
[0037] Embodiment 31 : The method of the immediately preceding embodiment, wherein RNA comprising the capture sequence is captured using a sequence-specific binding protein that specifically binds the recognition sequence.
[0038] Embodiment 32: The method of any one of the preceding embodiments, wherein the identifying sequences are operably linked to a promoter.
[0039] Embodiment 33: The method of any one of the preceding embodiments, wherein the capture sequence is operably linked to a promoter.
[0040] Embodiment 34: The method of any one of the two immediately preceding embodiments, wherein the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
[0041] Embodiment 35: The method of the immediately preceding embodiment, wherein the promoter comprises a RNAP I promoter, RNAP II promoter, or RNAP III promoter.
[0042] Embodiment 36: The method of the immediately preceding embodiment, wherein the promoter comprises a RNAP III promoter. [0043] Embodiment 37: The method of the immediately preceding embodiment, wherein the RNAP III promoter comprises a U6, 7SK, Hl, or small tRNA promoter.
[0044] Embodiment 38: The method of any one of the preceding embodiments, wherein the transduced cells are identified based on expression of a plurality of markers.
[0045] Embodiment 39: The method of the immediately preceding embodiment, wherein the plurality of markers comprise one or more of: AGLN3, ALBI, APOE, ARR3, ATP1B1, B2M, BCC3, BRN3A, CABP5, CALB1, CD14, CD164, CD37, CD44, CD74, CHAT, CHX10, CLDN5, CLU, CNGA1, CNGB1, COL4A1, CRABP1, CRYM, CTSB, CTSS, DKK3, DST, EPHB6, FCER1G, FXYD5, GABRD, GAD1, GAD2, GAP43, GFAP, GLUL, GNAT1, GNAT2, GNB1, GNGT1, GNGT2, GPR37, GRIK1, GRIN2A, GRM6, GUCA1A, GUCA1C, GYPC, HES1, HEXB, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRA, HLA- DRA, IBA1, IGFBP7, ISL1, ITRPM1, KCNJ12, KCNJ8, LAPTMS, LHX1, MFGEB, MGP, MYL9, NCAM1, NDRG1, NDRG4, NDRG4, NEFL, NEFM, NET01, NGFR, NR2E3, NRL, NTNAP2, ONECUT1, ONECUT2, OPN1LW, 0PN1MW, OPN1SW, OTX2, P2RY12, PAX6, PDC, PDE6A, PDE6B, PDE6C, PDE6H, POU4F1, POU4F2, POU4F3, PRKCA, PRPH2, PTN, PTPRF, QP4, RBPMS, RCVRN, RGC5, RGR, RHO, RLBP1, R0M1, RTN1, SAG, SEPT4, SEPT7, SERPINA5, SLC17A6, SLC1A3, SLC23A2, SLC24A1, SLC4A4, SLC5A7, SLC6A1, SLC6A9, SNCG, TFAP2A, TFAP2B, TFAP2C, THY1, TMEM119, TPM3, TTR, TUBB3, TYROBP, UCHL1, VSX1, VSX2, and YWHAH.
[0046] Embodiment 40: The method of any one of the preceding embodiments, wherein the single nuclei sequencing comprises isolating RNA from the transduced cells or nuclei.
[0047] Embodiment 41: The method of the immediately preceding embodiment, wherein the single nuclei sequencing further comprises subjecting the RNA to reverse transcription to obtain cDNA.
[0048] Embodiment 42: The method of the immediately preceding embodiment, wherein about 1 attogram of RNA is subjected to reverse transcription.
[0049] Embodiment 43: The method of any one of embodiments 40-42, further comprising tagging the RNA.
[0050] Embodiment 44: The method of the immediately preceding embodiment, wherein the RNA is tagged.
[0051] Embodiment 45: The method of the immediately preceding embodiment, wherein the RNA is tagged with a plurality of barcodes or UMIs.
[0052] Embodiment 46: The method of the immediately preceding embodiment, wherein the plurality of barcodes or UMIs corresponds to individual cells or nucleic. [0053] Embodiment 47: The method of any one of embodiments 41-46, further comprising pooling cDNA from different cells or nuclei prior to sequencing.
[0054] Embodiment 48: The method of any one of the preceding embodiments, wherein the transduced cells comprise eye cells, kidney cells, brain cells, or muscle cells.
[0055] Embodiment 49: The method of the immediately preceding embodiment, wherein the transduced cells comprise eye cells.
[0056] Embodiment 50: The method of the immediately preceding embodiment, wherein the eye cells comprise retinal cells.
[0057] Embodiment 51 : The method of the immediately preceding embodiment, wherein the retinal cells comprise amacrine cells, astrocytes, bipolar cells, cone cells, endothelial cells, horizontal cells, microglia, Muller cells, pericytes, Retinal ganglion cells (RGCs), and/or rod cells.
[0058] Embodiment 52: The method of any one of the preceding embodiments, wherein the one or more gene therapy agents comprises a viral vector.
[0059] Embodiment 53: The method of the immediately preceding embodiment, wherein the viral vector is an adeno-associated viral (AAV) particle.
[0060] Embodiment 54: The method of the immediately preceding embodiment, wherein the AAV particle comprises an AAV1 capsid, an AAV2 capsid, an AAV3 capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid, an AAV7 capsid, an AAV8 capsid, an AAVrh8 capsid, an AAV9 capsid, an AAV 10 capsid, an AAVrhlO capsid, an AAV11 capsid, an AAV12 capsid, an AAVrh32.33 capsid, an AAV-XL32 capsid, an AAV-XL32.1 capsid, an AAV LK03 capsid, an AAV2R471 A capsid, an AAV2/2-7m8 capsid, an AAV DJ capsid, an AAV DJ8 capsid, an AAV2 N587A capsid, an AAV2 E548A capsid, an AAV2 N708A capsid, an AAV V708K capsid, a goat AAV capsid, an AAV1/AAV2 chimeric capsid, a bovine AAV capsid, a mouse AAV capsid rAAV2/HBoVl (chimeric AAV / human bocavirus virus 1), an AAV2HBKO capsid, an AAVPHP.B capsid or an AAVPHP.eB capsid, or a functional variant thereof.
[0061] Embodiment 55: The method of the immediately preceding embodiment, wherein the AAV capsid comprises a tyrosine mutation, a heparin binding mutation, or an HBKO mutation.
[0062] Embodiment 56: The method of any one of embodiments 53-55, wherein the AAV viral particle comprises an AAV genome comprising one or more inverted terminal repeats (ITRs), wherein the one or more ITRs is an AAV1 ITR, an AAV2 ITR, an AAV3 ITR, an AAV4 ITR, an AAV5 ITR, an AAV6 ITR, an AAV7 ITR, an AAV8 ITR, an AAVrh8 ITR, an AAV9 ITR, an AAV10 ITR, an AAVrhlO ITR, an AAV11 ITR, or an AAV12 ITR.
[0063] Embodiment 57: The method of the immediately preceding embodiment, wherein the one or more ITRs and the capsid of the AAV particle are derived from the same AAV serotype.
[0064] Embodiment 58: The method of the immediately preceding embodiment, wherein the one or more ITRs and the capsid of the AAV particles are derived from different AAV serotypes.
[0065] Embodiment 59: The method of embodiment 52, wherein the viral vector is an adenoviral particle.
[0066] Embodiment 60: The method of the immediately preceding embodiment, wherein the adenoviral particle comprises a capsid from Adenovirus serotype 2, 1, 5, 6, 19, 3, 11, 7, 14, 16, 21, 12, 18, 31, 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24-30, 37, 40, 41, AdHu2, AdHu 3, AdHu4, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6, AdC7, AdC69, bovine Ad type 3, canine Ad type 2, ovine Ad, or porcine Ad type 3, or a functional variant thereof.
[0067] Embodiment 61 : The method of embodiment 52, wherein the viral vector is a lentiviral particle.
[0068] Embodiment 62: The method of the immediately preceding embodiment, wherein the lentiviral particle is pseudotyped with vesicular stomatitis virus (VSV), lymphocytic choriomeningitis virus (LCMV), Ross river virus (RRV), Ebola virus, Marburg virus, Mokala virus, Rabies virus, RD114, or a functional variant thereof.
[0069] Embodiment 63: The method of embodiment 52, wherein the viral vector is a Herpes simplex virus (HSV) particle.
[0070] Embodiment 64: The method of the immediately preceding embodiment, wherein the HSV particle is an HSV-1 particle or an HSV-2 particle, or a functional variant thereof.
[0071] Embodiment 65: The method of any one of embodiments 1-51, wherein at least one of the one or more gene therapy agents comprises a lipid nanoparticle.
[0072] Embodiment 66: The method of the immediately preceding embodiment, wherein the lipid nanoparticle comprises an expression cassette encoding an RNA comprising a capture sequence and an identifying sequence.
[0073] Embodiment 67: The method of the immediately preceding embodiment, wherein the expression cassette encoding an RNA comprising a capture sequence and an identifying sequence is operably linked to an RNAP III promoter. [0074] Embodiment 68: The method of any one of the two immediately preceding embodiments, wherein the lipid nanoparticles comprises multiple expression cassettes. [0075] Embodiment 69: The method of any one of the preceding embodiments, wherein the one or more gene therapy agents each comprise a nucleic acid encoding a heterologous transgene.
[0076] Embodiment 70: The method of the immediately preceding embodiment, wherein the heterologous transgene is operably linked to a promoter.
[0077] Embodiment 71 : The method of the immediately preceding embodiment, wherein the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter. [0078] Embodiment 72: The method of any one of embodiments 69-71, wherein the heterologous transgene encodes a marker protein.
[0079] Embodiment 73: The method of the immediately preceding embodiment, wherein the marker protein is a fluorescent protein, optionally wherein the fluorescent protein is a GFP, YFP, RFP, BFP, CFP, or VFP.
[0080] Embodiment 74: The method of any one of embodiments 79-71, wherein the heterologous transgene encodes a gene therapy product, vaccine antigen, or microRNA. [0081] Embodiment 75: The method of any one of embodiments 79-74, wherein the nucleic acid comprises closed-end DNA (ceDNA).
[0082] Embodiment 76: The method of any one of embodiments 79 or 72-74, wherein the nucleic acid comprises mRNA.
[0083] Embodiment 77: The method of any one of the preceding embodiments, wherein the one or more gene therapy agents is administered locally.
[0084] Embodiment 78: The method of the immediately preceding embodiment, wherein the one or more gene therapy agent are administered intravitreally, intracamerally, retinally, intrathecally, intramuscularly, intrarenally, intramuscularly, intracranially, intra-CSF, intra- DRG, intracerebroventricularly, intraocularly, intracisterna magna, intrahepatically, intravitreally, or intracamerally.
[0085] Embodiment 79: The method of the immediately preceding embodiment, wherein the one or more gene therapy agents are administered bilaterally or unilaterally.
[0086] Embodiment 80: The method of any one of the preceding embodiments, wherein the one or more gene therapy agents are administered systemically.
[0087] Embodiment 81 : The method of the immediately preceding embodiment, wherein the one or more gene therapy agent are administered intravenously, intraperitoneally, intraarterially, or subcutaneously. BRIEF DESCRIPTION OF THE DRAWINGS
[0088] FIG. 1A provides schematics of exemplary custom plasmids for both AAV packaging and transgene expression. Figure IB provides an exemplary workflow for SNAC (Single Nuclei Atlas of Capsid Distribution) methodology, to screen and select AAV capsids, e.g., targeting specific cell type populations in NHP retinas.
[0089] FIG. 2A provides a schematic illustration of an exemplary transgene plasmid with the comprising a U6 promoter (“U6”) expressing a unique barcode (“BC2”) and a 10X genomics platform based capture sequence (“10X capture seq”). FIG. 2B illustrates barcode detection, with each dot representing a detected nucleus. Each dot is shaded according to the abundance of the read counts of an AAV capsid (AAV1, AAV2, or AAV6 as indicated) detected in that nuclei’s transcriptome either by single nuclei sequencing (FIG. 2B, bottom row) or by polyA 3’ barcode sequencing (FIG. 2B, top row).
[0090] FIG. 3 shows results from a library of AAV Natural Isolates. 24 AAV natural isolates were individually prepared. The bar graph on the right represents total vector genomes (vg)/prep.
[0091] FIG. 4 provides a plot of t-distributed stochastic neighbor embedding parameters (tSNE l and tSNE_2) for the major cell types in NHP retina (macula and periphery) identified with 10X chromium single nuclei sequencing. Data are from 55,974 nuclei sequenced from 7 NHP samples (4 central/macula, 3 peripheral).
[0092] FIG. 5 provides a bar graph showing that the relative abundance per sample of the cells identified in FIG. 4 is concordant with sample anatomy (peripheral vs central/macula). [0093] FIG. 6 provides a plot showing the proportions per sample of the cells identified in FIG. 4 via SNAC sample annotation/processing generally agree with previously reported studies of NHP retina (Pearson: 0.7).
[0094] FIG. 7 provides quantification of expression of the top three capsids of an AAV natural isolate library in individual cell types in NHP retina using the SNAC workflow. Expression is quantified as % of cell type with at least 1 read count of a SN capsid barcode detected.
[0095] FIG. 8A and 8B provide pie graphs quantifying the ranked capsids abundance in indicated ocular tissues (Ciliary Body OS, Ciliary Body OD and Iris (FIG. 8A) and Ciliary Body and Iris (FIG. 8B)) analyzed by sequencing barcodes at bulk tissue resolution. [0096] FIG. 9 provides bar graphs showing percentages of cells with detected BC1 (polymRNA fraction) or BC2 (U6 RNA fraction) barcodes across three treatments: negative control, lower dose (le3), higher dose of the AAV1, AAV2, AAV6 viral pool 354 (le4). HEK293 cells infected with a pool of AAV1, AAV2 and AAV6 at MOI le3 showed higher number of read counts in the BC2 fraction for transduced cells. Two-tailed 356 unpaired test was performed. *: p<0.05.
[0097] FIG. 10 provides a graph showing cell type proportions in the macula and peripheral retina. Relative abundance by sample is shown.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0098] This description and exemplary embodiments should not be taken as limiting. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about,” to the extent they are not already so modified. “About” indicates a degree of variation that does not substantially affect the properties of the described subject matter, e.g., within 10%, 5%, 2%, or 1%. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0099] Reference will now be made in detail to certain embodiments of the invention. While the invention will be described in conjunction with such embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims.
[0100] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, reference to “a nucleic acid” includes a plurality of nucleic acids, reference to “a cell” includes a plurality of cells, and the like. [0101] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.
[0102] Unless specifically noted in the above specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of’ or “consisting essentially of’ the recited components; embodiments in the specification that recite “consisting of’ various components are also contemplated as “comprising” or “consisting essentially of’ the recited components; and embodiments in the specification that recite “consisting essentially of’ various components are also contemplated as “consisting of’ or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims).
[0103] The section headings used herein are for organizational purposes and are not to be construed as limiting the disclosed subject matter in any way. In the event that any document or other material incorporated by reference contradicts any explicit content of this specification, including definitions, this specification controls.
I. Definitions
[0104] As used herein, “profiling” a gene therapy agent refers to obtaining information about one or more properties of the gene therapy agent, such its tropism in one or more cell or tissue types or its biodistribution. An “expression profile” comprises a set of values representing the expression levels for a plurality of gene products, e.g., from one or more gene therapy agents and/or cells or nuclei.
[0105] As used herein, “isolated” refers to a biological component (such as a nucleic acid molecule, protein, or cell) that has been substantially separated, produced apart from, or purified away from other components (for example, other components in a sample, cell, or organism in which the component naturally occurs). Nucleic acid molecules, proteins, or cells that have been “isolated” include those purified using standard purification methods. The term “isolated” or “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated biological component is one in which the biological component is more enriched in a preparation than the biological component is in its natural environment within a cell, organism, sample, or production vessel (for example, a cell culture system). For example, an isolated biological component can represent at least 50%, such as at least 70%, at least 80%, at least 90%, at least 95%, or greater, of the total biological component content of the preparation.
[0106] As used herein, “subject” refers to an animal, such as a member of a mammalian species (e.g., human) or avian (e.g., bird) species, or other organism, such as a plant. More specifically, a subject can be a vertebrate, e.g., a mammal such as a mouse, a primate, a simian or a human. Animals include farm animals (e.g., production cattle, dairy cattle, poultry, horses, pigs, and the like), sport animals, and companion animals (e.g., pets or support animals). A subject can be a healthy individual, an individual that has or is suspected of having a disease or a predisposition to the disease, or an individual in need of therapy or suspected of needing therapy. The terms “individual” or “patient” are intended to be interchangeable with “subject”. For example, the subject can be an individual who is in need of gene therapy, e.g., due to having a disease such as an autoimmune disease or a developmental, neurological, or other genetic disorder. As another example, the subject can be a female individual who is pregnant or who is planning on becoming pregnant, who may have been diagnosed of or suspected of having a disease, e.g., a cancer, an auto-immune disease.
[0107] As used herein, the terms “operably linked” and “in functional connection with” with respect to a regulatory sequence (e.g., a promoter, enhancer or other transcriptional regulatory sequence) and another sequence element, means that expression of the sequence element is regulated, or controlled by, the promoter, enhancer or other transcriptional regulatory sequence. The terms “operably linked” and “in functional connection with” with respect to sequence elements that are not promoters, enhancers or other transcriptional regulatory sequences means that expression of the sequence elements are linked such that they are included in the same transcript upon transcription. Examples of sequence elements that are not promoters, enhancers or other transcriptional regulatory sequences include ORFs, identifying sequences such as barcodes, and capture sequences. The terms “operably linked” and “in functional connection with” are utilized interchangeably herein with respect to promoters and other sequence elements.
[0108] As used herein, the term “gene therapy agent” refers to a nucleic acid (e.g., expression construct, miRNA, antisense, shRNA, siRNA, mRNA) or a nucleic acid in combination with an agent used to deliver the nucleic acid to an individual or a cell to modify or manipulate the expression of one or more nucleic acids (e.g., gene, mRNA) in an individual or a cell to alter the biological propertied of living cells. Examples of gene therapy agents include, but are not limited to, viral vectors (e.g., adeno-associated virus, adenovirus, lentivirus, Herpes simples virus, baculovirus), bacterial vectors, and non-viral vectors (e.g., lipid nanoparticles encapsulating a therapeutic nucleic acid or plasmid DNAs (e.g., close ended DNA) comprising a therapeutic nucleic acid and/or encoding a therapeutic polypeptide).
[0109] As used herein, a “vector” refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo.
[0110] The term “polynucleotide” or “nucleic acid” as used herein refers to a polymeric form of nucleotides of any length, comprising ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of the nucleic acid can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the nucleic acid can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P- NH2) or a mixed phosphoramidate- phosphodiester oligomer. In addition, a double-stranded nucleic acid can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
[OHl] The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include post-translational modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present invention, a “polypeptide” refers to a protein which includes modifications, such as deletions, additions, and substitutions (which may be conservative in nature), to the native sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification. [0112] As used herein, the term “capture sequence” refers to a sequence configured to hybridize to, bind to, couple to, or otherwise interact with a capture agent, such as a capture probe, aptamer, resin, sequence-specific binding protein, or any other agent capable of specifically recognizing a particular sequence.
[0113] The term “identifying sequence,” as used herein, refers to a sequence in a gene therapy agent that is heterologous as to the subject or cell population to which the gene therapy agent is administered or is intended to be administered. Identifying sequences include, but are not limited to, barcodes.
[0114] The term “barcode,” as used herein, generally refers to an identifying sequence that can convey information about the analyte (e.g., nucleic acid molecule). A barcode can be a tag attached to a nucleic acid molecule or a combination of the tag in addition to an endogenous characteristic of the analyte (e.g., size of the analyte or end sequence(s)). The barcode may be unique. Barcodes can have a variety of different formats, for example, barcodes can include random and/or synthetic nucleic acid sequences. A barcode can be attached to an analyte in a reversible or irreversible manner. A barcode can be added to, for example, a fragment of a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sample before, during, and/or after sequencing of the sample. Barcodes can allow for identification and/or quantification of individual sequencing-reads in real time.
[0115] As used herein, a “promoter” refers to a nucleic acid sequence sufficient to direct transcription of an operably linked nucleic acid molecule. Promoters may include or be accompanied by transcription control elements (e.g., enhancers) that can render promoterdependent gene expression controllable in a cell type-specific, tissue-specific, or temporalspecific manner, or that are inducible by external signals or agents; such elements, which are well-known to skilled artisans, may be found in a 5' or 3' region of a gene or within an intron. A promoter can be operably linked to a nucleic acid sequence, for example, comprising one or more of an identifying sequence such as a barcode, a capture sequence, an ORF or a gene sequence, and/or an effector RNA coding sequence, in such a way as to enable expression of the nucleic acid sequence. A promoter can also be provided in an expression cassette into which a selected nucleic acid sequence to be transcribed can be conveniently inserted.
