WO2025174397A1 - Engineered long-lived yeast and uses thereof - Google Patents
Engineered long-lived yeast and uses thereofInfo
- Publication number
- WO2025174397A1 WO2025174397A1 PCT/US2024/026023 US2024026023W WO2025174397A1 WO 2025174397 A1 WO2025174397 A1 WO 2025174397A1 US 2024026023 W US2024026023 W US 2024026023W WO 2025174397 A1 WO2025174397 A1 WO 2025174397A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- sir2
- hap
- synthetic
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
- C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/04—Preserving or maintaining viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
- C12N1/18—Baker's yeast; Brewer's yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
Definitions
- TECHNICAL FIELD The present disclosure is related to methods and materials of synthesizing and using engineered long-lived yeast strain in modulating the cellular aging process.
- BACKGROUND Aging is a complex biological process that can accumulate diverse deleterious changes in cells causing increased risk of diseases and death.
- Recent advancements have revealed the possibility of manipulating the aging process through genetic engineering.
- understanding the gene networks that control cellular functions in these processes remain challenging due to the complex regulatory gene interactions.
- developing technologies that can engineer biological systems has emerged as an unmet need to interrogate the relationship between network structures and cellular functions in complex processes such as aging.
- the Attorney Docket No.15670-0396WO1 // SD-2024-130-1 polynucleotide encoding a strong constitutive promoter is transcriptionally repressed by the SIR2 gene product.
- the HAP-inducible promoter operably linked to SIR2 includes a CCAAT nucleotide sequence in an upstream activation sequence (UAS).
- the HAP-inducible promoter operably linked to SIR2 includes CYC1 or COX5a.
- the strong constitutive promoter operably linked to HAP4 includes Triose-phosphate dehydrogenase 3 (TDH3), TEF1, PGK1, CCW12, ADH1, or ENO2.
- the strong constitutive promoter operably linked to HAP4 includes TDH3.
- the activation of the synthetic SIR2-HAP negative feedback loop in the cell generates a periodic oscillation in the abundance of the SIR2 gene product and the HAP4 gene product, delaying the cell’s commitment to an aging pathway.
- the polynucleotide encoding a HAP-inducible promoter operably linked to SIR2 further includes a fluorescence marker.
- the fluorescence marker is mCherry, CFP, GFP, YFP, or RFP. Also provided herein are methods of modulating cellular aging in a cell, the method can include introducing into the cell the synthetic SIR2-HAP circuit construct.
- the method can include introducing a synthetic gene oscillator into the cell; thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes.
- the oscillator can include a first genetic construct for modulating nucleolar aging processes, and a second genetic construct for modulating mitochondrial aging processes, where the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct.
- methods of extending the lifespan of a cell the method can include introducing a synthetic gene oscillator into the cell; thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes.
- the method can include introducing a synthetic gene oscillator into the cell; thereby Attorney Docket No.15670-0396WO1 // SD-2024-130-1 inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes.
- the oscillator can include a first genetic construct for modulating nucleolar aging processes, and a second genetic construct for modulating mitochondrial aging processes, where the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct.
- the cell is a eukaryotic cell.
- the eukaryotic cell is selected from the group including animal cells, plant cells, fungus cells, and protist cells.
- the fungus cell is a yeast.
- the yeast is an engineered yeast strain including NH1574 and/or NH1524.
- FIG.1B The endogenous Sir2-HAP circuit and its simulated dynamic behaviors in WT cell aging.
- FIG.1B top panel shows the diagram of the circuit topology.
- FIG.1B bottom panel shows the phase plane diagram illustrating the dynamic changes of Sir2 and HAP activities during aging.
- the nullclines of Sir2 and HAP are represented in light grey and dark grey, respectively.
- the quivers represent the rate and direction of the movement of the system. Fixed points are indicated with open (unstable) and closed (stable) circles.
- FIG.1C The rewired Sir2- HAP circuit and its dynamic behaviors.
- FIG.1C top panel shows the circuit topology with the synthetic negative feedback loop.
- FIG.1C bottom panel shows the phase plane diagram with a limit cycle (black line) arising from the circuit, in which Sir2 and HAP periodically changed their levels. (Inset) Simulated time traces of oscillatory Sir2 expression.
- FIG.1D A schematic illustrating the construction of the synthetic circuit.
- FIGS.2A-2D Oscillations in the synthetic strain during aging.
- FIG.2A Dynamics of Sir2-mCherry fluorescence in WT (left) and the synthetic strain (right) during aging.
- FIG.2A top panel shows representative time-lapse images for phase and Sir2-mCherry from single aging cells in the microfluidic chamber. Phase images show aging and dead mother cells.
- FIG.2A shows fluorescence time traces throughout the lifespans of representative cells. The time trace in black corresponds to the time-lapse images shown above the plot. Time traces of all the cells measured are included in FIG.9.
- FIG.2B Distribution of the amplitudes of Sir2 oscillatory pulses in the engineered cells.
- FIG.2C Distribution of the periods of Sir2 oscillatory pulses in the engineered cells.
- FIG.2B and FIG.2C show distributions of single pulses. The quantification of amplitude and period is included in the materials and methods and FIG.10.
- FIGS.3A-3E Life-span extension by the synthetic oscillator.
- FIGS.4A-4C The life-span curves for WT and the synthetic oscillator strains were scaled by the median. The CV of lifespans among cells was calculated for WT and the synthetic oscillator strain.
- FIG.3D The histograms represent distributions of cell cycle lengths at different stages of aging for WT and the synthetic oscillator strain. Experiments were independently performed at least three times.
- FIG.3E Replicative lifespans of WT and the alternative oscillator strain NH1524 are shown.
- FIGS.4A-4C The synthetic oscillator maintained a balance between rDNA silencing and heme biogenesis.
