WO2025207495A1 - Stimulative piezoelectric nanofibrous scaffolds for enhanced extracellular vesicle production in 3d cultures - Google Patents

Stimulative piezoelectric nanofibrous scaffolds for enhanced extracellular vesicle production in 3d cultures

Info

Publication number
WO2025207495A1
WO2025207495A1 PCT/US2025/021108 US2025021108W WO2025207495A1 WO 2025207495 A1 WO2025207495 A1 WO 2025207495A1 US 2025021108 W US2025021108 W US 2025021108W WO 2025207495 A1 WO2025207495 A1 WO 2025207495A1
Authority
WO
WIPO (PCT)
Prior art keywords
piezoelectric
cell
cells
evs
nanofibrous scaffold
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/US2025/021108
Other languages
French (fr)
Inventor
Yichun Wang
James Johnston
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Notre Dame
Original Assignee
University of Notre Dame
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Notre Dame filed Critical University of Notre Dame
Publication of WO2025207495A1 publication Critical patent/WO2025207495A1/en
Pending legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0062General methods for three-dimensional culture
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N13/00Treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic waves
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0068General culture methods using substrates
    • HELECTRICITY
    • H10SEMICONDUCTOR DEVICES; ELECTRIC SOLID-STATE DEVICES NOT OTHERWISE PROVIDED FOR
    • H10NELECTRIC SOLID-STATE DEVICES NOT OTHERWISE PROVIDED FOR
    • H10N30/00Piezoelectric or electrostrictive devices
    • H10N30/01Manufacture or treatment
    • H10N30/09Forming piezoelectric or electrostrictive materials
    • HELECTRICITY
    • H10SEMICONDUCTOR DEVICES; ELECTRIC SOLID-STATE DEVICES NOT OTHERWISE PROVIDED FOR
    • H10NELECTRIC SOLID-STATE DEVICES NOT OTHERWISE PROVIDED FOR
    • H10N30/00Piezoelectric or electrostrictive devices
    • H10N30/704Piezoelectric or electrostrictive devices based on piezoelectric or electrostrictive films or coatings
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2521/00Culture process characterised by the use of hydrostatic pressure, flow or shear forces
    • C12N2521/10Sound, e.g. ultrasounds