[0116] A “viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (a nucleic acid sequence that does not naturally occur in the virus from which the vector is derived, e.g., a sequence that is not of viral origin or from a different virus). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one, e.g., two, inverted terminal repeat sequences (ITRs). [0117] An “AAV vector”, (also referred to as an rAAV vector)” refers to an adeno-associated viral vector. In some embodiments, the AAV vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin, also referred to as recombinant AAVs (rAAVs)). In some instances, the AAV vector is replication defective. In some instances, the heterologous sequence replace or render ineffective AAV infectious sequences thereby rendering the rAAV replication defective. In some embodiments, the rAAV comprises heterologous sequences that are flanked by at least one, e.g., two, AAV inverted terminal repeat sequences (ITRs). Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. A rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and, in embodiments, encapsidated in a viral particle, particularly an AAV particle. A rAAV vector can be packaged into an AAV virus capsid to generate a “adeno-associated viral particle (AAV particle)”.
[0118] An “AAV viral particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated AAV vector genome.
[0119] A “adenoviral vector” refers to a polynucleotide vector comprising one or more sequences of adenoviral origin. In some embodiments the adenoviral vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of adenovirus origin, also referred to as recombinant adenoviral vectors). In some instances, the adenoviral vector is replication defective. In some instances, the heterologous sequence replace or render ineffective adenoviral vector infectious sequences thereby rendering the adenoviral vector replication defective. In some embodiments, the rAAV comprises heterologous sequences that are flanked by at least one adenovirus inverted terminal repeat sequence (ITR). In some embodiments, the recombinant nucleic acid is flanked by two inverted terminal repeat sequences (ITRs). Such recombinant viral vectors can be replicated and packaged into infectious viral particles when present in a host cell that is expressing essential adenovirus genes deleted from the recombinant viral genome (e.g., El genes, E2 genes, E4 genes, etc.). When a recombinant viral vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the recombinant viral vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of adenovirus packaging functions. A recombinant viral vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, for example, an adenovirus particle. A viral vector can be packaged into an adenovirus virus capsid to generate an “adenoviral particle.” [0120] A “lentivirus vector” refers to a polynucleotide vector comprising one or more sequences of lentiviral origin. In some embodiments, the lentivirus vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of lentivirus origin, also referred to as recombinant lentivirus vectors). In some instances, the lentivirus vector is replication defective. In some instances, the heterologous sequence replace or render ineffective lentiviral infectious sequences thereby rendering the recombinant lentivirus vectors replication defective. In some embodiments, the recombinant lentivirus vectors comprises heterologous sequences that are flanked by at least one lentivirus terminal repeat sequences (LTRs). In some embodiments, the heterologous nucleic acid is flanked by two lentiviral terminal repeat sequences (LTRs). Such viral vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper function. A lentiviral vector can be packaged into a lentivirus capsid to generate a “lentiviral particle.”
[0121] A “herpes simplex vector (HSV vector)” refers to a polynucleotide vector comprising one or more sequences of herpes simplex viral origin. In some embodiments, the HSV vector comprises one or more heterologous sequences (i.e., nucleic acid sequence not of HSV origin, also referred to as recombinant HSV vectors). In some instances, the HSV vector is replication defective. In some instances, the heterologous sequence replace or render ineffective HSV infectious sequences thereby rendering the recombinant HSV vectors replication defective. In some embodiments, the recombinant HSV vectors comprise heterologous sequences that are flanked by HSV terminal repeat sequences. Such recombinant viral vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper functions. When a recombinant viral vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the recombinant viral vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of HSV packaging functions. A recombinant viral vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, for example, an HSV particle. A recombinant viral vector can be packaged into an HSV capsid to generate a “herpes simplex viral particle.”
[0122] “ Solid lipid nanoparticles” (SLNs, sLNPs), or “lipid nanoparticles” (LNPs) as used herein refer to nanoparticles comprising lipids that can contain a payload. In some examples, there is only one phospholipid layer; furthermore, in some embodiments, the bulk of the interior of the particle is composed substantially of lipophilic substance and a payload. Payloads such as nucleic acids can be embedded in the interior. In some examples, the lipid nanoparticle is a liposome, which comprises a lipid bilayer and may comprise a hydrophilic or aqueous interior comprising a payload. In other embodiments, the LNP is a targeted LNP which comprises a targeting moiety.
[0123] “Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a nucleic acid introduced by genetic engineering techniques into a different cell type is a heterologous nucleic acid (and, when expressed, can encode a heterologous polypeptide). Similarly, a cellular sequence (e.g., a gene or portion thereof) that is incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector.
[0124] The term “transgene” refers to a nucleic acid that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and/or expressed under appropriate conditions. In some embodiments, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. In another aspect, it may be transcribed into a molecule that mediates RNA interference, such as siRNA.
[0125] The terms “genome particles (gp),” “genome equivalents,” or “genome copies” as used in reference to a viral titer, refer to the number of virions containing the recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genome particles in a particular vector preparation can be measured by procedures such as described in the Examples herein, or for example, in Clark et al. (1999) Hum. Gene Then, 10: 1031- 1039; Veldwijk et al. (2002) Mol. Then, 6:272-278.
[0126] The terms “infection unit (iu),” “infectious particle,” or “replication unit,” as used in reference to a viral titer, refer to the number of infectious and replication-competent recombinant AAV vector particles as measured by the infectious center assay, also known as replication center assay, as described, for example, in McLaughlin et al. (1988) J. Virol., 62: 1963-1973.
[0127] The term “transducing unit (tu)” as used in reference to a viral titer, refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product as measured in functional assays such as described in Examples herein, or for example, in Xiao et al. (1997) Exp. Neurobiol., 144:113-124; or in Fisher et al. (1996) J. Virol., 70:520-532 (LFU assay).
[0128] An “inverted terminal repeat” or “ITR” sequence is a term well understood in the art and refers to relatively short sequences found at the termini of viral genomes which are in opposite orientation.
[0129] An “AAV inverted terminal repeat (ITR)” sequence, a term well-understood in the art, is an approximately 145 -nucleotide sequence that is present at both termini of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contains several shorter regions of self-complementarity (designated A, A', B, B', C, C and D regions), allowing intrastrand base-pairing to occur within this portion of the ITR. [0130] A “terminal resolution sequence” or “trs” is a sequence in the D region of the AAV ITR that is cleaved by AAV rep proteins during viral DNA replication. A mutant terminal resolution sequence is refractory to cleavage by AAV rep proteins. “AAV helper functions” refer to functions that allow AAV to be replicated and packaged by a host cell. AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents.
[0131] “AAV helper functions” refer to functions that allow AAV to be replicated and packaged by a host cell. AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents. [0132] A “helper virus” for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell. A number of such helper viruses have been identified, including adenoviruses, herpesviruses, poxviruses such as vaccinia, and baculovirus. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and are available from depositories such as the ATCC. Viruses of the herpes family, which are also available from depositories such as ATCC, include, for example, herpes simplex viruses (HSV), Epstein- Barr viruses (EBV), cytomegaloviruses (CMV) and pseudorabies viruses (PRV). Baculoviruses available from depositories include Autographa californica nuclear polyhedrosis virus.
[0133] “Percent (%) sequence identity” with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid or nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software programs, for example, those described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp. 30, section 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. A potential alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows: 100 times the fraction X/Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. For purposes herein, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows: 100 times the fraction W/Z, where W is the number of nucleotides scored as identical matches by the sequence alignment program in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C.
[0134] An “effective amount” of an agent refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. For example, an effective amount of a gene therapy agent refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired gene therapeutic result. In another example, an effective amount of an IL-2 conjugate may refer to an amount effective, at dosages and for periods of time necessary, to achieve the desired result of improved gene therapy.
[0135] A “therapeutically effective amount” of a substance/molecule of the invention, (e.g., a gene therapy agent and/or an IL-2 conjugate) may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance/molecule, agonist or antagonist to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the substance/molecule are outweighed by the therapeutically beneficial effects.
[0136] The term “suitable control” as it refers to a cytokine signature is the expression of the cytokines in the cytokine signature from adaptive immune cells that are not incubated with the gene therapy agent or the expression of the cytokines in the cytokine signature from adaptive immune cells prior to incubation with the gene therapy agent.
[0137] Administration “in combination with” as it related to a gene therapy agent and a modulator of an adaptive immune response (e.g., an IL-2 conjugate) includes simultaneous (concurrent), consecutive or sequential administration in any order of the gene therapy agent and the modulator of an adaptive immune response (e.g., an IL-2 conjugate).
[0138] The term “concurrently” is used herein to refer to administration of a gene therapy agent and a modulator of the adaptive immune response (e.g., an IL-2 conjugate), where at least part of the administration overlaps in time. Accordingly, concurrent administration includes a dosing regimen when the administration of a gene therapy agent or a modulator of an adaptive immune response (e.g., an IL-2 conjugate) continues after discontinuing the administration of the other agent/modulator.
[0139] As used herein, “in conjunction with” refers to administration of one treatment modality in addition to another treatment modality. As such, “in conjunction with” refers to administration of one treatment modality (a gene therapy agent or a modulator of an adaptive immune response (e.g., an IL-2 conjugate)) before, during or after administration of the other treatment modality to the individual. [0140] The terms “or a combination thereof’ and “or combinations thereof’ as used herein refers to any and all permutations and combinations of the listed terms preceding the term. For example, “A, B, C, or combinations thereof’ is intended to include at least one of A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, ACB, CBA, BCA, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CAB ABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
[0141] “ Or” is used in the inclusive sense, i.e., equivalent to “and/or,” unless the context requires otherwise.
II. Exemplary Methods
A. Overview
[0142] The present disclosure provides a method of profiling gene therapy agents, comprising: administering one or more gene therapy agents to a non-human subject, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the subject are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei and; performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells, thereby profiling the gene therapy agents. In some embodiments, the further comprises isolating a sample from the subject comprising a plurality of transduced nuclei or transduced cells. [0143] The present disclosure also provides a method of profiling gene therapy agents, comprising: contacting an ex vivo or in vitro cell population with one or more gene therapy agents, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the cell population are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells, thereby profiling the gene therapy agents. In some embodiments, the method further comprises isolating a sample from cell population comprising a plurality of transduced nuclei or transduced cells.
[0144] In some embodiments, the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced nuclei; performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and differential barcodes from the one or more gene therapy agents in at least a portion of the transduced nuclei.
[0145] In some embodiments, the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced cells; performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and differential barcodes from the one or more gene therapy agents in at least a portion of the transduced cells. B. Subjects and Cell Types
[0146] In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a monkey.
[0147] In some embodiments, the subject is suffering from a neurodegenerative ocular disease.
[0148] In some embodiments, the cell population comprises mammalian cells. In some embodiments, the cell population comprises primate cells. In some embodiments, the cell population comprises non-human primate cells. In some embodiments, the cell population comprises monkey cells. In some embodiments, the cell population comprises human cells. [0149] In some embodiments, the transduced cells are identified based on expression of a plurality of markers. Exemplary human cortical cell type markers are disclosed in Zemke, et al (2023) Nature, 624(7991), 390-402. Exemplary human kidney cell type markers are disclosed in Muto, et al (2021) Nature Communications, 12(1), 2190. Other markers for multiple human tissues single cell/nuclei RNAseq and markers are known in the art and are, e.g., available at humancellatlas.org (last accessed April 29, 2024).
[0150] In some embodiments, the plurality of markers comprise one or more of: AGLN3, ALBI, APOE, ARR3, ATP1B1, B2M, BCC3, BRN3A, CABP5, CALB1, CD14, CD164, CD37, CD44, CD74, CHAT, CHX10, CLDN5, CLU, CNGA1, CNGB1, COL4A1, CRABP1, CRYM, CTSB, CTSS, DKK3, DST, EPHB6, FCER1G, FXYD5, GABRD, GAD1, GAD2, GAP43, GFAP, GLUL, GNAT1, GNAT2, GNB1, GNGT1, GNGT2, GPR37, GRIK1, GRIN2A, GRM6, GUCA1A, GUCA1C, GYPC, HES1, HEXB, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRA, HLA-DRA, IBA1, IGFBP7, ISL1, ITRPM1, KCNJ12, KCNJ8, LAPTMS, LHX1, MFGEB, MGP, MYL9, NCAM1, NDRG1, NDRG4, NDRG4, NEFL, NEFM, NET01, NGFR, NR2E3, NRL, NTNAP2, ONECUT1, ONECUT2, OPN1LW, 0PN1MW, OPN1SW, OTX2, P2RY12, PAX6, PDC, PDE6A, PDE6B, PDE6C, PDE6H, POU4F1, POU4F2, POU4F3, PRKCA, PRPH2, PTN, PTPRF, QP4, RBPMS, RCVRN, RGC5, RGR, RHO, RLBP1, R0M1, RTN1, SAG, SEPT4, SEPT7, SERPINA5, SLC17A6, SLC1A3, SLC23A2, SLC24A1, SLC4A4, SLC5A7, SLC6A1, SLC6A9, SNCG, TFAP2A, TFAP2B, TFAP2C, THY1, TMEM119, TPM3, TTR, TUBB3, TYROBP, UCHL1, VSX1, VSX2, and YWHAH
[0151] In some embodiments, the transduced cells comprise eye cells, kidney cells, brain cells, or muscle cells. In some embodiments, the transduced cells comprise eye cells. In some embodiments, the eye cells comprise retinal cells. In some embodiments, the retinal cells comprise amacrine cells, astrocytes, bipolar cells, cone cells, endothelial cells, horizontal cells, microglia, Muller cells, pericytes, Retinal ganglion cells (RGCs), and/or rod cells. [0152] In some embodiments the transduced cells are identified as amacrine cells, cone photoreceptor cells, horizontal cells, Muller glia cells, retinal ganglion cells, astrocyte, microglia, and/or endothelial cells based on one or more, two or more or three or more markers.
[0153] In some embodiments, amacrine cells express one or more of the following markers: ATP1B1, PAX6, GAD1, GAD2, SLC6A1, EPHB6, SLC5A7, GABRD, KCNJ12, PTPRF, GRIN2A, TFAP2A, TFAP2B, TFAP2C, SLC6A9, CALB1, and/ or CHAT.
[0154] In some embodiments, bipolar cells express one or more of the following markers: VSX2, ISL1, GRM6, OTX2, TRPM1, CHX10, PRKCA, GIRK1, VSX1, CABP5, and/or NET01.
[0155] In some embodiments, cone photoreceptor cells express one or more of the following markers: ARR3, GUCA1C, PDE6C, PDE6H, OPN1LW, SLC23A2, DST, TTR, RCVRN, GNAT2, GNGT2, OPN1SW, 0PN1MW, and/or GUCA1A.
[0156] In some embodiments, horizontal cells express one or more of the following markers: ONECUT1, SEPT4, TPM3, NDRG1, SEPT7, CNTNAP2, PTN, NDRG4, TAGLN3, LHX, ONECUT2, and/or CALB1.
[0157] In some embodiments, Muller glia cells express one or more of the following markers: RLBP1, HES1, SLC1A3, GLUL, CLU, RGR, GPR37, NCAM1, CD164, APOE, CRABP1, DKK3, and/or CRYM.
[0158] In some embodiments, retina ganglion cells express one or more of the following markers: NEFL, RBPMS, TUBB3, POU4F1, SLC17A6, RTN1, NDRG4, UCHL1, YWHAH, POU4F2, POU4F3, THY1, NEFM. SNCG, BRN3A, and/or GAP43.
[0159] In some embodiments, rod photoreceptor cells express one or more of the following markers: PDE6A, SLC24A1, RHO, CNGB1, GNAT1, PDC, NRL, SAG, GNGT1, NR2E3, GNB1, PDE6B, CNGA1, R0M1, PRPH2, and/or MFGE8.
[0160] In some embodiments, astrocytes express one or more of the following markers: GYPC, SERPINA5, CD44, SLC4A4, AQP4, ABCC3, NGFR, and/or GFAP.
[0161] In some embodiments, microglia express one or more of the following markers: CD74, HLA-DRA, HA-DPA1, TYROBP, FCER1G, LAPTMS, CD14, HLA-DQA1, FXYD5, CTSB, CD37, HEXB, CTSS, P2RY12, TMEM, B2M, UBA1, HLADPB1, and/or HLA-DRA. [0162] In some embodiments, pericytes express one or more of the following markers: RGC5, MGP, KCNJ8, MYL9 and/or COL4A1.
[0163] In some embodiments, endothelial cells express one or more of the following markers: CLDN5, IGFBP7, and/or COL4A1.
C. Promoters and Capture Sequence
[0164] In some embodiments, the capture sequence is operably linked to the identifying sequence. In some embodiments, the identifying sequence comprises a barcode.
[0165] In some embodiments, the capture sequence and at least one of the differential barcodes are configured to be transcribed in a single RNA. In some embodiments, both mRNA and RNA comprising the capture sequence are captured.
[0166] In some embodiments, the capture sequence comprises a sequence that is not present in endogenous RNA of the cell population or subject. In some embodiments, the capture sequence comprises SEQ ID NO: 1 (gctttaaggccggtcctagcaa).
[0167] In some embodiments, the capture sequence comprises an aptamer sequence. In some embodiments, RNA comprising the capture sequence is captured using a bead coated with a target specifically bound by the aptamer sequence. In some embodiments, the capture sequence comprises a recognition sequence. In some embodiments, RNA comprising the capture sequence is captured using a sequence-specific binding protein that specifically binds the recognition sequence.
[0168] In some embodiments, the differential barcodes are operably linked to a promoter. In some embodiments, the capture sequence is operably linked to a promoter. In some embodiments, the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter. In some embodiments, the promoter comprises a RNAP I promoter, RNAP II promoter, or RNAP III promoter. In some embodiments, the promoter comprises a RNAP III promoter. In some embodiments, the RNAP III promoter comprises a U6 promoter. In some embodiments, the RNAP III promoter comprises a 7SK promoter. In some embodiments, the RNAP III promoter comprises a Hl promoter. In some embodiments, the RNAP III promoter comprises a small tRNA promoter.
[0169] In some embodiments, a capture sequence includes a nucleic acid sequence that is complementary to or substantially complementary to the capture domain of a capture probe such that the analyte capture sequence hybridizes to the capture domain of the capture probe. In some embodiments, a capture sequence comprises a poly(A) nucleic acid sequence that hybridizes to a capture domain that comprises a poly(T) nucleic acid sequence. In some embodiments, a capture sequence comprises a poly(T) nucleic acid sequence that hybridizes to a capture domain that comprises a poly(A) nucleic acid sequence.
D. Sequencing
[0170] In some embodiments, the single nuclei sequencing comprises isolating RNA from the transduced cells or nuclei. In some embodiments, the single nuclei sequencing comprises lOx genomics sequencing. In some embodiments, the single nuclei sequencing comprises Smart-seq2, CEL-Seq2, Drop-seq, Seq-Well, inDrops, sci-RNA-seq, DRONC-seq, Cl (SMART er), MATQ-seq, MARS-seq, or SPLIT-seq.
[0171] In some embodiments, the single nuclei sequencing further comprises subjecting the RNA to reverse transcription to obtain cDNA.