- FIG.4C Bar graphs show continuous times of the rDNA silencing–loss or heme-depletion state for WT (left) and the synthetic oscillator strain (right). Each bidirectional bar represents a single cell, in which the upward portion indicates its continuous time of the rDNA silencing–loss state, and the downward portion indicates the continuous time of the heme depletion-state. The graphs were quantified using the data from FIGS.4A-4B, and FIG.18. Experiments were independently performed at least three times.
- FIGS.5A-5B Representative time-lapse images of WT cells with divergent aging processes.
- FIG.5A Time-lapse images of a mother cell aging with rDNA silencing loss, previously designated as “mode 1” aging (34).
- FIG.5B Time-lapse images of a mother cell aging with heme depletion, previously designated as “mode 2” aging (34). Mode 1 and Mode 2 cells were classified based on their age-dependent changes in their daughter morphologies (Mode 1 – elongated daughters; Mode 2 – smaller round daughters) and dynamics of iRFP fluorescence (34, 55). Time-lapse images are shown for (top) Phase, (middle) rDNA-GFP, and (bottom) nuc. iRFP of the same cells. Replicative age of the mother cell is shown at the top left corner of each image.
- FIGS.6A-6C A mathematical model of the gene oscillator circuit.
- FIG.6A Diagram of the gene oscillator model with a synthetic negative feedback loop.
- FIG. 6B Ordinary differential equations of the gene oscillator model.
- FIG.6C Example of sustained oscillations in Sir2 and HAP from model simulation.
- FIGS.7A-7B Exploration of the parameter regime that favored oscillation.
- FIG.7A Boxplots show the ranges of parameter values that generated oscillation Attorney Docket No.15670-0396WO1 // SD-2024-130-1 (grey) vs no oscillation (black).
- the Monte Carlo method was used to explore parameter regimes for the model from FIG.6. Specifically, 1 million different sets of parameter values were randomly generated and were categorized into two groups - the ones that generated sustained oscillation and the ones that do not generate sustained oscillation. For each parameter, the grey boxplot shows the range of parameter values from the parameter group that generate oscillations and the black boxplot shows the range of parameter values from the group that do not generate oscillations. The left two columns show the parameters that governed the synthetic negative feedback loop. The right column shows the parameters that governed mRNA/protein production and degradation.
- FIG.7B Bifurcation plots show the dependence of oscillations on key parameters identified from the Monte Carlo method.
- FIGS.8A-8D Effects of the mCherry tag to Sir2 and the rDNA-GFP reporter on yeast aging and growth.
- FIG.8B Age-dependent changes of cell cycle length in WT with (+) rDNA-GFP and with (+) mCherry tag to Sir2, WT with (+) rDNA-GFP and without (-) mCherry tag to Sir2, WT without (-) rDNA-GFP and with (+) mCherry tag to Sir2, and WT without (-) rDNA-GFP and without (-) mCherry tag to Sir2 are shown.
- FIG.8C Single-cell color map trajectories of rDNA- GFP (top) and nuclear- anchored iRFP (bottom) for WT with (+) rDNA-GFP and with (+) mCherry tag to Sir2 and WT with (+) rDNA-GFP and without (-) mCherry tag to Sir2 are shown. Each row represents the time trace of a single cell throughout its lifespan. Color represents the fluorescence intensity as indicated in the color bar.
- FIG.10A Raw time trace data of Sir2-mCherry in a representative cell to illustrate the process of trace smoothing. Black dots are raw data; the curve is the smoothed time trace.
- FIG.10B Illustration of the quantification of the amplitude and period of oscillatory pulses using the representative time trace from FIG.10A: Peaks (downward triangle) and valleys (upward triangle) were determined using iPeak (from MathWorks File Exchange). Dashed line represents the baseline which connects all valleys. The amplitude (Amp) of a pulse was calculated as the distance from the peak to the point crossed by the vertical line from the peak to the baseline.
- FIG. 10C Left: Bar graph shows the amplitudes of each pulse in the time trace in FIG. 10B: Only the pulses with amplitudes over the threshold (dash line - 5 times of the average amplitude of fluctuation pulses in WT) were considered as true oscillatory pulses, as opposed to small fluctuations. Right: Bar graph shows the periods of each pulse in the time trace in FIG.10B.
- FIGS.11A-11B Spectral analysis of Sir2 oscillations.
- FIG.11A Illustration of the power spectral computation using single-cell time traces of (top) a representative oscillator cell and (bottom) a WT cell as examples.
- FIG.11B Average power spectrum for (left) the oscillator strain and (right) WT. Boxplots show the frequency-dependent Attorney Docket No.15670-0396WO1 // SD-2024-130-1 distributions of power spectrum. The bottom and top of the box are first and third quartiles, respectively. The band inside is the median.
- FIGS.12A-12C Stability determination for Sir2 oscillations.
- FIG.12A Defining the threshold for deviation from oscillations.
- the changepoints detection method was performed and the changing ratio (m end /m end-1 ) was calculated for Sir2- mCherry time trace for each single aging cell from the oscillator strain.
- the changepoints detection method was applied to the resulting changing ratio trajectory across cells to identify the turning point on the trajectory, which served as the threshold (THR; horizontal red dash line) for sustained oscillations vs deviations.
- FIGS.12B A representative Sir2-mCherry time trace illustrating the deviation from sustained oscillation with the changing ratio larger than THR. The time trace was separated by the change point into sustained region and deviated region.
- FIGS.12C A representative Sir2-mCherry time trace illustrating sustained oscillation with the changing ratio smaller than THR.
- FIGS.13A-13D Synthetic Sir2-HAP circuits with broken or weakened feedback interactions.
