WO2025193227A1 - Treating osteoarthritis by pharmacological modulation of klf4 - Google Patents

Abstract

The present invention provides methods for treating osteoarthritis. The methods of the invention involve administering to a subject in need of treatment a pharmaceutical composition that contains an effective amount of an KLF4-activating compound, e.g., mocetinostat.

Description

TREATING OSTEOARTHRITIS BY PHARMACOLOGICAL MODULATION OF KLF4

STATEMENT OF GOVERNMENT SUPPORT

[0001] This invention was made with government support under AG049617 and AG056144 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

[0002] Osteoarthritis (OA) is the most common joint disease.¹ Despite substantial progress in identifying mechanisms of OA pathogenesis and molecular targets for intervention², there have thus far not been any successful clinical trials and there are no approved pharmacological treatments to prevent disease onset or progression. A potential explanation is that more important molecular mechanisms than those previously targeted are involved in OA.

[0003] Degradation and loss of articular cartilage is a major factor of OA pathogenesis.² Cartilage extracellular matrix (ECM) molecules, including type-2 and type-11 collagen (COL2A1 and COL11A2), aggrecan (ACAN) and cartilage oligomeric matrix protein (COMP), are regulated by SRY-box transcription factor-9 (SOX9) cooperating with SOX5 and SOX6.³'⁷ Proteoglycan-4 (PRG4) also known as lubricin is dominantly expressed in the superficial zone of articular cartilage, and is essential for homeostasis of articular joints to prevent damage to the articular surface.⁸ While several transcription factors are reported to regulate PRG4^{9 11}, PRG4 is not subject to regulation by SOX9, which is a different regulatory mechanism compared to other cartilage ECM genes described earlier.^{5 12} A transcription factor that upregulates all these cartilage signature genes would be a promising therapeutic for cartilage engineering and in treatment of OA. Activation of catabolic and inflammatory events is another key mechanism in OA.^{2 13 14} Therefore, suppressing catabolic and inflammatory genes, including a disintegrin and metalloproteinase with thrombospondin motifs-5 (ADAMTS5), matrix metalloproteinase-3 (MMP3), MMP13, interleukin-6 (IL6), prostaglandin-endoperoxide synthase-2 (PTGS2), and nitric oxide synthase-2 (NOS2), will also be important for therapeutic intervention in OA.

[0004] There is a unmet need in the art for novel and effective methods for treating or ameliorating symptoms associated with OA. The present invention addresses this and other unmet needs in the art.

SUMMARY OF THE INVENTION

[0005] In one aspect, the invention provides methods for treating osteoarthritis in a subject. The methods entail administering to the subject a therapeutically effective amount of a compound that activates endogenous Kriippel-Like Factor 4 (KLF4) expression, thereby treating osteoarthritis in the subject. Examples of specific KLF4- activating compounds suitable for the invention are shown in Table 1, including functional derivative compounds thereof. In some preferred embodiments, the employed KLF4 -activating compound is N-(2-aminophenyl)-4-[[[4-(3-pyridinyl)-2- pyrimidinyl]amino]methyl]-benzamide (mocetinostat) or a functional derivative thereof. The methods can be used to treat subjects suffering from osteoarthritis or at risk of developing osteoarthritis. Preferably, the subject to be treated is a human.

[0006] In some methods of the invention, the KLF4-activating compound is administered to the subject via a parenteral route. In some of these embodiments, the compound is administered to the subject via intraperitoneal injection. Typically, the KLF4-activating compound is administered to the subject in a pharmaceutical composition. In some embodiments, the employed pharmaceutical composition is a sustained release formulation. In some of these embodiments, the pharmaceutical composition can be administered via intraarticular injection. In some embodiments, the KLF4-activating compound is administered to the subject in conjunction with a second drug for managing symptoms of osteoarthritis. For example, the KLF4-activating compounds can be administered to the subject together with an anti -inflammation agent or a pain reliver.

[0007] In a related aspect, the invention provides methods for preventing tissue destruction and inflammation associated with osteoarthritis in a subject. These methods involve administering to the subject a therapeutically effective amount of a compound that activates endogenous KLF4 expression. In various embodiments, the administered KLF4-activating compound is selected from the compounds shown in Table 1 or functional derivative thereof. In some preferred embodiments, the administered KLF4- activating compound is N-(2-aminophenyl)-4-[[[4-(3-pyridinyl)-2- pyrimidiny]]amino]methyl]-benzamide (mocetinostat) or a functional derivative thereof.

[0008] In another related aspect, the invention provides methods of promoting cartilage regeneration in the joints of a subject. These methods entail introducing into the joints of the subject a population of chondrocyte-like cells that are produced by inducing differentiation of a population of stem cells with a KLF4-activating compound shown in Table 1. In some of these methods, the employed KLF4-activating compound is N-(2-aminophenyl)-4-[[[4-(3-pyridinyl)-2-pyrimidinyl]amino]methyl]-benzamide (mocetinostat) or a functional derivative thereof. In some methods, the chondrocyte-like cells are produced by contacting the compound with the stem cells in vivo in the joints of the subject. In some other methods, the chondrocyte-like cells are produced by contacting the compound with the stem cells in vitro and then implanting the chondrocyte-like cells into the joints of the subject. Some of the methods are directed to human subjects suffering from or at risk of developing osteoarthritis. In various embodiments, the employed stem cells can be mesenchymal stem cells from bone marrow (BMSCs), adipose tissues, other joint tissues or derived from embryonic or induced pluripotent stem cells (iPSC).

[0009] A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims.

DESCRIPTION OF THE DRAWINGS

[0010] Figure 1. KLF4 expression levels in SW1353 cells treated with identified KLF-activating compounds. Cells were treated with the indicated compounds at the tolerated doses or DMSO, and RNA was collected 24 hours after initiation of treatment. mRNA levels are expressed as means±SE, relative to DMSO (n=4 from four independent experiments). *P<0.05, **P<0.01, Dunnett's test versus DMSO.

[0011] Figure 2. Treatment of human OA chondrocytes with the class I HD AC inhibitors. (A) Cells were treated with entinostat, chidamide, mocetinostat or DMSO, and RNA was collected 24 hours after initiation of treatment. mRNA levels are expressed as means±SE, relative to DMSO (n=4 donors). *P<0.05, **P<0.01, Dunnett's test versus DMSO. (B) Cells were treated with 30 pM of mocetinostat or DMSO, and RNA was collected 24 hours after initiation of treatment. mRNA levels are expressed as means±SE, relative to DMSO (n=6 donors). *P<0.05, **P<0.01, paired t-test. HDAC, histone deacetylase.

[0012] Figure 3. Regulation of chondrogenic and hypertrophic genes by mocetinostat in human BMSC pellets. (A, B) Human bone marrow-derived mesenchymal stem cells (BMSCs) were cultured in pellets, and were treated with 5 pM of mocetinostat, or DMSO ± 20 ng/ml of TGF-P3. RNA was collected one week after pellet culture. mRNA levels are expressed as means±SE, relative to DMSO (n=5 donors). *P<0.05, **P<0.01; paired t-test in (A), and Dunnett' s test versus mocetinostat in (B).

[0013] Figure 4. Regulation of inflammatory and catabolic genes by mocetinostat in human OA chondrocytes and synoviocytes on IL-ip stimulation. (A) Human OA chondrocytes were treated with 30 pM of mocetinostat or DMSO (n=6 donors). (B) Human synoviocytes from healthy donors were treated with 10 pM of mocetinostat or DMSO (n=4 donors). RNA was collected 24 hours after initiation of mocetinostat treatment and 6 hours after stimulation with 10 ng/ml of interleukin- ip (IL-ip). mRNA levels are expressed as means±SE, relative to DMSO. *P<0.05, **P<0.01, Dunnett' s test versus DMSO + IL-ip.

[0014] Figure 5. Therapeutic effects of mocetinostat in mouse OA model. (A) Fourteen-week-old mice underwent destabilization of the medial meniscus (DMM) or sham surgery, and mocetinostat or vehicle was injected intraperitoneally three times a week starting one week after DMM surgery. Knees were harvested at 10 weeks postoperatively for histological analysis. (B) Results of von Frey test in mice at 10 weeks after surgery. Numbers of paw withdrawals from 5 stimulations per filament per mouse are shown. (C) Representative Safranin-0 staining images for each group. Scale bars, 200 pm. (D) Summed Osteoarthritis Research Society International (OARSI) scores for the medial femoral condyle and the tibial plateau. (E) Meniscus histopathological scores. n=14 for DMM + 10 mg/kg of mocetinostat, and n=15 for the other groups. For (B, D and E), *P<0.05, **P<0.01, Dunn’s test versus DMM + vehicle. All quantitative data are expressed as means±SE. DETAILED DESCRIPTION

I. Overview

[0015] The present invention is predicated in part on studies undertaken by the inventors to identify small molecule compounds that activate KLF4 expression, provide regenerative and protective effects in joint tissues, and alleviate symptoms associated with osteoarthritis. As detailed herein, high-throughput screening (HTS) with 11,948 clinical-stage compounds was performed using a reporter cell line detecting endogenous KLF4 activation. Eighteen compounds were identified through the HTS and confirmed in a secondary screen. After testing in SW1353 chondrosarcoma cells and human chondrocytes, mocetinostat, a class I selective histone deacetylase (HD AC) inhibitor, had the best profile of biological activities. It was found that mocetinostat upregulated cartilage signature genes in human chondrocytes, meniscal cells and bone- marrow-derived mesenchymal stem cells, and it down-regulated hypertrophic, inflammatory and catabolic genes in those cells and synoviocytes. Additionally, the inventors observed that intraperitoneal administration of mocetinostat into mice reduced severity of OA-associated changes and improved pain behaviors. Further global gene expression and proteomics analyses revealed that regenerative and protective effects of mocetinostat were dependent on peroxisome proliferator-activated receptor gamma coactivator 1-a. These findings show therapeutic and protective activities of the identified compounds, esp. mocetinostat, against OA.