Definitions

  • Extracellular vesicles are nano/micro-sized lipid particles that are naturally secreted by most eukaryotic cells.
  • Small extracellular vesicles (sEVs) with diameters of 50-200 nm play a critical role in facilitating intercellular communication and have garnered significant interest as potential vehicles for drug delivery due to their numerous advantageous properties.
  • sEVs exhibit a robust capacity for the encapsulation and transference of bioactive molecules, including proteins, lipids, and nucleic acids.
  • the inherently low immunogenic profile and high biocompatibility of sEVs mitigate the risk of eliciting adverse immunological responses, thereby enhancing patient safety upon administration.
  • sEVs possess the optimal dimensional and structural configuration required for carriers in drug delivery applications. There have been tremendous efforts to advance the development of methodologies for the scalable production, isolation, and functionalization of sEVs for clinical and therapeutic applications.
  • the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof.
  • the polymer nanofibers comprise polyacrylonitrile (PAN).
  • the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
  • the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm.
  • the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
  • kits for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold; optionally, cell culture buffers and reagents; and optionally, packaging, labels, or instructions for use.
  • 3D three-dimensional
  • FIG. 1A-G show an overview of the piezoelectric nanofibrous scaffold fabrication and optimization for three-dimensional (3D) cell culture.
  • FIG. 1A shows a schematic for developing and processing the cell-compatible piezoelectric scaffold (PES).
  • FIG. 1 B shows scanning electron microscopy (SEM) images of the piezoelectric scaffold cross section with and without gas foaming.
  • FIG. 1 C-D show the expansion ratio (h/ho) (FIG. 1C) and the pore size and porosity (FIG. 1 D) of PES with varying expansion times.
  • FIG. 1 E-F show the effect of the acoustic frequency on the piezoelectric properties of the scaffolds.
  • FIG. 1G shows the effect of chitosan coating of the scaffolds on the cell seeding efficiency (Left: HepG2; Right: 3T3). Data shown as ⁇ S.D. of 5 replicate samples: ****p ⁇ 0.0001 .
  • FIG. 2A shows scanning electron microscopy (SEM) images for the Piezoelectric scaffolds (PES) at 0, 2, and 4 hours of gas foaming.
  • FIG. 2B shows measured fiber diameter inside PES along the gas expansion time.
  • FIG. 5 shows PE output comparison between pristine scaffold (left) and chitosan-coated scaffold (right).
  • FIG. 6 shows representative digital image of the scaffold inside the culture media.
  • FIG. 7A-C show confocal light scanning microscopic images of 3T3 and HepG2 on chitosan-coated scaffolds stained with live/dead kit.
  • FIG. 7A shows maximum intensity projected images of both cell lines (Left: 3T3 and Right: HepG2).
  • FIG. 7B shows 3D constructed confocal image of both cell lines (Left: 3T3 and Right: HepG2).
  • FIG. 8A-C show the biocompatibility and cell proliferation on PES.
  • FIG. 8A shows cell proliferation after 14 days of cell culture on PES.
  • FIG. 8B-C show cell viability after stimulation at amplitudes between 50-110 dB (FIG. 8B) and 85 dB (FIG. 8C).
  • FIG. 9A shows a schematic of the piezoelectric stimulation that enhances sEV production.
  • FIG. 9B-C show size distribution of sEVs derived from HepG2 (FIG. 9B) and 3T3 cells (FIG. 9C) using NTA. Data shown as ⁇ S.D. of 5 replicate samples.
  • FIG. 9D-E show the measured EV production rate per cell using ExoELISA. Data shown as ⁇ S.D. of 5 replicate samples: ****p ⁇ 0.0001.
  • FIG. 11 shows sEV characterization using nanoparticle tracking analysis (NTA).
  • NTA nanoparticle tracking analysis
  • the mean particle size of the produced sEVs. Error bars are ⁇ 1 S.D. (N 5).
  • FIG. 12A-B show size distribution of sEVs through transmission electron microscopy (TEM).
  • FIG. 12A shows TEM images of sEVs from control, and PES culture.
  • FIG. 12B shows size distributions histograms of sEVs based on TEM imaging.
  • FIG. 15A-E show the characterization of sEVs in 2D culture control, PES OFF, and PES ON groups.
  • FIG. 15A shows sEV marker characterization of CD9, CD63, and CD81, and HSP70 and HSP90 using western blot assays.
  • FIG. 15B-C show quantitative measurement of HSP70 in HepG2- (FIG. 15B) and 3T3-derived sEVs (FIG. 15C).
  • FIG. 15D-E show quantitative measurement of HSP90 in HepG2- (FIG. 15D) and 3T3-derived (FIG. 15E) sEVs. Data shown as mean ⁇ S.E.M. of 3 replicate samples are representative of two independent experiments: *P
  • FIG. 16A-B show images of Western blot gels using the white light channel for HepG2 derived sEVs (FIG. 16A) and 3T3 derived sEVs (FIG. 16B).
  • FIG. 17A-B show images of Western blot gels using the color light channel for HepG2 derived sEVs (FIG. 17A) and 3T3 derived sEVs (FIG. 17B), and the bands were imaged using the white light channel.
  • FIG. 18A-C show gel electrophoresis results from the plasma cell-free DNA (cfDNA) polymerase chain reaction (PCR) of sEV content.
  • FIG. 18A shows NRAS-targeting PCR result from HepG2 (left) and 3T3 (right).
  • FIG. 18B shows TP53 Inner-targeting PCR result from HepG2 (left) and 3T3 (right).
  • FIG. 18C shows TP53 Outer-targeting PCR result from HepG2 (left) and 3T3 (right).
  • FIG. 19A shows a schematic of mechanisms for enhanced EVs through control, PES OFF and PES ON groups.
  • FIG. 19B shows ATP levels for all groups at various cell counts using Celltiter-glo. Data shown as ⁇ S.D. of 3 replicate samples are representative of two independent experiments: *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , and ****p ⁇ 0.0001.
  • FIG. 19C shows a comparison of NADH activity for all groups at various cell counts using cell counting kit-8 (CCK- 8) assay. Data shown as ⁇ S.D. of 3 replicate samples are representative of two independent experiments: One-way ANOVA analysis with *P ⁇ 0.05, **P ⁇ 0.01 , and ***P ⁇ 0.001.
  • FIG. 19D shows the relative calcium concentrations of all groups measured by Fura-2AM. Data shown as ⁇ S.D. of 3 replicate samples are representative of two independent experiments: *P ⁇ 0.05, **P
  • FIG. 20A shows SEM images of HepG2 and 3T3 cells under three different cultures including 2D, PES OFF, and PES ON cultures. (Scale bar: 10 pm).
  • FIG. 20B shows the cell measurement through roundness.
  • FIG. 20C shows the correlation between the roundness and the sEV production rate and fold change in production rate post stimulation. All data shown as ⁇ S.D. of 3 replicate samples is representative of two independent experiments: *P ⁇ 0.05, **P ⁇ 0.01 ***P ⁇ 0.001 , and ****P ⁇ 0.0001 .
  • FIG. 21 shows cell morphology analysis outlined SEM images.
  • FIG. 23A-C show cell culture characterization of RAW264.7 cells on the piezoelectric scaffold (PES) platform.
  • FIG. 23A shows Live/Dead assay of RAW264.7 cultured on the PES with varying chitosan coating concentration. Scale bar is 100 pm.
  • FIG. 23B shows the calculated Cell viability based on the live/dead assay.
  • FIG. 23C shows cell growth curve of RAW264.7 and 3T3 cells on the PES.
  • FIG. 25A-D show quantification of sEV production rate of RAW264.7 cells cultured under various amplitudes of stimuli measured in decibels (dB).
  • FIG. 25A shows size distribution of sEVs through nanoparticle tracking analysis.
  • FIG. 25B shows sEV production rate of RAW264.7 derived sEVs.
  • FIG. 25C shows measured cell count of each sample obtained using cell counting kit-8 (CCK-8).
  • FIG. 25D shows the mean particle size of the sEVs.
  • FIG. 26A-D show quantification of sEV production rate of RAW264.7 cells cultured under various frequencies of stimuli measured in Hertz (Hz).
  • FIG. 26A shows size distribution of sEVs through nanoparticle tracking analysis.
  • FIG. 26B shows sEV production rate of RAW264.7 derived sEVs.
  • FIG. 26C shows measured cell count of each sample obtained using CCK-8.
  • FIG. 26D shows the mean particle size of the sEVs.
  • FIG. 27A-D show quantification of sEV production rate of RAW264.7 cells cultured under various beat frequencies of stimuli measured in Hertz (Hz).
  • FIG. 27A shows size distribution of sEVs through nanoparticle tracking analysis.
  • FIG. 27B shows sEV production rate of RAW264.7 derived sEVs.
  • FIG. 27C shows measured cell count of each sample obtained using CCK-8.
  • FIG. 27D shows the mean particle size of the sEVs.
  • FIG. 29A-B show fiber diameter characterization of PES samples.
  • FIG. 29A shows scanning electron microscopy (SEM) images of different scaffolds. Scale bar is 5 pm.
  • FIG. 29B shows the size distribution of each sample corresponding to the SEM image.
  • amino acid As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein.
  • the term “and/or” refers to both the conjunctive and disjunctive. As used herein, the term “substantially” means to a great or significant extent, but not completely.
  • the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value.
  • the symbol means “about” or “approximately.”
  • ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range.
  • a range of 0.1-2.0 includes 0.1 , 0.2, 0.3, 0.4 . . . 2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ⁇ 10% of any value within the range or within 3 or more standard deviations, including the end points, or as described above in the definition of “about.”
  • room temperature refers to the typical temperature in an indoor laboratory setting.
  • the laboratory setting is climate controlled to maintain the temperature at a substantially uniform temperature or with a specific range of temperatures.
  • room temperature refers a temperature of about 15-30 °C, including all integers and endpoints within the specified range.
  • PESs were fabricated using polymer nanofibers and structural parameters were optimized for ideal 3D cell culture conditions by tuning the porosity, pore size, and thickness using gas foaming techniques.
  • the data disclosed herein demonstrate that the 3D cell culture in PES increases the production rate of sEVs per cell by a factor of 15.7 in HepG2 cells and by a factor of 6.7 in 3T3 cells, compared with 2D culture. Importantly, the yielded sEVs were intact under the stimulated conditions.
  • the PES platform demonstrated a method for safe, low voltage stimulation resulting in cell viability of over 90%.
  • One embodiment described herein is a system for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the system comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold.
  • a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers
  • a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold.
  • Another embodiment described herein is a method of making a three-dimensional (3D) piezoelectric nanofibrous scaffold for cell culture, the method comprising: electrospinning a solution of piezoelectric polymer nanofibers to form a piezoelectric fiber membrane; and expanding the piezoelectric fiber membrane using gas foaming to form a 3D piezoelectric nanofibrous scaffold comprising polymer nanofibers.
  • kits for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold; optionally, cell culture buffers and reagents; and optionally, packaging, labels, or instructions for use.
  • 3D three-dimensional
  • the polymer nanofibers described herein comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co- glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PAN I), polyfluorene, polypyrrole (PPy), poly(3,4- ethylenedioxythiophene), or combinations thereof.
  • the polymer nanofibers comprise polyacrylonitrile (PAN).
  • the polymer nanofibers described herein have an average diameter of about 150 nm to about 2200 nm. In some embodiments, the polymer nanofibers have an average diameter of about 250 nm to about 2200 nm, about 500 nm to about 2200 nm, about 750 nm to about 2200 nm, about 1000 nm to about 2200 nm, about 1250 nm to about 2200 nm, about 1500 nm to about 2200 nm, about 1750 nm to about 2200 nm, about 2000 nm to about 2200 nm, about 150 nm to about 2000 nm, about 150 nm to about 1750 nm, about 150 nm to about 1500 nm, about 150 nm to about 1250 nm, about 150 nm to about 1000 nm, about 150 nm to about 750 nm, about 150 nm to about 500 nm, about 150 nm to about 250 nm, about 400
  • the polymer nanofibers have an average diameter of no less than about 150 nm, no less than about 250 nm, no less than about 500 nm, no less than about 750 nm, no less than about 1000 nm, no less than about 1250 nm, no less than about 1500 nm, no less than about 1750 nm, or no less than about 2000 nm.
  • the polymer nanofibers have an average diameter of no greater than about 2200 nm, no greater than about 2000 nm, no greater than about 1750 nm, no greater than about 1500 nm, no greater than about 1250 nm, no greater than about 1000 nm, no greater than about 750 nm, no greater than about 500 nm, or no greater than about 250 nm.
  • the 3D piezoelectric nanofibrous scaffolds described herein are porous and comprise an average pore size of about 2 pm to about 15 pm.
  • the 3D piezoelectric nanofibrous scaffolds comprise an average pore size of about 4 pm to about 15 pm, about 6 pm to about 15 pm, about 8 pm to about 15 pm, about 10 pm to about 15 pm, about 12 pm to about 15 pm, about 14 pm to about 15 pm, about 2 pm to about 13 pm, about 2 pm to about 11 pm, about 2 pm to about 9 pm, about 2 pm to about 7 pm, about 2 pm to about 5 pm, about 2 pm to about 3 pm, about 3 pm to about 14 pm, about 4 pm to about 13 pm, about 5 pm to about 12 pm, about 6 pm to about 11 pm, about 7 pm to about 10 pm, or about 8 pm to about 9 pm, including all values and ranges within these ranges.
  • the 3D piezoelectric nanofibrous scaffolds comprise an average pore size of no less than about 2 pm, no less than about 3 pm, no less than about 4 pm, no less than about 5 pm, no less than about 6 pm, no less than about 7 pm, no less than about 8 pm, no less than about 9 pm, no less than about 10 pm, no less than about 11 pm, no less than about 12 pm, no less than about 13 pm, or no less than about 14 pm.
  • the 3D piezoelectric nanofibrous scaffolds comprise an average pore size of no greater than about 15 pm, no greater than about 14 pm, no greater than about 13 pm, no greater than about 12 pm, no greater than about 11 pm, no greater than about 10 pm, no greater than about 9 pm, no greater than about 8 pm, no greater than about 7 pm, no greater than about 6 pm, no greater than about 5 pm, no greater than about 4 pm, or no greater than about 3 pm.
  • the 3D piezoelectric nanofibrous scaffolds comprise a porosity of no less than about 25%, no less than about 30%, no less than about 40%, no less than about 50%, no less than about 60%, no less than about 70%, no less than about 80%, or no less than about 90%. In other embodiments, the 3D piezoelectric nanofibrous scaffolds comprise a porosity of no greater than about 95%, no greater than about 90%, no greater than about 80%, no greater than about 70%, no greater than about 60%, no greater than about 50%, no greater than about 40%, or no greater than about 30%.
  • the acoustic stimulation described herein comprises an acoustic frequency of about 1 Hz to about 200 Hz.
  • the acoustic stimulation comprises an acoustic frequency of about 5 Hz to about 200 Hz, about 10 Hz to about 200 Hz, about 25 Hz to about 200 Hz, about 50 Hz to about 200 Hz, about 75 Hz to about 200 Hz, about 100 Hz to about 200 Hz, about 125 Hz to about 200 Hz, about 150 Hz to about 200 Hz, about 175 Hz to about 200 Hz, about 190 Hz to about 200 Hz, about 1 Hz to about 190 Hz, about 1 Hz to about 175 Hz, about 1 Hz to about 150 Hz, about 1 Hz to about 125 Hz, about 1 Hz to about 100 Hz, about 1 Hz to about 75 Hz, about 1 Hz to about 50 Hz, about 1 Hz to about 25 Hz, about 1 Hz to about 10 Hz, about 1 Hz to
  • the acoustic stimulation comprises an acoustic frequency of no less than about 1 Hz, no less than about 5 Hz, no less than about 10 Hz, no less than about 25 Hz, no less than about 50 Hz, no less than about 75 Hz, no less than about 100 Hz, no less than about 125 Hz, no less than about 150 Hz, no less than about 175 Hz, or no less than about 190 Hz.
  • the acoustic stimulation comprises an acoustic frequency of no greater than about 200 Hz, no greater than about 190 Hz, no greater than about 175 Hz, no greater than about 150 Hz, no greater than about 125 Hz, no greater than about 100 Hz, no greater than about 75 Hz, no greater than about 50 Hz, no greater than about 25 Hz, no greater than about 10 Hz, or no greater than about 5 Hz.
  • the acoustic stimulation described herein comprises an acoustic amplitude of about 50 dB to about 110 dB.
  • the acoustic stimulation comprises an acoustic amplitude of about 60 dB to about 110 dB, about 70 dB to about 110 dB, about 80 dB to about 110 dB, about 90 dB to about 110 dB, about 100 dB to about 110 dB, about 50 dB to about 100 dB, about 50 dB to about 90 dB, about 50 dB to about 80 dB, about 50 dB to about 70 dB, about 50 dB to about 60 dB, about 60 dB to about 100 dB, or about 70 dB to about 90 dB, including all values and ranges within these ranges.
  • the acoustic stimulation comprises an acoustic amplitude of no less than about 50 dB, no less than about 60 dB, no less than about 70 dB, no less than about 80 dB, no less than about 90 dB, or no less than about 100 dB. In other embodiments, the acoustic stimulation comprises an acoustic amplitude of no greater than about 110 dB, no greater than about 100 dB, no greater than about 90 dB, no greater than about 80 dB, no greater than about 70 dB, or no greater than about 60 dB.
  • the 3D piezoelectric nanofibrous scaffolds described herein output a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
  • the output voltage is about 50 mV to about 850 mV, about 100 mV to about 850 mV, about 150 mV to about 850 mV, about 200 mV to about 850 mV, about 250 mV to about 850 mV, about 300 mV to about 850 mV, about 350 mV to about 850 mV, about 400 mV to about 850 mV, about 450 mV to about 850 mV, about 500 mV to about 850 mV, about 550 mV to about 850 mV, about 600 mV to about 850 mV, about 650 mV to about 850 mV, about 700 mV to about 850 mV, about 750 mV to about 850 mV, about 800
  • the output voltage is no less than about 30 mV, no less than about 50 mV, no less than about 100 mV, no less than about 150 mV, no less than about 200 mV, no less than about 250 mV, no less than about 300 mV, no less than about
  • the output voltage is no greater than about 850 mV, no greater than about 800 mV, no greater than about 750 mV, no greater than about 700 mV, no greater than about 650 mV, no greater than about 600 mV, no greater than about 550 mV, no greater than about 500 mV, no greater than about 450 mV, no greater than about 400 mV, no greater than about 350 mV, no greater than about 300 mV, no greater than about 250 mV, no greater than about 200 mV, no greater than about 150 mV, no greater than about 100 mV, or no greater than about 50 mV upon acoustic stimulation.
  • the 3D piezoelectric nanofibrous scaffolds described herein have a thickness of about 100 pm to about 680 pm. In some embodiments, the 3D piezoelectric nanofibrous scaffold has a thickness of about 150 pm to about 680 pm, about 200 pm to about 680 pm, about 250 pm to about 680 pm, about 300 pm to about 680 pm, about 350 pm to about
  • the 3D piezoelectric nanofibrous scaffold has a thickness of no greater than about 680 pm, no greater than about 650 pm, no greater than about 600 pm, no greater than about 550 pm, no greater than about 500 pm, no greater than about 450 pm, no greater than about 400 pm, no greater than about 350 pm, no greater than about 300 pm, no greater than about 250 pm, no greater than about 200 pm, or no greater than about 150 pm.
  • the EVs described herein comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
  • sEVs small extracellular vesicles
  • the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
  • the systems, methods, and kits described herein enhance the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems, methods, and kits.
  • the production rate and secretion of EVs from cells are increased by greater than 15-fold.
  • the acoustic stimulation described herein does not affect cell viability. In one exemplary aspect, the acoustic stimulation results in greater than 90% cell viability.
  • the cells comprise mammalian cells. In certain exemplary aspects, the cells comprise cancer cells, fibroblasts, or immune cells.
  • the acoustic stimulation described herein is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min. In one exemplary aspect, the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 15 min.
  • One embodiment described herein is a system for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the system comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold.
  • a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers
  • a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold.
  • the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof.
  • the polymer nanofibers comprise polyacrylonitrile (PAN).
  • the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
  • the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm.
  • the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
  • the device is configured to apply an acoustic frequency of about 1 Hz to about 200 Hz. In another aspect, the device is configured to apply an acoustic amplitude of about 50 dB to about 110 dB.
  • the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
  • the EVs comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
  • the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
  • the system enhances the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems.
  • the acoustic stimulation does not affect cell viability.
  • the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min.
  • the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
  • the EVs comprise small extracellular vesicles (sEV), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
  • the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
  • the cells comprise mammalian cells.
  • Another embodiment described herein is a method of making a three-dimensional (3D) piezoelectric nanofibrous scaffold for cell culture, the method comprising: electrospinning a solution of piezoelectric polymer nanofibers to form a piezoelectric fiber membrane; and expanding the piezoelectric fiber membrane using gas foaming to form a 3D piezoelectric nanofibrous scaffold comprising polymer nanofibers.
  • the method further comprises adding a coating for cell adhesion to the 3D piezoelectric nanofibrous scaffold.
  • the coating for cell adhesion comprises chitosan.
  • compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations.
  • the scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described.