- FIG.13A Diagrams illustrate gene interactions in different versions of the Sir2-HAP circuit. Circuit without HAP-activated expression of Sir2 - SIR2 is expressed under its native promoter and hence is not regulated by HAP. Circuit without Sir2-mediated repression of HAP – HAP4 is expressed under its native promoter and is not inserted at rDNA-NTS. Circuit with a weaker transcriptional capacity of HAP – HAP4 is expressed under the ADH1 promoter, weaker than the oscillator’s TDH3 promoter.
- FIG.13C Proportions of aging cells with different versions of the synthetic circuit that showed sustained oscillation or a deviation from oscillation late in life (late-deviated), or no oscillation.
- FIG.13D Power spectral analysis for aging cells with different versions of the synthetic circuit.
- FIGS.13C-13D single-cell data from different strains Attorney Docket No.15670-0396WO1 // SD-2024-130-1 were processed through the same analytical pipeline used for the oscillator strain in FIG.2D and FIG.11.
- FIG.14 Sir2 abundance in WT and the oscillator strain. Boxplots show the distributions of Sir2 abundance averaged over the lifetimes of single aging cells in WT and synthetic oscillator strain.
- the mean Sir2 expression level in WT is 439.7 ⁇ 117.6 AU.
- the mean Sir2 expression level in the oscillator strain is 950 ⁇ 284 AU.
- FIGS.15A-15C Comparison of the synthetic oscillator strain with strains constitutively overexpressing SIR2 and HAP4.
- FIG.15B Lifespan curves of WT, the synthetic oscillator strain, SIR2 twofold overexpression (2 x SIR2), HAP4 overexpression (O/E HAP4), and combined HAP4 overexpression and SIR2 twofold overexpression (O/E HAP4 + 2 x SIR2), scaled by the median are shown.
- FIG.15C Age-dependent changes of cell cycle length in WT, the synthetic oscillator strain, SIR2 twofold overexpression (2 x SIR2), HAP4 overexpression (O/E HAP4), and combined HAP4 overexpression and SIR2 twofold overexpression (O/E HAP4 + 2 x SIR2) are shown.
- FIGS.16A-16C Comparison of the synthetic oscillator strain with strains carrying synthetic Sir2- HAP circuits with broken or weakened feedback interactions.
- the genetic circuits of these strains are shown in FIG.13A.
- FIG.16B Lifespan curves of WT, the synthetic oscillator strain, the strain without HAP- activated expression of Sir2, the strain without Sir2-mediated repression of HAP, and the strain with a weaker transcriptional capacity of HAP, scaled by the median are shown.
- the Coefficient of Variation (CV) of lifespans was calculated for each strain.
- FIG.16C Age-dependent changes of cell cycle length in WT, the synthetic oscillator strain, the strain without HAP-activated Attorney Docket No.15670-0396WO1 // SD-2024-130-1 expression of Sir2, the strain without Sir2-mediated repression of HAP, and the strain with a weaker transcriptional capacity of HAP are shown.
- FIGS.17A-17C Comparison of the synthetic oscillator strain with long-lived mutants identified in genetic screens.
- FIG.17B Lifespan curves of WT, the synthetic oscillator strain, fob1 ⁇ , sgf73 ⁇ , sch9 ⁇ fob1 ⁇ , and hxk2 ⁇ fob1 ⁇ , scaled by the median are shown.
- the threshold (dash line) for the state of rDNA silencing loss was defined as the third quartile (75th percentile) of all the rDNA-GFP fluorescence values measured from WT and synthetic oscillator strain.
- the portions of time traces above the threshold represent the state of silencing loss.
- the mean value of the continuous time spans at this state (H 1 for WT and H 1-5 for the synthetic oscillator, respectively) was calculated for each single aging cell.
- FIG. 18B Representative time traces of nuc. iRFP in WT (left) and the synthetic oscillator strain (right) illustrate the quantification of the continuous times at the heme depletion state for each single aging cell.
- FIG.20A Diagrams illustrate the synthetic Sir2-HAP circuits with broken or weakened interactions.
- FIG.22B Bar Attorney Docket No.15670-0396WO1 // SD-2024-130-1 graphs show continuous durations (as percentage of the lifetime) of single cells at the rDNA silencing loss state or the heme depletion state for O/E HAP4, 2 x SIR2, and O/E HAP4 + 2 x SIR2.
- FIGS.23A-23B Illustrations of strain construction.
- FIG.23A Diagram illustrates the steps for replacing the native SIR2 promoter by P CYC1 .
- FIG. 23B Diagram illustrates the steps for constructing the single-copy rDNA-GFP reporter.
- DETAILED DESCRIPTION Cellular aging is a fundamental and complex biological process that is an underlying driver for many diseases (20).
- Synthetic biology is a powerful approach to rewire and perturb intricate endogenous networks and to interrogate the relationship between network structure and cellular functions (e.g., cellular aging) (3, 13–19).
- the methods and materials herein discloses an oscillatory gene network that can effectively promote cellular longevity.
- Existing genetic approaches slow cellular aging by simply overexpressing or deleting aging-related genes.
- the present methods and materials show that engineering a synthetic gene oscillator by rewiring the endogenous Sir2-HAP circuit into a feedback loop can slow the cellular aging.
- modifying the genetic interactions between Sir2 and HAP4 resulted in altered temporal dynamics of their expression which enhanced homeostasis in processes that drive aging.
- the lysine deacetylase Sir2 and heme-activated protein (HAP) complex are deeply conserved and well-characterized transcriptional regulators that control yeast aging and life span. Isogenic wild-type yeast cells age toward two discrete terminal states (34): one with decreased rDNA silencing (light grey dots FIG. 1A and FIG.5A), which leads to nucleolar enlargement and fragmentation (34), and another with decreased heme abundance (FIG.1A and FIG.5B) which causes mitochondrial aggregation and dysfunction (34).
