WO2025199455A1 - Irna compositions and methods for silencing growth factor receptor bound protein 14 (grb14) in the liver - Google Patents

Irna compositions and methods for silencing growth factor receptor bound protein 14 (grb14) in the liver

Info

Publication number
WO2025199455A1
WO2025199455A1 PCT/US2025/020936 US2025020936W WO2025199455A1 WO 2025199455 A1 WO2025199455 A1 WO 2025199455A1 US 2025020936 W US2025020936 W US 2025020936W WO 2025199455 A1 WO2025199455 A1 WO 2025199455A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotides
nucleotide
grb14
dsrna agent
antisense strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/US2025/020936
Other languages
French (fr)
Inventor
Lucas BONDURANT
James D. Mcininch
Mark K. SCHLEGEL
Adam CASTORENO
Tuyen M. NGUYEN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alnylam Pharmaceuticals Inc
Original Assignee
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alnylam Pharmaceuticals Inc filed Critical Alnylam Pharmaceuticals Inc
Publication of WO2025199455A1 publication Critical patent/WO2025199455A1/en
Pending legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3183—Diol linkers, e.g. glycols or propanediols
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/343—Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • Insulin resistance increases risk of developing type 2 diabetes, non-alcoholic steatohepatitis (NASH), and other comorbidities including cardiovascular disease and cancer.
  • the prevalence of diabetes, e.g., type 2 diabetes has progressively increased and is expected to continue increasing.
  • the current treatment options for diabetes include lifestyle modifications, oral medications, insulin injections, and managing the associated comorbidities (e.g., hypertension, hyperlipidemia, obesity, metabolic syndrome, diabetic nephropathy, diabetic retinopathy, diabetic vasculopathy, and diabetic neuropathy), and involve long-term management.
  • Growth factor receptor bound protein 14 (GRB14) is an adapter protein that interacts with receptor tyrosine kinases, including insulin receptor and IGF receptors.
  • GRB14 negatively regulates signaling through insulin receptor and IGF-1 receptor and are associated with decreased insulin sensitivity.
  • GRB14-knockout mice have been reported to have improved insulin signaling in the liver and skeletal muscle.
  • GRB14 knockdown in the liver, white adipose tissues, and heart has been reported to improve glucose homeostasis in diet-induced obese mice. Accordingly, inhibition of GRB14 may offer therapeutic advantages for insulin resistance, pre-diabetes, and diabetes.
  • the present disclosure provides iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a growth factor receptor bound protein 14 (GRB14) gene.
  • the GRB14 gene may be within a cell, e.g., a cell within a subject, such as a human.
  • the present disclosure also provides methods of using the iRNA compositions of the disclosure for inhibiting the expression of a GRB14 gene and/or for treating a subject who would benefit from inhibiting or reducing the expression of a GRB14 gene, e.g., a subject suffering or prone to suffering from a GRB14-associated disease, for example, diabetes.
  • the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell.
  • dsRNA double stranded ribonucleic acid
  • the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4.
  • the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4.
  • the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell.
  • dsRNA double stranded ribonucleic acid
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding GRB14 which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16.
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding GRB14 which comprises at least 15 contiguous nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16.
  • the dsRNA agent targets a hotspot region of an mRNA encoding GRB14.
  • the present disclosure provides a dsRNA agent that targets a hotspot region of a GRB14 mRNA.
  • the dsRNA agent comprises at least one modified nucleotide.
  • substantially all of the nucleotides of the sense strand comprise a modification.
  • substantially all of the nucleotides of the antisense strand comprise a modification.
  • Page 2 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification.
  • the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell.
  • dsRNA double stranded ribonucleic acid
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus.
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus.
  • the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell.
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus.
  • all of the nucleotides of the sense strand comprise a modification.
  • all of the nucleotides of the antisense strand comprise a modification.
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.
  • the at least one modified nucleotide is selected from the group consisting of a deoxy-nucleotide, a 3’-terminal deoxy-thymine (dT) nucleotide, a 2’-O-methyl modified nucleotide, a 2’- fluoro modified nucleotide, a 2’-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino- modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nu
  • the at least one modified nucleotide is a 2’-O-methyl and/or a 2’-fluoro modification.
  • the region of complementarity may be at least 17 nucleotides in length; 19 to 30 nucleotides in length; 19-25 nucleotides in length; or 21 to 23 nucleotides in length.
  • Each strand may be no more than 30 nucleotides in length, e.g., each strand is independently 19-30 nucleotides in length; each strand is independently 19-25 nucleotides in length; each strand is independently 21-23 nucleotides in length.
  • the dsRNA may include at least one strand that comprises a 3’ overhang of at least 1 nucleotide; or at least one strand that comprises a 3’ overhang of at least 2 nucleotides.
  • the dsRNA agent further comprises a ligand.
  • the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent.
  • the ligand is an N-acetylgalactosamine (GalNAc) derivative.
  • the ligand is Page 4 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) H O OH O H H O N N O .
  • the present disclosure provides a dsRNA agent wherein (a) the sense strand comprises the nucleotide sequence CAAAACUUUCGUACUGUCAAA (SEQ ID NO: 8770) and the antisense strand comprises the nucleotide sequence UUUGACAGUACGAAAGUUUUGGG (SEQ ID NO: 8784); (b) the sense strand comprises the nucleotide sequence AAGACUUGGAUUGACUUUACA (SEQ ID NO: 8771) and the antisense strand comprises the nucleotide sequence UGUAAAGUCAAUCCAAGUCUUUG (SEQ ID NO: 8785); (c) the sense strand comprises the nucleotide sequence UUGACUUUACAUUCAUCAUUA (SEQ ID NO: 8777) and the antisense strand comprises the nucleotide sequence UAAUGATGAAUGUAAAGUCAAUC (SEQ ID NO: 8779)
  • the present disclosure provides a dsRNA agent wherein (a) the sense strand consists of the nucleotide sequence CAAAACUUUCGUACUGUCAAA (SEQ ID NO: 8770) and the antisense strand consists of the nucleotide sequence UUUGACAGUACGAAAGUUUUGGG (SEQ ID NO: 8784); (b) the sense strand consists of the nucleotide sequence AAGACUUGGAUUGACUUUACA (SEQ ID NO: 8771) and the antisense strand consists of the nucleotide sequence UGUAAAGUCAAUCCAAGUCUUUG (SEQ ID NO: 8785); (c) the sense strand consists of the nucleotide sequence UUGACUUUACAUUCAUCAUUA (SEQ ID NO: 8777) and the antisense strand consists of the nucleotide sequence UAAUGATGAAUGUAAAGUCAAUC (SEQ ID NO: 8791); (d)
  • the present disclosure provides a dsRNA agent wherein (a) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8798 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8812; (b) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8799 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8813; (c) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8805 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8819; (d) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8809 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8823; (e) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8811 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8825; or (f) the sense
  • the region of complementarity comprises any one of the antisense sequences in Tables 2-7 or 15-16.
  • the at least one modified nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2 ⁇ -methoxyethyl, 2 ⁇ -O-alkyl, 2 ⁇ -O-allyl, 2 ⁇ -C- allyl, 2 ⁇ -fluoro, 2’-O-methyl, 2 ⁇ -deoxy, and combinations thereof.
  • the at least one modified nucleotide is a 2 ⁇ -O-methyl or a 2 ⁇ -fluoro modification.
  • at least one strand of the dsRNA agent may comprise a 3’ overhang of at least 1 nucleotide; or a 3’ overhang of at least 2 nucleotides.
  • the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.
  • the phosphorothioate or methylphosphonate internucleotide linkage is at the 3’- terminus of one strand.
  • the strand is the antisense strand.
  • the strand is the sense strand.
  • the phosphorothioate or methylphosphonate internucleotide linkage is at the 5’- terminus of one strand.
  • the strand is the antisense strand.
  • the strand is the sense strand.
  • the strand is the antisense strand.
  • the strand is the sense strand.
  • the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5’- and 3’-terminus of one strand.
  • the base pair at the 1 position of the 5 ⁇ -end of the antisense strand of the duplex is an AU base pair.
  • the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.
  • the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of growth factor receptor bound protein 14 (GRB14) in a cell.
  • dsRNA double stranded ribonucleic acid
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O-methyl
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the antisense strand comprises two phosphoroth
  • the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of growth factor receptor bound protein 14 (GRB14) in a cell.
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, where
  • the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand comprise a modification Page 8 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
  • the region of complementarity comprises any one of the antisense sequences listed in Tables 2-7 or 15-16.
  • the agent is selected from the group consisting of AD-2217254, AD- 2217251, AD-2217248, AD-2217250, AD-2217245, AD-2217252, AD-2217253, AD-2217246, AD-2217262, AD- 2217258, AD-2217255, AD-2217257, or AD-2123142.
  • the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of the nucleotide sequences of any one of the agents listed in Tables 2-7 or 15-16.
  • the present disclosure also provides cells, vectors, and pharmaceutical compositions which include any of the dsRNA agents of the disclosure.
  • the dsRNA agents may be formulated in an unbuffered solution, e.g., saline or water, or in a buffered solution, e.g., a solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffered solution is phosphate buffered saline (PBS).
  • the present disclosure provides a method of inhibiting growth factor receptor bound protein 14 (GRB14) expression in a cell.
  • the method includes introducing into the cell a dsRNA agent or a pharmaceutical composition of the disclosure, thereby inhibiting expression of GRB14 in the cell.
  • the cell may be within a subject, such as a human subject.
  • the GRB14 expression is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or to below the level of detection of GRB14 expression.
  • the human subject suffers from a GRB14-associated disease, disorder, or condition.
  • the GRB14-associated disease, disorder, or condition is diabetes. In one embodiment the diabetes is type 2 diabetes.
  • the diabetes is type 1 diabetes.
  • the GRB14-associated disease, disorder, or condition is prediabetes.
  • the GRB14-associated disease, disorder, or condition is insulin resistance.
  • the GRB14- associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition.
  • the GRB14-associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic Page 9 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke.
  • the present disclosure provides a method of inhibiting the expression of GRB14 in a subject.
  • the methods include administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby inhibiting the expression of GRB14 in the subject.
  • the subject has a GRB14-associated disease, disorder, or condition.
  • the GRB14-associated disease, disorder, or condition is diabetes.
  • the diabetes is type 2 diabetes.
  • the diabetes is type 1 diabetes.
  • the GRB14-associated disease, disorder, or condition is prediabetes.
  • the GRB14-associated disease, disorder, or condition is insulin resistance.
  • the GRB14-associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition.
  • the GRB14- associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke.
  • the present disclosure provides a method of treating a subject suffering from a GRB14-associated disease, disorder, or condition. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby treating the subject suffering from a GRB14-associated disease, disorder, or condition.
  • the GRB14-associated disease, disorder, or condition is diabetes. In one embodiment the diabetes is type 2 diabetes. In another embodiment, the diabetes is type 1 diabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is prediabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is insulin resistance. In one embodiment, the GRB14-associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition. In one embodiment, the GRB14-associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke.
  • the present disclosure provides a method of preventing at least one symptom in a subject having a GRB14-associated disease, disorder, or condition.
  • the method includes administering to the subject a prophylactically effective amount of the agent of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby preventing at least one symptom in a subject having a GRB14-associated disease, disorder, or condition.
  • the GRB14-associated disease, disorder, or condition is diabetes.
  • the diabetes is type 2 diabetes.
  • the diabetes is type 1 diabetes.
  • the GRB14-associated disease, disorder, or condition is prediabetes.
  • the GRB14-associated disease, disorder, or condition is insulin resistance.
  • the GRB14- associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition.
  • the GRB14-associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke.
  • the present disclosure provides a method of reducing the risk of developing type 2 diabetes in a subject.
  • the method includes administering to the subject a prophylactically effective amount or a prophylactically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby reducing the risk of developing type 2 diabetes in the subject.
  • the present disclosure provides a method of increasing insulin sensitivity in a subject. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby increasing insulin sensitivity in the subject.
  • the insulin sensitivity is hepatic insulin sensitivity.
  • the present disclosure provides a method of reversing type 2 diabetes in a subject.
  • the method includes administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby reversing type 2 diabetes in the subject.
  • the subject is obese.
  • the methods and uses of the disclosure further include administering an additional therapeutic to the subject.
  • the dsRNA agent is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg.
  • the agent may be administered to the subject intravenously, intramuscularly, or subcutaneously.
  • the agent is administered to the subject subcutaneously.
  • the methods and uses of the disclosure further include determining, the level of GRB14 in the subject.
  • FIG.1 depicts the results of in vivo screening in PBX-mice.
  • the graph shows the percent of GRB14 mRNA (left bar) and protein (right bar) in liver relative to the PBS mean for AD-2217245 (5 mpk), AD-2217246 (5 mpk), AD-2217252 (5 mpk), AD-2217262 (5 mpk), and AD-213142 (10 mpk x3).
  • FIG.2 depicts the results of in vivo screening in non-human primates (NHP).
  • the graph shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 mRNA in liver at Day 22 post-dose.
  • FIG.3 depicts the results of in vivo screening in non-human primates (NHP).
  • the graph shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 protein in liver at Day 22 and Day 57 post-dose.
  • FIG.4A and FIG.4B show the results of an in vivo study in genetically obese mice (Ob/Ob).
  • FIG. 4A shows the GRB14 expression after treatment
  • FIG.4B illustrates the %HbA1c in the mice after treatment.
  • FIG.5A and FIG.5B show the results of an in vivo study in high fat diet (HFD) treated mice.
  • FIG.5A depicts the results of a Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) taken at week 8.
  • FIG.5B depicts the GRB14 expression.
  • FIG.6A, FIG.6B, and FIG.6C show the results of an in vivo study in diet induced obese (DIO) mice.
  • FIG.6A shows the results of a glucose tolerance test in DIO mice administered 10 mg/kg of the selected duplexes compared to DIO and lean mouse controls.
  • FIG.6B shows the results of an insulin tolerance test in DIO mice administered 10 mg/kg of the selected duplexes compared to DIO and lean mouse controls.
  • FIG.6C shows the body weight at week 8 of DIO mice administered 10 mg/kg of the selected duplexes compared to DIO and lean mouse controls.
  • RISC RNA-induced silencing complex
  • the present disclosure also provides methods of using the iRNA compositions of the disclosure for inhibiting the expression of a GRB14 gene, and for treating a subject who would benefit from inhibiting or reducing the expression of a GRB14 gene, e.g., a subject suffering or prone to suffering from a GRB14-associated disease disorder, or condition, such as a subject suffering or prone to suffering from type 2 diabetes, type 1 diabetes, prediabetes, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc.
  • a subject suffering or prone to suffering from a GRB14-associated disease disorder, or condition such as a subject suffering or prone to suffering from type 2 diabetes, type 1 diabetes, prediabetes, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic neuropathy, diabetic
  • the iRNAs of the disclosure targeting GRB14 may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18- 23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21- 24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at
  • one or both of the strands of the double stranded RNAi agents of the disclosure is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA Page 12 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) transcript of a GRB14 gene.
  • such iRNA agents having longer length antisense strands may include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
  • the use of the iRNA agents described herein enables the targeted degradation of mRNAs of a GRB14 gene in mammals. Very low dosages of the iRNAs, in particular, can specifically and efficiently mediate RNA interference (RNAi), resulting in significant inhibition of expression of a GRB14 gene.
  • RNAi RNA interference
  • compositions including these iRNAs are useful for treating a subject who would benefit from inhibiting or reducing the expression of a GRB14 gene, e.g., a subject that would benefit from a reduction of inflammation of the liver, e.g., a subject suffering or prone to suffering from a GRB14-associated disease disorder, or condition such as diabetes type 2, diabetes type 1, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic nephropathy, diabetic neurodpathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc.
  • compositions containing iRNAs to inhibit the expression of a GRB14 gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and/or reduction of the expression of this gene.
  • certain terms are first defined.
  • values and ranges intermediate to the recited values are also intended to be part of this disclosure.
  • the articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
  • an element means one element or more than one element, e.g., a plurality of elements.
  • the term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”.
  • the term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.
  • the term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.
  • GRB14 also known as “growth factor receptor bound protein 14,” refers to the well- known gene encoding a growth factor receptor bound protein 14 protein from any vertebrate or mammalian Page 13 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise.
  • the term also refers to fragments and variants of native GRB14 that maintain at least one in vivo or in vitro activity of a native GRB14.
  • the term encompasses full-length unprocessed precursor forms of GRB14 as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing.
  • the human GRB14 gene has 18 exons. Two variants of the human GRB14 gene have been identified, transcript variants 1 and 2.
  • the nucleotide and amino acid sequence of a human GRB14 trascript variant 1 can be found in, for example, GenBank Reference Sequence: NM_004490.3 (SEQ ID NO: 1; reverse complement, SEQ ID NO: 2); and the nucleotide and amino acid sequence of a human GRB14 transcript variant 2 can be found in, for example, GenBank Reference Sequence: NM_001303422.2 (SEQ ID NO: 3; reverse complement, SEQ ID NO: 4).
  • the human GRB14 gene is located in the chromosomal region 2q24.3.
  • the nucleotide sequence of the genomic region of human chromosome harboring the GRB14 gene may be found in, for example, the Genome Reference Consortium Human Build 38 (also referred to as Human Genome build 38 or GRCh38) available at GenBank.
  • the nucleotide sequence of the genomic region of human chromosome 2 harboring the GRB14 gene may also be found at, for example, GenBank Accession No. NC_000002.12, corresponding to nucleotides 164,492,417-164,622,959 of human chromosome 2.
  • the nucleotide sequence of the human GRB14 gene may be found in, for example, GenBank Accession No. NG_052839.1, corresponding to nucleotides 5,369-134,434.
  • the nucleotide and amino acid sequence of a mouse (Mus musculus) GRB14 transcript can be found in, for example, GenBank Reference Sequence: NM_016719.1 (SEQ ID NO: 5; reverse complement, SEQ ID NO: 6).
  • GenBank Reference Sequence: NM_031623.1 SEQ ID NO: 7; reverse complement, SEQ ID NO: 8.
  • NM_031623.1 SEQ ID NO: 7; reverse complement, SEQ ID NO: 8
  • the nucleotide and amino acid sequence of a Rhesus monkey GRB14 transcript variant 1 can be found in, for example, GenBank Reference Sequence: XM_015110244.2 (SEQ ID NO: 9; reverse complement, SEQ ID NO: 10); the nucleotide and amino acid sequence of a Rhesus monkey GRB14 transcript variant 2 can be found in, for example, GenBank Reference Sequence: XM_028830779.1 (SEQ ID NO: 11; reverse complement, SEQ ID NO: 12); and the nucleotide and amino acid sequence of a Rhesus monkey GRB14 transcript variant 3 can be found in, for example, GenBank Reference Sequence: XM_015110245.2 (SEQ ID NO: 13; reverse complement, SEQ ID NO: 14).
  • the nucleotide and amino acid sequence of a rabbit GRB14 transcript variant 1 can be found in, for example, GenBank Reference Sequence: XM_008258679.2 (SEQ ID NO: 15; Page 14 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) reverse complement, SEQ ID NO: 16); the nucleotide and amino acid sequence of a rabbit GRB14 transcript variant 2 can be found in, for example, GenBank Reference Sequence: XM_017342897.1 (SEQ ID NO: 17; reverse complement, SEQ ID NO: 18); and the nucleotide and amino acid sequence of a rabbit GRB14 transcript variant 3 can be found in, for example, GenBank Reference Sequence: XM_017342898.1 (SEQ ID NO: 19; reverse complement, SEQ ID NO: 20).
  • GRB14 mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM. Additional information on GRB14 can be found, for example, at www.ncbi.nlm.nih.gov/gene/2888.
  • GRB14 refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the GRB14 gene, such as a single nucleotide polymorphism in the GRB14 gene. Numerous SNPs within the GRB14 gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp).
  • Growth factor receptor-bound protein 14 is a protein belonging to a small family of adapter proteins that further comprises growth factor receptor-bound protein 7 (GRB7) and growth factor receptor- bound protein 10 (GRB10).
  • GRB14 binds an insulin receptor (IR), epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), fibroblast growth factor receptor (FGFR), as well as Tek/Tie2 (Han et al. (2001) Oncogene 20:6351-6321).
  • IR insulin receptor
  • EGFR epidermal growth factor receptor
  • PDGFR platelet-derived growth factor receptor
  • FGFR fibroblast growth factor receptor
  • Tek/Tie2 Tek/Tie2
  • GRB14 is a major negative regulator of insulin and IGF-1 metabolic pathways, whereas GRB7 regulates focal adhesion kinase (FAK)-mediated cell migration.
  • FAK focal adhesion kinase
  • GRB7/10/14 are most abundantly expressed in the pancreas, with GRB14 having relatively broad expression profiles (Han et al. (2001) Oncogene 20:6351-6321).
  • GRB14 mRNA and protein are expressed strongly in skeletal muscle and white adipose tissue, two major insulin target tissues, as well as heart and kidney (Holt et al. (2005) Biochem. J. 388:393– 406). Strong GRB14 expression is found also in the pancreatic islets, liver and in retinal rod photoreceptor cells (Desbuquois et al.
  • Insulin is a major hormonal regulator of glucose and lipid homeostasis, particularly in the target tissues of muscle, fat, and liver.
  • Overexpression of GRB14 blocks the interaction of PTP-1B with the insulin receptor, shielding it from dephosphorylation and at the same time inhibits Akt/PKB and ERK1/2 activation.
  • Akt/PKB and ERK1/2 activation Furthermore, in Grb14-deficient mice, insulin receptor tyrosine phosphorylation in the liver is decreased, and insulin activation of IRS and Akt/PKB is augmented (Dufresne et al.
  • GRB14 Overexpression of GRB14 in Chinese hamster ovary cells inhibited insulin-stimulated DNA and glycogen synthesis. GRB14 inhibited IR substrate phosphorylation in vitro (Deng et al. (2003) J Biol Chem 278(41):39311-22). Targeted deletion of the GRB14 gene has been shown to improve insulin sensitivity and glucose homeostasis, suggesting GRB14 negatively regulates insulin signaling and action (Wang et al. (2007) Mol Cell Biol (18):6497-505).
  • GRB14 mRNA and protein expression were found to be increased by 75–100% in adipose tissue, but not in liver, in two rodent models of type 2 diabetes, and mRNA expression was increased by 43% in subcutaneous adipose tissue, but was not significantly altered in skeletal muscle, of human type 2 diabetics (Holt et al. (2005) Biochem.
  • GRB14 decreases receptor phosphorylation of insulin receptor (IR) and IGF-I receptor, presumably due to increased phosphatase access, and is coupled with enhanced downstream signaling.
  • IR insulin receptor
  • IGF-I receptor IGF-I receptor
  • GRB14 protein is expressed prominently in insulin target tissues, including the liver, skeletal muscle, and adipose tissue. Variants of GRB14 have been associated with obesity and/or insulin resistance.
  • a number of other studies have examined the association of GRB14 single nucleotide polymorphisms with type 2 diabetes and/or associated metabolic profiles, each of which is hereby incorporated by reference in its entirety (Di Paula, et al., (2010) J. Intern.
  • Each protein of the GRB7/10/14 family comprises an N-terminal proline-rich region, a Ras- associating (RA) domain, a pleckstrin homology (PH) domain, a C-terminal Src homology 2 (SH2) domain, and a conserved region referred to as the BPS domain (named for being between the PH and SH2 domains) or the phosphorylated insulin receptor-interacting region (PIR) that is unique to the family.
  • RA Ras- associating
  • PH pleckstrin homology
  • SH2 C-terminal Src homology 2
  • target sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a GRB14 gene, including mRNA that is a product of RNA processing of a primary transcription product.
  • the target portion of the sequence will be at Page 16 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a GRB14 gene.
  • the target sequence of a GRB14 gene may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length.
  • the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18- 26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length.
  • strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
  • G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively.
  • ribonucleotide or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1).
  • guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.
  • a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil.
  • nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the disclosure by a nucleotide containing, for example, inosine.
  • adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure.
  • RNAi agent refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway.
  • RISC RNA-induced silencing complex
  • iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi).
  • RNAi RNA interference
  • the iRNA modulates, e.g., inhibits, the expression of the GRB14 gene in a cell, e.g., a cell within a subject, such as a mammalian subject.
  • an RNAi agent of the disclosure includes a single stranded RNA that interacts with a target RNA sequence, e.g., a GRB14 target mRNA sequence, to direct the cleavage of the target RNA.
  • a target RNA sequence e.g., a GRB14 target mRNA sequence
  • Dicer Type III endonuclease
  • Dicer a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with Page 17 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) characteristic two base 3’ overhangs (Bernstein, et al., (2001) Nature 409:363).
  • the siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309).
  • RISC RNA-induced silencing complex
  • the disclosure relates to a single stranded RNA (sssiRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a GRB14 gene.
  • siRNA is also used herein to refer to an RNAi as described above.
  • the RNAi agent may be a single-stranded RNAi agent that is introduced into a cell or organism to inhibit a target mRNA.
  • Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA.
  • the single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAi agents are described in U.S. Patent No.8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference.
  • an “iRNA” for use in the compositions and methods of the disclosure is a double-stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double-stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”.
  • dsRNA refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a GRB14 gene.
  • a double-stranded RNA dsRNA triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.
  • each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide.
  • an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides.
  • modified nucleotide refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or a modified nucleobase.
  • modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases.
  • the modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in Page 18 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the art.
  • the duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18- 22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20
  • the two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.”
  • a hairpin loop can comprise at least one unpaired nucleotide.
  • the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.
  • the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected.
  • the connecting structure is referred to as a “linker.”
  • the RNA strands may have the same or a different number of nucleotides.
  • an RNAi agent of the disclosure is a dsRNA, each strand of which comprises less than 30 nucleotides, e.g., 17-27, 19-27, 17-25, 19-25, or 19-23, that interacts with a target RNA sequence, e.g., a GRB14 target mRNA sequence, to direct the cleavage of the target RNA.
  • an RNAi agent of the disclosure is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a GRB14 target mRNA sequence, to direct the cleavage of the target RNA.
  • a target RNA sequence e.g., a GRB14 target mRNA sequence
  • the sense strand is 21 nucleotides in length.
  • the antisense strand is 23 nucleotides in length.
  • nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3’-end of one strand of a dsRNA extends beyond the 5’-end of the other strand, or vice versa, there is a nucleotide overhang.
  • a dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
  • a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside.
  • the overhang(s) can be on the sense strand, the antisense strand or any combination thereof.
  • the nucleotide(s) of an overhang can be present on the 5’-end, 3’-end or both ends of either an antisense or sense strand of a dsRNA.
  • the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and/or the 5’-end.
  • the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and/or the 5’-end.
  • one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
  • the overhang on the sense strand or the antisense strand, or both can include extended lengths longer than 10 nucleotides, e.g., 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides or 10-15 nucleotides in length.
  • an extended overhang is on the sense strand of the duplex.
  • an extended overhang is present on the 3’end of the sense strand of the duplex.
  • an extended overhang is present on the 5’end of the sense strand of the duplex.
  • an extended overhang is on the antisense strand of the duplex.
  • an extended overhang is present on the 3’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate.
  • the terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt.
  • dsRNA is said to be blunt ended.
  • a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length.
  • antisense strand or "guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a GRB14 mRNA.
  • region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a GRB14 nucleotide Page 20 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) sequence, as defined herein.
  • the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- and/or 3’- terminus of the iRNA.
  • cleavage region refers to a region that is located immediately adjacent to the cleavage site.
  • the cleavage site is the site on the target at which cleavage occurs.
  • the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site.
  • the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site.
  • the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.
  • the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
  • Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 o C or 70 o C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook et al. (1989) Cold Spring Harbor Laboratory Press).
  • stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 o C or 70 o C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook et al. (1989) Cold Spring Harbor Laboratory Press).
  • Other conditions such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
  • Complementary sequences within an iRNA include base- pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences.
  • Such sequences can be referred to as “fully complementary” with respect to each other herein.
  • first sequence is referred to as “substantially complementary” with respect to a second sequence herein
  • the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway.
  • a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.
  • “Complementary” sequences, as used herein, can also include, or be formed entirely from, non- Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled.
  • non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.
  • the terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.
  • a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding GRB14).
  • mRNA messenger RNA
  • a polynucleotide is complementary to at least a part of a GRB14 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding GRB14.
  • the antisense strand polynucleotides disclosed herein are fully complementary to the target GRB14 sequence.
  • the antisense strand polynucleotides disclosed herein are substantially complementary to the target GRB14 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1 or 3, or a fragment of SEQ ID NO: 1 or 3, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
  • an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target GRB14 sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 2 or 4, or a fragment of any one of SEQ ID NO: 2 or 4, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
  • an iRNA of the disclosure includes an antisense strand that is substantially complementary to the target GRB14 sequence and comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of Page 22 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) any one of the sense strands in Tables 2-7 or 15-16, or a fragment of any one of the sense strands in Tables 2-7 or 15-16, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.
  • inhibiting is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition.
  • the phrase “inhibiting expression of a GRB14 gene,” as used herein, includes inhibition of expression of any GRB14 gene (such as, e.g., a mouse GRB14 gene, a rat GRB14 gene, a monkey GRB14 gene, or a human GRB14 gene) as well as variants or mutants of a GRB14 gene that encode a GRB14 protein, respectively.
  • “Inhibiting expression of a GRB14 gene” includes any level of inhibition of a GRB14 gene, e.g., at least partial suppression of the expression of a GRB14 gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
  • the expression of a GRB14 gene may be assessed based on the level of any variable associated with GRB14 gene expression, e.g., GRB14 mRNA level or GRB14 protein level.
  • the expression of a GRB14 gene may also be assessed indirectly based on, for example, the enzymatic activity of GRB14 in a tissue sample, such as a liver sample. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level.
  • the control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
  • At least partial suppression of the expression of a GRB14 gene is assessed by a reduction of the amount of GRB14 mRNA which can be isolated from, or detected, in a first cell or group of cells in which a GRB14 gene is transcribed and which has or have been treated such that the expression of a GRB14 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).
  • the degree of inhibition may be expressed in terms of: (mRNAin control cells) - (mRNA in treated cells) ⁇ 100 % (mRNAin control cells)
  • contacting a cell with an RNAi agent includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or Page 23 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) indirectly.
  • the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
  • Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent.
  • Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located.
  • the RNAi agent may contain and/or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver.
  • a ligand e.g., GalNAc3
  • a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.
  • contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices.
  • iRNA into a cell may be in vitro and/or in vivo.
  • iRNA can be injected into a tissue site or administered systemically.
  • In vivo delivery can also be done by a beta-glucan delivery system.
  • In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.
  • the term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed.
  • a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose).
  • a primate such as a human, a non-human primate, e.g., a monkey, and a chimpanzee
  • a non-primate such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster,
  • the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in GRB14 expression; a human at risk for a disease, disorder or condition that would benefit from reduction in GRB14 expression; a human having a disease, disorder or condition that would benefit from reduction in GRB14 expression; and/or human being treated for a disease, disorder or condition that would benefit from reduction in GRB14 expression as described herein.
  • the subject is homozygous for the GRB14 gene. Each allele of the gene may encode a functional GRB14 protein.
  • the subject is heterozygous for the GRB14 gene.
  • the subject may have an allele encoding a functional GRB14 protein and an allele encoding a loss of Page 24 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) function variant of GRB14.
  • the subject has an allele encoding the rs3923113 variant.
  • the subject has an allele encoding the rs10195252 variant.
  • the subject has a GIGYF1 loss of function allele.
  • the subject has a GIGYF1 rs221797 variant (e.g., rs221797:A).
  • the subject has a GIGYF1 rs117231629 variant. In some embodiments, the subject has a GIGYF2 loss of function allele. In some embodiments, the subject has a GIGYF2 rs1801251 variant (e.g., rs1801251:A).
  • the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with GRB14 gene expression and/or GRB14 protein production.
  • symptoms associated with GRB14 gene expression and/or GRB14 protein production may be symptoms of a disease or disorder in which the pathology or cause is independent of GRB14 expression and/or GRB14 protein production, but which may nonetheless be compensated for/treated for/counteracted by inhibiting GRB14 gene expression and/or GRB14 protein production, e.g., a GRB14-associated disease, such as type 2 diabetes, type 1 diabetes, prediabetes, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc.
  • a GRB14-associated disease such as type 2 diabetes, type 1 diabetes, prediabetes, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipid
  • “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.
  • the term “lower” in the context of a GRB14-associated disease refers to a statistically significant decrease in such level.
  • the decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more.
  • a decrease is at least 20%.
  • “Lower” in the context of the level of GRB14 in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder.
  • “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of a GRB14 gene refers to a reduction in the likelihood that a subject will develop a symptom associated with such disease, disorder, or condition, e.g., a symptom of GRB14 gene expression or overexpression, such as insulin resistance.
  • GRB14-associated disease are diseases or disorders that are caused by, or associated with, GRB14 gene expression, respectively, or by GRB14 protein production, respectively.
  • GRB14-associated disease includes a disease, disorder or condition that would benefit from a Page 25 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) decrease in the gene expression or protein activity of GRB14, respectively.
  • a “GRB14-associated disease” includes a disease or disorder which does not arise as a result of the expression of a GRB14 gene and/or production of a GRB14 protein, but in which the reduced expression of a GRB14 gene and/or production of a GRB14 protein may nonetheless alleviate the symptoms of or counteract or compensate for the adverse physiological effects of the disease or disorder.
  • a subject having or being at risk for a GRB14- associated disease or disorder may include a subject expressing a wildtype GRB14 gene and/or otherwise exhibiting normal/healthy levels of expression of the GRB14 gene and levels of GRB14 protein production.
  • a "GRB14-associated disease” is type 2 diabetes.
  • a “GRB14- associated disease” is type 1 diabetes.
  • a “GRB14-associated disease” is prediabetes.
  • a “GRB14-associated disease” is insulin resistance.
  • a “GRB14- associated disease” is a diabetes-related complication, such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc.
  • “Therapeutically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a GRB14-associated disease, disorder, or condition, is sufficient to effective treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease).
  • the "therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.
  • “Prophylactically effective amount,” as used herein, is intended to include the amount of an iRNA that, when administered to a subject having a GRB14-associated disease, disorder, or condition, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease.
  • the “prophylactically effective amount” may vary depending on the iRNA, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
  • a “therapeutically-effective amount” or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment.
  • iRNA employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in Page 26 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically-acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
  • solvent encapsulating material involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated.
  • materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (1
  • sample includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject.
  • biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like.
  • Tissue samples may include samples from tissues, organs or localized regions.
  • samples may be derived from particular organs, parts of organs, or fluids or cells within those organs.
  • samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes).
  • a “sample derived from a subject” refers to blood or plasma drawn from the subject.
  • iRNAs of the Disclosure Described herein are iRNAs which inhibit the expression of a target gene. In one embodiment, the iRNAs inhibit the expression of a GRB14 gene.
  • the iRNA agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a GRB14 gene in a cell, such as a liver Page 27 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) cell, such as a liver cell within a subject, e.g., a mammal, such as a human with type 2 diabetes, type 1 diabetes, prediabetes, or insulin resistance.
  • the dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a GRB14 gene.
  • the region of complementarity is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length).
  • the iRNA inhibits the expression of the target gene (e.g., a human, a primate, a non-primate, or a bird target gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytometric techniques.
  • a dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used.
  • One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence.
  • the target sequence can be derived from the sequence of an mRNA formed during the expression of a GRB14 gene.
  • the other strand includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
  • the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
  • the duplex structure is between 15 and 30 base pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18- 26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26
  • the region of complementarity to the target sequence is between 15 and 30 nucleotides in length, e.g., between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15- 17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20- 22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length
  • the sense and antisense strands of the dsRNA are each independently about 15 to about 30 nucleotides in length, or about 25 to about 30 nucleotides in length, e.g., each strand is Page 28 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) independently between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19- 27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29
  • the dsRNA is between about 15 and about 23 nucleotides in length, or between about 25 and about 30 nucleotides in length.
  • the dsRNA is long enough to serve as a substrate for the Dicer enzyme.
  • dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer.
  • the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule.
  • a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).
  • the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 9 to 36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15- 18, 15-17, 18-30,
  • an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA.
  • a miRNA is a dsRNA.
  • a dsRNA is not a naturally occurring miRNA.
  • an iRNA agent useful to target GRB14 expression is not generated in the target cell by cleavage of a larger dsRNA.
  • the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from nucleotides which are perfectly complementary to any 15 contiguous nucleotides positioned within nucleotides 166-188, 168-190, 169-191, 170-192, 171-193, 173-195, 174-196, 175-197, 180-202, 181-203, 182-204, 352-374, 353-375, 354-376, 355-377, 356-378, 358-380, 359- 381, 360-382, 361-383, 362-384, 363-385, 364-386, 365-387, 366-388, 367-389, 368-390, 369-391, 370-392, 371-393, 373-395, 374-396, 375-397, 376-398, 377-399, 378-400, 379-401, 380-402, 381-403, 382-404, 383- 40
  • a dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts.
  • a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof.
  • nucleotide(s) of an overhang can be present on the 5’-end, 3’-end or both ends of either an antisense or sense strand of a dsRNA.
  • a dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.
  • iRNA compounds of the disclosure may be prepared using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are prepared separately.
  • a dsRNA of the disclosure includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence.
  • the sense strand sequence is selected from the group of sequences provided in Tables 2-7 or 15-16, and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the group of sequences of any one of Tables 2-7 or 15-16.
  • one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a GRB14 gene.
  • a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in Tables 2-7 or 15-16, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in Tables 2-7 or 15-16.
  • the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides.
  • the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide. It will be understood that, although the sequences in Tables 2-7 or 15-16are described as modified, unmodified, unconjugated.
  • the RNA of the iRNA of the disclosure e.g., a dsRNA of the disclosure
  • the skilled person is well aware that dsRNAs having a duplex structure of between about 20 and 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888).
  • dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above.
  • dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of a GRB14 gene by not more than Page 34 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) about 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present disclosure.
  • the RNAs described in Tables 2-7 or 15-16 identify a site(s) in a GRB14 transcript that is susceptible to RISC-mediated cleavage.
  • an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site.
  • Such an iRNA will generally include at least about 15 contiguous nucleotides from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the gene. While a target sequence is generally about 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA.
  • RNA sequence a “window” or “mask” of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences.
  • a “window” or “mask” of a given size as a non-limiting example, 21 nucleotides
  • figuratively including, e.g., in silico
  • This process coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression.
  • sequences identified herein represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.
  • Such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.
  • An iRNA agent as described herein can contain one or more mismatches to the target sequence.
  • an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch is not located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5’- or 3’-end of the region of complementarity. For example, for a 23 nucleotide iRNA agent the strand which is complementary to a region of a GRB14 gene, generally does not contain any mismatch within the central 13 nucleotides.
  • RNA target may have regions, or spans of the target RNA’s nucleotide sequence, which are relatively more susceptible or amenable than other regions of the RNA target to mediating cleavage of the RNA target via RNA interference induced by the binding of an RNAi agent to that region.
  • RNA interference within such “hotspot regions” means that iRNA agents targeting the region will likely have higher efficacy in inducing iRNA interference than iRNA agents which target other regions of the target RNA.
  • the accessibility of a target region of a target RNA may influence the efficacy of iRNA agents which target that region, with some hotspot regions having increased accessibility.
  • Secondary structures, for instance, that form in the RNA target may affect the ability of the iRNA agent to bind the target region and induce RNA interference.
  • an iRNA agent may be designed to target a hotspot region of any of the target RNAs described herein, including any identified portions of a target RNA (e.g., a particular exon).
  • a hotspot region may refer to an approximately 19-200, 19-150, 19- 100, 19-75, 19-50, 21-200, 21-150, 21-100, 21-75, 21-50, 50-200, 50-150, 50-100, 50-75, 75-200, 75- 150, 75-100, 100-200, or 100-150 nucleotide region of a target RNA sequence for which targeting using RNAi agents provides an observably higher probability of efficacious silencing relative to targeting other regions of the same target RNA.
  • a hotspot region may comprise a limited region of the target RNA, and in some cases, a substantially limited region of the target, including for example, less than half of the length of the target RNA, such as about 5%, 10%, 15%, 20%, 25%, or 30% of the length of the target RNA.
  • the other regions against which a hotspot is compared may cumulatively comprise at least a majority of the length of the target RNA.
  • Page 36 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the other regions may cumulatively comprise at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95% of the length of the target RNA.
  • Compared regions of the target RNA may be empirically evaluated for identification of hotspots using efficacy data obtained from in vitro or in vivo screening assays.
  • RNAi agents targeting various regions that span a target RNA may be compared for frequency of efficacious iRNA agents (e.g., the amount by which target gene expression is inhibited, such as measured by mRNA expression or protein expression) that bind each region.
  • a hotspot can be recognized by observing clustering of multiple efficacious RNAi agents that bind to a limited region of the RNA target.
  • a hotspot may be sufficiently characterized as such by observing efficacy of iRNA agents which cumulatively span at least about 60% of the target region identified as a hotspot, such as about 70%, about 80%, about 90%, or about 95% or more of the length of the region, including both ends of the region (i.e.
  • an iRNA agent which demonstrates at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% inhibition over the region (e.g., no more than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% mRNA remaining) may be identified as efficacious.
  • Amenability to targeting of RNA regions may also be assessed using quantitative comparison of inhibition measurements across different regions of a defined size (e.g., 25, 30, 40, 50, 60, 70, 80, 90, or 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nts). For example, an average level of inhibition may be determined for each region and the averages of each region may be compared. The average level of inhibition within a hotspot region may be substantially higher than the average of averages for all evaluated regions. According to some aspects, the average level of inhibition in a hotspot region may be at least about 10%, 20%, 30%, 40%, or 50% higher than the average of averages.
  • the average level of inhibition in a hotspot region may be at least about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5 1.6, 1.7, 1.8.1.9, or 2.0 standard deviations above the average of averages.
  • the average level of inhibition may be higher by a statistically significant (e.g., p ⁇ 0.05) amount.
  • each inhibition measurement within a hotspot region may be above a threshold amount (e.g., at or below a threshold amount of mRNA remaining).
  • each inhibition measurement within the region may be substantially higher than an average of all inhibition measurements across all the measured regions.
  • each inhibition measurement in a hotspot region may be at least about 10%, 20%, 30%, 40%, or 50% higher than the average of all inhibition measurements.
  • each inhibition measurement may be at least about 1.0, 1.1, 1.2, 1.3, 1.4, 1.51.6, 1.7, 1.8.1.9, or 2.0 standard deviations above the average of all inhibition measurements.
  • Each inhibition measurement may be higher by a statistically significant (e.g., p ⁇ 0.05) amount than the average of all inhibition Page 37 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) measurements.
  • a standard for evaluating a hotspot may comprise various combinations of the above standards where compatible (e.g., an average level of inhibition of at least about a first amount and having no inhibition measurements below a threshold level of a second amount, lesser than the first amount). It is therefore expressly contemplated that any iRNA agent, including the specific exemplary iRNA agents described herein, which targets a hotspot region of a target RNA, may be preferably selected for inducing RNA interference of the target mRNA as targeting such a hotspot region is likely to exhibit a robust inhibitory response relative to targeting a region which is not a hotspot region.
  • RNAi agents targeting target sequences that substantially overlap e.g., by at least about 70%, 75%, 80%, 85%, 90%, 95% of the target sequence length) or, preferably, that reside fully within the hotspot region may be considered to target the hotspot region.
  • Hotspot regions of the RNA target(s) of the instant disclosure may include any region for which the data disclosed herein demonstrates higher frequency of targeting by efficacious RNAi agents, including by any of the standards described elsewhere herein, whether or not the range(s) of such hotspot region(s) are explicitly specified.
  • a dsRNA agent of the present disclosure targets a hotspot region of an mRNA encoding GRB14.
  • the present disclosure provides a dsRNA agent that targets a hotspot region of a GRB14 mRNA.
  • a dsRNA is un-modified, and does not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein.
  • the RNA of an iRNA of the disclosure e.g., a dsRNA
  • substantially all of the nucleotides of an iRNA of the disclosure are modified.
  • nucleotides of an iRNA of the disclosure are modified.
  • iRNAs of the disclosure in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.
  • substantially all of the nucleotides of an iRNA of the disclosure are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2’-fluoro modifications (e.g., no more than 92 ⁇ -fluoro modifications, no more than 82 ⁇ -fluoro modifications, no more than 72 ⁇ -fluoro modifications, no more than 62 ⁇ -fluoro modifications, no more than 52 ⁇ -fluoro modifications, no more than 4 2 ⁇ -fluoro modifications, no more than 52 ⁇ -fluoro modifications, no more than 42 ⁇ -fluoro modifications, no more than 32 ⁇ -fluoro modifications, or no more than 22 ⁇ -fluoro modifications).
  • 2’-fluoro modifications e.g., no more than 92 ⁇ -fluoro modifications, no more than 82 ⁇ -fluoro modifications, no more than 72 ⁇ -fluoro modifications, no more than 62 ⁇ -fluoro modifications, no more than 52 ⁇ -fluoro modifications, no more than 4 2 ⁇ -fluoro modifications, no more than 52
  • the sense strand comprises no more than 4 nucleotides comprising 2 ⁇ -fluoro modifications (e.g., no more than 32 ⁇ -fluoro modifications, or no more than 22 ⁇ -fluoro modifications).
  • the Page 38 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) antisense strand comprises no more than 6 nucleotides comprising 2 ⁇ -fluoro modifications (e.g., no more than 52 ⁇ -fluoro modifications, no more than 42 ⁇ -fluoro modifications, no more than 42 ⁇ -fluoro modifications, or no more than 22 ⁇ -fluoro modifications).
  • all of the nucleotides of an iRNA of the disclosure are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2’-fluoro modifications (e.g., no more than 92 ⁇ -fluoro modifications, no more than 82 ⁇ -fluoro modifications, no more than 72 ⁇ -fluoro modifications, no more than 62 ⁇ -fluoro modifications, no more than 52 ⁇ -fluoro modifications, no more than 42 ⁇ -fluoro modifications, no more than 52 ⁇ -fluoro modifications, no more than 42 ⁇ -fluoro modifications, no more than 32 ⁇ -fluoro modifications, or no more than 22 ⁇ -fluoro modifications).
  • 2’-fluoro modifications e.g., no more than 92 ⁇ -fluoro modifications, no more than 82 ⁇ -fluoro modifications, no more than 72 ⁇ -fluoro modifications, no more than 62 ⁇ -fluoro modifications, no more than 52 ⁇ -fluoro modifications, no more than 42 ⁇ -fluoro modifications, no more than 52 ⁇ -flu
  • the double stranded RNAi agent of the disclosure further comprises a 5’- phosphate or a 5’-phosphate mimic at the 5’ nucleotide of the antisense strand.
  • the double stranded RNAi agent further comprises a 5’-phosphate or 5’-phosphate mimic at the 5’ nucleotide of the sense strand.
  • the 5’-phosphate mimic is a 5’-vinylphosphonate (5’-VP).
  • the nucleic acids featured in the disclosure can be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al.
  • Modifications include, for example, end modifications, e.g., 5’-end modifications (phosphorylation, conjugation, inverted linkages) or 3’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’-position or 4’-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages.
  • end modifications e.g., 5’-end modifications (phosphorylation, conjugation, inverted linkages) or 3’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.
  • base modifications e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucle
  • RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
  • modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • a modified iRNA will have a phosphorus atom in its internucleoside backbone.
  • Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ Page 39 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) to 5
  • the dsRNA agents of the disclosure are in a free acid form. In other embodiments of the disclosure, the dsRNA agents of the disclosure are in a salt form. In one embodiment, the dsRNA agents of the disclosure are in a sodium salt form. In certain embodiments, when the dsRNA agents of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and/or phosphorothioate groups present in the agent.
  • Agents in which substantially all of the phosphodiester and/or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and/or phosphorothioate linkages without a sodium counterion.
  • sodium ions are present in the agent as counterions for all of the phosphodiester and/or phosphorothioate groups present in the agent.
  • Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S.
  • Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos.5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.
  • RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • A1088681630WO AN-470-WO
  • PNA peptide nucleic acid
  • PNA compounds the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
  • RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular --CH 2 --NH--CH 2 -, --CH 2 --N(CH 3 )--O--CH 2 -- [known as a methylene (methylimino) or MMI backbone], --CH 2 --O--N(CH 3 )--CH 2 --, --CH 2 --N(CH 3 )-- N(CH 3 )--CH 2 -- and --N(CH 3 )--CH 2 ----[wherein the native phosphodiester backbone is represented as --O--P-- O--CH 2 --] of the above-referenced U.S.
  • RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Patent No.5,034,506. Modified RNAs can also contain one or more substituted sugar moieties.
  • the iRNAs e.g., dsRNAs, featured herein can include one of the following at the 2’-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N- alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C 1 to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • Exemplary suitable modifications include O[(CH 2 ) n O] m CH 3 , O(CH 2 ).
  • n OCH 3 O(CH 2 ) n NH 2 , O(CH 2 ) n CH 3 , O(CH 2 ) n ONH 2 , and O(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.
  • dsRNAs include one of the following at the 2’ position: C 1 to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties.
  • the modification includes a 2’-methoxyethoxy (2’-O--CH 2 CH 2 OCH 3 , also known as 2’-O-(2-methoxyethyl) or 2’-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group.
  • 2’-dimethylaminooxyethoxy i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2’-DMAOE, as described in examples herein below
  • 2’- dimethylaminoethoxyethoxy also known in the art as 2’-O-dimethylaminoethoxyethyl or 2’-DMAEOE
  • 2’-O--CH 2 --O--CH 2 --N(CH 2 ) 2 is 2’-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2’-DMAOE, as described in examples herein below
  • 2’- dimethylaminoethoxyethoxy also known in the art as 2’-O-dimethylaminoethoxyethyl or 2’-DMAEOE
  • Further exemplary modifications include: 5’-Me-2’-F nucleotides, 5’-Me-2’- OMe nucleotides, 5’-Me-2’-deoxynucleotides, (both R and S isomers in these three families); 2’-alkoxyalkyl; and 2’-NMA (N-methylacetamide).
  • Other modifications include 2’-methoxy (2’-OCH 3 ), 2’-aminopropoxy (2’-OCH 2 CH 2 CH 2 NH 2 ) and 2’- fluoro (2’-F).
  • RNA of an iRNA can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat.
  • RNA of the disclosure can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • unmodified or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8- substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substitute
  • nucleobases include those disclosed in U.S. Pat. No.3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure.
  • These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S., Crooke, S. T.
  • An iRNA of the disclosure can also be modified to include one or more locked nucleic acids (LNA).
  • LNA locked nucleic acids
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons. This structure effectively "locks" the ribose in the 3’-endo structural conformation.
  • the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439- 447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A.
  • an iRNA of the disclosure can also be modified to include one or more bicyclic sugar moieties.
  • a “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms.
  • a “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4’-carbon and the 2’- carbon of the sugar ring.
  • an agent of the disclosure may include one or more locked nucleic acids (LNA).
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons.
  • an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4’-CH2-O-2’ bridge. This structure effectively "locks" the ribose in the 3’-endo structural conformation.
  • the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR.
  • bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms.
  • the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge.
  • Examples of such 4’ to 2’ bridged bicyclic nucleosides include but are not limited to 4’-(CH2)—O-2’ (LNA); 4’-(CH2)—S-2’; 4’-(CH2)2—O- 2’ (ENA); 4’-CH(CH3)—O-2’ (also referred to as “constrained ethyl” or “cEt”) and 4’-CH(CH2OCH3)—O- 2’ (and analogs thereof; see, e.g., U.S. Pat.
  • Patent Publication No.2004/0171570 4’-CH2— Page 43 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) N(R)—O-2’, wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No.7,427,672); 4’- CH2—C(H)(CH3)-2’ (see, e.g., Chattopadhyaya et al., J. Org.
  • any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example ⁇ -L-ribofuranose and ⁇ -D-ribofuranose (see WO 99/14226).
  • An iRNA of the disclosure can also be modified to include one or more constrained ethyl nucleotides.
  • a "constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)-0-2’ bridge.
  • a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”
  • An iRNA of the disclosure may also include one or more “conformationally restricted nucleotides” (“CRN”).
  • CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5’ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA.
  • the linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.
  • an iRNA of the disclosure comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides.
  • UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar” residue.
  • UNA also encompasses monomer with bonds between C1’-C4’ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1’ and C4’ carbons).
  • the C2’-C3’ bond i.e. the covalent carbon-carbon bond between the C2’ and C3’ carbons
  • Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No.8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
  • RNA molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N- (acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2’-0-deoxythymidine (ether), N-(aminocaproyl)-4- hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others.
  • an RNAi agent of the present disclosure is an agent that inhibits the expression of a GRB14 gene which is selected from the group of agents listed in Tables 2-7 or 15-16. Any of these agents may further comprise a ligand.
  • the double stranded RNAi agents of the disclosure include agents with chemical modifications as disclosed, for example, in WO 2013/075035, filed on November 16, 2012, the entire contents of which are incorporated herein by reference.
  • the RNAi agent may be optionally conjugated with a GalNAc ligand, for instance on the sense strand.
  • the disclosure provides double stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., a GRB14 gene) in vivo.
  • the RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may range from 12-30 nucleotides in length.
  • each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
  • the sense strand is 21 nulceotides in length.
  • the antisense strand is 23 nucleotides in length.
  • RNAi agent a duplex double stranded RNA
  • the duplex region of an RNAi agent may be 12-30 nucleotide pairs in length.
  • the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
  • the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
  • the RNAi agent may contain one or more overhang regions and/or capping groups at the 3’-end, 5’-end, or both ends of one or both strands.
  • the overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
  • the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
  • the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2’-sugar modified, such as, 2-F, 2’- Omethyl, thymidine (T), 2 ⁇ -O-methoxyethyl-5-methyluridine (Teo), 2 ⁇ -O-methoxyethyladenosine (Aeo), 2 ⁇ - O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof.
  • TT can be an overhang sequence for either end on either strand.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the 5’- or 3’- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated.
  • the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different.
  • the overhang is present at the 3’-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3’-overhang is present in the antisense strand.
  • this 3’-overhang is present in the sense strand.
  • the RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability.
  • the single-stranded overhang may be located at the 3’-terminal end of the sense strand or, alternatively, at the 3’-terminal end of the antisense strand.
  • the RNAi may also have a blunt end, located at the 5’-end of the antisense strand (or the 3’-end of the sense strand) or vice versa.
  • the antisense strand of the RNAi has a nucleotide overhang at the 3’-end, and the 5’-end is blunt.
  • the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5’end.
  • the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.
  • the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive Page 46 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) nucleotides at positions 8, 9, 10 from the 5’end.
  • the antisense strand contains at least one motif of three 2’-O- methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.
  • the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end.
  • the antisense strand contains at least one motif of three 2’- O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.
  • the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end; the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang.
  • the 2 nucleotide overhang is at the 3’-end of the antisense strand.
  • the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and at the 5’-end of the antisense strand.
  • every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides.
  • each residue is independently modified with a 2’-O-methyl or 3’-fluoro, e.g., in an alternating motif.
  • the RNAi agent further comprises a ligand (GalNAc 3 ).
  • the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5’ terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3’ terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ‘ terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3’ terminal nucleotides are unpaired with sense strand, thereby forming a 3’ single stranded overhang of 1-6 nucleotides; wherein the 5’ terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30
  • the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.
  • the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3’ end than the first strand, wherein the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into
  • the RNAi agent further comprises a ligand.
  • the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
  • the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.
  • the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5’-end.