[0016] In accordance with these exemplified studies, the present invention provides methods of treating osteoarthritis, and methods of protecting against tissue destruction and inflammation in joint tissues. These methods rely on pharmacological modulation of KLF4 with the small molecule agonist compounds described herein, e.g., mocetinostat. Subjects suitable for treatment with methods of the invention include ones who have or are at risk of developing osteoarthritis.

[0017] Unless otherwise specified herein, the materials and reagents required for practicing the invention, e.g., the encoding polynucleotides, expression vectors and host cells, as well as the related therapeutic methods, can all be generated or performed in accordance with the procedures exemplified herein or routinely practiced protocols well known in the art. See, e.g., Methods in Enzymology, Volume 289: Solid-Phase Peptide Synthesis, J. N. Abelson, M. I. Simon, G. B. Fields (Editors), Academic Press; 1st edition (1997) (ISBN-13: 978-0121821906); U.S. Pat. Nos. 4,965,343, and 5,849,954; Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, N.Y., (3^rd ed., 2000); Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1986); or Methods in Enzymology: Guide to Molecular Cloning Techniques Vol. 152, S. L. Berger and A. R. Kimmerl Eds., Academic Press Inc., San Diego, USA (1987); Current Protocols in Protein Science (CPPS) (John E. Coligan, et. al., ed., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley -Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998). The following sections provide additional guidance for practicing the compositions and methods of the present invention.

II. Definitions

[0018] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Academic Press Dictionary of Science and Technology, Morris (Ed.), Academic Press (1^st ed., 1992); Oxford Dictionary of Biochemistry and Molecular Biology, Smith et al. (Eds.), Oxford University Press (revised ed., 2000); Encyclopaedic Dictionary of Chemistry, Kumar (Ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (Eds.), John Wiley & Sons (3^rd ed., 2002); Dictionary of Chemistry, Hunt (Ed.), Routledge (1^st ed., 1999); Dictionary of Pharmaceutical Medicine, Nahler (Ed.), Springer-Verlag Telos (1994); Dictionary of Organic Chemistry, Kumar and Anandand (Eds.), Anmol Publications Pvt. Ltd. (2002); and 4 Dictionary of Biology (Oxford Paperback Reference) , Martin and Hine (Eds.), Oxford University Press (4^th ed., 2000).

[0019] The term “agent” or “candidate agent” includes any substance, molecule, element, compound, entity, or a combination thereof. It includes, but is not limited to, e.g., protein, polypeptide, peptide or mimetic, small organic molecule, polysaccharide, polynucleotide, and the like. It can be a natural product, a synthetic compound, or a chemical compound, or a combination of two or more substances. Unless otherwise specified, the terms “agent”, “substance”, and “compound” are used interchangeably herein. In some screening methods of the invention, the employed candidate agents or candidate compounds are small organic molecules.

[0020] The term "analog" or “derivative” is used herein to refer to a molecule that structurally resembles a reference molecule (e.g., an KLF4-activating compound exemplified herein) but which has been modified in a targeted and controlled manner, by replacing a specific substituent of the reference molecule with an alternate substituent. Compared to the reference molecule, an analog would be expected, by one skilled in the art, to exhibit the same, similar, or improved utility. Synthesis and screening of analogs to identify variants of known compounds having improved traits (such as higher binding affinity for a target molecule) is an approach that is well known in pharmaceutical chemistry.

[0021] Administration "in conjunction with" one or more other therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.

[0022] The terms “subject” and "patient" are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals. Animals include all vertebrates, e.g., mammals and non-mammals, such as dogs, cats, sheep, cows, pigs, rabbits, chickens, etc. Preferred subjects for practicing the therapeutic methods of the present invention are human.

[0023] As used herein, an “effective amount” or a “therapeutically effective amount” of a compound of the invention refers to an amount of the compound that alleviates, in whole or in part, symptoms associated with the disorder or condition, or halts or slows further progression or worsening of those symptoms, or prevents, or provides prophylaxis for, the disorder or condition. In particular, a "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount is also one in which any toxic or detrimental effects of compounds of the invention are outweighed by the therapeutically beneficial effects.

[0024] The term “pharmaceutically acceptable salt” refers to salts which possess toxicity profiles within a range that affords utility in pharmaceutical applications.

Pharmaceutically unacceptable salts may nonetheless possess properties such as high crystallinity, which have utility in the practice of the present invention, such as for example utility in process of synthesis, purification or formulation of compounds of the invention. “Pharmaceutically or pharmacologically acceptable” include molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate. For human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologies standards.

[0025] The term "subject" for purposes of treatment refers to any animal classified as a mammal, e.g., human and non-human mammals. Examples of non-human animals include dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, and etc. Unless otherwise noted, the terms “patient” or “subject” are used herein interchangeably. Preferably, the subject is human.

[0026] The term “treating” or “alleviating” includes the administration of compounds or agents to a subject to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease (e.g., osteoarthritis), alleviating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder (e.g., joint tissue destruction). Subjects in need of treatment include those already suffering from the disease or disorder as well as those being at risk of developing the disorder. Treatment may be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease. In the treatment of a disease or disorder associated with or mediated by TLR signaling, a therapeutic agent may directly decrease the pathology of the disease, or render the disease more susceptible to treatment by other therapeutic agents.

III. Treating osteoarthritis with KLF4-activating compounds and related agents [0027] The invention provides therapeutic applications of several specific KLF4- activating compounds described herein and related compounds (e.g., analogs or derivatives) in subjects afflicted with osteoarthritis or otherwise suffering from cartilage damage or defects in the joints. As demonstrated herein (see, e.g., Figures 3), the specific KLF4-activating compounds described herein (e.g., mocetinostat) can induce chondrocytic differentiation of bone marrow mesenchymal stem cells (BMSC). In OA joints, the KLF4-activating compounds (e.g., mocetinostat) can provide therapeutic benefit by directing chondrocyte differentiation of stem cells in cartilage to repair cartilage lesions. Besides OA joints, the compounds are also suitable for use in the regeneration of traumatic cartilage defects in otherwise healthy joints. Importantly, mocetinostat enhanced expression levels of KLF4 and KLF2, and upregulated C0L2A1, COL11 A2, and PRG4 comparable with TGF-P3, a known inducer of chondrogenesis in BMSC. While TGF-P3 induced COL10A1, RUNX2, which are markers of undesired chondrocyte hypertrophy, mocetinostat treatment downregulated COL10A1 and RUNX2. It also downregulated undesired Col lai. Thus, the methods of the invention are superior to methods relying on any known agents such as TGF-P3 in inducing chondrocyte-like phenotype of mesenchymal stem cells.

[0028] Subjects that can be treated with methods of the invention include patients who have ongoing osteoarthritis or are in the early stage of developing osteoarthritis. They also include subjects who are at risk of developing osteoarthritis, as well as subjects with cartilage defects (e.g., due to injury to the joints) who are otherwise healthy. Suitable subjects can be human patients as well as non-human mammals. In some embodiments, the invention provides methods directed to treating osteoarthritis and for ameliorating symptoms associated with osteoarthritis (e.g., pain and tissue damage). In some related embodiments, the invention provides methods for preventing development of osteoarthritis and protecting against tissue destruction and inflammation associated with osteoarthritis. By promoting stem cell (e.g., mesenchymal stem cells) differentiation into chondrocyte-like phenotype, some other therapeutic methods of the invention are directed to repairing cartilage lesions in OA joints or to regeneration of defective cartilage (e.g., due to traumatic cartilage damage) in otherwise healthy joints.

[0029] Unless otherwise noted, KLF4-activating compounds refer to any small organic molecules that are capable of upregulating KLF4 expression in vivo, as exemplified herein. In various embodiments, the KLF4-activating compounds that can be employed in the methods of the invention are listed in Table 1. These compounds were demonstrated herein to exhibit regenerative and protective effects in joint tissues. In human joint tissue BMSCs, the compounds (e.g., mocetinostat) showed chondrogenic and anabolic effects, and suppressed hypertrophic, inflammatory and catabolic genes. Furthermore, intraperitoneal injections of the compounds (e.g., mocetinostat) in the mouse DMM model of experimental osteoarthritis ameliorated pain behaviors and alleviated the severity of osteoarthritis histopathological changes in cartilage, meniscus, and synovium.