- rDNA ribosomal DNA
- HAP regulates the expression of genes that are important for heme biogenesis and mitochondrial function (31).
- Cells The methods and materials described herein can be used to modulate cellular aging processes, extend the lifespan of a cell, slow age-related decline, or age-induced cell deterioration and/or promote longevity effects in a cell.
- the cell is a eukaryotic cell.
- the cell can be an animal cell, a plant cell, a fungus cell, or a protist cell.
- the fungus cell is a yeast.
- the Synthetic Oscillator Provided herein are cells (e.g., yeast) comprising a synthetic SIR2-HAP circuit construct including (a) a polynucleotide encoding a HAP-inducible promoter operably linked to SIR2, and (b) a polynucleotide encoding a strong constitutive promoter operably linked to HAP4.
- the polynucleotide is a DNA or an RNA.
- the HAP-inducible promoter operably linked to SIR2 can include a CCAAT nucleotide sequence in an upstream activation sequence (UAS).
- UAS upstream activation sequence
- the HAP-inducible promoter operably linked to SIR2 includes CYC1 or COX5a.
- the strong constitutive promoter operably linked to HAP4 can include Triose-phosphate dehydrogenase 3 (TDH3), TEF1, PGK1, CCW12, ADH1, or ENO2. In some cases, the strong constitutive promoter operably linked to HAP4 is TDH3.
- a mutual inhibition circuit of Sir2 and HAP resembles a toggle switch that can drive cellular fate decisions and commitment to either of these two detrimental states, contributing to cell deterioration and aging.
- a polynucleotide encoding a HAP4-inducible promoter operably linked to SIR2 is CYC1.
- a polynucleotide encoding a strong constitute promoter operably linked to HAP4 is TDH3.
- the synthetic SIR2-HAP circuit construct can be modeled using ordinary differential equation-based or stochastic differential equation-based mathematical models.
- the Sir2-HAP circuit construct is rewired into a negative feedback loop.
- the synthetic SIR2-HAP circuit construct can slow cell aging by periodically cycling between the two aging paths and can prevent prolonged commitment of the cell (e.g., yeast) to either the silencing or heme depletion state.
- activation of the synthetic SIR2-HAP negative feedback loop in the cell generates a periodic oscillation in the abundance of the SIR2 gene product (e.g., protein) and the HAP4 gene product (e.g., protein), delaying the cell’s commitment to an aging pathway (e.g., nucleolar enlargement and fragmentation or mitochondrial aggregation and dysfunction).
- the polynucleotide e.g., DNA
- a strong constitutive promoter e.g., TDH3
- the HAP-inducible promoter (e.g., CYC1) is transcriptionally induced by the HAP4 gene product.
- the polynucleotide encoding a strong constitutive promoter (e.g., TDH3) can be transcriptionally repressed by the SIR2 gene product.
- the engineered yeast strain NH1574 comprises a polynucleotide encoding a strong constitutive promoter operably linked to HAP4 is inserted at an rDNA locus.
- the engineered yeast strain NH1524 comprises a polynucleotide encoding a strong constitutive promoter operably linked to HAP4 is inserted at a silent HML locus.
- the HAP-inducible CYC1 promoter can include P CYC1 .
- the strong constitutive TDH3 promoter can include PTDH3.
- the polynucleotide encoding a HAP-inducible CYC1 promoter operably linked to SIR2 further comprises a fluorescence marker.
- the fluorescence marker can be mCherry, green fluorescent protein (GFP), yellow fluorescent protein (YFP), or red fluorescent protein (RFP).
- GFP green fluorescent protein
- YFP yellow fluorescent protein
- RFP red fluorescent protein
- SIR2 can be C-terminally tagged with mCherry.
- the age related decline is caused by nucleolar enlargement and degradation or mitochondrial aggregation and dysfunction.
- a cell e.g., yeast cell
- the method including introducing into the cell a synthetic SIR2- HAP circuit construct (e.g., a polynucleotide encoding a HAP-inducing CYC1 promoter operably linked to SIR2, and a polynucleotide encoding a strong constitutive TDH3 promoter operably linked to HAP4).
- Also provided here are methods and materials for modulating cellular aging in a cell the method comprising introducing a Attorney Docket No.15670-0396WO1 // SD-2024-130-1 synthetic gene oscillator into the cell, thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes.
- the methods and materials described herein slows age-related nucleolar and mitochondrial deterioration.
- the methods and materials described herein are effective to prevent aging cells from committing to either the nucleolar deterioration or mitochondrial dysfunction state. Modulating cellular aging can include slowing down age-related decline, age-induced cell deterioration, or promoting longevity factors.
- Nucleolar cellular aging process can include nucleolar enlargement and fragmentation.
- Mitochondrial cellular aging process can include mitochondrial aggregation and/or dysfunction.
- Periodic oscillation can enable a dynamic balance in Sir2 and HAP during aging, avoiding a prolonged duration or cell-fate commitment to either rDNA silencing-loss or a heme-depletion state, and can thus slow down cell deterioration and can extend life span.
- the oscillator includes a first genetic construct (e.g., SIR2) for modulating nucleolar aging processes, and a second genetic construct (e.g., HAP4, HAP1, HAP2) for modulating mitochondrial aging processes, wherein the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct.
- the cells and/or engineered circuits described herein can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) by about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to wild type cells.
- the methods and materials provided herein can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) between about 60% and about 90%, about 60% and about 65%, about 60% and about 70%, about 60% and about 75%, about 60% and about 80%, about 60% and about 85%, about 85% and about 65%, about 85% and about 70%, about 85% and about 75%, about 85% and about 80%, about 80% and about 65%, about 80% and about 70%, about 80% and Attorney Docket No.15670-0396WO1 // SD-2024-130-1 about 75%, about 75% and about 65%, about 75% and about 70%, or about 70% and about 65% compared to a wild type cells.