  • the exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein.
  • Clause 4 The system of any one of clauses 1-3, wherein the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
  • Clause 7 The system of any one of clauses 1-6, wherein the device is configured to apply an acoustic frequency of about 1 Hz to about 200 Hz.
  • Clause 9 The system of any one of clauses 1-8, wherein the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
  • EVs comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
  • sEVs small extracellular vesicles
  • exosomes exosomes
  • ectosomes microvesicles
  • liposomes lipoproteins
  • exomeres supermeres, or combinations thereof.
  • Clause 11 The system of any one of clauses 1-10, wherein the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
  • Clause 12 The system of any one of clauses 1-11 , wherein the system enhances the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems.
  • Clause 13 The system of any one of clauses 1-12, wherein the acoustic stimulation does not affect cell viability.
  • Clause 15 The method of clause 14, wherein the acoustic stimulation comprises an acoustic frequency of about 1 Hz to about 200 Hz.
  • Clause 16 The method of clause 14 or 15, wherein the acoustic stimulation comprises an acoustic amplitude of about 50 dB to about 110 dB.
  • Clause 17 The method of any one of clauses 14-16, wherein the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min.
  • Clause 18 The method of any one of clauses 14-17, wherein the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
  • Clause 20 The method of any one of clauses 14-19, wherein the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
  • Clause 21 The method of any one of clauses 14-20, wherein the cells comprise mammalian cells.
  • Clause 22 The method of any one of clauses 14-21 , further comprising isolating the EVs from cell culture media.
  • Clause 23 The method of any one of clauses 14-22, wherein the method enhances the production rate and secretion of EVs from the cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture methods.
  • Clause 24 The method of any one of clauses 14-23, wherein the acoustic stimulation does not affect cell viability.
  • Clause 26 The method of clause 25, further comprising adding a coating for cell adhesion to the 3D piezoelectric nanofibrous scaffold.
  • Clause 30 The method of any one of clauses 25-29, wherein the 3D piezoelectric nanofibrous scaffold has a thickness of about 100 pm to about 680 pm.
  • the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof.
  • PAN polyacrylonitrile
  • PS polystyrene
  • PC polycarbonate
  • PVP polyvinylpyrrolidone
  • PVB polyvinyl chloride
  • PVME polyvinyl methyl ether
  • PLGA polylactic-co-glycolic acid
  • PLA poly(l-lactic acid)
  • polyester poly
  • Clause 33 The method of any one of clauses 25-32, wherein the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
  • Clause 34 The method of any one of clauses 25-33, wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm.
  • Polyacrylonitrile (PAN; 181315), sodium borohydride (213462), and Pluronic f-127 powder (9003-11-6) were purchased from Sigma Aldrich (MA).
  • A/,A/-dimethylformamide (DMF; D119-4) was purchased from Fischer Scientific (MA).
  • Ethyl alcohol (3791-10), 99% acetic acid (BDH3092) and 0.22 pm vacuum filters (76010-388) were purchased from VWR (PA).
  • Chitosan powder (c1569) was purchased from Spectrum Chemical (NJ).
  • MEM Minimum Essential Medium
  • MA ThermoFisher
  • MA ThermoFisher
  • MA ThermoFisher
  • 4% paraformaldehyde in 0.1 M phosphate buffer (15735) was purchased from Electron Microscopy Science (PA).
  • Cell counting kit-8 (CCK-8;850- 039-kl01) was purchased from Enzo Life Sciences (NY).
  • 3D Celltiter-glo (G968A) was purchased from Promega (Wl).
  • Fura 2-AM was purchased from Invitrogen Life Technologies (CA). HEPES buffered saline solution (C-40020) was purchased from PromoCell (Heidelberg, Germany). The LIVE/DEADTM Cell Imaging Kit (488/570) was purchased from ThermoFisher Scientific (MA).
  • Solution property characteristics were performed. See Ico et al., J. Mater. Chem. A 4: 2293-2304 (2016). Solution viscosity was measured using a CPA-40 spindle connected to a Brookfield DV-I Prime viscometer (Brookfield, Toronto, Canada). The rotational speed of the spindle was ramped up from 0.5 rpm to whichever speed at which the torque reached closest to 100% (at least above 95%). After confirming that viscosity was independent of the shear rate, the viscosity value at maximum torque was recorded. Surface tension was measured using an automatic surface tensiometer (QBZY-1 ; Shanghai Fangrui Instrument, Shanghai, China), which had a platinum-coated plate connected to a hook.
  • QBZY-1 automatic surface tensiometer
  • Nanofibers with a diameter of 760 nm were produced through an electrospinning process.
  • a solution of 10 wt% PAN was prepared in DMF.
  • Electrospinning was carried out under specific conditions, namely an electrospinning distance of 10 cm, an applied voltage of 13 kV, and a solution feed rate of 1 ml_ hr 1 . This process was conducted in a controlled environment of 23 °C and 40% relative humidity.
  • the resulting nanofibers were collected on a rotating collector drum covered with aluminum foil, operating at 400 rpm.
  • the electrospinning duration was optimized to achieve nanofibers with the desired thickness of approximately 100 pm.
  • Nanofiber scaffolds were prepared in a cantilever setup, similar to prior work. See, e.g., Ico et al., J. Mater. Chem. 4: 2293-2304 (2016). This setup allows for the controlled application of strain to the samples while simultaneously measuring their electrical output.
  • the PAN nanofiber scaffolds were cut into strips of size 4 x 1.2 cm, and brass slabs of size 7.2 x 1.6 x 0.01 cm 3 , electrically isolated with polyimide tape, were employed as electrodes to measure the voltage.
  • One brass slab was in direct contact with the nanofiber sample, secured with double-sided copper tape, while the other slab remained unexposed.
  • t strain (%) — x 100 2R with t representing the cantilever thickness and R being the radius of curvature, as determined through a surface-mounted camera.
  • a sinusoidal sine wave with a controlled amplitude and a 10 Hz frequency was applied to the speaker system, and the voltage output was measured.
  • the porosity of the nanofiber scaffolds was calculated according to the liquid displacement of each sample.
  • the mass of each sample was measured before and after being submerged in water.
  • the porosity was calculated using Equation (4): where mo and m are the masses before and after being submerged in water, respectively, while p w and p s are the densities of water and the PAN bulk material, respectively.
  • HepG2 Human hepatocellular carcinoma cell line
  • 3T3 mouse embryonic fibroblast cell line
  • the medium was exchanged every 48 hr. Once the culture reached 70% confluency, the serum-containing medium was replaced with serum-free medium and incubated for 24 hr before being collected for sEV isolation. Cells were then harvested after media collection with Trypsin-EDTA for 5 min followed by spinning down the cells at 1000 rpm for 5 min. The cells were resuspended in fresh MEM and diluted appropriately to be counted using a hemocytometer.
  • the scaffolds were cut into 4 cm x 2 cm strips and prepared for seeding, which included washing, coating with chitosan, and sterilization. Each sample was rinsed in distilled water for 30 min and transferred to a solution of 1 mg ml_ -1 chitosan in 0.1 M acetic acid for 30 min. The coated nanofiber scaffolds were then rinsed with fresh distilled water for 30 min and air dried. The processed samples were placed in a 60 mL petri dish and UV-sterilized before seeding. HepG2 and 3T3 cells were passaged and seeded separately at 3 10 5 cell scaffold -1 .
  • 3D culture samples containing serum-free medium were stimulated using sinusoidal acoustic waves (3-0 subwoofer; PS-EW1-2; Samsung Electronics, Suwon-si, Republic of Korea) in a sound-controlled box. Samples were stimulated for 15 min at an amplitude of 85 dB and frequency of 100 Hz. The samples were incubated at 37 °C and 5% CO2 for 24 hr before being collected for sEV isolation. The cells were then detached and counted, similar to 2D and 3D cultured samples.
  • sinusoidal acoustic waves 3-subwoofer; PS-EW1-2; Samsung Electronics, Suwon-si, Republic of Korea
  • the cell seeding efficiency was measured in two different tests. One test calculated the number of cells in the scaffold (1), and the other test calculated the number of cells out of the scaffold (2):
  • Seeding efficiency (%) - x 100 cells seeded
  • the seeding efficiency was calculated for scaffolds with and without chitosan coating, and for monolayer cultures.
  • confocal imaging samples were placed in 2 mL of PBS after Live/Dead staining (refer to Section 2.8) and imaged using an A1R-MP Laser Scanning Confocal Microscope (CLSM; Nikon, Tokyo, Japan).
  • the live (green) and dead (red) cell signals obtained from the confocal microscopy were binarized using the threshold function in Imaged software and then combined using an OR operation for each X-Y plane. Viability values were calculated by dividing the binarized area of the red channel across the entire X- Y-Z space by the binarized of the combined green-red channel across the same X- Y-Z space.
  • CellTiter-Glo® and CCK-8 assays were used to measure the cell metabolism of 2D and 3D cultured samples. Both assays were performed using the manufacturer’s protocol.
  • CellTiter- Glo® HepG2 and 3T3 were seeded on 2D and 3D culture samples in 96 well plates at different cell densities (1 x 10 4 ; 2 x 10 4 ; 4 x 10 4 ; 8 x 10 4 ; and 16 x 10 4 cells sample -1 ) and incubated with 50 pL of serum-containing MEM at 37 °C and 5% CO2 for 24 h. The medium was then removed, and the cells were washed twice with PBS before new medium was added.
  • sEV Isolation and Concentration Measurement sEVs were isolated from the media via size-based separation. The isolated media first went through a 0.22 pm filter to capture larger vesicles and cell debris. The flowthrough solution was then added to a 100 kDa centrifuge filter and centrifuged at 200 x g for 4 x 30 min time periods; the mixture was washed with PBS between each centrifuge session. The sEV solution was then concentrated down to 1 ml_ for sEV characterization.
  • the sEV concentration and size distribution were measured through nanoparticle tracking analysis (NTA; Nanosight NS300; Malvern, Worcestershire, UK). Samples were diluted appropriately to maintain accurate particle counts. For each sample, five 60-sec videos were acquired at a camera level of 8 and detection threshold of 2. The laser chamber was cleaned with milliQ water between each sample reading to ensure no sample contamination occurred. The videos were analyzed using the NTA3.0 software to obtain the particle concentration, along with the mean and mode particle sizes of each sample.
  • Western Blot sEVs were lysed with 1 x RIPA buffer (9806; Cell Signaling Technology, USA), and the total protein concentration was quantified using Pierce BCA Protein Assay Kits (23225; Thermo Fisher, USA).
  • the protein amount in lysed sEVs was estimated based on a calibration curve plotted by albumin (BSA) standards.
  • BSA albumin
  • 12 pg of proteins from sEV lysates were denatured and loaded on sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE).
  • the secondary antibodies (anti-mouse HRP-linked antibody, 7076; Cell Signaling Technology, USA) were then treated for blotting and the HRP on the immunoblots was detected by Clarity Max Western Enhanced Chemiluminescence (ECL) Substrate (1705060; Bio-Rad, USA) using a ChemiDoc XRS+ System (Bio-Rad, USA).
  • ECL Western Enhanced Chemiluminescence
  • ELISA enzyme-linked immunosorbent assay
  • the sEV solutions were negatively stained and imaged through transmission electron microscopy (TEM) using the Talios F200i (S)TEM (ThermoFisher, MA) at an 80 kV accelerating voltage.
  • TEM samples were prepared by adding 5 pL of 1 x 10 8 particles mL -1 sEV solution to an ultrathin carbon film copper grid and incubating at room temperature for 2 min. The solution was then aspirated using filter paper and washed with 5 pL filtered distilled water for 10 sec.
  • Uranyless negative staining solution (22409; Electron Microscopy Science, PA) was added to the sample grid (CF200-CU-25; Electron Microscopy Science, PA) and incubated for 1 min.
  • the Uranyless solution was aspirated, and the grid was left to dry before imaging.
  • cfDNA Cell-Free DNA Isolation cfDNA was extracted and isolated from concentrated sEVs from Experimental section 2.12 using Plasma/Serum Cell-Free Circulating DNA Purification Kit - Mini (55100; Norgen Biotek, Canada) per manufacturer instructions.
  • the volume of concentrated sEVs used extraction were 500, 435, 145, 500, 280, and 85 pL for HepG2 2D-culture, HepG2 3D-culture without stimulation, HepG2 3D-culture with stimulation, 3T3 2D-culture, 3T3 3D-culture without stimulation, and 3T3 3D-culture with stimulation, respectively.
  • a blank control sample was extracted in parallel using 500 pL of DNA Dilution Buffer (4405587C; Thermo Fisher, USA). All samples were diluted to 500 pL prior to extraction. All samples were each eluted into 30 pL of purified cfDNA.
  • 2 pL of the isolated cfDNA for each sample and the blank control were used as the template forthe TP53 Outer and NRAS PCR reactions.
  • 2 pL of the amplified PCR products of the TP53 Outer reactions were used as templates for the TP53 Inner PCR reactions. Cycling conditions for the TP53 Outer reactions were: 10 min at 95 °C followed by 40-cycles of [30 sec at 95 °C, 30 sec at 53 °C, 1 min at 60 °C] and ending with 2 min at 60 °C.
  • Amplified PCR products were examined in a 1.5% Agarose- 1 gel formulated using 1 * TAE Buffer (J63931.K2; Thermo Fisher, USA).
  • Sample mixtures of 6 pL containing 1 pL of PCR product or GeneRuler 100 bp DNA Ladder (SM0243; Thermo Fisher, USA), 1 pL of DNA Gel Loading Dye (R0611; Thermo Fisher, USA), and 4 pL of DNA Dilution Buffer (4405587C; Thermo Fisher, USA) were loaded into each lane. Electrophoresis was run in 1 x TAE Buffer at 80 V for 70 min on a PowerPacTM Basic Power Supply (1645050; Thermo Fisher, USA).
  • gels were removed from the electrophoresis unit and incubated away from light in 5 pL Thiazole Green, 10,000x (40086; Biotium, USA) diluted in 50 mL 1 x TAE Buffer for 30 min. Gels were examined using a blue-light transilluminator. Images were taken with a smartphone camera and processed using Imaged.
  • the pore size and porosity of as-synthesized (i.e., 0 hr-expansion sample) and gas-foamed scaffolds were measured.
  • the gas foaming process resulted in scaffolds with significantly larger pore sizes (pristine: 3.0 ⁇ 0.3 pm, 2 hr: 5.3 ⁇ 0.8 pm, 4 hr: 12.6 ⁇ 2.3 pm). Pore sizes above 10 pm facilitate enhanced cell penetration through the scaffold, ensuring an even cell distribution.
  • a water-displacement test was conducted on both pristine and processed fibrous scaffolds.
  • the gas-foamed fibrous scaffolds exhibited ⁇ 2.5-fold higher porosity in comparison with the pristine ones (pristine: 37.0 ⁇ 6.9%, 2 hr: 62.3 ⁇ 5.6%, 4 hr: 91.3 ⁇ 3.7%), signifying greater void space for cell growth within the scaffolds.
  • there was no observed change in the average fiber diameter after gas foaming (pristine: 442 ⁇ 39 nm, 2 hr: 459 ⁇ 63 nm, 4 hr: 441 ⁇ 83 nm) (see FIG. 2B). Therefore, the PESs processed by gas foaming for 4 hr were used for the subsequent work to assess sEV production in the 3D stimulative culture platform.
  • the scaffolds were coated with chitosan, a well-known bioactive polymer used in promoting cell adhesion, cell proliferation, and antibacterial properties.
  • the chitosan coating alleviated the piezoelectric output from the scaffold without completely insulating its piezoelectric properties (FIG. 5).
  • the cell seeding efficiency of coated scaffolds was tested, as compared with unfunctionalized scaffolds (FIG. 1G; a photo of scaffolds before cell seeding is represented in FIG. 6).
  • Two cell lines were chosen, a human hepatocellular carcinoma line (HepG2) and a mouse derived fibroblast cell (3T3), as proof of concept for the following cell related experiments.
  • HepG2 human hepatocellular carcinoma line
  • 3T3 mouse derived fibroblast cell
  • the chitosan coated scaffold showed great biocompatibility for both cell lines (e.g., > 80% for both 3T3 and HepG2; FIG. 7C). These results indicate that cells adhere to the PES with good biocompatibility, aligning with the previous tests on cell viability and adhesion efficiency.
  • the proliferation of each cell line on the scaffolds over 13 days was tested (FIG. 8A). A 6.7 ( ⁇ 0.6)-fold expansion in HepG2 cells and 7.7 ( ⁇ 0.9)-fold expansion in 3T3 cells over 13 days was observed. Therefore, it was concluded that the cells can effectively reproduce on the scaffolds.
  • the sEV production was assessed with and without acoustic stimulation by measuring the sEV yield and the production rate per cell using the CD63 ELISA kit, ExoELISA (FIG. 9D-E). It was found that HepG2 cells in the PES ON group produced sEVs with a 15.4-fold increase in yield and a 15.7-fold increase in production rate compared with the control (2D culture). The effect of cell stimulation was further tested on non-cancer cells using 3T3 cells, a fibroblast cell line, and a similar trend was observed. The 3T3 cells stimulated in the PES produced the largest yield and at the highest rate among all conditions.
  • HSPs heat shock proteins
  • HSP90 in sEVs has several potential functions including selective client protein loading, stress response, cancer progression and metastasis.
  • HSP level increased significantly in PES OFF group while remained non-significant in PES ON group, compared to the control group.
  • HSP70 that stabilize protein did not change significantly and both non-cancer and cancer cells showed the similar trend, this observation indicated that cells in PES OFF group potentially produced more client protein loaded sEVs or displayed more stress response.
  • PES ON group produced sEVs that contained similar level of HSP70 and HSP90 to control group, indicating minimum effect of acoustic stimulations on these two cargos.
  • NADH and ATP assays revealed increased activity in PES 3D culture systems with (PES ON) and without stimulation (PES OFF) compared with the traditional 2D culture (control), which is consistent with previous studies. Notably, a 24% increase in NADH hydrolysis activity and a 16% increase in ATP levels in the PES OFF group were observed compared with 2D culture control. Furthermore, a 45% increase in NADH activity and ATP levels in the PES ON group was observed compared with 2D culture control. This heightened metabolic activity in the stimulated 3D culture, for both representative non-cancer and cancer cells (e.g., 3T3 and HepG2), potentially stems from the increase in secondary messengers such as calcium ions, thus facilitating increased metabolism and sEV biogenesis and production.
  • secondary messengers such as calcium ions
  • Fetal bovine serum (FBS; 26140079), 100X antibiotic- antimycotic (15240062), and 0.25% trypsin-EDTA (25200072) were purchased from ThermoFisher (MA).
  • 4% paraformaldehyde in 0.1 M phosphate buffer (15735) was purchased from Electron Microscopy Science (PA).
  • Cell counting kit-8 (CCK-8;850-039-kl01) was purchased from Enzo Life Sciences (NY).
  • the LIVE/DEADTM Cell Imaging Kit (488/570) was purchased from Thermofisher Scientific (MA).
  • the seeded scaffolds were then incubated for 30 min at 37 °C before the addition of serum-containing MEM and incubation at 37 °C and 5% CO2. After 48 hr, the conditioned medium was replaced with serum-free medium and incubated for 24 h before being collected for sEV isolation. Cells were then counted using cell counting kit-8 using the following protocol: The CCK-8 working reagent was prepared by diluting 10 pL of CCK-8 stock reagent in 190 pL MEM. Then, 200 pL of the working reagent was added to each well and incubated at 37 °C and 5% CO 2 for 4 h. The cell metabolism was then measured through absorbance at 460 nm wavelength.
  • the LIVE/DEADTM Cell Imaging Kit was used following the manufacturer’s instructions.
  • staining each scaffold whether embedding cells were exposed to 1 mL of final staining solution which was a 1 :2 mixture of staining agent from the product and fresh culture media.
  • sEV Isolation and Concentration Measurement sEVs were isolated from the media via size-based separation. The isolated media first went through a 0.22 pm filter to capture larger vesicles and cell debris. The flowthrough solution was then added to a 100 kDa centrifuge filter and centrifuged at 200 * g for 4 x 30 min time periods; the mixture was washed with PBS between each centrifuge session.
  • the sEV solution was then concentrated down to 1 mL for sEV characterization.
  • the sEV concentration and size distribution were measured through nanoparticle tracking analysis (NTA; Nanosight NS300; Malvern, Worcestershire, UK). Samples were diluted appropriately to maintain accurate particle counts. For each sample, five 60-sec videos were acquired at a camera level of 8 and detection threshold of 2. The laser chamber was cleaned with milliQ water between each sample reading to ensure no sample contamination occurred. The videos were analyzed using the NTA3.0 software to obtain the particle concentration, along with the mean and mode particle sizes of each sample. The production rate was calculated using the following equation:
  • RAW264.7 and 3T3 cells were seed on triplicates of PES samples in 96 well plates at 2 x 10 3 cell per scaffold and were incubated for a total of 15 days. At various time point, the cell count was measured using CCK-8 following the same protocol described above. The doubling time was calculated using the following equation: where td is the doubling time and /J is the growth rate.
  • a mouse derived macrophage cell line, RAW264.7 was integrated on the piezoelectric scaffold (PES). It was shown through confocal microscopy imaging that RAW264.7 cells are viable under varying concentrations of cell adhesive coating and can grow on the PES over 9 days with a doubling time of 23.50 ⁇ 0.31 hours which is comparable to the previous non- cancerous cell line (3T3) (Table 4). Overall, it was shown that RAW264.7 cells can be cultivated and grown on the PES. See FIG. 23A-C.
  • Nanofibrous scaffolds were prepared as described in Example 1 using varying wt% concentrations of PAN, including 6 wt%, 8 wt%, 10 wt%, 11 wt%, and 13 wt% PAN. Nanofiber diameters were characterized using SEM and the data are shown in Table 11 and FIG. 29A-B. The nanofiber diameters increased with increasing wt% concentrations of PAN, with average fiber diameters ranging from about 150 nm to about 2200 nm. Table 11. Effect of PAN Concentration on Fiber Diameter