[0172] In some embodiments, about 1 attogram of RNA is subjected to reverse transcription. [0173] In some embodiments, the method further comprises tagging the RNA. In some embodiments, in the RNA is tagged. In some embodiments, the RNA is tagged with a plurality of barcodes or UMIs. Unique molecular indices (UMIs) are sequences of nucleotides applied to or identified in DNA molecules that may be used to distinguish individual nucleic acid molecules from one another. Since UMIs are used to identify nucleic acid molecules, they are also referred to as unique molecular identifiers. See, e.g., Kivioja, Nature Methods 9, 72-74 (2012). UMIs may be sequenced along with the nucleic acid molecules with which they are associated to determine whether the read sequences are those of one source nucleic acid molecule or another. The term “UMI” is used herein to refer to both the sequence information of a polynucleotide and the physical polynucleotide per se. UMIs are similar to bar codes, which are commonly used to distinguish reads of one sample from reads of other samples, but UMIs are instead used to distinguish one source nucleic acid molecule from another when many nucleic acid molecules are sequenced together. Because there may be many more nucleic acid molecules in a sample than samples in a sequencing run, there are typically many more distinct UMIs than distinct barcodes in a sequencing run. In some embodiments, the plurality of barcodes or UMIs corresponds to individual cells or nucleic.
[0174] In some embodiments, the method further comprises pooling cDNA from different cells or nuclei prior to sequencing. [0175] Sequencing of polynucleotides can be performed by various commercial systems. More generally, sequencing can be performed using nucleic acid amplification, polymerase chain reaction (PCR) (e.g., digital PCR and droplet digital PCR (ddPCR), quantitative PCR, real time PCR, multiplex PCR, PCR-based singleplex methods, emulsion PCR), and/or isothermal amplification.
[0176] Other examples of methods for sequencing genetic material include, but are not limited to, DNA hybridization methods (e.g., Southern blotting), restriction enzyme digestion methods, Sanger sequencing methods, next-generation sequencing methods (e.g., singlemolecule real-time sequencing, nanopore sequencing, and Polony sequencing), ligation methods, and microarray methods. Additional examples of sequencing methods that can be used include targeted sequencing, single molecule real-time sequencing, exon sequencing, electron microscopy-based sequencing, panel sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, whole-genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, gel electrophoresis, duplex sequencing, cycle sequencing, single-base extension sequencing, solid-phase sequencing, high-throughput sequencing, massively parallel signature sequencing, co-amplification at lower denaturation temperature-PCR (COLD-PCR), sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, singlemolecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse-terminator sequencing, nanopore sequencing, MS-PET sequencing, and any combinations thereof. [0177] Sequence analysis of the nucleic acid molecules (including barcoded nucleic acid molecules or derivatives thereof) can be direct or indirect. Thus, the sequence analysis substrate (which can be viewed as the molecule which is subjected to the sequence analysis step or process) can be the barcoded nucleic acid molecule or it can be a molecule which is derived therefrom (e.g., a complement thereof). Thus, for example, in the sequence analysis step of a sequencing reaction, the sequencing template can be the barcoded nucleic acid molecule or it can be a molecule derived therefrom. For example, a first and/or second strand DNA molecule can be directly subjected to sequence analysis (e.g., sequencing), i.e., can directly take part in the sequence analysis reaction or process (e.g., the sequencing reaction or sequencing process, or be the molecule which is sequenced or otherwise identified).
[0178] Alternatively, the barcoded nucleic acid molecule can be subjected to a step of second strand synthesis or amplification before sequence analysis (e.g., sequencing or identification by another technique). The sequence analysis substrate (e.g., template) can thus be an amplicon or a second strand of a barcoded nucleic acid molecule.
[0179] In some embodiments, both strands of a double stranded molecule can be subjected to sequence analysis (e.g., sequenced). In some embodiments, single stranded molecules (e.g., barcoded nucleic acid molecules) can be analyzed (e.g., sequenced).
E. Gene Therapy Agents
[0180] In some embodiments of the disclosure, the one or more gene therapy agents (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle, or combinations thereof, or a plurality or library of any of the foregoing) may be administered to a particular tissue of interest, or may be administered systemically. In some embodiments, an effective amount of the one or more gene therapy agents may be administered to the subject. In some embodiments, an effective amount of the one or more gene therapy agents may be administered parenterally. Parenteral routes of administration may include without limitation intravenous, intraperitoneal, intraosseous, intra-arterial, intracerebral, intramuscular, intrathecal, subcutaneous, intracerebroventricular, intrahepatic, intracranial, intra-cerebrospinal fluid (CSF), intra-dorsal root ganglia (DRG), intraocular, intracisterna magna, and so forth. In some embodiments, an effective amount of the one or more gene therapy agents may be administered through one route of administration. In some embodiments, an effective amount of the one or more gene therapy agents may be administered through a combination of or multiple routes of administration (e.g., two, three etc.). In some embodiments, an effective amount of the one or more gene therapy agents is administered to one location. In other embodiments, an effective amount of the one or more gene therapy agents may be administered to more than one location.
[0181] In some embodiments, the one or more gene therapy agents comprise a library comprising at least two distinct subpopulations of gene therapy agents. In some embodiments, each agent in the library comprises a distinct identifying sequence, e.g., a barcode, such as a unique barcode. In some embodiments, at least one of the gene therapy agents comprises a viral vector.
[0182] In some embodiments, the one or more gene therapy agents comprises a nucleic acid encoding a heterologous transgene. In some embodiments, the heterologous transgene is operably linked to a promoter. In some embodiments, the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter. [0183] In some embodiments, the heterologous transgene encodes a marker protein. In some embodiments, the marker protein is a fluorescent protein, optionally wherein the fluorescent protein is a GFP, YFP, RFP, BFP, CFP, or VFP.
[0184] In some embodiments, the heterologous transgene encodes a gene therapy product, vaccine antigen, or microRNA.
[0185] In some embodiments, the nucleic acid comprises closed-end DNA (ceDNA). In some embodiments, the nucleic acid comprises mRNA.
[0186] In some embodiments, the library comprises at least three distinct subpopulations of gene therapy agents. In some embodiments, the library comprises at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 30 distinct subpopulations of gene therapy agents.
[0187] An effective amount of gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) is administered, depending on the objectives of treatment. For example, where a low percentage of transduction or transfection can achieve the desired therapeutic effect, then the objective of treatment is generally to meet or exceed this level of transduction or transfection. In some embodiments, this level of transduction or transfection can be achieved by transduction or transfection of only about 1 to 5% of the target cells of the desired tissue type, in some embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type. The gene therapy agent may be administered by one or more administrations, either during the same procedure or spaced apart by days, weeks, months, or years. One or more of any of the routes of administration described herein may be used. In some embodiments, multiple gene therapy agents may be used; for example, an AAV vector and a lentiviral vector.
[0188] Methods to identify cells transduced or transfected by gene therapy agents are known in the art; for example, immunohistochemistry or the use of a marker such as enhanced green fluorescent protein can be used to detect transduction or transfection cells by the gene therapy agent.
[0189] In some embodiments, an effective amount of gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) is administered to more than one location simultaneously or sequentially. In other embodiments, an effective amount of the gene therapy agent is administered to a single location more than once (e.g., repeated). In some embodiments, multiple injections of the gene therapy agent are no more than one hour, two hours, three hours, four hours, five hours, six hours, nine hours, twelve hours or 24 hours apart.
[0190] In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a gene therapy agent to treat an individual in need of gene therapy treatment. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 * 1012, 6 x 1012, 7 x 1012, 8 x 1012, 9 x 1012, 10 x 1012, 11 x 1012, 15 x 1012, 20 x 1012, 25 x 1012, 30 x 1012, or 50 x 1012genome copies/mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 1012to 6 x 1012, 6 x 1012 to 7 x 1012, 7 x 1012to 8 x 1012, 8 x 1012to 9 x 1012, 9 x 1012to 10 x 1012, 10 x 1012to 11 x 1012, 11 x io12to 15 x 1012, 15 x 1012to 20 x 1012, 20 x 1012to 25 x 1012, 25 x 1012to 30 x 1012, 30 x 1012to 50 x 1012, or 50 x 1012to 100 x 1012 genome copies/mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 1012to 10 x 1012, 10 x 1012to 25 x 1012, or 25 x 1012to 50 x 1012 genome copies/mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 x 109, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 10 x 109, 11 x 109, 15 x 109, 20 x 109, 25 x 109, 30 x 109, or 50 x 109 transducing units /mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 109to 6 x 109, 6 x 109to 7 x 109, 7 x 109to 8 x 109, 8 x 109to 9 x 109, 9 x 109to 10 x 109, 10 x 109to 11 x 109, 11 x io9to 15 x 109, 15 x 109to 20 x 109, 20 x 109to 25 x 109, 25 x 109to 30 x 109, 30 x 109 to 50 x 109 or 50 x 109to 100 x 109 transducing units/mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 109to 10 x 109, 10 x 109 to 15 x 109, 15 x 109to 25 x 109, or 25 x 109to 50 x 109 transducing units /mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x IO10, 6 x IO10, 7 x IO10, 8 x IO10, 9 x IO10, 10 x IO10, 11 x IO10, 15 x IO10, 20 x IO10, 25 x IO10, 30 x 1O10, 40 x 1O10, or 50 x IO10 infectious units/mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x 1010to 6 x io10, 6 x 1010to 7 x IO10, 7 x 1010to 8 x IO10, 8 x 1010to 9 x IO10, 9 x 1010to 10 x IO10, 10 x 1010to 11 x io10, 11 x io10to 15 x 1O10, 15 x 1010to 20 x 1O10, 20 x 1010to 25 x 1O10, 25 x 1010to 30 x 1O10, 30 x 1010to 40 x 1O10, 40 x 1010to 50 x 1O10, or 50 x 1010to 100 x IO10 infectious units/mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x 1010to 10 x 1O10, 10 x 1010to 15 x 1O10, 15 x 1010to 25 x 1O10, or 25 x 1010to 50 x IO10 infectious units/mL.
[0191] In some embodiments, the dose of gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) administered to the individual is at least about any of 1 x 108 to about 6 x io13 genome copies/kg of body weight. In some embodiments, the dose of gene therapy agent administered to the individual is about any of 1 x 108 to about 6 x io13 genome copies/kg of body weight.
[0192] In some embodiments, the total amount of the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) administered to the individual is at least about any of 1 x io9 to about 1 x io14 genome copies. In some embodiments, the total amount of the gene therapy agent administered to the individual is about any of 1 x 109 to about 1 x io14 genome copies.
[0193] Compositions of the disclosure comprising the gene therapy (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) can be used either alone or in combination with one or more additional therapeutic agents in addition to the IL-2 conjugate. The interval between sequential administration can be in terms of at least (or, alternatively, less than) minutes, hours, or days.
[0194] In some embodiments, described herein are gene therapy conjugates. In some embodiments, the gene therapy agent can be delivered to a cell of a subject. In some embodiments, the gene therapy agent can be administered to the subject before an IL-2 conjugate, concurrently with an IL-2 conjugate, or after an IL-2 conjugate. In some embodiments, the gene therapy agent is administered to a subject at least about 1 second, about 5 seconds, about 10 seconds, about 15 seconds, about 30 seconds, about 45 seconds, about 1 minute, about 2 minutes, about 5 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 3 hours, about 4 hours, or about 6 hours before the administration of the IL-2 conjugate. In some embodiments, the gene therapy agent is administered to a subject at least about 1 second, about 5 seconds, about 10 seconds, about 15 seconds, about 30 seconds, about 45 seconds, about 1 minute, about 2 minutes, about 5 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 3 hours, about 4 hours, or about 6 hours after the administration of the IL-2 conjugate.
[0195] In some embodiments, the disclosure provides methods for using IL-2 conjugates with gene therapy agents for improved gene therapy by inhibiting an adaptive immune response to the gene therapy agent. In some embodiments, the gene therapy agent is a viral particle or a lipid nanoparticle. In some embodiments, the gene therapy agent is an adeno-associated virus (AAV) particle, an adenovirus particle, a lentivirus particle, or a herpes simplex virus (HAV) particle. In some embodiments, the gene therapy agent is a lipid nanoparticle or a liposome. In some embodiments, the immune response to the gene therapy agent is an immune response to the viral particle (e.g., viral capsid proteins, viral envelopes, etc.). In some embodiments, the immune response to the gene therapy agent is an immune response to an LNP (e.g., one or more lipids used to produce the LNP). In some embodiments, the immune response to the gene therapy agent is an immune response to the gene therapy payload; e.g., nucleic acid encoding the therapeutic transgene (a viral genome, a plasmid, a closed ended DNA, an mRNA, an antisense nucleic acid, a siRNA, a shRNA and the like). In some embodiments, the immune response to the gene therapy agent is an immune response to the transgene product (e.g., a therapeutic polypeptide or therapeutic nucleic acid). In some embodiments, the transgene product (e.g., a therapeutic polypeptide or therapeutic nucleic acid) can be expressed and/or synthesized in a subject for at least about 1 week. In some embodiments, the transgene product (e.g., a therapeutic polypeptide or therapeutic nucleic acid) can be expressed and/or synthesized in a subject for at least about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 22 weeks, about 24 weeks, or about 26 weeks. In some embodiments, a transgene product may, e.g., supply a polypeptide and/or enzymatic activity that is absent or present at a reduced level in a cell or organism. In some embodiments, a transgene product may supply a polypeptide and/or enzymatic activity that indirectly counteracts an imbalance in a cell or organism. In some embodiments, a change in expression of the transgene product comprises changes in expression levels of a therapeutic nucleic acid and/or an endogenous nucleic acid in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control). In some embodiments, a change in synthesis of a transgene product comprises changes in synthesis levels of a therapeutic polypeptide encoded by a transgene product and/or an endogenous polypeptide in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control).
1. Adeno-Associated Virus Vector
[0196] In some embodiments, the one or more gene therapy agents comprise one or more AAV particles, e.g., a plurality of AAV particles, such as a library of AAV particles. In an AAV particle for gene therapy, a recombinant AAV (rAAV) genome encoding a heterologous nucleic acid (e.g., a therapeutic transgene) is encapsidated in an AAV capsid. In some embodiments, the viral genome comprises a heterologous nucleic acid and/or one or more of the following components, operatively linked in the direction of transcription, control sequences including transcription initiation and termination sequences, thereby forming an expression cassette.
[0197] In some embodiments, the rAAV genome comprises one or more AAV inverted terminal repeat (ITR) sequences (typically two AAV ITR sequences). For example, an expression cassette may be flanked on the 5' and 3' end by at least one functional AAV ITR sequence. By “functional AAV ITR sequences” it is meant that the ITR sequences function as intended for the rescue, replication and packaging of the AAV virion. See Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16: 10-16, all of which are incorporated herein in their entirety by reference. For practicing some embodiments of the disclosure, the recombinant viral genomes comprise at least all of the sequences of AAV essential for encapsidation into the AAV capsid and the physical structures for infection by the AAV particle. AAV ITRs for use in the vectors of the disclosure need not have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801), and may be altered by the insertion, deletion or substitution of nucleotides or the AAV ITRs may be derived from any of several AAV serotypes. More than 40 serotypes of AAV are currently known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003, 100(10):6081- 6; and Bossis et al., J. Virol., 2003, 77(12):6799-810. Use of any AAV serotype is considered within the scope of the present disclosure. In some embodiments, a rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV LK03, AAV2R471 A, AAV DJ, AAV DJ8, a goat AAV, bovine AAV, or mouse AAV ITRs or the like. In some embodiments, the AAV nucleic acid (e.g., an rAAV vector) comprises one or more (e.g., in some embodiments two) ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV LK03, AAV2R471 A, AAV DJ, AAV DJ8, a goat AAV, bovine AAV, or mouse AAV ITRs or the like. In some embodiments, the AAV particle comprises an AAV vector encoding a heterologous transgene flanked by one or more AAV ITRs.
[0198] In some embodiments, the AAV viral particle comprises an AAV genome comprising one or more inverted terminal repeats (ITRs), wherein the one or more ITRs is an AAV1 ITR, an AAV2 ITR, an AAV3 ITR, an AAV4 ITR, an AAV5 ITR, an AAV6 ITR, an AAV7 ITR, an AAV8 ITR, an AAVrh8 ITR, an AAV9 ITR, an AAV10 ITR, an AAVrhlO ITR, an AAV1 1 ITR, or an AAV12 ITR. In some embodiments, the one or more ITRs and the capsid of the AAV particle are derived from the same AAV serotype. In some embodiments, the one or more ITRs and the capsid of the AAV particles are derived from different AAV serotypes. [0199] In some embodiments, the AAV particle comprises a capsid protein selected from an AAV1 capsid, an AAV2 capsid, an AAV3 capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid, an AAV7 capsid, an AAV8 capsid, an AAVrh8 capsid, an AAV9 capsid, an AAV10 capsid, an AAVrhlO capsid, an AAV11 capsid, an AAV12 capsid, an AAVrh32.33 capsid, An AAV-XL32 capsid, an AAV-XL32.1 capsid, an AAV LK03 capsid, an AAV2R471 A capsid, an AAV2/2-7m8 capsid, an AAV DJ capsid, an AAV DJ8 capsid, an AAV2 N587A capsid, an AAV2 E548A capsid, an AAV2 N708A capsid, an AAV V708K capsid, a goat AAV capsid, an AAV1/AAV2 chimeric capsid, a bovine AAV capsid, a mouse AAV capsid rAAV2/HBoVl (chimeric AAV / human bocavirus virus 1), an AAV2HBKO capsid, an AAVPHP.B capsid or an AAVPHP.eB capsid, or a functional variant thereof. By “functional variant” of an AAV capsid, it is meant that the variant capsid is capable of packaging an AAV genome to generate an infectious AAV virion.
[0200] In some embodiments, the AAV capsid comprises a tyrosine mutation, a heparin binding mutation, or an HBKO mutation.
[0201] In further embodiments, a rAAV particle comprises capsid proteins of an AAV serotype from Clades A-F.
[0202] In some embodiments, the disclosure provides AAV particles comprising a recombinant self-complementing genome (e.g., a self-complementary or self-complimenting AAV vector). AAV viral particles with self-complementing vector genomes and methods of use of self- complementing rAAV genomes are described in US Patent Nos. 6,596,535;
7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which are incorporated herein by reference in its entirety. An AAV particle comprising a self-complementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a heterologous nucleic acid). In some embodiments, the vector comprises a first nucleic acid sequence encoding a heterologous nucleic acid and a second nucleic acid sequence encoding a complement of the nucleic acid, where the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. [0203] In some embodiments, the first heterologous nucleic acid sequence and a second heterologous nucleic acid sequence are linked by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5’- CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3’ (SEQ ID NO: 2). The mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence. As a result, on replicating a rAAV genome, the rep proteins will not cleave the viral genome at the mutated ITR and as such, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR.
[0204] Different AAV serotypes are used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue). An AAV particle can comprise viral proteins and viral nucleic acids of the same serotype or a mixed serotype. For example, an AAV particle may contain one or more ITRs and capsid derived from the same AAV serotype, or an AAV particle may contain one or more ITRs derived from a different AAV serotype than capsid of the AAV particle.
[0205] In some embodiments, the AAV capsid comprises a mutation, e.g., the capsid comprises a mutant capsid protein. In some embodiments, the mutation is a tyrosine mutation or a heparin binding mutation. In some embodiments, a mutant capsid protein maintains the ability to form an AAV capsid. In some embodiments, the AAV particle comprises an AAV2 or AAV5 tyrosine mutant capsid (see, e.g., Zhong L. et al., (2008) Proc Natl Acad Sci U S A 105(22):7827-7832), such as a mutation in Y444 or Y730 (numbering according to AAV2). In further embodiments, the AAV particle comprises capsid proteins of an AAV serotype from Clades A-F (Gao, et al., J. Virol. 2004, 78(12):6381).