[0030] In general, the therapeutic methods of the invention involve administering to a subject suffering from or at risk of developing osteoarthritis, as well as otherwise healthy subjects noted above, a therapeutically effective amount of a KLF4-activing compound described herein. The treatment can be in vivo, e.g., via directly administering to the subject a pharmaceutical composition described herein, e.g., by injecting or implanting of a sustained release formulation. The treatment can also be ex vivo, e.g., via inducing chondrocytic differentiation of a population of stem cells (e.g., BMSC or other stem cell types) in vitro with the KLF4-activing compound, and then implanting the cells into the cartilage defect in the subject. In some of these embodiments, chondrocytic differentiation can be induced with the compound and mesenchymal stem cells from bone marrow (BMSCs), adipose tissues, other joint tissues or derived from embryonic or induced pluripotent stem cells (iPSC). In various embodiments, any of compounds listed in Table 1 can be used in the therapeutic methods of the invention. In some preferred embodiments, the employed KLF4- activating compound is mocetinostat. Mocetinostat (MGCD0103; N-(2-aminophenyl)- 4-[[[4-(3-pyridinyl)-2-pyrimidinyl]aniino]methyl]-benzamide) is well-known benzamide histone deacetylase inhibitor compound. It has been studied in several clinical trials for treatment of various cancers. See, e.g., Johnson et al., Clin. Lung Cancer 2023; 24(3):218-227; Boumber et al., Expert Opin Investig Drugs. 2011; 20(6): 823-829; and Kell, Curr. Opin. Investig. Drugs. 2007; 8(6):485-492.

[0031] In addition to the KLF4-activating compounds set forth in Table 1, some analogs, variants or derivatives of these compounds may also be suitable for the practice of the methods of the invention. Typically, suitable analog compounds are functional derivatives that have the same or improved biological activities and pharmaceutical properties in comparison to the exemplified compounds (e.g., mocetinostat). For example, a number of mocetinostat analog compounds are known in the art. These include analogues with similar or better biological and pharmaceutical profiles (e.g., solubility and HDAC selectivity). See, e.g., Raeppel et al., Bioorg. Med. Chem. Lett. 2009, 644-649; Marson et al., J. Med. Chem. 2013, 56, 6156- 6174; and Marson et al., J. Med. Chem. 2015, 58, 6803-6818. [0032] In various embodiments, analogs and derivatives of the exemplified compounds can contain one or more substituted groups relative to one of the exemplified compounds. Substituted aryl and heteroaryl groups may include rings and fused ring systems in which a bond to a hydrogen atom is replaced with a bond to a carbon atom, or to a substituent group as defined below. Therefore, aryl and heteroaryl groups may be substituted with cycloalkyl, aryl, heterocyclyl and heteroaryl groups (each of which can be substituted), or with alkyl, alkenyl, and alkynyl groups, or with the substituent groups listed below or with other substituent groups known to persons of ordinary skill in the art (including but not limited to halogen, hydroxy, lower alkoxy, - NR₂ (where R = H, lower alkyl, acyl, sulfonyl) and the like).

[0033] When a number of atoms in a ring is specified, e.g., a 3- to 9-membered cycloalkyl or heterocyclyl ring, the cycloalkyl or heterocyclyl ring can include any of 3, 4, 5, 6, 7, 8, or 9 atoms. A cycloalkyl ring is carbocyclic; a heterocyclyl ring can include atoms of any element in addition to carbon capable of forming two or more bonds, e.g., nitrogen, oxygen, sulfur, and the like. The number of atoms in a ring is understood to necessarily be an integer. For example, relative to a lead KLF4-activating compound, some of their derivative compounds can have one or more mono- or multivalent groups replaced with a different mono- or multi-valent group. The replaced group can be, e.g., H; halogen; straight, cyclic or branched chain alkyl; straight, cyclic or branched chain alkenyl; straight, cyclic or branched chain alkynyl; halo-alkyl, - alkenyl or -alkynyl; CN; CF3; aryl and substituted aryl groups in which any or all H groups of the aryl ring is substituted with a different group; heterocyclic and substituted heterocyclic groups in which any or all groups of the aryl ring is substituted with a different group; carboxyl; carbonyl, alkoxyl; alkyloxyalkanes; alkoxycarbonyl; aryloxyl, heterocyclyloxyl; hydroxyl; amine; amide; amino; quaternary amino; nitro; sulfonyl; alkylamine; silyl, siloxyl; saturated C-C bonds; unsaturated C-C bonds; ester, ether, amino; amide, urethane, carbonyl, acetyl and ketyl groups; hetero atoms, including N, S and O; polymer groups; and amino acids. In some derivative compounds, one or more hydrogens can be substituted with a lower alkyl group. The various derivative compounds can be subject to a functional test (e.g., assay for upregulated KLF4 expression as exemplified herein) to ascertain their KLF4-activating activities. [0034] In some embodiments, variants or derivative compounds with similar or improved properties can be obtained by rational optimization of the exemplified KLF4- activating compounds (the lead compounds). Optionally, the compounds generated via rational design can be further subjected to a functional test or screening in order to identify compounds with improved activities. It is within ordinary skill to evaluate any KLF4-activating compound disclosed herein for effectiveness in inhibition of a monocarboxylate transporter and in the various cellular assays using the procedures described herein or found in the scientific literature. Accordingly, the person of ordinary skill can prepare and evaluate any of the compounds without undue experimentation. Any compound found to be an effective activator of KLF4 - monocarboxylate transporter can likewise be tested in animal models and in human clinical studies using the skill and experience of the investigator to guide the selection of dosages and treatment regimens.

[0035] In addition to the KLF4-activating compounds described herein or well known in the art, compounds suitable for the methods of the invention also include stereoisomers, tautomers, solvates, prodrugs, pharmaceutically acceptable salts and mixtures thereof. Suitable compounds also include diastereomers as well as their racemic and resolved, diastereomerically and enantiomerically pure forms and salts thereof. Diastereomeric pairs may be resolved by known separation techniques including normal and reverse phase chromatography, and crystallization.

[0036] The various KLF4-activating compounds suitable for the invention can be readily synthesized in accordance with standard protocols of organic chemistry. The compounds may be isolated from their reaction mixtures and purified by standard techniques such as filtration, liquid-liquid extraction, solid phase extraction, distillation, recrystallization or chromatography, including flash column chromatography, or HPLC. In some other embodiments, the KLF4-activating compounds can be readily synthesized in accordance with standard protocols of organic chemistry. Alternatively, the compounds can be obtained commercially from many suppliers. For example, some of these compounds (e.g., mocetinostat) can be obtained from commercial suppliers such as Selleck Chemicals LLC (Houston, TX) and Cayman Chemical (Ann Arbor, MI).

IV. Pharmaceutical compositions and dosages [0037] In the practice of methods of the invention, the KLF4-activating compounds (e.g., mocetinostat) can be administered alone to a subject in need of treatment. More preferably, they are administered in the form of a pharmaceutical composition or preparation in admixture with any of various pharmacologically- acceptable carriers or excipients. For example, the compounds may be administered in the form of a convenient pharmaceutical composition or formulation suitable for parenteral, topical, oral application, or the like. Pharmaceutical composition containing an KLF4-activating compound can be administered locally or systemically in a therapeutically effective amount or dose. The compositions can be administered by a variety of methods known in the art. They may be administered parenterally, by injection, rapid infusion, dermal absorption, and orally. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. In some preferred embodiments, pharmaceutical compositions containing the KLF4-activating compounds are administered to a subject via a parenteral route, e.g., intraarticular injection, intraperitoneal injection, subcutaneous injection, intramuscular injection, intravenous injection, or infusion. In some of these embodiments, the compounds are administered in sustained release formulations, e.g., via intraarticular injection.

[0038] Depending on the specific pharmaceutical composition and route of administration, suitable pharmaceutically acceptable carriers or excipients can include various substances. They can be coatings, solvents, isotonic and absorption delaying agents, binders, adhesives, lubricants, di sintergrants, coloring agents, flavoring agents, sweetening agents, absorbents, detergents, and emulsifying agents. For example, for compositions intended for injection or infusion, the carrier can be sterile water that provides a composition in the form of sterile, aqueous, isotonic saline solutions. For compositions that are suspensions and emulsions, they may contain as carrier, for example a natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol. The suspension or solutions for injections may contain, together with the active compound, a pharmaceutically acceptable carrier, e.g. sterile water, olive oil, ethyl oleate, glycols, e.g. propylene glycol, and if desired, a suitable amount of lidocaine hydrochloride. For a pharmaceutical composition which is a liquid dispersion for oral administration, e.g., a syrup, emulsion, or suspension, it can contain as carriers, for example, saccharose or saccharose with glycerine and/or mannitol and/or sorbitol.