Landscapes

  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Manufacturing & Machinery (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Described herein are systems and methods for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells. In some embodiments, the systems and methods comprise a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers, and acoustic stimulation of the 3D piezoelectric nanofibrous scaffold. In one aspect, the EVs comprise small extracellular vesicles (sEVs). Also described herein are methods of making 3D piezoelectric nanofibrous scaffolds for cell culture comprising electrospinning and gas foaming processes.

Description

STIMULATIVE PIEZOELECTRIC NANOFIBROUS SCAFFOLDS FOR ENHANCED EXTRACELLULAR VESICLE PRODUCTION IN 3D CULTURES
CROSS-REFERENCE TO RELATED APPLICATION(S)
This application claims priority to U.S. Provisional Patent Application No. 63/569,643, filed on March 25, 2024, which is incorporated by reference herein in its entirety.
FEDERALLY SPONSORED RESEARCH
This invention was made with government support under grants R21 CA277663 and R35 GM 150608 awarded by the National Institutes of Health. The government has certain rights in the invention.
REFERENCE TO SEQUENCE LISTING
This application was filed with a Sequence Listing XML in ST.26 XML format in accordance with 37 C.F.R. § 1.831 and PCT Rule 13ter. The Sequence Listing XML file submitted in the USPTO Patent Center, “092012-0043-W001_sequence_listing_xml_5-MAR-2025. xml,” was created on March 5, 2025, contains 6 sequences, has a file size of 8.0 kilobytes (8,192 bytes), and is incorporated by reference in its entirety into the specification.
BACKGROUND
Extracellular vesicles (EVs) are nano/micro-sized lipid particles that are naturally secreted by most eukaryotic cells. Small extracellular vesicles (sEVs) with diameters of 50-200 nm play a critical role in facilitating intercellular communication and have garnered significant interest as potential vehicles for drug delivery due to their numerous advantageous properties. Primarily sEVs exhibit a robust capacity for the encapsulation and transference of bioactive molecules, including proteins, lipids, and nucleic acids. Furthermore, the inherently low immunogenic profile and high biocompatibility of sEVs mitigate the risk of eliciting adverse immunological responses, thereby enhancing patient safety upon administration. Moreover, sEVs possess the optimal dimensional and structural configuration required for carriers in drug delivery applications. There have been tremendous efforts to advance the development of methodologies for the scalable production, isolation, and functionalization of sEVs for clinical and therapeutic applications.
The traditional approach to producing EVs for biomedical applications involves the extraction of media from two-dimensional (2D) cell cultures. However, 2D cell cultures lack certain cell-cell and cell-matrix interactions, resulting in limited efficiency of sEV production. For instance, the standard production method through 2D cell culture systems produces 20-300 sEVs cell-1 hr1 depending on the cell line, providing challenges for the efficient production of effective doses at 109-1011 sEVs mL-1 on a daily time scale. To address this limitation, several strategies for stimulating the cells have been developed as a means of enhancing the production efficiency of 2D cultures. These strategies include chemical, pH, mechanical, electrical, electroporation, hypoxia, and gene expression strategies, as well as exposure to oxidative, thermal, or radiative stress. Reports suggest that mechanical and electrical stimuli can enhance EV production without affecting their size or cargo. These strategies use high magnitudes of electricity, or high frequency mechanical waves to induce EV production through manipulating the cell membrane structure, resulting in EV production enhancements of 1.7-2.1-fold hr1. Despite the advances, these strategies can also lead to relatively low cell viability and the production of immunogenic EVs due to induced stress, posing challenges for their medical applications.
Recently, three-dimensional (3D) cell cultures have been developed to improve EV production efficiency by ~ 3-fold over that of the standard 2D Petri dish cultures. Biomaterialbased 3D culture platforms provide cells with a suitable 3D microenvironment through their biomimetic properties, such as porosity, pore size, and mechanical strength. Such a strategy can enhance EV production by up to three times and result in higher biomarker expressions on the produced EVs, indicating higher activity of EV biogenesis. Despite these advances in EV production methods, sustainable production that meets the requirements of clinical applications remains challenging. Therefore, innovative biomanufacturing platforms for high-efficiency and high-quality EV production have become a central focus in the field of biomedical science and engineering.
What is needed are systems and methods for enhanced cellular production rate and secretion of EVs in 3D cultures.
SUMMARY
One embodiment described herein is a system for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the system comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold. In one aspect, the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof. In another aspect, the polymer nanofibers comprise polyacrylonitrile (PAN). In another aspect, the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%. In another aspect, the device is configured to apply an acoustic frequency of about 1 Hz to about 200 Hz. In another aspect, the device is configured to apply an acoustic amplitude of about 50 dB to about 110 dB. In another aspect, the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation. In another aspect, the EVs comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof. In another aspect, the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm. In another aspect, the system enhances the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems. In another aspect, the acoustic stimulation does not affect cell viability.
Another embodiment described herein is a method for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the method comprising: culturing cells on a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and applying acoustic stimulation to the 3D piezoelectric nanofibrous scaffold, thereby stimulating production and secretion of EVs from the cells. In one aspect, the acoustic stimulation comprises an acoustic frequency of about 1 Hz to about 200 Hz. In another aspect, the acoustic stimulation comprises an acoustic amplitude of about 50 dB to about 110 dB. In another aspect, the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min. In another aspect, the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation. In another aspect, the EVs comprise small extracellular vesicles (sEV), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof. In another aspect, the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm. In another aspect, the cells comprise mammalian cells. In another aspect, the method further comprises isolating the EVs from cell culture media. In another aspect, the method enhances the production rate and secretion of EVs from the cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture methods. In another aspect, the acoustic stimulation does not affect cell viability.
Another embodiment described herein is a method of making a three-dimensional (3D) piezoelectric nanofibrous scaffold for cell culture, the method comprising: electrospinning a solution of piezoelectric polymer nanofibers to form a piezoelectric fiber membrane; and expanding the piezoelectric fiber membrane using gas foaming to form a 3D piezoelectric nanofibrous scaffold comprising polymer nanofibers. In one aspect, the method further comprises adding a coating for cell adhesion to the 3D piezoelectric nanofibrous scaffold. In another aspect, the coating for cell adhesion comprises chitosan. In another aspect, the solution of piezoelectric polymer nanofibers comprises about 6 wt% to about 13 wt% of the polymer nanofibers in N,N- dimethylformamide (DMF). In another aspect, gas foaming comprises submerging the piezoelectric fiber membrane in a solution of sodium borohydride for about 1 hr to about 6 hr. In another aspect, the 3D piezoelectric nanofibrous scaffold has a thickness of about 100 pm to about 680 pm. In another aspect, the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof. In another aspect, the polymer nanofibers comprise polyacrylonitrile (PAN). In another aspect, the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
Another embodiment described herein is a kit for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the kit comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold; optionally, cell culture buffers and reagents; and optionally, packaging, labels, or instructions for use.
DESCRIPTION OF THE DRAWINGS
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
FIG. 1A-G show an overview of the piezoelectric nanofibrous scaffold fabrication and optimization for three-dimensional (3D) cell culture. FIG. 1A shows a schematic for developing and processing the cell-compatible piezoelectric scaffold (PES). FIG. 1 B shows scanning electron microscopy (SEM) images of the piezoelectric scaffold cross section with and without gas foaming. FIG. 1 C-D show the expansion ratio (h/ho) (FIG. 1C) and the pore size and porosity (FIG. 1 D) of PES with varying expansion times. FIG. 1 E-F show the effect of the acoustic frequency on the piezoelectric properties of the scaffolds. FIG. 1G shows the effect of chitosan coating of the scaffolds on the cell seeding efficiency (Left: HepG2; Right: 3T3). Data shown as ± S.D. of 5 replicate samples: ****p < 0.0001 .
FIG. 2A shows scanning electron microscopy (SEM) images for the Piezoelectric scaffolds (PES) at 0, 2, and 4 hours of gas foaming. FIG. 2B shows measured fiber diameter inside PES along the gas expansion time.
FIG. 3 shows the effect of acoustic amplitude on the piezoelectric properties of PES at frequencies of 10, 25, 50, 75, 100, 150, 200, 500, 750, and 1000 Hz. Scale bars are ± 1 standard deviation. (N = 4).
FIG. 4 shows the effect of acoustic stimulation on the pore size of PES. Scale bars are ± 1 standard error of mean (S.E.M.). (N = 5).
FIG. 5 shows PE output comparison between pristine scaffold (left) and chitosan-coated scaffold (right).
FIG. 6 shows representative digital image of the scaffold inside the culture media.
FIG. 7A-C show confocal light scanning microscopic images of 3T3 and HepG2 on chitosan-coated scaffolds stained with live/dead kit. FIG. 7A shows maximum intensity projected images of both cell lines (Left: 3T3 and Right: HepG2). FIG. 7B shows 3D constructed confocal image of both cell lines (Left: 3T3 and Right: HepG2). FIG. 7C shows cell viability comparison between 3T3 and HepG2. Red and green signals were collected from confocal images for each cell line (N = 3).
FIG. 8A-C show the biocompatibility and cell proliferation on PES. FIG. 8A shows cell proliferation after 14 days of cell culture on PES. FIG. 8B-C show cell viability after stimulation at amplitudes between 50-110 dB (FIG. 8B) and 85 dB (FIG. 8C).
FIG. 9A shows a schematic of the piezoelectric stimulation that enhances sEV production. FIG. 9B-C show size distribution of sEVs derived from HepG2 (FIG. 9B) and 3T3 cells (FIG. 9C) using NTA. Data shown as ± S.D. of 5 replicate samples. FIG. 9D-E show the measured EV production rate per cell using ExoELISA. Data shown as ± S.D. of 5 replicate samples: ****p < 0.0001.
FIG. 10 shows raw particle count from NTA analysis (N = 5).
FIG. 11 shows sEV characterization using nanoparticle tracking analysis (NTA). The mean particle size of the produced sEVs. Error bars are ± 1 S.D. (N = 5). FIG. 12A-B show size distribution of sEVs through transmission electron microscopy (TEM). FIG. 12A shows TEM images of sEVs from control, and PES culture. FIG. 12B shows size distributions histograms of sEVs based on TEM imaging.
FIG. 13 shows the sEV production measurements of PES with and without activation using NTA (S.D.; N = 5). ****P < 0.0001 .
FIG. 14 shows the sEV production from control group with acoustic stimulation (Cntr ON; Red: HepG2, Blue: 3T3).
FIG. 15A-E show the characterization of sEVs in 2D culture control, PES OFF, and PES ON groups. FIG. 15A shows sEV marker characterization of CD9, CD63, and CD81, and HSP70 and HSP90 using western blot assays. FIG. 15B-C show quantitative measurement of HSP70 in HepG2- (FIG. 15B) and 3T3-derived sEVs (FIG. 15C). FIG. 15D-E show quantitative measurement of HSP90 in HepG2- (FIG. 15D) and 3T3-derived (FIG. 15E) sEVs. Data shown as mean ± S.E.M. of 3 replicate samples are representative of two independent experiments: *P
< 0.05, **P < 0.01 ***P < 0.001 , and ****P < 0.0001.
FIG. 16A-B show images of Western blot gels using the white light channel for HepG2 derived sEVs (FIG. 16A) and 3T3 derived sEVs (FIG. 16B).
FIG. 17A-B show images of Western blot gels using the color light channel for HepG2 derived sEVs (FIG. 17A) and 3T3 derived sEVs (FIG. 17B), and the bands were imaged using the white light channel.
FIG. 18A-C show gel electrophoresis results from the plasma cell-free DNA (cfDNA) polymerase chain reaction (PCR) of sEV content. FIG. 18A shows NRAS-targeting PCR result from HepG2 (left) and 3T3 (right). FIG. 18B shows TP53 Inner-targeting PCR result from HepG2 (left) and 3T3 (right). FIG. 18C shows TP53 Outer-targeting PCR result from HepG2 (left) and 3T3 (right).
FIG. 19A shows a schematic of mechanisms for enhanced EVs through control, PES OFF and PES ON groups. FIG. 19B shows ATP levels for all groups at various cell counts using Celltiter-glo. Data shown as ± S.D. of 3 replicate samples are representative of two independent experiments: *P < 0.05, **P < 0.01 , ***P < 0.001 , and ****p < 0.0001. FIG. 19C shows a comparison of NADH activity for all groups at various cell counts using cell counting kit-8 (CCK- 8) assay. Data shown as ± S.D. of 3 replicate samples are representative of two independent experiments: One-way ANOVA analysis with *P < 0.05, **P < 0.01 , and ***P < 0.001. FIG. 19D shows the relative calcium concentrations of all groups measured by Fura-2AM. Data shown as ± S.D. of 3 replicate samples are representative of two independent experiments: *P < 0.05, **P
< 0.01 , and ***P < 0.001. FIG. 20A shows SEM images of HepG2 and 3T3 cells under three different cultures including 2D, PES OFF, and PES ON cultures. (Scale bar: 10 pm). FIG. 20B shows the cell measurement through roundness. FIG. 20C shows the correlation between the roundness and the sEV production rate and fold change in production rate post stimulation. All data shown as ± S.D. of 3 replicate samples is representative of two independent experiments: *P < 0.05, **P < 0.01 ***P < 0.001 , and ****P < 0.0001 .
FIG. 21 shows cell morphology analysis outlined SEM images.
FIG. 22A-B show cell morphology measurement including axial ratio (FIG. 22A) and cell area (FIG. 22B) on 2D and PES culture platforms using SEM imaging. Scale bars are ± 1 S.D. (N = 3). **P < 0.01 and ***P < 0.001.
FIG. 23A-C show cell culture characterization of RAW264.7 cells on the piezoelectric scaffold (PES) platform. FIG. 23A shows Live/Dead assay of RAW264.7 cultured on the PES with varying chitosan coating concentration. Scale bar is 100 pm. FIG. 23B shows the calculated Cell viability based on the live/dead assay. FIG. 23C shows cell growth curve of RAW264.7 and 3T3 cells on the PES.
FIG. 24A-B show quantification of small extracellular vesicle (sEV) production rate of RAW264.7 cells cultured under standard 2D culture, PES without stimulation (PES OFF), and PES with acoustic stimulation (PES ON). FIG. 24A shows size distribution of sEVs through nanoparticle tracking analysis. FIG. 24B shows sEV production rate of RAW264.7 derived sEVs.
FIG. 25A-D show quantification of sEV production rate of RAW264.7 cells cultured under various amplitudes of stimuli measured in decibels (dB). FIG. 25A shows size distribution of sEVs through nanoparticle tracking analysis. FIG. 25B shows sEV production rate of RAW264.7 derived sEVs. FIG. 25C shows measured cell count of each sample obtained using cell counting kit-8 (CCK-8). FIG. 25D shows the mean particle size of the sEVs.
FIG. 26A-D show quantification of sEV production rate of RAW264.7 cells cultured under various frequencies of stimuli measured in Hertz (Hz). FIG. 26A shows size distribution of sEVs through nanoparticle tracking analysis. FIG. 26B shows sEV production rate of RAW264.7 derived sEVs. FIG. 26C shows measured cell count of each sample obtained using CCK-8. FIG. 26D shows the mean particle size of the sEVs.
FIG. 27A-D show quantification of sEV production rate of RAW264.7 cells cultured under various beat frequencies of stimuli measured in Hertz (Hz). FIG. 27A shows size distribution of sEVs through nanoparticle tracking analysis. FIG. 27B shows sEV production rate of RAW264.7 derived sEVs. FIG. 27C shows measured cell count of each sample obtained using CCK-8. FIG. 27D shows the mean particle size of the sEVs. FIG. 28 shows characterizations of the beat frequency using a standard microphone and sound meter. (N = 3).
FIG. 29A-B show fiber diameter characterization of PES samples. FIG. 29A shows scanning electron microscopy (SEM) images of different scaffolds. Scale bar is 5 pm. FIG. 29B shows the size distribution of each sample corresponding to the SEM image.
DETAILED DESCRIPTION
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of biochemistry, molecular biology, immunology, microbiology, genetics, cell and tissue culture, and protein and nucleic acid chemistry described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein.
As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein.
As used herein, terms such as “include,” “including,” “contain,” “containing,” “having,” and the like mean “comprising.” The present disclosure also contemplates other embodiments “comprising,” “consisting essentially of,” and “consisting of’ the embodiments or elements presented herein, whether explicitly set forth or not. As used herein, “comprising,” is an “open- ended” term that does not exclude additional, unrecited elements or method steps. As used herein, “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim.
As used herein, the term “a,” “an,” “the” and similar terms used in the context of the disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In addition, “a,” “an,” or “the” means “one or more” unless otherwise specified.
As used herein, the term “or” can be conjunctive or disjunctive.
As used herein, the term “and/or” refers to both the conjunctive and disjunctive. As used herein, the term “substantially” means to a great or significant extent, but not completely.
As used herein, the term “about” or “approximately” as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In one aspect, the term “about” refers to any values, including both integers and fractional components that are within a variation of up to ± 10% of the value modified by the term “about.” Alternatively, “about” can mean within 3 or more standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value. As used herein, the symbol means “about” or “approximately.”
All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1-2.0 includes 0.1 , 0.2, 0.3, 0.4 . . . 2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ±10% of any value within the range or within 3 or more standard deviations, including the end points, or as described above in the definition of “about.”
As used herein, the terms “room temperature,” “RT,” or “ambient temperature” refer to the typical temperature in an indoor laboratory setting. In one aspect, the laboratory setting is climate controlled to maintain the temperature at a substantially uniform temperature or with a specific range of temperatures. In one aspect, “room temperature” refers a temperature of about 15-30 °C, including all integers and endpoints within the specified range. In another aspect, “room temperature” refers to a temperature of about 15-30 °C; about 20-30 °C; about 22-30 °C; about 25-30 °C; about 27-30 °C; about 15-22 °C; about 15-25 °C; about 15-27 °C; about 20-22 °C; about 20-25 °C; about 20-27 °C; about 22-25 °C; about 22-27 °C; about 25-27 °C; about 15 °C ± 10%; about 20 °C ± 10%; about 22 °C ± 10%; about 25 °C ± 10%; about 27 °C ± 10%; ~20 °C, ~22 °C, ~25 °C, or ~27 °C, at standard atmospheric pressure.
As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments or control cells.
Nanofibrous scaffolds have been widely used for 3D cell cultures in tissue engineering due to their biomimetic properties, such as variable porosity, a high surface-volume ratio, and structural similarity to the extracellular matrix (ECM). An advantage is the integration of stimuli- responsive materials into nanofibrous structures. These materials can respond to various stimuli present in the tissue microenvironment, such as changes in temperature, pH, and mechanical forces, closely emulating the dynamic conditions of the ECM. By combining the effects of external cell stimuli with a 3D biomimetic microenvironment, these scaffolds enhance the cell-cell and cell-matrix interactions. Hence, stimulative nanofibrous scaffolds not only mimic the natural tissue settings more closely, but also have the potential to improve the efficiency and quality of EV production.
Small extracellular vesicles (sEVs) have great promise as effective carriers for drug delivery. However, the challenges associated with the efficient production of sEVs hinder their clinical applications. Herein, a stimulative 3D culture platform is described for enhanced sEV production. In some embodiments, the disclosed platform includes a piezoelectric nanofibrous scaffold (PES) coupled with acoustic stimulation to enhance sEV production of cells in a 3D biomimetic microenvironment. Combining cell stimulation with a 3D culture platform in this stimulative PES environment was found to enable a 15.7-fold increase in the production rate per cell with minimal deviations in particle size and protein composition compared with standard 2D cultures. It was also found that the enhanced sEV production is attributable to the activation and upregulation of crucial sEV production steps through the synergistic effect of stimulation and the 3D microenvironment. Moreover, changes in cell morphology lead to cytoskeleton redistribution through cell-matrix interactions in the 3D cultures. This in turn facilitates intracellular EV trafficking, which impacts the production rate. Overall, the work described herein provides a promising 3D cell culture platform based on piezoelectric biomaterials for enhanced EV production. This platform is expected to accelerate the potential use of EVs for drug delivery and broad biomedical applications.
In the studies described herein, a tunable, stimulative 3D culture platform using piezoelectric nanofibrous scaffolds was developed. This is the first 3D culture platform to achieve controlled piezoelectrical stimuli for enhanced sEV production. Piezoelectric polymers have recently been used to build nanofibrous scaffolds for energy storage, stimulatory cell cultures, and dynamic sensors. Specifically, piezoelectric nanofibers have been used in various biomedical applications such as tissue regeneration, where electrical stimulation causes cellular migration, and enhanced proliferation. In this regard, piezoelectric nanofibers provide controlled stimuli to cells by converting mechanical forces to electric potential through the direct piezoelectric effect. Piezoelectric nanofibers are easy to fabricate and can be finely tuned through the electrospinning process, offering precise control over their properties. Moreover, when used as tissue culture scaffolds, these piezoelectric nanofibers closely mimic certain bioelectrical properties by providing electrical stimuli through the cell-cell communication commonly found in natural cell microenvironments such as nervous tissue, liver tissue, and breast tissue.
As described herein, PESs were fabricated using polymer nanofibers and structural parameters were optimized for ideal 3D cell culture conditions by tuning the porosity, pore size, and thickness using gas foaming techniques. The data disclosed herein demonstrate that the 3D cell culture in PES increases the production rate of sEVs per cell by a factor of 15.7 in HepG2 cells and by a factor of 6.7 in 3T3 cells, compared with 2D culture. Importantly, the yielded sEVs were intact under the stimulated conditions. In addition, the PES platform demonstrated a method for safe, low voltage stimulation resulting in cell viability of over 90%.
By investigating the underlying mechanisms, it was discovered that the significant enhancement in sEV production is attributable to the activation and upregulation of crucial sEV production steps through the synergistic effect of stimulation and the 3D microenvironment. This was confirmed by a 1.5-fold rise in intracellular calcium ions and a 40% increase in metabolite concentration. Moreover, it was found that the enhancement in sEV production was correlated with the cell morphology across different cell lines and culture conditions, potentially contributing to the cytoskeleton changes due to cell-matrix interactions in 3D cultures that facilitate intracellular EV trafficking. Overall, the studies described herein provide a promising platform for overcoming the limitations of EV production by improving the production rates and size distribution of EVs for drug delivery and broad biomedical applications.
One embodiment described herein is a system for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the system comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold.
Another embodiment described herein is a method for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the method comprising: culturing cells on a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and applying acoustic stimulation to the 3D piezoelectric nanofibrous scaffold, thereby stimulating production and secretion of EVs from the cells.
Another embodiment described herein is a method of making a three-dimensional (3D) piezoelectric nanofibrous scaffold for cell culture, the method comprising: electrospinning a solution of piezoelectric polymer nanofibers to form a piezoelectric fiber membrane; and expanding the piezoelectric fiber membrane using gas foaming to form a 3D piezoelectric nanofibrous scaffold comprising polymer nanofibers. Another embodiment described herein is a kit for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the kit comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold; optionally, cell culture buffers and reagents; and optionally, packaging, labels, or instructions for use.