[0206] Numerous methods are known in the art for production of AAV particles for gene therapy including transfection stable cell line production and infectious hybrid virus production systems which include adenovirus-AAV hybrids, herpesvirus- AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789) and baculovirus-AAV hybrids (Urabe, M. et al., (2002) Human Gene Therapy 13(16): 1935-1943; Kotin, R. (2011) Hum Mol Genet. 2O(R1): R2-R6). AAV production cultures for the production of AAV particles all require; 1) suitable host cells, 2) suitable helper virus function, 3) AAV rep and cap genes and gene products; 4) a nucleic acid (such as a therapeutic nucleic acid) flanked by at least one AAV ITR sequences; and 5) suitable media and media components to support AAV production. In some embodiments, the suitable host cell is a primate host cell. In some embodiments, the suitable host cell is a human-derived cell lines such as HeLa, A549, 293, or Perc.6 cells. In some embodiments, the suitable helper virus function is provided by wildtype or mutant adenovirus (such as temperature sensitive adenovirus), herpes virus (HSV), baculovirus, or a plasmid construct providing helper functions. In some embodiments, the AAV rep and cap gene products may be from any AAV serotype. In general, but not obligatory, the AAV rep gene product is of the same serotype as the ITRs of the rAAV genome as long as the rep gene products may function to replicated and package the rAAV genome. Suitable media known in the art may be used for the production of AAV particles. In some embodiments, the AAV helper functions are provided by adenovirus or HSV. In some embodiments, the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).
[0207] One method for producing AAV particles is the triple transfection method. Briefly, a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid, may be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and virus may be collected and optionally purified. As such, in some embodiments, the AAV particle was produced by triple transfection of a nucleic acid encoding the AAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions into a host cell, wherein the transfection of the nucleic acids to the host cells generates a host cell capable of producing AAV particles.
[0208] In some embodiments, AAV particles may be produced by a producer cell line method (see Martin et al., (2013) Human Gene Therapy Methods 24:253-269; U.S. PG Pub. No. US2004/0224411; and Liu, X.L. et al. (1999) Gene Ther.6:293-299). Briefly, a cell line (e.g., a HeLa, 293, A549, or Perc.6 cell line) may be stably transfected with a plasmid containing a rep gene, a capsid gene, and a vector genome comprising a promoter- heterologous nucleic acid sequence. Cell lines may be screened to select a lead clone for AAV production, which may then be expanded to a production bioreactor and infected with a helper virus (e.g., an adenovirus or HSV) to initiate AAV production. Virus may subsequently be harvested, adenovirus may be inactivated (e.g., by heat) and/or removed, and the AAV particles may be purified. As such, in some embodiments, the AAV particle was produced by a producer cell line comprising one or more of nucleic acid encoding the rAAV genome, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions. [0209] In some embodiments, the nucleic acid encoding AAV rep and cap genes and/or the AAV viral genome are stably maintained in the producer cell line. In some embodiments, nucleic acid encoding AAV rep and cap genes and/or the rAAV genome is introduced on one or more plasmids into a cell line to generate a producer cell line. In some embodiments, the AAV rep, AAV cap, and AAV genome are introduced into a cell on the same plasmid. In other embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into a cell on different plasmids. In some embodiments, a cell line stably transfected with a plasmid maintains the plasmid for multiple passages of the cell line (e.g., 5, 10, 20, 30, 40, 50 or more than 50 passages of the cell). For example, the plasmid(s) may replicate as the cell replicates, or the plasmid(s) may integrate into the cell genome. A variety of sequences that enable a plasmid to replicate autonomously in a cell (e.g., a human cell) have been identified (see, e.g., Krysan, P.J. et al. (1989) Mol. Cell Biol.9: 1026-1033). In some embodiments, the plasmid(s) may contain a selectable marker (e.g., an antibiotic resistance marker) that allows for selection of cells maintaining the plasmid. Selectable markers commonly used in mammalian cells include without limitation blasticidin, G418, hygromycin B, zeocin, puromycin, and derivatives thereof. Methods for introducing nucleic acids into a cell are known in the art and include without limitation viral transduction, cationic transfection (e.g., using a cationic polymer such as DEAE- dextran or a cationic lipid such as lipofectamine), calcium phosphate transfection, microinjection, particle bombardment, electroporation, and nanoparticle transfection (for more details, see e.g., Kim, T.K. and Eberwine, J.H. (2010) Anal. Bioanal. Chem.397:3173-3178).
[0210] In some embodiments, the producer cell line is derived from a primate cell line (e.g., a non-human primate cell line, such as a Vero or FRhL-2 cell line). In some embodiments, the cell line is derived from a human cell line. In some embodiments, the producer cell line is derived from HeLa, 293, A549, or PERC.6® (Crucell) cells. For example, prior to introduction and/or stable maintenance/integration of nucleic acid encoding AAV rep and cap genes and/or the rAAV genome into a cell line to generate a producer cell line, the cell line is a HeLa, 293, A549, or PERC.6® (Crucell) cell line, or a derivative thereof.
[0211] In some embodiments, the producer cell line is adapted for growth in suspension. As is known in the art, anchorage-dependent cells are typically not able to grow in suspension without a substrate, such as microcarrier beads. Adapting a cell line to grow in suspension may include, for example, growing the cell line in a spinner culture with a stirring paddle, using a culture medium that lacks calcium and magnesium ions to prevent clumping (and optionally an antifoaming agent), using a culture vessel coated with a siliconizing compound, and selecting cells in the culture (rather than in large clumps or on the sides of the vessel) at each passage.
[0212] AAV particles of the disclosure may be harvested from AAV production cultures by lysis of the host cells of the production culture or by harvest of the spent media from the production culture, provided the cells are cultured under conditions known in the art to cause release of AAV particles into the media from intact cells, as described more fully in U.S. Patent No.6, 566,118). Suitable methods of lysing cells are also known in the art and include for example multiple freeze/thaw cycles, sonication, microfluidization, and treatment with chemicals, such as detergents and/or proteases.
[0213] In a further embodiment, the AAV particles are purified. The term “purified” as used herein includes a preparation of AAV particles devoid of at least some of the other components that may also be present where the AAV particles naturally occur or are initially prepared from. Thus, for example, isolated AAV particles may be prepared using a purification technique to enrich it from a source mixture, such as a culture lysate or production culture supernatant. Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase-resistant particles (DRPs) or genome copies (gc) present in a solution, or by infectivity, or it can be measured in relation to a second, potentially interfering substance present in the source mixture, such as contaminants, including production culture contaminants or in-process contaminants, including helper virus, media components, and the like.
[0214] In some embodiments, the AAV production culture harvest is clarified to remove host cell debris. In some embodiments, the production culture harvest is clarified by filtration through a series of depth filters including for example a grade DOHC Millipore Millistak+ HC Pod Filter, a grade A1HC Millipore Millistak+ HC Pod Filter, and a 0.2 pm Filter Opticap XL 10 Millipore Express SHC Hydrophilic Membrane filter. Clarification can also be achieved by a variety of other standard techniques known in the art, such as, centrifugation or filtration through any cellulose acetate filter of 0.2 pm or greater pore size known in the art.
[0215] In some embodiments, the AAV production culture harvest is further treated with Benzonase® to digest any high molecular weight DNA present in the production culture. In some embodiments, the Benzonase® digestion is performed under standard conditions known in the art including, for example, a final concentration of 1-2.5 units/ml of Benzonase® at a temperature ranging from ambient to 37°C for a period of 30 minutes to several hours. [0216] AAV particles may be isolated or purified using one or more of the following purification steps: equilibrium centrifugation; flow-through anionic exchange filtration; tangential flow filtration (TFF) for concentrating the AAV particles; AAV capture by apatite chromatography; heat inactivation of helper virus; AAV capture by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and AAV capture by anionic exchange chromatography, cationic exchange chromatography, or affinity chromatography. These steps may be used alone, in various combinations, or in different orders. In some embodiments, the method comprises all the steps in the order as described below. Methods to purify AAV particles are found, for example, in Xiao et al., (1998) Journal of Virology 72:2224-2232; US Patent Numbers 6,989,264 and 8,137,948; and WO 2010/148143.
[0217] In some embodiments in which the gene therapy agent comprises an AAV particle, the transgene product (e.g., a therapeutic polypeptide or therapeutic nucleic acid) can be expressed and/or synthesized in a subject for at least about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 22 weeks, about 24 weeks, or about 26 weeks. In some embodiments, a transgene product may, e.g., supply a polypeptide and/or enzymatic activity that is absent or present at a reduced level in a cell or organism. In some embodiments, a transgene product may supply a polypeptide and/or enzymatic activity that indirectly counteracts an imbalance in a cell or organism. In some embodiments, a change in expression of the transgene product comprises changes in expression levels of a therapeutic nucleic acid and/or an endogenous nucleic acid in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control). In some embodiments, a change in synthesis of a transgene product comprises changes in synthesis levels of a therapeutic polypeptide encoded by a transgene product and/or an endogenous polypeptide in a cell or organism of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 100% relative to baseline (e.g., from before treatment or from negative control).
2. Adenoviral Vector
[0218] In some embodiments, the one or more gene therapy agents comprise one or more adenovirus particles, e.g., a plurality of adenovirus particles, such as a library of adenovirus particles. Adenoviral vectors for gene therapy are typically adenoviral particles with a recombinant adenovirus (rAd) genome comprising one or more heterologous sequences (i.e., nucleic acid sequence not of adenoviral origin) between two adenoviral ITRs encapsidated into an adenoviral capsid. In some embodiments, the heterologous sequence encodes a therapeutic transgene. In some embodiments, the rAd genome lacks or contains a defective copy of one or more El genes, which renders the adenovirus replication- defective. Adenoviruses include a linear, double-stranded DNA genome within a large (~950A), nonenveloped icosahedral capsid. Adenoviruses have a large genome that can incorporate more than 30kb of heterologous sequence (e.g., in place of the El and/or E3 region) making them uniquely suited for use with larger heterologous genes. They are also known to infect dividing and non-dividing cells and do not naturally integrate into the host genome (although hybrid variants may possess this ability). In some embodiments, the adenoviral vector may be a first generation adenoviral vector with a heterologous sequence in place of El. In some embodiments, the adenoviral vector may be a second generation adenoviral vector with additional mutations or deletions in E2A, E2B, and/or E4. In some embodiments, the adenoviral vector may be a third generation or gutted adenoviral vector that lacks all viral coding genes, retaining only the ITRs and packaging signal and requiring a helper adenovirus in trans for replication, and packaging. Adenoviral particles have been investigated for use as vectors for transient transfection of mammalian cells as well as gene therapy vectors. For further description, see, e.g., Danthinne, X. and Imperiale, M.J. (2000) Gene Ther.7: 1707-14 and Tatsis, N. and Ertl, H.C. (2004) Mol. Ther.10:616-29.
[0219] In some embodiments, the adenoviral particle comprises a rAd genome comprising a therapeutic transgene. Use of any adenovirus serotype is considered within the scope of the present disclosure. In some embodiments, the adenoviral particle is derived from an adenovirus serotype, including without limitation, AdHu2, AdHu 3, AdHu4, AdHu5, AdHu7, AdHul l, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6, AdC7, AdC69, bovine Ad type 3, canine Ad type 2, ovine Ad, and porcine Ad type 3, or a functional variant thereof. The adenoviral particle also comprises capsid proteins. In some embodiments, the adenoviral particle includes one or more foreign viral capsid proteins. Such combinations may be referred to as pseudotyped adenoviral particles. In some embodiments, foreign viral capsid proteins used in pseudotyped adenoviral particles are derived from a foreign virus or from another adenovirus serotype. In some embodiments, the foreign viral capsid proteins are derived from, including without limitation, reovirus type 3. Examples of vector and capsid protein combinations used in pseudotyped adenovirus particles can be found in the following references (Tatsis, N. et al. (2004) Mol. Ther.10(4):616-629 and Ahi, Y. et al. (2011) Curr. Gene Ther. 11(4): 307-320). Different adenovirus serotypes can be used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue). Tissues or cells targeted by specific adenovirus serotypes, include without limitation, lung (e.g. HuAd3), spleen and liver (e.g. HuAd37), smooth muscle, synoviocytes, dendritic cells, cardiovascular cells, tumor cell lines (e.g. HuAdl 1), and dendritic cells (e.g. HuAd5 pseudotyped with reovirus type 3, HuAd30, or HuAd35). For further description, see Ahi, Y. et al. (2011) Curr. Gene Ther. 11(4):307-320, Kay, M. et al. (2001) Nat. Med.7(l):33- 40, and Tatsis, N. et al. (2004) Mol. Ther. 10(4):616-629.
[0220] Numerous methods are known in the art for production of adenoviral particles. For example, for a gutted adenoviral vector, the adenoviral vector genome and a helper adenovirus genome may be transfected into a packaging cell line (e.g., a 293 cell line). In some embodiments, the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes may be transfected into a packaging cell line that expresses a recombinase (e.g., the Cre/loxP system may be used), such that the adenoviral vector of interest is packaged more efficiently than the helper adenovirus (see, e.g., Alba, R. et al. (2005) Gene Ther. 12 Suppl 1 : S 18-27). Adenoviral vectors may be harvested and purified using standard methods, such as those described herein.
3. Lentiviral Vector
[0221] In some embodiments, the one or more gene therapy agents comprise one or more lentivirus particles, e.g., a plurality of lentivirus particles, such as a library of lentivirus particles. Lentiviral vectors for gene therapy are typically lentiviral particles with a recombinant lentivirus genome comprising one or more heterologous sequences (i.e., nucleic acid sequence not of lentiviral origin) between two long terminal repeats (LTRs). In some embodiments, the heterologous sequence encodes a therapeutic transgene. Lentiviruses are positive-sense, ssRNA retroviruses with a genome of approximately 10 kb. Lentiviruses integrate into the genome of dividing and non-dividing cells. Lentiviral particles may be produced, for example, by transfecting multiple plasmids (typically the lentiviral genome and the genes required for replication and/or packaging are separated to prevent viral replication) into a packaging cell line, which packages the modified lentiviral genome into lentiviral particles. In some embodiments, a lentiviral particle may refer to a first generation vector that lacks the envelope protein. In some embodiments, a lentiviral particle may refer to a second- generation vector that lacks all genes except the gag/pol and tat/rev regions. In some embodiments, a lentiviral particle may refer to a third generation vector that only contains the endogenous rev, gag, and pol genes and has a chimeric LTR for transduction without the tat gene (see Dull, T. et al. (1998) J. Virol. 72:8463-71). For further description, see Durand, S. and Cimarelli, A. (2011) Viruses 3:132-59.
[0222] In some embodiments, the lentiviral particle is pseudotyped with vesicular stomatitis virus (VSV), lymphocytic choriomeningitis virus (LCMV), Ross river virus (RRV), Ebola virus, Marburg virus, Mokala virus, Rabies virus, RD114, or a functional variant thereof. [0223] Use of any lentiviral vector is considered within the scope of the present disclosure. In some embodiments, the lentiviral vector is derived from a lentivirus including, without limitation, human immunodeficiency virus-1 (HIV-1), human immunodeficiency virus-2 (HIV- 2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), visna virus (VV), and caprine arthritis encephalitis virus (CAEV). The lentiviral particle also comprises capsid proteins. In some embodiments, the lentivirus particles include one or more foreign viral capsid proteins. Such combinations may be referred to as pseudotyped lentiviral particles. In some embodiments, foreign viral capsid proteins used in pseudotyped lentiviral particles are derived from a foreign virus. In some embodiments, the foreign viral capsid protein used in pseudotyped lentiviral particles is Vesicular stomatitis virus glycoprotein (VSV-GP). VSV-GP interacts with a ubiquitous cell receptor, providing broad tissue tropism to pseudotyped lentiviral particles. In addition, VSV- GP is thought to provide higher stability to pseudotyped lentiviral particles. In other embodiments, the foreign viral capsid proteins are derived from, including without limitation, Chandipura virus, Rabies virus, Mokola virus, Lymphocytic choriomeningitis virus (LCMV), Ross River virus (RRV), Sindbis virus, Semliki Forest virus (SFV), Venezuelan equine encephalitis virus, Ebola virus Reston, Ebola virus Zaire, Marburg virus, Lassa virus, Avian leukosis virus (ALV), Jaagsiekte sheep retrovirus (JSRV), Moloney Murine leukemia virus (MLV), Gibbon ape leukemia virus (GALV), Feline endogenous retrovirus (RD114), Human T-lymphotropic virus 1 (HTLV-1), Human foamy virus, Maedi-visna virus (MW), SARS- CoV, Sendai virus, Respiratory syncytia virus (RSV), Human parainfluenza virus type 3, Hepatitis C virus (HCV), Influenza virus, Fowl plague virus (FPV), or Autographa californica multiple nucleopolyhedro virus (AcMNPV). Examples of vector and capsid protein combinations used in pseudotyped lentivirus particles can be found, for example, in Cronin, J. et al. (2005). Curr. Gene Ther.5(4):387-398. Different pseudotyped lentiviral particles can be used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue). For example, tissues targeted by specific pseudotyped lentiviral particles, include without limitation, liver (e.g. pseudotyped with a VSV-G, LCMV, RRV, or SeV F protein), lung (e.g. pseudotyped with an Ebola, Marburg, SeV F and HN, or JSRV protein), pancreatic islet cells (e.g. pseudotyped with an LCMV protein), central nervous system (e.g. pseudotyped with a VSV-G, LCMV, Rabies, or Mokola protein), retina (e.g. pseudotyped with a VSV-G or Mokola protein), monocytes or muscle (e.g. pseudotyped with a Mokola or Ebola protein), hematopoietic system (e.g. pseudotyped with an RD114 or GALV protein), or cancer cells (e.g. pseudotyped with a GALV or LCMV protein). For further description, see Cronin, J. et al. (2005). Curr. Gene Ther.5(4):387-398 and Kay, M. et al. (2001) Nat. Med.7(l):33-40.
[0224] Numerous methods are known in the art for production of lentiviral particles. For example, for a third-generation lentiviral vector, a vector containing the recombinant lentiviral genome of interest with gag and pol genes may be co-transfected into a packaging cell line (e.g., a 293 cell line) along with a vector containing a rev gene. The recombinant lentiviral genome of interest also contains a chimeric LTR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. 72:8463-71). Lentiviral vectors may be harvested and purified using methods (e.g., Segura MM, et al., (2013) Expert Opin Biol Ther.13(7):987-1011) described herein.
4. Herpes Simplex Virus
[0225] In some embodiments, the one or more gene therapy agents comprise one or more HSV particles, e.g., a plurality of HSV particles, such as a library of HSV particles. HSV vectors for gene therapy are typically HSV particles with a recombinant HSV genome comprising one or more heterologous sequences (i.e., nucleic acid sequence not of HSV origin) between two terminal repeats (TRs). In some embodiments, the heterologous sequence encodes a therapeutic transgene. HSV is an enveloped, double-stranded DNA virus with a genome of approximately 152 kb. Advantageously, approximately half of its genes are nonessential and may be deleted to accommodate heterologous sequence. HSV particles infect non-dividing cells. In addition, they naturally establish latency in neurons, travel by retrograde transport, and can be transferred across synapses, making them advantageous for transfection of neurons and/or gene therapy approaches involving the nervous system. In some embodiments, the HSV particle may be replication- defective or replication-competent (e.g., competent for a single replication cycle through inactivation of one or more late genes). For further description, see Manservigi, R. et al. (2010) Open Virol. J.4: 123-56.
[0226] In some embodiments, the HSV particle is an HSV-1 particle or an HSV-2 particle, or a functional variant thereof.