  • the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1 st nucleotide from the 5’-end of the antisense strand, or, the count starting from the 1 st paired nucleotide within the duplex region from the 5’- end of the antisense strand.
  • the cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5’-end.
  • the sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand.
  • the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three Page 48 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand.
  • the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides.
  • the first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification.
  • the term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides.
  • the motifs When the motifs are immediately adjacent to each other, then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different.
  • Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.
  • the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand.
  • This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.
  • the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3’-end, 5’-end or both ends of the strand.
  • the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3’-end, 5’-end or both ends of the strand.
  • the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.
  • the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.
  • every nucleotide in the sense strand and antisense strand of the RNAi agent may be modified.
  • Each nucleotide may be modified with Page 49 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2 ⁇ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.
  • nucleic acids are polymers of subunits
  • many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety.
  • the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not.
  • a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand.
  • a modification may occur in a double strand region, a single strand region, or in both.
  • a modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA.
  • a phosphorothioate modification at a non- linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini.
  • the 5’ end or ends can be phosphorylated.
  • nucleotides or nucleotide surrogates may be included in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both.
  • all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein.
  • Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2’-deoxy-2’-fluoro (2’-F) or 2’- O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.
  • each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2’-methoxyethyl, 2’- O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-deoxy, or 2’-fluoro.
  • the strands can contain more than one modification.
  • each residue of the sense strand and antisense strand is independently modified with 2’- O-methyl or 2’-fluoro.
  • each residue of the sense strand and antisense strand is independently modified with 2’- O- methyl, 2’-fluoro, and/or a deoxy-nucleotide.
  • the RNAi agent comprises the pattern of the alternating motif of 2’-O-methyl modification and 2’-F modification on the sense strand initially has a shift relative to the pattern of the Page 50 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) alternating motif of 2’-O-methyl modification and 2’-F modification on the antisense strand initially, i.e., the 2’-O-methyl modified nucleotide on the sense strand base pairs with a 2’-F modified nucleotide on the antisense strand and vice versa.
  • the 1 position of the sense strand may start with the 2’-F modification, and the 1 position of the antisense strand may start with the 2’- O-methyl modification.
  • the introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand interrupts the initial modification pattern present in the sense strand and/or antisense strand. This interruption of the modification pattern of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense strand surprisingly enhances the gene silencing activity to the target gene.
  • the RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage.
  • the phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both strands in any position of the strand.
  • the internucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand and/or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern.
  • alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.
  • a double-stranded RNAi agent comprises 6-8phosphorothioate internucleotide linkages.
  • the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5’-terminus or the 3’-terminus.
  • the RNAi comprises a phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region.
  • the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.
  • Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
  • terminal three nucleotides there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide.
  • These terminal three nucleotides may be at the 3’-end of the antisense strand, the 3’-end of the sense strand, the 5’-end of the antisense strand, and/or the 5’end of the antisense strand.
  • the 2 nucleotide overhang is at the 3’-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide.
  • the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and at the 5’-end of the antisense strand.
  • the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof.
  • the mistmatch may occur in the overhang region or the duplex region.
  • the base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
  • A:U is preferred over G:C
  • G:U is preferred over G:C
  • the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex.
  • the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT.
  • at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.
  • the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.
  • the nucleotide at the 3’-end of the sense strand is deoxy-thymine (dT).
  • the nucleotide at the 3’-end of the antisense strand is deoxy-thymine (dT).
  • dT deoxy-thymine
  • there is a short sequence of deoxy-thymine nucleotides for example, two dT nucleotides on the 3’-end of the sense and/or antisense strand.
  • an RNAi agent of the disclosure may contain a low number of nucleotides containing a 2’-fluoro modification, e.g., 10 or fewer nucleotides with 2’-fluoro modification.
  • the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides with a 2’-fluoro modification.
  • the RNAi agent of the disclosure contains 10 nucleotides with a 2’-fluoro modification, Page 52 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 6 nucleotides with a 2’-fluoro modification in the antisense strand.
  • the RNAi agent of the disclosure contains 6 nucleotides with a 2’-fluoro modification, e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 2 nucleotides with a 2’-fluoro modification in the antisense strand.
  • an RNAi agent of the disclosure may contain an ultra-low number of nucleotides containing a 2’-fluoro modification, e.g., 2 or fewer nucleotides containing a 2’-fluoro modification.
  • the RNAi agent may contain 2, 1 of 0 nucleotides with a 2’-fluoro modification.
  • the RNAi agent may contain 2 nucleotides with a 2’-fluoro modification, e.g., 0 nucleotides with a 2-fluoro modification in the sense strand and 2 nucleotides with a 2’-fluoro modification in the antisense strand.
  • RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent.
  • the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
  • a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS).
  • RRMS ribose replacement modification subunit
  • a cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur.
  • the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
  • the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
  • the ligand may be attached to the polynucleotide via a carrier.
  • the carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.”
  • a “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid.
  • a “tethering attachment point” in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety.
  • the moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide.
  • the selected moiety is connected by an intervening tether to the cyclic carrier.
  • the cyclic carrier will often include a Page 53 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
  • A1088681630WO (ALN-470-WO) functional group e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
  • RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.
  • the RNAi agents may comprise a thermally destabilizing nucleotide placed at a site opposite to the seed region of the antisense strand (i.e., at positions 2-8 of the 5’-end of the antisense strand).
  • a thermally destabilizing nucleotide may be at a position of the sense strand that pairs with a nucleotide at positions 2-8 of the 5’-end of the antisense strand.
  • a thermally destabilizing nucleotide is at position 15 from the 5’-end of the sense strand.
  • a thermally destabilizing nucleotide nucleotide bears the thermally destabilizing modification which can include abasic modification; mismatch with the opposing nucleotide in the duplex; and sugar modification such as 2’-deoxy modification or acyclic nucleotide e.g., unlocked nucleic acids (UNA) or glycerol nucleic acid (GNA).
  • NUA unlocked nucleic acids
  • GNA glycerol nucleic acid
  • the thermally destabilizing modification selected from the group consisting of: i) mismatch with the opposing nucleotide in the antisense strand; ii) abasic modification selected from the group consisting of: H, Page 54 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) halogen, OR 3 , or alkyl; and R 3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar.
  • the thermally destabilizing modification is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2’-deoxy nucleobase.
  • the thermally destabilizing O is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2’-deoxy nucleobase.
  • the thermally destabilizing O is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U
  • the a phosphorus-containing group at the 5’-end of the sense strand or antisense containing group can be 5’-end phosphate (5’-P), 5’-end phosphorothioate (5’-PS), 5’-end phosphorodithioate (5’-PS 2 ), 5’-end vinylphosphonate (5’-VP), 5’-end methylphosphonate (MePhos), or 5’-deoxy-5’-C- ).
  • the 5’-end phosphorus-containing group is 5’-end be either 5’-E-VP isomer (i.e., trans- isomer (i.e., cis-vinylphosphonate, mixtures thereof.
  • the RNAi agent comprises a phosphorus-containing group at the 5’-end of the sense strand. In certain embodiments, the RNAi agent comprises a phosphorus-containing group at the 5’-end of the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-P. In certain embodiments, the RNAi agent comprises a 5’-P in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-PS. In certain embodiments, the RNAi agent comprises a 5’-PS in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-VP. In certain embodiments, the RNAi agent comprises a 5’-VP in the antisense strand.
  • the RNAi agent comprises a 5’- Page 55 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) E-VP in the antisense strand.
  • the RNAi agent comprises a 5’-Z-VP in the antisense strand.
  • the RNAi agent comprises a 5’-PS 2 .
  • the RNAi agent comprises a 5’-PS 2 in the antisense strand.
  • the RNAi agent comprises a 5’-PS 2 .
  • RNAi agent comprises a 5’-deoxy-5’-C-malonyl in the antisense strand.
  • an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an asialoglycoprotein receptor (ASGPR) ligand, and (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 17, 19, and 21, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, 14 to 16, 18, and 20 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 9, 11 to 13, 15, 17, 19, 21, and 23, and 2’F modifications at positions 2, 4, 6 to 8, 10, 14, 16, 18, 20, and 22 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide
  • an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 15, 17, 19, and 21, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5’ end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2’F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between
  • an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, 2’-F modifications at positions 7 and 9, and a deoxy-nucleotide (e.g.
  • an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, 10, 12, 14, and 16 to 21, and 2’-F modifications at positions 7, 9, 11, 13, and 15; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 5, 7, 9, 11, 13, 15, 17, 19, and 21 to 23, and 2’-F modifications at positions 2 to 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleo
  • an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 9, and 12 to 21, and 2’-F modifications at positions 10, and 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2’-F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between
  • a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, and 13, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, and 14 to 21; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5 to 7, 9, 11 to 13, 15, 17 to 19, and 21 to 23, and Page 57 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 2’-F modifications at positions 2, 4, 8, 10, 14, 16, and 20 (
  • a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii)an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7 and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 8, 10 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nu
  • a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7 and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nu
  • a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 19 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2’-F modifications at positions 5 and 7 to 9; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 21 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 21, and 2’-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between Page 58 of 346 WBD (US) 4891-2192-1712v1 WBD
  • a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 8 and 12 to 21, and 2’-F modifications at positions 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 4, 6, 8 to 11, 13, 15 to 23, and a 2’-F modification at position 14, and 2’-deoxy-modified nucleotides at positions 2, 5, 7, and 12 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2,
  • a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7 and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 14, and 16 (counting from the 5’ end) (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide
  • the sense strand of the RNAi agent has 2’-F modifications at positions 7 and 9 to 11 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’- F modifications at positions 9 to 11 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 7 to 9 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 5 and 7 to 9 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 9, 11, and 13 (counting from the 5’ end).
  • the sense strand of the RNAi agent has 2’-F modifications at positions 9, 11, and 12 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 1, 2, 6, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5’ end).
  • the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 6, 12, 14, 16, 18, and 19 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 3, 5, 10, 12, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 12, 14 and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 12, 14, and 16 (counting from the 5’ end).
  • the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 6, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has a 2’-F modification at only position 14 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-deoxy-modified nucleotides at positions 2, 5, 7, and 12 (counting from the 5’ end).
  • the antisense strand of the RNAi agent has a 2’-deoxy-modified nucleotide only at position 5 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has a GNA modified nucleotide at position 7 (counting from the 5’ end). In some embodiments, the RNAi agent only has 2’-OMe modifications and 2’-F modifications. Page 60 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In some embodiments, an ASGPR ligand is attached to the 3’-end of the sense strand.
  • an ASGPR ligand is attached to the 5’-end of the sense strand.
  • the ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker.
  • the iRNA for use in the methods of the disclosure is an agent selected from agents listed in Tables 2-7 or 15-16.
  • the agent is AD-2217254, AD-2217251, AD-2217248, AD-2217250, AD-2217245, AD-2217252, AD-2217253, AD-2217246, AD-2217262, AD- 2217258, AD-2217255, AD-2217257, or AD-2123142. These agents may further comprise a ligand. IV.
  • RNA of an iRNA of the disclosure involves chemically linking to the RNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA.
  • moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem.
  • a thioether e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl.
  • Acids Res., 20:533-538 an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl.
  • a phospholipid e.g., di-hexadecyl-rac-glycerol
  • Acids Res., 18:3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta,1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp.
  • a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated.
  • a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.
  • Preferred ligands will not take part in duplex pairing in a duplexed nucleic acid.
  • Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or a lipid.
  • the ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.
  • polyamino acids examples include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L- Page 61 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine.
  • PLL polylysine
  • poly L-aspartic acid poly L- Page 61 of 346 WBD (US) 4891-2192-1712v1 WBD Docket
  • polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
  • Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type.
  • a targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
  • Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell.
  • Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.
  • the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF- ⁇ B.
  • a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator).
  • PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc.
  • Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc.
  • Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present disclosure as ligands (e.g.
  • Ligand-conjugated oligonucleotides of the disclosure may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below).
  • This reactive oligonucleotide may be reacted Page 62 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
  • the oligonucleotides used in the conjugates of the present disclosure may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed.
  • the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.
  • the oligonucleotides or linked nucleosides of the present disclosure are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
  • an iRNA oligonucleotide further comprises a carbohydrate.
  • the carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein.
  • “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
  • Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums.
  • Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
  • a carbohydrate conjugate for use in the compositions and methods of the disclosure is selected from the group consisting of: H O OH O H H N N I; Page 64 of 346 WBD (US) 4891-2192-1712v1 HO OH O H HO O N Page 65 of 346 WBD (US) 4891-2192-1712v1 HO OH O O O O Page 66 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Page 67 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) ; Page 68 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (US) 4891-2192-1712v1 WBD Docket No.: A
  • the monosaccharide is an N-acetylgalactosamine, such as Page 71 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) H O OH O H H O N N O Formula I. for use in the embodiments described herein includes, H O OH O O H O O O N Y when one of X or Y is an oligonucleotide, the other is a hydrogen.
  • the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a monovalent linker.
  • the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a bivalent linker. In yet other embodiments of the disclosure, the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a trivalent linker. In one embodiment, the double stranded RNAi agents of the disclosure comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 3’ or 5’end of the sense strand of a dsRNA agent as described herein.
  • the double stranded RNAi agents of the disclosure comprise a plurality (e.g., 2, 3, 4, 5, or 6) of GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
  • each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
  • the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.
  • additional carbohydrate conjugates (and linkers) suitable for use in the present disclosure include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.
  • the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
  • linker or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.
  • Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO 2 , SO 2 NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alky
  • the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8- 16 atoms.
  • a cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together.
  • the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the Page 73 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
  • a first reference condition which can, e.g., be selected to mimic or represent intracellular conditions
  • A1088681630WO ALN-470-WO
  • Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
  • redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g.,
  • a cleavable linkage group such as a disulfide bond can be susceptible to pH.
  • the pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0.
  • Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
  • a linker can include a cleavable linking group that is cleavable by a particular enzyme.
  • cleavable linking group incorporated into a linker can depend on the cell to be targeted.
  • a liver- targeting ligand can be linked to a cationic lipid through a linker that includes an ester group.
  • Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich.
  • Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.
  • Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
  • the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • a degradative agent or condition
  • the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • the evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals.
  • useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
  • Peptide-based cleaving groups comprises a peptide-based cleavable linking group.
  • a peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells.
  • Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides.
  • Peptide-based cleavable groups do not include the amide group (-C(O)NH-).
  • the amide group can be formed between any alkylene, alkenylene or alkynelene.
  • a peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins.
  • the peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group.
  • Peptide- based cleavable linking groups have the general formula – NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
  • an iRNA of the disclosure is conjugated to a carbohydrate through a linker.
  • Non- limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the disclosure include, but are not limited to, Page 75 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) H O OH O O H O HO O AcHN N N H O X O Page 76 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) H O OH O O H O HO N N O X O Y Y one or an a
  • a ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.
  • iRNA compounds that are chimeric compounds. “Chimeric” iRNA compounds or “chimeras,” in the context of this disclosure, are iRNA compounds, preferably dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound.
  • iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression.
  • RNA of an iRNA can be modified by a non-ligand group.
  • non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature.
  • Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S- tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl.
  • Acids Res., 1990, 18:3777 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923).
  • RNA conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate. V.
  • an iRNA of the Disclosure Delivery of an iRNA of the Disclosure
  • a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a disorder of lipid metabolism)
  • delivery may be performed by contacting a cell with an iRNA of the disclosure either in vitro or in vivo.
  • In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject.
  • in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA.
  • any method of delivering a nucleic acid molecule can be adapted for use with an iRNA of the disclosure (see e.g., Akhtar S. and Julian RL., (1992) Trends Cell. Biol.2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties).
  • factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue.
  • the non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation.
  • Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the iRNA molecule to be administered.
  • Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ.
  • mice were both shown to prevent neovascularization in an experimental model of age-related macular degeneration.
  • direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther.11:267-274) and can prolong survival of tumor-bearing mice (Kim, WJ. et al., (2006) Mol. Ther.14:343-350; Li, S. et al., (2007) Mol. Ther.15:515- 523).
  • the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects.
  • iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J.
  • the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system.
  • drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system.
  • Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell.
  • Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH. et al., (2008) Journal of Controlled Release 129(2):107-116) that encases an iRNA.
  • the formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically.
  • Methods for making and administering cationic- iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR. et al. (2003) J.
  • an iRNA forms a complex with cyclodextrin for systemic administration.
  • Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7, 427, 605, which is herein incorporated by reference in its entirety. A.
  • Vector encoded iRNAs of the Disclosure iRNA targeting the GRB14 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type.
  • transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non- integrating vector.
  • the transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292).
  • the individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell.
  • each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid.
  • a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
  • iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources.
  • Such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment.
  • Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration Page 80 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
  • Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
  • pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
  • the constructs can include viral sequences for transfection, if desired.
  • the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors.
  • Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are known in the art. VI.
  • compositions of the Disclosure also includes pharmaceutical compositions and formulations which include the iRNAs of the disclosure.
  • a pharmaceutical composition comprising a double stranded ribonucleic acid (dsRNA) agent that inhibits expression of growth factor receptor bound protein 14 (GRB14) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1 or 3, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2 or 4; and a pharmaceutically acceptable carrier.
  • dsRNA double stranded ribonucleic acid
  • GRB14 growth factor receptor bound protein 14
  • the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 1 or 3, and said antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 2 or 4.
  • compositions comprising a dsRNA agent that inhibits expression of growth factor receptor bound protein 14 (GRB14) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16; and a pharmaceutically acceptable carrier.
  • GRB14 growth factor receptor bound protein 14
  • the dsRNA agent comprises a sense strand and an antisense strand, Page 81 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16.
  • the pharmaceutical compositions containing the iRNA of the disclosure are useful for treating a disease or disorder associated with the expression or activity of a GRB14 gene, e.g., diabetes. Such pharmaceutical compositions are formulated based on the mode of delivery.
  • compositions that are formulated for systemic administration via parenteral delivery e.g., by intravenous (IV), intramuscular (IM) or for subcutaneous delivery.
  • compositions that are formulated for direct delivery into the liver e.g., by infusion into the liver, such as by continuous pump infusion.
  • the pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of a GRB14 gene.
  • a suitable dose of an iRNA of the disclosure will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day.
  • a suitable dose of an iRNA of the disclosure will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg.
  • a repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every other day to once a year.
  • the iRNA is administered about once per week, once every 7-10 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once per month, once every 2 months, once every 3 months (once per quarter), once every 4 months, once every 5 months, or once every 6 months.
  • the treatments can be administered on a less frequent basis.
  • certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
  • treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments.
  • Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the disclosure can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
  • Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a GRB14-associated disease, disorder, or condition that would benefit from reduction in the expression of GRB14, including type 2 diabetes, obesity, and obesity-associated disorders.
  • Such models can be used for in vivo testing of RNAi agents, as well as for determining a therapeutically effective dose.
  • Suitable rodent models are known in the art and include, for example, those described in, for example, Lutz and Woods (2012) Curr. Protoc. Pharmacol. Chapter: Unit 5.61; Barrett, et al., (2016) Disease Models and Page 82 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Mechanisms, 9:1245-55; and Xie et al. (2014) PLoS ONE 9(9): e108559 (streptozotocin-induced diabetic mice). Many experimental type 2 diabetes animal models have been established from spontaneous or experimental mutants.
  • Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose.
  • Additional mouse models that may be relevant to GRB14 research are known in the art and include, for example, mice and rats fed a high fat diet (HFD; also referred to as a Western diet), a methionine-choline deficient (MCD) diet, or a high ⁇ fat (15%), high ⁇ cholesterol (1%) diet (HFHC), an obese (ob/ob) mouse containing a mutation in the obese (ob) gene (Wiegman et al., (2003) Diabetes, 52:1081-1089); a mouse containing homozygous knock-out of an LDL receptor (LDLR -/- mouse; Ishibashi et al., (1993) J Clin Invest 92(2):883-893); diet-induced artherosclerosis mouse model (Ishida et al., (1991) J.
  • HFD high fat diet
  • MCD methionine-
  • compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
  • Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral.
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
  • the iRNA can be delivered in a manner to target a particular cell or tissue, such as the liver (e.g., the hepatocytes of the liver).
  • the pharmaceutical compositions of the disclosure are suitable for intramuscular administration to a subject. In other embodiments, the pharmaceutical compositions of the disclosure are suitable for intravenous administration to a subject. In some embodiments of the disclosure, the pharmaceutical compositions of the disclosure are suitable for subcutaneous administration to a subject, e.g., using a 29g or 30g needle.
  • the pharmaceutical compositions of the disclosure may include an RNAi agent of the disclosure in an unbuffered solution, such as saline or water, or in a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the pharmaceutical compositions of the disclosure comprise an RNAi agent of the disclosure in phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • Suitable concentrations of PBS include, for example, 1mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, 5 mM, 6.5 mM, 7 mM, 7.5.mM, 9 mM, 8.5 mM, 9 mM, 9.5 mM, or about 10 mM PBS.
  • a pharmaceutical composition of the disclosure comprises an RNAi agent of the disclosure dissolved in a solution of about 5 mM PBS (e.g., 0.64 mM NaH 2 PO 4 , 4.36 mM Na 2 HPO 4 , 85 mM NaCl).
  • the pH of the pharmaceutical compositions of the disclosure may be between about 5.0 to about 8.0, about 5.5 to about 8.0, about 6.0 to about 8.0, about 6.5 to about 8.0, about 7.0 to about 8.0, about 5.0 to about 7.5, about 5.5 to about 7.5, about 6.0 to about 7.5, about 6.5 to about 7.5, about 5.0 to about 7.2, about 5.25 to about 7.2, about 5.5 to about 7.2, about 5.75 to about 7.2, about 6.0 to about 7.2, about 6.5 to about 7.2, or about 6.8 to about 7.2.
  • the osmolality of the pharmaceutical compositions of the disclosure may be suitable for subcutaneous administration, such as no more than about 400 mOsm/kg, e.g., between 50 and 400 mOsm/kg, between 75 and 400 mOsm/kg, between 100 and 400 mOsm/kg, between 125 and 400 mOsm/kg, between 150 and 400 mOsm/kg, between 175 and 400 mOsm/kg, between 200 and 400 mOsm/kg, between 250 and 400 mOsm/kg, between 300 and 400 mOsm/kg, between 50 and 375 mOsm/kg, between 75 and 375 mOsm/kg, between 100 and 375 mOsm/kg, between 125 and 375 mOsm/kg, between 150 and 375 mOsm/kg, between 175 and 375 mOsm
  • compositions of the disclosure comprising the RNAi agents of the disclosure, may be present in a vial that contains about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or about 2.0 mL of the pharmaceutical composition.
  • the concentration of the RNAi agents in the pharmaceutical compositions of the disclosure may be about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 130, 125, 130, 135, 140, 145, 150, 175, 180, 185, 190, 195, 200, 205, 210, 215, 230, 225, 230, 235, 240, 245, 250, 275, 280, 285, 290, 295, 300, 305, 310, 315, 330, 325, 330, 335, 340, 345, 350, 375, 380, 385, 390, 395, 400, 405, 410, 415, 430, 425, 430, 435, 440, 445, 450, 475, 480, 485, 490, 495, or about 500 mg/mL.
  • the concentration of the RNAi agents in the pharmaceutical compositions of the disclosure is about 100 mg/mL. Values intermediate to the above recited ranges and values are also intended to be part of this disclosure.
  • the pharmaceutical compositions of the disclosure may comprise a dsRNA agent of the disclosure in a free acid form. In other embodiments of the disclosure, the pharmaceutical compositions of the disclosure may comprise a dsRNA agent of the disclosure in a salt form, such as a sodium salt form. In certain embodiments, when the dsRNA agents of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and/or phosphorothioate groups present in the agent.
  • Agents in which substantially all of the phosphodiester and/or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and/or phosphorothioate linkages without a sodium counterion.
  • sodium ions are present in the agent as counterions for all of the phosphodiester and/or phosphorothioate groups present in the agent.
  • Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets.
  • oral formulations are those in which dsRNAs featured in the disclosure are administered in conjunction with one or more penetration enhancer surfactants and chelators.
  • Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
  • Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate.
  • DCA chenodeoxycholic acid
  • UDCA ursodeoxychenodeoxycholic acid
  • cholic acid dehydrocholic acid
  • deoxycholic acid deoxycholic acid
  • glucholic acid glycholic acid
  • glycodeoxycholic acid taurocholic acid
  • taurodeoxycholic acid sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate.
  • Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium).
  • arachidonic acid arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, gly
  • combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts.
  • One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA.
  • Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
  • DsRNAs featured in the disclosure can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles.
  • DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE- derivatized polyimines, pollulans, celluloses and starches.
  • Suitable complexing agents include chitosan, N- trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG).
  • TDAE polythiodiethylamino
  • compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations.
  • compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self- emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma.
  • the pharmaceutical formulations of the present disclosure which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • compositions of the present disclosure can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous or Page 86 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) mixed media.
  • Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension can also contain stabilizers.
  • liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art.
  • Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C 1215G , that contains a PEG moiety.
  • Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives.
  • Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S.
  • Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0445131 B1 and WO 90/04384 to Fisher.
  • Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No.5,213,804 and European Patent No. EP 0496 813 B1).
  • Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat.
  • Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p.245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.335;
  • Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other.
  • emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety.
  • w/o water-in-oil
  • o/w oil-in-water
  • an oily phase when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion.
  • Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either aqueous phase, oily phase or itself as a separate phase.
  • Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed.
  • compositions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water- in-oil-in-water (w/o/w) emulsions.
  • Such complex formulations often provide certain advantages that simple binary emulsions do not.
  • Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
  • a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.
  • Emulsions are characterized by little or no thermodynamic stability.
  • the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation.
  • Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams.
  • Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion.
  • Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199).
  • Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p.199).
  • Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
  • the ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations.
  • HLB hydrophile/lipophile balance
  • Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, Page 88 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) anionic, cationic and amphoteric (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.285).
  • Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
  • Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations.
  • polar inorganic solids such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
  • non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions.
  • Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
  • polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
  • cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
  • synthetic polymers for example, carbomers, cellulose ethers, and
  • emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives.
  • preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid.
  • Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
  • Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
  • antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • a microemulsion can be a system of water, oil and amphiphile which is a Page 89 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.245).
  • microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte.
  • microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p.271).
  • Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants.
  • ionic surfactants non-ionic surfactants
  • Brij 96 polyoxyethylene oleyl ethers
  • polyglycerol fatty acid esters tetraglycerol monolaurate (ML310),
  • the cosurfactant usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
  • Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art.
  • the aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
  • the oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
  • Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S.
  • Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Patent Nos.6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature.
  • Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present disclosure will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids. Microemulsions of the present disclosure can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present disclosure.
  • sorbitan monostearate sorbitan monostearate
  • Labrasol Labrasol
  • penetration enhancers penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present disclosure.
  • RNAi agent of the disclosure may be incorporated into a particle, e.g., a microparticle.
  • Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.
  • the present disclosure employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals.
  • nucleic acids particularly iRNAs
  • Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non- lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
  • Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Page 91 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Therapeutic Drug Carrier Systems, 1991, p.92).
  • A1088681630WO AN-470-WO
  • Surfactants are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced.
  • these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene- 9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M.
  • fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C 1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., To,
  • bile salts includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
  • Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M.
  • POE polyoxyethylene-9-lauryl ether
  • Chelating agents can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present disclosure, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339).
  • Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A.
  • EDTA disodium ethylenediaminetetraacetate
  • citric acid e.g., citric acid
  • salicylates e.g., sodium salicylate, 5-methoxysalicylate and homovanilate
  • N-acyl derivatives of collagen e.g., laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A.
  • non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33).
  • This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621- 626).
  • Agents that enhance uptake of iRNAs at the cellular level can also be added to the pharmaceutical and other compositions of the present disclosure.
  • cationic lipids such as lipofectin (Junichi et al, U.S.
  • transfection reagents examples include, for example LipofectamineTM (Invitrogen; Carlsbad, CA), Lipofectamine 2000TM (Invitrogen; Carlsbad, CA), 293fectinTM (Invitrogen; Carlsbad, CA), CellfectinTM (Invitrogen; Carlsbad, CA), DMRIE-CTM (Invitrogen; Carlsbad, CA), FreeStyleTM MAX (Invitrogen; Carlsbad, CA), LipofectamineTM 2000 CD (Invitrogen; Carlsbad, CA), LipofectamineTM (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), OligofectamineTM (Invitrogen; Carlsbad, CA), OptifectTM (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOT
  • compositions of the present disclosure also incorporate carrier compounds in the formulation.
  • carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
  • a nucleic acid and a carrier compound can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
  • the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4’isothiocyano- stilbene-2,2’-disulfonic acid (Miyao et al., DsRNA Res.
  • a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
  • the excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
  • Typical pharmaceutical carriers Page 94 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lau
  • compositions of the present disclosure can also be used to formulate the compositions of the present disclosure.
  • suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
  • the solutions can also contain buffers, diluents and other suitable additives.
  • Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. vii.
  • Other Components The compositions of the present disclosure can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
  • compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • such materials when added, should not unduly interfere with the biological activities of the components of the compositions of the present disclosure.
  • the formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
  • auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
  • Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension can also contain stabilizers.
  • compositions featured in the disclosure include (a) one or more RNAi agents and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating a GRB14-associated disorder, e.g., type 1 diabetes, type 2 diabetes, prediabetes, insulin resistance, or diabetes-related conditions such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc.
  • a GRB14-associated disorder e.g., type 1 diabetes, type 2 diabetes, prediabetes, insulin resistance, or diabetes-related conditions such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc.
  • agents include, but are not limited to, insulin (e.g., insulin detemir (Levemir), insulin glargine (Lantus)), Metformin (Glucophage), sulfonylureas, thiazolidinediones, dipeptidyl peptidase-4 inhibitors, SGLT2 inhibitors, glucagon-like peptide-1 analogs, angiotensin converting enzyme inhibitors (ACEIs), angiotensin receptor blockers (ARBs), Aliskiren (Tekturna, Rasilez), corticosteroids, protease inhibitors, orlistat (Alli, Xenical), phentermine and topiramate (Qsymia), bupropion and naltrexone (Contrave), liraglutide (Saxenda, Victoza), agents that decrease or otherwise affect the GRB14 activity, or agents that independently contribute to amelioration of symptoms and improvement of patients having a GRB14- associated disorder.
  • insulin
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
  • Compounds that exhibit high therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of compositions featured herein in the disclosure lies generally within a range of circulating concentrations that include the ED 50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC 50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • IC 50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
  • levels in plasma can be measured, for example, by high performance liquid chromatography.
  • the iRNAs featured in the disclosure can be administered in combination with other known agents effective in treatment of pathological processes mediated by GRB14 expression.
  • the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.
  • the methods featured in the disclosure may utilize protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS, Green, T.W.
  • protecting groups within the context of this disclosure are any group that reduces or eliminates unwanted reactivity of a functional group.
  • a protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group.
  • an “alcohol protecting group” is used.
  • An “alcohol protecting group” is any group which decreases or eliminates unwanted reactivity of an alcohol functional group.
  • Protecting groups can be added and removed using techniques well known in the art. VII.
  • the present disclosure also provides methods of using an iRNA of the disclosure and/or a composition of the disclosure to reduce and/or inhibit GRB14 expression in a cell, such as a cell in a subject, e.g., a hepatocyte.
  • the methods include contacting the cell with an RNAi agent or pharmaceutical composition comprising an iRNA agent of the disclosure.
  • the cell is maintained for a time sufficient to obtain degradation of the mRNA transcript of a GRB14 gene. Reduction in gene expression can be assessed by any methods known in the art.
  • a reduction in the expression of GRB14 may be determined by determining the mRNA expression level of GRB14 using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR; by determining the protein level of GRB14 using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques.
  • a reduction in the expression of GRB14 may also be assessed indirectly by measuring a decrease in biological activity of GRB14, e.g., a decrease in the enzymatic activity of GRB14 and/or a change in one or more associated markers of GRB14 activity (e.g., insulin receptor levels, glucose levels, HbA1c levels, etc.).
  • the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject.
  • a cell suitable for treatment using the methods of the disclosure may be any cell that expresses a GRB14 gene.
  • a cell suitable for use in the methods of the disclosure may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non- primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g.
  • the cell is a human cell, e.g., a human liver cell.
  • Page 97 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) GRB14 expression is inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92,
  • the in vivo methods of the disclosure may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the GRB14 gene of the mammal to be treated.
  • the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.
  • intracranial e.g., intraventricular, intraparenchymal and intrathecal
  • intravenous intramuscular
  • subcutaneous e.g., transdermal
  • airway aerosol
  • nasal rectal
  • topical including buccal and sublingual
  • the compositions are administered by intravenous infusion or injection.
  • the compositions are administered by subcutaneous injection.
  • the administration is via a depot injection.
  • a depot injection may release the iRNA in a consistent way over a prolonged time period.
  • a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of GRB14, or a therapeutic or prophylactic effect.
  • a depot injection may also provide more consistent serum concentrations.
  • Depot injections may include subcutaneous injections or intramuscular injections.
  • the depot injection is a subcutaneous injection.
  • the administration is via a pump.
  • the pump may be an external pump or a surgically implanted pump.
  • the pump is a subcutaneously implanted osmotic pump.
  • the pump is an infusion pump.
  • An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions.
  • the infusion pump is a subcutaneous infusion pump.
  • the pump is a surgically implanted pump that delivers the iRNA to the liver.
  • An iRNA of the disclosure may be present in a pharmaceutical composition, such as in a suitable buffer solution.
  • the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject.
  • an iRNA of the disclosure may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.
  • the mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated.
  • the route and site of administration may be chosen to enhance targeting.
  • the present disclosure also provides methods for inhibiting the expression of a GRB14 gene in a mammal.
  • the methods include administering to the mammal a composition comprising a dsRNA that targets a GRB14 gene in a cell of the mammal, thereby inhibiting expression of the GRB14 gene in the cell.
  • the methods include administering to the mammal a composition comprising a dsRNA that targets a GRB14 gene in a cell of the mammal, thereby inhibiting expression of the GRB14 gene in the cell.
  • the present disclosure provides use of an iRNA agent or a pharmaceutical composition of the disclosure for inhibiting the expression of a GRB14 gene in a mammal.
  • the present disclosure provides use of an iRNA agent of the disclosure targeting a GRB14 gene or a pharmaceutical composition comprising such an agent in the manufacture of a medicament for inhibiting expression of a GRB14 gene in a mammal. Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g.
  • the present disclosure also provides therapeutic and prophylactic methods which include administering to a subject having, or prone to developing a fatty liver-associated disease, disorder, or condition, the iRNA agents, pharmaceutical compositions comprising an iRNA agent, or vectors comprising an iRNA of the disclosure.
  • the present disclosure provides methods of treating a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., a GRB14-associated disease.
  • the treatment methods (and uses) of the disclosure include administering to the subject, e.g., a human, a therapeutically effective amount of a dsRNA agent that inhibits expression of GRB14 or a pharmaceutical composition comprising a dsRNA that inhibits expression of GRB14, thereby treating the subject.
  • the disclosure provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., diabetes.
  • the methods include administering to the subject a prophylactically effective amount of dsRNA agent or a pharmaceutical composition comprising a dsRNA, thereby preventing at least one symptom in the subject.
  • the at least one symptom is a symptom of a GRB14-associated disease.
  • the present disclosure also provides use of a therapeutically effective amount of an iRNA agent of the disclosure or a pharmaceutical composition comprising a dsRNA that inhibits expression of GRB14 for Page 99 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of GRB14 expression, e.g., a GRB14-associated disease, e.g., diabetes.
  • the present disclosure provides use of an iRNA agent, e.g., a dsRNA, of the disclosure targeting a GRB14 for gene or a pharmaceutical composition comprising an iRNA agent targeting a GRB14 for gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of GRB14 for expression, e.g., a GRB14-associated disease.
  • an iRNA agent e.g., a dsRNA
  • a pharmaceutical composition comprising an iRNA agent targeting a GRB14 for gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of GRB14 for expression, e.g., a GRB14-associated disease.
  • the present disclosure also provides use of a prophylactically effective amount of an iRNA agent of the disclosure or a pharmaceutical composition comprising a dsRNA that inhibits expression of GRB14 for preventing at least one symptom in a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., diabetes.
  • an iRNA agent e.g., a dsRNA
  • the present disclosure provides use of an iRNA agent, e.g., a dsRNA, of the disclosure targeting a GRB14 gene or a pharmaceutical composition comprising an iRNA agent targeting a GRB14 gene in the manufacture of a medicament for preventing at least one symptom in a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., diabetes.
  • the present disclosure provides methods of treating a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., a GRB14-associated disease, such as diabetes.
  • a GRB14-associated disease such as diabetes.
  • the GRB14-associated disease is type 2 diabetes.
  • the GRB14-associated disease is type 1 diabetes.
  • the GRB14-associated disease is prediabetes.
  • the GRB14-associated disease is insulin resistance.
  • the GRB14-associated disease is a diabetes-related condition such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc.
  • the subject is homozygous for the GRB14 gene.
  • Each allele of the gene may encode a functional GRB14 protein.
  • the subject is heterozygous for the GRB14 gene.
  • the subject may have an allele encoding a functional GRB14 protein and an allele encoding a loss of function variant of GRB14.
  • the subject has an allele encoding the rs3923113 variant.
  • the subject has an allele encoding the rs10195252 variant.
  • the subject has a GIGYF1 loss of function allele.
  • the subject has a GIGYF1 rs221797 variant (e.g., rs221797:A). In some embodiments, the subject has a GIGYF1 rs117231629 variant. In some embodiments, the subject has a GIGYF2 loss of function allele. In some embodiments, the subject has a GIGYF2 rs1801251 variant (e.g., rs1801251:A). In one embodiment, a GRB14-associated disorder is type 2 diabetes (T2D), used interchangeably with type 2 diabetes mellitus (2DM) or type II diabetes.
  • T2D type 2 diabetes
  • 2DM type 2 diabetes mellitus
  • Type 2 diabetes is a chronic multifactorial polygenic disease, influenced by multilple genes and environmental factors, characterized by impaired glucose Page 100 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) intolerance due to insulin resistance or relative insulin deficiency.
  • A1088681630WO AN-470-WO
  • ⁇ -cell mass which is mainly achieved through an increase in ⁇ -cell number.
  • insulin targets such as liver, muscle and adipose tissues become insulin-resistant and pancreatic ⁇ -cells show impaired insulin secretion.
  • Progression from normal glucose tolerance to impaired glucose tolerance to type 2 diabetes is characterized by a progressive decline in insulin secretion and plasma insulin concentration and a progressive rise in plasma glucagon concentration.
  • Type 2 diabetic patients are also characterized by hyperglucagonaemia and enhanced hepatic glucose production in response to glucagon as the suppression of glucose production is decreased.
  • Excessive glucose production and lipid accumulation are observed in the livers of obese patients with insulin resistance.
  • Excessive hepatic glucose production drives hyperglycemia.
  • Symptoms and signs of type 2 diabetes include increased thirst, frequent urination, increased hunger, fatigue, blurred vision, slow-healing sores, frequent infections, and areas of darkened skin.
  • Type 2 diabetes leads to serious complications including diabetic retinopathy, diabetic vasculopathy, diabetic neuropathy, and diabetic nephropathy. Being overweight or obese is a major modifiable risk factor for type 2 diabetes, and other risk factors include physical inactivity and family history.
  • Early stage type 2 diabetes may be controlled by dietary regimen and weight loss. In advanced stages, type 2 diabetes can be treated by medication (e.g., metformin, sulfonylureas, meglitinides) or insulin injection.
  • a GRB14-associated disorder is type 1 diabetes (T1D), also known as juvenile diabetes.
  • Type 1 diabetes is a polygenic disease that is highly heritable and ischaracterized by no production or insufficient production of insulin by the pancreas.
  • a GRB14-associated disorder is prediabetes.
  • Prediabetes may be characterized by elevated blood glucose levels that are below the threshold for type 2 diabetes, but may be an early stage of disease that progresses to type 2 diabetes. Subjects having prediabetes often have obesity (especially abdominal or visceral obesity), dyslipidemia with high triglycerides and/or low HDL cholesterol, and hypertension. Subjects with prediabetes may be at increased risk of cardiovascular disease and/or of developing type 2 diabetes.
  • a GRB14-associated disorder is insulin resistance.
  • Insulin resistance is not entirely understood, but is characterized by reduced sensitivity of insulin-targeting tissues to insulin resulting Page 101 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) in the inability of insulin to properly regulate glucose transport and blood glucose levels.
  • Insulin resistance is a component of type 2 diabetes and may be a component of prediabetes. Risk factors for insulin resistance include obesity, a sedentary lifestyle, and hereditary factors. Insulin resistance can generally be improved with lifestyle modifications, including diet and exercise.
  • an “iRNA” for use in the methods of the disclosure is a “dual targeting RNAi agent.”
  • the term “dual targeting RNAi agent” refers to a molecule comprising a first dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a first target RNA, i.e., a GRB14 gene, covalently attached to a molecule comprising a second dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a second target RNA.
  • a dual targeting RNAi agent triggers the degradation of the first and the second target RNAs, e.g., mRNAs, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.
  • the dsRNA agent may be administered to the subject at a dose of about 0.1 mg/kg to about 50 mg/kg. Typically, a suitable dose will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg.
  • the iRNA can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis.
  • Administration of the iRNA can reduce GRB14 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more.
  • administration of the iRNA can reduce GRB14 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%.
  • patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction.
  • the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF- alpha or INF-alpha) levels.
  • the iRNA can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of iRNA to a subject.
  • the injections may be Page 102 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) repeated over a period of time.
  • the administration may be repeated on a regular basis.
  • the treatments can be administered on a less frequent basis.
  • a repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every other day or to once a year.
  • the iRNA is administered about once per week, once every 7-10 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once per month, once every 2 months, once every 3 months once per quarter), once every 4 months, once every 5 months, or once every 6 months.
  • the method includes administering a composition featured herein such that expression of the target GRB14 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours.
  • expression of the target GRB14 gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer.
  • the iRNAs useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target GRB14 gene.
  • Compositions and methods for inhibiting the expression of these genes using iRNAs can be prepared and performed as described herein.
  • Administration of the dsRNA according to the methods of the disclosure may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with a disorder of lipid metabolism.
  • reduction in this context is meant a statistically significant decrease in such level.
  • the reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
  • Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention.
  • efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters.
  • efficacy of treatment of diabetes may be assessed, for example, by periodic monitoring of glucose levels or HbA1c levels. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters.
  • a disorder in connection with the administration of an iRNA or pharmaceutical composition thereof, "effective against" a disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients having the disorder, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement Page 103 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the disorder (e.g., diabetes) and the related causes.
  • a treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated.
  • a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment.
  • Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art.
  • kits for performing any of the methods of the disclosure include one or more RNAi agent(s) and instructions for use, e.g., instructions for inhibiting expression of a GRB14 in a cell by contacting the cell with an RNAi agent or pharmaceutical composition of the disclosure in an amount effective to inhibit expression of the GRB14.
  • kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of GRB14 (e.g., means for measuring the inhibition of GRB14 mRNA and/or GRB14 protein).
  • Such means for measuring the inhibition of GRB14 may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample.
  • the kits of the disclosure may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount.
  • nucleic acid sequences provided herein are represented using standard nomenclature. See the abbreviations of Table 1. Table 1. Abbreviations of nucleotide monomers used in nucleic acid sequence representation It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5’-3’-phosphodiester bonds.
  • GRB14 human growth factor receptor bound protein 14
  • NCBI GeneID NCBI GeneID: 2888
  • All the GRB14 siRNA designs have a perfect match to the human GRB14 transcript (transcript variant 1).
  • the human NM_004490 REFSEQ mRNA, version 3 has a length of 2,415 bases.
  • siRNA Synthesis siRNAs were synthesized and annealed using routine methods known in the art.
  • Custom CPG universal solid support was used for the synthesis of antisense single strands. Coupling time for all phosphoramidites (100 mM in acetonitrile) was 5 min employing 5-Ethylthio-1H-tetrazole (ETT) as activator (0.6 M in acetonitrile). Phosphorothioate linkages were generated using a 50 mM solution of 3-((Dimethylamino-methylidene) amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, MA, USA)) in anhydrous acetonitrile/pyridine (1:1 v/v). Oxidation time was 3 minutes.
  • DDTT 3-((Dimethylamino-methylidene) amino)-3H-1,2,4-dithiazole-3-thione
  • oligoribonucleotides were cleaved from the solid support and deprotected in sealed 96 deep well plates using 200 ⁇ L Aqueous Methylamine reagents at 60°C for 20 minutes.
  • a second step deprotection was performed using TEA.3HF (triethylamine trihydro fluoride) reagent.
  • DMSO dimethyl sulfoxide
  • 300ul TEA.3HF reagent was added to the methylamine deprotection solution and the solution was incubated for additional 20min at 60°C.
  • the synthesis plate was allowed to come to room temperature and was precipitated by addition of 1mL of acetontile: ethanol mixture (9:1). The plates were cooled at -80 C for 2 hrs, supernatant decanted carefully with the aid of a multi-channel pipette.
  • the oligonucleotide pellet was re-suspended in 20mM NaOAc buffer and were desalted using a 5 mL HiTrap size exclusion column (GE Healthcare) on an AKTA Purifier System equipped with an A905 autosampler and a Frac 950 fraction collector. Desalted samples were collected in 96-well plates. Samples from each sequence were analyzed by LC-MS to confirm the identity, UV (260 nm) for quantification and a selected set of samples by IEX chromatography to determine purity. Annealing of single strands was performed on a Tecan liquid handling robot. Equimolar mixture of sense and antisense single strands were combined and annealed in 96 well plates.
  • a duplex name without a decimal is equivalent to a duplex name with a decimal, which merely references the batch number of the duplex.
  • AD- 2217262 is equivalent to AD-2217262.1. Table 2.
  • Free uptake assays were performed to assess the pharmacodynamic properties of the siRNAs. Free uptake assay was performed similarly to the transfection assay without using Lipofectamine RNAimax and cells were incubated for 48 hours prior to the RNA purification. Experiments were performed essentially as described in Agarwal S., Nucleic Acid. Ther. (2021) 31(4):309-315. Dose response experiments were performed at various final duplex concentrations.
  • RNA isolation using DYNABEADS mRNA Isolation Kit RNA is isolated using an automated protocol on a BioTek-EL406 platform using DYNABEADs (Invitrogen, cat#61012). Briefly, 70ul of Lysis/Binding Buffer and 10ul of lysis buffer containing 3 ⁇ l of magnetic beads are added to the plate with cells. Plates were incubated on an electromagnetic shaker for 10 minutes at room temperature and then magnetic beads are captured and the supernatant is removed. Bead- bound RNA is then washed 2 times with 150ul Wash Buffer A and once with Wash Buffer B. Beads are then washed with 150 ⁇ l Elution Buffer, re-captured and supernatant removed.
  • cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813): Ten ⁇ l of a master mix containing 1 ⁇ l 10X Buffer, 0.4 ⁇ l 25X dNTPs, 1 ⁇ l 10x Random primers, 0.5 ⁇ l Reverse Transcriptase, 0.5 ⁇ l RNase inhibitor and 6.6 ⁇ l of H 2 O per reaction are added to RNA isolated above. Plates are sealed, mixed, and incubated on an electromagnetic shaker for 10 minutes at room temperature, followed by 2h at 37 o C.
  • ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813): Ten ⁇ l of a master mix containing 1 ⁇ l 10X Buffer, 0.4 ⁇ l 25X dNTPs, 1 ⁇ l 10x Random primers, 0.5 ⁇ l Reverse Transcriptase, 0.5 ⁇ l RNase inhibitor and 6.6 ⁇ l of H 2 O per reaction are added to RNA isolated above. Plate
  • Real time PCR Two ⁇ l of cDNA and 5 ⁇ l Lightcycler 480 probe master mix (Roche Cat # 04887301001) are added to 0.5 ⁇ l of Human GAPDH TaqMan Probe (4326317E) and 0.5 ⁇ l GRB14 Human probe (Hs00182949_m1, Thermo), or 0.5 ⁇ l Cyno GAPDH (custom) and 0.5 ⁇ l GRB14 Cyno probe per well in a 384 well plates (Roche cat # 04887301001).
  • Real time PCR is done in a LightCycler480 Real Time PCR system (Roche). Each duplex is tested at least two times and data are normalized to cells transfected with a non-targeting control siRNA.
  • GRB14 dsRNA IC50 Analysis Free Uptake Assay in PCH and PHH Cells PCH PHH % Message % Message Page 308 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 309 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc.
  • GRB14 dsRNA IC50 Analysis Transfection of PCH and PHH Cells PCH PHH Page 314 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 315 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc.
  • FIG.1 shows the percent of GRB14 mRNA and protein remaining, respectively, relative to the PBS mean of AD-2217245 (5 mpk), AD-2217246 (5 mpk), AD-2217252 (5 mpk), AD-2217262 (5 mpk), and AD-213142 (10 mpk x3).
  • AD-2217245, AD-2217246, AD-2217252, AD-2217257, and AD-2217262 with human/cynologous cross-reactivity were further investigated for their effectiveness in non-human primates.
  • a single dose of 3 mg/kg of AD-2217245, AD-2217246, AD-2217252, AD-2217257, and AD- 2217262 was subcutanesouly administered to cynologous monkeys.
  • a single dose of 20 mg/kg of AD- 2217245 was also subcutanesouly administered to cynologous monkeys.
  • the experimental design is shown in Table 14. Sera and tissue samples were collected at Days 22 and 57.
  • FIG.2 shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 mRNA at Day 22 post-dose.
  • FIG.3 shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 protein at Day 22 and Day 57 post-dose.
  • AD-2217245 at 3 mg/kg gave a protein knockdown of 89% at Day 22 and 80% at Day 57.
  • AD-2217245 at 20 mg/kg gave a protein knockdown of 92% at Day 22 and Day 57.
  • Table 14 Experimental Design Dose Dose Volume Dose Concentration No. of Page 322 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Example 5.
  • siRNAs targeting the mouse GRB14 gene were also designed using custom R and Python scripts.
  • the mouse NM_016719.1 mRNA has a length of 1978 bases.
  • a detailed list of the additional unmodified sense and antisense strand sequences of GRB14 dsRNA agents targeting NM_016719.1 mRNA are shown in Table 15.
  • a detailed list of the additional modified sense and antisense strand sequences of GRB14 dsRNA agents targeting NM_016719.1 mRNA are shown in Table 16. Table 15.
  • Ob/Ob mice were administered 1 mg/kg of AD-1363978 (siRNA 1), AD-1364167 (siRNA 2), and AD-1364168 (siRNA 3) every 2 weeks for 2 months.
  • Page 323 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) dsRNA agents targeting mouse GRB14 were further evaluated for efficacy in vivo in high fat diet (HFD) treated mice.
  • HFD high fat diet
  • HFD mice were administered 1 mg/kg and 0.1 mg/kg of AD-1363978 (siRNA 1) and AD-1364167 (siRNA 2) every 2 weeks for 8 weeks.
  • a Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) was taken at week 8.
  • dsRNA agents targeting mouse GRB14 were further evaluated for efficacy in vivo in diet induced obese (DIO) mice.
  • DIO mice were administered 10 mg/kg of AD-1363978 (siRNA 1) and AD-1364167 (siRNA 2) every 2 weeks for 8 weeks.
  • mice Lean mice were used as a control. Glucose tolerance and insulin tolerance tests were run at week 8 and week 9, respectively, with glucose and insulin administered in proportion to body weight. The final body weight of the mice was taken at week 11. The results, shown in FIG.6A, FIG.6B, and FIG.6C, demonstrated that knockdown of GRB14 with these GalNac-sRNAs improved glycemia and insulin sensitivity without weight gain.
  • GRB14 SEQUENCES SEQ ID NO: 1 >NM_004490.3 Homo sapiens growth factor receptor bound protein 14 (GRB14), transcript variant 1, mRNA GCAGATAGCTCGGCCGCGCGTCTCAGCCGCCGGGGCCCCGAGCGCAGGCGGCGAGGCCACCACACCTGCAGAGCGCT CGGGCTGCCTAGCCGGCACCTCGCCTCCCGCCGCAAACCCCTTCTCCCCACGCGCCGAGTCTCCCATGACGCCCG AGCCCCCCGGCCGGCGACAATGACCACTTCCCTGCAAGATGGGCAGAGCGCCGCGAGCAGGGCGGCTGCCCGGGATT CGCCGCTGGCCGCCCAGGTGTGTGGCGCTGCCCAGGGGAGGGGCGACGCCCACGACCTGGCCGGCCCCCTGGCTG CACGCGCGAGCTCCTGCCCCTTCCGGACGGGACCCGCGCGTGTGCTGCAGACAGGAGAAAAAAAAGAAAGATCTTGA TGTTCCGGAAATGCCATCTATTCCAAACCCTTTTCCTGAGCTATG