[0039] Pharmaceutical compositions of the invention can be prepared in accordance with methods well known and routinely practiced in the art. See, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20^th ed., 2000; and Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978. The therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration. Sterile injectable solutions can be prepared by incorporating the active compound (i.e., an KLF4-activating compound) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated herein. In the case of sterile, lyophilized powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and spraydrying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prolonged absorption of injectable compositions can be brought about by including, in the composition, an agent that delays absorption, for example, monostearate salts and gelatin.

[0040] In some preferred embodiments, the KLF4-activating compounds (e.g., mocetinostat) are administered via controlled release or sustained release formulations. Using a carrier to protect the KLF4-activating compound against rapid release, such formulations include time-released, delayed release, and sustained release delivery systems which deliver the compound prior to, and with sufficient time to cause, sensitization of the site to be treated. Many types of release delivery systems are available and known to those of ordinary skill in the art. Some examples of the controlled release formulation include implants, transdermal patches, and microencapsulated delivery systems. In some embodiments, the controlled release systems include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. In some embodiments, biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. For example, the compound can be delivered via a poly(lactic acid) (PLA) or poly(lactic-co-glycolic acid) (PLGA) based microparticles. PLA and PLGA microspheres are widely studied polymers in the medical field, as they allow for the encapsulation of the desired active pharmaceutical ingredient or drug. See, e.g., Anderson & Shive, Adv. Drug Deliv. Rev. 28, 5-24, 1997; Anderson et al., Adv. Drug Deliv. Rev. 64: 72-82, 2012; and Vlachopoulos et al., Pharmaceutics. 4: 359, 2022. The PLA microspheres aide in controlling the release of the drug from the polymer matrix and allow for a sustained release of the drug over a period of time that can vary from weeks to several months. In some other methods, the KLF4-activating compound can be delivered via a micronized suspension formulation. Micronized is a term used in the pharmaceutical industry to describe the size of a drug particle. In general, micronized particles are usually less usually than 50 microns, and are generally less than 10 microns. By reducing particle sizes to “micronized”, many drugs that are otherwise poorly water soluble can dissolve more quickly and therefore improve bioavailability.

[0041] Methods for preparation of the various pharmaceutical compositions or drug formulations described herein are patented or generally well known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, (J.R. Robinson, ed.) (Marcel Dekker, Inc., New York, 1978). Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109. Micronized suspension formulations can be prepared in accordance with methods well known in the art. See, e.g., Patel & Agrawal, J. Adv. Pharm. Technol. Res. 2: 81-87, 2011; Chowdary & Madhavi, Int. J. Chem. Sci.: 6: 2111-2117, 2008; and Kathpalia et al., Indian J. Pharm. Educ. Res. 55: 77-85, 2021. Delivery systems also include non-polymer systems that are lipids, including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-di-and triglycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the active composition is contained in a form within a matrix such as those described in U.S. Patents 4,452,775, 4,667,014, 4,748,034, and 5,239,660 and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patents 3,832,253 and 3,854,480.

[0042] The dosage level of the KLF4-activating compound to be administered depends upon a variety of pharmacokinetic factors including the activity of the particular compound employed, the route of administration, the time of administration, and the rate of excretion of the particular compound being employed. It also depends on the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, gender, weight, condition, general health and prior medical history of the subject being treated, and like factors. Methods for determining optimal dosages are described in the art, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20^th ed., 2000. For a given KLF4-activating compound, one skilled in the art can easily identify the effective amount by using routinely practiced pharmaceutical methods. Dosages used in vitro or in situ studies may provide useful guidance in the amounts useful for in vivo administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders.

[0043] Dosage and frequency of administration also vary depending on the halflife of the KLF4-activating compound and the other drugs in the subject. Typically, a pharmaceutically effective dosage would be between about 0.01 and 100 mg/kg body weight of the subject to be treated. In some embodiments, an KLF4-activating compound (e.g., mocetinostat) is dispensed in unit dosage form including from about 0.1 mg to about 50 mg of active ingredient together with a pharmaceutically acceptable carrier per unit dosage. In various embodiments, dosage forms suitable for parenteral, oral, transdermal administration include from about 0.5 mg to about 100 mg/kg/day, preferably from about 1 mg to about 50 mg, and more preferably from about 2 mg to about 10, 15, 20 or 25 mg of the compounds admixed with a pharmaceutically acceptable carrier or diluent. Depending on the specific formulation and administration route, dosage forms may in general be administered once a week, once every other day, once daily or even more frequently, as determined to be beneficial and advisable by a prescribing physician. In some embodiments, dosage is adjusted to achieve a plasma compound concentration of 1-1000 pg/ml, and in some methods 25-300 pg/ml or 10- 100 pg/ml. In some embodiments, the KLF4-activating compound can be administered as a sustained release formulation as noted above, in which case less frequent administration is required. For example, the sustained release formulation may be administered weekly, monthly, bimonthly, once every 3 months, once every 6 months, once every year, or even less frequently.

[0044] The invention also provides kits for carrying out the therapeutic applications disclosed herein. For example, the invention provides therapeutic kits for treating osteoarthritis and/or for providing regenerative and protective effects in joint tissues in subjects in need of treatment. The therapeutic kits of the invention typically comprise as active agent one or more of the described KLF4-activating compounds (e.g., mocetinostat). The kits can optionally contain suitable pharmaceutically acceptable carriers or excipients for administering the active agents as described above. Other reagents that can be included in the kits include antioxidants, vitamins, minerals, proteins, fats, and carbohydrates. The therapeutic kits can further include packaging material for packaging the reagents and a notification in or on the packaging material. The kits can additionally include appropriate instructions for use and labels indicating the intended use of the contents of the kit. The instructions can be present on any written material or recorded material supplied on or with the kit or which otherwise accompanies the kit.

[0045] The pharmaceutical compositions or therapeutic kits of the invention can be used alone in treating osteoarthritis or preventing against damage to joint tissues. They can also be used in conjunction with other known therapeutic regimens for treating osteoarthritis or managing symptoms associated with osteoarthritis. These include, e.g., topical therapies with topical NSAIDs or capsaicin, other anti-inflammatory medicines such as corticosteroids, and pain relivers such as opioids and over-the-counter pain killers. The therapeutic composition of the invention and other known treatment regimens can be administered to the subjects sequentially or simultaneously. These therapeutic applications of the invention can all be indicated on the instructions of the kits.

EXAMPLES

Example 1. HTS of small molecules activating endogenous KLF4 expression [0046] We established a KLF4 reporter cell line from SW1353 human chondrosarcoma cells, which enabled detection of endogenous KLF4 activation by HiBiT luminescence. Then, we performed HTS using the Repurposing, Focused Rescue, and Accelerated Medchem (ReFRAME) library, which is composed of 11,948 small molecules that have reached clinical development or undergone significant preclinical profiling (8, 9). Fifty-one hit compounds with ECso < 1 pM were identified in the HTS, and 18 compounds were confirmed in a secondary screen (Table 1).

Table 1. List of KLF4-activating compounds confirmed in the secondary screen.

Example 2. Validation experiments for the identified compounds

[0047] We treated SW1353 cells with different doses of the 18 confirmed hit compounds to determine tolerated doses as measured by cell viability. Twelve compounds were confirmed to significantly upregulate KLF4 expression with the tolerated doses, as compared to dimethyl sulfoxide (DMSO) treatment (Figure 1). We further measured expression levels of representative chondrogenic genes in the cells treated with either of the 12 compounds upregulating KLF4 and found that three class I HD AC inhibitors (entinostat, chidamide and mocetinostat) significantly increased expression of all the cartilage signature genes, COL2A1, COL11A2, SOX9 and ACAN. [0048] When human OA chondrocytes were treated with the three class I HD AC inhibitors, it was found that mocetinostat significantly upregulated KLF4, and that it also increased expression levels of COL2A1, COL11A2 and SOX9 (Figure 2, A). While mocetinostat upregulated KLF2, another KLF family member with functions similar to KLF4 (5), it also increased expression of forkhead box 01 (FOXOP) and down- regulated ADAMTS5 and IL6 (Figure 2, B), which are similar to effects of KLF4 (5). Furthermore, mocetinostat suppressed mRNA levels of the chondrocyte hypertrophy markers, COL10A1 and runt-related transcription factor 2 (RUNX2)' , and the fibroblast marker COL1A1 (Figure 2, B). Based on these biological activities of mocetinostat, we focused subsequent studies on this compound.