[0227] In some embodiments, the HSV particle comprises a recombinant HSV genome comprising a transgene. Use of any HSV vector is considered within the scope of the present disclosure. In some embodiments, the HSV vector is derived from a HSV serotype, including without limitation, HSV-1 and HSV-2. The HSV particle also comprises capsid proteins. In some embodiments, the HSV particles include one or more foreign viral capsid proteins. Such combinations may be referred to as pseudotyped HSV particles. In some embodiments, foreign viral capsid proteins used in pseudotyped HSV particles are derived from a foreign virus or from another HSV serotype. In some embodiments, the foreign viral capsid protein used in a pseudotyped HSV particle is a Vesicular stomatitis virus glycoprotein (VSV-GP). VSV-GP interacts with a ubiquitous cell receptor, providing broad tissue tropism to pseudotyped HSV particles. In addition, VSV-GP is thought to provide higher stability to pseudotyped HSV particles. In other embodiments, the foreign viral capsid protein may be from a different HSV serotype. For example, an HSV-1 vector may contain one or more HSV-2 capsid proteins. Different HSV serotypes can be used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue). Tissues or cells targeted by specific adenovirus serotypes include without limitation, central nervous system and neurons (e.g. HSV-1). For further description, see Manservigi, R. et al. (2010) Open Virol J 4: 123-156, Kay, M. et al. (2001) Nat. Med.7(l):33- 40, and Meignier, B. et al. (1987) J. Infect. Dis. l55(5):921-930.
[0228] Numerous methods are known in the art for production of HSV particles. HSV vectors may be harvested and purified using standard methods, such as those described herein. For example, for a replication-defective HSV vector, an HSV genome of interest that lacks all of the immediate early (IE) genes may be transfected into a complementing cell line that provides genes required for virus production, such as ICP4, ICP27, and ICP0 (see, e.g., Samaniego, L.A. et al. (1998) J. Virol.72:3307-20). HSV vectors may be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology 1144:63-79). 5. Non-viral Gene Transfer
[0229] In some embodiments, the one or more gene therapy agents comprise one or more non-viral gene therapy agent, e.g., a plurality of non-viral gene therapy agents, such as a library of non-viral gene therapy agents. A non-viral gene therapy agent may comprise a non- viral vector delivery system. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed to a delivery system. For example, the vector may be complexed to a lipid (e.g., a cationic or neutral lipid, and/or a targeted lipid), a liposome, a polycation, a lipid nanoparticle, or an agent that enhances the cellular uptake of nucleic acid. The nucleic acid may be complexed to an agent suitable for any of the delivery methods described herein. In some embodiments, the nucleic acid encodes a therapeutic transgene. [0230] In some embodiments, the one or more gene therapy agents comprise one or more lipid nanoparticles, e.g., a plurality of lipid nanoparticles. In some embodiments, the one or more lipid nanoparticles each comprise an expression cassette encoding an RNA comprising a capture sequence and a differential barcode. In some embodiments, the expression cassette encoding an RNA comprising a capture sequence and an identifying sequence is operably linked to an RNAP III promoter. In some embodiments, the one or more lipid nanoparticles each comprise multiple expression cassettes.
[0231] Lipid nanoparticles for gene therapy typically comprise a vector genome encapsulated in a lipid particle or a vector genome complexed with a lipid. In some embodiments, the heterologous sequence encodes a therapeutic transgene. In some embodiments, the vector genome is formulated in a lipoplex nanoparticle or liposome. In some embodiments, a lipoplex nanoparticle formulation for the gene therapy agent comprises the synthetic cationic lipid (R)-N,N,N-trimethyl-2,3-dioleyloxy-l-propanaminium chloride (DOTMA) and the phospholipid l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE). In some embodiments, the DOTMA/DOPE liposomal component is optimized for delivery and targeting of cells in the individual.
[0232] In some embodiments, nucleic acid comprising the vector genome is mixed with a pharmaceutical composition comprising one or more cationic lipids, including, e.g., (R)- N,N,N-trimethyl-2,3-dioleyloxy-l-propanaminium chloride (DOTMA) and the phospholipid l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE). In some embodiments, the pharmaceutical composition comprises at least one lipid. In some embodiments, the pharmaceutical composition comprises at least one cationic lipid. The cationic lipid can be monocationic or poly cationic. Any cationic amphiphilic molecule, e.g., a molecule which comprises at least one hydrophilic and lipophilic moiety is a cationic lipid within the meaning of the present disclosure. In some embodiments, the positive charges are contributed by the at least one cationic lipid and the negative charges are contributed by the nucleic acid. In some embodiments, the pharmaceutical composition comprises at least one helper lipid. The helper lipid may be a neutral or an anionic lipid. The helper lipid may be a natural lipid, such as a phospholipid or an analogue of a natural lipid, or a fully synthetic lipid, or lipid-like molecule, with no similarities with natural lipids. In one embodiment, the cationic lipid and/or the helper lipid is a bilayer forming lipid. Examples of helper lipids include, but are not limited to, 1,2-di- (9Z-octadecenoyl)-sn-glycero-3 -phosphoethanolamine (DOPE) or analogs or derivatives thereof, cholesterol (Choi) or analogs or derivatives thereof and/or 1,2-di oleoyl-sn-glycero-3- phosphocholine (DOPC) or analogs or derivatives thereof. [0233] In some embodiments, the molar ratio of the at least one cationic lipid to the at least one helper lipid is from 10:0 to 3:7, preferably 9: 1 to 3:7, 4: 1 to 1 :2, 4: 1 to 2:3, 7:3 to 1 : 1, or 2: 1 to 1 : 1, preferably about 1 : 1. In some embodiments, in this ratio, the molar amount of the cationic lipid results from the molar amount of the cationic lipid multiplied by the number of positive charges in the cationic lipid.
[0234] In some embodiments, the lipid is comprised in a vesicle encapsulating the vector genome. The vesicle may be a multilamellar vesicle, an unilamellar vesicle, or a mixture thereof. The vesicle may be a liposome.
6. Vector Genomes
[0235] In some embodiments, the one or more gene therapy agents comprise one or more therapeutic transgenes, e.g., a plurality of therapeutic transgenes, such as a library of therapeutic transgenes. In some embodiments, the one or more gene therapy agents comprise one or more vector genome for delivery and expression of the therapeutic transgene in the desired target in the individual.
[0236] The present disclosure contemplates the use of one or more gene therapy agents for the introduction of one or more nucleic acid sequences encoding a therapeutic polypeptide and/or nucleic acid for packaging into a viral particle (for viral gene therapy agents). The vector genome may include any element to establish the expression of the therapeutic polypeptide and/or nucleic acid, for example, a promoter, an ITR of the present disclosure, a ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal, and/or origin of replication. [0237] In some embodiments, the therapeutic transgene encodes a therapeutic polypeptide. A therapeutic polypeptide may, e.g., supply a polypeptide and/or enzymatic activity that is absent or present at a reduced level in a cell or organism. Alternatively, a therapeutic polypeptide may supply a polypeptide and/or enzymatic activity that indirectly counteracts an imbalance in a cell or organism. For example, a therapeutic polypeptide for a disorder related to buildup of a metabolite caused by a deficiency in a metabolic enzyme or activity may supply a missing metabolic enzyme or activity, or it may supply an alternate metabolic enzyme or activity that leads to reduction of the metabolite. A therapeutic polypeptide may also be used to reduce the activity of a polypeptide (e.g., one that is overexpressed, activated by a gain-of-function mutation, or whose activity is otherwise misregulated) by acting, e.g., as a dominant-negative polypeptide.
[0238] The vector genomes of the disclosure may encode polypeptides that are intracellular proteins, anchored in the cell membrane, remain within the cell, or are secreted by the cell transduced with the vectors of the disclosure. For polypeptides secreted by the cell that receives the vector; the polypeptide can be soluble (i.e., not attached to the cell). For example, soluble polypeptides are devoid of a transmembrane region and are secreted from the cell. Techniques to identify and remove nucleic acid sequences which encode transmembrane domains are known in the art.
[0239] In some embodiments, the vector genome of the disclosure encodes polypeptides used to treat a disease or disorder in an individual. Diseases and disorders treated by the gene therapy agent of the disclosure include but are not limited to Huntington disease (HD), progressive supranuclear palsy (PSP), multiple system atrophy (MSA), metachromatic leukodystrophy (MLD), amyotrophic lateral sclerosis (ALS), age-related macular degeneration (AMD), congenital muscular dystrophy (CMD), phenylketonuria (PKU), muscular dystrophy (MD), Al AT deficiency, focal segmental glomerulosclerosis (FSGS), cystinuria, hemophilia A, hemophilia B, Gaucher disease (GBA), Parkinson’s disease (PD), and Pompe disease.
[0240] In some embodiments, the therapeutic polypeptide is huntingtin (HTT), tau, amyloid precursor protein, alpha-synuclein, pseudoarylsulfatase (ARSA), superoxide dismutase 1 (SOD1), phenylalanine hydroxylase (PAH), dystrophin, alpha- 1 -antitrypsin (A1AT), cysteine transporter, Factor VIII (FVIII), Factor IX (FIX), acid beta-glucosidase, glial-derived growth factor (GDNF), brain-derived growth factor (BDNF), tyrosine hydroxlase (TH), GTP- cyclohydrolase (GTPCH), and/or amino acid decarboxylase (AADC), or alpha glucosidase. [0241] In some embodiments, a heterologous transgene may include without limitation an DNA, mRNA, closed-end DNA (ceDNA), siRNA, an shRNA, an RNAi, a miRNA, an antisense RNA.
[0242] In some embodiments, the heterologous nucleic acid encodes a therapeutic nucleic acid e.g. that can be used to replace, or knock down, one or more defective genes. In some embodiments, a therapeutic nucleic acid may include without limitation an DNA, siRNA, an shRNA, an RNAi, a miRNA, an antisense RNA, a ribozyme or a DNAzyme. As such, a therapeutic nucleic acid may encode an RNA that when transcribed from the nucleic acids of the vector can treat a disorder by interfering with translation or transcription of an abnormal or excess protein associated with a disorder of the disclosure. For example, the nucleic acids of the disclosure may encode for an RNA which treats a disorder by highly specific elimination or reduction of mRNA encoding the abnormal and/or excess proteins. Therapeutic RNA sequences include RNAi, small inhibitory RNA (siRNA), micro RNA (miRNA), and/or ribozymes (such as hammerhead and hairpin ribozymes) that can treat disorders by highly specific elimination or reduction of mRNA encoding the abnormal and/or excess proteins.
[0243] In some embodiments, the therapeutic polypeptide or therapeutic nucleic acid is used to treat a disorder of the CNS. Without wishing to be bound to theory, it is thought that a therapeutic polypeptide or therapeutic nucleic acid may be used to replace a mutated gene with a wild type or improved gene, reduce or eliminate the expression and/or activity of a polypeptide whose gain-of-function has been associated with a disorder, or to enhance the expression and/or activity of a polypeptide to complement a deficiency that has been associated with a disorder (e.g., a mutation in a gene whose expression shows similar or related activity). Non-limiting examples of disorders of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure (exemplary genes that may be targeted or supplied are provided in parenthesis for each disorder) include stroke (e.g., caspase-3, Beclinl, Askl, PARI, HIFla, PUMA, and/or any of the genes described in Fukuda, A.M. and Badaut, J. (2013) Genes (Basel) 4:435-456), Huntington’s disease (mutant HTT), epilepsy (e.g., SCN1A, NMD AR, ADK, and/or any of the genes described in Boison, D. (2010) Epilepsia 51 : 1659-1668), Parkinson’s disease (alpha-synuclein), Lou Gehrig’s disease (also known as amyotrophic lateral sclerosis; SOD1), Alzheimer’s disease (tau, amyloid precursor protein), corticobasal degeneration or CBD (tau), corticogasal ganglionic degeneration or CBGD (tau), frontotemporal dementia or FTD (tau), progressive supranuclear palsy or PSP (tau), multiple system atrophy or MSA (alpha- synuclein), cancer of the brain (e.g., a mutant or overexpressed oncogene implicated in brain cancer), and lysosomal storage diseases (LSD). Disorders of the disclosure may include those that involve large areas of the cortex, e.g., more than one functional area of the cortex, more than one lobe of the cortex, and/or the entire cortex. Other non-limiting examples of disorders of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure include traumatic brain injury, enzymatic dysfunction disorders, psychiatric disorders (including post-traumatic stress syndrome), neurodegenerative diseases, and cognitive disorders (including dementias, autism, and depression). Enzymatic dysfunction disorders include without limitation leukodystrophies (including Canavan’s disease) and any of the lysosomal storage diseases described below.
[0244] In some embodiments, the therapeutic polypeptide or therapeutic nucleic acid is used to treat a lysosomal storage disease. As is commonly known in the art, lysosomal storage diseases are rare, inherited metabolic disorders characterized by defects in lysosomal function. Such disorders are often caused by a deficiency in an enzyme required for proper mucopolysaccharide, glycoprotein, and/or lipid metabolism, leading to a pathological accumulation of lysosomally stored cellular materials. Non-limiting examples of lysosomal storage diseases of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure (exemplary genes that may be targeted or supplied are provided in parenthesis for each disorder) include Gaucher disease type 2 or type 3 (acid beta-glucosidase, GBA), GM1 gangliosidosis (beta-galactosidase- 1, GLB1), Hunter disease (iduronate 2-sulfatase, IDS), Krabbe disease (galactosylceramidase, GALC), a mannosidosis disease (a mannosidase, such as alpha-D- mannosidase, MAN2B1), p mannosidosis disease (beta-mannosidase, MANBA), metachromatic leukodystrophy disease (pseudoarylsulfatase A, ARSA), mucolipidosisII/III disease (N- acetylglucosamine-1 -phosphotransferase, GNPTAB), Niemann-Pick A disease (acid sphingomyelinase, ASM), Niemann-Pick C disease (Niemann-Pick C protein, NPC1), Pompe disease (acid alpha- 1,4-glucosidase, GAA), Sandhoff disease (hexosaminidase beta subunit, HEXB), Sanfilippo A disease (N- sulfoglucosamine sulfohydrolase, MPS3 A), Sanfilippo B disease (N-alpha- acetylglucosaminidase, NAGLU), Sanfilippo C disease (heparin acetyl- CoA:alpha- glucosaminidase N-acetyltransferase, MPS3C), Sanfilippo D disease (N- acetylglucosamine- 6-sulfatase, GNS), Schindler disease (alpha-N-acetylgalactosaminidase, NAGA), Sly disease (beta-glucuronidase, GUSB), Tay-Sachs disease (hexosaminidase alpha subunit, HEXA), and Wolman disease (lysosomal acid lipase, LIPA). [0245] In some embodiments, the therapeutic polypeptide encodes Factor VIII, Factor IX, myotubularin, survival motor neuron protein (SMN), retinoid isomerohydrolase (RPE65), NADH-ubiquinone oxidoreductase chain 4, Choroideremia protein (CHM), ornithine transcarbomylase, argininosuccinate synthetase, P-globin, y-globin, phenylalanine hydroxylase, adrenoleukodystrophy protein (ALD), dystrophin, a truncated dystrophin, an anti-VEGF agent, or a functional variant thereof.
[0246] In some embodiments, the heterologous nucleic acid is operably linked to a promoter. Exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, the RSV LTR, the MoMLV LTR, the phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter and a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HB V promoter, an hAAT promoter, a LSP promoter, chimeric liver-specific promoters (LSPs), the E2F promoter, the telomerase (hTERT) promoter; the cytomegalovirus enhancer/chicken beta- actin/Rabbit P-globin promoter (CAG promoter; Niwa et al., Gene, 1991, 108(2): 193-9) and the elongation factor 1- alpha promoter (EFl-alpha) promoter (Kim et al., Gene, 1990, 91(2):217-23 and Guo et al., Gene Then, 1996, 3(9):802-10). In some embodiments, the promoter comprises a human P- glucuronidase promoter or a cytomegalovirus enhancer linked to a chicken P-actin (CB A) promoter. The promoter can be a constitutive, inducible or repressible promoter. In some embodiments, the disclosure provides a recombinant vector comprising nucleic acid encoding a heterologous transgene of the present disclosure operably linked to a CBA promoter. Exemplary promoters and descriptions may be found, e.g., in U.S. PG Pub.20140335054.
[0247] Examples of constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41 :521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13 -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen],
[0248] Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346- 3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268: 1766- 1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486- inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only. [0249] In another embodiment, the native promoter, or fragment thereof, for the transgene will be used. The native promoter can be used when it is desired that expression of the transgene should mimic the native expression. The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissuespecific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.
[0250] In some embodiments, the regulatory sequences impart tissue-specific gene expression capabilities. In some embodiments, the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art.
[0251] In some embodiments, the vector comprises an intron. For example, in some embodiments, the intron is a chimeric intron derived from chicken beta-actin and rabbit betaglobin. In some embodiments, the intron is a minute virus of mice (MVM) intron.
[0252] In some embodiments, the vector comprises a polyadenylation (poly A) sequence. Numerous examples of polyadenylation sequences are known in the art, such as a bovine growth hormone (BGH) Poly(A) sequence (see, e.g., accession number EF592533), an SV40 polyadenylation sequence, and an HSV TK pA polyadenylation sequence. F. Pharmaceutical Compositions and Formulations
[0253] In some embodiments, a gene therapy agent, pharmaceutical composition, or formulation described herein is administered to a subject by any one or more of various administration routes, including but not limited to, parenteral, oral, buccal, rectal, sublingual, or transdermal administration routes. In some embodiments, the one or more gene therapy agents are administered locally. In some embodiments, the one or more gene therapy agents are administered intravitreally, intracam erally, retinally, intrathecally, intramuscularly, intrarenally, intramuscularly, intracranially, intra-CSF, intra-DRG, intracerebroventricularly, intraocularly, intracistema magna, intrahepatically, intravitreally or intracam erally. In some embodiments, the one or more gene therapy agents are administered bilaterally or unilaterally. In some embodiments, one or more gene therapy agents are administered systemically. In some embodiments, the one or more gene therapy agent are administered intravenously, intraperitoneally, intra-arterially, or subcutaneously.
[0254] In some embodiments, parenteral administration comprises intravenous, subcutaneous, intramuscular, intracerebral, intranasal, intra-arterial, intra-articular, intradermal, intravitreal, intraosseous infusion, intraperitoneal, intracranial, intra- cerebrospinal fluid (CSF), intra-dorsal root ganglia (DRG), intraocular, intracisterna magna, or intrathecal administration. In some embodiments, the pharmaceutical composition is formulated for local administration. In other instances, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition and formulations described herein are administered to a subject by intravenous, subcutaneous, and intramuscular administration. In some embodiments, the pharmaceutical composition and formulations described herein are administered to a subject by intravenous administration. In some embodiments, the pharmaceutical composition and formulations described herein are administered to a subject by administration. In some embodiments, the pharmaceutical composition and formulations described herein are administered to a subject by intramuscular administration.
[0255] In some embodiments, the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, dragees, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.
[0256] In some embodiments, the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) include a carrier or carrier materials selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995), Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975, Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980, and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkinsl999).