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The disclosure relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the GRB14 gene, as well as methods of inhibiting expression of GRB14, and methods of treating subjects that would benefit from reduction in expression of GRB14, such as subjects having a GRB14-associated disease, disorder, or condition, such as diabetes, using such dsRNA compositions.

Description

WBD Docket No.: A1088681630WO (ALN-470-WO) iRNA COMPOSITIONS AND METHODS FOR SILENCING GROWTH FACTOR RECEPTOR BOUND PROTEIN 14 (GRB14) IN THE LIVER CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63/762,453, filed on February 24, 2025, and to U.S. Provisional Application No.63/568,529, filed on March 22, 2024. The entire contents of the foregoing applications are hereby incorporated herein by reference. SEQUENCE LISTING The instant application contains a Sequence Listing which has been filed electronically in eXtensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on March 10, 2025, is named A108868_1630WO_SL.xml and is 55, 100, 878 bytes in size. BACKGROUND OF THE DISCLOSURE Insulin acts in the liver to increase uptake of glucose, decrease gluconeogenesis, and promote glycogen synthesis. Insulin promotes synthesis of carbohydrate (e.g., glycogen), fat (e.g., fatty acid, triacylglycerol, triglycerides), and protein in the muscle and adipose tissue. Insulin resistance increases risk of developing type 2 diabetes, non-alcoholic steatohepatitis (NASH), and other comorbidities including cardiovascular disease and cancer. The prevalence of diabetes, e.g., type 2 diabetes, has progressively increased and is expected to continue increasing. The current treatment options for diabetes include lifestyle modifications, oral medications, insulin injections, and managing the associated comorbidities (e.g., hypertension, hyperlipidemia, obesity, metabolic syndrome, diabetic nephropathy, diabetic retinopathy, diabetic vasculopathy, and diabetic neuropathy), and involve long-term management. Growth factor receptor bound protein 14 (GRB14) is an adapter protein that interacts with receptor tyrosine kinases, including insulin receptor and IGF receptors. GRB14 negatively regulates signaling through insulin receptor and IGF-1 receptor and are associated with decreased insulin sensitivity. GRB14-knockout mice have been reported to have improved insulin signaling in the liver and skeletal muscle. GRB14 knockdown in the liver, white adipose tissues, and heart has been reported to improve glucose homeostasis in diet-induced obese mice. Accordingly, inhibition of GRB14 may offer therapeutic advantages for insulin resistance, pre-diabetes, and diabetes. Page 1 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) SUMMARY OF THE DISCLOSURE The present disclosure provides iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a growth factor receptor bound protein 14 (GRB14) gene. The GRB14 gene may be within a cell, e.g., a cell within a subject, such as a human. The present disclosure also provides methods of using the iRNA compositions of the disclosure for inhibiting the expression of a GRB14 gene and/or for treating a subject who would benefit from inhibiting or reducing the expression of a GRB14 gene, e.g., a subject suffering or prone to suffering from a GRB14-associated disease, for example, diabetes. Accordingly, in one aspect, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell. The dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4. In another aspect, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell. The dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding GRB14 which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding GRB14 which comprises at least 15 contiguous nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16. In various embodiments of the dsRNA agents provided herein, the dsRNA agent targets a hotspot region of an mRNA encoding GRB14. In one aspect, the present disclosure provides a dsRNA agent that targets a hotspot region of a GRB14 mRNA. In one embodiment, the dsRNA agent comprises at least one modified nucleotide. In one embodiment, substantially all of the nucleotides of the sense strand comprise a modification. In another embodiment, substantially all of the nucleotides of the antisense strand comprise a modification. In yet another embodiment, Page 2 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification. In one aspect, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell. The dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus. In one aspect, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell. The dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus. Page 3 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In one embodiment, all of the nucleotides of the sense strand comprise a modification. In another embodiment, all of the nucleotides of the antisense strand comprise a modification. In yet another embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification. In one embodiment, the at least one modified nucleotide is selected from the group consisting of a deoxy-nucleotide, a 3’-terminal deoxy-thymine (dT) nucleotide, a 2’-O-methyl modified nucleotide, a 2’- fluoro modified nucleotide, a 2’-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino- modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non- natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5’-phosphate, a nucleotide comprising a 5’-phosphate mimic, a glycol modified nucleotide, and a 2-O-(N-methylacetamide) modified nucleotide, and combinations thereof. In one embodiment, the at least one modified nucleotide is a 2’-O-methyl and/or a 2’-fluoro modification. The region of complementarity may be at least 17 nucleotides in length; 19 to 30 nucleotides in length; 19-25 nucleotides in length; or 21 to 23 nucleotides in length. Each strand may be no more than 30 nucleotides in length, e.g., each strand is independently 19-30 nucleotides in length; each strand is independently 19-25 nucleotides in length; each strand is independently 21-23 nucleotides in length. The dsRNA may include at least one strand that comprises a 3’ overhang of at least 1 nucleotide; or at least one strand that comprises a 3’ overhang of at least 2 nucleotides. In some embodiment, the dsRNA agent further comprises a ligand. In one embodiment, the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent. In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In one embodiment, the ligand is Page 4 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) HO OH O H H O N N O . the ligand as shown in the following schematic In one embodiment, the X is O. In one embodiment, the present disclosure provides a dsRNA agent wherein (a) the sense strand comprises the nucleotide sequence CAAAACUUUCGUACUGUCAAA (SEQ ID NO: 8770) and the antisense strand comprises the nucleotide sequence UUUGACAGUACGAAAGUUUUGGG (SEQ ID NO: 8784); (b) the sense strand comprises the nucleotide sequence AAGACUUGGAUUGACUUUACA (SEQ ID NO: 8771) and the antisense strand comprises the nucleotide sequence UGUAAAGUCAAUCCAAGUCUUUG (SEQ ID NO: 8785); (c) the sense strand comprises the nucleotide sequence UUGACUUUACAUUCAUCAUUA (SEQ ID NO: 8777) and the antisense strand comprises the nucleotide sequence UAAUGATGAAUGUAAAGUCAAUC (SEQ ID NO: 8791); (d) the sense strand comprises the nucleotide sequence UUAUGCCAAAUAUGAGUUCUA (SEQ ID NO: 8781) and the antisense strand comprises the nucleotide sequence UAGAACTCAUATUUGGCAUAAUU (SEQ ID NO: 8795); (e) the sense strand comprises the nucleotide sequence UGCAAGUUGAAACAUUAUUGA (SEQ ID NO: 8783) and the antisense strand comprises the nucleotide sequence Page 5 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) UCAATAAUGUUTCAACUUGCAAG (SEQ ID NO: 8797); or (f) the sense strand comprises the nucleotide sequence UAUCCUGAAAUUCAUGGUUUA (SEQ ID NO: 7595) and the antisense strand comprises the nucleotide sequence UAAACCAUGAATUUCAGGAUAUG (SEQ ID NO: 7863). In one embodiment, the present disclosure provides a dsRNA agent wherein (a) the sense strand consists of the nucleotide sequence CAAAACUUUCGUACUGUCAAA (SEQ ID NO: 8770) and the antisense strand consists of the nucleotide sequence UUUGACAGUACGAAAGUUUUGGG (SEQ ID NO: 8784); (b) the sense strand consists of the nucleotide sequence AAGACUUGGAUUGACUUUACA (SEQ ID NO: 8771) and the antisense strand consists of the nucleotide sequence UGUAAAGUCAAUCCAAGUCUUUG (SEQ ID NO: 8785); (c) the sense strand consists of the nucleotide sequence UUGACUUUACAUUCAUCAUUA (SEQ ID NO: 8777) and the antisense strand consists of the nucleotide sequence UAAUGATGAAUGUAAAGUCAAUC (SEQ ID NO: 8791); (d) the sense strand consists of the nucleotide sequence UUAUGCCAAAUAUGAGUUCUA (SEQ ID NO: 8781) and the antisense strand consists of the nucleotide sequence UAGAACTCAUATUUGGCAUAAUU (SEQ ID NO: 8795); (e) the sense strand consists of the nucleotide sequence UGCAAGUUGAAACAUUAUUGA (SEQ ID NO: 8783) and the antisense strand consists of the nucleotide sequence UCAATAAUGUUTCAACUUGCAAG (SEQ ID NO: 8797); or (f) the sense strand consists of the nucleotide sequence UAUCCUGAAAUUCAUGGUUUA (SEQ ID NO: 7595) and the antisense strand consists of the nucleotide sequence UAAACCAUGAATUUCAGGAUAUG (SEQ ID NO: 7863). In one embodiment, the present disclosure provides a dsRNA agent wherein (a) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8798 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8812; (b) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8799 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8813; (c) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8805 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8819; (d) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8809 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8823; (e) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8811 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8825; or (f) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8131 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8399. In one embodiment, the region of complementarity comprises any one of the antisense sequences in Tables 2-7 or 15-16. Page 6 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In one embodiment, the at least one modified nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2^-methoxyethyl, 2^-O-alkyl, 2^-O-allyl, 2^-C- allyl, 2^-fluoro, 2’-O-methyl, 2^-deoxy, and combinations thereof. In one embodiment, the at least one modified nucleotide is a 2^-O-methyl or a 2^-fluoro modification. In one embodiment, at least one strand of the dsRNA agent may comprise a 3’ overhang of at least 1 nucleotide; or a 3’ overhang of at least 2 nucleotides. In one embodiment, the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage. In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3’- terminus of one strand. In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5’- terminus of one strand. In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5’- and 3’-terminus of one strand. In one embodiment, the base pair at the 1 position of the 5^-end of the antisense strand of the duplex is an AU base pair. In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides. In one aspect, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of growth factor receptor bound protein 14 (GRB14) in a cell. The dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification, a 2’-fluoro modification, and a deoxy-nucleotide, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus and two Page 7 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) phosphorothioate internucleotide linkages at the 3’-terminus, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, bivalent or trivalent branched linker at the 3’-terminus. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 and 3, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 2 and 4, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’- terminus, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, bivalent or trivalent branched linker at the 3’-terminus. In one aspect, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of growth factor receptor bound protein 14 (GRB14) in a cell. The dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O- methyl modification, a 2’-fluoro modification, and a deoxy-nucleotide, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, bivalent or trivalent branched linker at the 3’-terminus. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16, and the antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand comprise a modification Page 8 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, bivalent or trivalent branched linker at the 3’-terminus. In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides. In one embodiment, the region of complementarity comprises any one of the antisense sequences listed in Tables 2-7 or 15-16. In one embodiment, the agent is selected from the group consisting of AD-2217254, AD- 2217251, AD-2217248, AD-2217250, AD-2217245, AD-2217252, AD-2217253, AD-2217246, AD-2217262, AD- 2217258, AD-2217255, AD-2217257, or AD-2123142. In one embodiment, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of the nucleotide sequences of any one of the agents listed in Tables 2-7 or 15-16. The present disclosure also provides cells, vectors, and pharmaceutical compositions which include any of the dsRNA agents of the disclosure. The dsRNA agents may be formulated in an unbuffered solution, e.g., saline or water, or in a buffered solution, e.g., a solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In one embodiment, the buffered solution is phosphate buffered saline (PBS). In one aspect, the present disclosure provides a method of inhibiting growth factor receptor bound protein 14 (GRB14) expression in a cell. The method includes introducing into the cell a dsRNA agent or a pharmaceutical composition of the disclosure, thereby inhibiting expression of GRB14 in the cell. The cell may be within a subject, such as a human subject. In one embodiment, the GRB14 expression is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or to below the level of detection of GRB14 expression. In one embodiment, the human subject suffers from a GRB14-associated disease, disorder, or condition. In one embodiment, the GRB14-associated disease, disorder, or condition is diabetes. In one embodiment the diabetes is type 2 diabetes. In another embodiment, the diabetes is type 1 diabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is prediabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is insulin resistance. In one embodiment, the GRB14- associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition. In one embodiment, the GRB14-associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic Page 9 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke. In one aspect, the present disclosure provides a method of inhibiting the expression of GRB14 in a subject. The methods include administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby inhibiting the expression of GRB14 in the subject. In one embodiment, the subject has a GRB14-associated disease, disorder, or condition. In one embodiment, the GRB14-associated disease, disorder, or condition is diabetes. In one embodiment the diabetes is type 2 diabetes. In another embodiment, the diabetes is type 1 diabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is prediabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is insulin resistance. In one embodiment, the GRB14-associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition. In one embodiment, the GRB14- associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke. In another aspect, the present disclosure provides a method of treating a subject suffering from a GRB14-associated disease, disorder, or condition. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby treating the subject suffering from a GRB14-associated disease, disorder, or condition. In one embodiment, the GRB14-associated disease, disorder, or condition is diabetes. In one embodiment the diabetes is type 2 diabetes. In another embodiment, the diabetes is type 1 diabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is prediabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is insulin resistance. In one embodiment, the GRB14-associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition. In one embodiment, the GRB14-associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke. In another aspect, the present disclosure provides a method of preventing at least one symptom in a subject having a GRB14-associated disease, disorder, or condition. The method includes administering to the subject a prophylactically effective amount of the agent of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby preventing at least one symptom in a subject having a GRB14-associated disease, disorder, or condition. In one embodiment, the GRB14-associated disease, disorder, or condition is diabetes. In one embodiment the diabetes is type 2 diabetes. In another embodiment, the diabetes is type 1 diabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is prediabetes. In one embodiment, the GRB14-associated disease, disorder, or condition is insulin resistance. In one embodiment, the GRB14- associated disease, disorder, or condition is a diabetes-related disease, disorder, or condition. In one Page 10 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) embodiment, the GRB14-associated disease, disorder, or condition is obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke. In another aspect, the present disclosure provides a method of reducing the risk of developing type 2 diabetes in a subject. The method includes administering to the subject a prophylactically effective amount or a prophylactically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby reducing the risk of developing type 2 diabetes in the subject. In another aspect, the present disclosure provides a method of increasing insulin sensitivity in a subject. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby increasing insulin sensitivity in the subject. In one embodiment, the insulin sensitivity is hepatic insulin sensitivity. In another aspect, the present disclosure provides a method of reversing type 2 diabetes in a subject. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition of the disclosure, thereby reversing type 2 diabetes in the subject. In one embodiment, the subject is obese. In one embodiment, the methods and uses of the disclosure further include administering an additional therapeutic to the subject. In one embodiment, the dsRNA agent is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. The agent may be administered to the subject intravenously, intramuscularly, or subcutaneously. In one embodiment, the agent is administered to the subject subcutaneously. In one embodiment, the methods and uses of the disclosure further include determining, the level of GRB14 in the subject. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1 depicts the results of in vivo screening in PBX-mice. The graph shows the percent of GRB14 mRNA (left bar) and protein (right bar) in liver relative to the PBS mean for AD-2217245 (5 mpk), AD-2217246 (5 mpk), AD-2217252 (5 mpk), AD-2217262 (5 mpk), and AD-213142 (10 mpk x3). FIG.2 depicts the results of in vivo screening in non-human primates (NHP). The graph shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 mRNA in liver at Day 22 post-dose. FIG.3 depicts the results of in vivo screening in non-human primates (NHP). The graph shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 protein in liver at Day 22 and Day 57 post-dose. Page 11 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) FIG.4A and FIG.4B show the results of an in vivo study in genetically obese mice (Ob/Ob). FIG. 4A shows the GRB14 expression after treatment and FIG.4B illustrates the %HbA1c in the mice after treatment. FIG.5A and FIG.5B show the results of an in vivo study in high fat diet (HFD) treated mice. FIG.5A depicts the results of a Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) taken at week 8. FIG.5B depicts the GRB14 expression. FIG.6A, FIG.6B, and FIG.6C show the results of an in vivo study in diet induced obese (DIO) mice. FIG.6A shows the results of a glucose tolerance test in DIO mice administered 10 mg/kg of the selected duplexes compared to DIO and lean mouse controls. FIG.6B shows the results of an insulin tolerance test in DIO mice administered 10 mg/kg of the selected duplexes compared to DIO and lean mouse controls. FIG.6C shows the body weight at week 8 of DIO mice administered 10 mg/kg of the selected duplexes compared to DIO and lean mouse controls. DETAILED DESCRIPTION OF THE DISCLOSURE The present disclosure provides iRNA compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a GRB14 gene. The GRB14 gene may be within a cell, e.g., a cell within a subject, such as a human. The present disclosure also provides methods of using the iRNA compositions of the disclosure for inhibiting the expression of a GRB14 gene, and for treating a subject who would benefit from inhibiting or reducing the expression of a GRB14 gene, e.g., a subject suffering or prone to suffering from a GRB14-associated disease disorder, or condition, such as a subject suffering or prone to suffering from type 2 diabetes, type 1 diabetes, prediabetes, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc. The iRNAs of the disclosure targeting GRB14 may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18- 23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21- 24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a GRB14 gene. In some embodiments, one or both of the strands of the double stranded RNAi agents of the disclosure is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA Page 12 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) transcript of a GRB14 gene. In some embodiments, such iRNA agents having longer length antisense strands may include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides. The use of the iRNA agents described herein enables the targeted degradation of mRNAs of a GRB14 gene in mammals. Very low dosages of the iRNAs, in particular, can specifically and efficiently mediate RNA interference (RNAi), resulting in significant inhibition of expression of a GRB14 gene. Thus, methods and compositions including these iRNAs are useful for treating a subject who would benefit from inhibiting or reducing the expression of a GRB14 gene, e.g., a subject that would benefit from a reduction of inflammation of the liver, e.g., a subject suffering or prone to suffering from a GRB14-associated disease disorder, or condition such as diabetes type 2, diabetes type 1, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic nephropathy, diabetic neurodpathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc. The following detailed description discloses how to make and use compositions containing iRNAs to inhibit the expression of a GRB14 gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and/or reduction of the expression of this gene. I. Definitions In order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless context clearly indicates otherwise. The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. The term “GRB14,” also known as “growth factor receptor bound protein 14,” refers to the well- known gene encoding a growth factor receptor bound protein 14 protein from any vertebrate or mammalian Page 13 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native GRB14 that maintain at least one in vivo or in vitro activity of a native GRB14. The term encompasses full-length unprocessed precursor forms of GRB14 as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing. The human GRB14 gene has 18 exons. Two variants of the human GRB14 gene have been identified, transcript variants 1 and 2. The nucleotide and amino acid sequence of a human GRB14 trascript variant 1 can be found in, for example, GenBank Reference Sequence: NM_004490.3 (SEQ ID NO: 1; reverse complement, SEQ ID NO: 2); and the nucleotide and amino acid sequence of a human GRB14 transcript variant 2 can be found in, for example, GenBank Reference Sequence: NM_001303422.2 (SEQ ID NO: 3; reverse complement, SEQ ID NO: 4). The human GRB14 gene is located in the chromosomal region 2q24.3. The nucleotide sequence of the genomic region of human chromosome harboring the GRB14 gene may be found in, for example, the Genome Reference Consortium Human Build 38 (also referred to as Human Genome build 38 or GRCh38) available at GenBank. The nucleotide sequence of the genomic region of human chromosome 2 harboring the GRB14 gene may also be found at, for example, GenBank Accession No. NC_000002.12, corresponding to nucleotides 164,492,417-164,622,959 of human chromosome 2. The nucleotide sequence of the human GRB14 gene may be found in, for example, GenBank Accession No. NG_052839.1, corresponding to nucleotides 5,369-134,434. The nucleotide and amino acid sequence of a mouse (Mus musculus) GRB14 transcript can be found in, for example, GenBank Reference Sequence: NM_016719.1 (SEQ ID NO: 5; reverse complement, SEQ ID NO: 6). The nucleotide and amino acid sequence of a rat (Rattus norvegicus) GRB14 transcript can be found in, for example, GenBank Reference Sequence: NM_031623.1 (SEQ ID NO: 7; reverse complement, SEQ ID NO: 8). There are three predicted transcript variants of the Rhesus monkey (Macaca mulatta) GRB14 gene. The nucleotide and amino acid sequence of a Rhesus monkey GRB14 transcript variant 1 can be found in, for example, GenBank Reference Sequence: XM_015110244.2 (SEQ ID NO: 9; reverse complement, SEQ ID NO: 10); the nucleotide and amino acid sequence of a Rhesus monkey GRB14 transcript variant 2 can be found in, for example, GenBank Reference Sequence: XM_028830779.1 (SEQ ID NO: 11; reverse complement, SEQ ID NO: 12); and the nucleotide and amino acid sequence of a Rhesus monkey GRB14 transcript variant 3 can be found in, for example, GenBank Reference Sequence: XM_015110245.2 (SEQ ID NO: 13; reverse complement, SEQ ID NO: 14). There are three predicted transcript variants of the rabbit (Oryctolagus cuniculus) GRB14 gene. The nucleotide and amino acid sequence of a rabbit GRB14 transcript variant 1 can be found in, for example, GenBank Reference Sequence: XM_008258679.2 (SEQ ID NO: 15; Page 14 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) reverse complement, SEQ ID NO: 16); the nucleotide and amino acid sequence of a rabbit GRB14 transcript variant 2 can be found in, for example, GenBank Reference Sequence: XM_017342897.1 (SEQ ID NO: 17; reverse complement, SEQ ID NO: 18); and the nucleotide and amino acid sequence of a rabbit GRB14 transcript variant 3 can be found in, for example, GenBank Reference Sequence: XM_017342898.1 (SEQ ID NO: 19; reverse complement, SEQ ID NO: 20). Additional examples of GRB14 mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM. Additional information on GRB14 can be found, for example, at www.ncbi.nlm.nih.gov/gene/2888. The term GRB14 as used herein also refers to variations of the GRB14 gene including variants provided in the clinical variant database, for example, at www.ncbi.nlm.nih.gov/clinvar/?term=GRB14[gene]. The term “GRB14” as used herein also refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the GRB14 gene, such as a single nucleotide polymorphism in the GRB14 gene. Numerous SNPs within the GRB14 gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp). Growth factor receptor-bound protein 14 (GRB14) is a protein belonging to a small family of adapter proteins that further comprises growth factor receptor-bound protein 7 (GRB7) and growth factor receptor- bound protein 10 (GRB10). These adapter proteins interact with a number of receptor tyrosine kinases and signaling molecules. GRB14 binds an insulin receptor (IR), epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), fibroblast growth factor receptor (FGFR), as well as Tek/Tie2 (Han et al. (2001) Oncogene 20:6351-6321). No binding of GRB14 to insulin-like growth factor receptor (IGFR) has been reported, but IGFR was sensitive to inhibition of tyrosine kinase activity by GRB14 in vitro, though less so than IR (Holt et al. (2005) Biochem. J.388:393–406). GRB14 is a major negative regulator of insulin and IGF-1 metabolic pathways, whereas GRB7 regulates focal adhesion kinase (FAK)-mediated cell migration. GRB7/10/14 are most abundantly expressed in the pancreas, with GRB14 having relatively broad expression profiles (Han et al. (2001) Oncogene 20:6351-6321). GRB14 mRNA and protein are expressed strongly in skeletal muscle and white adipose tissue, two major insulin target tissues, as well as heart and kidney (Holt et al. (2005) Biochem. J. 388:393– 406). Strong GRB14 expression is found also in the pancreatic islets, liver and in retinal rod photoreceptor cells (Desbuquois et al. (2013) FEBS J 280(3):794-816; Holt et al. (2005) Biochem. J.388:393–406). Insulin is a major hormonal regulator of glucose and lipid homeostasis, particularly in the target tissues of muscle, fat, and liver. Overexpression of GRB14 blocks the interaction of PTP-1B with the insulin receptor, shielding it from dephosphorylation and at the same time inhibits Akt/PKB and ERK1/2 activation. Furthermore, in Grb14-deficient mice, insulin receptor tyrosine phosphorylation in the liver is decreased, and insulin activation of IRS and Akt/PKB is augmented (Dufresne et al. (2005) Endocrinology 146(10):4399– Page 15 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 4409). Overexpression of GRB14 in Chinese hamster ovary cells inhibited insulin-stimulated DNA and glycogen synthesis. GRB14 inhibited IR substrate phosphorylation in vitro (Deng et al. (2003) J Biol Chem 278(41):39311-22). Targeted deletion of the GRB14 gene has been shown to improve insulin sensitivity and glucose homeostasis, suggesting GRB14 negatively regulates insulin signaling and action (Wang et al. (2007) Mol Cell Biol (18):6497-505). Disruption of the GRB14 gene in mice results in a slight decrease in body mass and liver mass, an increase in heart mass, and an improved in vivo glucose tolerance and insulin sensitivity. It also enhances insulin-induced stimulation of glucose transport in skeletal muscle, as well as glycogen synthesis in liver and muscle (Desbuquois et al. (2013) FEBS J 280(3):794-816). GRB14 mRNA and protein expression were found to be increased by 75–100% in adipose tissue, but not in liver, in two rodent models of type 2 diabetes, and mRNA expression was increased by 43% in subcutaneous adipose tissue, but was not significantly altered in skeletal muscle, of human type 2 diabetics (Holt et al. (2005) Biochem. J. 388:393– 406). Removal of GRB14 decreases receptor phosphorylation of insulin receptor (IR) and IGF-I receptor, presumably due to increased phosphatase access, and is coupled with enhanced downstream signaling. As described above, GRB14 protein is expressed prominently in insulin target tissues, including the liver, skeletal muscle, and adipose tissue. Variants of GRB14 have been associated with obesity and/or insulin resistance. A number of other studies have examined the association of GRB14 single nucleotide polymorphisms with type 2 diabetes and/or associated metabolic profiles, each of which is hereby incorporated by reference in its entirety (Di Paula, et al., (2010) J. Intern. Med.267(1):132–133; Di Paula, et al., (2006) Diabetes Care 29(5):1181-1182; Manning et al. (2013) Nat. Genet.44(6):659–669; Rampersaud et al. (2007) Diabetes 56:3053-3062; Scott et al. (2012) Nat. Genet. 44(9):991–1005; Kooner et al. (2013) Nat Genet.43(10):984– 989). In animal studies, the germline Grb14-knockout mice have improved insulin signaling in liver and skeletal muscle (Cooney et al. (2004) Embo J.23:582-593). Grb14 knockdown in the liver, white adipose tissues, and heart improved glucose homeostasis in diet-induced obese mice (Ding et al. (2020) Sci Rep. 10:3417). Each protein of the GRB7/10/14 family comprises an N-terminal proline-rich region, a Ras- associating (RA) domain, a pleckstrin homology (PH) domain, a C-terminal Src homology 2 (SH2) domain, and a conserved region referred to as the BPS domain (named for being between the PH and SH2 domains) or the phosphorylated insulin receptor-interacting region (PIR) that is unique to the family. GRB7/10/14 family members share high sequence identity (approximately 60-70%) in the SH2 domain and a smaller sequence identify with members of the SH2B family of adapter proteins (approximately 25-30%). As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a GRB14 gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodiment, the target portion of the sequence will be at Page 16 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a GRB14 gene. The target sequence of a GRB14 gene may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18- 26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the disclosure by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure. The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of the GRB14 gene in a cell, e.g., a cell within a subject, such as a mammalian subject. In one embodiment, an RNAi agent of the disclosure includes a single stranded RNA that interacts with a target RNA sequence, e.g., a GRB14 target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev.15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with Page 17 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) characteristic two base 3’ overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev.15:188). Thus, in one aspect the disclosure relates to a single stranded RNA (sssiRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a GRB14 gene. Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above. In another embodiment, the RNAi agent may be a single-stranded RNAi agent that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents (ssRNAi) bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAi agents are described in U.S. Patent No.8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894. In another embodiment, an “iRNA” for use in the compositions and methods of the disclosure is a double-stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double-stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a GRB14 gene. In some embodiments of the disclosure, a double-stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi. In general, the majority of nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in Page 18 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.  The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18- 22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21- 23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs. In one embodiment, an RNAi agent of the disclosure is a dsRNA, each strand of which comprises less than 30 nucleotides, e.g., 17-27, 19-27, 17-25, 19-25, or 19-23, that interacts with a target RNA sequence, e.g., a GRB14 target mRNA sequence, to direct the cleavage of the target RNA. In another embodiment, an RNAi agent of the disclosure is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a GRB14 target mRNA sequence, to direct the cleavage of the target RNA. In one embodiment, the sense strand is 21 nucleotides in length. In another embodiment, the antisense strand is 23 nucleotides in length. Page 19 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3’-end of one strand of a dsRNA extends beyond the 5’-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5’-end, 3’-end or both ends of either an antisense or sense strand of a dsRNA. In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and/or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and/or the 5’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate. The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length. The term “antisense strand” or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a GRB14 mRNA. As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a GRB14 nucleotide Page 20 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- and/or 3’- terminus of the iRNA. The term “sense strand” or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein. As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13. As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50oC or 70oC for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides. Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base- pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as Page 21 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein. “Complementary” sequences, as used herein, can also include, or be formed entirely from, non- Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use. As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding GRB14). For example, a polynucleotide is complementary to at least a part of a GRB14 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding GRB14. In some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target GRB14 sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target GRB14 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1 or 3, or a fragment of SEQ ID NO: 1 or 3, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In one embodiment, an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target GRB14 sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 2 or 4, or a fragment of any one of SEQ ID NO: 2 or 4, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In some embodiments, an iRNA of the disclosure includes an antisense strand that is substantially complementary to the target GRB14 sequence and comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of Page 22 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) any one of the sense strands in Tables 2-7 or 15-16, or a fragment of any one of the sense strands in Tables 2-7 or 15-16, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary. The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition. The phrase “inhibiting expression of a GRB14 gene,” as used herein, includes inhibition of expression of any GRB14 gene (such as, e.g., a mouse GRB14 gene, a rat GRB14 gene, a monkey GRB14 gene, or a human GRB14 gene) as well as variants or mutants of a GRB14 gene that encode a GRB14 protein, respectively. “Inhibiting expression of a GRB14 gene” includes any level of inhibition of a GRB14 gene, e.g., at least partial suppression of the expression of a GRB14 gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. The expression of a GRB14 gene may be assessed based on the level of any variable associated with GRB14 gene expression, e.g., GRB14 mRNA level or GRB14 protein level. The expression of a GRB14 gene may also be assessed indirectly based on, for example, the enzymatic activity of GRB14 in a tissue sample, such as a liver sample. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control). In one embodiment, at least partial suppression of the expression of a GRB14 gene, is assessed by a reduction of the amount of GRB14 mRNA which can be isolated from, or detected, in a first cell or group of cells in which a GRB14 gene is transcribed and which has or have been treated such that the expression of a GRB14 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of: (mRNAin control cells) - (mRNA in treated cells) ^100 % (mRNAin control cells) The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or Page 23 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell. Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and/or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject. In one embodiment, contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an iRNA into a cell may be in vitro and/or in vivo. For example, for in vivo introduction, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be done by a beta-glucan delivery system. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art. The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed. As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose). In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in GRB14 expression; a human at risk for a disease, disorder or condition that would benefit from reduction in GRB14 expression; a human having a disease, disorder or condition that would benefit from reduction in GRB14 expression; and/or human being treated for a disease, disorder or condition that would benefit from reduction in GRB14 expression as described herein. In another embodiment, the subject is homozygous for the GRB14 gene. Each allele of the gene may encode a functional GRB14 protein. In yet another embodiment, the subject is heterozygous for the GRB14 gene. The subject may have an allele encoding a functional GRB14 protein and an allele encoding a loss of Page 24 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) function variant of GRB14. In some embodiments, the subject has an allele encoding the rs3923113 variant. In some ebomdiments, the subject has an allele encoding the rs10195252 variant. In some embodiments, the subject has a GIGYF1 loss of function allele. In some embodiments, the subject has a GIGYF1 rs221797 variant (e.g., rs221797:A). In some embodiments, the subject has a GIGYF1 rs117231629 variant. In some embodiments, the subject has a GIGYF2 loss of function allele. In some embodiments, the subject has a GIGYF2 rs1801251 variant (e.g., rs1801251:A). As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with GRB14 gene expression and/or GRB14 protein production. In some embodiments, symptoms associated with GRB14 gene expression and/or GRB14 protein production may be symptoms of a disease or disorder in which the pathology or cause is independent of GRB14 expression and/or GRB14 protein production, but which may nonetheless be compensated for/treated for/counteracted by inhibiting GRB14 gene expression and/or GRB14 protein production, e.g., a GRB14-associated disease, such as type 2 diabetes, type 1 diabetes, prediabetes, insulin resistance, or a diabetes-related disease, disorder, or condition, such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. The term “lower” in the context of a GRB14-associated disease refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, a decrease is at least 20%. “Lower” in the context of the level of GRB14 in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder. As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of a GRB14 gene, refers to a reduction in the likelihood that a subject will develop a symptom associated with such disease, disorder, or condition, e.g., a symptom of GRB14 gene expression or overexpression, such as insulin resistance. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms (e.g., by days, weeks, months or years) is considered effective prevention. As used herein, the terms and “GRB14-associated disease” are diseases or disorders that are caused by, or associated with, GRB14 gene expression, respectively, or by GRB14 protein production, respectively. The term “GRB14-associated disease” includes a disease, disorder or condition that would benefit from a Page 25 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) decrease in the gene expression or protein activity of GRB14, respectively. For instance, a “GRB14-associated disease” includes a disease or disorder which does not arise as a result of the expression of a GRB14 gene and/or production of a GRB14 protein, but in which the reduced expression of a GRB14 gene and/or production of a GRB14 protein may nonetheless alleviate the symptoms of or counteract or compensate for the adverse physiological effects of the disease or disorder. A subject having or being at risk for a GRB14- associated disease or disorder may include a subject expressing a wildtype GRB14 gene and/or otherwise exhibiting normal/healthy levels of expression of the GRB14 gene and levels of GRB14 protein production. In one embodiment, a "GRB14-associated disease” is type 2 diabetes. In one embodiment, a “GRB14- associated disease” is type 1 diabetes. In one embodiment, a “GRB14-associated disease” is prediabetes. In one embodiment, a “GRB14-associated disease” is insulin resistance. In one embodiment, a “GRB14- associated disease” is a diabetes-related complication, such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc. "Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a GRB14-associated disease, disorder, or condition, is sufficient to effective treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. “Prophylactically effective amount,” as used herein, is intended to include the amount of an iRNA that, when administered to a subject having a GRB14-associated disease, disorder, or condition, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the iRNA, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated. A "therapeutically-effective amount" or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. iRNA employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in Page 26 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer’s solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. II. iRNAs of the Disclosure Described herein are iRNAs which inhibit the expression of a target gene. In one embodiment, the iRNAs inhibit the expression of a GRB14 gene. In one embodiment, the iRNA agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a GRB14 gene in a cell, such as a liver Page 27 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) cell, such as a liver cell within a subject, e.g., a mammal, such as a human with type 2 diabetes, type 1 diabetes, prediabetes, or insulin resistance. The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a GRB14 gene. The region of complementarity is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). Upon contact with a cell expressing the target gene, the iRNA inhibits the expression of the target gene (e.g., a human, a primate, a non-primate, or a bird target gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytometric techniques. A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of a GRB14 gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides. Generally, the duplex structure is between 15 and 30 base pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18- 26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. Similarly, the region of complementarity to the target sequence is between 15 and 30 nucleotides in length, e.g., between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15- 17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20- 22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. In some embodiments, the sense and antisense strands of the dsRNA are each independently about 15 to about 30 nucleotides in length, or about 25 to about 30 nucleotides in length, e.g., each strand is Page 28 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) independently between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19- 27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In some embodiments, the dsRNA is between about 15 and about 23 nucleotides in length, or between about 25 and about 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway). One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 9 to 36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15- 18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20- 23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target GRB14 expression is not generated in the target cell by cleavage of a larger dsRNA. In one embodiment, the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from nucleotides which are perfectly complementary to any 15 contiguous nucleotides positioned within nucleotides 166-188, 168-190, 169-191, 170-192, 171-193, 173-195, 174-196, 175-197, 180-202, 181-203, 182-204, 352-374, 353-375, 354-376, 355-377, 356-378, 358-380, 359- 381, 360-382, 361-383, 362-384, 363-385, 364-386, 365-387, 366-388, 367-389, 368-390, 369-391, 370-392, 371-393, 373-395, 374-396, 375-397, 376-398, 377-399, 378-400, 379-401, 380-402, 381-403, 382-404, 383- 405, 384-406, 385-407, 386-408, 387-409, 388-410, 389-411, 390-412, 391-413, 392-414, 393-415, 394-416, 395-417, 396-418, 397-419, 398-420, 399-421, 400-422, 401-423, 402-424, 403-425, 404-426, 405-427, 406- 428, 407-429, 408-430409-431, 411-433, 412-434, 413-435, 414-436, 415-437, 416-438, 418-440, 419-441, Page 29 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 438-460, 439-461, 440-462, 441-463, 442-464, 464-486, 465-487, 466-488, 467-489, 468-490, 469-491, 470- 492, 471-493, 472-494, 473-495, 474-496, 475-497, 476-498, 477-499, 478-500, 479-501, 480-502, 481-503, 482-504, 483-505, 484-506, 485-507, 486-508, 487-509, 506-528, 507-529, 508-530, 527-549, 528-550, 529- 551, 530-552, 531-553, 532-554, 534-556, 535-557, 536-558, 537-559, 538-560, 540-562, 541-563, 542-564, 543-565, 545-567, 546-568, 548-570, 549-571, 550-572, 551-573, 552-574, 553-575, 554-576, 555-577, 556- 578, 557-579, 558-580, 559-581, 560-582, 561-583, 562-584, 563-585, 564-586, 565-587, 566-588, 567-589, 568-590, 569-591, 570-592, 571-593, 572-594, 573-595, 574-596, 575-597, 576-598, 577-599, 578-600, 579- 601, 580-602, 581-603, 582-604, 620-642, 621-643, 622-644, 628-650, 631-653, 636-658, 637-659, 638-660, 639-661, 640-662, 641-663, 642-664, 643-665, 644-666, 645-667, 646-668, 647-669, 648-670, 649-671, 650- 672, 651-673, 652-674, 671-693, 672-694, 673-695, 674-696, 675-697, 676-698, 677-699, 678-700, 679-701, 680-702, 681-703, 682-704, 683-705, 736-758, 739-761, 740-762, 741-763, 742-764, 743-765, 744-766, 745- 767, 746-768, 747-769, 748-770, 749-771, 750-772, 751-773, 752-774, 753-775, 754-776, 755-777, 756-778, 757-779, 758-780, 765-787, 766-788, 767-789, 768-790, 769-791, 770-792, 771-793, 772-794, 773-795, 774- 796, 775-797, 776-798, 777-799, 778-800, 779-801, 780-802, 781-803, 782-804, 783-805, 784-806, 785-807, 786-808, 787-809, 788-810, 789-811, 790-812, 791-813, 792-814, 793-815, 793-815, 794-816, 795-817, 796- 818, 797-819, 798-820, 798-820, 799-821, 800-822, 801-823, 844-866, 845-867, 846-868, 847-869, 848-870, 849-871, 850-872, 851-873, 852-874, 853-875, 872-894, 873-895, 874-896, 875-897, 876-898, 877-899, 878- 900, 879-901, 880-902, 881-903, 882-904, 883-905, 884-906, 885-907, 886-908, 887-909, 888-910, 889-911, 890-912, 893-915, 894-916, 895-917, 896-918, 897-919, 898-920, 900-922, 901-923, 902-924,903-925, 904- 926, 906-928, 907-929, 908-930, 909-931, 910-932, 911-933, 912-934, 913-935, 916-938, 917-939, 935-957, 936-958, 937-959, 938-960, 939-961, 940-962, 941-963, 942-964, 943-965, 944-966, 945-967, 948-970, 949- 971, 951-973, 952-974, 957-979, 982-1004, 985-1007, 986-1008, 988-1010, 989-1011, 991-1013, 993-1015, 994-1016, 995-1017, 996-1018, 996-1018, 997-1019, 998-1020, 999-1021, 1000-1022, 1001-1023, 1002- 1024, 1003-1025, 1004-1026, 1005-1027, 1006-1028, 1007-1029, 1008-1030, 1009-1031, 1010-1032, 1011- 1033, 1012-1034, 1013-1035, 1014-1036, 1015-1037, 1016-1038, 1017-1039, 1019-1041, 1020-1042, 1021- 1043, 1022-1044, 1023-1045, 1024-1046, 1061-1083, 1062-1084, 1063-1085, 1064-1086, 1065-1087, 1066- 1088, 1067-1089, 1068-1090, 1069-1091, 1070-1092, 1071-1093, 1072-1094, 1073-1095, 1074-1096, 1075- 1097, 1076-1098, 1077-1099, 1078-1100, 1079-1101, 1080-1102, 1081-1103, 1082-1104, 1083-1105, 1084- 1106, 1085-1107, 1086-1108, 1087-1109, 1088-1110, 1089-1111, 1090-1112, 1120-1142, 1121-1143, 1122- 1144, 1123-1145, 1124-1146, 1125-1147, 1126-1148, 1127-1149, 1128-1150, 1129-1151, 1130-1152, 1131- 1153, 1132-1154, 1135-1157, 1136-1158, 1138-1160, 1139-1161, 1140-1162, 1141-1163, 1142-1164, 1143- 1165, 1144-1166, 1149-1171, 1154-1176, 1155-1177, 1163-1185, 1164-1186, 1165-1187, 1167-1189, 1168- 1190, 1169-1191, 1170-1192, 1171-1193, 1172-1194, 1173-1195, 1174-1196, 1175-1197, 1176-1198, 1177- 1199, 1178-1200, 1179-1201, 1180-1202, 1181-1203, 1182-1204, 1183-1205, 1184-1206, 1185-1207, 1186- Page 30 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 1208, 1187-1209, 1188-1210, 1189-1211, 1191-1213, 1192-1214, 1196-1218, 1197-1219, 1198-1220, 1199- 1221, 1201-1223, 1202-1224, 1203-1225, 1204-1226, 1205-1227, 1206-1228, 1207-1229, 1208-1230, 1209- 1231, , 1210-1232, 1211-1233, 1212-1234, 1213-1235, 1214-1236, 1215-1237, 1216-1238, 1217-1239, 1218- 1240, 1219-1241, 1220-1242, 1221-1243, 1222-1244, 1223-1245, 1224-1246, 1225-1247, 1226-1248, 1226- 1248, 1227-1249, 1228-1250, 1247-1269, 1249-1271, 1250-1272, 1269-1291, 1270-1292, 1271-1293, 1272- 1294, 1273-1295, 1296-1318, 1304-1326, 1307-1329, 1308-1330, 1309-1331, 1311-1333, 1316-1338, 1317- 1339, 1318-1340, 1319-1341, 1320-1342, 1321-1343, 1322-1344, 1323-1345, 1324-1346, 1325-1347, 1326- 1348, 1327-1349, 1328-1350, 1329-1351, 1330-1352, 1331-1353, 1332-1354, 1333-1355, 1334-1356, 1335- 1357, 1336-1358, 1337-1359, 1339-1361, 1340-1362, 1341-1363, 1344-1366, 1345-1367, 1347-1369, 1348- 1370, 1376-1398, 1377-1399, 1378-1400, 1379-1401, 1379-1401, 1380-1402, 1381-1403, 1382-1404, 1383- 1405, 1384-1406, 1385-1407, 1386-1408, 1387-1409, 1388-1410, 1389-1411, 1390-1412, 1391-1413, 1392- 1414, 1393-1415, 1394-1416, 1395-1417, 1407-1429, 1431-1453, 1451-1473, 1452-1474, 1453-1475, 1454- 1476, 1455-1477, 1469-1491, 1470-1492, 1471-1493, 1471-1493, 1473-1495, 1476-1498, 1477-1499, 1478- 1500, 1479-1501, 1480-1502, 1481-1503, 1482-1504, 1483-1505, 1484-1506, 1485-1507, 1486-1508, 1487- 1509, 1488-1510, 1489-1511, 1490-1512, 1491-1513, 1492-1514, 1493-1515, 1494-1516, 1495-1517, 1496- 1518, 1497-1519, 1498-1520, 1499-1521, 1500-1522, 1501-1523, 1506-1528, 1507-1529, 1510-1532, 1511- 1533, 1512-1534, 1513-1535, 1514-1536, 1515-1537, 1516-1538, 1517-1539, 1518-1540, , 1519-1541, 1520- 1542, 1521-1543, 1522-1544, 1523-1545, 1524-1546, 1525-1547, 1526-1548, 1527-1549, 1528-1550, 1529- 1551, 1530-1552, 1531-1553, 1532-1554, 1536-1558, 1537-1559, 1539-1561, 1540-1562, 1541-1563, 1542- 1564, 1543-1565, 1544-1566, 1545-1567, 1546-1568, 1547-1569, 1548-1570, 1549-1571, 1550-1572, 1551- 1573, 1553-1575, 1554-1576, 1555-1577, 1556-1578, 1557-1579, 1558-1580, 1559-1581, 1560-1582, 1561- 1583, 1562-1584, 1563-1585, 1564-1586, 1565-1587, 1566-1588, 1587-1609, 1588-1610, 1589-1611, 1590- 1612, 1591-1613, 1592-1614, 1593-1615, 1594-1616, 1595-1617, 1596-1618, 1597-1619, 1598-1620, 1599- 1621, 1600-1622, 1601-1623, 1602-1624, 1603-1625, 1604-1626, 1605-1627, 1606-1628, 1607-1629, 1608- 1630, 1609-1631, 1610-1632, 1611-1633, 1612-1634, 1613-1635, 1614-1636, 1615-1637, 1616-1638, 1617- 1639, 1618-1640, 1626-1648, 1627-1649, 1628-1650, 1629-1651, 1630-1652, 1631-1653, 1632-1654, 1633- 1655, 1634-1656, 1635-1657, 1636-1658, 1637-1659, 1638-1660, 1639-1661, 1640-1662, 1641-1663, 1643- 1665, 1644-1666, 1645-1667, 1646-1668, 1647-1669, 1648-1670, 1649-1671, 1650-1672, 1651-1673, 1652- 1674, 1653-1675, 1654-1676, 1655-1677, 1656-1678, 1657-1679, 1658-1680, 1659-1681, 1660-1682, 1661- 1683, 1663-1685, 1664-1686, 1665-1687, 1666-1688, 1667-1689, 1668-1690, 1689-1711, 1690-1712, 1691- 1713, 1692-1714, 1693-1715, 1694-1716, 1695-1717, 1696-1718, 1715-1737, 1716-1738, 1717-1739, 1718- 1740, 1719-1741, 1720-1742, 1721-1743, 1722-1744, 1723-1745, 1724-1746, 1725-1747, 1726-1748, 1727- 1749, 1729-1751, 1730-1752, 1731-1753, 1732-1754, 1733-1755, 1734-1756, 1735-1757, 1736-1758, 1737- 1759, 1738-1760, 1741-1763, 1744-1766, 1745-1767, 1746-1768, 1747-1769, 1748-1770, 1749-1771, 1750- Page 31 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 1772, 1751-1773, 1752-1774, 1753-1775, 1754-1776, 1755-1777, 1756-1778, 1757-1779, 1758-1780, 1759- 1781, 1760-1782, 1761-1783, 1762-1784, 1762-1784, 1763-1785, 1765-1787, 1765-1787, 1766-1788, 1767- 1789, 1768-1790, 1769-1791, 1770-1792, 1771-1793, 1772-1794, 1773-1795, 1774-1796, 1775-1797, 1798- 1820, 1799-1821, 1800-1822, 1801-1823, 1802-1824, 1803-1825, 1804-1826, 1805-1827, 1807-1829, 1808- 1830, 1827-1849, 1828-1850, 1829-1851, 1830-1852, 1835-1857, 1838-1860, 1849-1871, 1850-1872, 1880- 1902, 1881-1903, 1882-1904, 1901-1923, 1902-1924, 1903-1925, 1916-1938, 1935-1957, 1936-1958, 1937- 1959, 1938-1960, 1939-1961, 1940-1962, 1941-1963, 1942-1964, 1943-1965, 1944-1966, 1945-1967, 1946- 1968, 1947-1969, 1948-1970, 1949-1971, 1950-1972, 1951-1973, 1952-1974, 1953-1975, 1954-1976, 1955- 1977, 1956-1978, 1957-1979, 448-470, 449-471, 450-472, 451-473, 452-474, 453-475, 454-476, 455-477, 456-478, 457-479, 458-480, 459-481, 460-482, 461-483, 462-484, 463-485, 488-510, 490-512, 491-513, 492- 514, 493-515, 494-516, 495-517, 496-518, 497-519, 498-520, 499-521, 500-522, 501-523, 502-524, 503-525, 504-526, 505-527, 509-531, 510-532, 511-533, 512-534, 513-535, 514-536, 515-537, 516-538, 517-539, 518- 540, 519-541, 520-542, 521-543, 522-544, 523-545, 524-546, 525-547, 526-548, 653-675, 654-676, 655-677, 656-678, 657-679, 658-680, 659-681, 660-682, 661-683, 662-684, 663-685, 664-686, 665-687, 666-688, 667- 689, 668-690, 669-691, 670-692, 705-727, 706-728, 707-729, 709-731, 710-732, 711-733, 854-876, 855-877, 856-878, 857-879, 858-880, 859-881, 860-882, 861-883, 862-884, 863-885, 864-886, 865-887, 866-888, 867- 889, 868-890, 869-891, 870-892, 871-893, 963-985, 964-986, 965-987, 966-988, 967-989, 968-990, 969-991, 970-992, 971-993, 972-994, 973-995, 974-996, 975-997, 976-998, 1043-1065, 1044-1066, 1045-1067, 1046- 1068, 1047-1069, 1048-1070, 1049-1071, 1050-1072, 1051-1073, 1052-1074, 1053-1075, 1054-1076, 1055- 1077, 1056-1078, 1057-1079, 1058-1080, 1059-1081, 1060-1082, 1349-1371, 1350-1372, 1351-1373, 1352- 1374, 1353-1375, 1354-1376, 1355-1377, 1356-1378, 1357-1379, 1358-1380, 1359-1381, 1360-1382, 1361- 1383, 1362-1384, 1363-1385, 1364-1386, 1365-1387, 1366-1388, 1367-1389, 1368-1390, 1369-1391, 1370- 1392, 1371-1393, 1372-1394, 1373-1395, 1374-1396, 1375-1397, 1433-1455, 1434-1456, 1435-1457, 1436- 1458, 1437-1459, 1438-1460, 1439-1461, 1440-1462, 1441-1463, 1442-1464, 1443-1465, 1444-1466, 1445- 1467, 1446-1468, 1447-1469, 1448-1470, 1449-1471, 1450-1472, 1697-1719, 1698-1720, 1699-1721, 1700- 1722, 1701-1723, 1702-1724, 1703-1725, 1704-1726, 1705-1727, 1706-1728, 1707-1729, 1708-1730, 1709- 1731, 1710-1732, 1711-1733, 1712-1734, 1713-1735, 1714-1736, 1776-1798, 1777-1799, 1778-1800, 1779- 1801, 1780-1802, 1781-1803, 1782-1804, 1783-1805, 1784-1806, 1785-1807, 1786-1808, 1787-1809, 1788- 1810, 1789-1811, 1790-1812, 1791-1813, 1792-1814, 1793-1815, 1794-1816, 1795-1817, 1796-1818, 1797- 1819, 1809-1831, 1810-1832, 1814-1836, 1815-1837, 1816-1838, 1817-1839, 1818-1840, 1819-1841, 1820- 1842, 1821-1843, 1822-1844, 1823-1845, 1824-1846, 1825-1847, 1826-1848, 1851-1873, 1883-1905, 1884- 1906, 1885-1907, 1886-1908, 1887-1909, 1888-1910, 1889-1911, 1890-1912, 1891-1913, 1892-1914, 1893- 1915, 1894-1916, 1895-1917, 1896-1918, 1897-1919, 1898-1920, 1899-1921, 1900-1922, 1904-1926, 1905- 1927, 1906-1928, 1907-1929, 1909-1931, 1912-1934, 1913-1935, 1998-2020, 1999-2021, 2000-2022, 2001- Page 32 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 2023, 2002-2024, 2003-2025, 2004-2026, 2005-2027, 2006-2028, 2007-2029, 2008-2030, 2009-2031, 2010- 2032, 2011-2033, 2012-2034, 2013-2035, 2014-2036, 2015-2037, 2016-2038, 2017-2039, 2018-2040, 2019- 2041, 2020-2042, 2021-2043, 2022-2044, 2023-2045, 2024-2046, 2025-2047, 2026-2048, 2027-2049, 2028- 2050, 2029-2051, 2030-2052, 2031-2053, 2032-2054, 2033-2055, 2034-2056, 2070-2092, 2071-2093, 2072- 2094, 2073-2095, 2074-2096, 2075-2097, 2076-2098, 2077-2099, 2078-2100, 2079-2101, 2080-2102, 2081- 2103, 2082-2104, 2083-2105, 2084-2106, 2086-2108, 2117-2139, 2118-2140, 2129-2151, 2131-2153, 2133- 2155, 2134-2156, 2135-2157, 2136-2158, 2137-2159, 2138-2160, 2139-2161, 2140-2162, 2141-2163, 2142- 2164, 2143-2165, 2144-2166, 2145-2167, 2146-2168, 2147-2169, 2148-2170, 2149-2171, 2150-2172, 2151- 2173, 2170-2192, 2226-2248, 2227-2249, 2228-2250, 2229-2251, 2230-2252, 2231-2253, 2232-2254, 2233- 2255, 2234-2256, 2235-2257, 2236-2258, 2237-2259, 2238-2260, 2239-2261, 2240-2262, 2241-2263, 2242- 2264, 2243-2265, 2244-2266, 2245-2267, 2246-2268, 2247-2269, 2248-2270, 2249-2271, 2250-2272, 2251- 2273, 2293-2315, 2294-2316, 2316-2338, 2317-2339, 2338-2360, 2352-2374, 2354-2376, 2355-2377, 2356- 2378, 2357-2379, 2358-2380, 1271-1293, 1272-1294, 1272-1294, 1316-1338, 1317-1339, 1320-1342, 1323- 1345, 1325-1347, 1335-1357, 1379-1401, 1379-1401, 1384-1406, 1386-1408, 1387-1409, 1390-1412, 1391- 1413, 1392-1414, 1394-1416, 1486-1508, 1487-1509, 1489-1511, 1595-1617, 1645-1667, 1650-1672, 1651- 1673, 1729-1751, 1731-1753, 1741-1763, 1748-1770, 1748-1770, 1749-1771, 1751-1773, 1752-1774, 1754- 1776, 1756-1778, 1760-1782, 1762-1784, 1768-1790, 1770-1792, 1770-1792, 1771-1793, 1772-1794, 1774- 1796, 1800-1822, 1801-1823, 1827-1849, 1830-1852, 1881-1903, 1882-1904, 1902-1924, 1903-1925, 1916- 1938, 1935-1957, 1937-1959, 1938-1960, 1940-1962, 1942-1964, 1943-1965, 1944-1966, 1945-1967, 1946- 1968, 1947-1969, 1948-1970, 1949-1971, 1950-1972, 1951-1973, 1952-1974, 1955-1977, 1956-1978, 1957- 1979, 869-891, 870-892, 871-893, 1710-1732, 1713-1735, 1825-1847, 1898-1920, 747-769, 784-806, 787- 809, 788-810, 848-870, 848-870, 850-872, 852-874, 872-894, 877-899, 881-903, 882-904, 908-930, 910-932, 911-933, 912-934, 916-938, , 917-939, 989-1011, 989-1011, 996-1018, 996-1018, 998-1020, 1000-1022, 1008-1030, 1015-1037, 1020-1042, 1021-1043, 1022-1044, 1062-1084, 1076-1098, 1202-1224, 1206-1228, 1207-1229, 1208-1230, 1211-1233, 1947-1969, 1952-1974, 1956-1978, 1957-1979, 871-893, or 1756-1778 of SEQ ID NO: 1. A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5’-end, 3’-end or both ends of either an antisense or sense strand of a dsRNA. Page 33 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) A dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. iRNA compounds of the disclosure may be prepared using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the disclosure can be prepared using solution-phase or solid-phase organic synthesis or both. In one aspect, a dsRNA of the disclosure includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence. The sense strand sequence is selected from the group of sequences provided in Tables 2-7 or 15-16, and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the group of sequences of any one of Tables 2-7 or 15-16. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a GRB14 gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in Tables 2-7 or 15-16, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in Tables 2-7 or 15-16. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide. It will be understood that, although the sequences in Tables 2-7 or 15-16are described as modified, unmodified, unconjugated. and/or conjugated sequences, the RNA of the iRNA of the disclosure e.g., a dsRNA of the disclosure, may comprise any one of the sequences set forth in Tables 2-7 or 15-16that is un- modified, un-conjugated, and/or modified and/or conjugated differently than described therein. The skilled person is well aware that dsRNAs having a duplex structure of between about 20 and 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of a GRB14 gene by not more than Page 34 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) about 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present disclosure. In addition, the RNAs described in Tables 2-7 or 15-16identify a site(s) in a GRB14 transcript that is susceptible to RISC-mediated cleavage. As such, the present disclosure further features iRNAs that target within these sites. As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least about 15 contiguous nucleotides from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the gene. While a target sequence is generally about 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified herein represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics. Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of iRNAs based on those target sequences in an inhibition assay as known in the art and/or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor. Page 35 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) An iRNA agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch is not located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5’- or 3’-end of the region of complementarity. For example, for a 23 nucleotide iRNA agent the strand which is complementary to a region of a GRB14 gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of a GRB14 gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of a GRB14 gene is important, especially if the particular region of complementarity in a GRB14 gene is known to have polymorphic sequence variation within the population. An RNA target may have regions, or spans of the target RNA’s nucleotide sequence, which are relatively more susceptible or amenable than other regions of the RNA target to mediating cleavage of the RNA target via RNA interference induced by the binding of an RNAi agent to that region. The increased susceptibility to RNA interference within such “hotspot regions” (or simply “hotspots”) means that iRNA agents targeting the region will likely have higher efficacy in inducing iRNA interference than iRNA agents which target other regions of the target RNA. For example, without being bound by theory, the accessibility of a target region of a target RNA may influence the efficacy of iRNA agents which target that region, with some hotspot regions having increased accessibility. Secondary structures, for instance, that form in the RNA target (e.g., within or proximate to hotspot regions) may affect the ability of the iRNA agent to bind the target region and induce RNA interference. According to certain aspects of the disclosure, an iRNA agent may be designed to target a hotspot region of any of the target RNAs described herein, including any identified portions of a target RNA (e.g., a particular exon). As used herein, a hotspot region may refer to an approximately 19-200, 19-150, 19- 100, 19-75, 19-50, 21-200, 21-150, 21-100, 21-75, 21-50, 50-200, 50-150, 50-100, 50-75, 75-200, 75- 150, 75-100, 100-200, or 100-150 nucleotide region of a target RNA sequence for which targeting using RNAi agents provides an observably higher probability of efficacious silencing relative to targeting other regions of the same target RNA. According to certain aspects of the disclosure, a hotspot region may comprise a limited region of the target RNA, and in some cases, a substantially limited region of the target, including for example, less than half of the length of the target RNA, such as about 5%, 10%, 15%, 20%, 25%, or 30% of the length of the target RNA. Conversely, the other regions against which a hotspot is compared may cumulatively comprise at least a majority of the length of the target RNA. For example, Page 36 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the other regions may cumulatively comprise at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95% of the length of the target RNA. Compared regions of the target RNA may be empirically evaluated for identification of hotspots using efficacy data obtained from in vitro or in vivo screening assays. For example, RNAi agents targeting various regions that span a target RNA may be compared for frequency of efficacious iRNA agents (e.g., the amount by which target gene expression is inhibited, such as measured by mRNA expression or protein expression) that bind each region. In general, a hotspot can be recognized by observing clustering of multiple efficacious RNAi agents that bind to a limited region of the RNA target. A hotspot may be sufficiently characterized as such by observing efficacy of iRNA agents which cumulatively span at least about 60% of the target region identified as a hotspot, such as about 70%, about 80%, about 90%, or about 95% or more of the length of the region, including both ends of the region (i.e. at least about 60%, 70%, 80%, 90%, or 95% or more of the nucleotides within the region, including the nucleotides at each end of the region, were targeted by an iRNA agent). According to some aspects of the disclosure, an iRNA agent which demonstrates at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% inhibition over the region (e.g., no more than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% mRNA remaining) may be identified as efficacious. Amenability to targeting of RNA regions may also be assessed using quantitative comparison of inhibition measurements across different regions of a defined size (e.g., 25, 30, 40, 50, 60, 70, 80, 90, or 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nts). For example, an average level of inhibition may be determined for each region and the averages of each region may be compared. The average level of inhibition within a hotspot region may be substantially higher than the average of averages for all evaluated regions. According to some aspects, the average level of inhibition in a hotspot region may be at least about 10%, 20%, 30%, 40%, or 50% higher than the average of averages. According to some aspects, the average level of inhibition in a hotspot region may be at least about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5 1.6, 1.7, 1.8.1.9, or 2.0 standard deviations above the average of averages. The average level of inhibition may be higher by a statistically significant (e.g., p < 0.05) amount. According to some aspects, each inhibition measurement within a hotspot region may be above a threshold amount (e.g., at or below a threshold amount of mRNA remaining). According to some aspects, each inhibition measurement within the region may be substantially higher than an average of all inhibition measurements across all the measured regions. For example, each inhibition measurement in a hotspot region may be at least about 10%, 20%, 30%, 40%, or 50% higher than the average of all inhibition measurements. According to some aspects, each inhibition measurement may be at least about 1.0, 1.1, 1.2, 1.3, 1.4, 1.51.6, 1.7, 1.8.1.9, or 2.0 standard deviations above the average of all inhibition measurements. Each inhibition measurement may be higher by a statistically significant (e.g., p < 0.05) amount than the average of all inhibition Page 37 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) measurements. A standard for evaluating a hotspot may comprise various combinations of the above standards where compatible (e.g., an average level of inhibition of at least about a first amount and having no inhibition measurements below a threshold level of a second amount, lesser than the first amount). It is therefore expressly contemplated that any iRNA agent, including the specific exemplary iRNA agents described herein, which targets a hotspot region of a target RNA, may be preferably selected for inducing RNA interference of the target mRNA as targeting such a hotspot region is likely to exhibit a robust inhibitory response relative to targeting a region which is not a hotspot region. RNAi agents targeting target sequences that substantially overlap (e.g., by at least about 70%, 75%, 80%, 85%, 90%, 95% of the target sequence length) or, preferably, that reside fully within the hotspot region may be considered to target the hotspot region. Hotspot regions of the RNA target(s) of the instant disclosure may include any region for which the data disclosed herein demonstrates higher frequency of targeting by efficacious RNAi agents, including by any of the standards described elsewhere herein, whether or not the range(s) of such hotspot region(s) are explicitly specified. In various embodiments, a dsRNA agent of the present disclosure targets a hotspot region of an mRNA encoding GRB14. In one aspect, the present disclosure provides a dsRNA agent that targets a hotspot region of a GRB14 mRNA. III. Modified iRNAs of the Disclosure In one embodiment, the RNA of the iRNA of the disclosure e.g., a dsRNA, is un-modified, and does not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, the RNA of an iRNA of the disclosure, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the disclosure, substantially all of the nucleotides of an iRNA of the disclosure are modified. In other embodiments of the disclosure, all of the nucleotides of an iRNA of the disclosure are modified. iRNAs of the disclosure in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides. In some aspects of the disclosure, substantially all of the nucleotides of an iRNA of the disclosure are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2’-fluoro modifications (e.g., no more than 92^-fluoro modifications, no more than 82^-fluoro modifications, no more than 72^-fluoro modifications, no more than 62^-fluoro modifications, no more than 52^-fluoro modifications, no more than 4 2^-fluoro modifications, no more than 52^-fluoro modifications, no more than 42^-fluoro modifications, no more than 32^-fluoro modifications, or no more than 22^-fluoro modifications). For example, in some embodiments, the sense strand comprises no more than 4 nucleotides comprising 2^-fluoro modifications (e.g., no more than 32^-fluoro modifications, or no more than 22^-fluoro modifications). In other embodiments, the Page 38 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) antisense strand comprises no more than 6 nucleotides comprising 2^-fluoro modifications (e.g., no more than 52^-fluoro modifications, no more than 42^-fluoro modifications, no more than 42^-fluoro modifications, or no more than 22^-fluoro modifications). In other aspects of the disclosure, all of the nucleotides of an iRNA of the disclosure are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2’-fluoro modifications (e.g., no more than 92^-fluoro modifications, no more than 82^-fluoro modifications, no more than 72^-fluoro modifications, no more than 62^-fluoro modifications, no more than 52^-fluoro modifications, no more than 42^-fluoro modifications, no more than 52^-fluoro modifications, no more than 42^-fluoro modifications, no more than 32^-fluoro modifications, or no more than 22^-fluoro modifications). In one embodiment, the double stranded RNAi agent of the disclosure further comprises a 5’- phosphate or a 5’-phosphate mimic at the 5’ nucleotide of the antisense strand. In another embodiment, the double stranded RNAi agent further comprises a 5’-phosphate or 5’-phosphate mimic at the 5’ nucleotide of the sense strand. In a specific embodiment, the 5’-phosphate mimic is a 5’-vinylphosphonate (5’-VP). The nucleic acids featured in the disclosure can be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5’-end modifications (phosphorylation, conjugation, inverted linkages) or 3’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’-position or 4’-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified iRNA will have a phosphorus atom in its internucleoside backbone. Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ Page 39 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) to 5’-2’. Various salts, mixed salts and free acid forms are also included. In some embodiments of the disclosure, the dsRNA agents of the disclosure are in a free acid form. In other embodiments of the disclosure, the dsRNA agents of the disclosure are in a salt form. In one embodiment, the dsRNA agents of the disclosure are in a sodium salt form. In certain embodiments, when the dsRNA agents of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and/or phosphorothioate groups present in the agent. Agents in which substantially all of the phosphodiester and/or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and/or phosphorothioate linkages without a sodium counterion. In some embodiments, when the dsRNA agents of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for all of the phosphodiester and/or phosphorothioate groups present in the agent. Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos.3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and US Pat RE39464, the entire contents of each of which are hereby incorporated herein by reference. Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos.5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference. In other embodiments, suitable RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. Page 40 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500. Some embodiments featured in the disclosure include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH2--NH--CH2-, --CH2--N(CH3)--O--CH2-- [known as a methylene (methylimino) or MMI backbone], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)-- N(CH3)--CH2-- and --N(CH3)--CH2----[wherein the native phosphodiester backbone is represented as --O--P-- O--CH2--] of the above-referenced U.S. Patent No.5,489,677, and the amide backbones of the above- referenced U.S. Patent No.5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Patent No.5,034,506. Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2’-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N- alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO] mCH3, O(CH2).nOCH3, O(CH2)nNH2, O(CH2) nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2’ position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2’-methoxyethoxy (2’-O--CH2CH2OCH3, also known as 2’-O-(2-methoxyethyl) or 2’-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2’-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2’-DMAOE, as described in examples herein below, and 2’- dimethylaminoethoxyethoxy (also known in the art as 2’-O-dimethylaminoethoxyethyl or 2’-DMAEOE), i.e., 2’-O--CH2--O--CH2--N(CH2)2. Further exemplary modifications include: 5’-Me-2’-F nucleotides, 5’-Me-2’- OMe nucleotides, 5’-Me-2’-deoxynucleotides, (both R and S isomers in these three families); 2’-alkoxyalkyl; and 2’-NMA (N-methylacetamide). Page 41 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Other modifications include 2’-methoxy (2’-OCH3), 2’-aminopropoxy (2’-OCH2CH2CH2NH2) and 2’- fluoro (2’-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3’ position of the sugar on the 3’ terminal nucleotide or in 2’-5’ linked dsRNAs and the 5’ position of 5’ terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos.4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference. An iRNA of the disclosure can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8- substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No.3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp.276-278) and are exemplary base substitutions, even more particularly when combined with 2’-O-methoxyethyl sugar modifications. Page 42 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Patent Nos.3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference. An iRNA of the disclosure can also be modified to include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons. This structure effectively "locks" the ribose in the 3’-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439- 447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). An iRNA of the disclosure can also be modified to include one or more bicyclic sugar moieties. A “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4’-carbon and the 2’- carbon of the sugar ring. Thus, in some embodiments an agent of the disclosure may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4’-CH2-O-2’ bridge. This structure effectively "locks" the ribose in the 3’-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge. Examples of such 4’ to 2’ bridged bicyclic nucleosides, include but are not limited to 4’-(CH2)—O-2’ (LNA); 4’-(CH2)—S-2’; 4’-(CH2)2—O- 2’ (ENA); 4’-CH(CH3)—O-2’ (also referred to as “constrained ethyl” or “cEt”) and 4’-CH(CH2OCH3)—O- 2’ (and analogs thereof; see, e.g., U.S. Pat. No.7,399,845); 4’-C(CH3)(CH3)—O-2’ (and analogs thereof; see e.g., US Patent No.8,278,283); 4’-CH2—N(OCH3)-2’ (and analogs thereof; see e.g., US Patent No. 8,278,425); 4’-CH2—O—N(CH3)-2’ (see, e.g., U.S. Patent Publication No.2004/0171570); 4’-CH2— Page 43 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) N(R)—O-2’, wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No.7,427,672); 4’- CH2—C(H)(CH3)-2’ (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4’-CH2— C(═CH2)-2’ (and analogs thereof; see, e.g., US Patent No.8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos.6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133;7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference. Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see WO 99/14226). An iRNA of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)-0-2’ bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.” An iRNA of the disclosure may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5’ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering. Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No.2013/0190383; and PCT publication WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference. In some embodiments, an iRNA of the disclosure comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between C1’-C4’ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1’ and C4’ carbons). In another example, the C2’-C3’ bond (i.e. the covalent carbon-carbon bond between the C2’ and C3’ carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133- 134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference). Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No.8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference. Page 44 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Potentially stabilizing modifications to the ends of RNA molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N- (acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2’-0-deoxythymidine (ether), N-(aminocaproyl)-4- hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861. Other modifications of an iRNA of the disclosure include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5’-terminal phosphate or phosphate mimic on the antisense strand of an RNAi agent. Suitable phosphate mimics are disclosed in, for example US Patent Publication No.2012/0157511, the entire contents of which are incorporated herein by reference. In certain specific embodiments, an RNAi agent of the present disclosure is an agent that inhibits the expression of a GRB14 gene which is selected from the group of agents listed in Tables 2-7 or 15-16. Any of these agents may further comprise a ligand. A. Modified iRNAs Comprising Motifs of the Disclosure In certain aspects of the disclosure, the double stranded RNAi agents of the disclosure include agents with chemical modifications as disclosed, for example, in WO 2013/075035, filed on November 16, 2012, the entire contents of which are incorporated herein by reference. The RNAi agent may be optionally conjugated with a GalNAc ligand, for instance on the sense strand. Accordingly, the disclosure provides double stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., a GRB14 gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may range from 12-30 nucleotides in length. For example, each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. In one embodiment, the sense strand is 21 nulceotides in length. In one embodiment, the antisense strand is 23 nucleotides in length. The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 12-30 nucleotide pairs in length. For example, the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length. Page 45 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In one embodiment, the RNAi agent may contain one or more overhang regions and/or capping groups at the 3’-end, 5’-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers. In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2’-sugar modified, such as, 2-F, 2’- Omethyl, thymidine (T), 2`-O-methoxyethyl-5-methyluridine (Teo), 2`-O-methoxyethyladenosine (Aeo), 2`- O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The 5’- or 3’- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3’-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3’-overhang is present in the antisense strand. In one embodiment, this 3’-overhang is present in the sense strand. The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3’-terminal end of the sense strand or, alternatively, at the 3’-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5’-end of the antisense strand (or the 3’-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3’-end, and the 5’-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5’-end of the antisense strand and 3’-end overhang of the antisense strand favor the guide strand loading into RISC process. In one embodiment, the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end. In another embodiment, the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive Page 46 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) nucleotides at positions 8, 9, 10 from the 5’end. The antisense strand contains at least one motif of three 2’-O- methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end. In yet another embodiment, the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end. The antisense strand contains at least one motif of three 2’- O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end. In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end; the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. Preferably, the 2 nucleotide overhang is at the 3’-end of the antisense strand. When the 2 nucleotide overhang is at the 3’-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and at the 5’-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2’-O-methyl or 3’-fluoro, e.g., in an alternating motif. Optionally, the RNAi agent further comprises a ligand (GalNAc3). In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5’ terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3’ terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ‘ terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3’ terminal nucleotides are unpaired with sense strand, thereby forming a 3’ single stranded overhang of 1-6 nucleotides; wherein the 5’ terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5’ overhang; wherein at least the sense strand 5’ terminal and 3’ terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double Page 47 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at or near the cleavage site. In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3’ end than the first strand, wherein the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentially results in an siRNA comprising the 3’ end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand. In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand. In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand. For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5’-end. Thus the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1st nucleotide from the 5’-end of the antisense strand, or, the count starting from the 1st paired nucleotide within the duplex region from the 5’- end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5’-end. The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three Page 48 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap. In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other, then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif. Like the sense strand, the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand. In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3’-end, 5’-end or both ends of the strand. In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3’-end, 5’-end or both ends of the strand. When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides. When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region. In one embodiment, every nucleotide in the sense strand and antisense strand of the RNAi agent, including the nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with Page 49 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2^ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone. As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases, the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA. For example, a phosphorothioate modification at a non- linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5’ end or ends can be phosphorylated. It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2’-deoxy-2’-fluoro (2’-F) or 2’- O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence. In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2’-methoxyethyl, 2’- O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-deoxy, or 2’-fluoro. The strands can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2’- O-methyl or 2’-fluoro. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2’- O- methyl, 2’-fluoro, and/or a deoxy-nucleotide. At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2’- O-methyl or 2’-fluoro modifications, or others. In one embodiment, the RNAi agent comprises the pattern of the alternating motif of 2’-O-methyl modification and 2’-F modification on the sense strand initially has a shift relative to the pattern of the Page 50 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) alternating motif of 2’-O-methyl modification and 2’-F modification on the antisense strand initially, i.e., the 2’-O-methyl modified nucleotide on the sense strand base pairs with a 2’-F modified nucleotide on the antisense strand and vice versa. The 1 position of the sense strand may start with the 2’-F modification, and the 1 position of the antisense strand may start with the 2’- O-methyl modification. The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand interrupts the initial modification pattern present in the sense strand and/or antisense strand. This interruption of the modification pattern of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense strand surprisingly enhances the gene silencing activity to the target gene. The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both strands in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand and/or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand. In one embodiment, a double-stranded RNAi agent comprises 6-8phosphorothioate internucleotide linkages. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5’-terminus or the 3’-terminus. In one embodiment, the RNAi comprises a phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. Page 51 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) These terminal three nucleotides may be at the 3’-end of the antisense strand, the 3’-end of the sense strand, the 5’-end of the antisense strand, and/or the 5’end of the antisense strand. In one embodiment, the 2 nucleotide overhang is at the 3’-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. Optionally, the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and at the 5’-end of the antisense strand. In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mistmatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings. In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex. In one embodiment, the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. In another embodiment, the nucleotide at the 3’-end of the sense strand is deoxy-thymine (dT). In another embodiment, the nucleotide at the 3’-end of the antisense strand is deoxy-thymine (dT). In one embodiment, there is a short sequence of deoxy-thymine nucleotides, for example, two dT nucleotides on the 3’-end of the sense and/or antisense strand. In certain embodiments, an RNAi agent of the disclosure may contain a low number of nucleotides containing a 2’-fluoro modification, e.g., 10 or fewer nucleotides with 2’-fluoro modification. For example, the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides with a 2’-fluoro modification. In a specific embodiment, the RNAi agent of the disclosure contains 10 nucleotides with a 2’-fluoro modification, Page 52 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 6 nucleotides with a 2’-fluoro modification in the antisense strand. In another specific embodiment, the RNAi agent of the disclosure contains 6 nucleotides with a 2’-fluoro modification, e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 2 nucleotides with a 2’-fluoro modification in the antisense strand. In other embodiments, an RNAi agent of the disclosure may contain an ultra-low number of nucleotides containing a 2’-fluoro modification, e.g., 2 or fewer nucleotides containing a 2’-fluoro modification. For example, the RNAi agent may contain 2, 1 of 0 nucleotides with a 2’-fluoro modification. In a specific embodiment, the RNAi agent may contain 2 nucleotides with a 2’-fluoro modification, e.g., 0 nucleotides with a 2-fluoro modification in the sense strand and 2 nucleotides with a 2’-fluoro modification in the antisense strand. Various publications describe multimeric RNAi agents that can be used in the methods of the disclosure. As described in more detail below, the RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a Page 53 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring. The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone. The RNAi agents may comprise a thermally destabilizing nucleotide placed at a site opposite to the seed region of the antisense strand (i.e., at positions 2-8 of the 5’-end of the antisense strand). For example, a thermally destabilizing nucleotide may be at a position of the sense strand that pairs with a nucleotide at positions 2-8 of the 5’-end of the antisense strand. In one example, a thermally destabilizing nucleotide is at position 15 from the 5’-end of the sense strand. A thermally destabilizing nucleotide nucleotide bears the thermally destabilizing modification which can include abasic modification; mismatch with the opposing nucleotide in the duplex; and sugar modification such as 2’-deoxy modification or acyclic nucleotide e.g., unlocked nucleic acids (UNA) or glycerol nucleic acid (GNA). In certain embodiments, the thermally destabilizing modification selected from the group consisting of: i) mismatch with the opposing nucleotide in the antisense strand; ii) abasic modification selected from the group consisting of: H, Page 54 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) halogen, OR3, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar. In certain embodiments, the thermally destabilizing modification is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2’-deoxy nucleobase. In one example, the thermally destabilizing O . The a phosphorus-containing group at the 5’-end of the sense strand or antisense containing group can be 5’-end phosphate (5’-P), 5’-end phosphorothioate (5’-PS), 5’-end phosphorodithioate (5’-PS2), 5’-end vinylphosphonate (5’-VP), 5’-end methylphosphonate (MePhos), or 5’-deoxy-5’-C- ). When the 5’-end phosphorus-containing group is 5’-end be either 5’-E-VP isomer (i.e., trans- isomer (i.e., cis-vinylphosphonate, mixtures thereof. the RNAi agent comprises a phosphorus-containing group at the 5’-end of the sense strand. In certain embodiments, the RNAi agent comprises a phosphorus-containing group at the 5’-end of the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-P. In certain embodiments, the RNAi agent comprises a 5’-P in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-PS. In certain embodiments, the RNAi agent comprises a 5’-PS in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-VP. In certain embodiments, the RNAi agent comprises a 5’-VP in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’- Page 55 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) E-VP in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-Z-VP in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-PS2. In certain embodiments, the RNAi agent comprises a 5’-PS2 in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-PS2. In certain embodiments, the RNAi agent comprises a 5’-deoxy-5’-C-malonyl in the antisense strand. In another embodiment, an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an asialoglycoprotein receptor (ASGPR) ligand, and (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 17, 19, and 21, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, 14 to 16, 18, and 20 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 9, 11 to 13, 15, 17, 19, 21, and 23, and 2’F modifications at positions 2, 4, 6 to 8, 10, 14, 16, 18, 20, and 22 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the dsRNA agents have a two- nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 15, 17, 19, and 21, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5’ end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2’F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two- nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, 2’-F modifications at positions 7 and 9, and a deoxy-nucleotide (e.g. dT) at position 11 (counting from the 5’ end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 7, 9, Page 56 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 11, 13, 15, 17, and 19 to 23, and 2’-F modifications at positions 2, 4 to 6, 8, 10, 12, 14, 16, and 18 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two- nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, 10, 12, 14, and 16 to 21, and 2’-F modifications at positions 7, 9, 11, 13, and 15; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 5, 7, 9, 11, 13, 15, 17, 19, and 21 to 23, and 2’-F modifications at positions 2 to 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, an RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 9, and 12 to 21, and 2’-F modifications at positions 10, and 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2’-F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, and 13, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, and 14 to 21; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5 to 7, 9, 11 to 13, 15, 17 to 19, and 21 to 23, and Page 57 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 2’-F modifications at positions 2, 4, 8, 10, 14, 16, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii)an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7 and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 8, 10 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7 and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 19 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2’-F modifications at positions 5 and 7 to 9; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 21 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 21, and 2’-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between Page 58 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 8 and 12 to 21, and 2’-F modifications at positions 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 4, 6, 8 to 11, 13, 15 to 23, and a 2’-F modification at position 14, and 2’-deoxy-modified nucleotides at positions 2, 5, 7, and 12 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand In another embodiment, a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7 and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 4, 6, 8 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 14, and 16, a 2’-deoxy-modified nucleotide at position 5, and a GNA at position 7 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two-nucleotide overhang at the 3’- end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another embodiment, a RNAi agent of the present disclosure comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7 and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 14, and 16 (counting from the 5’ end) (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and Page 59 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two- nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 7 and 9 to 11 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’- F modifications at positions 9 to 11 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 7 to 9 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 5 and 7 to 9 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 9, 11, and 13 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 9, 11, and 12 (counting from the 5’ end). In some embodiments, the sense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 1, 2, 6, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 6, 12, 14, 16, 18, and 19 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 3, 5, 10, 12, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 4, 12, 14 and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 12, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 6, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-F modifications at positions 2, 14, and 16 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has a 2’-F modification at only position 14 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has 2’-deoxy-modified nucleotides at positions 2, 5, 7, and 12 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has a 2’-deoxy-modified nucleotide only at position 5 (counting from the 5’ end). In some embodiments, the antisense strand of the RNAi agent has a GNA modified nucleotide at position 7 (counting from the 5’ end).In some embodiments, the RNAi agent only has 2’-OMe modifications and 2’-F modifications. Page 60 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In some embodiments, an ASGPR ligand is attached to the 3’-end of the sense strand. In some embodiments, an ASGPR ligand is attached to the 5’-end of the sense strand. In some embodiments, the ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker. In certain embodiments, the iRNA for use in the methods of the disclosure is an agent selected from agents listed in Tables 2-7 or 15-16. In one embodiment, the agent is AD-2217254, AD-2217251, AD-2217248, AD-2217250, AD-2217245, AD-2217252, AD-2217253, AD-2217246, AD-2217262, AD- 2217258, AD-2217255, AD-2217257, or AD-2123142. These agents may further comprise a ligand. IV. iRNAs Conjugated to Ligands Another modification of the RNA of an iRNA of the disclosure involves chemically linking to the RNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta,1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937). In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Preferred ligands will not take part in duplex pairing in a duplexed nucleic acid. Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L- Page 61 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide. Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB. In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present disclosure as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein. Ligand-conjugated oligonucleotides of the disclosure may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted Page 62 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto. The oligonucleotides used in the conjugates of the present disclosure may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives. In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present disclosure, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks. When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present disclosure are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis. A. Carbohydrate Conjugates In some embodiments of the compositions and methods of the disclosure, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8). Page 63 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the disclosure is selected from the group consisting of: HO OH O H H N N I; Page 64 of 346 WBD (US) 4891-2192-1712v1 HO OH O H HO O N Page 65 of 346 WBD (US) 4891-2192-1712v1 HO OH O O O O Page 66 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Page 67 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) ; Page 68 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Y O P O , wherein Y is O or S and n is 3-6 (Formula XXIV); X O ; Page 69 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Page 70 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) of the disclosure is a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as Page 71 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) HO OH O H H O N N O Formula I. for use in the embodiments described herein includes, HO OH O O H O O O N Y when one of X or Y is an oligonucleotide, the other is a hydrogen. In certain embodiments of the disclosure, the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a bivalent linker. In yet other embodiments of the disclosure, the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a trivalent linker. In one embodiment, the double stranded RNAi agents of the disclosure comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 3’ or 5’end of the sense strand of a dsRNA agent as described herein. In another embodiment, the double stranded RNAi agents of the disclosure comprise a plurality (e.g., 2, 3, 4, 5, or 6) of GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers. In some embodiments, for example, when the two strands of an iRNA agent of the disclosure are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3’-end of one strand Page 72 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) and the 5’-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide. Additional carbohydrate conjugates (and linkers) suitable for use in the present disclosure include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference. B. Linkers In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable. The term "linker" or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8- 16 atoms. A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the Page 73 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum). Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases. A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell. A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver- targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis. Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes. In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions). Page 74 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) v. Peptide-based cleaving groups In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide- based cleavable linking groups have the general formula – NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above. In one embodiment, an iRNA of the disclosure is conjugated to a carbohydrate through a linker. Non- limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the disclosure include, but are not limited to, Page 75 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) HO OH O O H O HO O AcHN N N H O X O Page 76 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) HO OH O O H O HO N N O X O Y Y one or an a In certain embodiments of the compositions and methods of the disclosure, a ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker. It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present disclosure also includes iRNA compounds that are chimeric compounds. “Chimeric” iRNA compounds or “chimeras,” in the context of this disclosure, are iRNA compounds, preferably dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy Page 77 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non- ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate. V. Delivery of an iRNA of the Disclosure The delivery of an iRNA of the disclosure to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a disorder of lipid metabolism) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the disclosure either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below. Page 78 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an iRNA of the disclosure (see e.g., Akhtar S. and Julian RL., (1992) Trends Cell. Biol.2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ. et al., (2004) Retina 24:132-138) and subretinal injections in mice (Reich, SJ. et al. (2003) Mol. Vis.9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther.11:267-274) and can prolong survival of tumor-bearing mice (Kim, WJ. et al., (2006) Mol. Ther.14:343-350; Li, S. et al., (2007) Mol. Ther.15:515- 523). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO. et al., (2006) Nat. Biotechnol.24:1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH. et al., (2008) Journal of Controlled Release 129(2):107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic- iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR. et al. (2003) J. Page 79 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Mol. Biol 327:761-766; Verma, UN. et al., (2003) Clin. Cancer Res.9:1291-1300; Arnold, AS et al., (2007) J. Hypertens.25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN. et al., (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS. et al., (2006) Nature 441:111-114), cardiolipin (Chien, PY. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol.26:1087-1091), polyethyleneimine (Bonnet ME. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol.71659), Arg-Gly- Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm.3:472-487), and polyamidoamines (Tomalia, DA. et al., (2007) Biochem. Soc. Trans.35:61-67; Yoo, H. et al., (1999) Pharm. Res.16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7, 427, 605, which is herein incorporated by reference in its entirety. A. Vector encoded iRNAs of the Disclosure iRNA targeting the GRB14 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non- integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292). The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively, each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure. iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration Page 80 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell. Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells’ genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are known in the art. VI. Pharmaceutical Compositions of the Disclosure The present disclosure also includes pharmaceutical compositions and formulations which include the iRNAs of the disclosure. Accordingly, in one embodiment, provided herein are pharmaceutical compositions comprising a double stranded ribonucleic acid (dsRNA) agent that inhibits expression of growth factor receptor bound protein 14 (GRB14) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1 or 3, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2 or 4; and a pharmaceutically acceptable carrier. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 1 or 3, and said antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 2 or 4. In another embodiment, provided herein are pharmaceutical compositions comprising a dsRNA agent that inhibits expression of growth factor receptor bound protein 14 (GRB14) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16; and a pharmaceutically acceptable carrier. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, Page 81 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides from any one of the antisense sequences listed in Tables 2-7 or 15-16. The pharmaceutical compositions containing the iRNA of the disclosure are useful for treating a disease or disorder associated with the expression or activity of a GRB14 gene, e.g., diabetes. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV), intramuscular (IM) or for subcutaneous delivery. Another example is compositions that are formulated for direct delivery into the liver, e.g., by infusion into the liver, such as by continuous pump infusion. The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of a GRB14 gene. In general, a suitable dose of an iRNA of the disclosure will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of an iRNA of the disclosure will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every other day to once a year. In certain embodiments, the iRNA is administered about once per week, once every 7-10 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once per month, once every 2 months, once every 3 months (once per quarter), once every 4 months, once every 5 months, or once every 6 months. After an initial treatment regimen, the treatments can be administered on a less frequent basis. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the disclosure can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein. Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a GRB14-associated disease, disorder, or condition that would benefit from reduction in the expression of GRB14, including type 2 diabetes, obesity, and obesity-associated disorders. Such models can be used for in vivo testing of RNAi agents, as well as for determining a therapeutically effective dose. Suitable rodent models are known in the art and include, for example, those described in, for example, Lutz and Woods (2012) Curr. Protoc. Pharmacol. Chapter: Unit 5.61; Barrett, et al., (2016) Disease Models and Page 82 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Mechanisms, 9:1245-55; and Xie et al. (2014) PLoS ONE 9(9): e108559 (streptozotocin-induced diabetic mice). Many experimental type 2 diabetes animal models have been established from spontaneous or experimental mutants. Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose. Additional mouse models that may be relevant to GRB14 research are known in the art and include, for example, mice and rats fed a high fat diet (HFD; also referred to as a Western diet), a methionine-choline deficient (MCD) diet, or a high‐fat (15%), high‐cholesterol (1%) diet (HFHC), an obese (ob/ob) mouse containing a mutation in the obese (ob) gene (Wiegman et al., (2003) Diabetes, 52:1081-1089); a mouse containing homozygous knock-out of an LDL receptor (LDLR -/- mouse; Ishibashi et al., (1993) J Clin Invest 92(2):883-893); diet-induced artherosclerosis mouse model (Ishida et al., (1991) J. Lipid. Res., 32:559-568); heterozygous lipoprotein lipase knockout mouse model (Weistock et al., (1995) J. Clin. Invest. 96(6):2555-2568); mice and rats fed a choline-deficient, L-amino acid-defined, high-fat diet (CDAHFD) (Matsumoto et al. (2013) Int. J. Exp. Path.94:93-103); mice and rats fed a high-trans-fat, cholesterol diet (HTF-C) (Clapper et al. (2013) Am. J. Physiol. Gastrointest. Liver Physiol.305:G483-G495); mice and rats fed a high-fat, high-cholesterol, bile salt diet (HF/HC/BS) (Matsuzawa et al. (2007) Hepatology 46:1392- 1403); and mice and rats fed a high-fat diet + fructose (30%) water (Softic et al. (2018) J. Clin. Invest.128(1)- 85-96). The pharmaceutical compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. The iRNA can be delivered in a manner to target a particular cell or tissue, such as the liver (e.g., the hepatocytes of the liver). In some embodiments, the pharmaceutical compositions of the disclosure are suitable for intramuscular administration to a subject. In other embodiments, the pharmaceutical compositions of the disclosure are suitable for intravenous administration to a subject. In some embodiments of the disclosure, the pharmaceutical compositions of the disclosure are suitable for subcutaneous administration to a subject, e.g., using a 29g or 30g needle. The pharmaceutical compositions of the disclosure may include an RNAi agent of the disclosure in an unbuffered solution, such as saline or water, or in a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. Page 83 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In one embodiment, the pharmaceutical compositions of the disclosure, e.g., such as the compositions suitable for subcutaneous administration, comprise an RNAi agent of the disclosure in phosphate buffered saline (PBS). Suitable concentrations of PBS include, for example, 1mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, 5 mM, 6.5 mM, 7 mM, 7.5.mM, 9 mM, 8.5 mM, 9 mM, 9.5 mM, or about 10 mM PBS. In one embodiment of the disclosure, a pharmaceutical composition of the disclosure comprises an RNAi agent of the disclosure dissolved in a solution of about 5 mM PBS (e.g., 0.64 mM NaH2PO4, 4.36 mM Na2HPO4, 85 mM NaCl). Values intermediate to the above recited ranges and values are also intended to be part of this disclosure. In addition, ranges of values using a combination of any of the above recited values as upper and/or lower limits are intended to be included. The pH of the pharmaceutical compositions of the disclosure may be between about 5.0 to about 8.0, about 5.5 to about 8.0, about 6.0 to about 8.0, about 6.5 to about 8.0, about 7.0 to about 8.0, about 5.0 to about 7.5, about 5.5 to about 7.5, about 6.0 to about 7.5, about 6.5 to about 7.5, about 5.0 to about 7.2, about 5.25 to about 7.2, about 5.5 to about 7.2, about 5.75 to about 7.2, about 6.0 to about 7.2, about 6.5 to about 7.2, or about 6.8 to about 7.2. Ranges and values intermediate to the above recited ranges and values are also intended to be part of this disclosure. The osmolality of the pharmaceutical compositions of the disclosure may be suitable for subcutaneous administration, such as no more than about 400 mOsm/kg, e.g., between 50 and 400 mOsm/kg, between 75 and 400 mOsm/kg, between 100 and 400 mOsm/kg, between 125 and 400 mOsm/kg, between 150 and 400 mOsm/kg, between 175 and 400 mOsm/kg, between 200 and 400 mOsm/kg, between 250 and 400 mOsm/kg, between 300 and 400 mOsm/kg, between 50 and 375 mOsm/kg, between 75 and 375 mOsm/kg, between 100 and 375 mOsm/kg, between 125 and 375 mOsm/kg, between 150 and 375 mOsm/kg, between 175 and 375 mOsm/kg, between 200 and 375 mOsm/kg, between 250 and 375 mOsm/kg, between 300 and 375 mOsm/kg, between 50 and 350 mOsm/kg, between 75 and 350 mOsm/kg, between 100 and 350 mOsm/kg, between 125 and 350 mOsm/kg, between 150 and 350 mOsm/kg, between 175 and 350 mOsm/kg, between 200 and 350 mOsm/kg, between 250 and 350 mOsm/kg, between 50 and 325 mOsm/kg, between 75 and 325 mOsm/kg, between 100 and 325 mOsm/kg, between 125 and 325 mOsm/kg, between 150 and 325 mOsm/kg, between 175 and 325 mOsm/kg, between 200 and 325 mOsm/kg, between 250 and 325 mOsm/kg, between 300 and 325 mOsm/kg, between 300 and 350 mOsm/kg, between 50 and 300 mOsm/kg, between 75 and 300 mOsm/kg, between 100 and 300 mOsm/kg, between 125 and 300 mOsm/kg, between 150 and 300 mOsm/kg, between 175 and 300 mOsm/kg, between 200 and 300 mOsm/kg, between 250 and 300, between 50 and 250 mOsm/kg, between 75 and 250 mOsm/kg, between 100 and 250 mOsm/kg, between 125 and 250 mOsm/kg, between 150 and 250 mOsm/kg, between 175 and 350 mOsm/kg, between 200 and 250 mOsm/kg, e.g., about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 295, 300, 305, 310, 320, 325, 330, 335, 340, Page 84 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, or about 400 mOsm/kg. Ranges and values intermediate to the above recited ranges and values are also intended to be part of this disclosure. The pharmaceutical compositions of the disclosure comprising the RNAi agents of the disclosure, may be present in a vial that contains about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or about 2.0 mL of the pharmaceutical composition. The concentration of the RNAi agents in the pharmaceutical compositions of the disclosure may be about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 130, 125, 130, 135, 140, 145, 150, 175, 180, 185, 190, 195, 200, 205, 210, 215, 230, 225, 230, 235, 240, 245, 250, 275, 280, 285, 290, 295, 300, 305, 310, 315, 330, 325, 330, 335, 340, 345, 350, 375, 380, 385, 390, 395, 400, 405, 410, 415, 430, 425, 430, 435, 440, 445, 450, 475, 480, 485, 490, 495, or about 500 mg/mL. In one embodiment, the concentration of the RNAi agents in the pharmaceutical compositions of the disclosure is about 100 mg/mL. Values intermediate to the above recited ranges and values are also intended to be part of this disclosure. The pharmaceutical compositions of the disclosure may comprise a dsRNA agent of the disclosure in a free acid form. In other embodiments of the disclosure, the pharmaceutical compositions of the disclosure may comprise a dsRNA agent of the disclosure in a salt form, such as a sodium salt form. In certain embodiments, when the dsRNA agents of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and/or phosphorothioate groups present in the agent. Agents in which substantially all of the phosphodiester and/or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and/or phosphorothioate linkages without a sodium counterion. In some embodiments, when the dsRNA agents of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for all of the phosphodiester and/or phosphorothioate groups present in the agent. Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the disclosure are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some Page 85 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the disclosure can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE- derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N- trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Patent 6,887,906, US Publication. No.20030027780, and U.S. Patent No. 6,747,014, each of which is incorporated herein by reference. Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients. Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self- emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma. The pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. The compositions of the present disclosure can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous or Page 86 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers. Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C1215G, that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos.4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE- PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0445131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No.5,213,804 and European Patent No. EP 0496 813 B1). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No.5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.). Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No.5,540,935 (Miyazaki et al.) and U.S. Pat. No.5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces. A. Additional Formulations i. Emulsions The compositions of the present disclosure can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1^m in diameter (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p.245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.335; Higuchi et al., in Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p.301). Page 87 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water- in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise, a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion. Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199). Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p.199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, Page 88 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) anionic, cationic and amphoteric (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.285). Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate. A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199). Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase. Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin. ii. Microemulsions In one embodiment of the present disclosure, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be a system of water, oil and amphiphile which is a Page 89 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p.271). Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil. Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Patent Nos.6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Page 90 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Patent Nos.6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present disclosure will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids. Microemulsions of the present disclosure can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present disclosure. Penetration enhancers used in the microemulsions of the present disclosure can be classified as belonging to one of five broad categories--surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of these classes has been discussed above. iii. Microparticles An RNAi agent of the disclosure may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques. iv. Penetration Enhancers In one embodiment, the present disclosure employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non- lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Page 91 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail. Surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene- 9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252). Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E. et al. Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654). The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat- soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilman’s The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp.934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington’s Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Page 92 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583). Chelating agents, as used in connection with the present disclosure, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present disclosure, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51). As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621- 626). Agents that enhance uptake of iRNAs at the cellular level can also be added to the pharmaceutical and other compositions of the present disclosure. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No.5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Page 93 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Switzerland), Transfectam® Reagent (Promega; Madison, WI), TransFast™ Transfection Reagent (Promega; Madison, WI), Tfx™-20 Reagent (Promega; Madison, WI), Tfx™-50 Reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPassª D1 Transfection Reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™/LipoGen™ (Invitrogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B- Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA), or HiFect™ (B-Bridge International, Mountain View, CA, USA), among others. Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone. v. Carriers Certain compositions of the present disclosure also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4’isothiocyano- stilbene-2,2’-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183. vi. Excipients In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers Page 94 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc). Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. vii. Other Components The compositions of the present disclosure can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present disclosure. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation. Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers. Page 95 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In some embodiments, pharmaceutical compositions featured in the disclosure include (a) one or more RNAi agents and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating a GRB14-associated disorder, e.g., type 1 diabetes, type 2 diabetes, prediabetes, insulin resistance, or diabetes-related conditions such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc. Examples of such agents include, but are not limited to, insulin (e.g., insulin detemir (Levemir), insulin glargine (Lantus)), Metformin (Glucophage), sulfonylureas, thiazolidinediones, dipeptidyl peptidase-4 inhibitors, SGLT2 inhibitors, glucagon-like peptide-1 analogs, angiotensin converting enzyme inhibitors (ACEIs), angiotensin receptor blockers (ARBs), Aliskiren (Tekturna, Rasilez), corticosteroids, protease inhibitors, orlistat (Alli, Xenical), phentermine and topiramate (Qsymia), bupropion and naltrexone (Contrave), liraglutide (Saxenda, Victoza), agents that decrease or otherwise affect the GRB14 activity, or agents that independently contribute to amelioration of symptoms and improvement of patients having a GRB14- associated disorder. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the disclosure lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the disclosure, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography. In addition to their administration, as discussed above, the iRNAs featured in the disclosure can be administered in combination with other known agents effective in treatment of pathological processes mediated by GRB14 expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein. Page 96 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) In some embodiments, the methods featured in the disclosure may utilize protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS, Green, T.W. et al., Wiley-Interscience, New York City, 1999). Briefly, protecting groups within the context of this disclosure are any group that reduces or eliminates unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group. In some embodiments an “alcohol protecting group” is used. An “alcohol protecting group” is any group which decreases or eliminates unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art. VII. Methods of the Disclosure The present disclosure also provides methods of using an iRNA of the disclosure and/or a composition of the disclosure to reduce and/or inhibit GRB14 expression in a cell, such as a cell in a subject, e.g., a hepatocyte. The methods include contacting the cell with an RNAi agent or pharmaceutical composition comprising an iRNA agent of the disclosure. In some embodiments, the cell is maintained for a time sufficient to obtain degradation of the mRNA transcript of a GRB14 gene. Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of GRB14 may be determined by determining the mRNA expression level of GRB14 using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR; by determining the protein level of GRB14 using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques. A reduction in the expression of GRB14 may also be assessed indirectly by measuring a decrease in biological activity of GRB14, e.g., a decrease in the enzymatic activity of GRB14 and/or a change in one or more associated markers of GRB14 activity (e.g., insulin receptor levels, glucose levels, HbA1c levels, etc.). In the methods of the disclosure the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject. A cell suitable for treatment using the methods of the disclosure may be any cell that expresses a GRB14 gene. A cell suitable for use in the methods of the disclosure may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non- primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human liver cell. Page 97 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) GRB14 expression is inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In preferred embodiments, GRB14 expression is inhibited by at least 20%. In one embodiment, the in vivo methods of the disclosure may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the GRB14 gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection. In some embodiments, the administration is via a depot injection. A depot injection may release the iRNA in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of GRB14, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection. In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the iRNA to the liver. An iRNA of the disclosure may be present in a pharmaceutical composition, such as in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject. Alternatively, an iRNA of the disclosure may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation. Page 98 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting. In one aspect, the present disclosure also provides methods for inhibiting the expression of a GRB14 gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets a GRB14 gene in a cell of the mammal, thereby inhibiting expression of the GRB14 gene in the cell. In some embodiment, the methods include administering to the mammal a composition comprising a dsRNA that targets a GRB14 gene in a cell of the mammal, thereby inhibiting expression of the GRB14 gene in the cell. In another aspect, the present disclosure provides use of an iRNA agent or a pharmaceutical composition of the disclosure for inhibiting the expression of a GRB14 gene in a mammal. In yet another aspect, the present disclosure provides use of an iRNA agent of the disclosure targeting a GRB14 gene or a pharmaceutical composition comprising such an agent in the manufacture of a medicament for inhibiting expression of a GRB14 gene in a mammal. Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, enzymatic activity, described herein. The present disclosure also provides therapeutic and prophylactic methods which include administering to a subject having, or prone to developing a fatty liver-associated disease, disorder, or condition, the iRNA agents, pharmaceutical compositions comprising an iRNA agent, or vectors comprising an iRNA of the disclosure. In one aspect, the present disclosure provides methods of treating a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., a GRB14-associated disease. The treatment methods (and uses) of the disclosure include administering to the subject, e.g., a human, a therapeutically effective amount of a dsRNA agent that inhibits expression of GRB14 or a pharmaceutical composition comprising a dsRNA that inhibits expression of GRB14, thereby treating the subject. In one aspect, the disclosure provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., diabetes. The methods include administering to the subject a prophylactically effective amount of dsRNA agent or a pharmaceutical composition comprising a dsRNA, thereby preventing at least one symptom in the subject. In one embodiment, the at least one symptom is a symptom of a GRB14-associated disease. The present disclosure also provides use of a therapeutically effective amount of an iRNA agent of the disclosure or a pharmaceutical composition comprising a dsRNA that inhibits expression of GRB14 for Page 99 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of GRB14 expression, e.g., a GRB14-associated disease, e.g., diabetes. In another aspect, the present disclosure provides use of an iRNA agent, e.g., a dsRNA, of the disclosure targeting a GRB14 for gene or a pharmaceutical composition comprising an iRNA agent targeting a GRB14 for gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of GRB14 for expression, e.g., a GRB14-associated disease. The present disclosure also provides use of a prophylactically effective amount of an iRNA agent of the disclosure or a pharmaceutical composition comprising a dsRNA that inhibits expression of GRB14 for preventing at least one symptom in a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., diabetes. In another aspect, the present disclosure provides use of an iRNA agent, e.g., a dsRNA, of the disclosure targeting a GRB14 gene or a pharmaceutical composition comprising an iRNA agent targeting a GRB14 gene in the manufacture of a medicament for preventing at least one symptom in a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., diabetes. Accordingly, in one aspect, the present disclosure provides methods of treating a subject having a disorder that would benefit from reduction in GRB14 expression, e.g., a GRB14-associated disease, such as diabetes. In one embodiment, the GRB14-associated disease is type 2 diabetes. In one embodiment, the GRB14-associated disease is type 1 diabetes. In one embodiment, the GRB14-associated disease is prediabetes. In one embodiment, the GRB14-associated disease is insulin resistance. In one embodiment, the GRB14-associated disease is a diabetes-related condition such as obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, stroke, etc. In another embodiment, the subject is homozygous for the GRB14 gene. Each allele of the gene may encode a functional GRB14 protein. In yet another embodiment, the subject is heterozygous for the GRB14 gene. The subject may have an allele encoding a functional GRB14 protein and an allele encoding a loss of function variant of GRB14. In some embodiments, the subject has an allele encoding the rs3923113 variant. In some ebomdiments, the subject has an allele encoding the rs10195252 variant. In some embodiments, the subject has a GIGYF1 loss of function allele. In some embodiments, the subject has a GIGYF1 rs221797 variant (e.g., rs221797:A). In some embodiments, the subject has a GIGYF1 rs117231629 variant. In some embodiments, the subject has a GIGYF2 loss of function allele. In some embodiments, the subject has a GIGYF2 rs1801251 variant (e.g., rs1801251:A). In one embodiment, a GRB14-associated disorder is type 2 diabetes (T2D), used interchangeably with type 2 diabetes mellitus (2DM) or type II diabetes. Type 2 diabetes is a chronic multifactorial polygenic disease, influenced by multilple genes and environmental factors, characterized by impaired glucose Page 100 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) intolerance due to insulin resistance or relative insulin deficiency. In the progression of diabetes, insulin secretion is increased, and a large amount of the increase in the first stage of this compensation process is due to increased β-cell mass, which is mainly achieved through an increase in β-cell number. Eventually, insulin targets such as liver, muscle and adipose tissues become insulin-resistant and pancreatic β-cells show impaired insulin secretion. Progression from normal glucose tolerance to impaired glucose tolerance to type 2 diabetes is characterized by a progressive decline in insulin secretion and plasma insulin concentration and a progressive rise in plasma glucagon concentration. Type 2 diabetic patients are also characterized by hyperglucagonaemia and enhanced hepatic glucose production in response to glucagon as the suppression of glucose production is decreased. Excessive glucose production and lipid accumulation are observed in the livers of obese patients with insulin resistance. Excessive hepatic glucose production drives hyperglycemia. Symptoms and signs of type 2 diabetes include increased thirst, frequent urination, increased hunger, fatigue, blurred vision, slow-healing sores, frequent infections, and areas of darkened skin. Uncontrolled type 2 diabetes leads to serious complications including diabetic retinopathy, diabetic vasculopathy, diabetic neuropathy, and diabetic nephropathy. Being overweight or obese is a major modifiable risk factor for type 2 diabetes, and other risk factors include physical inactivity and family history. Early stage type 2 diabetes may be controlled by dietary regimen and weight loss. In advanced stages, type 2 diabetes can be treated by medication (e.g., metformin, sulfonylureas, meglitinides) or insulin injection. In one embodiment, a GRB14-associated disorder is type 1 diabetes (T1D), also known as juvenile diabetes. Type 1 diabetes is a polygenic disease that is highly heritable and ischaracterized by no production or insufficient production of insulin by the pancreas. While the cause of type 1 diabetes is unknown, the pathophysiology involves an autoimmune destruction of the insulin-producing β-cells in the pancreas. The classic symptoms are frequent urination, increased thirst, increased hunger, and weight loss, and may include blurry vision, tiredness, and poor wound healing. Symptoms typically develop over a short period of time. Uncontrolled type 1 diabetes can lead to complications including ketoacidosis, cardiovascular disease, diabetic neuropathy, diabetic retinopathy, sexual dysfunction, and a high prevalence of urinary tract infections. Insulin injections are generally necessary for the control of type 1 diabetes. In one embodiment, a GRB14-associated disorder is prediabetes. Prediabetes may be characterized by elevated blood glucose levels that are below the threshold for type 2 diabetes, but may be an early stage of disease that progresses to type 2 diabetes. Subjects having prediabetes often have obesity (especially abdominal or visceral obesity), dyslipidemia with high triglycerides and/or low HDL cholesterol, and hypertension. Subjects with prediabetes may be at increased risk of cardiovascular disease and/or of developing type 2 diabetes. In one embodiment, a GRB14-associated disorder is insulin resistance. Insulin resistance is not entirely understood, but is characterized by reduced sensitivity of insulin-targeting tissues to insulin resulting Page 101 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) in the inability of insulin to properly regulate glucose transport and blood glucose levels. Insulin resistance is a component of type 2 diabetes and may be a component of prediabetes. Risk factors for insulin resistance include obesity, a sedentary lifestyle, and hereditary factors. Insulin resistance can generally be improved with lifestyle modifications, including diet and exercise. In one embodiment, an “iRNA” for use in the methods of the disclosure is a “dual targeting RNAi agent.” The term “dual targeting RNAi agent” refers to a molecule comprising a first dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a first target RNA, i.e., a GRB14 gene, covalently attached to a molecule comprising a second dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a second target RNA. In some embodiments of the disclosure, a dual targeting RNAi agent triggers the degradation of the first and the second target RNAs, e.g., mRNAs, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi. The dsRNA agent may be administered to the subject at a dose of about 0.1 mg/kg to about 50 mg/kg. Typically, a suitable dose will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg. The iRNA can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. Administration of the iRNA can reduce GRB14 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In a preferred embodiment, administration of the iRNA can reduce GRB14 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%. Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF- alpha or INF-alpha) levels. Alternatively, the iRNA can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of iRNA to a subject. The injections may be Page 102 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every other day or to once a year. In certain embodiments, the iRNA is administered about once per week, once every 7-10 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once per month, once every 2 months, once every 3 months once per quarter), once every 4 months, once every 5 months, or once every 6 months. In one embodiment, the method includes administering a composition featured herein such that expression of the target GRB14 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, expression of the target GRB14 gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer. Preferably, the iRNAs useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target GRB14 gene. Compositions and methods for inhibiting the expression of these genes using iRNAs can be prepared and performed as described herein. Administration of the dsRNA according to the methods of the disclosure may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with a disorder of lipid metabolism. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%. Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of diabetes may be assessed, for example, by periodic monitoring of glucose levels or HbA1c levels. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA or pharmaceutical composition thereof, "effective against" a disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients having the disorder, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement Page 103 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the disorder (e.g., diabetes) and the related causes. A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. The iRNA agent and an additional therapeutic agent and/or treatment may be administered at the same time and/or in the same combination, e.g., subcutaneously, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein. VIII. Kits The present disclosure also provides kits for performing any of the methods of the disclosure. Such kits include one or more RNAi agent(s) and instructions for use, e.g., instructions for inhibiting expression of a GRB14 in a cell by contacting the cell with an RNAi agent or pharmaceutical composition of the disclosure in an amount effective to inhibit expression of the GRB14. The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of GRB14 (e.g., means for measuring the inhibition of GRB14 mRNA and/or GRB14 protein). Such means for measuring the inhibition of GRB14 may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the disclosure may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Page 104 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) EXAMPLES Example 1. GRB14 iRNA Design, Synthesis, and Selection This Example describes methods for the design, synthesis, and selection of GRB14 iRNA agents. Nucleic acid sequences provided herein are represented using standard nomenclature. See the abbreviations of Table 1. Table 1. Abbreviations of nucleotide monomers used in nucleic acid sequence representation It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5’-3’-phosphodiester bonds. Abbreviation Nucleotide(s) A Adenosine-3’-phosphate Page 105 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Abbreviation Nucleotide(s) L961 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol (Hyp-(GalNAc- alk l)3) Experimental Methods Bioinformatics Source of reagents Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology. Transcripts A set of siRNAs targeting the human growth factor receptor bound protein 14 (GRB14) gene (human NCBI refseqID NM_004490.3; NCBI GeneID: 2888) were designed using custom R and Python scripts. All the GRB14 siRNA designs have a perfect match to the human GRB14 transcript (transcript variant 1). The human NM_004490 REFSEQ mRNA, version 3, has a length of 2,415 bases. siRNA Synthesis siRNAs were synthesized and annealed using routine methods known in the art. Page 106 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Briefly, siRNA sequences were synthesized at 1 ^mol scale on a Mermade 192 synthesizer (BioAutomation) using the solid support mediated phosphoramidite chemistry. The solid support was controlled pore glass (500 A) loaded with custom GalNAc ligand or universal solid support (AM biochemical). Ancillary synthesis reagents, 2’-F and 2’-O-Methyl RNA and deoxy phosphoramidites were obtained from Thermo-Fisher (Milwaukee, WI) and Hongene (China).2’F 2’-O-Methyl, GNA (glycol nucleic acids), 5’-phosphate and other modifications were introduced using the corresponding phosphoramidites. For all the duplex designs shown in Table 3, a 5’-phosphate was introduced at the 5’ nucleotide position of the antisense strand. Synthesis of 3’ GalNAc conjugated single strands was performed on a GalNAc modified CPG support. Custom CPG universal solid support was used for the synthesis of antisense single strands. Coupling time for all phosphoramidites (100 mM in acetonitrile) was 5 min employing 5-Ethylthio-1H-tetrazole (ETT) as activator (0.6 M in acetonitrile). Phosphorothioate linkages were generated using a 50 mM solution of 3-((Dimethylamino-methylidene) amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, MA, USA)) in anhydrous acetonitrile/pyridine (1:1 v/v). Oxidation time was 3 minutes. All sequences were synthesized with final removal of the DMT group (“DMT off”). Upon completion of the solid phase synthesis, oligoribonucleotides were cleaved from the solid support and deprotected in sealed 96 deep well plates using 200 µL Aqueous Methylamine reagents at 60°C for 20 minutes. For sequences containing 2’ ribo residues (2’-OH) that are protected with a tert- butyl dimethyl silyl (TBDMS) group, a second step deprotection was performed using TEA.3HF (triethylamine trihydro fluoride) reagent. To the methylamine deprotection solution, 200uL of dimethyl sulfoxide (DMSO) and 300ul TEA.3HF reagent was added and the solution was incubated for additional 20min at 60°C. At the end of cleavage and deprotection step, the synthesis plate was allowed to come to room temperature and was precipitated by addition of 1mL of acetontile: ethanol mixture (9:1). The plates were cooled at -80 C for 2 hrs, supernatant decanted carefully with the aid of a multi-channel pipette. The oligonucleotide pellet was re-suspended in 20mM NaOAc buffer and were desalted using a 5 mL HiTrap size exclusion column (GE Healthcare) on an AKTA Purifier System equipped with an A905 autosampler and a Frac 950 fraction collector. Desalted samples were collected in 96-well plates. Samples from each sequence were analyzed by LC-MS to confirm the identity, UV (260 nm) for quantification and a selected set of samples by IEX chromatography to determine purity. Annealing of single strands was performed on a Tecan liquid handling robot. Equimolar mixture of sense and antisense single strands were combined and annealed in 96 well plates. After combining the complementary single strands, the 96-well plate was sealed tightly and heated in an oven at 100oC for 10 minutes and allowed to come slowly to room temperature over a period 2-3 hours. The concentration of each duplex was normalized to 10^M in 1X PBS and then submitted for in vitro screening assays. Page 107 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Detailed lists of the unmodified nucleotide sequences of the sense strand and antisense strand sequences for dsRNA agents targeting GRB14 are shown in Table 2. Detailed lists of the modified nucleotide sequences of the sense strand and antisense strand sequences for dsRNA agents targeting GRB14 are shown in Table 3. Unmodified and modified nucleotide sequences of the sense strand and antisense strand sequences designed with a VP at the 5’ end of the antisense strand for dsRNA agents targeting GRB14 are shown in Tables 4 and 5, respectively. Unmodified and modified nucleotide sequences of the sense strand and antisense strand sequences designed without a VP at the 5’ end of the antisense strand for dsRNA agents targeting GRB14 are shown in Tables 6 and 7, respectively. It is to be understood that, throughout the application, a duplex name without a decimal is equivalent to a duplex name with a decimal, which merely references the batch number of the duplex. For example, AD- 2217262 is equivalent to AD-2217262.1. Table 2. Human Unmodified Sense and Antisense Strand Sequences of GRB14 dsRNA Agents Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 Page 108 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1947937 GCUGCAGACAGG 39 354-374 ATUUTUTCUCCTG 1520 352-374 Page 109 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1947961 AAAGAAAGAUCU 63 371-391 AGAACATCAAGA 1544 369-391 Page 110 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1947985 UCCGGAAAUGCC 87 389-409 AGAATAGAUGGC 1568 387-409 Page 111 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948009 UUCCAAACCCUU 111 406-426 ACUCAGGAAAAG 1592 404-426 Page 112 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948033 UACAUCUGUGUU 135 443-463 ACUGCUGACAAC 1616 441-463 Page 113 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948057 AAUUCAAGGAAA 159 480-500 AACCTGTUUUUUC 1640 478-500 Page 114 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948081 GCUUUAGAUGUA 183 534-554 ATCACUGGGUAC 1664 532-554 Page 115 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948105 ACGGCUCGAGAU 207 558-578 ATGACAAACAUC 1688 556-578 Page 116 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948129 UCAGCUGUUGAU 231 575-595 AUCUTCAGGAUC 1712 573-595 Page 117 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948153 CUCACAUAGGUG 255 640-660 ATCUTUCUACACC 1736 638-660 Page 118 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948177 ACGAACUGGUGA 279 673-693 ACACTUCAAUCAC 1760 671-693 Page 119 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948201 UUAUGCCAAAUA 303 743-763 AAGAACTCAUAU 1784 741-763 Page 120 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948225 AAACCCAAUGUA 327 767-787 AGAAAAAAAUAC 1808 765-787 Page 121 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948249 CCAGAGCAUAUG 351 786-806 AAAAGATACCAU 1832 784-806 Page 122 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948273 CUUUUGCAACUG 375 802-822 AAUUGGTUUCAG 1856 800-822 Page 123 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948297 AAAUUCAUGGUU 399 880-900 AAUGTAAGAAAC 1880 878-900 Page 124 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948321 UGCGAAAGAACA 423 899-919 ATCUTUCCCUGTU 1904 897-919 Page 125 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948345 AAGUCUUGGAAA 447 918-938 ATAAAUTUUUUTC 1928 916-938 Page 126 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948369 GAACCGCGGCAU 471 990-1010 AAACTGCAAAUG 1952 988-1010 Page 127 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948393 CAGCGAAUUUGG 495 1013-1033 ACACTATUGCCAA 1976 1011-1033 Page 128 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948417 UGGAGCACCGAC 519 1067-1087 ACAUAGTUAGUC 2000 1065-1087 Page 129 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948441 UGGAUUCUGCUU 543 1085-1105 AUAGGCTUAAAG 2024 1083-1105 Page 130 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948465 AAAAUGCUCUGU 567 1131-1151 AUCUTCTGCACAG 2048 1129-1151 Page 131 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948489 UGGGUGACCGCG 591 1170-1190 AAAUCUAAUCGC 2072 1168-1190 Page 132 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948513 UGCUUAAGUAUG 615 1189-1209 ACUGCATGCCAUA 2096 1187-1209 Page 133 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948537 UACCAGAAUUAU 639 1212-1232 AGGATGCAUAUA 2120 1210-1232 Page 134 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948561 CCAUAUCAAGGU 663 1230-1250 ACCACUTCUACCU 2144 1228-1250 Page 135 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948585 CAGGCCAGAAAA 687 1318-1338 AAACTCTGCUUUU 2168 1316-1338 Page 136 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948609 GAGUUAUAGAA 711 1333-1353 AAGUGGGAUUUT 2192 1331-1353 Page 137 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948633 ACUCGCUUGGAG 735 1382-1402 ACUUTUTUCCUCC 2216 1380-1402 Page 138 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948657 GCCACAAACAUG 759 1455-1475 ATGGAUAGCCATG 2240 1453-1475 Page 139 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948681 AUGGUUUCACCA 783 1487-1507 AAAATUTUGUGG 2264 1485-1507 Page 140 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948705 GAUGAGGCUCAG 807 1512-1532 AAUCAATCGCUG 2288 1510-1532 Page 141 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948729 GAUUAUUCAGCA 831 1529-1549 ACAAGUCCUUGC 2312 1527-1549 Page 142 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948753 UGGAGUUUUCUU 855 1553-1573 ACCCGUACCAAG 2336 1551-1573 Page 143 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948777 AAACUUUCGUAC 879 1591-1611 ACAUTGACAGUA 2360 1589-1611 Page 144 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948801 AAUGAGUCAUGG 903 1607-1627 ATUUTUTGUCCAU 2384 1605-1627 Page 145 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948825 AAGCACUUUCAA 927 1629-1649 AGGUAUAAUUUG 2408 1627-1649 Page 146 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948849 CAGUAGAAGAUG 951 1648-1668 ATUCACCGUCATC 2432 1646-1668 Page 147 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948873 GAAAUGUUCCAC 975 1665-1685 ATCCAGTGUGUGG 2456 1663-1685 Page 148 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948897 CUGGUGGAGUUC 999 1719-1739 AAGUTGAUAGAA 2480 1717-1739 Page 149 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948921 CAAUAAGGGCGU 1023 1739-1759 AAAGGAAGAACG 2504 1737-1759 Page 150 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948945 GCAAGUUGAAAC 1047 1759-1779 AACAAUAAUGUT 2528 1757-1779 Page 151 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948969 AGCCAGAAGUGA 1071 1800-1820 ATUAAUAAGUCA 2552 1798-1820 Page 152 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1948993 AUAAAAGACCAU 1095 1851-1871 ACCUTATUUAUGG 2576 1849-1871 Page 153 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-1949017 AGCAAAGACUUG 1119 1945-1965 AAGUCAAUCCAA 2600 1943-1965 Page 154 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20173671 GUUGUCAGCAGA 1143 452-472 AGAAAUAGGUCT 2624 450-472 Page 155 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20173911 AUUAAAGUAUAC 1167 501-521 ATCUTCACUGUAU 2648 499-521 Page 156 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20174151 AGCAGGGCUUUA 1191 528-548 AGGUACAUCUAA 2672 526-548 Page 157 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20174391 AGAAGAAAACAA 1215 713-733 AAGUAUAGUUUG 2696 711-733 Page 158 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20174631 CUACUAAAGGAA 1239 970-990 ACUUTGAUGUUC 2720 968-990 Page 159 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20174871 AAAAACAUGGAG 1263 1060-1080 AAGUCGGUGCUC 2744 1058-1080 Page 160 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20175111 UUGAAGAAGGAC 1287 1372-1392 ACCAAGCGAGUC 2768 1370-1392 Page 161 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20175351 GAUUUACAGAUC 1311 1699-1719 ACUGTATUAGATC 2792 1697-1719 Page 162 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20175591 GAUUGCUCUCUA 1335 1784-1804 AGGCTUGUCUAG 2816 1782-1804 Page 163 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20175831 UAUUGAAGGAA 1359 1822-1842 ATGAGUCCUUUTC 2840 1820-1842 Page 164 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20176071 UUUCACCUGCAA 1383 1901-1921 ATUUGUAACUUG 2864 1899-1921 Page 165 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20176311 AAUGACUUGGUG 1407 2015-2035 ACAAGAACACAC 2888 2013-2035 Page 166 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20176551 CAUAUUUAAAAC 1431 2074-2094 AGGAGACAUGUT 2912 2072-2094 Page 167 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20176801 AAUAAAUUGGG 1455 2141-2161 ATUCCUGACUCCC 2936 2139-2161 Page 168 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20177041 AAACUAUCCACA 1479 2238-2258 ATAACAGGUUGT 2960 2236-2258 Page 169 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5’ SEQ ID Range in Antisense Sequence SEQ ID Range in to 3’ NO: NM_004490.3 5’ to 3’ NO: NM_004490.3 AD-20177321 AUGUUGAUUUU 1503 2358-2378 ATACCUGGAAAA 2984 2356-2378 Table 3. Human Modified Sense and Antisense Strand Sequences of GRB14 dsRNA Agents Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: Page 170 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1947941 u ca aCfaGfGfAf 3005 PaUfcudTu(T n)uucuc 4486 GCUGCAGACAGGA 5967 Page 171 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1947965 a aaa auCfUfUf a 3029 PadC dAadCaucadA 4510 AAAGAAAGAUCUU 5991 Page 172 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1947989 aaau cCfAfUfc 3053 PadTu dGadAua adT 4534 CCGGAAAUGCCAU 6015 Page 173 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948013 caaacccuUfUfUfcc 3077 PadTa dCudCa adAa 4558 UCCAAACCCUUUU 6039 Page 174 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948037 uauuucCfcAfAfAf 3101 PaUf adAu(T n)u cuu 4582 CCUAUUUCCCAAA 6063 Page 175 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948061 ucaa aaAfAfAfac 3125 PadAucdAcdCu uudT 4606 AUUCAAGGAAAAA 6087 Page 176 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948085 ua au uaCfCfCfa 3149 PadTaudGudCacu dG 4630 UUUAGAUGUACCC 6111 Page 177 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948109 cuc aGfaUfGfUf 3173 PaAf cdT (A n)caaac 4654 CGGCUCGAGAUGU 6135 Page 178 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948133 cu uu aUfCfCfu 3197 PadGaudTcdTuca dGa 4678 CAGCUGUUGAUCC 6159 Page 179 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948157 cacauaGf UfGfUf 3221 PaGfuudCu(T n)ucuac 4702 CUCACAUAGGUGU 6183 Page 180 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948181 aacu GfuGfAfUf 3245 PaAf cdAc(T n)ucaau 4726 ACGAACUGGUGAU 6207 Page 181 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948205 u ccaaauAfUfGfa 3269 PadTaadA dAacucdA 4750 UAUGCCAAAUAUG 6231 Page 182 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948229 ccaau uaUfUfUfu 3293 PadTcudG dAaaaadAa 4774 ACCCAAUGUAUUU 6255 Page 183 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948253 a cauauGfGfUfa 3317 PadGcadAadA auadC 4798 CAGAGCAUAUGGU 6279 Page 184 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948277 u ca aUf UfUfUf 3341 PaUf adAc(T n)ca aa 4822 UUUGCAGAUGUUU 6303 Page 185 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948301 uucau uUfUfCfu 3365 PadC cdAudGuaa dA 4846 AAUUCAUGGUUUC 6327 Page 186 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948325 aaa aAfcAfGfGf 3389 PaAfcudTc(T n)uuccc 4870 GCGAAAGAACAGG 6351 Page 187 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948349 cuuuuuucUfAfAf 3413 PadCa dAudCuucudT 4894 UACUUUUUUCUAA 6375 Page 188 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948373 c cauuuGfCfAf 3437 PadCu dAadAaacudG 4918 CGCGGCAUUUGCA 6399 Page 189 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948397 c aauuu GfCfAfa 3461 PadTaudCadCuauudGc 4942 AGCGAAUUUGGCA 6423 Page 190 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948421 cacc acUfAfAfcu 3485 PadAaudCcdAua udT 4966 GAGCACCGACUAA 6447 Page 191 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948445 uucu cuuUfAfAf 3509 PadTu dTudA cudTa 4990 GAUUCUGCUUUAA 6471 Page 192 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948469 au cucUf UfGfCf 3533 PaUfcudTc(T n)ucu c 5014 AAAUGCUCUGUGC 6495 Page 193 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948493 u acc cGfAfUfu 3557 PadA cdAadTcuaadTc 5038 GGGUGACCGCGAU 6519 Page 194 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948517 uaa uau GfCfAfu 3581 PadAcadGcdT caudGc 5062 CUUAAGUAUGGCA 6543 Page 195 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948541 ca aauuaUfAfUf 3605 PadTaudG dAu cadTa 5086 ACCAGAAUUAUAU 6567 Page 196 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948565 ca uucaCfAfGfa 3629 PadT adTadT cucdT 5110 CUGCAGUUCACAG 6591 Page 197 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948589 cca aaaAfGfCfa 3653 PadTaudAadCucu dC 5134 AGGCCAGAAAAGC 6615 Page 198 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948613 uuaua AfaAfAfUf 3677 PaUfucdA (T n) au 5158 AGUUAUAGAAAAU 6639 Page 199 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948637 c cuu aGfGfAfa 3701 PadAucdCudTuuuudC 5182 CUCGCUUGGAGGA 6663 Page 200 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948661 cacaaacaUfGfGfcu 3725 PadG udG dAua cdC 5206 GCCACAAACAUGG 6687 Page 201 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948685 uuucaccaCfAfAfaa 3749 PadCuadGadAauuudT 5230 GGUUUCACCACAA 6711 Page 202 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948709 u a cUfcAfGfCf 3773 PaUfaadTc(A n)auc c 5254 GAUGAGGCUCAGC 6735 Page 203 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948733 uauuca cAfAfGf 3797 PadCcadCadA uccdTu 5278 AUUAUUCAGCAAG 6759 Page 204 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948757 uuuucuu GfUfAfc 3821 PadAcudAudCcc udA 5302 AGUUUUCUUGGUA 6783 Page 205 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948781 cuuuc uaCfUfGfu 3845 PadAcudCadTu acdA 5326 AACUUUCGUACUG 6807 Page 206 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948805 u a ucauGfGfAfc 3869 PadTaudTudTuu udCc 5350 AAUGAGUCAUGGA 6831 Page 207 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948829 cacuuucaAfAfUfu 3893 PadAcudG dTauaadTu 5374 AGCACUUUCAAAU 6855 Page 208 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948853 ua aa auGfAfCf 3917 PadCaudTudCacc dTc 5398 AGUAGAAGAUGAC 6879 Page 209 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948877 au uuccaCfAfCfac 3941 PadTcadTcdCa u dT 5422 AAAUGUUCCACAC 6903 Page 210 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948901 u aGfuUfCfUf 3965 PaUf adGu(T n) aua 5446 CUGGUGGAGUUCU 6927 Page 211 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948925 aa cGfuUfCfUf 3989 PaUfu dCa(A n) aa 5470 AUAAGGGCGUUCU 6951 Page 212 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948949 uu aaacAfUfUfa 4013 PadTa dCadCaauadAu 5494 AAGUUGAAACAUU 6975 Page 213 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948973 a aa u aCfUfUfa 4037 PadTa dTudTaauadA 5518 CCAGAAGUGACUU 6999 Page 214 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1948997 ccau uGfaAfAfAf 4061 PaAfaudAc(A n)uucu 5542 UACCAUGUGAAAA 7023 Page 215 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-1949021 aaa acuuGfGfAfu 4085 PadTaadA dTcaaudCc 5566 GCAAAGACUUGGA 7047 Page 216 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20173711 uca ca aCfCfUfau 4109 PadTu dG dAaauadG 5590 UGUCAGCAGACCU 7071 Page 217 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20173951 aa uauacAfGfUf 4133 PadTucdAudCuucadC 5614 UAAAGUAUACAGU 7095 Page 218 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20174191 aacaauaGfAfAf a 4157 PadTucdGudG ucudT 5638 AAGAACAAUAGAA 7119 Page 219 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20174431 u a uucaAfGfCfa 4181 PadA dAudAu u dC 5662 UCUGAGUUCAAGC 7143 Page 220 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20174671 uaaa aaCfAfUfca 4205 PadGuudCcdTuu adT 5686 ACUAAAGGAACAU 7167 Page 221 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20174911 u aa cccUfUfUfca 4229 PadCc dCadAcu adA 5710 ACUGAAGCCCUUU 7191 Page 222 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20175151 a aa acUfCfGfcu 4253 PadTccdTcdCaa cdGa 5734 GAAGAAGGACUCG 7215 Page 223 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20175391 uaca aucUfAfAfu 4277 PadCcadGcdT uaudTa 5758 UUUACAGAUCUAA 7239 Page 224 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20175631 cucucuaGfAfCfaa 4301 PadTucdT dGcuu dTc 5782 UUGCUCUCUAGAC 7263 Page 225 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20175871 aa aaaAfGfGfac 4325 PadTucdTudGa ucdCu 5806 UUGAAGGAAAAGG 7287 Page 226 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20176111 u caa uuAfCfAfa 4349 PadCuadTudTuuuudG 5830 CCUGCAAGUUACA 7311 Page 227 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20176351 acuu u UfGfUfu 4373 PadCacdAcdAa aadCa 5854 UGACUUGGUGUGU 7335 Page 228 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20176591 uuuaaaacAfUfGfu 4397 PadTaadG dGa acdA 5878 UAUUUAAAACAUG 7359 Page 229 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20176841 aauu aGfUfCfa 4421 PadAuudAudTccu dA 5902 UAAAUUGGGAGUC 7383 Page 230 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Sense Sequence SEQ ID Antisense Sequence 5’ SEQ ID mRNA Target SEQ ID Duplex ID 5’ to 3’ NO: to 3’ NO: Sequence 5’ to 3’ NO: AD-20177081 uauccacaAfCfCfu 4445 PadTcadTudAaca dGu 5926 ACUAUCCACAACC 7407 Page 231 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Table 4. Human GRB14 Unmodified Sense and Antisense Sequences Designed for VP Modification Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD 21229761 AAUUAUAUGCA 7430 1218 UUGAUAUGGAUG 7698 1216 Page 232 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21229991 GCUUGGAGGAA 7453 1386- UCAUCCUUUUUU 7721 1384- Page 233 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21230241 CAAAACUUUCG 7477 1589- UUUGACAGUACG 7745 1587- Page 234 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21230481 UCCUUGCAAGU 7501 1754- UAAUGUUUCAAC 7769 1752- Page 235 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21230721 CCAGAAGUGAC 7525 1802- UGUUTAAUAAGT 7793 1800- Page 236 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21230961 AAAUAAGCAAA 7549 1940- UAUCCAAGUCUU 7817 1938- Page 237 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21231201 ACUUGGAUUGA 7573 1952- UAAUGUAAAGUC 7841 1950- 1 1 2 2 3 3 3 Page 238 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21231441 AAUACAGCUGG 7597 1712- UAGAACUCCACC 7865 1710- 3 3 9 9 6 6 8 8 9 9 0 0 Page 239 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21231681 AGAUGUUUCUG 7621 850- UGCUUGAACUCA 7889 848-870 0 0 2 2 2 4 4 4 4 4 4 9 9 9 3 3 3 4 4 4 0 0 0 Page 240 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21231921 GGAAAGAAGUC 7645 912- UUUUUUCCAAGA 7913 910-932 2 2 3 3 3 4 4 8 8 9 9 Page 241 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21232161 UUUCAGCGAAU 7669 1010- UUAUUGCCAAAU 7937 1008- Page 242 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ Range to 3' ID NO 5' to 3' ID NO AD-21232401 UGUACCAGAAU 7693 1210- UAUGCAUAUAAU 7961 1208- Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO Page 243 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21229921 asasa caGfaGfUf 7982 VPusAfsuuuUfcuauaa 8250 GAAAAGCAGAGU 8518 Page 244 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21230171 us s uuucaCfCfA 8006 VPusdGsaadAudTuu 8274 CAUGGUUUCACC 8542 Page 245 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21230411 ususcuucCfuUfGf 8030 VPusUfsuudCa(A n)c 8298 CGUUCUUCCUUG 8566 Page 246 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21230651 usasuu u cUfAfG 8054 VPusdAs adGcdAauc 8322 AUUAUUGUGCUA 8590 Page 247 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21230891 asasaaaaAfuAfGf 8078 VPusAfsau Cfacaaacu 8346 ACAAAAAAAUAG 8614 Page 248 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21231131 asas acuu GfAfU 8102 VPusdGsuadAadGuca 8370 CAAAGACUUGGA 8638 Page 249 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21231371 csasuaucCfuGfAf 8126 VPusAfsccaUf aauuu 8394 CACAUAUCCUGA 8662 Page 250 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21231611 cscsa a caUfAfUf 8150 VPusdAsaadGadTacca 8418 UUCCAGAGCAUA 8686 Page 251 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21231851 ususcau GfuUfUf 8174 VPusCfs cdAudAuaa 8442 AAUUCAUGGUUU 8710 Page 252 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21232091 scsauuuGfcAfGf 8198 VPusCfs cdT (A n)a 8466 CGGCAUUUGCAG 8734 Page 253 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA target SEQ 5' to 3' ID NO 5' to 3' ID NO sequence ID NO AD-21232331 us sca cUf UfAf 8222 VPusAfsuaaUfucu u 8490 CAUGCAGCUGUA 8758 a e . uman nmo e ense an n sense equences esgne ou Modification Duplex ID Sense Sequence 5' SEQ Range Antisense Sequence SEQ ID Range to 3' ID NO 5' to 3' NO Page 254 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) AD-2217253.1 UUGACUUUACA 8778 1959- UAAUGATGAAUG 8792 1957- UUCAUCAUUA 1979 UAAAGUCAAUC 1979 AD-22172541 UAUCCUGAAAU 8779 873-893 UAAACCAUGAAT 8793 871-893 3 3 8 Modification Duplex ID Sense Sequence SEQ Antisense Sequence SEQ mRNA Target SEQ 5' to 3' ID NO 5' to 3' ID NO Sequence ID NO Page 255 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Example 2. In vitro screening methods This Example describes in vitro Hep3B, Primary Human Hepatocytes, and Primary Cynomolgus Hepatocytes screening. Cell culture and transfections: Hep3B cells (ATCC, Manassas, VA) were grown to near confluence at 37°C in an atmosphere of 5% CO2 in Eagle’s Minimum Essential Medium (Gibco) supplemented with 10% FBS (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 14.7 µl of Opti-MEM plus 0.3 µl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778-150) to 5 µl of each siRNA duplex to an individual well in a 96-well plate with 4 replicates of each siRNA duplex. The mixture was then incubated at room temperature for 15 minutes. Eighty µl of complete growth media without antibiotic containing ~1.5 x104 Hep3B cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Multi-dose experiments were performed at 10 nM, 1 nM, and 0.1 nM final duplex concentration. Primary Human Hepatocytes (BioIVT) were transfected by adding 4.9^l of Opti-MEM plus 0.1^l of RNAiMAX per well (Invitrogen, Carlsbad CA. cat # 13778-150) to 5^l of siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubated at room temperature for 15 minutes. Thirty-five ^l of InVitroGRO CP plating media (BioIVT) containing ~15 x103 cells were then added to the siRNA mixture. Cells were incubated for 48 hours prior to RNA purification. Multi-dose experiments were performed at 250nM, 100nM, 10 nM, and 1 nM. Primary Cynomolgus Hepatocytes (BioIVT) were transfected by adding 4.9^l of Opti-MEM plus 0.1^l of RNAiMAX per well (Invitrogen, Carlsbad CA. cat # 13778-150) to 5^l of siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubated at room temperature for 15 minutes. Thirty-five ^l of InVitroGRO CP plating media (BioIVT) containing ~5 x103 cells were then added to the siRNA mixture. Cells were incubated for 48 hours prior to RNA purification. Multi-dose experiments were performed at 250nM, 100nM, 10 nM, and 1 nM. Free uptake: Free uptake assays were performed to assess the pharmacodynamic properties of the siRNAs. Free uptake assay was performed similarly to the transfection assay without using Lipofectamine RNAimax and cells were incubated for 48 hours prior to the RNA purification. Experiments were performed essentially as described in Agarwal S., Nucleic Acid. Ther. (2021) 31(4):309-315. Dose response experiments were performed at various final duplex concentrations. Page 256 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) LogIC50 assay: The IC50 experiments were then performed to characterize the potency of each siRNA duplex by determining the concentration at which 50% of the mRNA was remaining. Free uptake assays or transfection assays of PHH or PCH cells were performed as described above, except various log concentrations of selected siRNA duplexes were used in the assays. The percent of message remaining was determined and the LogIC50 was calculated. Total RNA isolation using DYNABEADS mRNA Isolation Kit: RNA is isolated using an automated protocol on a BioTek-EL406 platform using DYNABEADs (Invitrogen, cat#61012). Briefly, 70ul of Lysis/Binding Buffer and 10ul of lysis buffer containing 3µl of magnetic beads are added to the plate with cells. Plates were incubated on an electromagnetic shaker for 10 minutes at room temperature and then magnetic beads are captured and the supernatant is removed. Bead- bound RNA is then washed 2 times with 150ul Wash Buffer A and once with Wash Buffer B. Beads are then washed with 150µl Elution Buffer, re-captured and supernatant removed. cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813): Ten µl of a master mix containing 1^l 10X Buffer, 0.4µl 25X dNTPs, 1^l 10x Random primers, 0.5^l Reverse Transcriptase, 0.5^l RNase inhibitor and 6.6^l of H2O per reaction are added to RNA isolated above. Plates are sealed, mixed, and incubated on an electromagnetic shaker for 10 minutes at room temperature, followed by 2h at 37oC. Real time PCR: Two µl of cDNA and 5µl Lightcycler 480 probe master mix (Roche Cat # 04887301001) are added to 0.5µl of Human GAPDH TaqMan Probe (4326317E) and 0.5µl GRB14 Human probe (Hs00182949_m1, Thermo), or 0.5µl Cyno GAPDH (custom) and 0.5µl GRB14 Cyno probe per well in a 384 well plates (Roche cat # 04887301001). Real time PCR is done in a LightCycler480 Real Time PCR system (Roche). Each duplex is tested at least two times and data are normalized to cells transfected with a non-targeting control siRNA. To calculate relative fold change, real time data is analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with a non-targeting control siRNA. The data are expressed as percent GRB14 mRNA remaining relative to control (e.g., GAPDH mRNA). The results of a multi-dose screening assay in Hep3B cells are shown in Table 8. The results of a multi-dose free uptake assay in PCH cells are shown in Table 9. The results of a multi-dose free uptake assay in PHH cells are shown in Table 10. The results of IC50 assays in PCH and PHH cells are shown in Tables 11 and 12. Page 257 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Table 8. Multi-dose In vitro Screening of GRB14 dsRNA agents in Hep3B Cells 10nM 1nM 0.1nM % mRNA % mRNA % mRNA V 0 7 0 8 0 5 0 0 6 3 9 5 8 4 4 6 3 6 4 0 6 9 0 9 7 3 8 9 3 9 9 3 5 3 4 5 1 Page 258 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 9 8 2 4 2 7 9 8 6 9 6 1 2 9 6 1 7 7 5 0 6 8 2 8 6 7 7 8 5 1 8 4 0 5 4 0 7 4 6 1 Page 259 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 0 8 4 8 0 2 4 5 3 3 4 2 1 5 9 4 6 2 6 7 3 6 0 2 6 8 6 8 2 8 9 8 7 4 1 6 6 7 7 0 Page 260 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 7 1 3 9 2 5 2 5 5 0 2 9 2 6 9 4 6 1 5 1 6 3 5 7 4 4 4 6 7 3 5 5 1 6 8 9 5 9 8 1 Page 261 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 3 1 1 9 3 4 7 5 4 8 6 3 1 6 1 9 2 6 7 4 3 4 4 4 9 4 5 1 6 0 9 2 7 1 2 8 0 2 7 1 Page 262 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 7 4 8 6 4 1 5 4 3 7 3 6 6 2 8 7 4 6 3 7 6 6 8 9 5 5 9 5 2 6 6 7 3 6 2 5 1 1 8 4 Page 263 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 4 3 4 2 2 7 5 7 3 0 8 7 5 3 6 5 0 5 0 3 9 7 7 4 5 0 2 6 6 5 5 4 9 2 8 2 7 5 3 2 Page 264 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 6 7 4 0 5 9 9 4 9 6 8 6 8 8 6 2 9 3 5 4 9 6 8 1 3 4 4 5 5 7 3 2 7 9 9 3 1 1 4 5 Page 265 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 1 4 7 3 7 1 6 5 3 3 9 7 5 5 5 9 7 3 5 4 1 8 3 3 3 0 9 9 6 5 1 8 9 6 9 5 5 0 8 9 Page 266 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 3 4 6 4 6 5 5 9 6 6 8 8 0 9 9 7 7 5 8 4 7 3 6 6 2 6 2 5 3 3 9 8 4 9 8 1 2 8 6 2 Page 267 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 7 5 5 0 1 8 8 8 2 7 3 0 5 5 9 5 1 3 4 2 3 9 9 7 2 4 4 4 2 7 8 5 0 7 5 4 2 6 3 0 Page 268 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 1 3 7 6 9 7 5 5 2 5 0 9 5 1 0 1 7 2 3 3 0 6 3 8 9 4 9 6 0 7 6 3 1 9 1 9 7 0 5 3 Page 269 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 1 9 7 2 1 6 6 8 4 7 0 8 1 8 4 3 5 7 4 5 9 5 6 6 8 4 1 8 5 6 8 9 3 0 4 0 7 9 5 0 Page 270 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 9 2 1 0 0 3 5 7 6 4 2 9 0 1 3 0 2 1 2 7 5 0 9 9 3 5 0 4 1 3 0 7 1 9 3 1 1 1 2 Page 271 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 2 7 7 3 7 4 0 6 0 1 3 8 1 1 2 0 9 2 0 8 0 8 5 2 0 7 8 4 8 0 7 5 5 6 3 6 3 8 1 7 Page 272 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 1 6 2 8 2 9 0 7 8 7 4 6 6 5 5 9 2 3 7 9 7 4 1 6 5 0 1 7 1 9 3 5 9 8 2 9 9 1 6 7 Page 273 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 9 0 8 6 6 5 4 6 3 4 7 7 0 4 7 8 9 3 6 2 9 7 1 5 8 6 5 3 7 3 8 8 8 6 0 5 0 7 9 Page 274 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 5 1 7 1 7 6 6 4 5 9 2 3 2 0 1 9 9 2 6 0 2 6 2 8 9 8 1 0 0 9 3 8 3 8 4 0 2 3 7 0 Page 275 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 4 1 7 0 9 6 7 9 2 8 1 1 7 5 2 4 5 6 6 0 7 1 7 9 0 9 2 8 8 8 4 0 2 7 9 2 6 0 9 Page 276 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 1 8 8 6 8 0 8 0 2 0 6 8 6 4 0 9 7 2 2 1 0 8 5 6 6 4 8 6 0 8 0 1 4 7 4 0 0 8 4 3 Page 277 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 9 9 7 7 2 7 3 2 8 0 8 7 0 9 8 5 2 8 8 2 9 7 7 8 4 8 5 7 5 9 3 8 9 3 9 8 4 6 7 6 Page 278 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 1 3 6 7 0 3 9 6 8 8 9 7 7 6 7 5 9 8 8 7 5 3 6 9 8 8 9 9 9 1 7 9 2 7 0 8 0 9 6 0 Page 279 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 4 2 7 5 6 8 8 7 7 3 7 5 2 6 3 2 8 6 8 7 0 7 2 5 4 3 6 3 3 3 6 1 1 4 8 8 9 4 5 4 Page 280 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 3 7 6 5 8 9 9 5 8 8 9 8 4 8 8 7 1 5 6 1 8 6 9 1 4 4 5 0 1 6 0 7 7 6 6 5 1 0 7 Page 281 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 3 9 9 8 3 1 0 8 7 9 7 9 0 4 2 6 1 9 6 0 0 7 6 7 0 7 8 0 6 2 8 8 7 3 0 9 5 0 5 Page 282 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 6 7 3 5 1 7 0 3 6 6 8 5 8 7 8 4 5 8 7 7 2 0 8 9 0 4 7 7 6 7 3 3 6 6 0 2 0 0 8 7 Page 283 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 6 7 6 8 7 5 6 8 8 8 9 0 8 0 7 9 7 0 9 1 6 9 5 1 6 3 2 0 0 4 7 7 9 8 9 7 8 8 0 7 Page 284 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 5 1 3 9 5 2 8 0 0 0 8 6 1 1 9 0 9 1 1 5 2 2 9 7 7 6 9 1 9 7 2 9 3 9 4 1 8 0 3 8 Page 285 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 5 4 3 1 2 2 9 8 0 2 2 6 4 5 7 2 9 5 6 8 9 7 4 0 0 6 6 0 5 7 6 0 2 6 3 1 7 2 6 6 Page 286 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 6 8 7 1 2 3 7 4 3 9 6 0 3 7 4 8 7 5 1 0 5 3 6 7 1 4 2 8 2 7 4 4 8 7 2 3 6 6 0 Page 287 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 0 1 6 8 7 2 8 7 2 6 2 0 3 4 0 9 8 5 5 7 5 6 9 8 6 3 0 5 2 2 8 8 4 2 1 8 6 4 6 1 Page 288 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 9 9 4 5 6 0 9 9 2 5 2 6 8 2 5 9 3 8 6 5 5 6 9 9 0 0 1 7 0 2 2 5 8 3 6 8 2 3 9 1 Page 289 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 4 9 4 2 5 3 1 7 7 6 4 9 6 7 5 5 0 2 9 9 1 7 1 2 8 4 6 7 2 1 5 0 2 9 3 5 7 5 7 6 Page 290 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 4 4 6 2 6 4 3 5 5 6 6 1 7 8 2 1 6 5 6 9 6 5 6 9 7 5 4 4 8 8 7 8 5 6 8 9 5 2 5 6 Page 291 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 1 6 7 6 0 8 8 0 9 3 6 9 7 7 5 0 3 0 6 5 5 6 2 7 4 6 3 1 7 8 6 5 5 0 7 6 7 7 6 1 Page 292 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 6 8 2 0 5 0 7 6 6 2 8 6 3 9 3 1 0 9 1 4 3 7 5 4 0 7 6 5 3 0 6 4 8 5 2 4 5 0 4 Page 293 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 10nM 1nM 0.1nM % mRNA % mRNA % mRNA 8 2 1 3 9 4 5 6 3 4 7 3 8 0 2 8 9 4 0 3 6 5 4 5 0 4 0 7 4 3 1 5 0 2 2 3 Page 294 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Table 9. Multi-Dose In vitro Screen Free-Uptake of GRB14 dsRNA Agents in PCH Cells 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 5 43 6 27 7 7 9 9 8 4 7 6 3 4 1 8 3 13 15 5 5 4 4 5 2 5 8 6 11 3 6 13 4 2 21 10 7 3 5 Page 295 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 12 6 3 3 2 9 19 8 11 10 9 5 4 6 6 6 5 5 4 8 4 12 7 5 27 3 2 2 7 8 3 6 11 8 5 9 6 10 8 1 Page 296 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 6 9 4 10 11 8 8 7 10 7 7 19 15 16 14 10 9 6 19 2 12 1 13 12 10 7 8 13 5 10 1 3 12 11 6 7 13 8 8 4 Page 297 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 6 7 4 2 11 1 8 4 4 3 2 4 5 9 7 9 5 2 7 10 3 16 8 3 8 5 7 3 7 10 8 5 2 16 10 12 9 16 12 8 Page 298 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 2 4 10 7 8 3 9 9 10 9 9 12 5 2 6 4 8 12 8 2 3 7 9 5 13 12 16 9 23 4 11 11 51 42 17 7 23 4 21 9 Page 299 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 7 15 9 9 21 13 3 9 2 12 1 11 8 13 11 8 8 3 4 6 7 7 10 9 13 5 9 70 13 7 7 3 3 8 7 4 7 4 15 6 Page 300 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 8 7 8 1 4 4 3 6 7 4 6 8 12 5 9 4 11 8 3 1 13 3 6 5 6 5 6 9 8 Table 10. Multi-Dose In vitro Screen Free-Uptake of GRB14 dsRNA Agents in PHH Cells 250nM 100nM 10nM 1nM V 9 10 4 7 10 7 Page 301 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 3 3 8 1 8 14 9 8 2 7 9 8 5 3 6 8 14 9 6 15 18 19 3 3 4 8 6 3 5 6 9 8 13 8 5 4 11 13 12 5 Page 302 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 4 10 8 10 11 8 20 15 16 12 14 20 7 12 4 5 3 4 8 6 4 9 4 8 9 9 9 7 3 6 11 12 4 8 12 6 8 9 7 9 Page 303 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 20 10 10 4 1 8 13 9 10 10 4 4 7 9 6 11 11 6 8 11 5 7 8 5 5 9 5 5 13 6 1 6 5 15 8 8 7 1 4 7 Page 304 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 8 14 9 12 3 3 7 6 5 3 4 5 4 8 3 1 5 6 6 9 5 6 7 7 2 4 9 10 15 15 7 7 7 10 8 8 9 7 6 8 Page 305 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 4 15 9 4 8 11 8 9 6 6 13 7 8 3 7 11 8 6 12 13 6 12 7 6 20 2 4 1 21 13 19 14 11 18 22 3 12 9 12 18 Page 306 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 27 20 5 17 26 4 13 31 8 12 21 19 11 32 18 15 20 6 21 26 12 14 14 2 18 18 8 10 6 14 27 19 27 29 8 16 22 17 9 20 Page 307 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 250nM 100nM 10nM 1nM % mRNA % mRNA % mRNA % mRNA V 14 23 22 21 16 11 5 3 4 6 18 7 13 12 7 11 4 18 14 5 1 9 Table 11. GRB14 dsRNA IC50 Analysis: Free Uptake Assay in PCH and PHH Cells PCH PHH % Message % Message Page 308 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 309 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 310 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 311 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 312 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 313 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Table 12. GRB14 dsRNA IC50 Analysis: Transfection of PCH and PHH Cells PCH PHH Page 314 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 315 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 316 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 317 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 318 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 319 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) PCH PHH % Message % Message Duplex ID Conc. (nM) STDEV STDEV Page 320 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Example 3. In vivo Screening in Mice A study was performed in PXB-mice. Mice were dosed with a single injection of 5 mg/kg of AD-2217254.2, AD-2217251.2, AD-2217248.2, AD-2217250.2 , AD-2217245.2, AD-2217252.2, AD- 2217253.2, AD-2217246.2, AD-2217262.2, AD-2217258.2, AD-2217255.2, AD-2217257.2, 10 mg/kg 3 times per week of AD-2123142.6, 10 mg/kg 2 times per week of AD-2123142.6, or PBS (control) by subcutaneous injection (n=4 per group). A liver sample was collected on Day 21 and analyzed for mRNA and protein levels. mRNA levels were measured by hGRB14 qPCR and protein levels were measured by LC-MS. Table 13 shows the average percent mRNA remaining on Day 21. Table 13. Average Percent Remanining of GRB14 mRNA Duplex Dose Frequency Avg % mRNA SD remaining Page 321 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) FIG.1 shows the percent of GRB14 mRNA and protein remaining, respectively, relative to the PBS mean of AD-2217245 (5 mpk), AD-2217246 (5 mpk), AD-2217252 (5 mpk), AD-2217262 (5 mpk), and AD-213142 (10 mpk x3). Example 4. In vivo Screening in Non-Human Primates Duplexes AD-2217245, AD-2217246, AD-2217252, AD-2217257, and AD-2217262 with human/cynologous cross-reactivity were further investigated for their effectiveness in non-human primates. A single dose of 3 mg/kg of AD-2217245, AD-2217246, AD-2217252, AD-2217257, and AD- 2217262 was subcutanesouly administered to cynologous monkeys. A single dose of 20 mg/kg of AD- 2217245 was also subcutanesouly administered to cynologous monkeys. The experimental design is shown in Table 14. Sera and tissue samples were collected at Days 22 and 57. mRNA was extracted from liver tissue by a magnetic bead-based extraction method. Taqman probe-based qPCR was used to quantify GRB14 mRNA which was normalized