In certain aspects, the polymer nanofibers described herein comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co- glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PAN I), polyfluorene, polypyrrole (PPy), poly(3,4- ethylenedioxythiophene), or combinations thereof. In one exemplary aspect, the polymer nanofibers comprise polyacrylonitrile (PAN).
In certain aspects, the polymer nanofibers described herein have an average diameter of about 150 nm to about 2200 nm. In some embodiments, the polymer nanofibers have an average diameter of about 250 nm to about 2200 nm, about 500 nm to about 2200 nm, about 750 nm to about 2200 nm, about 1000 nm to about 2200 nm, about 1250 nm to about 2200 nm, about 1500 nm to about 2200 nm, about 1750 nm to about 2200 nm, about 2000 nm to about 2200 nm, about 150 nm to about 2000 nm, about 150 nm to about 1750 nm, about 150 nm to about 1500 nm, about 150 nm to about 1250 nm, about 150 nm to about 1000 nm, about 150 nm to about 750 nm, about 150 nm to about 500 nm, about 150 nm to about 250 nm, about 400 nm to about 2000 nm, about 600 nm to about 1800 nm, about 800 nm to about 1600 nm, about 1000 nm to about 1600 nm, or about 1200 nm to about 1400 nm, including all values and ranges within these ranges. In other embodiments, the polymer nanofibers have an average diameter of no less than about 150 nm, no less than about 250 nm, no less than about 500 nm, no less than about 750 nm, no less than about 1000 nm, no less than about 1250 nm, no less than about 1500 nm, no less than about 1750 nm, or no less than about 2000 nm. In other embodiments, the polymer nanofibers have an average diameter of no greater than about 2200 nm, no greater than about 2000 nm, no greater than about 1750 nm, no greater than about 1500 nm, no greater than about 1250 nm, no greater than about 1000 nm, no greater than about 750 nm, no greater than about 500 nm, or no greater than about 250 nm.
In certain aspects, the 3D piezoelectric nanofibrous scaffolds described herein are porous and comprise an average pore size of about 2 pm to about 15 pm. In some embodiments, the 3D piezoelectric nanofibrous scaffolds comprise an average pore size of about 4 pm to about 15 pm, about 6 pm to about 15 pm, about 8 pm to about 15 pm, about 10 pm to about 15 pm, about 12 pm to about 15 pm, about 14 pm to about 15 pm, about 2 pm to about 13 pm, about 2 pm to about 11 pm, about 2 pm to about 9 pm, about 2 pm to about 7 pm, about 2 pm to about 5 pm, about 2 pm to about 3 pm, about 3 pm to about 14 pm, about 4 pm to about 13 pm, about 5 pm to about 12 pm, about 6 pm to about 11 pm, about 7 pm to about 10 pm, or about 8 pm to about 9 pm, including all values and ranges within these ranges. In other embodiments, the 3D piezoelectric nanofibrous scaffolds comprise an average pore size of no less than about 2 pm, no less than about 3 pm, no less than about 4 pm, no less than about 5 pm, no less than about 6 pm, no less than about 7 pm, no less than about 8 pm, no less than about 9 pm, no less than about 10 pm, no less than about 11 pm, no less than about 12 pm, no less than about 13 pm, or no less than about 14 pm. In other embodiments, the 3D piezoelectric nanofibrous scaffolds comprise an average pore size of no greater than about 15 pm, no greater than about 14 pm, no greater than about 13 pm, no greater than about 12 pm, no greater than about 11 pm, no greater than about 10 pm, no greater than about 9 pm, no greater than about 8 pm, no greater than about 7 pm, no greater than about 6 pm, no greater than about 5 pm, no greater than about 4 pm, or no greater than about 3 pm.
In certain aspects, the 3D piezoelectric nanofibrous scaffolds described herein are porous and comprise a porosity of about 25% to about 95%. In some embodiments, the 3D piezoelectric nanofibrous scaffolds comprise a porosity of about 30% to about 95%, about 40% to about 95%, about 50% to about 95%, about 60% to about 95%, about 70% to about 95%, about 80% to about 95%, about 90% to about 95%, about 25% to about 90%, about 25% to about 80%, about 25% to about 70%, about 25% to about 60%, about 25% to about 50%, about 25% to about 40%, about 25% to about 30%, about 30% to about 90%, about 40% to about 80%, or about 50% to about 70%, including all values and ranges within these ranges. In other embodiments, the 3D piezoelectric nanofibrous scaffolds comprise a porosity of no less than about 25%, no less than about 30%, no less than about 40%, no less than about 50%, no less than about 60%, no less than about 70%, no less than about 80%, or no less than about 90%. In other embodiments, the 3D piezoelectric nanofibrous scaffolds comprise a porosity of no greater than about 95%, no greater than about 90%, no greater than about 80%, no greater than about 70%, no greater than about 60%, no greater than about 50%, no greater than about 40%, or no greater than about 30%.
In certain aspects, the acoustic stimulation described herein comprises an acoustic frequency of about 1 Hz to about 200 Hz. In some embodiments, the acoustic stimulation comprises an acoustic frequency of about 5 Hz to about 200 Hz, about 10 Hz to about 200 Hz, about 25 Hz to about 200 Hz, about 50 Hz to about 200 Hz, about 75 Hz to about 200 Hz, about 100 Hz to about 200 Hz, about 125 Hz to about 200 Hz, about 150 Hz to about 200 Hz, about 175 Hz to about 200 Hz, about 190 Hz to about 200 Hz, about 1 Hz to about 190 Hz, about 1 Hz to about 175 Hz, about 1 Hz to about 150 Hz, about 1 Hz to about 125 Hz, about 1 Hz to about 100 Hz, about 1 Hz to about 75 Hz, about 1 Hz to about 50 Hz, about 1 Hz to about 25 Hz, about 1 Hz to about 10 Hz, about 1 Hz to about 5 Hz, about 5 Hz to about 190 Hz, about 10 Hz to about 175 Hz, about 25 Hz to about 150 Hz, about 50 Hz to about 125 Hz, or about 75 Hz to about 100 Hz, including all values and ranges within these ranges. In other embodiments, the acoustic stimulation comprises an acoustic frequency of no less than about 1 Hz, no less than about 5 Hz, no less than about 10 Hz, no less than about 25 Hz, no less than about 50 Hz, no less than about 75 Hz, no less than about 100 Hz, no less than about 125 Hz, no less than about 150 Hz, no less than about 175 Hz, or no less than about 190 Hz. In other embodiments, the acoustic stimulation comprises an acoustic frequency of no greater than about 200 Hz, no greater than about 190 Hz, no greater than about 175 Hz, no greater than about 150 Hz, no greater than about 125 Hz, no greater than about 100 Hz, no greater than about 75 Hz, no greater than about 50 Hz, no greater than about 25 Hz, no greater than about 10 Hz, or no greater than about 5 Hz.
In certain aspects, the acoustic stimulation described herein comprises an acoustic amplitude of about 50 dB to about 110 dB. In some embodiments, the acoustic stimulation comprises an acoustic amplitude of about 60 dB to about 110 dB, about 70 dB to about 110 dB, about 80 dB to about 110 dB, about 90 dB to about 110 dB, about 100 dB to about 110 dB, about 50 dB to about 100 dB, about 50 dB to about 90 dB, about 50 dB to about 80 dB, about 50 dB to about 70 dB, about 50 dB to about 60 dB, about 60 dB to about 100 dB, or about 70 dB to about 90 dB, including all values and ranges within these ranges. In other embodiments, the acoustic stimulation comprises an acoustic amplitude of no less than about 50 dB, no less than about 60 dB, no less than about 70 dB, no less than about 80 dB, no less than about 90 dB, or no less than about 100 dB. In other embodiments, the acoustic stimulation comprises an acoustic amplitude of no greater than about 110 dB, no greater than about 100 dB, no greater than about 90 dB, no greater than about 80 dB, no greater than about 70 dB, or no greater than about 60 dB.
In certain aspects, the 3D piezoelectric nanofibrous scaffolds described herein output a voltage of about 30 mV to about 850 mV upon acoustic stimulation. In some embodiments, the output voltage is about 50 mV to about 850 mV, about 100 mV to about 850 mV, about 150 mV to about 850 mV, about 200 mV to about 850 mV, about 250 mV to about 850 mV, about 300 mV to about 850 mV, about 350 mV to about 850 mV, about 400 mV to about 850 mV, about 450 mV to about 850 mV, about 500 mV to about 850 mV, about 550 mV to about 850 mV, about 600 mV to about 850 mV, about 650 mV to about 850 mV, about 700 mV to about 850 mV, about 750 mV to about 850 mV, about 800 mV to about 850 mV, about 30 mV to about 800 mV, about 30 mV to about 750 mV, about 30 mV to about 700 mV, about 30 mV to about 650 mV, about 30 mV to about 600 mV, about 30 mV to about 550 mV, about 30 mV to about 500 mV, about 30 mV to about 450 mV, about 30 mV to about 400 mV, about 30 mV to about 350 mV, about 30 mV to about 300 mV, about 30 mV to about 250 mV, about 30 mV to about 200 mV, about 30 mV to about 150 mV, about 30 mV to about 100 mV, about 30 mV to about 50 mV, about 50 mV to about 800 mV, about 100 mV to about 750 mV, about 150 mV to about 700 mV, about 200 mV to about 650 mV, about 250 mV to about 600 mV, about 300 mV to about 550 mV, about 350 mV to about
500 mV, or about 400 mV to about 450 mV upon acoustic stimulation, including all values and ranges within these ranges. In other embodiments, the output voltage is no less than about 30 mV, no less than about 50 mV, no less than about 100 mV, no less than about 150 mV, no less than about 200 mV, no less than about 250 mV, no less than about 300 mV, no less than about
350 mV, no less than about 400 mV, no less than about 450 mV, no less than about 500 mV, no less than about 550 mV, no less than about 600 mV, no less than about 650 mV, no less than about 700 mV, no less than about 750 mV, or no less than about 800 mV upon acoustic stimulation. In other embodiments, the output voltage is no greater than about 850 mV, no greater than about 800 mV, no greater than about 750 mV, no greater than about 700 mV, no greater than about 650 mV, no greater than about 600 mV, no greater than about 550 mV, no greater than about 500 mV, no greater than about 450 mV, no greater than about 400 mV, no greater than about 350 mV, no greater than about 300 mV, no greater than about 250 mV, no greater than about 200 mV, no greater than about 150 mV, no greater than about 100 mV, or no greater than about 50 mV upon acoustic stimulation.
In certain aspects, the 3D piezoelectric nanofibrous scaffolds described herein have a thickness of about 100 pm to about 680 pm. In some embodiments, the 3D piezoelectric nanofibrous scaffold has a thickness of about 150 pm to about 680 pm, about 200 pm to about 680 pm, about 250 pm to about 680 pm, about 300 pm to about 680 pm, about 350 pm to about
680 pm, about 400 pm to about 680 pm, about 450 pm to about 680 pm, about 500 pm to about
680 pm, about 550 pm to about 680 pm, about 600 pm to about 680 pm, about 650 pm to about
680 pm, about 100 pm to about 650 pm, about 100 pm to about 600 pm, about 100 pm to about
550 pm, about 100 pm to about 500 pm, about 100 pm to about 450 pm, about 100 pm to about
400 pm, about 100 pm to about 350 pm, about 100 pm to about 300 pm, about 100 pm to about
250 pm, about 100 pm to about 200 pm, about 100 pm to about 150 pm, about 150 pm to about
650 pm, about 200 pm to about 600 pm, about 250 pm to about 550 pm, about 300 pm to about
500 pm, or about 350 pm to about 450 pm, including all values and ranges within these ranges. In other embodiments, the 3D piezoelectric nanofibrous scaffold has a thickness of no less than about 100 pm, no less than about 150 pm, no less than about 200 pm, no less than about 250 pm, no less than about 300 pm, no less than about 350 pm, no less than about 400 pm, no less than about 450 pm, no less than about 500 pm, no less than about 550 pm, no less than about 600 pm, or no less than about 650 pm. In other embodiments, the 3D piezoelectric nanofibrous scaffold has a thickness of no greater than about 680 pm, no greater than about 650 pm, no greater than about 600 pm, no greater than about 550 pm, no greater than about 500 pm, no greater than about 450 pm, no greater than about 400 pm, no greater than about 350 pm, no greater than about 300 pm, no greater than about 250 pm, no greater than about 200 pm, or no greater than about 150 pm.
In certain aspects, the EVs described herein comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof. In one exemplary aspect, the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
In certain aspects, the systems, methods, and kits described herein enhance the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems, methods, and kits. In one exemplary aspect, the production rate and secretion of EVs from cells are increased by greater than 15-fold.
In certain aspects, the acoustic stimulation described herein does not affect cell viability. In one exemplary aspect, the acoustic stimulation results in greater than 90% cell viability. In other aspects, the cells comprise mammalian cells. In certain exemplary aspects, the cells comprise cancer cells, fibroblasts, or immune cells.
In certain aspects, the acoustic stimulation described herein is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min. In one exemplary aspect, the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 15 min.
In certain aspects, the methods described herein further comprise isolating the EVs from cell culture media using known techniques.
In certain aspects, the methods described herein further comprise adding a coating for cell adhesion to the 3D piezoelectric nanofibrous scaffold. In one exemplary aspect, the coating for cell adhesion comprises chitosan.
In certain aspects, the solution of piezoelectric polymer nanofibers described herein comprises about 6 wt% to about 13 wt% of the polymer nanofibers in A/,A/-dimethylformamide (DMF). In some embodiments, the solution of piezoelectric polymer nanofibers comprises about 7 wt% to about 13 wt%, about 8 wt% to about 13 wt%, about 9 wt% to about 13 wt%, about 10 wt% to about 13 wt%, about 11 wt% to about 13 wt%, about 12 wt% to about 13 wt%, about 6 wt% to about 12 wt%, about 6 wt% to about 11 wt%, about 6 wt% to about 10 wt%, about 6 wt% to about 9 wt%, about 6 wt% to about 8 wt%, about 6 wt% to about 7 wt%, about 7 wt% to about 12 wt%, about 8 wt% to about H wt%, or about 9 wt% to about 10 wt% of the polymer nanofibers in DMF, including all values and ranges within these ranges. In other embodiments, the solution of piezoelectric polymer nanofibers comprises no less than about 6 wt%, no less than about 7 wt%, no less than about 8 wt%, no less than about 9 wt%, no less than about 10 wt%, no less than about 11 wt%, or no less than about 12 wt% of the polymer nanofibers in DMF. In other embodiments, the solution of piezoelectric polymer nanofibers comprises no greater than about 13 wt%, no greater than about 12 wt%, no greater than about 11 wt%, no greater than about 10 wt%, no greater than about 9 wt%, no greater than about 8 wt%, or no greater than about 7 wt% of the polymer nanofibers in DMF. In one exemplary aspect, the solution of piezoelectric polymer nanofibers comprises 10 wt% of the polymer nanofibers in DMF.
In certain aspects, gas foaming comprises submerging the piezoelectric fiber membrane in a solution of sodium borohydride for about 1 hr to about 6 hr. In one exemplary aspect, gas foaming comprises submerging the piezoelectric fiber membrane in a solution of sodium borohydride for about 4 hr.
One embodiment described herein is a system for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the system comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold. In one aspect, the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof. In another aspect, the polymer nanofibers comprise polyacrylonitrile (PAN). In another aspect, the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%. In another aspect, the device is configured to apply an acoustic frequency of about 1 Hz to about 200 Hz. In another aspect, the device is configured to apply an acoustic amplitude of about 50 dB to about 110 dB. In another aspect, the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation. In another aspect, the EVs comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof. In another aspect, the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm. In another aspect, the system enhances the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems. In another aspect, the acoustic stimulation does not affect cell viability.
Another embodiment described herein is a method for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the method comprising: culturing cells on a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and applying acoustic stimulation to the 3D piezoelectric nanofibrous scaffold, thereby stimulating production and secretion of EVs from the cells. In one aspect, the acoustic stimulation comprises an acoustic frequency of about 1 Hz to about 200 Hz. In another aspect, the acoustic stimulation comprises an acoustic amplitude of about 50 dB to about 110 dB. In another aspect, the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min. In another aspect, the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation. In another aspect, the EVs comprise small extracellular vesicles (sEV), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof. In another aspect, the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm. In another aspect, the cells comprise mammalian cells. In another aspect, the method further comprises isolating the EVs from cell culture media. In another aspect, the method enhances the production rate and secretion of EVs from the cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture methods. In another aspect, the acoustic stimulation does not affect cell viability.
Another embodiment described herein is a method of making a three-dimensional (3D) piezoelectric nanofibrous scaffold for cell culture, the method comprising: electrospinning a solution of piezoelectric polymer nanofibers to form a piezoelectric fiber membrane; and expanding the piezoelectric fiber membrane using gas foaming to form a 3D piezoelectric nanofibrous scaffold comprising polymer nanofibers. In one aspect, the method further comprises adding a coating for cell adhesion to the 3D piezoelectric nanofibrous scaffold. In another aspect, the coating for cell adhesion comprises chitosan. In another aspect, the solution of piezoelectric polymer nanofibers comprises about 6 wt% to about 13 wt% of the polymer nanofibers in N,N- dimethylformamide (DMF). In another aspect, gas foaming comprises submerging the piezoelectric fiber membrane in a solution of sodium borohydride for about 1 hr to about 6 hr. In another aspect, the 3D piezoelectric nanofibrous scaffold has a thickness of about 100 pm to about 680 pm. In another aspect, the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof. In another aspect, the polymer nanofibers comprise polyacrylonitrile (PAN). In another aspect, the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm. In another aspect, the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
Another embodiment described herein is a kit for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the kit comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold; optionally, cell culture buffers and reagents; and optionally, packaging, labels, or instructions for use.
It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described. The exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein. The ratios of the mass of any component of any of the compositions or formulations disclosed herein to the mass of any other component in the formulation or to the total mass of the other components in the formulation are hereby disclosed as if they were expressly disclosed. Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. Furthermore, the foregoing discussion discloses and describes merely exemplary embodiments. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof.
Various embodiments and aspects of the inventions described herein are summarized by the following clauses: Clause 1 . A system for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the system comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold.
Clause 2. The system of clause 1 , wherein the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLI_A), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof.
Clause 3. The system of clause 1 or 2, wherein the polymer nanofibers comprise polyacrylonitrile (PAN).
Clause 4. The system of any one of clauses 1-3, wherein the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
Clause 5. The system of any one of clauses 1-4, wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm.
Clause 6. The system of any one of clauses 1-5, wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
Clause 7. The system of any one of clauses 1-6, wherein the device is configured to apply an acoustic frequency of about 1 Hz to about 200 Hz.
Clause 8. The system of any one of clauses 1-7, wherein the device is configured to apply an acoustic amplitude of about 50 dB to about 110 dB.
Clause 9. The system of any one of clauses 1-8, wherein the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
Clause 10. The system of any one of clauses 1-9, wherein the EVs comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
Clause 11. The system of any one of clauses 1-10, wherein the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
Clause 12. The system of any one of clauses 1-11 , wherein the system enhances the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems. Clause 13. The system of any one of clauses 1-12, wherein the acoustic stimulation does not affect cell viability.
Clause 14. A method for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the method comprising: culturing cells on a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and applying acoustic stimulation to the 3D piezoelectric nanofibrous scaffold, thereby stimulating production and secretion of EVs from the cells.
Clause 15. The method of clause 14, wherein the acoustic stimulation comprises an acoustic frequency of about 1 Hz to about 200 Hz.
Clause 16. The method of clause 14 or 15, wherein the acoustic stimulation comprises an acoustic amplitude of about 50 dB to about 110 dB.
Clause 17. The method of any one of clauses 14-16, wherein the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min.
Clause 18. The method of any one of clauses 14-17, wherein the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
Clause 19. The method of any one of clauses 14-18, wherein the EVs comprise small extracellular vesicles (sEV), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
Clause 20. The method of any one of clauses 14-19, wherein the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
Clause 21. The method of any one of clauses 14-20, wherein the cells comprise mammalian cells.
Clause 22. The method of any one of clauses 14-21 , further comprising isolating the EVs from cell culture media.
Clause 23. The method of any one of clauses 14-22, wherein the method enhances the production rate and secretion of EVs from the cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture methods.
Clause 24. The method of any one of clauses 14-23, wherein the acoustic stimulation does not affect cell viability.
Clause 25. A method of making a three-dimensional (3D) piezoelectric nanofibrous scaffold for cell culture, the method comprising: electrospinning a solution of piezoelectric polymer nanofibers to form a piezoelectric fiber membrane; and expanding the piezoelectric fiber membrane using gas foaming to form a 3D piezoelectric nanofibrous scaffold comprising polymer nanofibers.
Clause 26. The method of clause 25, further comprising adding a coating for cell adhesion to the 3D piezoelectric nanofibrous scaffold.
Clause 27. The method of clause 25 or 26, wherein the coating for cell adhesion comprises chitosan.
Clause 28. The method of any one of clauses 25-27, wherein the solution of piezoelectric polymer nanofibers comprises about 6 wt% to about 13 wt% of the polymer nanofibers in /V,A/-dimethylformamide (DMF).
Clause 29. The method of any one of clauses 25-28, wherein gas foaming comprises submerging the piezoelectric fiber membrane in a solution of sodium borohydride for about 1 hr to about 6 hr.
Clause 30. The method of any one of clauses 25-29, wherein the 3D piezoelectric nanofibrous scaffold has a thickness of about 100 pm to about 680 pm.
Clause 31. The method of any one of clauses 25-30, wherein the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof.
Clause 32. The method of any one of clauses 25-31 , wherein the polymer nanofibers comprise polyacrylonitrile (PAN).
Clause 33. The method of any one of clauses 25-32, wherein the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
Clause 34. The method of any one of clauses 25-33, wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm.
Clause 35. The method of any one of clauses 25-34, wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
Clause 36. A kit for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the kit comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold; optionally, cell culture buffers and reagents; and optionally, packaging, labels, or instructions for use.
EXAMPLES
Example 1
Materials and Reagents
Polyacrylonitrile (PAN; 181315), sodium borohydride (213462), and Pluronic f-127 powder (9003-11-6) were purchased from Sigma Aldrich (MA). A/,A/-dimethylformamide (DMF; D119-4) was purchased from Fischer Scientific (MA). Ethyl alcohol (3791-10), 99% acetic acid (BDH3092) and 0.22 pm vacuum filters (76010-388) were purchased from VWR (PA). Chitosan powder (c1569) was purchased from Spectrum Chemical (NJ).
Minimum Essential Medium (MEM; 10-010-CV) and Corning SpinX centrifuge filters (431491) were purchased from Corning (NY). Fetal bovine serum (FBS; 26140079), 100X antibiotic-antimycotic (15240062), 0.25% trypsin-EDTA (25200072), and Prestoblue (A13261) were purchased from ThermoFisher (MA). 4% paraformaldehyde in 0.1 M phosphate buffer (15735) was purchased from Electron Microscopy Science (PA). Cell counting kit-8 (CCK-8;850- 039-kl01) was purchased from Enzo Life Sciences (NY). 3D Celltiter-glo (G968A) was purchased from Promega (Wl). Fura 2-AM (F1221) was purchased from Invitrogen Life Technologies (CA). HEPES buffered saline solution (C-40020) was purchased from PromoCell (Heidelberg, Germany). The LIVE/DEAD™ Cell Imaging Kit (488/570) was purchased from ThermoFisher Scientific (MA).
Preparation of PAN Solution and PAN Nanofiber Scaffolds