- a cell e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit
- the cells and/or engineered circuits described herein include cells with sustained oscillations.
- sustained oscillations can include an oscillation over the majority of the lifespan of the cell.
- sustained oscillations in the cell can be effective to extend the lifespan of the cell by about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% compared to wild type cells.
- the sustained oscillations provided herein can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) between about 50% and about 150%, about 50% and about 135%, about 50% and about 125%, about 50% and about 115%, about 50% and about 105%, about 60% and about 150%, about 60% and about 135%, about 50% and about 115%, about 60% and about 105% compared to a wild type cell.
- the sustained oscillations in the cell can extend the lifespan of a cell by about 90% to about 125% compared to wild type cells.
- the engineered cells described herein include cells with deviated oscillations.
- deviated oscillations can include an oscillation over the majority of the lifespan of the cell, and wherein the cell accumulates an increasing amount of Sir2 gene product leading to nucleolar enlargement and degradation.
- deviated oscillations in the cell can be effective to extend the lifespan of the cell by about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, or about 65% compared to wild type cells.
- the deviated oscillations provided herein can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) between about 10% and about 60%, about 10% and about 50%, about 15% and about 65%, about 15% and about 55%, about 20% and about 50%, about 25% and about 50%, or about 30% to about 55% compared to wild type cells.
- a cell e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit
- cells with deviated oscillations can extend the lifespan of a cell by about 30% to about 50% compared to the wild type cells.
- the HindIII (AAGCTT) restriction site at HAP4 ORF was synonymously mutated to ATGCTT, so that the plasmid has a unique HindIII site located within the NTS1 homologous part of the plasmid for further linearization and integration into the rDNA region in the genome.
- the synthetic oscillator strain NH1574 was constructed by following 5 steps: 1, In the WT strain with nuc.
- NH1545 was transformed with SphI digested plasmids from NHB0638;
- O/E HAP4 (NH1857), NH1545 was transformed with BsmI digested plasmids from NHB0659;
- NH1545 was Attorney Docket No.15670-0396WO1 // SD-2024-130-1 transformed with BsmI digested plasmids from NHB0659 and SphI digested plasmids from NHB0299 sequentially.
- Exemplary yeast strains Strain Name Description NH0268 BY4741 MATa his3 ⁇ 1 leu2 ⁇ 0 met15 ⁇ 0 ura3 ⁇ 0 NHP6a-iRFP- Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Strain Name Description B Y4741 MATa his3 ⁇ 1 leu2 ⁇ 0 met15 ⁇ 0 ura3 ⁇ 0, NHP6a-iRFP- k nMX P -SIR2-mCh rr -LEU2 h 4 ⁇ HIS3 NTS1 -P 3- - y- Table 2.
- Exemplary plasmids Plasmid Name Description Attorney Docket No.15670-0396WO1 // SD-2024-130-1 N HB0638 pRS303-P SIR2 -SIR2 N HB0659 pRS303-P TDH3 -HAP4 NHB0730 ZZ-rDNA-GFP-re orter20-URA3 (for sin le co rDNA Primer Sequence (5'-3') Description ir2 s r2 1 1 2 2 3 3 4 4 Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Primer Sequence (5'-3') Description Sir2dw@p CACTAAATTAATAATGACCATCCC Forward primer for F5 5 6 6 7- 7-8 9 .
- FFT Fast Fourier Transformation
- Yeast cells were inoculated into 2 ml of synthetic complete medium (SD, 2% glucose) and cultured overnight at 30°C. From this culture, 2 ⁇ l of the saturated culture was diluted into 20 mL of fresh SD medium until its OD600 reached ⁇ 0.9. The chip containing four microfluidic devices was placed under vacuum for 20 minutes. Meanwhile, 50 mL of SD medium with 0.04% Tween-20 (Sigma) was filled into a 60 ml syringe (Luer-Lok Tip, BD) to which plastic tubing (TYGON, ID 0.020 IN, OD0.060 IN, wall 0.020 IN) was connected. After vacuum, the device was quickly connected to the prepared syringe through plastic tubing from its inlet port.
- SD synthetic complete medium
- Tween-20 0.04% Tween-20
- the outlet of the microfluidic device was also connected to plastic tubing.
- the chip with inlet and outlet connected was then fixed onto the motorized stage of the microscope ready for cell loading.
- cells were transferred into a 60 ml syringe with plastic tubing connected.
- the media supply tubing into the inlet was then replaced with the tubing connected to the cell loading syringe.
- the flow of medium in the device was maintained by gravity to drive cells into traps.
- the media supply syringe and tubing were switched back to the inlet of the device. Heights of all tubing were adjusted to make the height difference around 240 cm.
- Tween-20 is a non-ionic surfactant that helps reduce cell friction on the PDMS of the chip.
- Time-lapse microscopy Time-lapse microscopy experiments were conducted using a Nikon Ti-E inverted fluorescence microscope with an EMCCD camera (Andor iXon X3 DU897). The light source was a spectra X LED system. Images were taken using a CFI plan Apochromat Lambda DM 60X oil immersion objective (NA 1.40 WD 0.13MM). In all experiments, the images were acquired for each fluorescence channel every 15 minute for a total of 90 to 110 hours.
- the exposure and intensity setting for each channel were set as follows: Phase 50 ms, GFP 3 ms at 10% lamp intensity with an EM Gain of 50, mCherry 90 ms at 10% lamp intensity with an EM Gain of 200, and iRFP 300 ms at 15% lamp intensity with an EM Gain of 300.
- Peaks (Pi) and valleys (Vi) of oscillations of Sir2 trajectories for each single cell were identified by iPeak (from MathWorks File Exchange), where i denotes the i-th peak or valley.
- the baseline was formed by connecting all valleys with the polyline (FIG.10B, black dashed line).