to the geometric mean of a housekeeping gene. Targeted quantitation of GRB14 protein in cynomolgus monkey liver was performed via liquid chromatography coupled to mass spectrometer (LC-MS). The signature peptide sequence selected for quantitation was ALDVPSDITAR (SEQ ID NO: 8855). FIG.2 shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 mRNA at Day 22 post-dose. FIG.3 shows the effect of administration of a single 20 mg/kg dose and 3 mg/kg dose of the selected duplexes on the level of GRB14 protein at Day 22 and Day 57 post-dose. AD-2217245 at 3 mg/kg gave a protein knockdown of 89% at Day 22 and 80% at Day 57. AD-2217245 at 20 mg/kg gave a protein knockdown of 92% at Day 22 and Day 57. Table 14. Experimental Design Dose Dose Volume Dose Concentration No. of Page 322 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) Example 5. In vivo Screening in Mouse Models for Diabetes and Obesity Additional siRNAs were designed, synthesized, and prepared using methods known in the art and described above in Example 1. siRNAs targeting the mouse GRB14 gene (NCBI reference NM_016719.1) were also designed using custom R and Python scripts. The mouse NM_016719.1 mRNA has a length of 1978 bases. A detailed list of the additional unmodified sense and antisense strand sequences of GRB14 dsRNA agents targeting NM_016719.1 mRNA are shown in Table 15. A detailed list of the additional modified sense and antisense strand sequences of GRB14 dsRNA agents targeting NM_016719.1 mRNA are shown in Table 16. Table 15. Unmodified Sense and Antisense Strand Sequences of GRB14 dsRNA Agents Duplex Sense Strand SEQ Antiense Strand SEQ ID Range ID Sequence 5' to 3' ID NO Range Sequence 5' to 3' NO 0 3 4 Table 16. Modified Sense and Antisense Strand Sequences of GRB14 dsRNA Agents Duplex Sense Strand SEQ Antiense Strand SEQ mRNA target SEQ ID ' ' ' ' dsRNA agents targeting mouse GRB14 were further evaluated for efficacy in vivo in genetically obese mice (Ob/Ob). Ob/Ob mice were administered 1 mg/kg of AD-1363978 (siRNA 1), AD-1364167 (siRNA 2), and AD-1364168 (siRNA 3) every 2 weeks for 2 months. The results, shown in FIG.4A and FIG.4B, demonstrated that GRB14 knockdown with these GalNac-sRNAs maintained low HbA1c in genetically obese mice. Page 323 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) dsRNA agents targeting mouse GRB14 were further evaluated for efficacy in vivo in high fat diet (HFD) treated mice. HFD mice were administered 1 mg/kg and 0.1 mg/kg of AD-1363978 (siRNA 1) and AD-1364167 (siRNA 2) every 2 weeks for 8 weeks. A Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) was taken at week 8. The results, shown in FIG.5A and FIG.5B, demonstrated that GRB14 knockdown with these GalNac-sRNAs improved HOMA-IR in HFD mice. In FIG.5A, *=p<0.05 and **=p<0.01. dsRNA agents targeting mouse GRB14 were further evaluated for efficacy in vivo in diet induced obese (DIO) mice. DIO mice were administered 10 mg/kg of AD-1363978 (siRNA 1) and AD-1364167 (siRNA 2) every 2 weeks for 8 weeks. Lean mice were used as a control. Glucose tolerance and insulin tolerance tests were run at week 8 and week 9, respectively, with glucose and insulin administered in proportion to body weight. The final body weight of the mice was taken at week 11. The results, shown in FIG.6A, FIG.6B, and FIG.6C, demonstrated that knockdown of GRB14 with these GalNac-sRNAs improved glycemia and insulin sensitivity without weight gain. GRB14 SEQUENCES SEQ ID NO: 1 >NM_004490.3 Homo sapiens growth factor receptor bound protein 14 (GRB14), transcript variant 1, mRNA GCAGATAGCTCGGCCGCGCGTCTCAGCCGCCGGGGCCCCGAGCGCAGGCGGCGAGGCCACCACACCTGCAGAGCGCT CGGGCTGCCTAGCCGGCACCTCGCCTCCCGCCGCGCAAACCCCTTCTCCCCACGCGCCGAGTCTCCCATGACGCCCG AGCCCCCCGGCCGGCGACAATGACCACTTCCCTGCAAGATGGGCAGAGCGCCGCGAGCAGGGCGGCTGCCCGGGATT CGCCGCTGGCCGCCCAGGTGTGTGGCGCTGCCCAGGGGAGGGGCGACGCCCACGACCTGGCGCCGGCCCCCTGGCTG CACGCGCGAGCGCTCCTGCCCCTTCCGGACGGGACCCGCGGCTGTGCTGCAGACAGGAGAAAAAAGAAAGATCTTGA TGTTCCGGAAATGCCATCTATTCCAAACCCTTTTCCTGAGCTATGCTGTTCTCCATTTACATCTGTGTTGTCAGCAG ACCTATTTCCCAAAGCAAATTCAAGGAAAAAACAGGTGATTAAAGTATACAGTGAAGATGAAACCAGCAGGGCTTTA GATGTACCCAGTGACATAACGGCTCGAGATGTTTGTCAGCTGTTGATCCTGAAGAATCATTACATTGATGACCACAG CTGGACCCTTTTTGAGCACCTGCCTCACATAGGTGTAGAAAGAACAATAGAAGACCACGAACTGGTGATTGAAGTGC TATCCAACTGGGGGATAGAAGAAGAAAACAAACTATACTTTAGAAAAAATTATGCCAAATATGAGTTCTTTAAAAAC CCAATGTATTTTTTTCCAGAGCATATGGTATCTTTTGCAACTGAAACCAATGGTGAAATATCCCCCACACAGATTTT GCAGATGTTTCTGAGTTCAAGCACATATCCTGAAATTCATGGTTTCTTACATGCGAAAGAACAGGGAAAGAAGTCTT GGAAAAAAATTTACTTTTTTCTAAGAAGATCTGGTTTATATTTTTCTACTAAAGGAACATCAAAGGAACCGCGGCAT TTGCAGTTTTTCAGCGAATTTGGCAATAGTGATATTTATGTGTCACTGGCAGGCAAAAAAAAACATGGAGCACCGAC TAACTATGGATTCTGCTTTAAGCCTAACAAAGCGGGAGGGCCCCGAGACCTGAAAATGCTCTGTGCAGAAGAAGAGC AGAGTAGGACGTGCTGGGTGACCGCGATTAGATTGCTTAAGTATGGCATGCAGCTGTACCAGAATTATATGCATCCA TATCAAGGTAGAAGTGGCTGCAGTTCACAGAGCATATCACCTATGAGAAGTATATCAGAGAATTCCCTGGTAGCAAT GGACTTCTCAGGCCAGAAAAGCAGAGTTATAGAAAATCCCACTGAAGCCCTTTCAGTTGCGGTTGAAGAAGGACTCG CTTGGAGGAAAAAAGGATGTTTACGCCTGGGCACTCACGGTAGCCCCACTGCCTCTTCACAGAGCTCTGCCACAAAC ATGGCTATCCACCGGTCCCAGCCATGGTTTCACCACAAAATTTCTAGAGATGAGGCTCAGCGATTGATTATTCAGCA AGGACTTGTGGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACCCCAAAACTTTCGTACTGTCAATGAGTCATG GACAAAAAATAAAGCACTTTCAAATTATACCAGTAGAAGATGACGGTGAAATGTTCCACACACTGGATGATGGCCAC ACAAGATTTACAGATCTAATACAGCTGGTGGAGTTCTATCAACTCAATAAGGGCGTTCTTCCTTGCAAGTTGAAACA TTATTGTGCTAGGATTGCTCTCTAGACAAGCCAGAAGTGACTTATTAAACTATTGAAGGAAAAGGACTCAAGAAAAA TAATAAAAGACCATAAATAAGGGCGAAAACATTACCATGTGAAAAGAATGTATTTCACCTGCAAGTTACAAAAAAAT AGTTTGTGCATTGCAAATAAGCAAAGACTTGGATTGACTTTACATTCATCATTTAAAATTCATTAGTTAAAATTAAA CCTTAGGAAAAAAATGACTTGGTGTGTTCTTGTGTGATTTTTACATTGCTATAATATTTTCTTCAAATATGCATATT TAAAACATGTCTCCCTTATTTACCATATAGCAACATCAGAATTCTGAAACACAAAATATGAAATAAATTGGGAGTCA GGAATAATTATTTGTGCACTAAATTTCAATTATACTATTTTTTAATGTTAAGAAATATGATAATAACTTATCAATTA AAAGAAACTATCCACAACCTGTTAATGAAACTAAAAACTATTTTGAATTATATATTTTCCGGGTTTATGATCATCTT Page 324 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) AAAATGAAATCATATTTTGAGATAGTAGCTTTAAACCATTTTGAAATATGTTGATTTTTTCCAGGTAATTTAAAAAT ATTATTAAATAGTTAATTATAAAATTTA SEQ ID NO: 2 >Reverse Complement of SEQ ID NO: 1 TAAATTTTATAATTAACTATTTAATAATATTTTTAAATTACCTGGAAAAAATCAACATATTTCAAAATGGTTTAAAG CTACTATCTCAAAATATGATTTCATTTTAAGATGATCATAAACCCGGAAAATATATAATTCAAAATAGTTTTTAGTT TCATTAACAGGTTGTGGATAGTTTCTTTTAATTGATAAGTTATTATCATATTTCTTAACATTAAAAAATAGTATAAT TGAAATTTAGTGCACAAATAATTATTCCTGACTCCCAATTTATTTCATATTTTGTGTTTCAGAATTCTGATGTTGCT ATATGGTAAATAAGGGAGACATGTTTTAAATATGCATATTTGAAGAAAATATTATAGCAATGTAAAAATCACACAAG AACACACCAAGTCATTTTTTTCCTAAGGTTTAATTTTAACTAATGAATTTTAAATGATGAATGTAAAGTCAATCCAA GTCTTTGCTTATTTGCAATGCACAAACTATTTTTTTGTAACTTGCAGGTGAAATACATTCTTTTCACATGGTAATGT TTTCGCCCTTATTTATGGTCTTTTATTATTTTTCTTGAGTCCTTTTCCTTCAATAGTTTAATAAGTCACTTCTGGCT TGTCTAGAGAGCAATCCTAGCACAATAATGTTTCAACTTGCAAGGAAGAACGCCCTTATTGAGTTGATAGAACTCCA CCAGCTGTATTAGATCTGTAAATCTTGTGTGGCCATCATCCAGTGTGTGGAACATTTCACCGTCATCTTCTACTGGT ATAATTTGAAAGTGCTTTATTTTTTGTCCATGACTCATTGACAGTACGAAAGTTTTGGGGTTACTCTGACTATCCCG TACCAAGAAAACTCCATCCACAAGTCCTTGCTGAATAATCAATCGCTGAGCCTCATCTCTAGAAATTTTGTGGTGAA ACCATGGCTGGGACCGGTGGATAGCCATGTTTGTGGCAGAGCTCTGTGAAGAGGCAGTGGGGCTACCGTGAGTGCCC AGGCGTAAACATCCTTTTTTCCTCCAAGCGAGTCCTTCTTCAACCGCAACTGAAAGGGCTTCAGTGGGATTTTCTAT AACTCTGCTTTTCTGGCCTGAGAAGTCCATTGCTACCAGGGAATTCTCTGATATACTTCTCATAGGTGATATGCTCT GTGAACTGCAGCCACTTCTACCTTGATATGGATGCATATAATTCTGGTACAGCTGCATGCCATACTTAAGCAATCTA ATCGCGGTCACCCAGCACGTCCTACTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCTCGGGGCCCTCCCGCTTT GTTAGGCTTAAAGCAGAATCCATAGTTAGTCGGTGCTCCATGTTTTTTTTTGCCTGCCAGTGACACATAAATATCAC TATTGCCAAATTCGCTGAAAAACTGCAAATGCCGCGGTTCCTTTGATGTTCCTTTAGTAGAAAAATATAAACCAGAT CTTCTTAGAAAAAAGTAAATTTTTTTCCAAGACTTCTTTCCCTGTTCTTTCGCATGTAAGAAACCATGAATTTCAGG ATATGTGCTTGAACTCAGAAACATCTGCAAAATCTGTGTGGGGGATATTTCACCATTGGTTTCAGTTGCAAAAGATA CCATATGCTCTGGAAAAAAATACATTGGGTTTTTAAAGAACTCATATTTGGCATAATTTTTTCTAAAGTATAGTTTG TTTTCTTCTTCTATCCCCCAGTTGGATAGCACTTCAATCACCAGTTCGTGGTCTTCTATTGTTCTTTCTACACCTAT GTGAGGCAGGTGCTCAAAAAGGGTCCAGCTGTGGTCATCAATGTAATGATTCTTCAGGATCAACAGCTGACAAACAT CTCGAGCCGTTATGTCACTGGGTACATCTAAAGCCCTGCTGGTTTCATCTTCACTGTATACTTTAATCACCTGTTTT TTCCTTGAATTTGCTTTGGGAAATAGGTCTGCTGACAACACAGATGTAAATGGAGAACAGCATAGCTCAGGAAAAGG GTTTGGAATAGATGGCATTTCCGGAACATCAAGATCTTTCTTTTTTCTCCTGTCTGCAGCACAGCCGCGGGTCCCGT CCGGAAGGGGCAGGAGCGCTCGCGCGTGCAGCCAGGGGGCCGGCGCCAGGTCGTGGGCGTCGCCCCTCCCCTGGGCA GCGCCACACACCTGGGCGGCCAGCGGCGAATCCCGGGCAGCCGCCCTGCTCGCGGCGCTCTGCCCATCTTGCAGGGA AGTGGTCATTGTCGCCGGCCGGGGGGCTCGGGCGTCATGGGAGACTCGGCGCGTGGGGAGAAGGGGTTTGCGCGGCG GGAGGCGAGGTGCCGGCTAGGCAGCCCGAGCGCTCTGCAGGTGTGGTGGCCTCGCCGCCTGCGCTCGGGGCCCCGGC GGCTGAGACGCGCGGCCGAGCTATCTGC SEQ ID NO: 3 >NM_001303422.2 Homo sapiens growth factor receptor bound protein 14 (GRB14), transcript variant 2, mRNA ATTACTTTCCTAGTTGTTTCATTGCACTGAGCCCTGAGATTCCCAAGGAGTAACCATAAAAGATTTCTTTTATTTTG TCCATGACCTACGAGACAGGATCATTCTAAGAAGAGCAGGCATGAGTTTGAGTGCAAGAAGAGTCACTCTGCCTGCA ATAACGCCAATAATTCTACAGAAAAGGGTGATTAAAGTATACAGTGAAGATGAAACCAGCAGGGCTTTAGATGTACC CAGTGACATAACGGCTCGAGATGTTTGTCAGCTGTTGATCCTGAAGAATCATTACATTGATGACCACAGCTGGACCC TTTTTGAGCACCTGCCTCACATAGGTGTAGAAAGAACAATAGAAGACCACGAACTGGTGATTGAAGTGCTATCCAAC TGGGGGATAGAAGAAGAAAACAAACTATACTTTAGAAAAAATTATGCCAAATATGAGTTCTTTAAAAACCCAATGTA TTTTTTTCCAGAGCATATGGTATCTTTTGCAACTGAAACCAATGGTGAAATATCCCCCACACAGATTTTGCAGATGT TTCTGAGTTCAAGCACATATCCTGAAATTCATGGTTTCTTACATGCGAAAGAACAGGGAAAGAAGTCTTGGAAAAAA ATTTACTTTTTTCTAAGAAGATCTGGTTTATATTTTTCTACTAAAGGAACATCAAAGGAACCGCGGCATTTGCAGTT TTTCAGCGAATTTGGCAATAGTGATATTTATGTGTCACTGGCAGGCAAAAAAAAACATGGAGCACCGACTAACTATG GATTCTGCTTTAAGCCTAACAAAGCGGGAGGGCCCCGAGACCTGAAAATGCTCTGTGCAGAAGAAGAGCAGAGTAGG ACGTGCTGGGTGACCGCGATTAGATTGCTTAAGTATGGCATGCAGCTGTACCAGAATTATATGCATCCATATCAAGG TAGAAGTGGCTGCAGTTCACAGAGCATATCACCTATGAGAAGTATATCAGAGAATTCCCTGGTAGCAATGGACTTCT CAGGCCAGAAAAGCAGAGTTATAGAAAATCCCACTGAAGCCCTTTCAGTTGCGGTTGAAGAAGGACTCGCTTGGAGG AAAAAAGGATGTTTACGCCTGGGCACTCACGGTAGCCCCACTGCCTCTTCACAGAGCTCTGCCACAAACATGGCTAT CCACCGGTCCCAGCCATGGTTTCACCACAAAATTTCTAGAGATGAGGCTCAGCGATTGATTATTCAGCAAGGACTTG Page 325 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) TGGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACCCCAAAACTTTCGTACTGTCAATGAGTCATGGACAAAAA ATAAAGCACTTTCAAATTATACCAGTAGAAGATGACGGTGAAATGTTCCACACACTGGATGATGGCCACACAAGATT TACAGATCTAATACAGCTGGTGGAGTTCTATCAACTCAATAAGGGCGTTCTTCCTTGCAAGTTGAAACATTATTGTG CTAGGATTGCTCTCTAGACAAGCCAGAAGTGACTTATTAAACTATTGAAGGAAAAGGACTCAAGAAAAATAATAAAA GACCATAAATAAGGGCGAAAACATTACCATGTGAAAAGAATGTATTTCACCTGCAAGTTACAAAAAAATAGTTTGTG CATTGCAAATAAGCAAAGACTTGGATTGACTTTACATTCATCATTTAAAATTCATTAGTTAAAATTAAACCTTAGGA AAAAAATGACTTGGTGTGTTCTTGTGTGATTTTTACATTGCTATAATATTTTCTTCAAATATGCATATTTAAAACAT GTCTCCCTTATTTACCATATAGCAACATCAGAATTCTGAAACACAAAATATGAAATAAATTGGGAGTCAGGAATAAT TATTTGTGCACTAAATTTCAATTATACTATTTTTTAATGTTAAGAAATATGATAATAACTTATCAATTAAAAGAAAC TATCCACAACCTGTTAATGAAACTAAAAACTATTTTGAATTATATATTTTCCGGGTTTATGATCATCTTAAAATGAA ATCATATTTTGAGATAGTAGCTTTAAACCATTTTGAAATATGTTGATTTTTTCCAGGTAATTTAAAAATATTATTAA ATAGTTAATTATAAAATTTA SEQ ID NO: 4 >Reverse Complement of SEQ ID NO: 3 TAAATTTTATAATTAACTATTTAATAATATTTTTAAATTACCTGGAAAAAATCAACATATTTCAAAATGGTTTAAAG CTACTATCTCAAAATATGATTTCATTTTAAGATGATCATAAACCCGGAAAATATATAATTCAAAATAGTTTTTAGTT TCATTAACAGGTTGTGGATAGTTTCTTTTAATTGATAAGTTATTATCATATTTCTTAACATTAAAAAATAGTATAAT TGAAATTTAGTGCACAAATAATTATTCCTGACTCCCAATTTATTTCATATTTTGTGTTTCAGAATTCTGATGTTGCT ATATGGTAAATAAGGGAGACATGTTTTAAATATGCATATTTGAAGAAAATATTATAGCAATGTAAAAATCACACAAG AACACACCAAGTCATTTTTTTCCTAAGGTTTAATTTTAACTAATGAATTTTAAATGATGAATGTAAAGTCAATCCAA GTCTTTGCTTATTTGCAATGCACAAACTATTTTTTTGTAACTTGCAGGTGAAATACATTCTTTTCACATGGTAATGT TTTCGCCCTTATTTATGGTCTTTTATTATTTTTCTTGAGTCCTTTTCCTTCAATAGTTTAATAAGTCACTTCTGGCT TGTCTAGAGAGCAATCCTAGCACAATAATGTTTCAACTTGCAAGGAAGAACGCCCTTATTGAGTTGATAGAACTCCA CCAGCTGTATTAGATCTGTAAATCTTGTGTGGCCATCATCCAGTGTGTGGAACATTTCACCGTCATCTTCTACTGGT ATAATTTGAAAGTGCTTTATTTTTTGTCCATGACTCATTGACAGTACGAAAGTTTTGGGGTTACTCTGACTATCCCG TACCAAGAAAACTCCATCCACAAGTCCTTGCTGAATAATCAATCGCTGAGCCTCATCTCTAGAAATTTTGTGGTGAA ACCATGGCTGGGACCGGTGGATAGCCATGTTTGTGGCAGAGCTCTGTGAAGAGGCAGTGGGGCTACCGTGAGTGCCC AGGCGTAAACATCCTTTTTTCCTCCAAGCGAGTCCTTCTTCAACCGCAACTGAAAGGGCTTCAGTGGGATTTTCTAT AACTCTGCTTTTCTGGCCTGAGAAGTCCATTGCTACCAGGGAATTCTCTGATATACTTCTCATAGGTGATATGCTCT GTGAACTGCAGCCACTTCTACCTTGATATGGATGCATATAATTCTGGTACAGCTGCATGCCATACTTAAGCAATCTA ATCGCGGTCACCCAGCACGTCCTACTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCTCGGGGCCCTCCCGCTTT GTTAGGCTTAAAGCAGAATCCATAGTTAGTCGGTGCTCCATGTTTTTTTTTGCCTGCCAGTGACACATAAATATCAC TATTGCCAAATTCGCTGAAAAACTGCAAATGCCGCGGTTCCTTTGATGTTCCTTTAGTAGAAAAATATAAACCAGAT CTTCTTAGAAAAAAGTAAATTTTTTTCCAAGACTTCTTTCCCTGTTCTTTCGCATGTAAGAAACCATGAATTTCAGG ATATGTGCTTGAACTCAGAAACATCTGCAAAATCTGTGTGGGGGATATTTCACCATTGGTTTCAGTTGCAAAAGATA CCATATGCTCTGGAAAAAAATACATTGGGTTTTTAAAGAACTCATATTTGGCATAATTTTTTCTAAAGTATAGTTTG TTTTCTTCTTCTATCCCCCAGTTGGATAGCACTTCAATCACCAGTTCGTGGTCTTCTATTGTTCTTTCTACACCTAT GTGAGGCAGGTGCTCAAAAAGGGTCCAGCTGTGGTCATCAATGTAATGATTCTTCAGGATCAACAGCTGACAAACAT CTCGAGCCGTTATGTCACTGGGTACATCTAAAGCCCTGCTGGTTTCATCTTCACTGTATACTTTAATCACCCTTTTC TGTAGAATTATTGGCGTTATTGCAGGCAGAGTGACTCTTCTTGCACTCAAACTCATGCCTGCTCTTCTTAGAATGAT CCTGTCTCGTAGGTCATGGACAAAATAAAAGAAATCTTTTATGGTTACTCCTTGGGAATCTCAGGGCTCAGTGCAAT GAAACAACTAGGAAAGTAAT SEQ ID NO: 5 >NM_016719.1 Mus musculus growth factor receptor bound protein 14 (Grb14), mRNA GCGGCCCTGCCACCGCACCTGCAAGGCGCTCGCTGCCTGCAACCGCTCGGCTCTGCTCGCCCCCAGCCCTTCGTAGC TTTCGCCTCGCGGTCGATGACTCCCTAGACCCCTGGCCTACGACCATGACCACGTCCCTGCAAGACGGGCAGAGCGC CGCGGGCCGGGCAGGCGCCCAGGATTCGCCGCTGGCAGTGCAGGTGTGCCGCGTTGCCCAGGGCAAGGGAGACGCCC AGGACCCGGCGCAGGTCCCCGGACTGCACGCGCTGTCCCCCGCCTCCGATGCGACCCTCCGCGGTGCCATAGACAGG AGAAAAATGAAAGATCTGGATGTTCTGGAAAAGCCACCCATTCCCAACCCCTTTCCTGAGCTCTGCTGCTCTCCGCT TACATCTGTGCTGTCAGCAGGCCTGTTTCCCAGGGCCAATTCAAGGAAGAAGCAGGTGATTAAAGTTTACAGCGAGG ATGAAACCAGCAGAGCATTAGAGGTGCCCAGTGACATCACAGCCCGAGATGTTTGCCAGCTGTTGATCCTGAAGAAC CACTATGTGGACGACAACAGCTGGACCCTTTTTGAGCACCTATCTCACATAGGTTTAGAAAGAACCGTAGAGGACCA CGAGCTGCCAACTGAAGTGCTGTCTCACTGGGGAGTGGAAGAAGACAATAAGCTGTATCTTAGAAAGAATTATGCCA AATATGAATTTTTTAAGAACCCAATGTATTTCTTTCCAGAGCACATGGTGTCTTTTGCAGCTGAAATGAATGGTGAC Page 326 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) AGATCCCCTACACAGATACTGCAGGTGTTTTTAAGCTCCAGCACGTATCCTGAAATCCATGGCTTCTTACATGCAAA GGAACAGGGAAAGAAGTCTTGGAAAAAAGCTTACTTTTTTCTCAGAAGATCTGGCTTATATTTTTCTACTAAAGGCA CATCCAAGGAACCACGGCATTTGCAGCTTTTCAGTGAATTCAGCACTAGTCACGTTTATATGTCACTGGCAGGAAAA AAAAAACACGGAGCGCCAACTCCCTATGGATTCTGCTTAAAGCCTAACAAAGCAGGAGGGCCCCGGGACCTGAAAAT GCTCTGTGCAGAAGAAGAGCAGAGCAGGACGTGCTGGGTGACCGCCATCCGACTGCTGAAGGATGGCATGCAGCTGT ATCAGAATTATATGCATCCATACCAAGGTAGAAGCGCCTGCAATTCTCAGAGCATGTCACCCATGAGAAGCGTATCA GAGAATTCCCTAGTAGCAATGGACTTCTCAGGTGAGAAGAGCAGAGTCATAGACAACCCCACTGAAGCGCTTTCGGT TGCTGTTGAGGAAGGCCTCGCGTGGAGGAAAAAAGGCTGTTTACGCCTGGGGAATCACGGAAGCCCCAGTGCCCCCT CCCAGAGCTCTGCTGTGAACATGGCTCTCCATCGGTCCCAACCATGGTTTCACCACAGAATTTCCAGAGATGAGGCT CAGCGGCTGATCATTCGGCAGGGGCCTGTGGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACCCCAGAACTTT TGTACTGTCAATGAGTCATGGACAAAAGATAAAACACTATCAAATTATACCCGTAGAAGATGATGGTGAGCTGTTCC ATACTCTGGATGATGGCCATACGAAGTTCACAGACCTCATCCAGCTGGTGGAGTTCTACCAGCTCAACAGGGGGGTC CTTCCTTGCAAGCTGAAGCATTACTGTGCTAGGATGGCTGTTTAGCCAAACTGTGTGTCACTCGTTACACTACAGAA GAAGAAGGATGCAAAGGAGAATGATTAGAGAGAGAGAGAGAGATCACAAGGCTGAAAACAAATCATGGTGAAAAGAA GATTTCACCTGCGGGTTACAAAAAAAAATAGGTCACACATTGCAAATTAGTGAAAACTTGGATTCCTATTACACTCA TGACTTTAAATTTATTAGTTAAAATTAAACCTTATTAAAAAAAAAAAAAAAAA SEQ ID NO: 6 >Reverse Complement of SEQ ID NO: 5 TTTTTTTTTTTTTTTTTAATAAGGTTTAATTTTAACTAATAAATTTAAAGTCATGAGTGTAATAGGAATCCAAGTTT CTCCACCAGCTGGATGAGGTCTGTGAACTTCGTATGGCCATCATCCAGAGTATGGAACAGCTCACCATCATCTTCTA CGGGTATAATTTGATAGTGTTTTATCTTTTGTCCATGACTCATTGACAGTACAAAAGTTCTGGGGTTACTCTGACTA TCCCGTACCAAGAAAACTCCATCCACAGGCCCCTGCCGAATGATCAGCCGCTGAGCCTCATCTCTGGAAATTCTGTG GTGAAACCATGGTTGGGACCGATGGAGAGCCATGTTCACAGCAGAGCTCTGGGAGGGGGCACTGGGGCTTCCGTGAT TCCCCAGGCGTAAACAGCCTTTTTTCCTCCACGCGAGGCCTTCCTCAACAGCAACCGAAAGCGCTTCAGTGGGGTTG TCTATGACTCTGCTCTTCTCACCTGAGAAGTCCATTGCTACTAGGGAATTCTCTGATACGCTTCTCATGGGTGACAT GCTCTGAGAATTGCAGGCGCTTCTACCTTGGTATGGATGCATATAATTCTGATACAGCTGCATGCCATCCTTCAGCA GTCGGATGGCGGTCACCCAGCACGTCCTGCTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCCCGGGGCCCTCCT GCTTTGTTAGGCTTTAAGCAGAATCCATAGGGAGTTGGCGCTCCGTGTTTTTTTTTTCCTGCCAGTGACATATAAAC GTGACTAGTGCTGAATTCACTGAAAAGCTGCAAATGCCGTGGTTCCTTGGATGTGCCTTTAGTAGAAAAATATAAGC CAGATCTTCTGAGAAAAAAGTAAGCTTTTTTCCAAGACTTCTTTCCCTGTTCCTTTGCATGTAAGAAGCCATGGATT TCAGGATACGTGCTGGAGCTTAAAAACACCTGCAGTATCTGTGTAGGGGATCTGTCACCATTCATTTCAGCTGCAAA AGACACCATGTGCTCTGGAAAGAAATACATTGGGTTCTTAAAAAATTCATATTTGGCATAATTCTTTCTAAGATACA GCTTATTGTCTTCTTCCACTCCCCAGTGAGACAGCACTTCAGTTGGCAGCTCGTGGTCCTCTACGGTTCTTTCTAAA CCTATGTGAGATAGGTGCTCAAAAAGGGTCCAGCTGTTGTCGTCCACATAGTGGTTCTTCAGGATCAACAGCTGGCA AACATCTCGGGCTGTGATGTCACTGGGCACCTCTAATGCTCTGCTGGTTTCATCCTCGCTGTAAACTTTAATCACCT GCTTCTTCCTTGAATTGGCCCTGGGAAACAGGCCTGCTGACAGCACAGATGTAAGCGGAGAGCAGCAGAGCTCAGGA AAGGGGTTGGGAATGGGTGGCTTTTCCAGAACATCCAGATCTTTCATTTTTCTCCTGTCTATGGCACCGCGGAGGGT CGCATCGGAGGCGGGGGACAGCGCGTGCAGTCCGGGGACCTGCGCCGGGTCCTGGGCGTCTCCCTTGCCCTGGGCAA CGCGGCACACCTGCACTGCCAGCGGCGAATCCTGGGCGCCTGCCCGGCCCGCGGCGCTCTGCCCGTCTTGCAGGGAC GTGGTCATGGTCGTAGGCCAGGGGTCTAGGGAGTCATCGACCGCGAGGCGAAAGCTACGAAGGGCTGGGGGCGAGCA GAGCCGAGCGGTTGCAGGCAGCGAGCGCCTTGCAGGTGCGGTGGCAGGGCCGC SEQ ID NO: 7 >NM_031623.1 Rattus norvegicus growth factor receptor bound protein 14 (Grb14), mRNA GCTGGACCCCAGCCTTTCTTCGCTTTCGCCTCGCGGTCGATGACTCCCTAGACCCCCTGGCCTACGATCATGACCAC GTCCCTGCAAGATGGGCAGAGCGCCGCGGGCCGGGCGGGCGCCCAGGACTCCCCGCTGGCAGTGCAGGTGTGCCGCG TTGCCCAGGGCAAGGGAGACGCCCAGGACCCGGCTCAGGTCCCCGGACTGCACGCGCTGTCCCCGGCCTCAGATGCG ACCCGCCGCGGTGCCATGGACAGGAGAAAAGCGAAAGATCTGGAAGTTCAGGAAACGCCTTCCATTCCTAACCCCTT CCCTGAGCTCTGCTGTTCTCCACTTACATCGGTGCTGTCAGCAGGCCTCTTCCCCAGATCAAATTCAAGGAAGAAAC AGGTGATTAAAGTTTACAGCGAGGATGAGACCAGCAGAGCGTTAGAGGTGCCCAGTGACGTCACAGCCCGTGATGTC TGCCAGCTGTTGATCCTGAAGAACCACTATGTCGACGACAATAGCTGGACCCTTTTTGAGCACCTGTCTCACACAGG CGTAGAAAGGACAGTGGAGGACCATGAGCTGCTGACTGAAGTGCTGTCTCATTGGGTGATGGAAGAAGATAATAAGC Page 327 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) TGTATCTTAGAAAGAATTATGCCAAATATGAATTTTTTAAGAACCCAATGTATTTCTTTCCAGAGCACATGGTGTCT TTTGCAACTGAAATGAACGGTGACAGATCCCTTACACAGATCCCGCAGGTGTTTTTAAGCTCAAACACATATCCTGA AATCCATGGCTTCCTGCATGCAAAGGAACAGGGGAAGAAGTCTTGGAAAAAAGCTTACTTTTTTCTCAGAAGATCTG GTTTATATTTTTCTACTAAAGGCACATCCAAGGAACCACGGCACTTGCAGTTTTTCAGTGAATTCAGCACTAGTAAT GTTTACATGTCACTGGCAGGCAAAAAAAAGCATGGAGCGCCGACTCCCTATGGATTCTGCTTTAAGCCTACCAAAGC AGGAGGGCCCCGGGACCTGAAAATGCTGTGTGCAGAAGAAGACCAAAGCAGGATGTGCTGGGTGACCGCCATTAGAT TGCTCAAGTATGGCATGCAGCTCTACCAGAATTATATGCATCCATCCCAAGCTAGAAGCGCCTGCAGTTCTCAGAGC GTATCACCCATGAGAAGCGTATCAGAGAATTCCCTAGTAGCAATGGACTTCTCAGGTCAGAAGACCAGAGTCATAGA CAACCCCACTGAAGCCCTTTCGGTTGCCGTTGAGGAAGGACTCGCTTGGAGGAAAAAAGGATGTTTACGCCTGGGGA ATCATGGGAGTCCCACTGCGCCCTCTCAGAGCTCTGCTGTGAACATGGCTCTCCACCGGTCCCAGCCATGGTTTCAC CACAGAATTTCTAGAGATGAAGCTCAGCAGTTGATTACCCGGCAGGGGCCTGTGGATGGAGTTTTCTTGGTACGGGA TAGTCAGAGTAACCCCAGAACTTTTGTACTGTCAATGAGTCACGGACAAAAGATAAAACACTTTCAAATTATACCCG TGGAAGATGATGGTGAGGTGTTCCACACCCTGGATGATGGCCATACGAAGTTCACAGATCTCATCCAGCTCGTGGAG TTCTACCAGCTCAACAAGGGGGTCCTTCCTTGCAAGCTGAAGCATTACTGTGCTAGGATGGCTGTTTAGCCAAACTG TCTGTGACTCGTTAAACTATGGAAGATGGAGGATGCAAAGAAGAATGATTAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGAGAGAGAGAGAGGAGATCACAAGGCTGGAAACAAATCATGGTGAAAAGAAGATTCACCTGTGGG TTACAAAAAAATAGGTCACGTATTGCAAATTAGTGAAGACTTGGATTCGTATTACTCTCGTTACTTTAAATTTATTA GTTAAAATTAAACCTTATTAAAAAA SEQ ID NO: 8 >Reverse Complement of SEQ ID NO: 7 TTTTTTAATAAGGTTTAATTTTAACTAATAAATTTAAAGTAACGAGAGTAATACGAATCCAAGTCTTCACTAATTTG CAATACGTGACCTATTTTTTTGTAACCCACAGGTGAATCTTCTTTTCACCATGATTTGTTTCCAGCCTTGTGATCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTAATCATTCTTCTTTGCATCCTCCAT CTTCCATAGTTTAACGAGTCACAGACAGTTTGGCTAAACAGCCATCCTAGCACAGTAATGCTTCAGCTTGCAAGGAA GGACCCCCTTGTTGAGCTGGTAGAACTCCACGAGCTGGATGAGATCTGTGAACTTCGTATGGCCATCATCCAGGGTG TGGAACACCTCACCATCATCTTCCACGGGTATAATTTGAAAGTGTTTTATCTTTTGTCCGTGACTCATTGACAGTAC AAAAGTTCTGGGGTTACTCTGACTATCCCGTACCAAGAAAACTCCATCCACAGGCCCCTGCCGGGTAATCAACTGCT GAGCTTCATCTCTAGAAATTCTGTGGTGAAACCATGGCTGGGACCGGTGGAGAGCCATGTTCACAGCAGAGCTCTGA GAGGGCGCAGTGGGACTCCCATGATTCCCCAGGCGTAAACATCCTTTTTTCCTCCAAGCGAGTCCTTCCTCAACGGC AACCGAAAGGGCTTCAGTGGGGTTGTCTATGACTCTGGTCTTCTGACCTGAGAAGTCCATTGCTACTAGGGAATTCT CTGATACGCTTCTCATGGGTGATACGCTCTGAGAACTGCAGGCGCTTCTAGCTTGGGATGGATGCATATAATTCTGG TAGAGCTGCATGCCATACTTGAGCAATCTAATGGCGGTCACCCAGCACATCCTGCTTTGGTCTTCTTCTGCACACAG CATTTTCAGGTCCCGGGGCCCTCCTGCTTTGGTAGGCTTAAAGCAGAATCCATAGGGAGTCGGCGCTCCATGCTTTT TTTTGCCTGCCAGTGACATGTAAACATTACTAGTGCTGAATTCACTGAAAAACTGCAAGTGCCGTGGTTCCTTGGAT GTGCCTTTAGTAGAAAAATATAAACCAGATCTTCTGAGAAAAAAGTAAGCTTTTTTCCAAGACTTCTTCCCCTGTTC CTTTGCATGCAGGAAGCCATGGATTTCAGGATATGTGTTTGAGCTTAAAAACACCTGCGGGATCTGTGTAAGGGATC TGTCACCGTTCATTTCAGTTGCAAAAGACACCATGTGCTCTGGAAAGAAATACATTGGGTTCTTAAAAAATTCATAT TTGGCATAATTCTTTCTAAGATACAGCTTATTATCTTCTTCCATCACCCAATGAGACAGCACTTCAGTCAGCAGCTC ATGGTCCTCCACTGTCCTTTCTACGCCTGTGTGAGACAGGTGCTCAAAAAGGGTCCAGCTATTGTCGTCGACATAGT GGTTCTTCAGGATCAACAGCTGGCAGACATCACGGGCTGTGACGTCACTGGGCACCTCTAACGCTCTGCTGGTCTCA TCCTCGCTGTAAACTTTAATCACCTGTTTCTTCCTTGAATTTGATCTGGGGAAGAGGCCTGCTGACAGCACCGATGT AAGTGGAGAACAGCAGAGCTCAGGGAAGGGGTTAGGAATGGAAGGCGTTTCCTGAACTTCCAGATCTTTCGCTTTTC TCCTGTCCATGGCACCGCGGCGGGTCGCATCTGAGGCCGGGGACAGCGCGTGCAGTCCGGGGACCTGAGCCGGGTCC TGGGCGTCTCCCTTGCCCTGGGCAACGCGGCACACCTGCACTGCCAGCGGGGAGTCCTGGGCGCCCGCCCGGCCCGC GGCGCTCTGCCCATCTTGCAGGGACGTGGTCATGATCGTAGGCCAGGGGGTCTAGGGAGTCATCGACCGCGAGGCGA AAGCGAAGAAAGGCTGGGGTCCAGC SEQ ID NO: 9 >XM_015110244.2 PREDICTED: Macaca mulatta growth factor receptor bound protein 14 (GRB14), transcript variant X1, mRNA AAGAAGAGGCACGTGGGGAAGGACTGGGGCAAACCCAGCCCCCTGGTGCCCTGGCCTCCTGCCCTCCTGGCCCGGTA GGGACTGTCATGGCGGCCCAGCAACAGCTTAGGTGATCTCAGATGGCAGAGCAGGAAGAATGCAAGGGTATGAGGGT CAGGGCTGCGCAGACCCCTGTCCCGCCTGCGGTCCTCCCGGCAAGCCCAGGGGGAGAGCCCGCTCTGCTGGGTCTCC GCCTCCAGCGGCGCCGGGCCGCCCAGACCCTGGGCTCAGTCTTGCGCCCCGGTGCCCACCTGGGGAGGCGGCGGTCC CGGCCTCGCGTCCCGGATCGGACGGCGCGGGAGCGATGCCAGCGGCCCCGAGCGCCCCGGGCCACGCGCGGGGCCGG CCGGACGCTCTCGCGCCCTCCCAGCCCCCTCCGCGGCTCGCCCCGCCGCCCGCGGCCCCCACCCACCGGCCGCTCCT Page 328 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) CCCCTCTCCCCACCCTCCTCCTCCGCCCCCTCCCCTCCCCCGCCGCCTCGCAGATTGCTCGGCAGCGTGTCTCAGCC GCCGGGGCTCCGAGCGCAGGCTGCGAGGCCACCACACCTGCAGAGCGCTCGGGCTGCCTAGCCGGCACCTCGCCTCC GGCCGCGCGGTCCCCTTCTCCCCACGCGCCGAGTGTCCCATGACGCCCGAGCCCCCCGGCCGGCGACAATGACCACT TCCCTGCAAGATGGGCAGAGCGCCGCGGGCAGGGCGGCTGCCCGGGATTCGCCGCTGGCCGCCCAGGTGTGCGGCGC TGCCCAGGGGAGGGGCGACGCCCACGACCTGGCGCCCGGCCCCTGGCTGCACGCGGGAGCGCTCCTGCCCCCTCCGG ACGGGACCCGCGGCTGTGCTGCAGACAGGAGAAAAAAGAAAGATCTTGATGTTCCGGAAATGCCATCTATTCCAAAC CCTTTTCCTGAGCTATGCTGTTCTCCATTTACATCTGTGTTGTCAGCAGACCTGTTTCCCAAAGCAAATTCAAGGAA AAAACAGGTGATTAAAGTGTACAGTGAAGATGAAACCAGTAGGGCTTTAGATGTACCCAGTGACATAACGGCTCGAG ATGTTTGTCAGCTGTTGATCCTGAAGAATCATTACATTGATGACCACAGCTGGACCCTTTTTGAGCACCTGCCTCAC ATAGGTGTAGAAAGAACAATAGAAGACCATGAACTGGTGATTGAAGTGCTATCCAACTGGGGGATAGAAGAAGAAAA CAAGCTATACTTTAGAAAAAATTATGCCAAATATGAGTTCTTTAAAAACCCAATGTATTTTTTTCCAGAGCATATGG TATCTTTTGCAACTGAAACCAATGGTGAAATATCCCCCACACAGATTTTGCAGATGTTTCTGAGTTCAAGCACATAC CCTGAAATTCATGGTTTCTTACATGCGAAAGAACAGGGAAAGAAGTCTTGGAAAAAAATTTACTTTTTTCTAAGAAG ATCTGGTTTATATTTTTCTACTAAAGGGACATCAAAGGAACCGCGGCATTTGCAGTTTTTCAGCGAATTTGGCAATA GTGATATTTATGTGTCACTGGCAGGCAAAAAAAAGCATGGAGCACCGACTAACTATGGATTCTGCTTTAAGCCTAAC AAAGCGGGAGGGCCCCGAGACCTGAAAATGCTCTGTGCAGAAGAAGAGCAGAGTAGGACGTGCTGGGTGACCGCGAT TAGATTGCTTAAGTATGGCATGCAGCTGTACCAGAATTATATGCATCCATATCAAGGTAGAAGTGGCTGCAGTTCAC AGAGCATATCACCTATGAGAAGTATATCAGAGAATTCCCTGGTAGCAATGGACTTCTCAGGCCAGAAAAGCAGAGTT ATAGAAAATCCCACTGAAGCCCTTTCAGTTGCAGTTGAAGAGGGACTCGCTTGGAGGAAAAAAGGATGTTTACGCCT GGGCACTCACGGTAGCCCCACTGCCTCTTCACAGAGCTCTGCCACAAACATGGCTATCCACCGGTCCCAGCCATGGT TTCACCACAAAATTTCTAGAGATGAGGCTCAGCGATTGATTATTCAGCAAGGACTTGTGGATGGAGTTTTCTTGGTA CGGGATAGTCAGAGTAACCCCAAAACTTTCGTACTGTCAATGAGTCATGGACAAAAAATAAAGCACTTTCAAATTAT ACCAGTAGAAGATGACGGTGAAATGTTCCACACACTGGATGATGGCCACACAAGATTTACAGATCTAATACAACTGG TGGAGTTCTATCAACTCAATAAGGGCGTTCTTCCTTGCAAGTTGAAACATTATTGTGCTAGGATTGCTCTCTAGCTA AACCAGAAGTGACTTATTAAACTATTGAAGAAAAAGGACTCAAGAAAAATAATAAAAGACCATAAATAAGGGTGAAA ATGTTACCATGTGAAAAGAATGTATTTTACCTGCAAGTTACAAAAAAAATAGTTTGTGCATTGCAAATAAGCAAAGA CTTGGATTGACTTTACATTCATCATTTAAAATTCATTAGTTAAAATTAAACCTTAGAAAAAAATTGA SEQ ID NO: 10 >Reverse Complement of SEQ ID NO: 9 AAGAAGAGGCACGTGGGGAAGGACTGGGGCAAACCCAGCCCCCTGGTGCCCTGGCCTCCTGCCCTCCTGGCCCGGTA GGGACTGTCATGGCGGCCCAGCAACAGCTTAGGTGATCTCAGATGGCAGAGCAGGAAGAATGCAAGGGTATGAGGGT CAGGGCTGCGCAGACCCCTGTCCCGCCTGCGGTCCTCCCGGCAAGCCCAGGGGGAGAGCCCGCTCTGCTGGGTCTCC GCCTCCAGCGGCGCCGGGCCGCCCAGACCCTGGGCTCAGTCTTGCGCCCCGGTGCCCACCTGGGGAGGCGGCGGTCC CGGCCTCGCGTCCCGGATCGGACGGCGCGGGAGCGATGCCAGCGGCCCCGAGCGCCCCGGGCCACGCGCGGGGCCGG CCGGACGCTCTCGCGCCCTCCCAGCCCCCTCCGCGGCTCGCCCCGCCGCCCGCGGCCCCCACCCACCGGCCGCTCCT CCCCTCTCCCCACCCTCCTCCTCCGCCCCCTCCCCTCCCCCGCCGCCTCGCAGATTGCTCGGCAGCGTGTCTCAGCC GCCGGGGCTCCGAGCGCAGGCTGCGAGGCCACCACACCTGCAGAGCGCTCGGGCTGCCTAGCCGGCACCTCGCCTCC GGCCGCGCGGTCCCCTTCTCCCCACGCGCCGAGTGTCCCATGACGCCCGAGCCCCCCGGCCGGCGACAATGACCACT TCCCTGCAAGATGGGCAGAGCGCCGCGGGCAGGGCGGCTGCCCGGGATTCGCCGCTGGCCGCCCAGGTGTGCGGCGC TGCCCAGGGGAGGGGCGACGCCCACGACCTGGCGCCCGGCCCCTGGCTGCACGCGGGAGCGCTCCTGCCCCCTCCGG ACGGGACCCGCGGCTGTGCTGCAGACAGGAGAAAAAAGAAAGATCTTGATGTTCCGGAAATGCCATCTATTCCAAAC CCTTTTCCTGAGCTATGCTGTTCTCCATTTACATCTGTGTTGTCAGCAGACCTGTTTCCCAAAGCAAATTCAAGGAA AAAACAGGTGATTAAAGTGTACAGTGAAGATGAAACCAGTAGGGCTTTAGATGTACCCAGTGACATAACGGCTCGAG ATGTTTGTCAGCTGTTGATCCTGAAGAATCATTACATTGATGACCACAGCTGGACCCTTTTTGAGCACCTGCCTCAC ATAGGTGTAGAAAGAACAATAGAAGACCATGAACTGGTGATTGAAGTGCTATCCAACTGGGGGATAGAAGAAGAAAA CAAGCTATACTTTAGAAAAAATTATGCCAAATATGAGTTCTTTAAAAACCCAATGTATTTTTTTCCAGAGCATATGG TATCTTTTGCAACTGAAACCAATGGTGAAATATCCCCCACACAGATTTTGCAGATGTTTCTGAGTTCAAGCACATAC CCTGAAATTCATGGTTTCTTACATGCGAAAGAACAGGGAAAGAAGTCTTGGAAAAAAATTTACTTTTTTCTAAGAAG ATCTGGTTTATATTTTTCTACTAAAGGGACATCAAAGGAACCGCGGCATTTGCAGTTTTTCAGCGAATTTGGCAATA GTGATATTTATGTGTCACTGGCAGGCAAAAAAAAGCATGGAGCACCGACTAACTATGGATTCTGCTTTAAGCCTAAC AAAGCGGGAGGGCCCCGAGACCTGAAAATGCTCTGTGCAGAAGAAGAGCAGAGTAGGACGTGCTGGGTGACCGCGAT TAGATTGCTTAAGTATGGCATGCAGCTGTACCAGAATTATATGCATCCATATCAAGGTAGAAGTGGCTGCAGTTCAC AGAGCATATCACCTATGAGAAGTATATCAGAGAATTCCCTGGTAGCAATGGACTTCTCAGGCCAGAAAAGCAGAGTT ATAGAAAATCCCACTGAAGCCCTTTCAGTTGCAGTTGAAGAGGGACTCGCTTGGAGGAAAAAAGGATGTTTACGCCT GGGCACTCACGGTAGCCCCACTGCCTCTTCACAGAGCTCTGCCACAAACATGGCTATCCACCGGTCCCAGCCATGGT TTCACCACAAAATTTCTAGAGATGAGGCTCAGCGATTGATTATTCAGCAAGGACTTGTGGATGGAGTTTTCTTGGTA Page 329 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) CGGGATAGTCAGAGTAACCCCAAAACTTTCGTACTGTCAATGAGTCATGGACAAAAAATAAAGCACTTTCAAATTAT ACCAGTAGAAGATGACGGTGAAATGTTCCACACACTGGATGATGGCCACACAAGATTTACAGATCTAATACAACTGG TGGAGTTCTATCAACTCAATAAGGGCGTTCTTCCTTGCAAGTTGAAACATTATTGTGCTAGGATTGCTCTCTAGCTA AACCAGAAGTGACTTATTAAACTATTGAAGAAAAAGGACTCAAGAAAAATAATAAAAGACCATAAATAAGGGTGAAA ATGTTACCATGTGAAAAGAATGTATTTTACCTGCAAGTTACAAAAAAAATAGTTTGTGCATTGCAAATAAGCAAAGA CTTGGATTGACTTTACATTCATCATTTAAAATTCATTAGTTAAAATTAAACCTTAGAAAAAAATTGA SEQ ID NO: 11 >XM_028830779.1 PREDICTED: Macaca mulatta growth factor receptor bound protein 14 (GRB14), transcript variant X2, mRNA TTGCCATGCACGTGAATGTCAGACAATGAAGAGGAAGGCCATATGAATACTATGTGTCTAGTGGCTGATGCTGGCCA CAGACTTGGATCCCAGCCTGGTGGTACCCAAGAGGTGATTAAAGTGTACAGTGAAGATGAAACCAGTAGGGCTTTAG ATGTACCCAGTGACATAACGGCTCGAGATGTTTGTCAGCTGTTGATCCTGAAGAATCATTACATTGATGACCACAGC TGGACCCTTTTTGAGCACCTGCCTCACATAGGTGTAGAAAGAACAATAGAAGACCATGAACTGGTGATTGAAGTGCT ATCCAACTGGGGGATAGAAGAAGAAAACAAGCTATACTTTAGAAAAAATTATGCCAAATATGAGTTCTTTAAAAACC CAATGTATTTTTTTCCAGAGCATATGGTATCTTTTGCAACTGAAACCAATGGTGAAATATCCCCCACACAGATTTTG CAGATGTTTCTGAGTTCAAGCACATACCCTGAAATTCATGGTTTCTTACATGCGAAAGAACAGGGAAAGAAGTCTTG GAAAAAAATTTACTTTTTTCTAAGAAGATCTGGTTTATATTTTTCTACTAAAGGGACATCAAAGGAACCGCGGCATT TGCAGTTTTTCAGCGAATTTGGCAATAGTGATATTTATGTGTCACTGGCAGGCAAAAAAAAGCATGGAGCACCGACT AACTATGGATTCTGCTTTAAGCCTAACAAAGCGGGAGGGCCCCGAGACCTGAAAATGCTCTGTGCAGAAGAAGAGCA GAGTAGGACGTGCTGGGTGACCGCGATTAGATTGCTTAAGTATGGCATGCAGCTGTACCAGAATTATATGCATCCAT ATCAAGGTAGAAGTGGCTGCAGTTCACAGAGCATATCACCTATGAGAAGTATATCAGAGAATTCCCTGGTAGCAATG GACTTCTCAGGCCAGAAAAGCAGAGTTATAGAAAATCCCACTGAAGCCCTTTCAGTTGCAGTTGAAGAGGGACTCGC TTGGAGGAAAAAAGGATGTTTACGCCTGGGCACTCACGGTAGCCCCACTGCCTCTTCACAGAGCTCTGCCACAAACA TGGCTATCCACCGGTCCCAGCCATGGTTTCACCACAAAATTTCTAGAGATGAGGCTCAGCGATTGATTATTCAGCAA GGACTTGTGGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACCCCAAAACTTTCGTACTGTCAATGAGTCATGG ACAAAAAATAAAGCACTTTCAAATTATACCAGTAGAAGATGACGGTGAAATGTTCCACACACTGGATGATGGCCACA CAAGATTTACAGATCTAATACAACTGGTGGAGTTCTATCAACTCAATAAGGGCGTTCTTCCTTGCAAGTTGAAACAT TATTGTGCTAGGATTGCTCTCTAGCTAAACCAGAAGTGACTTATTAAACTATTGAAGAAAAAGGACTCAAGAAAAAT AATAAAAGACCATAAATAAGGGTGAAAATGTTACCATGTGAAAAGAATGTATTTTACCTGCAAGTTACAAAAAAAAT AGTTTGTGCATTGCAAATAAGCAAAGACTTGGATTGACTTTACATTCATCATTTAAAATTCATTAGTTAAAATTAAA CCTTAGAAAAAAATTGA SEQ ID NO: 12 >Reverse Complement of SEQ ID NO: 11 TCAATTTTTTTCTAAGGTTTAATTTTAACTAATGAATTTTAAATGATGAATGTAAAGTCAATCCAAGTCTTTGCTTA TTTGCAATGCACAAACTATTTTTTTTGTAACTTGCAGGTAAAATACATTCTTTTCACATGGTAACATTTTCACCCTT ATTTATGGTCTTTTATTATTTTTCTTGAGTCCTTTTTCTTCAATAGTTTAATAAGTCACTTCTGGTTTAGCTAGAGA GCAATCCTAGCACAATAATGTTTCAACTTGCAAGGAAGAACGCCCTTATTGAGTTGATAGAACTCCACCAGTTGTAT TAGATCTGTAAATCTTGTGTGGCCATCATCCAGTGTGTGGAACATTTCACCGTCATCTTCTACTGGTATAATTTGAA AGTGCTTTATTTTTTGTCCATGACTCATTGACAGTACGAAAGTTTTGGGGTTACTCTGACTATCCCGTACCAAGAAA ACTCCATCCACAAGTCCTTGCTGAATAATCAATCGCTGAGCCTCATCTCTAGAAATTTTGTGGTGAAACCATGGCTG GGACCGGTGGATAGCCATGTTTGTGGCAGAGCTCTGTGAAGAGGCAGTGGGGCTACCGTGAGTGCCCAGGCGTAAAC ATCCTTTTTTCCTCCAAGCGAGTCCCTCTTCAACTGCAACTGAAAGGGCTTCAGTGGGATTTTCTATAACTCTGCTT TTCTGGCCTGAGAAGTCCATTGCTACCAGGGAATTCTCTGATATACTTCTCATAGGTGATATGCTCTGTGAACTGCA GCCACTTCTACCTTGATATGGATGCATATAATTCTGGTACAGCTGCATGCCATACTTAAGCAATCTAATCGCGGTCA CCCAGCACGTCCTACTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCTCGGGGCCCTCCCGCTTTGTTAGGCTTA AAGCAGAATCCATAGTTAGTCGGTGCTCCATGCTTTTTTTTGCCTGCCAGTGACACATAAATATCACTATTGCCAAA TTCGCTGAAAAACTGCAAATGCCGCGGTTCCTTTGATGTCCCTTTAGTAGAAAAATATAAACCAGATCTTCTTAGAA AAAAGTAAATTTTTTTCCAAGACTTCTTTCCCTGTTCTTTCGCATGTAAGAAACCATGAATTTCAGGGTATGTGCTT GAACTCAGAAACATCTGCAAAATCTGTGTGGGGGATATTTCACCATTGGTTTCAGTTGCAAAAGATACCATATGCTC TGGAAAAAAATACATTGGGTTTTTAAAGAACTCATATTTGGCATAATTTTTTCTAAAGTATAGCTTGTTTTCTTCTT CTATCCCCCAGTTGGATAGCACTTCAATCACCAGTTCATGGTCTTCTATTGTTCTTTCTACACCTATGTGAGGCAGG TGCTCAAAAAGGGTCCAGCTGTGGTCATCAATGTAATGATTCTTCAGGATCAACAGCTGACAAACATCTCGAGCCGT TATGTCACTGGGTACATCTAAAGCCCTACTGGTTTCATCTTCACTGTACACTTTAATCACCTCTTGGGTACCACCAG GCTGGGATCCAAGTCTGTGGCCAGCATCAGCCACTAGACACATAGTATTCATATGGCCTTCCTCTTCATTGTCTGAC ATTCACGTGCATGGCAA Page 330 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) SEQ ID NO: 13 >XM_015110245.2 PREDICTED: Macaca mulatta growth factor receptor bound protein 14 (GRB14), transcript variant X3, mRNA CCTTAATTGGCTTTGGGTAGATTGGAATCACATAAGCAGGGTGACATTTATTACTTTCCTAGTTGTTTCATTGCACT GAGCCCTGAGATTCCTGTAAAAGATTTCTTTTATTTTGTCCATGACCTACAAGAGAGGATCATTCTAAGAAGAGCAG GCATGAGTTTGAGTGCAAGAAGAGTCACTCTGCCTGCAATAACGCCAATAATTCTACAGAAAAGGGTGATTAAAGTG TACAGTGAAGATGAAACCAGTAGGGCTTTAGATGTACCCAGTGACATAACGGCTCGAGATGTTTGTCAGCTGTTGAT CCTGAAGAATCATTACATTGATGACCACAGCTGGACCCTTTTTGAGCACCTGCCTCACATAGGTGTAGAAAGAACAA TAGAAGACCATGAACTGGTGATTGAAGTGCTATCCAACTGGGGGATAGAAGAAGAAAACAAGCTATACTTTAGAAAA AATTATGCCAAATATGAGTTCTTTAAAAACCCAATGTATTTTTTTCCAGAGCATATGGTATCTTTTGCAACTGAAAC CAATGGTGAAATATCCCCCACACAGATTTTGCAGATGTTTCTGAGTTCAAGCACATACCCTGAAATTCATGGTTTCT TACATGCGAAAGAACAGGGAAAGAAGTCTTGGAAAAAAATTTACTTTTTTCTAAGAAGATCTGGTTTATATTTTTCT ACTAAAGGGACATCAAAGGAACCGCGGCATTTGCAGTTTTTCAGCGAATTTGGCAATAGTGATATTTATGTGTCACT GGCAGGCAAAAAAAAGCATGGAGCACCGACTAACTATGGATTCTGCTTTAAGCCTAACAAAGCGGGAGGGCCCCGAG ACCTGAAAATGCTCTGTGCAGAAGAAGAGCAGAGTAGGACGTGCTGGGTGACCGCGATTAGATTGCTTAAGTATGGC ATGCAGCTGTACCAGAATTATATGCATCCATATCAAGGTAGAAGTGGCTGCAGTTCACAGAGCATATCACCTATGAG AAGTATATCAGAGAATTCCCTGGTAGCAATGGACTTCTCAGGCCAGAAAAGCAGAGTTATAGAAAATCCCACTGAAG CCCTTTCAGTTGCAGTTGAAGAGGGACTCGCTTGGAGGAAAAAAGGATGTTTACGCCTGGGCACTCACGGTAGCCCC ACTGCCTCTTCACAGAGCTCTGCCACAAACATGGCTATCCACCGGTCCCAGCCATGGTTTCACCACAAAATTTCTAG AGATGAGGCTCAGCGATTGATTATTCAGCAAGGACTTGTGGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACC CCAAAACTTTCGTACTGTCAATGAGTCATGGACAAAAAATAAAGCACTTTCAAATTATACCAGTAGAAGATGACGGT GAAATGTTCCACACACTGGATGATGGCCACACAAGATTTACAGATCTAATACAACTGGTGGAGTTCTATCAACTCAA TAAGGGCGTTCTTCCTTGCAAGTTGAAACATTATTGTGCTAGGATTGCTCTCTAGCTAAACCAGAAGTGACTTATTA AACTATTGAAGAAAAAGGACTCAAGAAAAATAATAAAAGACCATAAATAAGGGTGAAAATGTTACCATGTGAAAAGA ATGTATTTTACCTGCAAGTTACAAAAAAAATAGTTTGTGCATTGCAAATAAGCAAAGACTTGGATTGACTTTACATT CATCATTTAAAATTCATTAGTTAAAATTAAACCTTAGAAAAAAATTGA SEQ ID NO: 14 >Reverse Complement of SEQ ID NO: 13 TCAATTTTTTTCTAAGGTTTAATTTTAACTAATGAATTTTAAATGATGAATGTAAAGTCAATCCAAGTCTTTGCTTA TTTGCAATGCACAAACTATTTTTTTTGTAACTTGCAGGTAAAATACATTCTTTTCACATGGTAACATTTTCACCCTT ATTTATGGTCTTTTATTATTTTTCTTGAGTCCTTTTTCTTCAATAGTTTAATAAGTCACTTCTGGTTTAGCTAGAGA GCAATCCTAGCACAATAATGTTTCAACTTGCAAGGAAGAACGCCCTTATTGAGTTGATAGAACTCCACCAGTTGTAT TAGATCTGTAAATCTTGTGTGGCCATCATCCAGTGTGTGGAACATTTCACCGTCATCTTCTACTGGTATAATTTGAA AGTGCTTTATTTTTTGTCCATGACTCATTGACAGTACGAAAGTTTTGGGGTTACTCTGACTATCCCGTACCAAGAAA ACTCCATCCACAAGTCCTTGCTGAATAATCAATCGCTGAGCCTCATCTCTAGAAATTTTGTGGTGAAACCATGGCTG GGACCGGTGGATAGCCATGTTTGTGGCAGAGCTCTGTGAAGAGGCAGTGGGGCTACCGTGAGTGCCCAGGCGTAAAC ATCCTTTTTTCCTCCAAGCGAGTCCCTCTTCAACTGCAACTGAAAGGGCTTCAGTGGGATTTTCTATAACTCTGCTT TTCTGGCCTGAGAAGTCCATTGCTACCAGGGAATTCTCTGATATACTTCTCATAGGTGATATGCTCTGTGAACTGCA GCCACTTCTACCTTGATATGGATGCATATAATTCTGGTACAGCTGCATGCCATACTTAAGCAATCTAATCGCGGTCA CCCAGCACGTCCTACTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCTCGGGGCCCTCCCGCTTTGTTAGGCTTA AAGCAGAATCCATAGTTAGTCGGTGCTCCATGCTTTTTTTTGCCTGCCAGTGACACATAAATATCACTATTGCCAAA TTCGCTGAAAAACTGCAAATGCCGCGGTTCCTTTGATGTCCCTTTAGTAGAAAAATATAAACCAGATCTTCTTAGAA AAAAGTAAATTTTTTTCCAAGACTTCTTTCCCTGTTCTTTCGCATGTAAGAAACCATGAATTTCAGGGTATGTGCTT GAACTCAGAAACATCTGCAAAATCTGTGTGGGGGATATTTCACCATTGGTTTCAGTTGCAAAAGATACCATATGCTC TGGAAAAAAATACATTGGGTTTTTAAAGAACTCATATTTGGCATAATTTTTTCTAAAGTATAGCTTGTTTTCTTCTT CTATCCCCCAGTTGGATAGCACTTCAATCACCAGTTCATGGTCTTCTATTGTTCTTTCTACACCTATGTGAGGCAGG TGCTCAAAAAGGGTCCAGCTGTGGTCATCAATGTAATGATTCTTCAGGATCAACAGCTGACAAACATCTCGAGCCGT TATGTCACTGGGTACATCTAAAGCCCTACTGGTTTCATCTTCACTGTACACTTTAATCACCCTTTTCTGTAGAATTA TTGGCGTTATTGCAGGCAGAGTGACTCTTCTTGCACTCAAACTCATGCCTGCTCTTCTTAGAATGATCCTCTCTTGT AGGTCATGGACAAAATAAAAGAAATCTTTTACAGGAATCTCAGGGCTCAGTGCAATGAAACAACTAGGAAAGTAATA AATGTCACCCTGCTTATGTGATTCCAATCTACCCAAAGCCAATTAAGG SEQ ID NO: 15 >XM_008258679.2 PREDICTED: Oryctolagus cuniculus growth factor receptor bound protein 14 (GRB14), transcript variant X1, mRNA Page 331 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) TCCGCCCCCTCCCCTCCCCCGCCGCCTCGCAGACTGCTCAGCCGAGCTGCTGAGCCGCCGGGGCCGGAGCGCAGGCG GCCAGGCCACCGCACCTGCAGGGCGCTCGGGCCGCCGAGCCGGCATCCCGCCTCCCGCCTCCCGACACCCCGCAGCC TAGGCGCCCGGGCTCCCATGCCGCCTGAGCCCCCGGGCCGGCAACCATGACCACTTCCCTGCAAGATGGGCAGAGCG CCGCGGACAGGGCGGCTGCCCGGGACTCGCCGCTGGCCGCCCAGGTGTGCGGCGCTGCCCAGGGAAGGGACGACGCC CACGACCCGGCGCGGGCCCCCTGGCTGCACGCGCGAGCTCTGGTGCCGGCTCCGGACGGGACCCGCGGCTGTGCTGC AGACAGGAGAAAAAAGAAAGATCTTGATGTTCTGGAAACGCCATCTATTCCAAACCCCTTTCCTGAGCTCTGCTGTT CTCCATTTACATCTGTGTTGTCAGCAGGCCTCTTTCCCAAAGCAAATTCAAGGAAAAAACAGGTGATTAAAGTGTAC AGTGAAGATGAAACCAGCAGGGCTCTAGAGGTTCCCAGTGACATAACAGCCCGAGATGTTTGCCAGTTGTTGATTCT AAAGAATCATTACGTCGATGACCACAGCTGGACACTCTTTGAGCATCTGCCTCACATAGGTGTAGAAAGAATAATAG AAGACCATGAGCTAGTGACCGAAGTGCTATCCAACTGGGGAATGGAAGAAGAAAATAAGTTATTCTTTCGAAAAAAT TATGCCAAATATGAATTCTTTAAAAATCCAATGTATTTTTTTCCAGAGCATATGGTGTCTTTTGCAACTGAAACCAA TGGTGAAATTTCCCCCACACAGATTTTACAGATGTTTCTGAGTTCAACTACATATCCTGAAATCCATGGCTTCTTAC ATGCAAAAGAACAGGGAAAGAAGTCCTGGAAAAAAATTTACTTCCTTCTGAGAAGATCTGGTTTATATTTTTCTACT AAAGGGACATCAAAGGAACCACGACATTTGCAGTTTTTCAGCGAATTTGGCAGTAGTGATATATATGTGTCACTGAC AGGCAGAAAAAAACACGGAGCACCGACTCACTATGGATTCTGCTTTAAGCCTAACAAAGCAGGAGGGCCCCGAGACC TGAAAATGCTCTGTGCAGAAGAAGAGCAGAGCAGGACGTGCTGGGTGACTGCCATTCGATTACTTAAGTATGGCATG CAGCTCTACCAGAATTATATGCATCCATATCAAGGTAGAAGTGGCTGCAGTTCTCAGAGTATATCACCCATGAGGAG TATATCAGAGAATTCTCTGGTAGCAATGGACTTCTCAGGTCAGAAAAGCAGAGTTATCGAAAATCCCACAGAAGCCC TTTCAGTTGCAGTCGAAGAAGGACTTGCTTGGAGGAAAAAAGGATGTTTACGCCTTGGCGTCCATGGTAGCCCCACT GCTTCTTCGCAGAGCAGTGCCGCAAACATGGCTATCCACCGCTCCCAACCCTGGTTTCACCACAAAATTTCTAGAGA TGAAGCTCAGCGACTGATTATTCAGCAAGGACTTGTAGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACCCCA AAACTTTTGTACTATCAATGAGTCATGGACAAAAAATAAAGCACTTTCAAATTATACCAATTGAAGATGATGGTGCA ATGTTCCATACACTGGATGATGGCCACACAAGATTTACAGATCTAATTCAACTGGTGGAGTTCTATCAACTCAATAA GGGTGTTCTTCCTTGCAAGTTGAAGCATTATTGTGCTAGGATGGCTCTTTAACCAAACCAGAAGTGACTTGTGAAAC TATTGAAGGAAAAAGAACTCAAGAAGAAAATTAAGAGAGAGACCATAAATAAGGGTGAAAATGTTAACCATGGGGAA AAGAATGTATTTCATCTCAAGTTACAAGAAAGAGTTATACATTGCAAATAAGCAAAGACTTGGATTGACATTATATT CATCATTTAAAGTTCATTAGTTAAAAATTAAACTTTAGGAAAAAA SEQ ID NO: 16 >Reverse Complement of SEQ ID NO: 15 TTTTTTCCTAAAGTTTAATTTTTAACTAATGAACTTTAAATGATGAATATAATGTCAATCCAAGTCTTTGCTTATTT GCAATGTATAACTCTTTCTTGTAACTTGAGATGAAATACATTCTTTTCCCCATGGTTAACATTTTCACCCTTATTTA TGGTCTCTCTCTTAATTTTCTTCTTGAGTTCTTTTTCCTTCAATAGTTTCACAAGTCACTTCTGGTTTGGTTAAAGA GCCATCCTAGCACAATAATGCTTCAACTTGCAAGGAAGAACACCCTTATTGAGTTGATAGAACTCCACCAGTTGAAT TAGATCTGTAAATCTTGTGTGGCCATCATCCAGTGTATGGAACATTGCACCATCATCTTCAATTGGTATAATTTGAA AGTGCTTTATTTTTTGTCCATGACTCATTGATAGTACAAAAGTTTTGGGGTTACTCTGACTATCCCGTACCAAGAAA ACTCCATCTACAAGTCCTTGCTGAATAATCAGTCGCTGAGCTTCATCTCTAGAAATTTTGTGGTGAAACCAGGGTTG GGAGCGGTGGATAGCCATGTTTGCGGCACTGCTCTGCGAAGAAGCAGTGGGGCTACCATGGACGCCAAGGCGTAAAC ATCCTTTTTTCCTCCAAGCAAGTCCTTCTTCGACTGCAACTGAAAGGGCTTCTGTGGGATTTTCGATAACTCTGCTT TTCTGACCTGAGAAGTCCATTGCTACCAGAGAATTCTCTGATATACTCCTCATGGGTGATATACTCTGAGAACTGCA GCCACTTCTACCTTGATATGGATGCATATAATTCTGGTAGAGCTGCATGCCATACTTAAGTAATCGAATGGCAGTCA CCCAGCACGTCCTGCTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCTCGGGGCCCTCCTGCTTTGTTAGGCTTA AAGCAGAATCCATAGTGAGTCGGTGCTCCGTGTTTTTTTCTGCCTGTCAGTGACACATATATATCACTACTGCCAAA TTCGCTGAAAAACTGCAAATGTCGTGGTTCCTTTGATGTCCCTTTAGTAGAAAAATATAAACCAGATCTTCTCAGAA GGAAGTAAATTTTTTTCCAGGACTTCTTTCCCTGTTCTTTTGCATGTAAGAAGCCATGGATTTCAGGATATGTAGTT GAACTCAGAAACATCTGTAAAATCTGTGTGGGGGAAATTTCACCATTGGTTTCAGTTGCAAAAGACACCATATGCTC TGGAAAAAAATACATTGGATTTTTAAAGAATTCATATTTGGCATAATTTTTTCGAAAGAATAACTTATTTTCTTCTT CCATTCCCCAGTTGGATAGCACTTCGGTCACTAGCTCATGGTCTTCTATTATTCTTTCTACACCTATGTGAGGCAGA TGCTCAAAGAGTGTCCAGCTGTGGTCATCGACGTAATGATTCTTTAGAATCAACAACTGGCAAACATCTCGGGCTGT TATGTCACTGGGAACCTCTAGAGCCCTGCTGGTTTCATCTTCACTGTACACTTTAATCACCTGTTTTTTCCTTGAAT TTGCTTTGGGAAAGAGGCCTGCTGACAACACAGATGTAAATGGAGAACAGCAGAGCTCAGGAAAGGGGTTTGGAATA GATGGCGTTTCCAGAACATCAAGATCTTTCTTTTTTCTCCTGTCTGCAGCACAGCCGCGGGTCCCGTCCGGAGCCGG CACCAGAGCTCGCGCGTGCAGCCAGGGGGCCCGCGCCGGGTCGTGGGCGTCGTCCCTTCCCTGGGCAGCGCCGCACA CCTGGGCGGCCAGCGGCGAGTCCCGGGCAGCCGCCCTGTCCGCGGCGCTCTGCCCATCTTGCAGGGAAGTGGTCATG GTTGCCGGCCCGGGGGCTCAGGCGGCATGGGAGCCCGGGCGCCTAGGCTGCGGGGTGTCGGGAGGCGGGAGGCGGGA TGCCGGCTCGGCGGCCCGAGCGCCCTGCAGGTGCGGTGGCCTGGCCGCCTGCGCTCCGGCCCCGGCGGCTCAGCAGC TCGGCTGAGCAGTCTGCGAGGCGGCGGGGGAGGGGAGGGGGCGGA Page 332 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) SEQ ID NO: 17 >XM_017342897.1 PREDICTED: Oryctolagus cuniculus growth factor receptor bound protein 14 (GRB14), transcript variant X2, mRNA TCCGCCCCCTCCCCTCCCCCGCCGCCTCGCAGACTGCTCAGCCGAGCTGCTGAGCCGCCGGGGCCGGAGCGCAGGCG GCCAGGCCACCGCACCTGCAGGGCGCTCGGGCCGCCGAGCCGGCATCCCGCCTCCCGCCTCCCGACACCCCGCAGCC TAGGCGCCCGGGCTCCCATGCCGCCTGAGCCCCCGGGCCGGCAACCATGACCACTTCCCTGCAAGATGGGCAGAGCG CCGCGGACAGGGCGGCTGCCCGGGACTCGCCGCTGGCCGCCCAGGTGTGCGGCGCTGCCCAGGGAAGGGACGACGCC CACGACCCGGCGCGGGCCCCCTGGCTGCACGCGCGAGCTCTGGTGCCGGCTCCGGACGGGACCCGCGGCTGTGCTGC AGACAGGAGAAAAAAGAAAGATCTTGATGTTCTGGAAACGCCATCTATTCCAAACCCCTTTCCTGAGCTCTGCTGTT CTCCATTTACATCTGTGTTGTCAGCAGGCCTCTTTCCCAAAGCAAATTCAAGGAAAAAACAGGTGATTAAAGTGTAC AGTGAAGATGAAACCAGCAGGGCTCTAGAGGTTCCCAGTGACATAACAGCCCGAGATGTTTGCCAGTTGTTGATTCT AAAGAATCATTACGTCGATGACCACAGCTGGACACTCTTTGAGCATCTGCCTCACATAGGTGTAGAAAGAATAATAG AAGACCATGAGCTAGTGACCGAAGTGCTATCCAACTGGGGAATGGAAGAAGAAAATAAGTTATTCTTTCGAAAAAAT TATGCCAAATATGAATTCTTTAAAAATCCAATGATGTTTCTGAGTTCAACTACATATCCTGAAATCCATGGCTTCTT ACATGCAAAAGAACAGGGAAAGAAGTCCTGGAAAAAAATTTACTTCCTTCTGAGAAGATCTGGTTTATATTTTTCTA CTAAAGGGACATCAAAGGAACCACGACATTTGCAGTTTTTCAGCGAATTTGGCAGTAGTGATATATATGTGTCACTG ACAGGCAGAAAAAAACACGGAGCACCGACTCACTATGGATTCTGCTTTAAGCCTAACAAAGCAGGAGGGCCCCGAGA CCTGAAAATGCTCTGTGCAGAAGAAGAGCAGAGCAGGACGTGCTGGGTGACTGCCATTCGATTACTTAAGTATGGCA TGCAGCTCTACCAGAATTATATGCATCCATATCAAGGTAGAAGTGGCTGCAGTTCTCAGAGTATATCACCCATGAGG AGTATATCAGAGAATTCTCTGGTAGCAATGGACTTCTCAGGTCAGAAAAGCAGAGTTATCGAAAATCCCACAGAAGC CCTTTCAGTTGCAGTCGAAGAAGGACTTGCTTGGAGGAAAAAAGGATGTTTACGCCTTGGCGTCCATGGTAGCCCCA CTGCTTCTTCGCAGAGCAGTGCCGCAAACATGGCTATCCACCGCTCCCAACCCTGGTTTCACCACAAAATTTCTAGA GATGAAGCTCAGCGACTGATTATTCAGCAAGGACTTGTAGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACCC CAAAACTTTTGTACTATCAATGAGTCATGGACAAAAAATAAAGCACTTTCAAATTATACCAATTGAAGATGATGGTG CAATGTTCCATACACTGGATGATGGCCACACAAGATTTACAGATCTAATTCAACTGGTGGAGTTCTATCAACTCAAT AAGGGTGTTCTTCCTTGCAAGTTGAAGCATTATTGTGCTAGGATGGCTCTTTAACCAAACCAGAAGTGACTTGTGAA ACTATTGAAGGAAAAAGAACTCAAGAAGAAAATTAAGAGAGAGACCATAAATAAGGGTGAAAATGTTAACCATGGGG AAAAGAATGTATTTCATCTCAAGTTACAAGAAAGAGTTATACATTGCAAATAAGCAAAGACTTGGATTGACATTATA TTCATCATTTAAAGTTCATTAGTTAAAAATTAAACTTTAGGAAAAAA SEQ ID NO: 18 >Reverse Complement of SEQ ID NO: 17 TTTTTTCCTAAAGTTTAATTTTTAACTAATGAACTTTAAATGATGAATATAATGTCAATCCAAGTCTTTGCTTATTT GCAATGTATAACTCTTTCTTGTAACTTGAGATGAAATACATTCTTTTCCCCATGGTTAACATTTTCACCCTTATTTA TGGTCTCTCTCTTAATTTTCTTCTTGAGTTCTTTTTCCTTCAATAGTTTCACAAGTCACTTCTGGTTTGGTTAAAGA GCCATCCTAGCACAATAATGCTTCAACTTGCAAGGAAGAACACCCTTATTGAGTTGATAGAACTCCACCAGTTGAAT TAGATCTGTAAATCTTGTGTGGCCATCATCCAGTGTATGGAACATTGCACCATCATCTTCAATTGGTATAATTTGAA AGTGCTTTATTTTTTGTCCATGACTCATTGATAGTACAAAAGTTTTGGGGTTACTCTGACTATCCCGTACCAAGAAA ACTCCATCTACAAGTCCTTGCTGAATAATCAGTCGCTGAGCTTCATCTCTAGAAATTTTGTGGTGAAACCAGGGTTG GGAGCGGTGGATAGCCATGTTTGCGGCACTGCTCTGCGAAGAAGCAGTGGGGCTACCATGGACGCCAAGGCGTAAAC ATCCTTTTTTCCTCCAAGCAAGTCCTTCTTCGACTGCAACTGAAAGGGCTTCTGTGGGATTTTCGATAACTCTGCTT TTCTGACCTGAGAAGTCCATTGCTACCAGAGAATTCTCTGATATACTCCTCATGGGTGATATACTCTGAGAACTGCA GCCACTTCTACCTTGATATGGATGCATATAATTCTGGTAGAGCTGCATGCCATACTTAAGTAATCGAATGGCAGTCA CCCAGCACGTCCTGCTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCTCGGGGCCCTCCTGCTTTGTTAGGCTTA AAGCAGAATCCATAGTGAGTCGGTGCTCCGTGTTTTTTTCTGCCTGTCAGTGACACATATATATCACTACTGCCAAA TTCGCTGAAAAACTGCAAATGTCGTGGTTCCTTTGATGTCCCTTTAGTAGAAAAATATAAACCAGATCTTCTCAGAA GGAAGTAAATTTTTTTCCAGGACTTCTTTCCCTGTTCTTTTGCATGTAAGAAGCCATGGATTTCAGGATATGTAGTT GAACTCAGAAACATCATTGGATTTTTAAAGAATTCATATTTGGCATAATTTTTTCGAAAGAATAACTTATTTTCTTC TTCCATTCCCCAGTTGGATAGCACTTCGGTCACTAGCTCATGGTCTTCTATTATTCTTTCTACACCTATGTGAGGCA GATGCTCAAAGAGTGTCCAGCTGTGGTCATCGACGTAATGATTCTTTAGAATCAACAACTGGCAAACATCTCGGGCT GTTATGTCACTGGGAACCTCTAGAGCCCTGCTGGTTTCATCTTCACTGTACACTTTAATCACCTGTTTTTTCCTTGA ATTTGCTTTGGGAAAGAGGCCTGCTGACAACACAGATGTAAATGGAGAACAGCAGAGCTCAGGAAAGGGGTTTGGAA TAGATGGCGTTTCCAGAACATCAAGATCTTTCTTTTTTCTCCTGTCTGCAGCACAGCCGCGGGTCCCGTCCGGAGCC GGCACCAGAGCTCGCGCGTGCAGCCAGGGGGCCCGCGCCGGGTCGTGGGCGTCGTCCCTTCCCTGGGCAGCGCCGCA CACCTGGGCGGCCAGCGGCGAGTCCCGGGCAGCCGCCCTGTCCGCGGCGCTCTGCCCATCTTGCAGGGAAGTGGTCA TGGTTGCCGGCCCGGGGGCTCAGGCGGCATGGGAGCCCGGGCGCCTAGGCTGCGGGGTGTCGGGAGGCGGGAGGCGG Page 333 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) GATGCCGGCTCGGCGGCCCGAGCGCCCTGCAGGTGCGGTGGCCTGGCCGCCTGCGCTCCGGCCCCGGCGGCTCAGCA GCTCGGCTGAGCAGTCTGCGAGGCGGCGGGGGAGGGGAGGGGGCGGA SEQ ID NO: 19 >XM_017342898.1 PREDICTED: Oryctolagus cuniculus growth factor receptor bound protein 14 (GRB14), transcript variant X3, mRNA CATTTATTACTTCCCTGGTTGTTTCTTTGCACTGAGCCCTGAGATTCCCAAGGAGTAACCGTTAAAGATTTCTTTCA TTTCGTCTATGACCTGCAAGGGGAAATCATTCTCAGAAGAGCAGGCATGAGTTTGAGTGCAAGAAGAGTGACTCTGC CTGCAATAACACCACTAGTTCTACAGAAAAGGGTGATTAAAGTGTACAGTGAAGATGAAACCAGCAGGGCTCTAGAG GTTCCCAGTGACATAACAGCCCGAGATGTTTGCCAGTTGTTGATTCTAAAGAATCATTACGTCGATGACCACAGCTG GACACTCTTTGAGCATCTGCCTCACATAGGTGTAGAAAGAATAATAGAAGACCATGAGCTAGTGACCGAAGTGCTAT CCAACTGGGGAATGGAAGAAGAAAATAAGTTATTCTTTCGAAAAAATTATGCCAAATATGAATTCTTTAAAAATCCA ATGTATTTTTTTCCAGAGCATATGGTGTCTTTTGCAACTGAAACCAATGGTGAAATTTCCCCCACACAGATTTTACA GATGTTTCTGAGTTCAACTACATATCCTGAAATCCATGGCTTCTTACATGCAAAAGAACAGGGAAAGAAGTCCTGGA AAAAAATTTACTTCCTTCTGAGAAGATCTGGTTTATATTTTTCTACTAAAGGGACATCAAAGGAACCACGACATTTG CAGTTTTTCAGCGAATTTGGCAGTAGTGATATATATGTGTCACTGACAGGCAGAAAAAAACACGGAGCACCGACTCA CTATGGATTCTGCTTTAAGCCTAACAAAGCAGGAGGGCCCCGAGACCTGAAAATGCTCTGTGCAGAAGAAGAGCAGA GCAGGACGTGCTGGGTGACTGCCATTCGATTACTTAAGTATGGCATGCAGCTCTACCAGAATTATATGCATCCATAT CAAGGTAGAAGTGGCTGCAGTTCTCAGAGTATATCACCCATGAGGAGTATATCAGAGAATTCTCTGGTAGCAATGGA CTTCTCAGGTCAGAAAAGCAGAGTTATCGAAAATCCCACAGAAGCCCTTTCAGTTGCAGTCGAAGAAGGACTTGCTT GGAGGAAAAAAGGATGTTTACGCCTTGGCGTCCATGGTAGCCCCACTGCTTCTTCGCAGAGCAGTGCCGCAAACATG GCTATCCACCGCTCCCAACCCTGGTTTCACCACAAAATTTCTAGAGATGAAGCTCAGCGACTGATTATTCAGCAAGG ACTTGTAGATGGAGTTTTCTTGGTACGGGATAGTCAGAGTAACCCCAAAACTTTTGTACTATCAATGAGTCATGGAC AAAAAATAAAGCACTTTCAAATTATACCAATTGAAGATGATGGTGCAATGTTCCATACACTGGATGATGGCCACACA AGATTTACAGATCTAATTCAACTGGTGGAGTTCTATCAACTCAATAAGGGTGTTCTTCCTTGCAAGTTGAAGCATTA TTGTGCTAGGATGGCTCTTTAACCAAACCAGAAGTGACTTGTGAAACTATTGAAGGAAAAAGAACTCAAGAAGAAAA TTAAGAGAGAGACCATAAATAAGGGTGAAAATGTTAACCATGGGGAAAAGAATGTATTTCATCTCAAGTTACAAGAA AGAGTTATACATTGCAAATAAGCAAAGACTTGGATTGACATTATATTCATCATTTAAAGTTCATTAGTTAAAAATTA AACTTTAGGAAAAAA SEQ ID NO: 20 >Reverse Complement of SEQ ID NO: 19 TTTTTTCCTAAAGTTTAATTTTTAACTAATGAACTTTAAATGATGAATATAATGTCAATCCAAGTCTTTGCTTATTT GCAATGTATAACTCTTTCTTGTAACTTGAGATGAAATACATTCTTTTCCCCATGGTTAACATTTTCACCCTTATTTA TGGTCTCTCTCTTAATTTTCTTCTTGAGTTCTTTTTCCTTCAATAGTTTCACAAGTCACTTCTGGTTTGGTTAAAGA GCCATCCTAGCACAATAATGCTTCAACTTGCAAGGAAGAACACCCTTATTGAGTTGATAGAACTCCACCAGTTGAAT TAGATCTGTAAATCTTGTGTGGCCATCATCCAGTGTATGGAACATTGCACCATCATCTTCAATTGGTATAATTTGAA AGTGCTTTATTTTTTGTCCATGACTCATTGATAGTACAAAAGTTTTGGGGTTACTCTGACTATCCCGTACCAAGAAA ACTCCATCTACAAGTCCTTGCTGAATAATCAGTCGCTGAGCTTCATCTCTAGAAATTTTGTGGTGAAACCAGGGTTG GGAGCGGTGGATAGCCATGTTTGCGGCACTGCTCTGCGAAGAAGCAGTGGGGCTACCATGGACGCCAAGGCGTAAAC ATCCTTTTTTCCTCCAAGCAAGTCCTTCTTCGACTGCAACTGAAAGGGCTTCTGTGGGATTTTCGATAACTCTGCTT TTCTGACCTGAGAAGTCCATTGCTACCAGAGAATTCTCTGATATACTCCTCATGGGTGATATACTCTGAGAACTGCA GCCACTTCTACCTTGATATGGATGCATATAATTCTGGTAGAGCTGCATGCCATACTTAAGTAATCGAATGGCAGTCA CCCAGCACGTCCTGCTCTGCTCTTCTTCTGCACAGAGCATTTTCAGGTCTCGGGGCCCTCCTGCTTTGTTAGGCTTA AAGCAGAATCCATAGTGAGTCGGTGCTCCGTGTTTTTTTCTGCCTGTCAGTGACACATATATATCACTACTGCCAAA TTCGCTGAAAAACTGCAAATGTCGTGGTTCCTTTGATGTCCCTTTAGTAGAAAAATATAAACCAGATCTTCTCAGAA GGAAGTAAATTTTTTTCCAGGACTTCTTTCCCTGTTCTTTTGCATGTAAGAAGCCATGGATTTCAGGATATGTAGTT GAACTCAGAAACATCTGTAAAATCTGTGTGGGGGAAATTTCACCATTGGTTTCAGTTGCAAAAGACACCATATGCTC TGGAAAAAAATACATTGGATTTTTAAAGAATTCATATTTGGCATAATTTTTTCGAAAGAATAACTTATTTTCTTCTT CCATTCCCCAGTTGGATAGCACTTCGGTCACTAGCTCATGGTCTTCTATTATTCTTTCTACACCTATGTGAGGCAGA TGCTCAAAGAGTGTCCAGCTGTGGTCATCGACGTAATGATTCTTTAGAATCAACAACTGGCAAACATCTCGGGCTGT TATGTCACTGGGAACCTCTAGAGCCCTGCTGGTTTCATCTTCACTGTACACTTTAATCACCCTTTTCTGTAGAACTA GTGGTGTTATTGCAGGCAGAGTCACTCTTCTTGCACTCAAACTCATGCCTGCTCTTCTGAGAATGATTTCCCCTTGC AGGTCATAGACGAAATGAAAGAAATCTTTAACGGTTACTCCTTGGGAATCTCAGGGCTCAGTGCAAAGAAACAACCA GGGAAGTAATAAATG Page 334 of 346 WBD (US) 4891-2192-1712v1