Example 3. Functions of mocetinostat in human BMSCs and joint tissue cells [0049] To further investigate functions of mocetinostat in regulation of joint tissue homeostasis, we tested it in several different cell types. During monolayer culture of human BMSCs, mocetinostat increased KLF4, KLF2, COL2A1, COL11A2, PRG4 and SOX9. In pellet-cultured BMSCs, mocetinostat enhanced expression levels of KLF4 and KLF2. and upregulated COL2A1, COL11A2 and PRG4 comparable to TGF-P3, a known inducer of chondrogenesis in BMSC (Figure 3). Notably, mocetinostat treatment down-regulated COL10A1, RUNX2 and COL1A1 (Figure 3, B). Human meniscal cells treated with mocetinostat showed higher mRNA levels of KLF4. KLF2, COL2A1, COL11A2 and SOX9. It also upregulated scleraxis (SCX) and tenascin-B (TNXB), which are reported to be highly expressed in meniscus and are upregulated by KLF4 (5, 10). [0050] We examined regulation of genes related to inflammation and ECM degradation by mocetinostat. In human IL-ip-stimulated OA chondrocytes, mocetinostat significantly down-regulated IL6, MMP3, PTGS2, MMP13 and ADAMTS5 (Figure 4, A). Similarly, mocetinostat suppressed IL6, MMP3 and ADAMTS5 in human synoviocytes treated with IL-ip (Figure 4, B). Collectively, mocetinostat enhanced chondrogenic and anabolic effects, and also had anti-hypertrophic, anti-inflammatory and anti-catabolic properties in joint tissue cells and BMSCs, suggesting its potential as a DM0 AD.

Example 4. Therapeutic effects of mocetinostat in a mouse OA model [0051] To confirm therapeutic effects against OA in vivo, mice underwent OA induction by surgical destabilization of the medial meniscus (DMM) (11), and received intraperitoneal injections of either 2 mg/kg or 10 mg/kg of mocetinostat three times per week starting one week after surgery, and their knee joints were harvested at 10 weeks postoperatively (Figure 5, A). We performed von Frey test (12, 13) preoperatively, and at 5 and 10 weeks after surgery to evaluate mechanical allodynia. Treatment with mocetinostat at both doses significantly decreased numbers of paw withdrawals at 5 and 10 weeks after DMM surgery, as compared to vehicle-injected mice (Figure 5, B). The severity of OA was significantly alleviated in the 2 mg/kg group and tended to be decreased in the 10 mg/kg group, as shown by the Osteoarthritis Research Society International (OARSI) scores (14) (Figure 5, C and D). Moreover, both 2 mg/kg and 10 mg/kg doses of mocetinostat significantly improved meniscus histopathological scores (15), synovitis scores (16) and bone scores (5, 17) (Figure 5, E). There were no apparent systemic adverse reactions to mocetinostat injections, and no mice showed signs of distress requiring euthanasia. To determine whether these protective effects of mocetinostat were associated with increased KLF4 expression, we performed immunohistochemistry (IHC) for KLF4. Rates of KLF4-positive cells were increased in cartilage from mice that received mocetinostat injections. Meanwhile, expression of catabolic and inflammatory proteins, including ADAMTS5, IL6 and MMP13, was significantly decreased in articular cartilage by mocetinostat treatment. Furthermore, mocetinostat enhanced expression of FOXO1, which has protective functions in OA pathogenesis (17). These results demonstrated that mocetinostat increased KLF4 in vivo, and reduced OA-associated joint damage and mechanical allodynia.

Example 5. Global analysis of genes regulated by mocetinostat

[0052] To study genes regulated by mocetinostat comprehensively and to elucidate its regulatory mechanisms, we performed global expression profiling by high- throughput RNA-seq analysis of mocetinostat- and DMSO-treated TC28a2 human chondrocyte cells. There are a great number of significantly upregulated genes (URGs; 3,375 genes) and down-regulated genes (DRGs; 1,171 genes), where genes with a false discovery rate (FDR) of <0.05 and a |log2(fold change [FC])| >1 were considered to be significantly differentially expressed. The results indicate that mocetinostat significantly upregulated cartilage ECM genes such as C0I.2A L C0L11A2, ACAN, COMP and PRG4.

[0053] Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses (18) were performed using the URGs and DRGs. Significantly enriched pathways were identified. In the URGs, “ECM-receptor interaction”, where cartilage ECM genes such as COL2A1 and COMP are annotated, was significantly enriched. While terms common with our previous dataset using KLF4-overexpressing cells (5), such as “Rapl signaling pathway”, “Calcium signaling pathway”, “cAMP signaling pathway” and “MAPK signaling pathway” were also enriched, enrichment of several unique pathways was seen such as PPAR signaling pathway.

Example 6. Global proteomics analysis in mocetinostat-treated cells

[0054] After confirming that mocetinostat increased KLF4 protein level via Western blotting analysis, we analyzed mocetinostat- and DMSO-treated TC28a2 cells using tandem mass tag-mass spectrometry (TMT-MS), and 5,306 proteins were quantified. All significantly upregulated proteins (URPs; 853 proteins) and down- regulated proteins (DRPs) were identified, where proteins with an FDR of <0.05 were considered to be significantly differentially expressed. Significantly enriched pathways were identified via KEGG pathway analysis using the URPs and DRPs.

[0055] When we intersected significantly enriched pathways between the URGs of the RNA-seq data and the URPs of the TMT-MS data, there were 9 common pathways. Among them, while 6 terms were also significantly enriched in our existing high- throughput RNA-seq dataset using KLF4-transduced cells (5), ‘PPAR signaling pathway’, ‘Arginine and proline metabolism’, and ‘Toxoplasmosis’ were not enriched, suggesting that these terms might be related to regulatory mechanisms of mocetinostat independent of upregulation of KLF4.

Example 7. PGC- la-dependent regulation of anabolic and catabolic genes by mocetinostat

[0056] Among the three enriched terms specific to mocetinostat-treated cells, we focused on peroxisome proliferator-activated receptor (PPAR) pathway which mediates protective functions in cartilage and OA (19). Analyzing expression changes of PPARs and PPARG coactivators by mocetinostat treatment in the high-throughput RNA-seq dataset, only PPARGC1A was significantly upregulated. The PPARGC1A gene encodes peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-la), which interacts with PPARG and is also a master regulator of mitochondrial biogenesis (20- 22). Reverse transcription quantitative PCR (RT-qPCR) also showed an approximately thirty -fold increase of PPARGC1A expression by mocetinostat treatment in TC28a2 cells. Furthermore, rates of PGC- la-positive cells were significantly increased in cartilage from mice that received mocetinostat injections.

[0057] We examined whether regulation of anabolic and catabolic genes by mocetinostat in human chondrocytes would be dependent on KLF4 and PP ARGCI A, using small interfering RNAs (siRNAs). While a knock-down efficiency of siKLF4 was about 92%, that of siPPARGCl A was about 67%. Expression of cartilage signature genes, including COL2A1, COL11A2 and SOX9, was not affected by siRNA treatment against KLF4. By siPPARGCl A treatment, upregulation of SOX9 was significantly diminished, but expression levels of COL2A1 and COL11A2 did not change. Meanwhile, siRNA-mediated knock-down of PPARGC1A significantly diminished suppression of catabolic and inflammatory genes, such as PTGS2, MMP13 and ATAMTS5, in IL-ip-stimulated chondrocytes. Knock-down of KLF4 did not have significant effects on expression of these genes. We considered a possibility that expression of anabolic genes was not affected by siRNA-mediated knockdown of PPARGC1A because its knock-down efficiency was not sufficient. Therefore, we tested SR-18292, a PGC-la inhibitor, in mocetinostat-treated chondrocytes. Treatment with SR-18292 diminished or eliminated upregulation of COL2A1, COL11A2 and SOX9 by mocetinostat. Collectively, these findings demonstrated that mocetinostat upregulated anabolic genes and down-regulated catabolic and inflammatory genes in chondrocytes, dependently on PGC-la.

Example 8. Other exemplified methods and materials

[0058] Mice: All mice used in the experiments were males on the C57BL/6J background strain, and littermate mice were randomly assigned to the groups. Sample sizes were decided based on previous experience. There were no mice excluded from the analysis.

[0059] Processing of human tissues and primary cell culture: For human OA chondrocyte isolation, cartilage was harvested from tissues removed during knee replacement surgery of OA patients. For isolation of cells from normal human knees, meniscus and synovium were harvested from intact knee joints obtained from tissue banks within 48 hours postmortem. The donors with no history of joint disease or trauma were included, and all cartilage and meniscus surfaces were intact upon macroscopic inspection. Harvested tissues were digested with 2 mg/ml of type 2 collagenase overnight at 37°C. Isolated cells were maintained in DMEM with 10% calf serum (CS) supplemented with 1% penicillin-streptomycin-glutamine (PSG).