- the amplitude (A i ) was measured as the vertical distance from P i to the baseline between Vi-1 and Vi (FIG.10B).
- peaks of oscillation only the peaks with an amplitude at least five times higher than the average amplitude of fluctuation pulses in WT cells were considered as the “oscillatory pulses” that came from the synthetic oscillation circuit (FIGS.10B-10C).
- the period (T i ) for each oscillatory pulse was measured as the time span between valley Vi-1 and Vi (FIGS.10B-10C).
- the power spectrum of an individual time trace was calculated Attorney Docket No.15670-0396WO1 // SD-2024-130-1 2
- time traces shorter than 23 hours or deviated before 23 hours were not applied to FFT.
- P(f) of each cell was firstly linear interpolated at 5000 query frequency points which were uniformly distributed along the frequency range. Average power ⁇ P(f i )> was then calculated at each query frequency point fi.
- ⁇ is the deviation measurement following the cost function. had 1 2 or more changepoints.
- the Sir2 time trace was therefore divided into 2 or more sections by the changepoint(s) where the standard deviation of the trajectory changed the most (FIG.12).
- the mean of each section was calculated (m i ).
- the ratio for the mean value of the last section divided by that of the next to last section ( m end m end-1 ) was defined as the changing ratio for the Sir2 trace.
- the changepoints detection method was applied to the resulting changing ratio trajectory across cells to identify the turning point on the trajectory, which served as the threshold Attorney Docket No.15670-0396WO1 // SD-2024-130-1 (THR; horizontal dash line in FIG.12A) for sustained oscillations versus deviations.
- the cells with changing ratios above the threshold were considered deviations from the oscillation.
- the threshold (dash line in FIG.18A) for the state of rDNA silencing loss was defined as the third quartile (75th percentile) of all the rDNA-GFP fluorescence values measured from WT and synthetic oscillator strain.
- the portions of time traces above the threshold represented the state of silencing loss (FIG.18A).
- the mean value of the continuous time spans at this state was calculated for each single aging cell.
- the threshold (FIG.18B) for the state of heme depletion was defined as the first quartile (25th percentile) of all the nuc. iRFP fluorescence values measured from the WT and synthetic oscillator strains.
- the portions of time traces below the threshold represented the state of heme depletion (FIG.18B).
- the mean value of the continuous time spans at this state was calculated for each single aging cell. Continuous times at the silencing loss state and the heme depletion state were shown for each single aging cell in FIG.4C.
- iRFP iRFP
- biliverdin a product of heme catabolism
- heme a product of heme catabolism
- microfluidics was coupled with time-lapse microscopy of single cells. Isogenic WT cells aged toward two discrete terminal states (34): one with decreased rDNA silencing (FIG.1A (light grey dots) and FIG.5A), which led to nucleolar enlargement and fragmentation (34), and one with decreased heme abundance (FIG.1A (dark grey dots) and FIG.5B) and hence, mitochondrial aggregation and dysfunction (34).
- HAP4 To ensure a high capacity for transcription of HAP, a construct was built that contained the HAP4 gene, encoding a major component of the HAP complex, under a strong, constitutive TDH3 (triose- phosphate dehydrogenase 3) promoter.
- TDH3 triose- phosphate dehydrogenase 3
- the HAP4 construct was integrated at the nontranscribed spacer (NTS) region within the rDNA, which was subjected to transcriptional silencing mediated by Sir2 (29, 38) (FIG.1D).
- NTS nontranscribed spacer
- FIG.1D The endogenous copy of HAP4 was deleted in the synthetic strain to minimize leakiness of HAP4 expression.
- HAP4 was not tagged with a fluorescent reporter because its protein abundance was below the detection limit of fluorescence microscopy.
- WT control cells did not show such oscillations (FIG.2A and FIG.9).
- the amplitude and period of oscillatory pulses in the engineered cells were quantified (FIG.10).
- the average amplitude of oscillations was 309 ⁇ 108 arbitrary units (FIG.2B), which was much larger than fluctuations in WT cells (36 ⁇ 30 AU).
- the average period was 557 ⁇ 151 min (FIG.2C), longer than the typical cell doubling times ( ⁇ 90 to 120 min), which indicated that the oscillations were not driven by cell cycle.
- Spectral analysis of Sir2 time traces was also performed (FIG.11).
- Example 4 The synthetic oscillator extends life span The synthetic oscillator strain showed an 82% increase in life span compared to that of WT control cells (FIG.3A). This was the most pronounced life-span extension in yeast that was observed with genetic perturbations. Among the engineered cells, those aging with sustained oscillations had greater life-span extension (105% increase in life span, doubling that of WT) than those that deviated from oscillations late in life (45% increase relative to that of WT) (FIG.3A, right versus left dashed curves).
- the alternative oscillator strain, NH1524 also produced periodic oscillations between nucleolar and mitochondrial cellular aging processes and thereby slowing age-dependent cellular deterioration and dramatically extended the lifespan. Thus, maintaining Sir2 oscillation appeared to be important for maximally extending life span.
- the synthetic oscillator strain exhibited a fast cell cycle rate and the elongation of cell cycles during aging was delayed and decreased compared to that in WT cells (FIG.3B).
- Engineered cells with sustained oscillations retained a fast cell cycle rate (70 to 90 minutes per cell cycle) throughout their entire lifespans, whereas those that deviated from oscillations had much slower cell cycles late in life (FIG.3B, lower vs upper dashed curves).
- CV coefficient of variation
- the abundance of Sir2, averaged over the lifetime was elevated by about twofold relative to that of WT (FIG.14).