Solution property characteristics were performed. See Ico et al., J. Mater. Chem. A 4: 2293-2304 (2016). Solution viscosity was measured using a CPA-40 spindle connected to a Brookfield DV-I Prime viscometer (Brookfield, Toronto, Canada). The rotational speed of the spindle was ramped up from 0.5 rpm to whichever speed at which the torque reached closest to 100% (at least above 95%). After confirming that viscosity was independent of the shear rate, the viscosity value at maximum torque was recorded. Surface tension was measured using an automatic surface tensiometer (QBZY-1 ; Shanghai Fangrui Instrument, Shanghai, China), which had a platinum-coated plate connected to a hook. The force exerted on the hook as the plate came in contact with the solution was converted into surface tension values Arduino code (Atlas Scientific, NY) was used to take electrical conductivity measurement through a glass-body electrical conductivity probe (K = 0.1 , Oakton) paired with an embedded conductivity circuit (EZO- EC; Atlas Scientific, NY) and an Arduino Uno Rev3 board. All solution property measurements were taken at room temperature immediately before or after electrospinning to correlate them most closely with the resulting nanofiber properties. Characteristics are shown in Table 1.
Table 1 . Characteristics and Parameters of Polyacrylonitrile (PAN) Solution
Surface Electrical
Material / Solvent Viscosity (cP) Tension Conductivity Density (g/mL)
10 wt% PAN in DMF 411.8 27.5 38.5 1.194
Nanofibers with a diameter of 760 nm were produced through an electrospinning process. A solution of 10 wt% PAN was prepared in DMF. Electrospinning was carried out under specific conditions, namely an electrospinning distance of 10 cm, an applied voltage of 13 kV, and a solution feed rate of 1 ml_ hr1. This process was conducted in a controlled environment of 23 °C and 40% relative humidity. The resulting nanofibers were collected on a rotating collector drum covered with aluminum foil, operating at 400 rpm. The electrospinning duration was optimized to achieve nanofibers with the desired thickness of approximately 100 pm.
Gas Foaming Expansion of PAN Scaffolds
Gas foaming expansion of PAN scaffolds was performed based on a previous study. See, e.g., Joshi et al., Chem. Eng. J. 275: 79-88 (2015). A 2 cm x 2 cm x 100 pm scaffold was submerged in a freshly prepared 1 M sodium borohydride solution for varying lengths of time (0,
2, and 4 hr) at 22 °C. The expanded nanofiber scaffolds were gently transferred into a separate beaker and washed three times with DDI water before being freeze-dried for 24 hr. The sample thickness was measured using a ruler and the morphology was documented via a digital camera.
Piezoelectric Property Measurement
Nanofiber scaffolds were prepared in a cantilever setup, similar to prior work. See, e.g., Ico et al., J. Mater. Chem. 4: 2293-2304 (2016). This setup allows for the controlled application of strain to the samples while simultaneously measuring their electrical output. The PAN nanofiber scaffolds were cut into strips of size 4 x 1.2 cm, and brass slabs of size 7.2 x 1.6 x 0.01 cm3, electrically isolated with polyimide tape, were employed as electrodes to measure the voltage. One brass slab was in direct contact with the nanofiber sample, secured with double-sided copper tape, while the other slab remained unexposed. Two 24-gauge wires were soldered to these electrodes, sealed with polyimide tape, and connected to a breadboard with inputs to a PicoScope 2204A (Pico Technology Ltd., Cambridgeshire, UK) for voltage measurement. To induce controlled strain, a 2.3 g proof mass was placed on the cantilever’s end, driven by a custom-made oscillatory system, with the cantilever holder clamped atop a subwoofer diaphragm. The strain was calculated using Equation (1): t strain (%) = — x 100 2R with t representing the cantilever thickness and R being the radius of curvature, as determined through a surface-mounted camera. A sinusoidal sine wave with a controlled amplitude and a 10 Hz frequency was applied to the speaker system, and the voltage output was measured.
Scanning Electron Microscopy (SEM) Images of Scaffolds
Scanning electron microscopy (SEM; Thermo Prima environmental-SEM; ThermoFisher, MA) was used to image samples with and without cells. Cell-free samples were fixed on a metallic stud (75210; Electron Microscopy Science, PA) with double-sided conductive tape and sputter- coated with gold before imaging under 10 kV. The sample thickness, average fiber diameter, and pore size were measured based on the SEM images using Imaged software. For the SEM imaging of cells seeded on the nanofiber scaffold, the cells were fixed with 2% paraformaldehyde for 1 hr. Samples were then washed three times with PBS and dehydrated sequentially in 50% ethanol (2 x 10 min), 70% ethanol (2 x min), 80% ethanol (2 x 10 min), 95% ethanol (2 x 10 min), and 100% ethanol (3 x 10 min). Samples were then dried at room temperature and fixed on a metallic stud with double-sided conductive tape before being imaged. SEM images were processed by manually tracing the outline of each cell on the SEM image. The traced images were then transferred and logged into the ROI manager for measurement. Before measuring using the measurement function on the ROI manager, the roundness and axial ratio were preselected as parameters of interest. Imaged calculated the roundness of the object by measuring the area and the major axis length of the outline and converting these values to roundness using Equation (2):
4 x Area Roundness = - - n x major axis£
The measuring function on the ROI manager calculated the axial ratio of the object by measuring the major and minor axis length of the outline and converting these values to axial ratio using Equation (3): major axis Axial Ratio = - minor axis
These measurements were used to quantitatively compare the cell morphology between 2D culture, PES OFF, and PES ON samples.
Porosity Measurements of PAN Scaffolds
The porosity of the nanofiber scaffolds was calculated according to the liquid displacement of each sample. The mass of each sample was measured before and after being submerged in water. The porosity was calculated using Equation (4): where mo and m are the masses before and after being submerged in water, respectively, while pw and ps are the densities of water and the PAN bulk material, respectively.
2D Cell Culture and Media Collection
Human hepatocellular carcinoma cell line (HepG2) and mouse embryonic fibroblast cell line (3T3) were cultured separately on six well plates at a density of 3 x 105 cells/well in MEM containing 10% FBS and 1% 100x Antibiotic-Antimycotic. The medium was exchanged every 48 hr. Once the culture reached 70% confluency, the serum-containing medium was replaced with serum-free medium and incubated for 24 hr before being collected for sEV isolation. Cells were then harvested after media collection with Trypsin-EDTA for 5 min followed by spinning down the cells at 1000 rpm for 5 min. The cells were resuspended in fresh MEM and diluted appropriately to be counted using a hemocytometer.
3D Cell Culture on PAN Scaffolds and Media Collection
The scaffolds were cut into 4 cm x 2 cm strips and prepared for seeding, which included washing, coating with chitosan, and sterilization. Each sample was rinsed in distilled water for 30 min and transferred to a solution of 1 mg ml_-1 chitosan in 0.1 M acetic acid for 30 min. The coated nanofiber scaffolds were then rinsed with fresh distilled water for 30 min and air dried. The processed samples were placed in a 60 mL petri dish and UV-sterilized before seeding. HepG2 and 3T3 cells were passaged and seeded separately at 3 105 cell scaffold-1. The seeded scaffolds were then incubated for 30 min at 37 °C before the addition of serum-containing MEM and incubation at 37 °C and 5% CO2. After 48 hr, the conditioned medium was replaced with serum-free medium and incubated for 24 h before being collected for sEV isolation. Cells were then harvested after media collection with Trypsin-EDTA for 5 min followed by spinning down the cells at 1000 rpm for 5 min. The cells were resuspended in fresh MEM and diluted appropriately to be counted using a hemocytometer. For the Live/Dead assay, the LIVE/DEAD™ Cell Imaging Kit was used following the manufacturer’s instructions. For the staining, each scaffold whether embedding cells were exposed to 1 ml_ of final staining solution which was a 1 :2 mixture of staining agent from the product and fresh culture media.
Acoustic Stimulation and Media Collection
3D culture samples containing serum-free medium were stimulated using sinusoidal acoustic waves (3-0 subwoofer; PS-EW1-2; Samsung Electronics, Suwon-si, Republic of Korea) in a sound-controlled box. Samples were stimulated for 15 min at an amplitude of 85 dB and frequency of 100 Hz. The samples were incubated at 37 °C and 5% CO2 for 24 hr before being collected for sEV isolation. The cells were then detached and counted, similar to 2D and 3D cultured samples.
Cell Seeding Efficiency Measurements for Nanofiber Scaffolds
HepG2 and 3T3 cells were seeded separately on 2 mm x 2 mm scaffolds (N = 3) with and without a chitosan coating at a density of 5 x 105 cells scaffold-1 and incubated in serumcontaining MEM at 37 °C and 5% CO2 for 24 hr. The cell seeding efficiency was measured in two different tests. One test calculated the number of cells in the scaffold (1), and the other test calculated the number of cells out of the scaffold (2):
(1) The cultured medium was aspirated, and the scaffolds were washed with PBS thrice before the addition of 10% CCK-8 reagent in cell culture media and incubation for 4 hr at 37 °C and 5% CO2. For Pesto-blue assay, standard protocol from vendor was applied. The cell count was then measured through absorbance at 460 nm wavelength, and the seeding efficiency was calculated using Equation (5): cells counted
Seeding efficiency (%) = - x 100 cells seeded
The seeding efficiency was calculated for scaffolds with and without chitosan coating, and for monolayer cultures.
(2) The cell medium during each step of EV production was collected and measured for cell count using the above CCK-8 method.
For confocal imaging, samples were placed in 2 mL of PBS after Live/Dead staining (refer to Section 2.8) and imaged using an A1R-MP Laser Scanning Confocal Microscope (CLSM; Nikon, Tokyo, Japan). The live (green) and dead (red) cell signals obtained from the confocal microscopy were binarized using the threshold function in Imaged software and then combined using an OR operation for each X-Y plane. Viability values were calculated by dividing the binarized area of the red channel across the entire X- Y-Z space by the binarized of the combined green-red channel across the same X- Y-Z space.
Cell Metabolism Assay
CellTiter-Glo® and CCK-8 assays were used to measure the cell metabolism of 2D and 3D cultured samples. Both assays were performed using the manufacturer’s protocol. CellTiter- Glo®: HepG2 and 3T3 were seeded on 2D and 3D culture samples in 96 well plates at different cell densities (1 x 104; 2 x 104; 4 x 104; 8 x 104; and 16 x 104 cells sample-1) and incubated with 50 pL of serum-containing MEM at 37 °C and 5% CO2 for 24 h. The medium was then removed, and the cells were washed twice with PBS before new medium was added. The samples were then equilibrated to room temperature for 30 min followed by the addition of 50 pL CellTiter-Glo® 3D reagent to each sample. The samples were mixed vigorously for 5 min to induce cell lysis and allowed to incubate at room temperature for 25 min to stabilize the luminescent signal. The ATP levels were measured through luminescence measurements. CCK-8: The seeding, incubation, and medium change was the same as for the CellTiter-Glo® assay. The CCK-8 working reagent was prepared by diluting 10 pL of CCK-8 stock reagent in 190 pL MEM. Then, 200 pL of the working reagent was added to each well and incubated at 37 °C and 5% CO2 for 4 h. The cell metabolism was then measured through absorbance at 460 nm wavelength. sEV Isolation and Concentration Measurement sEVs were isolated from the media via size-based separation. The isolated media first went through a 0.22 pm filter to capture larger vesicles and cell debris. The flowthrough solution was then added to a 100 kDa centrifuge filter and centrifuged at 200 x g for 4 x 30 min time periods; the mixture was washed with PBS between each centrifuge session. The sEV solution was then concentrated down to 1 ml_ for sEV characterization. The sEV concentration and size distribution were measured through nanoparticle tracking analysis (NTA; Nanosight NS300; Malvern, Worcestershire, UK). Samples were diluted appropriately to maintain accurate particle counts. For each sample, five 60-sec videos were acquired at a camera level of 8 and detection threshold of 2. The laser chamber was cleaned with milliQ water between each sample reading to ensure no sample contamination occurred. The videos were analyzed using the NTA3.0 software to obtain the particle concentration, along with the mean and mode particle sizes of each sample. Western Blot sEVs were lysed with 1 x RIPA buffer (9806; Cell Signaling Technology, USA), and the total protein concentration was quantified using Pierce BCA Protein Assay Kits (23225; Thermo Fisher, USA). The protein amount in lysed sEVs was estimated based on a calibration curve plotted by albumin (BSA) standards. Next, 12 pg of proteins from sEV lysates were denatured and loaded on sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were subsequently transferred onto a nitrocellulose membrane (1662807; BioRad, USA) and blotted overnight with primary antibodies purchased from Santa Cruz Biotechnology, USA: anti-CD9 antibody (C-4), anti-CD63 antibody (MX-49.129.5), anti-CD81 antibody (B-11), anti-CD9 antibody, anti-HSP70 antibody (W27), anti-HSP90 antibody (F-8), and anti-beta-actin antibody (sc-47778). The secondary antibodies (anti-mouse HRP-linked antibody, 7076; Cell Signaling Technology, USA) were then treated for blotting and the HRP on the immunoblots was detected by Clarity Max Western Enhanced Chemiluminescence (ECL) Substrate (1705060; Bio-Rad, USA) using a ChemiDoc XRS+ System (Bio-Rad, USA). The relative expression levels of the detected proteins were quantified using the Imaged software. sEV Production Rate Measurement using ExoELISA
An enzyme-linked immunosorbent assay (ELISA) of sEV solutions was performed using ExoELISA (System Biosciences, CA) following the manufacturer’s protocol. The sEV samples were prepared by adding 60 pL of sample and 60 pL coating buffer into triplicate wells. Standards were prepared using the manufacturer’s protocol. The samples were then incubated at 37 °C for 1 hr, followed by washing with 1 x wash buffer three times for 5 min. The samples were then incubated with CD63 primary antibody at 37 °C for 1 h followed by washing with 1 x wash buffer three times for 5 min. The samples were then incubated with CD63 secondary antibody at 37 °C for 1 hr and washed with 1 x buffer three times for 5 min. Finally, the TMB ELISA substrate was added to the sample and incubated at room temperature for 15 min while shaking. After shaking, a stop buffer was added, and the absorbance was measured at 450 nm using a microplate reader (30190087; TECAN, Mannedorf, Switzerland).
Transmission Electron Microscopy (TEM) of sEVs
The sEV solutions were negatively stained and imaged through transmission electron microscopy (TEM) using the Talios F200i (S)TEM (ThermoFisher, MA) at an 80 kV accelerating voltage. The TEM samples were prepared by adding 5 pL of 1 x 108 particles mL-1 sEV solution to an ultrathin carbon film copper grid and incubating at room temperature for 2 min. The solution was then aspirated using filter paper and washed with 5 pL filtered distilled water for 10 sec. After aspirating the distilled water, 5 pL of Uranyless negative staining solution (22409; Electron Microscopy Science, PA) was added to the sample grid (CF200-CU-25; Electron Microscopy Science, PA) and incubated for 1 min. The Uranyless solution was aspirated, and the grid was left to dry before imaging.
Intracellular Ca2+ Measurements
The intracellular Ca2+ concentration was measured using Fura 2-am following a similar protocol as in previous studies. See Yang et al., Nat. Biomed. Eng. 4: 69-83 (2020). Cells were seeded at a density of 3 x 105 cells well-1 in a 6-well plate and incubated overnight at 37 °C and 5% CO2. After incubation, they were treated with 10 pM Fura-2 AM in HEPES-buffered saline solution and pluronic f-127 for 1 hr in a humidified incubator. The cells were then washed to remove the extracellular dye and replenished with MEM. The appropriate samples were then exposed to acoustic stimulation and the changes in the fluorescence intensity were measured with a spectrophotometric plate reader (TECAN, Mannedorf, Switzerland).
Cell-Free DNA (cfDNA) Isolation cfDNAwas extracted and isolated from concentrated sEVs from Experimental section 2.12 using Plasma/Serum Cell-Free Circulating DNA Purification Kit - Mini (55100; Norgen Biotek, Canada) per manufacturer instructions. The volume of concentrated sEVs used extraction were 500, 435, 145, 500, 280, and 85 pL for HepG2 2D-culture, HepG2 3D-culture without stimulation, HepG2 3D-culture with stimulation, 3T3 2D-culture, 3T3 3D-culture without stimulation, and 3T3 3D-culture with stimulation, respectively. A blank control sample was extracted in parallel using 500 pL of DNA Dilution Buffer (4405587C; Thermo Fisher, USA). All samples were diluted to 500 pL prior to extraction. All samples were each eluted into 30 pL of purified cfDNA.
TP53 Nested PCR and NRAS PCR of cfDNA
A wild-type sequence and associated primer sets within TP53 were previously reported. See Kou et al., Oncol. Rep. 39: 2537-2544 (2018). The TP53 nested PCR was performed using the outer and inner primer sets listed in Table 2. A wild-type sequence within NRAS was identified using NCBI Sequence Viewer for Homo sapiens chromosome 1 , GRCh38.p14 Primary Assembly. Primer sequences were designed using Primer-BLAST service. PCR assays were designed for 20 pL reactions containing 10 pL SsoAdvanced™ Universal SYBR® Green Supermix (1725271 ; Bio-Rad, USA) and 200-nM of the appropriate forward and reverse primers (Integrated DNA Technologies, USA). 2 pL of the isolated cfDNA for each sample and the blank control were used as the template forthe TP53 Outer and NRAS PCR reactions. 2 pL of the amplified PCR products of the TP53 Outer reactions were used as templates for the TP53 Inner PCR reactions. Cycling conditions for the TP53 Outer reactions were: 10 min at 95 °C followed by 40-cycles of [30 sec at 95 °C, 30 sec at 53 °C, 1 min at 60 °C] and ending with 2 min at 60 °C. Cycling conditions for the TP53 Inner reactions were: 10 min at 95 °C followed by 40 cycles of [30 sec at 95 °C, 30 sec at 52 °C, 1 min at 60 °C] and ending with 2 min at 60 °C. Cycling conditions for the NRAS reactions were: 2 min at 95 °C followed by 40 cycles of [30 sec at 95 °C, 20 sec at 50 °C, 40 sec at 60 °C] and ending with 2 min at 60 °C. Amplified products were stored in 4 °C until examination via gel electrophoresis.
Table 2. Primer Sequences for TP53 Nested PCR and NRAS PCR
Name DNA Sequence (5 ' >3') SEQ ID NO:
TP53 Outer Fwd CTGAGTGACAGAGCAAGACCCTAT 1
TP53 Outer Rev AGTGTTTCTGTCATCCA ATACTCC 2
TP53 Inner Fwd GTTTCTTTGCTGCCGTCTTC 3
TP53 Inner Rev ACACGCAAATTTCCTTCCAC 4
NRAS Fwd CACAAAGATCATCCTTTCAGAGA 5
NRAS Rev ACAAGAAGAGTACAGTGCCA 6 cfDNA Gel Electrophoresis
Amplified PCR products were examined in a 1.5% Agarose- 1 gel formulated using 1 * TAE Buffer (J63931.K2; Thermo Fisher, USA). Sample mixtures of 6 pL containing 1 pL of PCR product or GeneRuler 100 bp DNA Ladder (SM0243; Thermo Fisher, USA), 1 pL of DNA Gel Loading Dye (R0611; Thermo Fisher, USA), and 4 pL of DNA Dilution Buffer (4405587C; Thermo Fisher, USA) were loaded into each lane. Electrophoresis was run in 1 x TAE Buffer at 80 V for 70 min on a PowerPac™ Basic Power Supply (1645050; Thermo Fisher, USA). Upon completion, gels were removed from the electrophoresis unit and incubated away from light in 5 pL Thiazole Green, 10,000x (40086; Biotium, USA) diluted in 50 mL 1 x TAE Buffer for 30 min. Gels were examined using a blue-light transilluminator. Images were taken with a smartphone camera and processed using Imaged.
Statistical Analyses The data presented in this paper are expressed as the mean ± the standard deviation (S.D.) or the standard error of replicate measurements (S.E.M.) and analyzed using one way ANOVA test using GraphPad Prism 8 software, where applicable.
Example 2
Scaffold Fabrication and Processing for 3D Cell Cultures
For piezoelectric scaffold, PAN was selected due to its electrospinnable feature enabling the nanofibrous matrix, hydrophilic nature allowing 3D cell culture, and piezoelectric characteristics enabling the acoustic stimulation to cells. The PESs were first fabricated through electrospinning using 10 wt% PAN in DMF (solution characteristic shown in Table 1). Following successful fabrication, scaffold parameters were tuned, including the pore size, porosity, and thickness, to ensure cell penetration and ample void space for cell growth. This was done by employing a gas foaming technique. The expansion effect of the gas foaming technique on the scaffold were examined through SEM imaging (FIG. 1 B-C; FIG. 2). During the gas forming processes, there was loosen porous structure observed (FIG. 2A) while no significant change in the average fiber diameter (pristine: 442 ± 39 nm, 2 hr: 459 ± 63 nm, 4 hr: 441 ± 83 nm) (FIG. 2B). The expansion ratio (i.e. , h/ho where tr. expanded height of scaffold, ho'. original height of scaffold) increased by a factor of 4.4 ± 0.3 after 2 hr and a factor of 6.8 ± 0.6 after 4 hr, (FIG. 1 D). To ensure the scaffolds had the optimal structural parameters for cell seeding and cell growth, the pore size and porosity of as-synthesized (i.e., 0 hr-expansion sample) and gas-foamed scaffolds were measured. The gas foaming process resulted in scaffolds with significantly larger pore sizes (pristine: 3.0 ± 0.3 pm, 2 hr: 5.3 ± 0.8 pm, 4 hr: 12.6 ± 2.3 pm). Pore sizes above 10 pm facilitate enhanced cell penetration through the scaffold, ensuring an even cell distribution. To validate the porosity of the scaffolds, a water-displacement test was conducted on both pristine and processed fibrous scaffolds. The gas-foamed fibrous scaffolds exhibited ~2.5-fold higher porosity in comparison with the pristine ones (pristine: 37.0 ± 6.9%, 2 hr: 62.3 ± 5.6%, 4 hr: 91.3 ± 3.7%), signifying greater void space for cell growth within the scaffolds. In addition, there was no observed change in the average fiber diameter after gas foaming (pristine: 442 ± 39 nm, 2 hr: 459 ± 63 nm, 4 hr: 441 ± 83 nm) (see FIG. 2B). Therefore, the PESs processed by gas foaming for 4 hr were used for the subsequent work to assess sEV production in the 3D stimulative culture platform.
To verify whether the piezoelectric properties of the processed scaffolds were sufficient for inducing cell stimulation, a cantilever test was conducted to measure the mechanical strain of the fibers in conjunction with the electrical output (FIG. 1 E). The cantilever tests were performed after the post-processing phase of scaffold fabrication and in a wet phase to mimic the scaffold structure during cell culture. In this test, a peak-to-peak voltage output of 110 ± 15 mV was observed, which is within the desired voltage output for facilitating safe cell stimulation. The effect of the acoustic frequency on the piezoelectric output (FIG. 1 F and FIG. 3) was also investigated to optimize the conditions for cell stimulation. An inverse relationship between the acoustic frequency and piezoelectric output was found, with an active frequency range of 10-100 Hz for PESs. This was supported by the finding that PESs activated by acoustic frequencies above 100 Hz did not exhibit significantly different voltages or percentage strains. Additionally, acoustic frequency had no significant effect on the pore size of the scaffold, demonstrating the physical stability of the system for cell stimulation in 3D cell culture (FIG. 4). Based on these findings, an acoustic frequency of 100 Hz was used to provide a sufficient voltage output in the PESs, from a strain of 0.01% produced by an acoustic amplitude of 85 dB.
To ensure that the cells adhered to the scaffolds, the scaffolds were coated with chitosan, a well-known bioactive polymer used in promoting cell adhesion, cell proliferation, and antibacterial properties. The chitosan coating alleviated the piezoelectric output from the scaffold without completely insulating its piezoelectric properties (FIG. 5). The cell seeding efficiency of coated scaffolds was tested, as compared with unfunctionalized scaffolds (FIG. 1G; a photo of scaffolds before cell seeding is represented in FIG. 6). Two cell lines were chosen, a human hepatocellular carcinoma line (HepG2) and a mouse derived fibroblast cell (3T3), as proof of concept for the following cell related experiments. It was found that the seeding efficiency for HepG2 on the chitosan-functionalized scaffolds (> 95%) was 25-fold higher than that of unfunctionalized scaffolds (3.2 ± 1.0%). This is due to the electrostatic interactions between the chitosan and the cell surface. Similar to the HepG2, a 26-fold increase in the seeding efficiency of 3T3 cells on the chitosan-functionalized scaffolds was observed (functionalized: 87.4 ± 2.0%, unfunctionalized: 3.3 ± 1.7%), confirming sufficient cell adhesion to the functionalized scaffolds. Cell adhesion was also tested indirectly by tracking the number of cells dislodged from the scaffold. In doing so, 88.3 ± 1.6% of cells were observed to be adhered to the scaffold, supporting the enhanced cell adhesion capability of the chitosan coated PESs (Table 3). The cell adhesion to the scaffold was then imaged using confocal microscopy, in which cells were observed to be properly adhered (FIG. 7). As shown in the confocal microscopic imaging and its analysis, live and dead cells for both HepG2 and 3T3 cases (e.g., Green channel: Live cells; Red channel: Dead cells) were stably adhered to chitosan-coated scaffolds (FIG. 7A) throughout 3D spaces (FIG. 7B), demonstrating successful cell seeding on the scaffold and inside the scaffold. Besides, the chitosan coated scaffold showed great biocompatibility for both cell lines (e.g., > 80% for both 3T3 and HepG2; FIG. 7C). These results indicate that cells adhere to the PES with good biocompatibility, aligning with the previous tests on cell viability and adhesion efficiency. To confirm growth of cells on the scaffolds, the proliferation of each cell line on the scaffolds over 13 days was tested (FIG. 8A). A 6.7 (± 0.6)-fold expansion in HepG2 cells and 7.7 (± 0.9)-fold expansion in 3T3 cells over 13 days was observed. Therefore, it was concluded that the cells can effectively reproduce on the scaffolds. A plateau in the cell count starting after 9 days of cell culture was also observed, indicating that the stationary phase of cell growth on the scaffold starts at 9 days. To ensure that activating the PES does not affect the cultured cells, the cell viability was tested at acoustic amplitudes ranging from 50-110 dB with a frequency of 100 Hz and found that the cell viability remained above 93% under all conditions (FIG. 8B-C). Overall, the PESs with functionalization and activation exhibited high biocompatibility of both cell lines.