Claims

WBD Docket No.: A1088681630WO (ALN-470-WO) We claim: 1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell, wherein said dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding GRB14 which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-7 or 15- 16. 2. The dsRNA agent of claim 1, wherein said dsRNA agent comprises at least one modified nucleotide. 3. The dsRNA agent of claim 1 or 2, wherein substantially all of the nucleotides of the sense strand comprise a modification. 4. The dsRNA agent of claim 1 or 2, wherein substantially all of the nucleotides of the antisense strand comprise a modification. 5. The dsRNA agent of claim 1 or 2, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification. 6. A double stranded RNA (dsRNA) agent for inhibiting expression of growth factor receptor bound protein 14 (GRB14) in a cell, wherein the double stranded RNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3’-terminus. 7. The dsRNA agent of claim 6, wherein all of the nucleotides of the sense strand comprise a modification. Page 335 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 8. The dsRNA agent of claim 6, wherein all of the nucleotides of the antisense strand comprise a modification. 9. The dsRNA agent of claim 6, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification. 10. The dsRNA agent of any one of claims 2-9, wherein the at least one modified nucleotide is selected from the group consisting of a deoxy-nucleotide, a 3’-terminal deoxy-thymine (dT) nucleotide, a 2’- O-methyl modified nucleotide, a 2’-fluoro modified nucleotide, a 2’-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5’-phosphate, a nucleotide comprising a 5’-phosphate mimic, a glycol modified nucleotide, and a 2-O-(N-methylacetamide) modified nucleotide, and combinations thereof. 11. The dsRNA agent of claim 10, wherein the at least one modified nucleotide is a 2’-O-methyl and/or a 2’-fluoro modification. 12. The dsRNA agent of any one of claims 1-11, wherein the region of complementarity is at least 17 nucleotides in length. 13. The dsRNA agent of any one of claims 1-12, wherein the region of complementarity is 19 to 30 nucleotides in length. 14. The dsRNA agent of claim 13, wherein the region of complementarity is 19-25 nucleotides in length. 15. The dsRNA agent of claim 14, wherein the region of complementarity is 21 to 23 nucleotides in length. 16. The dsRNA agent of any one of claims 1-15, wherein each strand is no more than 30 nucleotides in length. Page 336 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 17. The dsRNA agent of any one of claims 1-16, wherein each strand is independently 19-30 nucleotides in length. 18. The dsRNA agent of claim 17, wherein each strand is independently 19-25 nucleotides in length. 19. The dsRNA agent of claim 17, wherein each strand is independently 21-23 nucleotides in length. 20. The dsRNA agent of any one of claims 1-19, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide. 21. The dsRNA agent of any one of claim 20, wherein at least one strand comprises a 3’ overhang of at least 2 nucleotides. 22. The dsRNA agent of any one of claims 1-5 and 10-21, further comprising a ligand. 23. The dsRNA agent of claim 22, wherein the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent. 24. The dsRNA agent of claim 6, 22, or 23, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative. 25. The dsRNA agent of claim 24, wherein the ligand is HO OH . Page 337 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 26. The dsRNA agent of claim 25, wherein the dsRNA agent is conjugated to the ligand as shown in the following schematic 27. The dsRNA agent of claim 26, wherein the X is O. 28. The dsRNA agent of any one of claims 1-27, wherein (a) the sense strand comprises the nucleotide sequence CAAAACUUUCGUACUGUCAAA (SEQ ID NO: 8770) and the antisense strand comprises the nucleotide sequence UUUGACAGUACGAAAGUUUUGGG (SEQ ID NO: 8784); (b) the sense strand comprises the nucleotide sequence AAGACUUGGAUUGACUUUACA (SEQ ID NO: 8771) and the antisense strand comprises the nucleotide sequence UGUAAAGUCAAUCCAAGUCUUUG (SEQ ID NO: 8785); (c) the sense strand comprises the nucleotide sequence UUGACUUUACAUUCAUCAUUA (SEQ ID NO: 8777) and the antisense strand comprises the nucleotide sequence UAAUGATGAAUGUAAAGUCAAUC (SEQ ID NO: 8791); (d) the sense strand comprises the nucleotide sequence UUAUGCCAAAUAUGAGUUCUA (SEQ ID NO: 8781) and the antisense strand comprises the nucleotide sequence UAGAACTCAUATUUGGCAUAAUU (SEQ ID NO: 8795); (e) the sense strand comprises the nucleotide sequence UGCAAGUUGAAACAUUAUUGA (SEQ ID NO: 8783) and the antisense strand comprises the nucleotide sequence UCAATAAUGUUTCAACUUGCAAG (SEQ ID NO: 8797); or (f) the sense strand comprises the nucleotide sequence UAUCCUGAAAUUCAUGGUUUA (SEQ ID NO: 7595) and the antisense strand comprises the nucleotide sequence UAAACCAUGAATUUCAGGAUAUG (SEQ ID NO: 7863). Page 338 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 29. The dsRNA agent of any one of claims 1-28, wherein (a) the sense strand consists of the nucleotide sequence CAAAACUUUCGUACUGUCAAA (SEQ ID NO: 8770) and the antisense strand consists of the nucleotide sequence UUUGACAGUACGAAAGUUUUGGG (SEQ ID NO: 8784); (b) the sense strand consists of the nucleotide sequence AAGACUUGGAUUGACUUUACA (SEQ ID NO: 8771) and the antisense strand consists of the nucleotide sequence UGUAAAGUCAAUCCAAGUCUUUG (SEQ ID NO: 8785); (c) the sense strand consists of the nucleotide sequence UUGACUUUACAUUCAUCAUUA (SEQ ID NO: 8777) and the antisense strand consists of the nucleotide sequence UAAUGATGAAUGUAAAGUCAAUC (SEQ ID NO: 8791); (d) the sense strand consists of the nucleotide sequence UUAUGCCAAAUAUGAGUUCUA (SEQ ID NO: 8781) and the antisense strand consists of the nucleotide sequence UAGAACTCAUATUUGGCAUAAUU (SEQ ID NO: 8795); (e) the sense strand consists of the nucleotide sequence UGCAAGUUGAAACAUUAUUGA (SEQ ID NO: 8783) and the antisense strand consists of the nucleotide sequence UCAATAAUGUUTCAACUUGCAAG (SEQ ID NO: 8797); or (f) the sense strand consists of the nucleotide sequence UAUCCUGAAAUUCAUGGUUUA (SEQ ID NO: 7595) and the antisense strand consists of the nucleotide sequence UAAACCAUGAATUUCAGGAUAUG (SEQ ID NO: 7863). 30. The dsRNA agent of any one of claims 1-28, wherein (a) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8798 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8812; (b) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8799 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8813; (c) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8805 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8819; (d) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8809 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8823; (e) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8811 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8825; or (f) the sense strand comprises the sequence and all the modifications of SEQ ID NO: 8131 and the antisense strand comprises the sequence and all the modifications of SEQ ID NO: 8399. Page 339 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 31. The dsRNA agent of claim 1, wherein the region of complementarity comprises any one of the antisense sequences in Tables 2-7 or 15-16. 32. The dsRNA agent of claim 31, wherein the dsRNA agent is selected from the group consisting of AD-2217254, AD-2217251, AD-2217248, AD-2217250, AD-2217245, AD-2217252, AD- 2217253, AD-2217246, AD-2217262, AD-2217258, AD-2217255, AD-2217257, or AD-2123142. 33. The dsRNA agent of any one of claims 2-29, wherein the at least one modified nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2^-methoxyethyl, 2^-O-alkyl, 2^-O-allyl, 2^-C- allyl, 2^-fluoro, 2’-O-methyl, 2^-deoxy, and combinations thereof. 34. The dsRNA agent of claim 33, wherein the at least one modified nucleotide is a 2^-O-methyl and/or a 2^-fluoro modification. 35. The dsRNA agent of any one of claims 1-33, wherein the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage. 36. The dsRNA agent of claim 35, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 3’-terminus of one strand. 37. The dsRNA agent of claim 36, wherein said strand is the antisense strand. 38. The dsRNA agent of claim 36, wherein said strand is the sense strand. 39. The dsRNA agent of claim 35, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 5’-terminus of one strand. 40. The dsRNA agent of claim 39, wherein said strand is the antisense strand. 41. The dsRNA agent of claim 39, wherein said strand is the sense strand. 42. The dsRNA agent of claim 35, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5’- and 3’-terminus of one strand. Page 340 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 43. The dsRNA agent of any one of claims 1-42, wherein the base pair at the 1 position of the 5^- end of the antisense strand of the duplex is an AU base pair. 44. The dsRNA agent of any one of claims 1-43, wherein the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides. 45. A double stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of growth factor receptor bound protein 14 (GRB14) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any one of the sense sequences listed in any one of Tables 2-7 or 15-16 and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any one of the antisense sequences listed in any one of Tables 2-7 or 15-16, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification, a 2’-fluoro modification, and a deoxy-nucleotide, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’- terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a monovalent, bivalent or trivalent branched linker at the 3’-terminus. 46. The dsRNA agent of claim 45, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides. 47. The dsRNA agent of any one of claims 1, 45, or 46, wherein the region of complementarity comprises any one of the antisense sequences listed in Tables 2-7 or 15-16. 48. The dsRNA agent of any one of claims 1-47, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of the nucleotide sequences of any one of the agents listed in Tables 2-7 or 15-16. 49. The dsRNA agent of any one of claims 1-48, wherein the dsRNA agent targets a hotspot region of an mRNA encoding GRB14. Page 341 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 50. A dsRNA agent that targets a hotspot region of a growth factor receptor protein 14 (GRB14) mRNA. 51. A cell containing the dsRNA agent of any one of claims 1-50. 52. A vector encoding at least one strand of the dsRNA agent of any one of claims 1-50. 53. A pharmaceutical composition for inhibiting expression of the growth factor receptor protein 14 (GRB14) gene comprising the dsRNA agent of any one of claims 1-50. 54. The pharmaceutical composition of claim 53, wherein the dsRNA agent is formulated in an unbuffered solution. 55. The pharmaceutical composition of claim 54, wherein the unbuffered solution is saline or water. 56. The pharmaceutical composition of claim 53, wherein the agent is formulated with a buffered solution. 57. The pharmaceutical composition of claim 56, wherein said buffered solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. 58. The pharmaceutical composition of claim 56, wherein the buffered solution is phosphate buffered saline (PBS). 59. A method of inhibiting growth factor receptor bound protein 14 (GRB14) expression in a cell, the method comprising introducing into the cell the dsRNA agent of any one of claims 1-50, or a pharmaceutical composition of any one of claims 53-58, thereby inhibiting expression of GRB14 in the cell. 60. The method of claim 59, wherein said cell is within a subject. 61. The method of claim 60, wherein the subject is a human. 62. The method of any one of claims 59-61, wherein the GRB14 expression is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or to below the level of detection of GRB14 expression. Page 342 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 63. The method of claim 61, wherein the human subject has a GRB14-associated disease, disorder, or condition. 64. The method of claim 63, wherein the GRB14-associated disease, disorder, or condition is diabetes. 65. The method of claim 64, wherein the diabetes is type 2 diabetes. 66. The method of claim 64, wherein the diabetes is type 1 diabetes. 67. The method of claim 63, wherein the GRB14-associated disease, disorder, or condition is prediabetes. 68. The method of claim 63, wherein the GRB14-associated disease, disorder, or condition is insulin resistance. 69. The method of claim 63, wherein the GRB14-associated disease, disorder, or condition is selected from the group consisting of obesity, diabetic neuropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke. 70. A method of inhibiting the expression of GRB14 in a subject, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1-50, or a pharmaceutical composition of any one of claims 53-58, thereby inhibiting the expression of GRB14 in said subject. 71. A method of treating a subject having a GRB14-associated disease, disorder, or condition, comprising administering to the subject a therapeutically effective amount of the agent of any one of claims 1- 50, or a pharmaceutical composition of any one of claims 53-58, thereby treating the subject having the GRB14-associated disease, disorder, or condition. 72. A method of preventing at least one symptom in a subject having a GRB14-associated disease, disorder, or condition comprising administering to the subject a prophylactically effective amount of the agent of any one of claims 1-50, or a pharmaceutical composition of any one of claims 53-58, thereby preventing at least one symptom in the subject having the GRB14-associated disease, disorder, or condition. Page 343 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 73. The method of claim 71 or 72, wherein the GRB14-associated disease, disorder, or condition is diabetes. 74. The method of claim 73, wherein the diabetes is type 2 diabetes. 75. The method of claim 74, wherein the diabetes is type 1 diabetes. 76. The method of claim 71 or 72, wherein the GRB14-associated disease, disorder, or condition is prediabetes. 77. The method of claim 71 or 72, wherein the GRB14-associated disease, disorder, or condition is insulin resistance. 78. The method of claim 71 or 72, wherein the GRB14-associated disease, disorder, or condition is selected from the group consisting of obesity, diabetic neuropathy, diabetic nephropathy, diabetic vasculopathy, diabetic retinopathy, hypertension, dyslipidemia, atherosclerosis, coronary heart disease, and stroke. 79. A method of reducing risk of a subject developing type 2 diabetes, the method comprising administering to the subject a prophylactically effective amount of the dsRNA agent of any one of claims 1- 50, or a pharmaceutical composition of any one of claims 53-58, thereby reducing the risk of the subject developing type 2 diabetes. 80. A method of increasing insulin sensitivity in a subject, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1-50, or a pharmaceutical composition of any one of claims 53-58, thereby increasing insulin sensitivity in the subject. 81. A method of reversing type 2 diabetes in a subject, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1-50, or a pharmaceutical composition of any one of claims 53-58, thereby reversing type 2 diabetes in the subject. 82. The method of any one of claims 60-81, wherein the subject is obese. 83. The method of any one of claims 60-82, further comprising administering an additional therapeutic to the subject. Page 344 of 346 WBD (US) 4891-2192-1712v1 WBD Docket No.: A1088681630WO (ALN-470-WO) 84. The method of any one of claims 60-83, wherein the dsRNA agent is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. 85. The method of any one of claims 60-84, wherein the agent is administered to the subject intravenously, intramuscularly, or subcutaneously. 86. The method of any one of claims 60-85, further comprising determining a level of GRB14 mRNA or protein in the subject.   Page 345 of 346 WBD (US) 4891-2192-1712v1
PCT/US2025/020936 2024-03-22 2025-03-21 Irna compositions and methods for silencing growth factor receptor bound protein 14 (grb14) in the liver Pending WO2025199455A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202463568529P 2024-03-22 2024-03-22
US63/568,529 2024-03-22
US202563762453P 2025-02-24 2025-02-24
US63/762,453 2025-02-24

Publications (1)

Publication Number Publication Date
WO2025199455A1 true WO2025199455A1 (en) 2025-09-25

Family

ID=97140351

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2025/020936 Pending WO2025199455A1 (en) 2024-03-22 2025-03-21 Irna compositions and methods for silencing growth factor receptor bound protein 14 (grb14) in the liver

Country Status (2)

Country Link
TW (1) TW202603168A (en)
WO (1) WO2025199455A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257851A1 (en) * 2002-11-26 2006-11-16 Itzhak Bentwich Bioinformatically detectable group of novel viral regulatory genes and uses thereof
US20220119890A1 (en) * 2019-01-25 2022-04-21 Grail, Llc Detecting cancer, cancer tissue of origin, and/or a cancer cell type
US20230332147A1 (en) * 2020-09-09 2023-10-19 Alnylam Pharmaceuticals, Inc. Irna compositions and methods for silencing growth factor receptor bound protein 10 (grb10) or growth factor receptor bound protein 14 (grb14) in the liver

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257851A1 (en) * 2002-11-26 2006-11-16 Itzhak Bentwich Bioinformatically detectable group of novel viral regulatory genes and uses thereof
US20220119890A1 (en) * 2019-01-25 2022-04-21 Grail, Llc Detecting cancer, cancer tissue of origin, and/or a cancer cell type
US20230332147A1 (en) * 2020-09-09 2023-10-19 Alnylam Pharmaceuticals, Inc. Irna compositions and methods for silencing growth factor receptor bound protein 10 (grb10) or growth factor receptor bound protein 14 (grb14) in the liver

Also Published As

Publication number Publication date
TW202603168A (en) 2026-01-16

Similar Documents

Publication Publication Date Title
US12492401B2 (en) Angiopoietin-like 3 (ANGPTL3) iRNA compositions and methods of use thereof
EP3898979A2 (en) Amyloid precursor protein (app) rnai agent compositions and methods of use thereof
US20250017953A1 (en) LACTATE DEHYDROGENASE A (LDHA) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US20250188456A1 (en) High mobility group box-1 (hmgb1) irna compositions and methods of use thereof
EP4188390A1 (en) Atxn2 irna compositions and methods of use thereof for treating or preventing atxn2-associated neurodegenerative diseases
WO2022212231A2 (en) Huntingtin (htt) irna agent compositions and methods of use thereof
US20240425854A1 (en) Kisspeptin 1 (kiss1) irna compositions and methods of use thereof
US20240117349A1 (en) iRNA COMPOSITIONS AND METHODS FOR SILENCING AMYLOID PRECURSOR PROTEIN (APP)
US20230332147A1 (en) Irna compositions and methods for silencing growth factor receptor bound protein 10 (grb10) or growth factor receptor bound protein 14 (grb14) in the liver
EP4013870A1 (en) Small ribosomal protein subunit 25 (rps25) irna agent compositions and methods of use thereof
WO2023076450A2 (en) HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
AU2022283796A1 (en) HUMAN CHROMOSOME 9 OPEN READING FRAME 72 (C9ORF72) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2026101913A1 (en) Sirnas targeting complement factor h-related (cfhr) gene transcripts and methods of use
TW202603168A (en) Irna compositions and methods for silencing growth factor receptor bound protein 14 (grb14) in the liver

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 25774193

Country of ref document: EP

Kind code of ref document: A1