- deletion mutants fob1 ⁇ (“forkblocking less,” which encodes a protein required for replication fork blocking), sgf73 ⁇ (SAGA-associated factor 73, which encodes a component of the SAGA/SLIK complex deubiquitination module), fob1 ⁇ hxk2 ⁇ (the double mutant of genes that encode forkblocking less and hexokinase 2), and fob1 ⁇ sch9 ⁇ (the double mutant of genes that encode forkblocking less and an ortholog of the mammalian S6 kinase). Under the genetic background and experimental conditions used (32, 34, 47), the synthetic oscillator strain had a longer and more uniform life span than most mutants (FIGS.17A-17B).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Provided herein are methods and materials of synthesizing and using engineered long-lived yeast strain (e.g., synthetic Sir2-HAP oscillating circuit) in modulating cellular aging process. The methods and materials include using the engineered long-lived yeast strain for extending the lifespan of cells. Specifically, the engineered yeast cells can include a synthetic SIR2-HAP circuit construct comprising a polynucleotide encoding a HAP-inducible promoter (e.g., CYC1) operably linked to SIR2; and a polynucleotide encoding a strong constitutive promoter (e.g., TDH3) operably linked to HAP4 inserted at an rDNA locus or a silent HML locus.
Description
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 ENGINEERED LONG-LIVED YEAST AND USES THEREOF CLAIM OF PRIORITY This application claims the benefit of U.S. Provisional Application Serial No. 63/552,922, filed on February 13, 2024. The entire contents of the foregoing are incorporated herein by reference. FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. GM111458, AG068112, GM144595, and AG056440 awarded by the National Institutes of Health. The Government has certain rights in the invention. TECHNICAL FIELD The present disclosure is related to methods and materials of synthesizing and using engineered long-lived yeast strain in modulating the cellular aging process. BACKGROUND Aging is a complex biological process that can accumulate diverse deleterious changes in cells causing increased risk of diseases and death. Recent advancements have revealed the possibility of manipulating the aging process through genetic engineering. However, understanding the gene networks that control cellular functions in these processes remain challenging due to the complex regulatory gene interactions. Thus, developing technologies that can engineer biological systems has emerged as an unmet need to interrogate the relationship between network structures and cellular functions in complex processes such as aging. SUMMARY Provided herein are cells including a synthetic SIR2-HAP circuit construct including: (a) a polynucleotide encoding a HAP-inducible promoter operably linked to SIR2; and (b) a polynucleotide encoding a strong constitutive promoter operably linked to HAP4. In some embodiments, the polynucleotide encoding a strong constitutive promoter operably linked to HAP4 is inserted at an rDNA locus or a silent HML locus in the cell. In some embodiments, the HAP-inducible promoter is transcriptionally induced by the HAP4 gene product. In some embodiments, the
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 polynucleotide encoding a strong constitutive promoter is transcriptionally repressed by the SIR2 gene product. In some embodiments, the HAP-inducible promoter operably linked to SIR2 includes a CCAAT nucleotide sequence in an upstream activation sequence (UAS). In some embodiments, the HAP-inducible promoter operably linked to SIR2 includes CYC1 or COX5a. In some embodiments, the strong constitutive promoter operably linked to HAP4 includes Triose-phosphate dehydrogenase 3 (TDH3), TEF1, PGK1, CCW12, ADH1, or ENO2. In some embodiments, the strong constitutive promoter operably linked to HAP4 includes TDH3. In some embodiments, the activation of the synthetic SIR2-HAP negative feedback loop in the cell generates a periodic oscillation in the abundance of the SIR2 gene product and the HAP4 gene product, delaying the cell’s commitment to an aging pathway. In some embodiments, the polynucleotide encoding a HAP-inducible promoter operably linked to SIR2 further includes a fluorescence marker. In some embodiments, the fluorescence marker is mCherry, CFP, GFP, YFP, or RFP. Also provided herein are methods of modulating cellular aging in a cell, the method can include introducing into the cell the synthetic SIR2-HAP circuit construct. Also provided herein are method of modulating cellular aging in a cell, the method can include introducing a synthetic gene oscillator into the cell; thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. In some embodiments, the oscillator can include a first genetic construct for modulating nucleolar aging processes, and a second genetic construct for modulating mitochondrial aging processes, where the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct. Also provided herein are methods of extending the lifespan of a cell, the method can include introducing a synthetic gene oscillator into the cell; thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. Also provided herein are methods of delaying age-related decline in a cell, the method can include introducing a synthetic gene oscillator into the cell; thereby
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. In some embodiments, the oscillator can include a first genetic construct for modulating nucleolar aging processes, and a second genetic construct for modulating mitochondrial aging processes, where the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is selected from the group including animal cells, plant cells, fungus cells, and protist cells. In some embodiments, the fungus cell is a yeast. In some embodiments, the yeast is an engineered yeast strain including NH1574 and/or NH1524. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS FIGS.1A-1D. Construction of a synthetic gene oscillator to reprogram aging. FIG.1A: Divergent aging in isogenic wild-type (WT) cells. Dot plots show the distributions of rDNA-GFP and nuc. iRFP reporter fluorescence in single cells tracked by time lapse microscopy of single cells over the course of their lifespans. Each dot represents a single cell monitored individually in a microfluidic chamber. The light grey dots represent aging with rDNA silencing–loss, indicated by increased rDNA- GFP fluorescence. The dark grey dots represent aging with heme depletion, indicated by decreased iRFP fluorescence. Experiments were independently performed at least