[0060] Cell culture: All cells were cultured at 37°C in a humidified atmosphere with 5% CO2. SW1353 cells were obtained from the American Type Culture Collection (Manassas, VA), and TC28a2 cells were purchased from Sigma-Aldrich (St Louis, MO). SW1353 cells, TC28a2 cells and human primary cells were cultured in DMEM with 10% CS supplemented with 1% PSG. BMSCs were purchased from Lonza (Walkersville, MD), and were cultured in MSCGM human Mesenchymal Stem Cell Growth BulletKit Medium (Lonza). In pellet culture of BMSCs, hMSC Chondrogenic Differentiation BulletKit Medium (Lonza) was used. Human IL-ip (PeproTech, Rocky Hill, NJ) and TGF-P3 (PeproTech) were used to treat cells. The compounds used in screenings and validation experiments were provided by Calibr (a Division of Scripps Research Institute, La Jolla, CA). Mocetinostat for other experiments was obtained from LC Laboratories (Woburn, MA), and SR- 18292 was purchased from Selleck Chemicals (Houston, TX). Stocks of the compounds were diluted in DMSO. Cell viability was measured with Countess II FL Automated Cell Counter (Thermo Fisher Scientific, Waltham, MA) using Trypan Blue stain 0.4% (Thermo Fisher Scientific). [0061] Establishment of the monoclonal KLF4 reporter cell line: We inserted the HiBiT sequence (gtgagcggctggcggctgttcaagaagattagc; SEQ ID NO: 1) into the site immediately after the first ATG codon of KLF4 gene in SW1353 cells by electroporation with ribonucleoprotein complexes which consisted of recombinant Cas9 nuclease and synthetic guide RNA (ucugggcccccacauuaaug; SEQ ID NO:2) in the presence of a single-stranded oligodeoxynucleotide template (gtgag- cggctggcggctgttcaagaagattagcggaggaggtggttctggtggtggaggtagc; SEQ ID NO:3).

Expression of HiBiT in the edited cell pools was confirmed by measuring luminescence of cell lysates using Nano-Gio HiBiT Lytic Detection System (Promega, Madison, WI), according to the manufacturer’s instruction. Successful integration of the HiBiT sequence at the intended loci was confirmed by Sanger sequencing. The monoclonal KLF4 reporter cells were established by serial limiting dilution.

[0062] HTS with the ReFRAME library: The ReFRAME library is composed of 11,948 small molecules that have reached clinical development or undergone significant preclinical profiling (8, 9). The compounds were pre-spotted into 1536-well assay plates with the Echo Acoustic Liquid Handler (Beckman Coulter, Brea, CA) to achieve a final concentration of 5 pM in a final assay volume of 8 pL per well. The KLF4 reporter SW1353 cells were dispensed into the assay plates with 100 cells per well and were allowed to grow for 24 hours. Quantitation of luminescence activity was performed Nano-Gio HiBiT Lytic Detection System, and the raw signal intensities were normalized across each plate using Z-scores. Compounds with Z-scores above two standard deviations were replated in triplicate for confirmation assays and evaluated in 10-point dose-response concentration curves. ECso for each compound was calculated from the dose-response curves, and EC50 < 1 pM was adopted as a criterion for the validated hit selection.

[0063] RNA isolation and RT-qPCR: Total RNA was isolated with Direct-zol RNA MicroPrep kit (Zymo Research, Irvine, CA), and was reverse transcribed using PrimeScript RT Reagent kit (TaKaRa Bio, Otsu, Japan). RT-qPCR was performed on a LightCycler 96 instrument (Roche, Basel, Switzerland) using TaqMan probes (Thermo Fisher Scientific). mRNA levels were normalized with GAPDH.

[0064] DMM surgery and intraperitoneal injections in mice: The mouse surgical OA model was induced by DMM surgery (11). In brief, the surgical approach to the knee was the medial parapatellar. The fat pad was dissected, and the medial meniscus (MM) and the medial meniscotibial ligament (MMTL) were identified. The MMTL was transected, and the MM was confirmed to be freely displaceable. The operators were blinded to treatment groups.

[0065] Intraperitoneal injections of 2 mg/kg or 10 mg/kg of mocetinostat or vehicle were executed three times a week starting one week after DMM or Sham surgery. Mocetinostat was first diluted in DMSO, and further diluted in 5% dextrose at concentration of 0.2 mg/ml for the 2 mg/kg group and 1 mg/ml for the 10 mg/kg group. The final concentration of DMSO was adjusted to 1.67% for all groups. Those who performed injections were aware of the group allocation. The mice were monitored for water and food intake, and were inspected for activity and hair appearance three times per week. Knees were harvested at 10 weeks postoperatively for histological evaluation.

[0066] Von Frey test: To evaluate mechanical allodynia in mice, von Frey filaments with 5 different target forces (#1 : 0.04 g, #2: 0.16 g, #3: 0.4 g, #4: 1 g and #5: 2 g; Touch Test Sensory Evaluators; North Coast Medical, Morgan Hill, CA) were used for mechanical stimulation to the plantar surface of the hind paw, as previously described (12, 13). Numbers of paw withdrawals from 5 stimulations per filament per mouse were counted. Mice were tested in randomized order at each time point.

[0067] Histological analyses: Mouse knee joint tissues were fixed in Z-fix (Anatech, San Diego, CA) for 2 days, and were decalcified in TBD-2 (Thermo Fisher Scientific) for further 2 days. The samples were embedded in paraffin and were sectioned in 4 pm thickness. Safranin-0 and fast green staining was performed according to the standard protocols.

[0068] Histological scoring of OA for the medial femoral condyle and tibial plateau was performed using the summed OARSI scores (score, 0-48) (14). Meniscus histopathological scores were graded by Kwok’s meniscus scoring system (score 0-50) (15). Synovial changes were evaluated using Krenn’s synovitis scoring system (score, 0-9) (16). All scorings were performed blindly.

[0069] IHC: Sections were deparaffinized, washed and blocked with 2.5% horse serum (Vector Laboratories, Burlingame, CA) for 1 hour at room temperature. They were incubated with primary antibodies overnight at 4°C. Goat or rabbit IgG (Vector Laboratories) was used as negative controls. Immune complexes were detected using VECTASTAIN Elite ABC-HRP Kits (Vector Laboratories). Sections were incubated with DAB, and then were counterstained with hematoxylin and methyl green. For quantification of positive cells in IHC samples of mouse knees, calculation of positive cell rates was obtained from fields in the medial tibial plateau.

[0070] High-throughput RNA-seq analysis: TC28a2 cells were treated with 2 pM of mocetinostat or DMSO for 24 hours, and total RNA was collected. RNA-seq libraries were constructed using an early access High Throughput RNA-seq Prep kit (Jumpcode Genomics, San Diego, CA). Briefly, 20 ng of total RNA per sample was fragmented by heat, followed by reverse transcription and ligation of adapter at the 3’ end of the cDNA. Libraries were PCR amplified to add full-length adapter sequences and index barcodes (i5 and i7). After PCR, libraries were treated with the CRISPRclean Bulk Ribodepletion Reagents (Human, Mouse, Rat) (Jumpcode Genomics) per manufacturer’s recommended protocol and were sequenced with single read 100 base pairs on a NextSeq2000 instrument (Illumina, San Diego, CA) at an average of 5 million reads per sample.

[0071] The high throughput RNA-seq data were analyzed using nf-core/RNA-seq pipeline version 1.4.2 (implemented on Nextflow version 20.07.1), which is an open- source and available at github.com/nf-core/rnaseq as part of the nf-core project (55). Briefly, the reads were trimmed for adapters with trimGalore! version 0.6.4 (www.bioinformatics.babraham.ac.uk/projects/trim_galore/), and reads mapping to ribosomal RNA were removed using SortMeRNA version 2.1b (56). The remaining reads were aligned to the human reference genome (GRCh38 ENSEMBL build 98) with STAR version 2.6. Id (57). Gene-level assignment was performed using featureCounts version 1.6.4 (58). The gene expression matrix with raw gene counts was then used for differential gene expression analysis with the Bioconductor DESeq2 R package version 1.20.0 (59).

[0072] The resulting P-values were adjusted using the Benjamini -Hochberg's approach for controlling the FDRs. Genes with an FDR of <0.05 and a |log2(FC)| >1 were considered significantly differentially expressed. DAVID Bioinformatics Resources (v2022q3; david.ncifcrf.gov/) was used for KEGG pathway analysis (18). Pathways satisfying an FDR <0.05 was considered significant.

[0073] siRNA knockdown experiments: siRNAs for KLF4 (#sl7794; Thermo Fisher Scientific), PP ARGCI A (#s21394; Thermo Fisher Scientific) and the negative control (#4390843; Thermo Fisher Scientific) were used for knockdown experiments. Cells were transfected with siRNA using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific), following manufacturer's protocol.

[0074] TMT-MS analysis: TC28a2 cells were treated with 2 pM of mocetinostat or DMSO for 24 hours, and cells were lysed in Pierce RIPA Buffer supplemented with 1% Halt protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific) to collect protein lysates. Total protein was quantified using Pierce Rapid Gold BCA Protein Assay Kit (Thermo Fisher Scientific). Protein lysates were precipitated with 25% trichloroacetic acid overnight. The dried precipitated protein pellet was resuspended in 50mM triethylammonium bicarbonate (pH 8.5) containing 8 M urea. The protein samples were alkylated with 5mM tris (2-carboxy ethyl) phosphine and were reduced with lOmM chloroacetamide. Next, the samples were digested with trypsin overnight at 37°C and were desalted with C18 Spin Columns (Thermo Fisher Scientific). The desalted peptides were labeled with TMT isobaric tags (Thermo Fisher Scientific, Lot #XA338782) following the previously published protocol (60). The labeled peptides were combined into one tube and dried via a Speed-Vac, and the peptides were fractionated using High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific).