[0257] In some embodiments, the pharmaceutical composition (e.g., comprising a gene therapy agent described herein) is formulated as an immunoliposome, which comprises an IL-2 conjugate and/or a gene therapy agent or a plurality of IL-2 conjugates and/or a plurality of gene therapy agents bound either directly or indirectly to lipid bilayer of liposomes. Exemplary lipids include, but are not limited to, fatty acids; phospholipids; sterols such as cholesterols; sphingolipids such as sphingomyelin; glycosphingolipids such as gangliosides, globocides, and cerebrosides; surfactant amines such as stearyl, oleyl, and linoleyl amines. In some embodiments, the lipid comprises a cationic lipid. In some embodiments, the lipid comprises a phospholipid. Exemplary phospholipids include, but are not limited to, phosphatidic acid (“PA”), phosphatidylcholine (“PC”), phosphatidylglycerol (“PG”), phophatidylethanolamine (“PE”), phophatidylinositol (“PI”), and phosphatidyl serine (“PS”), sphingomyelin (including brain sphingomyelin), lecithin, lysolecithin, lysophosphatidylethanolamine, cerebrosides, diarachidoylphosphatidylcholine (“DAPC”), didecanoyl-L-alpha-phosphatidylcholine (“DDPC”), dielaidoylphosphatidylcholine (“DEPC”), dilauroylphosphatidylcholine (“DLPC”), dilinoleoylphosphatidylcholine, dimyristoylphosphatidylcholine (“DMPC”), dioleoylphosphatidylcholine (“DOPC”), dipalmitoylphosphatidylcholine (“DPPC”), distearoylphosphatidylcholine (“DSPC”), 1- palmitoyl-2-oleoyl-phosphatidylcholine (“POPC”), diarachidoylphosphatidylglycerol (“DAPG”), didecanoyl-L-alpha-phosphatidylglycerol (“DDPG”), dielaidoylphosphatidylglycerol (“DEPG”), dilauroylphosphatidylglycerol (“DLPG”), dilinoleoylphosphatidylglycerol, dimyristoylphosphatidylglycerol (“DMPG”), dioleoylphosphatidylglycerol (“DOPG”), dipalmitoylphosphatidylglycerol (“DPPG”), distearoylphosphatidylglycerol (“DSPG”), l-palmitoyl-2-oleoyl-phosphatidylglycerol (“POPG”), diarachidoylphosphatidylethanolamine (“DAPE”), didecanoyl-L-alpha- phosphatidylethanolamine (“DDPE”), dielaidoylphosphatidylethanolamine (“DEPE”), dilauroylphosphatidylethanolamine (“DLPE”), dilinoleoylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine (“DMPE”), dioleoylphosphatidylethanolamine (“DOPE”), dipalmitoylphosphatidylethanolamine (“DPPE”), distearoylphosphatidylethanolamine (“DSPE”), l-palmitoyl-2-oleoyl- phosphatidylethanolamine (“POPE”), diarachidoylphosphatidylinositol (“DAPI”), didecanoyl-L-alpha-phosphatidylinositol (“DDPI”), dielaidoylphosphatidylinositol (“DEPI”), dilauroylphosphatidylinositol (“DLPI”), dilinoleoylphosphatidylinositol, dimyristoylphosphatidylinositol (“DMPI”), dioleoylphosphatidylinositol (“DOPI”), dipalmitoylphosphatidylinositol (“DPPI”), distearoylphosphatidylinositol (“DSPI”), 1- palmitoyl-2-oleoyl-phosphatidylinositol (“POPI”), diarachidoylphosphatidylserine (“DAPS”), didecanoyl-L-alpha-phosphatidylserine (“DDPS”), dielaidoylphosphatidylserine (“DEPS”), dilauroylphosphatidylserine (“DLPS”), dilinoleoylphosphatidylserine, dimyristoylphosphatidylserine (“DMPS”), dioleoylphosphatidylserine (“DOPS”), dipalmitoylphosphatidylserine (“DPPS”), distearoylphosphatidylserine (“DSPS”), 1- palmitoyl-2-oleoyl-phosphatidylserine (“POPS”), diarachidoyl sphingomyelin, didecanoyl sphingomyelin, dielaidoyl sphingomyelin, dilauroyl sphingomyelin, dilinoleoyl sphingomyelin, dimyristoyl sphingomyelin, sphingomyelin, dioleoyl sphingomyelin, dipalmitoyl sphingomyelin, distearoyl sphingomyelin, and l-palmitoyl-2-oleoyl- sphingomyelin.
[0258] In some embodiments, the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) further include pH adjusting agents or buffering agents which include acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids, bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tri s-hydroxymethylaminom ethane, and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases, and buffers are included in an amount required to maintain pH of the composition in an acceptable range.
[0259] In some embodiments, the pharmaceutical formulation includes one or more salts in an amount required to bring osmolality of the composition into an acceptable range. Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions, suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.
[0260] In some embodiments, the pharmaceutical formulations (e.g., comprisingagene therapy agent described herein) include, but are not limited to, sugars like trehalose, sucrose, mannitol, maltose, glucose, or salts like potassium phosphate, sodium citrate, ammonium sulfate and/or other agents such as heparin to increase the solubility and in vivo stability of polypeptides.
[0261] In some embodiments, the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) further include diluent that are used to stabilize compounds because they can provide a more stable environment. Salts dissolved in buffered solutions (which also can provide pH control or maintenance) are utilized as diluents in the art, including, but not limited to a phosphate buffered saline solution. In certain instances, diluents increase bulk of the composition to facilitate compression or create sufficient bulk for homogenous blend for capsule filling. Such compounds can include e.g., lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel®, dibasic calcium phosphate, dicalcium phosphate dihydrate, tricalcium phosphate, calcium phosphate, anhydrous lactose, spray-dried lactose, pregelatinized starch, compressible sugar, such as Di- Pac® (Amstar), mannitol, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose-based diluents, confectioner’s sugar, monobasic calcium sulfate monohydrate, calcium sulfate dihydrate, calcium lactate trihydrate, dextrates, hydrolyzed cereal solids, amylose, powdered cellulose, calcium carbonate, glycine, kaolin, mannitol, sodium chloride, inositol, bentonite, and the like. In some embodiments, the IL-2 conjugates and/or gene therapy agents disclosed herein may be used in pharmaceutical formulations comprising histidine, sorbitol, and polysorbate 80, or any combination that affords a stable formulation and can be administered to subjects in need thereof. In one embodiment, the IL-2 conjugates disclosed herein may be presented as a finished drug product in a suitable container, such as a vial, as follows: IL-2 conjugate (about 2 mg to about 10 mg); L-histidine (about 0.5 mg to about 2 mg); L-histidine hydrochloride (about 1 mg to about 2 mg); sorbitol (about 20 mg to about 80 mg); and polysorbate 80 (about 0.1 mg to about 0.2 mg); with a sufficient quantity of water for injection to provide a liquid formulation suitable for use in the disclosed methods.
[0262] In some embodiments, the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) include disintegration agents or disintegrants to facilitate the breakup or disintegration of a substance. The term “disintegrate” include both the dissolution and dispersion of the dosage form when contacted with gastrointestinal fluid. Examples of disintegration agents include a starch, e.g., a natural starch such as corn starch or potato starch, a pregelatinized starch such as National 1551 or Amijel®, or sodium starch glycolate such as Promogel® or Explotab®, a cellulose such as a wood product, methylcrystalline cellulose, e.g., Avicel®, Avicel® PH101, Avicel® PH102, Avicel® PH105, Elcema® P100, Emcocel®, Vivacel®, Ming Tia®, and Solka-Floc®, methylcellulose, croscarmellose, or a cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose (Ac-Di-Sol®), cross-linked carboxymethylcellulose, or cross-linked croscarmellose, a cross-linked starch such as sodium starch glycolate, a cross-linked polymer such as crospovidone, a cross-linked polyvinylpyrrolidone, alginate such as alginic acid or a salt of alginic acid such as sodium alginate, a clay such as Veegum® HV (magnesium aluminum silicate), a gum such as agar, guar, locust bean, Karaya, pectin, or tragacanth, sodium starch glycolate, bentonite, a natural sponge, a surfactant, a resin such as a cation- exchange resin, citrus pulp, sodium lauryl sulfate, sodium lauryl sulfate in combination starch, and the like.
[0263] In some embodiments, the pharmaceutical formulations (e.g., comprising a gene therapy agent described herein) include filling agents such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.
[0264] Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein (e.g., comprising a gene therapy agent described herein) for preventing, reducing or inhibiting adhesion or friction of materials. Exemplary lubricants include, e.g., stearic acid, calcium hydroxide, talc, sodium stearyl fumerate, a hydrocarbon such as mineral oil, or hydrogenated vegetable oil such as hydrogenated soybean oil (Sterotex®), higher fatty acids and their alkali-metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, glycerol, talc, waxes, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol (e.g., PEG-4000) or a methoxypolyethylene glycol such as Carbowax™, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica such as Syloid™, Cab-O-Sil®, a starch such as com starch, silicone oil, a surfactant, and the like.
[0265] Plasticizers include compounds used to soften the microencapsulation material or film coatings to make them less brittle. Suitable plasticizers include, e.g., polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose and triacetin. Plasticizers can also function as dispersing agents or wetting agents.
[0266] Solubilizers include compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium docusate, vitamin E TPGS, dimethylacetamide, N- methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide and the like.
[0267] Stabilizers include compounds such as any antioxidation agents, buffers, acids, preservatives and the like. Exemplary stabilizers include L-arginine hydrochloride, tromethamine, albumin (human), citric acid, benzyl alcohol, phenol, disodium biphosphate dehydrate, propylene glycol, metacresol or m-cresol, zinc acetate, polysorbate-20 or Tween® 20, or trometamol.
[0268] Suspending agents include compounds such as polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinyl pyrrolidone/vinyl acetate copolymer (S630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxy ethylcellulose, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone and the like.
[0269] Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF), and the like. Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils, e.g., polyoxyethylene (60) hydrogenated castor oil, and polyoxyethylene alkylethers and alkylphenyl ethers, e.g., octoxynol 10, octoxynol 40. Sometimes, surfactants is included to enhance physical stability or for other purposes.
[0270] Viscosity enhancing agents include, e.g., methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof.
[0271] Wetting agents include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium docusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts and the like.
[0272] In some embodiments, the disclosure is directed to a pharmaceutical composition comprising the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) as described herein. The pharmaceutical compositions may be suitable for any mode of administration described herein or known in the art.
[0273] In some embodiments, the pharmaceutical composition (e.g., comprising a gene therapy agent described herein) comprising a pharmaceutically acceptable excipient. As is well known in the art, pharmaceutically acceptable excipients are relatively inert substances that facilitate administration of a pharmacologically effective substance and can be supplied as liquid solutions or suspensions, as emulsions, or as solid forms suitable for dissolution or suspension in liquid prior to use. For example, an excipient can give form or consistency, or act as a diluent. Suitable excipients include but are not limited to stabilizing agents wetting and emulsifying agents salts for varying osmolarity encapsulating agents, pH buffering substances, and buffers. Such excipients include any pharmaceutical agent suitable for direct delivery to the eye which may be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, sorbitol, any of the various TWEEN compounds, and liquids such as water, saline, glycerol and ethanol. Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in REMINGTON’S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J.1991). In some embodiments, the pharmaceutical composition comprising a rAAV particle described herein and a pharmaceutically acceptable carrier is suitable for administration to human. Such carriers are well known in the art (see, e.g., Remington’s Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 and 1570-1580).
[0274] Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like. Saline solutions and aqueous dextrose, polyethylene glycol (PEG) and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. The pharmaceutical composition (e.g., comprising a gene therapy agent described herein) may further comprise additional ingredients, for example preservatives, buffers, tonicity agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, viscosity-increasing agents, and the like. The pharmaceutical compositions described herein (e.g., comprising a gene therapy agent described herein) can be packaged in single unit dosages or in multidosage forms. The compositions are generally formulated as sterile and substantially isotonic solution. Kits and Articles of Manufacture
[0275] The gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) as described herein may be contained within a kit or article of manufacture, e.g., designed for use in one of the methods of the disclosure as described herein.
[0276] In some embodiments, the kits or articles of manufacture further include instructions for administration of the gene therapy agent. The kits or articles of manufacture described herein may further include other materials desirable from a commercial and user standpoint including other buffers diluents filters needles syringes and package inserts with instructions for performing any methods described herein. Suitable packaging materials may also be included and may be any packaging materials known in the art, including, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and/or sealed.
[0277] In some embodiments, the kits or articles of manufacture further contain one or more of the buffers and/or pharmaceutically acceptable excipients described herein (e.g., as described in REMINGTON’ S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J.1991). In some embodiments, the kits or articles of manufacture include one or more pharmaceutically acceptable excipients, carriers, solutions, and/or additional ingredients described herein. The kits or articles of manufacture described herein can be packaged in single unit dosages or in multidosage forms. The contents of the kits or articles of manufacture are generally formulated as sterile and can be lyophilized or provided as a substantially isotonic solution.
G. Regimens
[0278] In some embodiments, the one or more gene therapy agents are administered 1 time, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times. In some embodiments, the gene therapy agent is administered 2 times. In some embodiments, the gene therapy agent is administered 1 time. In some embodiments, the gene therapy agent is administered 3 times.
[0279] In some embodiments, the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered once per day, twice per day, three times per day or more frequently. In some embodiments, pharmaceutical composition (e.g., comprising a gene therapy agent described herein) is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more. In some embodiments, the pharmaceutical composition (e.g., comprising a gene therapy agent described herein) is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.
[0280] In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once per week, once every two weeks, once every three weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, once every 20 weeks, once every 21 weeks, once every 22 weeks, once every 23 weeks, once every 24 weeks, once every 25 weeks, once every 26 weeks, once every 27 weeks, or once every 28 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once per week. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every two weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every three weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 4 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 5 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 6 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 7 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 8 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 9 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 10 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 11 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 12 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 13 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 14 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 15 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 16 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 17 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 18 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 19 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 20 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 21 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 22 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 23 weeks. In some embodiments, an effective amount of the pharmaceutical composition (e.g., comprising one or more gene therapy agents described herein) is administered to a subject in need thereof once every 24 weeks.
[0281] In some embodiments, the pharmaceutical compositions described herein (e.g., comprising a gene therapy agent described herein) are administered for therapeutic applications. Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, can be reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained.
[0282] In some embodiments, the amount of a given agent that correspond to such an amount varies depending upon factors such as the particular compound, the severity of the disease, the identity (e.g., weight) of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, and the subject or host being treated. In some embodiments, the desired dose is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.
[0283] The foregoing ranges are merely suggestive, as the number of variables in regard to an individual treatment regime is large, and considerable excursions from these recommended values are not uncommon. Such dosages are altered depending on a number of variables, not limited to the activity of the compound used, the disease or condition to be treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the practitioner.
[0284] In some embodiments, toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50. Compounds exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage varies within this range depending upon the dosage form employed and the route of administration utilized.
[0285] In some embodiments, the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) is useful for treating a disease or disorder suitable for treatment by gene therapy. In some embodiments, the disease or disorder is a monogenic disease or disorder. In some embodiments, the disease or disorder is a neurodegenerative ocular disease. Because the eye is a relatively small and contained anatomical structure, AAVs can be delivered locally. Therefore, ophthalmic gene therapy can potentially avoid systemic immune responses and provide therapeutic benefit at low capsid doses, making ophthalmology an excellent candidate for the gene therapy approach.
[0286] In some embodiments, the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) is useful for treating a disorder of the CNS. Non-limiting disorders of the CNS include stroke, Huntington’s disease, epilepsy, Parkinson’s disease, Lou Gehrig’s disease (also known as amyotrophic lateral sclerosis), Alzheimer’s disease, corticobasal degeneration or CBD, corticogasal ganglionic degeneration or CBGD, frontotemporal dementia or FTD, progressive supranuclear palsy or PSP, multiple system atrophy or MSA, cancer of the brain, and lysosomal storage diseases (LSD). Other non-limiting examples of disorders of the disclosure that may be treated by a gene therapy in conjunction with an IL-2 conjugate include traumatic brain injury, enzymatic dysfunction disorders, psychiatric disorders (including post- traumatic stress syndrome), neurodegenerative diseases, and cognitive disorders (including dementias, autism, and depression), and enzymatic dysfunction disorders include without limitation leukodystrophies (including Canavan’s disease).
[0287] In some embodiments, the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) is useful for treating a lysosomal storage disease. As is commonly known in the art, lysosomal storage disease are rare, inherited metabolic disorders characterized by defects in lysosomal function. Such disorders are often caused by a deficiency in an enzyme required for proper mucopolysaccharide, glycoprotein, and/or lipid metabolism, leading to a pathological accumulation of lysosomally stored cellular materials. Non-limiting examples of lysosomal storage diseases of the disclosure that may be treated by a therapeutic polypeptide or therapeutic nucleic acid of the disclosure include Gaucher disease type 2 or type 3, GM1 gangliosidosis, Hunter disease, Krabbe disease, a mannosidosis disease, mannosidosis disease, metachromatic leukodystrophy disease, mucolipidosisII/III disease, Niemann-Pick A disease, Niemann-Pick C disease, Pompe disease, Sandhoff disease, Sanfilippo A disease, Sanfilippo B disease, Sanfilippo C disease, Sanfilippo D disease, Schindler disease, Sly disease, Tay-Sachs disease, and Wolman disease.
[0288] In some embodiments, the gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle) is useful for treating hemophilia A, hemophilia B, age related macular degeneration, diabetic retinopathy, glaucoma, muscular dystrophy, X-Linked Myotubular Myopathy, spinal muscular atrophy, Leber’s congenital amaurosis, choroideremia, Leber hereditary optic neuropathy, ornithine transcarbamylase (OTC) deficiency, citrullinemia type 1, phenylketonuria (PKU), adrenoleukodystrophy, sickle cell disease, muscular dystrophy, or beta thalassemia.
[0289] In some embodiments, the disclosure provides a composition for use in the manufacture of a medicament for delivering nucleic acid to a cell of an individual in need thereof, wherein the composition comprises a gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle), and wherein the composition is formulated for use in combination with an IL-2 conjugate. In some embodiments, the disclosure provides a composition for use in the manufacture of a medicament for delivering nucleic acid to a cell of an individual in need thereof, wherein the composition comprises an IL-2 conjugate, and wherein the composition is formulated for use in combination with a gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle).
[0290] In some embodiments, the disclosure provides a composition for use in the manufacture of a medicament for treating an individual in need of gene therapy, wherein the composition comprises a gene therapy agent (e.g., an AAV particle, an adenovirus particle, a lentivirus particle, a HSV particle, or a lipid nanoparticle).
[0291] In some embodiments, the subject is treated with an anti-inflammatory agent and/or an immunosuppressive agent before administration of the library. In some embodiments, the anti-inflammatory agent and/or immunosuppressive agent comprises an immunosuppressive steroid and/or an IgG-degrading enzyme. In some embodiments, wherein the immunosuppressive steroid comprises prednisolone and/or the IgG-degrading enzyme comprises IdeS, optionally wherein the IdeS is Streptococcus IdeS.
III. Kits
[0292] Also provided are kits for use in the methods as described herein. Such kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the containers are formed from a variety of materials such as glass or plastic.