Table 3. Cell Adhesion-Cell Loss Throughout Cell Seeding and Stimuli Processes (Cell Counting Kit (CCK) and Pesto-blue (PB)
Platform Cell Loss (%) Cell Adhesion (%)
In Seeding In Stimuli
HepG2
. .. . CCK: 90.9 ± 9.21 CCK: 3.95 ± 1.78 CCK: 5.13 ± 1.26
2D Non-Adhesive PB: 91.0 ± 9.65 PB: 3.80 ± 2.17 PB: 5.24 ± 1.15
9n AdhP A CCK: 1.78 ± 0.45 CCK: 0.67 ± 0.31 CCK: 97.6 ± 0.85
AANESIVE PB: 1 .80 ± 0.38 PB: 0.64 ± 0.37 PB: 97.6 ± 0.86
CCK: 1.88 ± 0.15 CCK: 1.35 ± 0.38 CCK: 96.8 ± 1.08
JU Htb Uhh PB: 1.87 ± 0.35 PB: 1.31 ± 0.25 PB: 96.8 ± 1.10
CCK: 1.73 ± 0.16 CCK: 1.00 ± 0.23 CCK: 97.3 ± 2.44
JD Htb UN PB: 1.67 ± 0.08 PB: 1.04 ± 0.25 PB: 97.3 ± 2.44
3T3
. .. . CCK: 76.7 ± 6.30 CCK: 8.27 ± 0.37 CCK: 15.0 ± 2.24
2D Non-Adhesive PB: 91.0 ± 9.65 PB: 3.80 ± 2.17 PB: 5.24 ± 1.15 CCK: 1.43 ± 0.16 CCK: 0.72 ± 0.04 CCK: 97.9 ± 0.81 B: 1.8 ± 0.38 PB: 0.64 ± 0.37 PB: 97.6 ± 0.86
CCK: 1.34 ± 0.14 CCK: 0.58 ± 0.07 CCK: 98.1 ± 0.99
JU Ht Uhh PB: 1.87 ± 0.35 PB: 1.31 ± 0.25 PB: 96.8 ± 1.10
CCK: 1.34 ± 0.18 CCK: 0.75 ± 0.18 CCK: 97.9 ± 1.20
JD Ftb UN PB: 1.67 ± 0.08 PB: 1.04 ± 0.25 PB: 97.3 ± 2.44
Example 3 Synergistic Effect of 3D Culture and Cell Stimulation in PES on EV Production
Upon successful cell seeding and culturing in the optimized PAN PESs, the synergistic effect of the 3D culture and cell stimulation on sEV production was tested (FIG. 9A). To confirm the quality of the sEVs, their size, integrity, and morphology were analyzed using NTA and TEM. The size distributions of sEVs from both cell lines were analyzed based on the NTA results (FIG. 9B-C; Raw particle count including fresh media shown in FIG. 10). According to NTA, cells cultured in all groups, including 2D culture (control), 3D culture in PES with (PES ON) and without stimulation (PES OFF), generated particles within the size range of sEVs, and the mean particle sizes among all groups were not significantly different (p > 0.05). The sEVs produced from HepG2 cells in the control group exhibited a mean particle size of 152 ± 38 nm, and average sizes of 136 ± 36 nm and 132 ± 40 nm in the PES OFF and PES ON groups, respectively (FIG. 11). The 3T3 cells exhibited particles with similar sizes among all groups (control: 141 ± 40 nm, PES OFF: 131± 32 nm, PES ON: 136 ± 37 nm). TEM images of the sEVs confirmed their stability, showing that sEVs in all groups were intact, round, and oval-like (FIG. 12A), with a narrow size distribution (FIG. 12B) without any significant distribution differences from NTA analysis.
To evaluate the production efficiency of sEVs from the PES ON group compared with the control and PES OFF groups, the sEV production was assessed with and without acoustic stimulation by measuring the sEV yield and the production rate per cell using the CD63 ELISA kit, ExoELISA (FIG. 9D-E). It was found that HepG2 cells in the PES ON group produced sEVs with a 15.4-fold increase in yield and a 15.7-fold increase in production rate compared with the control (2D culture). The effect of cell stimulation was further tested on non-cancer cells using 3T3 cells, a fibroblast cell line, and a similar trend was observed. The 3T3 cells stimulated in the PES produced the largest yield and at the highest rate among all conditions. Conversely, the stimulation was not as effective on the EV production rate in the 3T3 cells (6.7-fold increase) as in the HepG2 cells (15.7-fold increase). These results agree with analysis from NTA measurements (FIG. 13). Additionally, the sEV distribution curves from control group with acoustic stimulation (i.e., Cntr ON) confirmed the increase in sEV yield was not induced by the acoustic stimulation only (FIG. 14).
To further verify the presence of sEVs produced from the PES platform, a western blot was conducted for sEV biomarkers (CD63, CD9, and CD81) (FIG. 15-17). The western blot results of PES-derived sEVs clearly displayed distinct bands for all sEV biomarkers, confirming the presence of sEVs from both HepG2 and 3T3 cell lines. To note, sample concentrations have been normalized by protein content and thus the level of sEV markers, CD9, CD63, and CD81 in WB are not informative regarding sEV quantity. The stress levels of sEVs across all groups (2D, PES OFF, and PES ON) were further compared based on the expression of heat shock proteins (HSPs) (HSP70: FIG. 15B-C; HSP90: FIG. 15D-E). The relative expression levels were normalized against |3-actin, which was used as the loading control in this western blot analysis. While there was no significant difference in the expression level of HSP70 among all groups within both cell lines, distinctions in HSP90 levels were observed. The PES OFF group exhibited the highest level of HSP90 expression, while the control group showed the lowest expression level. Interestingly, cell stimulation in the PES ON group reduced HSP90 expression to 50% compared with the PES OFF group. Notably, this trend was consistent in both cell lines.
HSP70 and HSP90 have been reported as released from cells into EVs involved in intercellular communication in cancer, immunity, and various pathological conditions. HSP70 is a molecular chaperone that helps in the proper folding of proteins. HSP70 in sEVs plays multifaceted roles in maintaining protein homeostasis, facilitating intercellular communication, modulating immune responses, and protecting cells from apoptosis. From these results, HSP70 levels did not change significantly, indicating the sEVs produced from 3D culture can maintain the protein cargo stability and homeostasis and thus fulfil its biological functions. HSP90 is an essential protein in protein folding, cancer progression and wound healing. It has been reported that HSP90 has been found to be a major cargo contained in sEVs. HSP90 in sEVs has several potential functions including selective client protein loading, stress response, cancer progression and metastasis. However, the precise mechanisms and implications of HSP90's role in sEVs are still being actively researched. In this study, it was observed that HSP level increased significantly in PES OFF group while remained non-significant in PES ON group, compared to the control group. While HSP70 that stabilize protein did not change significantly and both non-cancer and cancer cells showed the similar trend, this observation indicated that cells in PES OFF group potentially produced more client protein loaded sEVs or displayed more stress response. Most importantly, PES ON group produced sEVs that contained similar level of HSP70 and HSP90 to control group, indicating minimum effect of acoustic stimulations on these two cargos.
In addition, a cfDNA PCR analysis for genetic sEV cargo was performed to understand the effect of the extracellular environment on the EV content. Two cargo sequences that code for key proteins in sEV biogenesis were tested: NRAS, and P53 (Primers shown in Table 2). NRAS is a member of the ras-GTPase family that regulates proliferation and cell division by controlling the activation of the MAPK/ERK signaling pathway and PI3P pathways for cell growth, and cell survival. More importantly, NRAS is essential for sEV biogenesis, by mediating cargo selection and inducing sEV secretion. On the other hand, P53 is a transcription factor that functions as a tumor suppressing protein. In addition, previous reports have shown that sEV secretion can be promoted by the HSP-P53-TASP6 signalling pathway. Slight increases in genetic NRAS in HepG2 cell derived sEVs were observed with no significant change in 3T3 derived sEVs (FIG. 18A). Meanwhile, upregulated TP53 were observed in genetic P53 content (FIG. 18B-C), suggesting that the 3D environment can affect key players in sEV biogenesis and promote pathways for induced sEV secretion. While this would support the findings of enhanced sEV production, further upregulation of cell proliferation pathways such as the MAPK/ERK signaling pathway and PI3P pathway can promote autophagy, and tumorigenesis, requiring future studies to understand the cell’s phenotypical characteristics under stimulated conditions. Most importantly, there is no significant difference between PES ON and PEF OFF samples, indicating that stimulated conditions did not induce unexpected changes in the sEV product.
Example 4
Enhanced sEV Production in Stimulated PES via Increased Cellular Metabolic Rate and Intracellular Calcium Concentration
Understanding the factors that influence sEV biosynthesis and production in stimulative PESs is important for engineering suitable platforms for future applications. Previous studies have confirmed the impact of metabolic rate and increased metabolite levels on EV production, as several critical steps in sEV production rely on these metabolites for activation (FIG. 19A). Metabolites such as NADH and ATP play a pivotal role in promoting the ATP-dependent trafficking of multivesicular bodies (MVBs) for sEV secretion, thereby influencing sEV biogenesis and production. To investigate the underlaying mechanism of enhanced sEV production in the PES 3D culture platform, colorimetric assays measuring NADH hydrolysis activity were conducted (FIG. 19B) and ATP levels (FIG. 19C). Both NADH and ATP assays revealed increased activity in PES 3D culture systems with (PES ON) and without stimulation (PES OFF) compared with the traditional 2D culture (control), which is consistent with previous studies. Notably, a 24% increase in NADH hydrolysis activity and a 16% increase in ATP levels in the PES OFF group were observed compared with 2D culture control. Furthermore, a 45% increase in NADH activity and ATP levels in the PES ON group was observed compared with 2D culture control. This heightened metabolic activity in the stimulated 3D culture, for both representative non-cancer and cancer cells (e.g., 3T3 and HepG2), potentially stems from the increase in secondary messengers such as calcium ions, thus facilitating increased metabolism and sEV biogenesis and production.
Previous studies have also highlighted the crucial role of elevated intracellular calcium in sEV production by triggering essential steps such as sEV formation, cargo recruitment, and sEV secretion. To investigate the potential role of calcium ions in the PES culture platform, intracellular calcium measurements were conducted using Fura-2AM (FIG. 19D). Across all groups, a 1.5- fold increase in the intracellular calcium ion concentration in the PES ON group was observed as compared with the PES OFF group and control 2D culture, confirming its impact on sEV production. Various mechanisms account for this calcium influx. While electrical stimulation has been shown to promote cell membrane reorganization, leading to calcium influx, the system operates at 10-100-fold lower voltages to preserve cell viability and cell membrane integrity, suggesting the coexistence of alternative mechanisms. A possible pathway for calcium influx is the activation of voltage-gated calcium channels (VGCCs) such as L-, N-, and P-type VGCCs, which are opened through cell membrane depolarization requiring only 30 mV for activation. Low- frequency AC electric fields can also influence the cell membrane action potential and open VGCCs, allowing for an influx of Ca2+ ions into the cell. Alongside piezoelectric stimulation, audible acoustic stimulation can activate mechanosensing calcium channels such as Piezo-1 through mechanical force induction. Overall, it was found that increased metabolite levels coupled with enhanced intracellular calcium levels potentially activated multiple stages of sEV production in both cell lines.
Example 5
Impact of Cell Morphology in PES 3D Culture Platform on sEV Production
While a significant increase in sEV production yield and rate in the stimulated PES 3D culture platform was observed, this synergistic effect varied across different cell lines. Therefore, other potential mechanisms were investigated that could have influenced sEV production in this platform. It was first hypothesized that such a difference was attributable to the varied cell morphology in the 3D culture, with enhanced cell-matrix interactions, as well as in different cell types. This is based on recent studies showing that less well-developed actin cytoskeletons due to cell-matrix interactions, as reflected in cell morphology changes, promote intracellular MVB trafficking and resulting fusion with the plasma membrane. The inhibition of actin-related proteins restores MVB trafficking on the stiffer substrate, which leads to changes in EV production. In particular, when cell morphology changes to a rounder shape, the cytoskeleton is redistributed to the plasma membrane, promoting MVB trafficking near the membrane for sEV secretion.
To assess this hypothesis, both HepG2 and 3T3 cells were imaged in all groups using SEM (FIG. 20A and FIG. 21), and then analyzed cell morphology parameters including the roundness, cell axial ratio, and cell area (FIG. 20B and FIG. 22). With great biocompatibility (see FIG. 7C) and stable cell adhesiveness of this system (Table 3), morphological parameters were able to serve as indicators of membrane curvature and cell polarity. First, these parameters were compared between cells cultured in the 2D control and in 3D PES culture platform for each cell line. The results demonstrated that cell roundness in the PES OFF group is 1.3-fold higher (HepG2 cells) and 2.1 -fold higher (3T3 cells) than that in the 2D culture. Interestingly, the cell roundness is highly correlated with the sEV production rate and the enhancement in production rate in PES (FIG. 20C), implying cell roundness under 3D culture as a key factor affected by cell type (see FIG. 9D-E). To quantify the correlation between sEV production and cell roundness, the data were fitted to the equation: y = Yoekx where Y is the sEV production rate and fold change of the production rate after stimulation, Yb is an initial fitting parameter, k is the exponential fitting coefficient, and x is the cell roundness.
Based on mathematical fitting, the cell roundness is exponentially correlated with the EV production rate with k = 3.33 ± 0.5 and is correlated with the enhancement in EV production in stimulated groups with k = 6.56 ± 0.8. These correlations indicate that cell roundness, influenced by the cell culture microenvironment in the 3D culture matrix, plays a key role in sEV production, and profoundly impacts the synergistic effect of EV production through both the 3D culture and cell stimulation. Additionally, by comparing the cell morphologies between cell lines, it was further discovered that 3T3 cells consistently exhibited a 2.5-fold higher axial ratio than HepG2 cells across all groups (see FIG. 22). Although manually tracing individual cell boundaries may introduce human errors, combining all the interpreted results from image analysis indicate that the more polarized cell morphology of 3T3 cells compared with HepG2 cells creates a more complicated sEV biogenesis pathway, potentially decreasing the sEV production rate in 3T3 cells compared with HepG2 cells.
In summary, the synergistic effect of employing electrical stimulation strategies for enhancing sEV production within a 3D culture model were showcased. This synergistic effect translated into 15.7-fold and 6.7-fold increases in sEV production rate compared with the traditional 2D culture for HepG2 and 3T3 cells, respectively. It was postulated that this synergistic effect on sEV production was influenced by a 1 .5-fold rise in intracellular calcium ions and a 40% increase in metabolite concentration. Furthermore, the exponential correlation between cell roundness and the magnitude of sEV production enhancement post-stimulation was identified, indicating that the cell morphology in the 3D culture platform based on PES plays a pivotal role in influencing sEV production efficiency.
Despite these findings, the specific interplaying mechanisms between factors such as Ca2+ remain unclear, requiring further investigation and understanding. Accordingly, optimization of scaffold parameters and stimulation conditions will be conducted for future applications to enable optimal sEV production. Furthermore, beyond the proof-of-concept studies, the use of human cell lines, including stem cells and white blood cells, will provide more clinically relevant therapeutic applications in future translational studies.
In this study, the effect of 3D culture and cell stimulation on EV biomanufacturing was systematically investigated. These findings highlight the significance of this approach in the context of the scaled-up manufacture of EVs for clinical translation. Herein, it was demonstrated that the 3D stimulated culture produced EVs at a 15.7-fold increased rate per cell without any significant deviation in particle size or protein composition. Cells under the stimulated 3D culture also contained significantly higher metabolite and calcium ion concentrations, indicating that specific steps in sEV biogenesis are being activated and upregulated faster than in the standard 2D culture. These findings hold great promise for advancing EV therapeutics into clinical applications and overcoming the challenge of low EV production rates in standard methods. In addition, these findings in both non-cancer and cancer cells provide a promising 3D culture platform based on piezoelectric biomaterials for various applications, including investigation of the effect of bioelectricity on the metastatic behavior of cancer cells and the stimulated production of sEVs for advanced therapeutics in clinical settings.
Example 6
Polyacrylonitrile (PAN; 181315) was purchased from Sigma Aldrich (MA). N,N- dimethylformamide (DMF;D119-4) was purchased from Fischer Scientific (MA). Ethyl alcohol (3791-10), 99% acetic acid (BDH3092) and 0.22 pm vacuum filters (76010-388) were purchased from VWR (PA). Chitosan powder (c1569) was purchased from Spectrum Chemical (NJ). Minimum Essential Medium (MEM; 10-010-CV) and Corning SpinX centrifuge filters (431491) were purchased from Corning (NY). Fetal bovine serum (FBS; 26140079), 100X antibiotic- antimycotic (15240062), and 0.25% trypsin-EDTA (25200072) were purchased from ThermoFisher (MA). 4% paraformaldehyde in 0.1 M phosphate buffer (15735) was purchased from Electron Microscopy Science (PA). Cell counting kit-8 (CCK-8;850-039-kl01) was purchased from Enzo Life Sciences (NY). The LIVE/DEAD™ Cell Imaging Kit (488/570) was purchased from Thermofisher Scientific (MA).
3D Cell Culture on PES and Media Collection for Production Rate Calculations
The scaffolds were cut into 4 cm x 2 cm strips and prepared for seeding, which included washing, coating with chitosan, and sterilization. Each sample was rinsed in distilled water for 30 min and transferred to a solution of varying concentrations of chitosan in 0.1 M acetic acid for 30 min. The coated nanofiber scaffolds were then rinsed with fresh distilled water for 30 min and air dried. The processed samples were placed in a 60 mL petri dish and UV-sterilized before seeding. HepG2 and 3T3 cells were passaged and seeded separately at 3 x 1 o5 cell scaffold-1. The seeded scaffolds were then incubated for 30 min at 37 °C before the addition of serum-containing MEM and incubation at 37 °C and 5% CO2. After 48 hr, the conditioned medium was replaced with serum-free medium and incubated for 24 h before being collected for sEV isolation. Cells were then counted using cell counting kit-8 using the following protocol: The CCK-8 working reagent was prepared by diluting 10 pL of CCK-8 stock reagent in 190 pL MEM. Then, 200 pL of the working reagent was added to each well and incubated at 37 °C and 5% CO2 for 4 h. The cell metabolism was then measured through absorbance at 460 nm wavelength. For the Live/Dead assay, the LIVE/DEAD™ Cell Imaging Kit was used following the manufacturer’s instructions. For the staining, each scaffold whether embedding cells were exposed to 1 mL of final staining solution which was a 1 :2 mixture of staining agent from the product and fresh culture media. sEV Isolation and Concentration Measurement sEVs were isolated from the media via size-based separation. The isolated media first went through a 0.22 pm filter to capture larger vesicles and cell debris. The flowthrough solution was then added to a 100 kDa centrifuge filter and centrifuged at 200 * g for 4 x 30 min time periods; the mixture was washed with PBS between each centrifuge session. The sEV solution was then concentrated down to 1 mL for sEV characterization. The sEV concentration and size distribution were measured through nanoparticle tracking analysis (NTA; Nanosight NS300; Malvern, Worcestershire, UK). Samples were diluted appropriately to maintain accurate particle counts. For each sample, five 60-sec videos were acquired at a camera level of 8 and detection threshold of 2. The laser chamber was cleaned with milliQ water between each sample reading to ensure no sample contamination occurred. The videos were analyzed using the NTA3.0 software to obtain the particle concentration, along with the mean and mode particle sizes of each sample. The production rate was calculated using the following equation:
Concentration x Volume Rate = - - - -
Time x Cell Count
Cell Proliferation and Doubling Time Calculations
RAW264.7 and 3T3 cells were seed on triplicates of PES samples in 96 well plates at 2 x 103 cell per scaffold and were incubated for a total of 15 days. At various time point, the cell count was measured using CCK-8 following the same protocol described above. The doubling time was calculated using the following equation: where td is the doubling time and /J is the growth rate.
Acoustic Characterization
Amplitude frequency and beat frequency was characterized through using a standard phone microphone and a sound meter (DecibeIX). The sounds were measured over a period of 30 seconds. Amplitudes and frequencies were averaged over this period with a time resolution of 20 ms per point.
EV Production from Macrophage Cells
A mouse derived macrophage cell line, RAW264.7, was integrated on the piezoelectric scaffold (PES). It was shown through confocal microscopy imaging that RAW264.7 cells are viable under varying concentrations of cell adhesive coating and can grow on the PES over 9 days with a doubling time of 23.50 ± 0.31 hours which is comparable to the previous non- cancerous cell line (3T3) (Table 4). Overall, it was shown that RAW264.7 cells can be cultivated and grown on the PES. See FIG. 23A-C.
Table 4. Doubling Time of 3T3 and RAW264.7 Cells
Cell Line Doubling Time (hr)
3T3 23.85 ± 0.22
RAW264.7 23.5 ± 0.31
The sEV production rate of RAW264.7 cells was measured through standard 2D culture, the PES without stimulation, and PES with acoustic stimulation at 80 dB amplitude, and 100 Hz frequency. It was found that the sEV production rate of macrophage cells was enhanced by a factor of 1.49 ± 0.11 when cultured on PES samples without stimulation. Furthermore, a further enhancement in sEV production rate of 6.05 ± 0.47-fold was observed when cultured on the PES with 15 minutes of acoustic stimulation (Table 5). See FIG. 24A-B.
Table 5. Fold Change Compared to 2D Control PES OFF 1.49 ± 0.11
PES ON 6.05 ± 0.47
To test the effect of amplitude on sEV production, a range of amplitudes ranging from 55 dB to 110 dB at 100 Hz acoustic frequency was tested and sEV production was measured. A linear correlation between sEV production and amplitude was found where the rate plateaus at -100 dB amplitude (Table 6). Therefore, the production rate of sEVs can be controlled by simply adjusting the amplitude of acoustic stimulation. See FIG. 25A-B.
Table 6. Acoustic Amplitude
Sample Fold Change
PES OFF 1.49
55 dB 2.84
60 dB 3.71
70 dB 5.05
80 dB 5.93
90 dB 7.45
100 dB 7.65
110 dB 7.62 To test the effect of frequency on sEV production, a range of frequencies between 50 Hz and 1000 Hz at 80 dB amplitude was tested and sEV production was measured. In this case, an inverse relationship between acoustic frequency and production rate was found where the frequencies above 200 Hz did not affect sEV production (Table 7). Therefore, the production rate of sEVs can also be controlled by adjusting the acoustic frequency. See FIG. 26A-D.
Table 7. Acoustic Frequency
Sample Fold Change
PES OFF 1.49
50 Hz 12.78
75 Hz 7.71
100 Hz 5.30
150 Hz 3.26
200 Hz 2.20
500 Hz 1.62
1000 Hz 1.64
To test the effect of beat frequency on sEV production, a range of beat frequencies between 2 Hz and 10 Hz at 80 dB amplitude and 100 Hz frequency was tested and sEV production was measured. In this case, an optimal production rate at 8 Hz was found where a drop in sEV production rate at 10 Hz beat frequency was observed (Table 8). Therefore, additional tuning of sEV production rate can be performed within the amplitude and frequency by incorporating beat frequencies to the acoustic stimulation. See FIG. 27A-D.
In addition to the acoustic characterizations shown in Tables 9-10, the cyclic beat frequencies were also characterized and showed stable pulsed frequency at all stages. See FIG. 28. In these studies, beat frequencies of 2, 4, 6, 8, and 10 Hz were used, as shown in FIG. 27k- D.
Table 8. Acoustic Beat Frequency
Sample Fold Change
PES OFF 1.51
2 Hz 2.31
4 Hz 5.46
6 Hz 7.75
8 Hz 9.78
10 Hz 5.26
Table 9. Acoustic Frequency Characterization
Set Measurement Actual % Error
50 Hz 55.4 ± 5.7 10.3%
75 Hz 78.3 ± 7.4 9.5%
100 Hz 108.4 ± 9.6 8.9%
150 Hz 155 ± 7.4 4.8%
200 Hz 205.6 ± 7.9 3.9%
500 Hz 510 ± 15.8 3.1 %
1000 Hz 1008 ± 9.4 0.9%
Table 10. Acoustic Amplitude Characterization
Set Measurement Actual % Error
55 dB 55.7 ± 2.6 4.6%
60 dB 61.4 ± 1.9 3.1 %
70 dB 71.1 ± 1.6 2.3%
80 dB 80.4 ± 2.1 2.6%
90 dB 89.8 ± 1.7 1.9%
100 dB 101.1 ± 2.5 2.51%
110 dB 109.7 ± 3.4 3.1 %
Example 7
Effect of Different Polymer Nanofiber Concentrations on Fiber Diameter
The effect of different polymer nanofiber concentrations on fiber diameter was evaluated. Nanofibrous scaffolds were prepared as described in Example 1 using varying wt% concentrations of PAN, including 6 wt%, 8 wt%, 10 wt%, 11 wt%, and 13 wt% PAN. Nanofiber diameters were characterized using SEM and the data are shown in Table 11 and FIG. 29A-B. The nanofiber diameters increased with increasing wt% concentrations of PAN, with average fiber diameters ranging from about 150 nm to about 2200 nm. Table 11. Effect of PAN Concentration on Fiber Diameter
Wt% PAN Average Fiber Diameter (nm) Standard Error (nm)
6 152 37
8 350 77
10 475 103
11 1010 145
13 2200 521