[0075] The TMT-labeled samples were analyzed on an Orbitrap Fusion Lumos Tribrid Mass Spectrometer (Thermo Fisher Scientific). Samples were injected directly onto a 25 cm, 100 pm ID column packed with BEH 1.7 pm C18 resin (Waters, Milford, MA), and were separated at a flow rate of 300 nL/minute on an Easy-nLC 1200 System (Thermo Fisher Scientific). Buffers A and B were 0.1% formic acid in water and 90% acetonitrile, respectively. A gradient of 1-25% B over 120 minutes, an increase to 40% B over 40 minutes, an increase to 100% B over 10 minutes and held at 100% B for 10 minutes was used for a 180-minute total run time. Peptides were eluted directly from the tip of the column and nanosprayed directly into the mass spectrometer by application of 2.5 kV voltage at the back of the column. The Lumos was operated in a data dependent mode. Full MSI scans were collected in the Orbitrap at 120,000 resolution. The cycle time was set to 3 seconds, and within these 3 seconds the most abundant ions per scan were selected for collision-induced dissociation MS2 in the ion trap. MS3 analysis with multinotch isolation was utilized for detection of TMT reporter ions at 60,000 resolution. Monoisotopic precursor selection was enabled and dynamic exclusion was used with an exclusion duration of 10 seconds.

[0076] MS data analysis: The MS spectra was analyzed by Proteome Discoverer 2.5 (Thermo Fisher Scientific), and was searched using the Uniprot human protein database including protein isoforms (version 2022-08-03) and a list of common protein contaminants. The decoy database was the reverse of this Uniprot database to filter identifications to an FDR of 0.01. The processing workflow used was Tribid_TMT_Quan_SPS_MS3_SequestHT_Percolator and the consensus workflow was Comprehensive EnhancedAnnotation Reporter Quan. Parameters were specified as follows: peptide length between 7 and 45 amino acids, fully tryptic or semi-tryptic digestion, and a maximum of 2 miscleavages. The static modification searched for were TMT tags on lysine residues, peptide N-termini (+229.162932 Da) and carbamidomethylation of cysteine residues (+57.021464 Da). Reporter ion distributions specific to the lot number of the TMT reagent were employed as correction factors.

[0077] Statistical analysis and fold changes were calculated by Proteome Discoverer 2.5. The resulting P-values were adjusted using the Benjamini -Hochberg's approach for controlling the FDRs. Proteins with an FDR of <0.05 were considered to be significantly differentially expressed proteins. DAVID Bioinformatics Resources (v2022q3) was used for KEGG pathway analysis. Pathways satisfying an FDR <0.05 was considered significant.

[0078] Statistics: Results were analyzed using GraphPad Prism version 9.4.0 (GraphPad Software, San Diego, CA). Two-tailed paired t-test was used to establish statistical significance between the two groups. One-way mixed-effects ANOVA followed by Dunnett' s test, two-way mixed-effects ANOVA followed by Sidak's multiple comparison test, and Kruskal -Wallis followed by Dunn’s test were used for multiple group comparisons. In statistical analyses of RT-qPCR data, log2 transformed values were used to assume normal distribution. Biologically independent sample numbers were shown in legends. For micrographs, representative images in each group were displayed.

[0079] References

1. Cross M, et al. The global burden of hip and knee osteoarthritis: estimates from the global burden of disease 2010 study. Ann Rheum Dis. 2014;73(7): 1323-1330.

2. Oo WM, Hunter DJ. Repurposed and investigational disease-modifying drugs in osteoarthritis (DM0 ADs). Ther Adv Musculoskelet Dis.

2022; 14: 1759720X221090297.

3. McConnell BB, Yang VW. Mammalian Kruppel-like factors in health and diseases. Physiol Rev. 2010;90(4): 1337-1381.

4. Fisch KM, et al. Identification of transcription factors responsible for dysregulated networks in human osteoarthritis cartilage by global gene expression analysis. Osteoarthritis Cartilage. 2018;26(l 1): 1531-1538.

5. Kawata M, et al. Kruppel-like factor-4 and Kruppel-like factor-2 are important regulators of joint tissue cells and protect against tissue destruction and inflammation in osteoarthritis [published online May 9, 2022], Ann Rheum Dis. 6. Neefjes M, et al. Transcription Factors in Cartilage Homeostasis and Osteoarthritis. Biology (Basel). 2020;9(9).

7. Schwinn MK, et al. CRISPR-Mediated Tagging of Endogenous Proteins with a Luminescent Peptide. ACS Chem Biol. 2018;13(2):467-474.

8. Metaferia B, et al. Phenotypic screening of the ReFRAME drug repurposing library to discover new drugs for treating sickle cell disease. Proceedings of the National Academy of Sciences of the United States of America.

2022;l 19(40):e2210779119.

9. Janes J, et al. The ReFRAME library as a comprehensive drug repurposing library and its application to the treatment of cryptosporidiosis. Proceedings of the National Academy of Sciences of the United States of America. 2018; 115(42): 10750- 10755.

10. Lee KI, et al. Mohawk is a transcription factor that promotes meniscus cell phenotype and tissue repair and reduces osteoarthritis severity. Sci Transl Med.

2020; 12(567).

11. Glasson SS, et al. The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129/SvEv mouse. Osteoarthritis Cartilage.

2007;15(9): 1061-1069.

12. Deuis JR, et al. Methods Used to Evaluate Pain Behaviors in Rodents. Front Mol Neurosci. 2017;10:284.

13. Tran PB, et al. Spinal microglial activation in a murine surgical model of knee osteoarthritis. Osteoarthritis Cartilage. 2017;25(5):718-726.

14. Pritzker KP, et al. Osteoarthritis cartilage histopathology: grading and staging. Osteoarthritis Cartilage. 2006; 14(1): 13-29.

15. Kwok J, et al. Histopathological analyses of murine menisci: implications for joint aging and osteoarthritis. Osteoarthritis Cartilage. 2016;24(4):709-718.

16. Krenn V, et al. Grading of chronic synovitis— a histopathological grading system for molecular and diagnostic pathology. Pathol Res Pract. 2002; 198(5):317-325.

17. Matsuzaki T, et al. FoxO transcription factors modulate autophagy and proteoglycan 4 in cartilage homeostasis and osteoarthritis. Sci Transl Med. 2018;10(428).

18. Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic acids research. 2000;28(l):27-30. 19. Vasheghani F, et al. PPARgamma deficiency results in severe, accelerated osteoarthritis associated with aberrant mTOR signalling in the articular cartilage. Ann Rheum Dis. 2015;74(3):569-578.

20. Liang H, Ward WF. PGC-1 alpha: a key regulator of energy metabolism. Adv Physiol Educ. 2006;30(4):145-151.

21. Nguyen TTT, et al. HD AC inhibitors elicit metabolic reprogramming by targeting super-enhancers in glioblastoma models. J Clin Invest. 2020;130(7):3699- 3716.

22. Jomayvaz FR, Shulman GI. Regulation of mitochondrial biogenesis. Essays Biochem. 2010;47:69-84.

23. Milazzo G, et al. Histone Deacetylases (HDACs): Evolution, Specificity, Role in Transcriptional Complexes, and Pharmacological Actionability. Genes (Basel). 2020; 11(5).

24. Zhang H, et al. The Role of HDACs and HDACi in Cartilage and Osteoarthritis. Front Cell Dev Biol. 2020;8:560117.

25. Information NCfB. PubChem Compound Summary for CID 9865515, Mocetinostat. Updated June 24, 2023. Accessed June 27, 2023.

26. Information NCfB. PubChem Compound Summary for CID 4261, Entinostat. Updated June 24, 2023. Accessed June 27, 2023.

27. Que Y, et al. Frequent amplification of HDAC genes and efficacy of HDAC inhibitor chidamide and PD-1 blockade combination in soft tissue sarcoma. J Immunother Cancer. 2021;9(2).

28. Kee HJ, Kook H. Kruppel-like factor 4 mediates histone deacetylase inhibitor- induced prevention of cardiac hypertrophy. J Mol Cell Cardiol. 2009;47(6):770-780.

29. Huang Y, et al. HDACI and Klf4 interplay critically regulates human myeloid leukemia cell proliferation. Cell Death Dis. 2014;5:el491.

30. Deng X, et al. ATF4-mediated histone deacetylase HDACI promotes the progression of acute pancreatitis. Cell Death Dis. 2021 ; 12(1): 5.

31. Ohzono H, et al. Targeting FoxO transcription factors with HDAC inhibitors for the treatment of osteoarthritis. Ann Rheum Dis. 2023; 82(2): 262-271.