[0293] In some embodiments, kits comprise one or more of the gene therapy agents disclosed herein, and optionally one or more pharmaceutical excipients described herein to facilitate the delivery of one or more of the gene therapy agents. Such kits further optionally include an identifying description or label or instructions relating to its use in the methods described herein.
[0294] A kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
[0295] In one embodiment, a label is on or associated with the container. In one embodiment, a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself, a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert. In one embodiment, a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.
[0296] In certain embodiments, the pharmaceutical compositions (e.g., comprising a gene therapy agent described herein) are presented in a pack or dispenser device which contains one or more unit dosage forms containing a compound provided herein. The pack, for example, contains metal or plastic foil, such as a blister pack. In one embodiment, the pack or dispenser device is accompanied by instructions for administration. In one embodiment, the pack or dispenser is also accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, is the labeling approved by the U.S. Food and Drug Administration for drugs, or the approved product insert. In one embodiment, compositions containing a compound provided herein formulated in a compatible pharmaceutical carrier are also prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
[0297] All patents, patent applications, websites, other publications or documents, accession numbers and the like cited herein are incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifically and individually indicated to be so incorporated by reference. If different versions of a sequence are associated with an accession number at different times, the version associated with the accession number at the effective filing date of this application is meant. The effective filing date means the earlier of the actual filing date or filing date of a priority application referring to the accession number, if applicable. Likewise, if different versions of a publication, website or the like are published at different times, the version most recently published at the effective filing date of the application is meant, unless otherwise indicated.
EXAMPLES
[0298] The following examples are provided to illustrate certain disclosed embodiments and are not to be construed as limiting the scope of this disclosure in any way. Example 1: Methods
1. Synthesis of transgene plasmid
[0299] scAAV eGFP ITR plasmid (sequence provided) was digested with BsrGI and Spel and gene fragment (GF 49) encoding KASH sequence and U6 promoter was inserted using NEBuilder HIFi DNA assembly (NEB, E2621L) to generate intermediate plasmid (pscAAV- minCBA-EGFP-KASH-U6). The intermediate plasmid was digested with restriction enzymes Bcul and Smil and two fragments (5075 bp and 575 bp) were gel purified using QIAquick Gel Extraction Kit (QIAGEN # 28704). The smaller fragment was amplified with OL 397 and OL 396 to add the bulk seq and single nuclei barcodes. OL 397 contains NWNWNWNWNWNWNWN (SEQ ID NO: 3) 15 bp Bulk seq barcode while OL 396 contains 10X genomics compatible barcode sequence pool followed by 10X compatible capture sequence gctttaaggccggtcctagcaa (SEQ ID NO: 1), as shown in Figure 2 (left) The linearized plasmid backbone (5075 bp) and amplicon containing barcodes (767 bp) were assembled to generate a final transgene plasmid library using NEBuilder HIFi DNA assembly (NEB, E2621L). Individual sequence verified clones containing unique bulk seq and single nuclei barcode were used for AAV manufacturing.
2. Synthesis of CAP plasmids
[0300] CAP gene of various natural isolates to be tested were ordered as gene fragments from IDT. AAV2 rep cap plasmid was digested with Swal-HF and Sphl-HF. The linearized backbone and CAP gene fragments 24 natural isolates were assembled to generate AAV2 rep CAP NI (natural isolate). All the plasmids were sequence verified prior to use for AAV manufacturing.
3. Manufacturing of AAV
[0301] AAVs were manufactured using triple transfection method. HEK293T cells were plated at density of 2e7 cells per pl 50 plates. Cells were transfected with sequence verified AAV2 rep CAP (natural isolate) plasmid (22.8 ug), transgene plasmid (5.7 ug) with unique barcodes and Ad helper plasmid (11.4 ug). 20 pl 50 plates were used for each AAV serotype. [0302] Virus was purified from the media and the cell pellet. Media was collected at 90 hours and 120 hours post transfection and 8 ml of 40% Poly Ethylene Glycol (PEG 8000 Sigma Aldrich 89510-1KG-F) was added to 40 ml of media incubated for 2 hours at 4C. Media was centrifuged at 4000g for 10 and the pellet was resuspended in 14 ml AAV lysis buffer (150mM NaCl, 50mM Tris pH 8.4). The cells were harvested at 120 h post transfection and lysed in 14 ml of AAV lysis buffer followed by two cycles of freeze-thaw. The lysate from the cells and media was combined for an additional cycle of freeze-thaw and incubated at 37C for 30 min after addition of 5.6 ul of benzonaze (Millipore Sigma E8263-25KU). Centrifuge at 3700 g at room temp and supernatant was used loaded on to an iodixanol gradient (14 ml lysate, 9 ml 15% iodixanol, 6 ml of 25% iodixanol, 5 ml of 40% iodixanol and 5ml of 60% iodixanol). The gradient was centrifuged at 70,000 rpm for 70 mins in a Beckman Ultracentrifuge. 3 ml of virus was taken from the 40-60 interface and 30 ml of IX PBS 0.005% pluronic acid was added. The virus was concentrated using Amicon Ultra-4 centrifugal filters-lOOK (Millipore Sigma UFC810024).
4. Titration of AAV vectors
[0303] Titration of AAV vectors was done by a Taqman RT-PCR based assay using primer and probe sequence below:
[0304] T-BGH-F: 5'-TCTAGTTGCCAGCCATCTGTTGT-3' (SEQ ID NO: 4) [0305] T-BGH-R: 5'-TGGGAGTGGCACCTTCCA-3' (SEQ ID NO: 5)
[0306] T-BGH-PB: 5'-/56-FAM/TCCCCCGTGCCTTCCTTGACC/36-TAMNph/-3' (SEQ ID NO: 6)
[0307] /56-FAM/ and /36-TAMNph/ represent 5' and 3’ fluorophore oligonucleotide labels, respectively.
5. Pooling of viral library
[0308] All the 24 natural isolates were pooled together in equal vg amounts. The pool was concentrated using Amicon Ultra-4 centrifugal filters- 100K (Millipore Sigma UFC810024) and Taqman RT-PCR based titration was performed prior to injection into NHP.
6. In vitro experiment: HEK293 cells infection and library preparation
[0309] HEK293T cells were plated in a 6 well plate (5E5 cells/well) and infected with a pool of AAV1, AAV2 and AAV6 at MOI of le3 or le4 for 72h. Corresponding transgene plasmid pool (lug) was transfected using lipofectamine 3000 and used as a positive control.
HEK293T cells were detached by 0.05%Trypsin, washed and counted by CellacaMX. Single cell capture, barcoding, post GEM cDNA amplification and libraries constructions were performed using Chromium Single Cell 3 'Reagent Kits v3.1 with Feature Barcode technology for CRISPR Screening (10X Genomics, CG000316) and associated 10X Genomics protocols.
Library sequencing was done by Illumina Novaseq 6000.
7. In vitro Hek293 experiment: quantification of barcodes per nuclei
[0310] Following sequencing, the fastq files were processed with similar workflow as described for the NHP samples (below), except cellranger multi was used on a custom-made human genome based on the GRCh38 assembly with GenCode v 42 annotation, and two sets of 24 AAV barcode sequences corresponding to either polyA 3’ bulk barcodes, or U6 single nuclei (sn) barcodes. Similarly, to the NHP data workflow described below, Seurat package was used to process the data; barcodes with more than 750 UMI/cell and 250 genes/cell and less than 15% mitochondrial expression were kept for the downstream analysis.
8. Tissue processing and RNA isolation for bulk barcode detection from NHP
[0311] NHP tissues were transferred into 2.8 mm bead tubes (Fisher #15-340-154) and homogenized at 5.65 m/s for two cycles for 20 seconds using Omni tissue homogenizer (Fisherbrand bead mill 24 homogenizer #15-340-163). Nucleic acids (DNA and RNA) were extracted using Qiagen all prep kit (# 80204). Concentration of nucleic acid were measure using Quibit and RNA integrity measured using Agilent tapestation. cDNA was synthesized using Superscript VILO cDNA synthesis kit followed by PCR of region with barcodes using Q5 polymerase NEB. Unique indices (New England Biolabs) were attached via PCR amplification. Samples were pooled, cleaned with Ampure XP beads (Beckman Coulter), quantified using Qubit, and paired end sequencing was performed using 160 NextSeq Pl 300 cycle reagent kit (Illumina, 20050264).
9. In vivo ocular dosing
[0312] Ocular Dosing in non-human primates: Four cynomolgus macaques (Macaca fascicularis) were dosed either intravitreally or intracamerally as shown in the table (Table 1). Two cynomolgus macaques were given bilateral intravitreal injections of 2el 1 vg/eye in 60pl. All animals received prednisolone (1 mg/kg) daily beginning 7 days prior to AAV dosing until the day of necropsy. All animals also received an intravenous dose of IgG- degrading enzyme of Streptococcus (IdeS) at 0.5 mg/kg 3 days prior to AAV administration. Group 1 animals received bilateral intravitreal injections, and Group 2 received bilateral intracam eral injections of AAV according to the table below.
[0313] Intravitreal and intracameral injections: Group 1 animals received a bilateral intravitreal dose of the AAV capsid library. Anesthetized animals received 2-5 drops of proparacaine (0.5%) to anesthetize both eyes. After approximately 2 minutes, 1-2 drops of Betadine® (5%) were added to the eyes and left for approximately 5 minutes. After 5 minutes, excess was rinsed with saline. The eye was held open with a speculum. For intravitreal administration, a syringe with 29-31G needle was used to inject into the eye at a 45-degree angle pointed towards the optic nerve (being careful not to hit the lens). For intracameral injections, the needle was advanced 1-2 mm anterior to the limbus and parallel to the iris, then the needle was carefully inserted into the cornea with the bevel facing up. The needle was carefully withdrawn after the test material was delivered and monitored for efflux. Antibiotic ointment or drops were applied immediately post injection.
[0314] All animals were euthanized on Day 31. Both eyes were dissected fresh into the following tissues: optic nerve, retina macula and RPE/choroid macula (4 mm punch over fovea), peripheral retina, RPE+choroid, cornea, trabecular meshwork, iris, and ciliary body. Table 1 : Experimental design of NHP in vivo study
10. Bulk RNAseq data analysis
[0315] The quality of NGS sequencing was checked using FastQC barcode abundance (Wingett et al., FlOOORes 2018) and quantified as follows. First, paired end reads were merged and aligned to a reference amplicon sequence. Then, custom python scripts were applied to quantify read counts for each of the 24 unique capsid barcodes. To account for sample-to-sample variation in sequencing depth, read counts for each capsid barcode in the sample were normalized to the sum of all barcode counts in the sample. 11. snRNAseq data analysis
[0316] Both the alignment and the processing of count matrices was performed in the CellBridge v 1.0.0 workflow (Nouri et al, 2023). To quantify the capture of AAV capsids, we used the count pipeline Cell Ranger version 7.1.0 with a CRISPR application. First, BCL files produced by the NovaSeq 6000 were converted to the FASTQ format using BCL Convert version 4.1.5-2.el7, followed by the Cell Ranger count alignment to a custom-made cynomolgus monkey (Macaca fascicularis) genome that was based on the assembly version 6.0 and annotation version 107 as per Ensembl. Two versions of the genome were built for the Cell Ranger application using Cell Ranger’s mkref pipeline: (1) containing all the bulk AAV barcode sequences, and (2) containing one master bulk AAV barcode sequence with Ns substituted for the nucleotides specifying the unique AAV identifiers. For CRISPR capture, we used the spacers sequences standard for lOx protocols and included in the custom plasmid design of the AAV library.
[0317] The resulting count matrices were processed using the standard Seurat version 5.0.1 workflow, with an additional step that included doublet removal. Barcodes with fewer than 1000 UMIs/cell and 150 genes/cell were removed. Scrublet version 0.2.3 was run to remove doublets (cutoff scrublet score 0.4). For gene expression matrices, the standard Seurat pipeline (“NormalizeData”, “FindVariableFeatures”, “ScaleData”, “RunPCA”, “FindNeighbors”, “FindClusters”, “RunUMAP”) was performed with default parameters except for the following: 30 dimensions (“dims=l :30”) were used in the nearest-neighbors graph (“FindNeighbors”) and the Uniform Manifold Approximation and Projection UMAP reduction (“FindUMAP”). In addition, the resolution of 0.7 (“resolution=0.7”) was used in clustering. For CRISPR feature-count matrices, Seurat’s default antibody-derived tag (“ADT”) processing was used (center log ratio [CLR] transformation was used across cells in “NormalizeData”; flags “normalization.method=’CLR”’ and “margin=2”).
[0318] After the standard preprocessing of snRNAseq additional custom QC steps were conducted on the data. Specifically, for each sample based on the observation that the distribution of total UMI reads were mostly bimodal, low UMI peak nuclei were discarded. In addition, nuclei labeled “unrecognized” by CellBridge cell type assignment were removed, as those could potentially be debris representing mixture of various cell types, as opposed to valid nuclei.
[0319] Following the QC, cell type assignment, we report AAV barcodes transduction by cell type, using Seurat’s DotPlot function, representing percent of each cell population in which a certain AAV barcode has been detected. In addition, we report total number of a particular AAV barcode detected in entire population or other summary metrics.
12. Cell type assignment
[0320] Cell type assignment was performed using the Sargent package from CellBridge (Nouri et al, 2023). The signatures for the retina cell type were derived from the review of key literature on human and NHP ocular cell types transcriptomes derived from previous single cell/nuclei RNAseq studies (Peng et al. Cell 2019, van Zyl, Tave et al. PNAS 2022, Liang, Qingnan et al. Nature Comm 2019, Lukowski, Samuel W et al. EMBO 2019). The gene sets from the different sources were unified and filtered by expert curation.
13. Validation of cell type proportions
[0321] SNAC-derived NHP retinal cell type proportions in the central/macula were compared to comparable previously reported cell type proportions for the fovea grouping cell types in the study to match general reported classes i.e., PR (photoreceptors; = rods and cones), BC (bipolar cells), HC (horizontal cells), AC (amacrine cells), RGC (retinal ganglion cells), and Nonneuronal (Astrocytes, Microglia, Endothelial Cells, Pericytes, Mueller glia) (Peng et al., Cell 2019). The reported cell type proportions were averaged across 22 Foveal samples and plotted the averages +/- standard deviation.
Table 2: List of marker genes for identification of cell types in NHP retina
Example 2: Design and validation of a method for detection of AAV transduction at single nuclei resolution
[0322] Single nucleic atlas of capsid distribution (SNAC), was developed for screening of AAV capsid libraries at single-cell resolution (FIG. IB). To improve the sensitivity of detection of capsids, a custom transgene plasmid was developed containing both a bulk sequencing barcode and a single-nuclei (sn) sequencing barcode (FIG. 1 A). Like standard barcoded AAV libraries, this plasmid contains a CMV promoter driven EGFP transgene with a bulk sequencing barcode in its 3'UTR. However, to facilitate cell-type specific detection of transduction, the plasmid also contains a U6 promoter which drives the expression of a capsid-specific single nuclei (sn) sequencing barcode and a lOx genomics compatible capture sequence. This allows us to isolate two RNA fractions, the polyA mRNA and the U6-driven fraction.
[0323] To demonstrate that SNAC could achieve reliable and robust barcode detection, we tested the strategy in vitro in Hek293 cells using a pool of AAV1, AAV2, and AAV6 (FIG. 2A), which are all known to transduce Hek293 cells. We isolated the U6-driven RNA and the polyA mRNA from the same samples and compared detection of the U6-driven single nuclei (sn) barcode to detection of the bulk barcode (located at the 3' end of the CBA-driven transcript). We found that while the relative proportion of the AAV transcripts was equivalent with the two methods, using the sn barcode increased the frequency of detection compared to the bulk method (FIG 2B). Whereas using the sn barcode, we detected AAV2 in 73% of cells, using the bulk barcode we only detected it in 41% of cells. Similarly, AAV1 was detected in 72% of cells using the sn barcode and 36% using the bulk barcode. AAV6, which had both the lowest transduction and the lowest expression, was detected in 23% of cells using the sn barcode and only 14% using the bulk barcode. In addition, the sn barcode increased the sensitivity of detection. In transduced cells with at least one detected read count of either barcode, the number of read counts was higher in the BC2 fraction (sn barcode) for both AAV1 and AAV2. AAV6 was not detected in the BC1 fraction (bulk barcode) (FIG 9). These results indicate that SNAC is both accurate and sensitive and is superior to detection of barcodes from polyA mRNA. This could allow for the screening of larger capsid libraries, thus reducing costs and accelerating identification of capsids with therapeutically relevant cell-type specific transduction profiles.
[0324] For screening (FIG. IB), a library was constructed by individually packaging uniquely barcoded AAVs with different cap genes (FIG. 3) and creating a pool of these AAVs using equal vector genome copy numbers. This pool was injected into animals, samples were collected, and a single nuclei suspension was created from which one may isolate two fractions, the polyA mRNA and, using the lOx capture sequence, the U6 driven fraction. The polyA mRNA fraction can determine cell identity based on the expression of known marker genes (Table 2), while the U6-driven sn barcode is used to identify cell type specific capsid enrichment. The result was a cell-type specific transduction profile for each AAV in the library.
Example 3: Generation of cell-type specific transduction profiles from pooled AAVs in vivo
[0325] Next, the scalability and reliability of SNAC was demonstrated in vivo in a therapeutically relevant context. Because of the unique structure of the eye, ocular diseases are particularly amenable to AAV gene therapy approaches. Therefore, the method was tested on a pool of natural isolates delivered via intravitreal injection.
[0326] First, a barcoded AAV library of 24 natural AAV isolates was constructed (FIG. 3). The library was designed to contain a broad range of capsids spanning all the common AAV clades. Individual packaging of these isolates resulted in a range of titers of 1.89xl09 - 3.8xl012 (FIG. 3), with no observable phylogenetic pattern. Next, these natural isolates were pooled in equal proportions and administered the pool into NHP retinas by intravitreal injection. Thirty-one days post dosing, animals were euthanized, eyes were collected, and the peripheral retina and macula were dissected. Following the steps outlined above, the polyA and U6-driven RNA fractions were isolated and prepared for sequencing. Using the endogenous polyA mRNA, cell types were assigned based on a data-derived set of marker genes (Table 2) using a custom analysis pipeline. The pipeline identified all seven major cell types in the NHP retina (rods, cones, Muller glia, horizontal cells, amacrine cells, bipolar cells and RGCs), plus endothelial cells, pericytes, astrocytes and microglia as expected (FIG. 4). Cell type distribution varied by anatomical region with enrichment for RGCs in the central macula and photoreceptors in peripheral samples (FIG. 5). Cell type proportions in the macula and peripheral retina show regional differences consistent with regional anatomy (FIG. 10). Furthermore, the cell type proportions agreed with previously reported cell fractions for the NHP retina (Pearson correlation of 0.7; FIG. 5 and FIG. 6), validating this approach to cell type assignment.
[0327] Finally, the U6-driven fraction was used to generate cell-type specific transduction profiles for each AAV in the library. For each cell type, sn barcodes were quantified and normalized to sequencing depth. In agreement with previously published results, it was found that AAV2, AAV6 and AAV1 achieved the highest transduction overall. As a measure of transduction, the percentage of nuclei is reported in which at least 1 count of a capsid barcode is detected (FIG. 7). AAV2 transduction was highest in RGCs, followed by Muller glia, endothelial cells, and neuronal cells including amacrine, bipolar and horizontal cells.
Consistent with previous reports, AAV1 transduced microglia while AAV6 transduced primarily RGCs (Han et al., Hum Gene Ther 2020). Analysis of average cell-type specific expression showed that AAV2 expression was highest in RGCs, then Muller glia, amacrine cells, and endothelial cells (FIG. 7).
[0328] To further validate the results, bulk tissue samples from the same animals (peripheral ocular tissue from the same NHP eye) were sequenced and capsid expression was quantified. AAV 2, AAV 6 and AAV 1 were top ranked capsids in other ocular tissues analyzed by sequencing barcodes at bulk tissue resolution (FIG. 8A and 8B). AAV2 was again the top ranked capsid in both iris and ciliary body, comprising approximately half of the normalized reads in iris, and about one quarter in ciliary body. AAV1 and AAV2 were also ranked highly in both samples; however, bulk RNAseq detected low levels of numerous other serotypes in ciliary body and iris. To directly compare bulk and snRNAseq, the average normalized read counts from iris and ciliary body from bulk and single nuclei sequencing was compared.
Results corroborate the single nuclei transduction rank orders with AAV2, AAV1 and AAV6 as the top capsids (Table 3; significant positive association detected by the estimated intraclass correlation of 0.596 and is significantly greater than 0 (p-value= 0.000885; <0.001)). These results indicate that SNAC enables the generation of cell-type specific transduction profiles from pooled AAVs in tissue.
Table 3: Comparison of ranking of capsids based on single nuclei versus bulk barcodes