Claims

CLAIMS What is claimed:
1. A system for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the system comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold.
2. The system of claim 1 , wherein the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLLA), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof.
3. The system of claim 2, wherein the polymer nanofibers comprise polyacrylonitrile (PAN).
4. The system of claim 1 , wherein the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
5. The system of claim 1 , wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm.
6. The system of claim 1 , wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
7. The system of claim 1, wherein the device is configured to apply an acoustic frequency of about 1 Hz to about 200 Hz.
8. The system of claim 1, wherein the device is configured to apply an acoustic amplitude of about 50 dB to about 110 dB.
9. The system of claim 1 , wherein the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
10. The system of claim 1 , wherein the EVs comprise small extracellular vesicles (sEVs), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
11. The system of claim 10, wherein the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
12. The system of claim 1 , wherein the system enhances the production rate and secretion of EVs from cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture systems.
13. The system of claim 1 , wherein the acoustic stimulation does not affect cell viability.
14. A method for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the method comprising: culturing cells on a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; and applying acoustic stimulation to the 3D piezoelectric nanofibrous scaffold, thereby stimulating production and secretion of EVs from the cells.
15. The method of claim 14, wherein the acoustic stimulation comprises an acoustic frequency of about 1 Hz to about 200 Hz.
16. The method of claim 14, wherein the acoustic stimulation comprises an acoustic amplitude of about 50 dB to about 110 dB.
17. The method of claim 14, wherein the acoustic stimulation is applied to the 3D piezoelectric nanofibrous scaffold for about 5 min to about 30 min.
18. The method of claim 14, wherein the 3D piezoelectric nanofibrous scaffold outputs a voltage of about 30 mV to about 850 mV upon acoustic stimulation.
19. The method of claim 14, wherein the EVs comprise small extracellular vesicles (sEV), exosomes, ectosomes, microvesicles, liposomes, lipoproteins, exomeres, supermeres, or combinations thereof.
20. The method of claim 19, wherein the EVs comprise sEVs having an average diameter of about 50 nm to about 200 nm.
21. The method of claim 14, wherein the cells comprise mammalian cells.
22. The method of claim 14, further comprising isolating the EVs from cell culture media.
23. The method of claim 14, wherein the method enhances the production rate and secretion of EVs from the cells by at least 5-fold as compared to conventional two-dimensional (2D) cell culture methods.
24. The method of claim 14, wherein the acoustic stimulation does not affect cell viability.
25. A method of making a three-dimensional (3D) piezoelectric nanofibrous scaffold for cell culture, the method comprising: electrospinning a solution of piezoelectric polymer nanofibers to form a piezoelectric fiber membrane; and expanding the piezoelectric fiber membrane using gas foaming to form a 3D piezoelectric nanofibrous scaffold comprising polymer nanofibers.
26. The method of claim 25, further comprising adding a coating for cell adhesion to the 3D piezoelectric nanofibrous scaffold.
27. The method of claim 26, wherein the coating for cell adhesion comprises chitosan.
28. The method of claim 25, wherein the solution of piezoelectric polymer nanofibers comprises about 6 wt% to about 13 wt% of the polymer nanofibers in N,N- dimethylformamide (DMF).
29. The method of claim 25, wherein gas foaming comprises submerging the piezoelectric fiber membrane in a solution of sodium borohydride for about 1 hr to about 6 hr.
30. The method of claim 25, wherein the 3D piezoelectric nanofibrous scaffold has a thickness of about 100 pm to about 680 pm.
31. The method of claim 25, wherein the polymer nanofibers comprise polyacrylonitrile (PAN), polystyrene (PS), polycarbonate (PC), polyvinylpyrrolidone (PVP), polybutadiene, polyvinyl butyral (PVB), polyvinyl chloride (PVC), polyvinyl methyl ether (PVME), polylactic-co-glycolic acid (PLGA), poly(l-lactic acid) (PLI_A), polyester, polycaprolactone (PCL), polyethylene oxide (PEO), polyaniline (PANI), polyfluorene, polypyrrole (PPy), poly(3,4-ethylenedioxythiophene), or combinations thereof.
32. The method of claim 31 , wherein the polymer nanofibers comprise polyacrylonitrile (PAN).
33. The method of claim 25, wherein the polymer nanofibers have an average diameter of about 150 nm to about 2200 nm.
34. The method of claim 25, wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises an average pore size of about 2 pm to about 15 pm.
35. The method of claim 25, wherein the 3D piezoelectric nanofibrous scaffold is porous and comprises a porosity of about 25% to about 95%.
36. A kit for enhancing the production rate and secretion of extracellular vesicles (EVs) from cells, the kit comprising: a three-dimensional (3D) piezoelectric nanofibrous scaffold comprising polymer nanofibers; a device configured to apply acoustic stimulation to the 3D piezoelectric nanofibrous scaffold; optionally, cell culture buffers and reagents; and optionally, packaging, labels, or instructions for use.
PCT/US2025/021108 2024-03-25 2025-03-24 Stimulative piezoelectric nanofibrous scaffolds for enhanced extracellular vesicle production in 3d cultures Pending WO2025207495A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202463569643P 2024-03-25 2024-03-25
US63/569,643 2024-03-25

Publications (1)

Publication Number Publication Date
WO2025207495A1 true WO2025207495A1 (en) 2025-10-02

Family

ID=97217254

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2025/021108 Pending WO2025207495A1 (en) 2024-03-25 2025-03-24 Stimulative piezoelectric nanofibrous scaffolds for enhanced extracellular vesicle production in 3d cultures

Country Status (1)

Country Link
WO (1) WO2025207495A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8591419B2 (en) * 2008-07-14 2013-11-26 Arizona Board Of Regents For And On Behalf Of Arizona State University Methods and devices for modulating cellular activity using ultrasound
US20180116973A1 (en) * 2012-01-12 2018-05-03 Nanofiber Solutions, Inc. Nanofiber scaffolds for biological structures

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8591419B2 (en) * 2008-07-14 2013-11-26 Arizona Board Of Regents For And On Behalf Of Arizona State University Methods and devices for modulating cellular activity using ultrasound
US20180116973A1 (en) * 2012-01-12 2018-05-03 Nanofiber Solutions, Inc. Nanofiber scaffolds for biological structures

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AMBATTU LIZEBONA AUGUST, RAMESAN SHWATHY, DEKIWADIA CHAITALI, HANSSEN ERIC, LI HAIYAN, YEO LESLIE Y.: "High frequency acoustic cell stimulation promotes exosome generation regulated by a calcium-dependent mechanism", COMMUNICATIONS BIOLOGY, vol. 3, no. 1, 1 December 2020 (2020-12-01), XP055906880, DOI: 10.1038/s42003-020-01277-6 *
LAI CHENGTENG, JIN FEI, FENG ZHANGQI, ZHANG RUI, YUAN MENG, QIAN LILI, ZHANG LEI, WANG YONGXIANG, ZHAO JIANNING: "Combining Piezoelectric Stimulation and Extracellular Vesicles for Cartilage Regeneration", JOURNAL OF TISSUE ENGINEERING AND REGENERATIVE MEDICINE, vol. 2023, 29 June 2023 (2023-06-29), US , pages 1 - 11, XP093363225, ISSN: 1932-7005, DOI: 10.1155/2023/5539194 *
LI TONG, SHI CHUANMEI, JIN FEI, YANG FAN, GU LONG, WANG TING, DONG WEI, FENG ZHANG-QI: "Cell activity modulation and its specific function maintenance by bioinspired electromechanical nanogenerator", SCIENCE ADVANCES, vol. 7, no. 39, 24 September 2021 (2021-09-24), US , pages 1 - 16, XP093363236, ISSN: 2375-2548, DOI: 10.1126/sciadv.abh2350 *
YU SOOYOUN, MILAM-GUERRERO JOANNA, TAI YOUYI, YANG STEVE, CHOI YUN YOUNG, NAM JIN, MYUNG NOSANG V.: "Maximizing Polyacrylonitrile Nanofiber Piezoelectric Properties through the Optimization of Electrospinning and Post-thermal Treatment Processes", ACS APPLIED POLYMER MATERIALS, vol. 4, no. 1, 14 January 2022 (2022-01-14), pages 635 - 644, XP093363229, ISSN: 2637-6105, DOI: 10.1021/acsapm.1c01549 *

Similar Documents

Publication Publication Date Title
Khan et al. Three-dimensionally microporous and highly biocompatible bacterial cellulose–gelatin composite scaffolds for tissue engineering applications
Sin et al. Polyurethane (PU) scaffolds prepared by solvent casting/particulate leaching (SCPL) combined with centrifugation
Lee et al. Microfluidic wet spinning of chitosan-alginate microfibers and encapsulation of HepG2 cells in fibers
CN105349487B (en) An exosome-based method for promoting the proliferation of human bone marrow mesenchymal stem cells
Cai et al. Influence of highly porous electrospun PLGA/PCL/nHA fibrous scaffolds on the differentiation of tooth bud cells in vitro
Azoidis et al. Three-dimensional cell culture of human mesenchymal stem cells in nanofibrillar cellulose hydrogels
Amaro-Prellezo et al. Extracellular vesicles from dental pulp mesenchymal stem cells modulate macrophage phenotype during acute and chronic cardiac inflammation in athymic nude rats with myocardial infarction
Johnston et al. Stimulative piezoelectric nanofibrous scaffolds for enhanced small extracellular vesicle production in 3D cultures
Zhang et al. Coating with flexible DNA network enhanced T-cell activation and tumor killing for adoptive cell therapy
Li et al. TiO2 nanopillar arrays coated with gelatin film for efficient capture and undamaged release of circulating tumor cells
WO2025207495A1 (en) Stimulative piezoelectric nanofibrous scaffolds for enhanced extracellular vesicle production in 3d cultures
Wang et al. Emerging roles of extracellular vesicles in oral and maxillofacial areas
Cook et al. Advancing extracellular vesicle production: Improving physiological relevance and yield with 3D cell culture
RU2014135202A (en) METHOD FOR OBTAINING AN ARTIFICIAL ATTACHMENT OF THE TOOTH IN VITRO AND THE ARTIFICIAL ATTACHMENT OF THE TOOTH OBTAINED BY IT
Johnson et al. Biomaterials science
Wang et al. Plant xylem-inspired chitosan-gelatin scaffolds reinforced with graphene oxide with a superior mechanical strength and hydrophilicity for bone tissue engineering
Feng et al. Anti-inflammatory and osteogenic nanofibrous scaffolds of bioactive glass/carboxymethyl chitosan-reinforced PCL short fibers for alveolar bone regeneration
JPWO2018131673A1 (en) Novel tissue regeneration material and method for producing the same
Wang et al. Migration of BEAS-2B cells enhanced by H1299 cell derived-exosomes
Park et al. Focal adhesion dynamics-mediated cell migration and proliferation on silica bead arrays
CN118006547A (en) A method for preparing mesenchymal stem cell exosomes, prepared exosomes and applications thereof
Xue et al. Research on the guidance of bone regeneration by microchannel porous scaffolds loaded with deferoxamine
Brechmann et al. Just a little prick: careful cell contacts enabled by ceramic nanostraws
Rahmani et al. Wharton’s Jelly-derived Mesenchymal Stem Cells and Polycaprolactone/Hydroxyapatite (PCL/HA) Scaffold for Bone Tissue Engineering
El Hajj et al. SHEDs and BMSCs exhibit distinct lineage preferences in HUVECs dynamic spheroid co‐cultures: vascular versus osteogenic commitment

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 25777768

Country of ref document: EP

Kind code of ref document: A1