32. Hong S, et al. A novel domain in histone deacetylase 1 and 2 mediates repression of cartilage-specific genes in human chondrocytes. FASEB J. 2009;23(10):3539-3552. 33. Carpio LR, Westendorf JJ. Histone Deacetylases in Cartilage Homeostasis and Osteoarthritis. Curr Rheumatol Rep. 2016;18(8):52.

34. Liu CJ, et al. Leukemia/lymphoma-related factor, a POZ domain-containing transcriptional repressor, interacts with histone deacetylase-1 and inhibits cartilage oligomeric matrix protein gene expression and chondrogenesis. The Journal of biological chemistry. 2004;279(45):47081-47091.

35. Queirolo V, et al. PKCepsilon is a regulator of hypertrophic differentiation of chondrocytes in osteoarthritis. Osteoarthritis Cartilage. 2016;24(8): 1451-1460.

36. Zhang H, et al. The Therapeutic Effects of Treadmill Exercise on Osteoarthritis in Rats by Inhibiting the HDAC3/NF-KappaB Pathway in vivo and in vitro. Front Physiol. 2019;10: 1060.

37. Colaianni G, et al. Deletion of the Transcription Factor PGC-lalpha in Mice Negatively Regulates Bone Mass. Calcif Tissue Int. 2018;103(6):638-652.

38. Zhao X, et al. Peroxisome proliferator-activated receptor gamma coactivator lalpha and FoxO3A mediate chondroprotection by AMP-activated protein kinase. Arthritis Rheumatol. 2014;66(l l):3073-3082.

39. Salminen A, et al. AMP-activated protein kinase inhibits NF-kappaB signaling and inflammation: impact on healthspan and lifespan. J Mol Med (Berl).

2011;89(7):667-676.

40. Wang Y, et al. Mitochondrial biogenesis is impaired in osteoarthritis chondrocytes but reversible via peroxisome proliferator-activated receptor gamma coactivator lalpha. Arthritis Rheumatol. 2015;67(8):2141-2153.

41. Mao X, et al. Mitochondria: Potential Targets for Osteoarthritis. Front Med (Lausanne). 2020;7:581402.

42. Yang X, et al. Down-Regulation of MiR-150 Alleviates Inflammatory Injury Induced by Interleukin 1 via Targeting Kruppel-Like Factor 2 in Human Chondrogenic Cells. Cell Physiol Biochem. 2018;47(6):2579-2588.

43. Chang SF, et al. 2 dyn/cm(2) shear force upregulates kruppel-like factor 4 expression in human chondrocytes to inhibit the interleukin- Ibeta-activated nuclear factor-kappaB. J Cell Physiol. 2018;234(l):958-968.

44. Weber JS, et al. Clinical and immune correlate results from a phase lb study of the histone deacetylase inhibitor mocetinostat with ipilimumab and nivolumab in unresectable stage III/IV melanoma. Melanoma Res. 2022;32(5):324-333. 45. Batlevi CL, et al. A phase 2 study of mocetinostat, a histone deacetylase inhibitor, in relapsed or refractory lymphoma. Br J Haematol. 2017;178(3):434-441.

46. Younes A, et al. Mocetinostat for relapsed classical Hodgkin's lymphoma: an open-label, single-arm, phase 2 trial. Lancet Oncol. 2011; 12(13): 1222-1228.

47. Chan E, et al. Phase Eli study of mocetinostat in combination with gemcitabine for patients with advanced pancreatic cancer and other advanced solid tumors. Cancer Chem other Pharmacol. 2018; 81(2): 355-364.

48. Nural-Guvener H, et al. Anti-Fibrotic Effects of Class I HDAC Inhibitor, Mocetinostat Is Associated with IL-6/Stat3 Signaling in Ischemic Heart Failure. Int J Mol Sci. 2015;16(5): 11482-11499.

49. Culley KL, et al. Class I histone deacetylase inhibition modulates metalloproteinase expression and blocks cytokine-induced cartilage degradation. Arthritis Rheum. 2013;65(7): 1822-1830.

50. Laschanzky RS, et al. Selective Inhibition of Histone Deacetylases 1/2/6 in Combination with Gemcitabine: A Promising Combination for Pancreatic Cancer Therapy. Cancers (Basel). 2019; 11(9).

51. Zhang L, et al. Trend of histone deacetylase inhibitors in cancer therapy: isoform selectivity or multitargeted strategy. Med Res Rev. 2015;35(l):63-84.

52. Bobrowicz M, et al. Selective inhibition of HDAC6 sensitizes cutaneous T-cell lymphoma to PI3K inhibitors. Oncol Lett. 2020;20(l):533-540.

53. Shah RR. Safety and Tolerability of Histone Deacetylase (HDAC) Inhibitors in Oncology. Drug Saf. 2019;42(2):235-245.

54. McGee-Lawrence ME, Westendorf JJ. Histone deacetylases in skeletal development and bone mass maintenance. Gene. 201 l;474(l-2): 1-11.

55. Ewels PA, et al. The nf-core framework for community-curated bioinformatics pipelines. Nature biotechnology. 2020;38(3):276-278.

56. Kopylova E, et al. SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics. 2012;28(24):3211-3217.

57. Dobin A, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(l): 15-21.

58. Liao Y, et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923-930. 59. Love MI, et al. Moderated estimation of fold change and dispersion for RNA- seq data with DESeq2. Genome biology. 2014;15(12):550.

60. Zecha J, et al. TMT Labeling for the Masses: A Robust and Cost-efficient, Insolution Labeling Approach. Mol Cell Proteomics. 2019;18(7): 1468-1478.

***

[0080] The invention thus has been disclosed broadly and illustrated in reference to representative embodiments described above. It is understood that various modifications can be made to the present invention without departing from the spirit and scope thereof.

[0081] It is further noted that all publications, patents and patent applications cited herein are hereby expressly incorporated by reference in their entirety and for all purposes as if each is individually so denoted. Definitions that are contained in text incorporated by reference are excluded to the extent that they contradict definitions in this disclosure.

Claims

WHAT IS CLAIMED IS:

1. A method for treating osteoarthritis in a subject, comprising administering to the subject a therapeutically effective amount of a compound that activates endogenous KLF4 expression, thereby treating osteoarthritis in the subject; wherein the compound is selected from the compounds shown in Table 1 or functional derivative thereof.

2. The methods of claim 1, wherein the compound is N-(2- aminophenyl)-4-[[[4-(3-pyridinyl)-2-pyrimidinyl]amino]methyl]-benzamide (mocetinostat) or a functional derivative thereof.

3. The methods of claim 1, wherein the subject is suffering from osteoarthritis or at risk of developing osteoarthritis.

4. The methods of claim 1, wherein the subject is a human.

5. The methods of claim 1, wherein the compound is administered to the subject via a parenteral route.

6. The methods of claim 5, wherein the compound is administered to the subject via intraarticular injection.

7. The method of claim 1, wherein the compound is administered to the subject in a pharmaceutical composition.

8. The methods of claim 7, wherein the pharmaceutical composition is a sustained release formulation.

9. The method of claim 1, further comprising administering to the subject a second drug for managing symptoms of osteoarthritis.

10. The method of claim 9, wherein the second drug is an antiinflammation agent or a pain reliver.

11. A method for preventing tissue destruction and inflammation associated with osteoarthritis in a subject, comprising administering to the subject a therapeutically effective amount of a compound that activates endogenous KLF4 expression, thereby preventing tissue destruction and inflammation associated with osteoarthritis in the subject; wherein the compound is selected from the compounds shown in Table 1 or functional derivative thereof.

12. The method of claim 11, wherein the compound is N-(2- aminophenyl)-4-[[[4-(3-pyridinyl)-2”pyrimidinyl]amino]methyl]-benzamide (mocetinostat) or a functional derivative thereof.

13. The methods of claim 11, wherein the subject is suffering from osteoarthritis or at risk of developing osteoarthritis.

14. The methods of claim 11, wherein the compound is administered to the subject via intraarticular injection.

15. A method of promoting cartilage regeneration in the joints of a subject, comprising introducing into the joints of the subject a population of chondrocytelike cells, wherein the chondrocyte-like cells are produced by inducing differentiation of a population of stem cells with a KLF4-activating compound shown in Table 1, thereby promoting cartilage regeneration in the joints of the subject.

16. The methods of claim 15, wherein the compound is N-(2- aminophenyr)-4-[[[4-(3-pyridinyl)-2-pyrimidinyl]amino]methyl]-benzamide (mocetinostat) or a functional derivative thereof.

17. The methods of claim 15, wherein the chondrocyte-like cells are produced by contacting the compound with the stem cells in vivo in the joints of the subject.

18. The methods of claim 15, wherein the chondrocyte-like cells are produced by contacting the compound with the stem cells in vitro and then implanting the chondrocyte-like cells into the joints of the subject.

19. The methods of claim 15, wherein the subject suffers from osteoarthritis or has traumatic cartilage damage.

20. The methods of claim 15, wherein the stem cells are mesenchymal stem cells.