Claims

What is claimed is:
1. A method of profiling gene therapy agents, comprising: administering one or more gene therapy agents to a non-human subject, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the subject are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells, thereby profiling the gene therapy agents.
2. The method of the immediately preceding claim, wherein the subject is a non-human mammal.
3. The method of the immediately preceding claim, wherein the subject is a non-human primate.
4. The method of the immediately preceding claim, wherein the subject is a monkey.
5. The method of any one of the preceding claims, wherein the subject is treated with an anti-inflammatory agent and/or an immunosuppressive agent before administration of the one or more gene therapy agents.
6. The method of the immediately preceding claim, wherein the anti-inflammatory agent and/or immunosuppressive agent comprises an immunosuppressive steroid and/or an IgG-degrading enzyme.
7. The method of the immediately preceding claim, wherein the immunosuppressive steroid comprises prednisolone and/or the IgG-degrading enzyme comprises IdeS, optionally wherein the IdeS is Streptococcus IdeS.
8. The method of any one of the preceding claims, further comprising isolating a sample from the subject comprising a plurality of transduced nuclei or transduced cells.
9. A method of profiling gene therapy agents, comprising: contacting an ex vivo or in vitro cell population with one or more gene therapy agents, wherein the one or more gene therapy agents each comprise an identifying sequence, wherein the identifying sequence is operably linked to an RNA polymerase III promoter and/or the identifying sequence is operably linked to a capture sequence, under conditions in which a plurality of cells in the cell population are transduced with one or more of the gene therapy agents, thereby producing transduced cells comprising transduced nuclei; and performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data and analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei; and/or performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data and analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells, thereby profiling the gene therapy agents.
10. The method of the immediately preceding claim, wherein the cell population comprises mammalian cells.
11. The method of the immediately preceding claim, wherein the cell population comprises primate cells.
12. The method of the immediately preceding claim, wherein the cell population comprises non-human primate cells.
13. The method of the immediately preceding claim, wherein the cell population comprises monkey cells.
14. The method of claim 10 or 11, wherein the cell population comprises human cells.
15. The method of any one of the preceding claims, further comprising isolating a sample from cell population comprising a plurality of transduced nuclei or transduced cells.
16. The method of any one of the preceding claims, wherein the one or more gene therapy agents comprise a library comprising at least two distinct subpopulations of gene therapy agents.
17. The method of the immediately preceding claim, wherein each agent in the library comprises a distinct identifying sequence.
18. The method of the immediately preceding claim, wherein each distinct identifying sequence is a barcode.
19. The method of any one of claims 16-18, wherein the library comprises at least three distinct subpopulations of gene therapy agents.
20. The method of the immediately preceding claim, wherein the library comprises at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 30 distinct subpopulations of gene therapy agents.
21. The method of any one of the preceding claims, wherein the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced nuclei; performing single nuclei sequencing on at least a portion of the transduced nuclei to obtain single nuclei sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single nuclei sequencing data to identify cell types of at least a portion of the transduced nuclei and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced nuclei.
22. The method of any one of the preceding claims, wherein the method comprises isolating a sample from the subject or cell population comprising a plurality of transduced cells; performing single cell sequencing on at least a portion of the transduced cells to obtain single cell sequencing data; and generating cell type profiles for the one or more gene therapy agents by analyzing the single cell sequencing data to identify cell types of at least a portion of the transduced cells and identifying sequences from the one or more gene therapy agents in at least a portion of the transduced cells.
23. The method of any one of the preceding claims, wherein the capture sequence is operably linked to the identifying sequence.
24. The method of any one of the preceding claims, wherein the identifying sequence comprises a barcode.
25. The method of any one of the preceding claims, wherein both mRNA and RNA comprising the capture sequence are captured.
26. The method of any one of the preceding claims, wherein the capture sequence comprises a unique sequence that is not present in endogenous RNA of the cell population or subject.
27. The method of any one of the preceding claims, wherein the capture sequence comprises SEQ ID NO: 1 (gctttaaggccggtcctagcaa).
28. The method of any one of claims 1-26, wherein the capture sequence comprises an aptamer sequence.
29. The method of the immediately preceding claim, wherein RNA comprising the capture sequence is captured using a bead coated with a target specifically bound by the aptamer sequence.
30. The method of any one of claims 1-26, wherein the capture sequence comprises a recognition sequence.
31. The method of the immediately preceding claim, wherein RNA comprising the capture sequence is captured using a sequence-specific binding protein that specifically binds the recognition sequence.
32. The method of any one of the preceding claims, wherein the identifying sequences are operably linked to a promoter.
33. The method of any one of the preceding claims, wherein the capture sequence is operably linked to a promoter.
34. The method of any one of the two immediately preceding claims, wherein the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
35. The method of the immediately preceding claim, wherein the promoter comprises a RNAP I promoter, RNAP II promoter, or RNAP III promoter.
36. The method of the immediately preceding claim, wherein the promoter comprises a RNAP III promoter.
37. The method of the immediately preceding claim, wherein the RNAP III promoter comprises a U6, 7SK, Hl, or small tRNA promoter.
38. The method of any one of the preceding claims, wherein the transduced cells are identified based on expression of a plurality of markers.
39. The method of the immediately preceding claim, wherein the plurality of markers comprise one or more of: AGLN3, ALBI, APOE, ARR3, ATP1B1, B2M, BCC3, BRN3A, CABP5, CALB1, CD14, CD164, CD37, CD44, CD74, CHAT, CHX10, CLDN5, CLU, CNGA1, CNGB1, COL4A1, CRABP1, CRYM, CTSB, CTSS, DKK3, DST, EPHB6, FCER1G, FXYD5, GABRD, GAD1, GAD2, GAP43, GFAP, GLUL, GNAT1, GNAT2, GNB1, GNGT1, GNGT2, GPR37, GRIK1, GRIN2A, GRM6, GUCA1A, GUCA1C, GYPC, HES1, HEXB, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRA, HLA-DRA, IBA1, IGFBP7, ISL1, ITRPM1, KCNJ12, KCNJ8, LAPTMS, LHX1, MFGEB, MGP, MYL9, NCAM1, NDRG1, NDRG4, NDRG4, NEFL, NEFM, NET01, NGFR, NR2E3, NRL, NTNAP2, ONECUT1, ONECUT2, 0PN1LW, 0PN1MW, OPN1SW, OTX2, P2RY12, PAX6, PDC, PDE6A, PDE6B, PDE6C, PDE6H, POU4F1, POU4F2, POU4F3, PRKCA, PRPH2, PTN, PTPRF, QP4, RBPMS, RCVRN, RGC5, RGR, RHO, RLBP1, R0M1, RTN1, SAG, SEPT4, SEPT7, SERPINA5, SLC17A6, SLC1A3, SLC23A2, SLC24A1, SLC4A4, SLC5A7, SLC6A1, SLC6A9, SNCG, TFAP2A, TFAP2B, TFAP2C, THY1, TMEM119, TPM3, TTR, TUBB3, TYROBP, UCHL1, VSX1, VSX2, and YWHAH.
40. The method of any one of the preceding claims, wherein the single nuclei sequencing comprises isolating RNAfrom the transduced cells or nuclei.
41. The method of the immediately preceding claim, wherein the single nuclei sequencing further comprises subjecting the RNAto reverse transcription to obtain cDNA.
42. The method of the immediately preceding claim, wherein about 1 attogram of RNAis subjected to reverse transcription.
43. The method of any one of claims 40-42, further comprising tagging the RNA.
44. The method of the immediately preceding claim, wherein the RNA is tagged.
45. The method of the immediately preceding claim, wherein the RNA is tagged with a plurality of barcodes or UMIs.
46. The method of the immediately preceding claim, wherein the plurality of barcodes or UMIs corresponds to individual cells or nucleic.
47. The method of any one of claims 41-46, further comprising pooling cDNA from different cells or nuclei prior to sequencing.
48. The method of any one of the preceding claims, wherein the transduced cells comprise eye cells, kidney cells, brain cells, or muscle cells.
49. The method of the immediately preceding claim, wherein the transduced cells comprise eye cells.
50. The method of the immediately preceding claim, wherein the eye cells comprise retinal cells.
51. The method of the immediately preceding claim, wherein the retinal cells comprise amacrine cells, astrocytes, bipolar cells, cone cells, endothelial cells, horizontal cells, microglia, Muller cells, pericytes, Retinal ganglion cells (RGCs), and/or rod cells.
52. The method of any one of the preceding claims, wherein at least one, of the one or more gene therapy agents comprises a viral vector.
53. The method of the immediately preceding claim, wherein the viral vector is an adeno- associated viral (AAV) particle.
54. The method of the immediately preceding claim, wherein the AAV particle comprises an AAV1 capsid, an AAV2 capsid, an AAV3 capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid, an AAV7 capsid, an AAV8 capsid, an AAVrh8 capsid, an AAV9 capsid, an AAV10 capsid, an AAVrhlO capsid, an AAV11 capsid, an AAV12 capsid, an AAVrh32.33 capsid, an AAV-XL32 capsid, an AAV-XL32.1 capsid, an AAV LK03 capsid, an AAV2R471 A capsid, an AAV2/2-7m8 capsid, an AAV DJ capsid, an AAV DJ8 capsid, an AAV2 N587A capsid, an AAV2 E548A capsid, an AAV2 N708A capsid, an AAV V708K capsid, a goat AAV capsid, an AAV1/AAV2 chimeric capsid, a bovine AAV capsid, a mouse AAV capsid rAAV2/HBoVl (chimeric AAV / human bocavirus virus 1), an AAV2HBK0 capsid, an AAVPHP.B capsid or an AAVPHP.eB capsid, or a functional variant thereof.
55. The method of the immediately preceding claim, wherein the AAV capsid comprises a tyrosine mutation, a heparin binding mutation, or an HBKO mutation.
56. The method of any one of claims 53-55, wherein the AAV viral particle comprises an AAV genome comprising one or more inverted terminal repeats (ITRs), wherein the one or more ITRs is an AAV1 ITR, an AAV2 ITR, an AAV3 ITR, an AAV4 ITR, an AAV5 ITR, an AAV6 ITR, an AAV7 ITR, an AAV8 ITR, an AAVrh8 ITR, an AAV9 ITR, an AAV10 ITR, an AAVrhlO ITR, an AAV11 ITR, or an AAV12 ITR.
57. The method of the immediately preceding claim, wherein the one or more ITRs and the capsid of the AAV particle are derived from the same AAV serotype.
58. The method of the immediately preceding claim, wherein the one or more ITRs and the capsid of the AAV particles are derived from different AAV serotypes.
59. The method of claim 52, wherein the viral vector is an adenoviral particle.
60. The method of the immediately preceding claim, wherein the adenoviral particle comprises a capsid from Adenovirus serotype 2, 1, 5, 6, 19, 3, 11, 7, 14, 16, 21, 12, 18, 31, 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24-30, 37, 40, 41, AdHu2, AdHu 3, AdHu4, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6, AdC7, AdC69, bovine Ad type 3, canine Ad type 2, ovine Ad, or porcine Ad type 3, or a functional variant thereof.
61. The method of claim 52, wherein the viral vector is a lentiviral particle.
62. The method of the immediately preceding claim, wherein the lentiviral particle is pseudotyped with vesicular stomatitis virus (VSV), lymphocytic choriomeningitis virus (LCMV), Ross river virus (RRV), Ebola virus, Marburg virus, Mokala virus, Rabies virus, RD114, or a functional variant thereof.
63. The method of claim 52, wherein the viral vector is a Herpes simplex virus (HSV) particle.
64. The method of the immediately preceding claim, wherein the HSV particle is an HSV- 1 particle or an HSV-2 particle, or a functional variant thereof.
65. The method of any one of claims 1-51, wherein at least one of the one or more gene therapy agents comprises a lipid nanoparticle.
66. The method of the immediately preceding claim, wherein the lipid nanoparticle comprises an expression cassette encoding an RNA comprising a capture sequence and an identifying sequence.
67. The method of the immediately preceding claim, wherein the expression cassette encoding an RNA comprising a capture sequence and an identifying sequence is operably linked to an RNAP III promoter.
68. The method of any one of the two immediately preceding claims, wherein the lipid nanoparticles comprises multiple expression cassettes.
69. The method of any one of the preceding claims, wherein the one or more gene therapy agents each comprise a nucleic acid encoding a heterologous transgene.
70. The method of the immediately preceding claim, wherein the heterologous transgene is operably linked to a promoter.
71. The method of the immediately preceding claim, wherein the promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
72. The method of any one of claims 69-71, wherein the heterologous transgene encodes a marker protein.
73. The method of the immediately preceding claim, wherein the marker protein is a fluorescent protein, optionally wherein the fluorescent protein is a GFP, YFP, RFP, BFP, CFP, or VFP
74. The method of any one of claims 79-71, wherein the heterologous transgene encodes a gene therapy product, vaccine antigen, or microRNA.
75. The method of any one of claims 79-74, wherein the nucleic acid comprises closed- end DNA (ceDNA).
76. The method of any one of claims 79 or 72-74, wherein the nucleic acid comprises mRNA.
77. The method of any one of the preceding claims, wherein the one or more gene therapy agents is administered locally.
78. The method of the immediately preceding claim, wherein the one or more gene therapy agent are administered intravitreally, intracam erally, retinally, intrathecally, intramuscularly, intrarenally, intramuscularly, intracranially, intra-CSF, intra-DRG, intracerebroventricularly, intraocularly, intracisterna magna, intrahepatically, intravitreally, or intracamerally.
79. The method of the immediately preceding claim, wherein the one or more gene therapy agents are administered bilaterally or unilaterally.
80. The method of any one of the preceding claims, wherein the one or more gene therapy agents are administered systemically.
81. The method of the immediately preceding claim, wherein the one or more gene therapy agent are administered intravenously, intraperitoneally, intra-arterially, or subcutaneously.
PCT/US2025/028187 2024-05-08 2025-05-07 Profiling of gene therapy agents Pending WO2025235643A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202463644233P 2024-05-08 2024-05-08
US63/644,233 2024-05-08

Publications (1)

Publication Number Publication Date
WO2025235643A1 true WO2025235643A1 (en) 2025-11-13

Family

ID=96094495

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2025/028187 Pending WO2025235643A1 (en) 2024-05-08 2025-05-07 Profiling of gene therapy agents

Country Status (1)

Country Link
WO (1) WO2025235643A1 (en)

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998010088A1 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
US20040224411A1 (en) 2003-02-26 2004-11-11 Clark Kelly Reed Recombinant adeno-associated virus production
US6989264B2 (en) 1997-09-05 2006-01-24 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US7465583B2 (en) 2000-06-01 2008-12-16 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
WO2010148143A1 (en) 2009-06-16 2010-12-23 Genzyme Corporation Improved methods for purification of recombinant aav vectors
US8137948B2 (en) 2003-05-21 2012-03-20 Genzyme Corporation Methods for producing preparations of recombinant AAV virions substantially free of empty capsids
US20140335054A1 (en) 2010-04-23 2014-11-13 University Of Massachusetts Cns targeting aav vectors and methods of use thereof
US20210172017A1 (en) * 2019-09-19 2021-06-10 The Broad Institute, Inc. Methods of in vivo evaluation of gene function
WO2021251905A1 (en) * 2020-06-12 2021-12-16 Agency For Science, Technology And Research A method for assessing transduction efficiency and/or specificity of vectors at single cell level
WO2024064673A2 (en) * 2022-09-19 2024-03-28 The Children's Hospital Of Philadelphia Aav evolution at single-cell resolution using split-seq

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998010088A1 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6989264B2 (en) 1997-09-05 2006-01-24 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
US8093054B2 (en) 1999-08-09 2012-01-10 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US7125717B2 (en) 1999-08-09 2006-10-24 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US7846729B2 (en) 1999-08-09 2010-12-07 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US7785888B2 (en) 1999-08-09 2010-08-31 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US7790154B2 (en) 2000-06-01 2010-09-07 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
US7465583B2 (en) 2000-06-01 2008-12-16 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
US8361457B2 (en) 2000-06-01 2013-01-29 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
US20040224411A1 (en) 2003-02-26 2004-11-11 Clark Kelly Reed Recombinant adeno-associated virus production
US8137948B2 (en) 2003-05-21 2012-03-20 Genzyme Corporation Methods for producing preparations of recombinant AAV virions substantially free of empty capsids
WO2010148143A1 (en) 2009-06-16 2010-12-23 Genzyme Corporation Improved methods for purification of recombinant aav vectors
US20140335054A1 (en) 2010-04-23 2014-11-13 University Of Massachusetts Cns targeting aav vectors and methods of use thereof
US20210172017A1 (en) * 2019-09-19 2021-06-10 The Broad Institute, Inc. Methods of in vivo evaluation of gene function
WO2021251905A1 (en) * 2020-06-12 2021-12-16 Agency For Science, Technology And Research A method for assessing transduction efficiency and/or specificity of vectors at single cell level
WO2024064673A2 (en) * 2022-09-19 2024-03-28 The Children's Hospital Of Philadelphia Aav evolution at single-cell resolution using split-seq

Non-Patent Citations (66)

* Cited by examiner, † Cited by third party
Title
"Pharmaceutical Dosage Forms and Drug Delivery Systems", 1999, LIPPINCOTT WILLIAMS & WILKINS
"Pharmaceutical Dosage Forms", 1980, MARCEL DECKER
"Remington: The Science and Practice of Pharmacy", 1995, MACK PUBLISHING COMPANY
AHI, Y. ET AL., CURR. GENE THER., vol. 11, no. 4, 2011, pages 307 - 320
ALBA, R. ET AL., GENE THER., vol. 1, 2005, pages 18 - 27
BOISON, D., EPILEPSIA, vol. 51, 2010, pages 1659 - 1668
BOSHART ET AL., CELL, vol. 41, 1985, pages 521 - 530
BROWN DAVID ET AL: "Deep Parallel Characterization of AAV Tropism and AAV-Mediated Transcriptional Changes via Single-Cell RNA Sequencing", FRONTIERS IN IMMUNOLOGY, vol. 12, 21 October 2021 (2021-10-21), Lausanne, CH, XP093307223, ISSN: 1664-3224, DOI: 10.3389/fimmu.2021.730825 *
CLARK ET AL., HUM. GENE THER., vol. 10, 1999, pages 1031 - 1039
CONWAY, JE ET AL., J. VIROLOGY, vol. 71, no. 11, 1997, pages 8780 - 8789
CRONIN, J. ET AL., CURR. GENE THER., vol. 5, no. 4, 2005, pages 387 - 398
DANTHINNE, XIMPERIALE, M.J., GENE THER, vol. 7, 2000, pages 1707 - 14
DAVIDSON ET AL., PNAS, vol. 97, no. 7, 2000, pages 3428 - 32
DULL, T. ET AL., J. VIROL., vol. 72, 1998, pages 8463 - 71
DURAND, SCIMARELLI, A., VIRUSES, vol. 3, 2011, pages 132 - 59
FISHER, J. VIROL., vol. 70, 1996, pages 520 - 532
FUKUDA, A.M.BADAUT, J, GENES (BASEL, vol. 4, 2013, pages 435 - 456
GAO ET AL., J. VIROL., vol. 78, no. 12, 2004, pages 6381
GAO ET AL., PNAS, vol. 100, no. 10, 2003, pages 6081 - 6
GAO ET AL., PNAS, vol. 99, no. 18, 2002, pages 11854 - 6
GOINS, WF ET AL., HERPES SIMPLEX VIRUS METHODS IN MOLECULAR BIOLOGY, vol. 1144, 2014, pages 63 - 79
GOSSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547 - 5551
GOSSEN ET AL., SCIENCE, vol. 268, 1995, pages 1766 - 1769
GUO ET AL., GENE THER., vol. 3, no. 9, 1996, pages 802 - 10
HAN ET AL., HUM GENE THER, 2020
HARVEY ET AL., CURR. OPIN. CHEM. BIOL., vol. 2, 1998, pages 512 - 518
HOOVER, JOHN E.: "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING CO., pages: 1035 - 1038
KAY, M. ET AL., NAT. MED, vol. 7, no. 1, 2001, pages 33 - 40
KAY, M. ET AL., NAT. MED., vol. 7, no. 1, 2001, pages 33 - 40
KENG CHOONG TAT ET AL: "Multiplex viral tropism assay in complex cell populations with single-cell resolution", GENE THERAPY, vol. 29, no. 9, 23 August 2022 (2022-08-23), GB, pages 555 - 565, XP093307231, ISSN: 0969-7128, Retrieved from the Internet <URL:https://www.nature.com/articles/s41434-022-00360-3> DOI: 10.1038/s41434-022-00360-3 *
KIM ET AL., GENE, vol. 91, no. 2, 1990, pages 217 - 23
KIM, T.K.EBERWINE, J.H, ANAL. BIOANAL. CHEM, vol. 397, 2010, pages 3173 - 3178
KIVIOJA, NATURE METHODS, vol. 9, 2012, pages 72 - 74
KOTIN, HUM. GENE THER., vol. 5, 1994, pages 793 - 801
KOTIN, R., HUM MOL GENET, vol. 20, no. R1, 2011, pages R2 - R6
KRYSAN, P.J. ET AL., MOL. CELL BIOL., vol. 9, 1989, pages 1026 - 1033
LIANG, QINGNAN ET AL., NATURE COMM, 2019
LIU, X.L. ET AL., GENE THER, vol. 6, 1999, pages 293 - 299
LUKOWSKI, SAMUEL W ET AL., EMBO, 2019
MAGARI ET AL., J. CLIN. INVEST., vol. 100, 1997, pages 2865 - 2872
MANSERVIGI, R. ET AL., OPEN VIROL J, vol. 4, 2010, pages 123 - 156
MANSERVIGI, R. ET AL., OPEN VIROL. J, vol. 4, 2010, pages 123 - 56
MARTIN ET AL., HUMAN GENE THERAPY METHODS, vol. 24, 2013, pages 253 - 269
MCLAUGHLIN ET AL., J. VIROL., vol. 62, 1988, pages 1963 - 1973
MEIGNIER, B. ET AL., J. INFECT. DIS, vol. 155, no. 5, 1987, pages 921 - 930
MUTO ET AL., NATURE COMMUNICATIONS, vol. 12, no. 1, 2021, pages 2190
NIWA ET AL., GENE, vol. 108, no. 2, 1991, pages 193 - 9
NO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 3346 - 3351
PASSINI ET AL., J. VIROL., vol. 77, no. 12, 2003, pages 6799 - 810
PECHAN ET AL., GENE THER., vol. 16, 2009, pages 10 - 16
PENG ET AL., CELL, 2019
SAMANIEGO, L.A. ET AL., J. VIROL, vol. 72, 1998, pages 3307 - 20
SARKER FARHANA A. ET AL: ") vectors that efficiently target high grade glioma cells, for in vitro monitoring of temporal cell responses", FEBS OPEN BIO, vol. 14, no. 11, 10 September 2024 (2024-09-10), US, pages 1914 - 1925, XP093307238, ISSN: 2211-5463, DOI: 10.1002/2211-5463.13894 *
SEGURA MM ET AL., EXPERT OPIN BIOL THER, vol. 13, no. 7, 2013, pages 987 - 1011
TATSIS, N. ET AL., MOL. THER, vol. 10, no. 4, 2004, pages 616 - 629
TATSIS, N.ERTL, H.C, MOL. THER., vol. 10, no. 4, 2004, pages 616 - 629
URABE, M. ET AL., HUMAN GENE THERAPY, vol. 13, no. 16, 2002, pages 1935 - 1943
VELDWIJK ET AL., MOL. THER., vol. 6, 2002, pages 272 - 278
WANG ET AL., GENE THER., vol. 4, 1997, pages 432 - 441
WANG ET AL., NAT. BIOTECH., vol. 15, 1997, pages 239 - 243
WANG Z. ET AL., GENE THER, vol. 10, 2003, pages 2105 - 2111
XIAO ET AL., EXP. NEUROBIOL., vol. 144, 1997, pages 113 - 124
XIAO ET AL., JOURNAL OF VIROLOGY, vol. 72, 1998, pages 2224 - 2232
ZEMKE ET AL., NATURE, vol. 624, no. 7991, 2023, pages 390 - 402
ZHONG L. ET AL., PROC NATL ACAD SCI U S A, vol. 105, no. 22, 2008, pages 7827 - 7832
ZYL, TAVÉ ET AL., PNAS, 2022

Similar Documents

Publication Publication Date Title
US20240197837A1 (en) Gene editing of deep intronic mutations
US12241077B2 (en) Adeno-associated virus (AAV) systems for treatment of genetic hearing loss
US12357707B2 (en) Compositions and methods for treating laminopathies
US20230270884A1 (en) Compositions useful for treatment of charcot-marie-tooth disease
US20230405014A1 (en) Use of an irak4 modulator for gene therapy
US20260091132A1 (en) Gene therapies for usher syndrome (ush1b)
CN118318045A (en) Liver-specific expression cassette, vector and use thereof for expressing therapeutic proteins
US20240401078A1 (en) Compositions useful for treatment of charcot-marie-tooth disease
WO2024163678A2 (en) Fusion proteins and systems for targeted activation of frataxin (fxn) and related methods
WO2025235643A1 (en) Profiling of gene therapy agents
TW202604549A (en) Profiling of gene therapy agents
WO2024073310A2 (en) Elements for de-targeting gene expression in dorsal root ganglion and/or liver
CA3223324A1 (en) Genomic editing of rbm20 mutations
HK1252469B (en) Gene editing of deep intronic mutations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 25732572

Country of ref document: EP

Kind code of ref document: A1