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 three times. AU, arbitrary units. FIG.1B: The endogenous Sir2-HAP circuit and its simulated dynamic behaviors in WT cell aging. FIG.1B top panel shows the diagram of the circuit topology. FIG.1B bottom panel shows the phase plane diagram illustrating the dynamic changes of Sir2 and HAP activities during aging. The nullclines of Sir2 and HAP are represented in light grey and dark grey, respectively. The quivers represent the rate and direction of the movement of the system. Fixed points are indicated with open (unstable) and closed (stable) circles. The stable fixed point on the bottom right corresponds to the terminal states of aging cells undergoing rDNA silencing loss and nucleolar decline as shown in FIG.1A; the stable fixed points on the left correspond to the terminal states of aging cells undergoing heme depletion and mitochondrial decline as shown in FIG.1A. FIG.1C: The rewired Sir2- HAP circuit and its dynamic behaviors. FIG.1C top panel shows the circuit topology with the synthetic negative feedback loop. FIG.1C bottom panel shows the phase plane diagram with a limit cycle (black line) arising from the circuit, in which Sir2 and HAP periodically changed their levels. (Inset) Simulated time traces of oscillatory Sir2 expression. FIG.1D: A schematic illustrating the construction of the synthetic circuit. The native promoter of SIR2 was replaced with a HAP-inducible CYC1 promoter (PCYC1). HAP4 under a strong, constitutive TDH3 promoter (PTDH3) was inserted at the rDNA locus, which was subjected to transcriptional silencing mediated by Sir2. FIGS.2A-2D. Oscillations in the synthetic strain during aging. FIG.2A: Dynamics of Sir2-mCherry fluorescence in WT (left) and the synthetic strain (right) during aging. FIG.2A top panel shows representative time-lapse images for phase and Sir2-mCherry from single aging cells in the microfluidic chamber. Phase images show aging and dead mother cells. In fluorescence images, replicative age of the mother cell is shown at the top left corner of each image. FIG.2A bottom shows fluorescence time traces throughout the lifespans of representative cells. The time trace in black corresponds to the time-lapse images shown above the plot. Time traces of all the cells measured are included in FIG.9. FIG.2B: Distribution of the amplitudes of Sir2 oscillatory pulses in the engineered cells. FIG.2C: Distribution of the periods of Sir2 oscillatory pulses in the engineered cells. FIG.2B and FIG.2C show distributions of single pulses. The quantification of amplitude and period is included in the materials and methods and FIG.10. FIG.2D: Proportions of aging cells from the synthetic
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 strain that show sustained oscillations (Sustained) or a deviation from oscillation late in life (Late- deviated) (n = 113). (Left) Representative time traces for sustained oscillation (top) and late deviation from oscillation (bottom). The stability determination for Sir2 oscillations is available in the materials and methods and FIG. 12. Experiments were independently performed at least three times. FIGS.3A-3E. Life-span extension by the synthetic oscillator. FIG.3A: Replicative lifespans of WT (black, n = 131 cells) and the synthetic oscillator strain (dark grey, n = 120 cells) are shown. Among the cells in the synthetic oscillator strain, the lifespans for those that deviated from oscillations (n = 39 cells) and those with sustained oscillations (n = 74 cells) are shown as left and right dashed curves, respectively. P < 0.0001 with Gehan-Breslow-Wilcoxon test. FIG.3B: Changes in length of cell cycle during aging for WT (left, black solid curve), the synthetic oscillator strain (right, dark grey solid curve), the oscillator cells that deviated from oscillations (left dashed curve), and the oscillator cells with sustained oscillations (right dashed curve). Shaded areas represent standard errors of the mean (SEM). FIG. 3C: The life-span curves for WT and the synthetic oscillator strains were scaled by the median. The CV of lifespans among cells was calculated for WT and the synthetic oscillator strain. FIG.3D: The histograms represent distributions of cell cycle lengths at different stages of aging for WT and the synthetic oscillator strain. Experiments were independently performed at least three times. FIG.3E: Replicative lifespans of WT and the alternative oscillator strain NH1524 are shown. FIGS.4A-4C. The synthetic oscillator maintained a balance between rDNA silencing and heme biogenesis. FIG.4A: Single-cell color map trajectories of rDNA- GFP (top) and nuclear-anchored iRFP (bottom) in WT aging cells (n = 83). Each row represents the time trace of a single cell throughout its life span. Color represents the fluorescence intensity as indicated in the color bar. Color maps for rDNA-GFP and iRFP are from the same cells with the same top-to-bottom order. Cells were classified into two groups. Those in the top half of the color maps are WT cells that showed continuous high GFP and iRFP signals, which indicated rDNA silencing–loss and high heme abundance at the later stage of life span. These cells also produced elongated daughters at the later stage of life span and were previously designated as “mode 1” aging (34). Those in the bottom half of the color maps are WT cells that
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 showed constantly or gradually decreased GFP fluorescence and sharply decreased iRFP fluorescence, which indicated high rDNA silencing and heme depletion at the late stage of aging. These cells produced small round daughters throughout the life span, previously designated as “mode 2” aging (34). FIG.4B: Single-cell color map trajectories of rDNA-GFP (top) and nuc. iRFP (bottom) in aging cells of the synthetic oscillator strain (n = 64). Color maps for rDNA-GFP and iRFP are from the same cells. Color maps used the same color bars as those in FIG.4A. FIG.4C: Bar graphs show continuous times of the rDNA silencing–loss or heme-depletion state for WT (left) and the synthetic oscillator strain (right). Each bidirectional bar represents a single cell, in which the upward portion indicates its continuous time of the rDNA silencing–loss state, and the downward portion indicates the continuous time of the heme depletion-state. The graphs were quantified using the data from FIGS.4A-4B, and FIG.18. Experiments were independently performed at least three times. FIGS.5A-5B. Representative time-lapse images of WT cells with divergent aging processes. FIG.5A: Time-lapse images of a mother cell aging with rDNA silencing loss, previously designated as “mode 1” aging (34). FIG.5B: Time-lapse images of a mother cell aging with heme depletion, previously designated as “mode 2” aging (34). Mode 1 and Mode 2 cells were classified based on their age-dependent changes in their daughter morphologies (Mode 1 – elongated daughters; Mode 2 – smaller round daughters) and dynamics of iRFP fluorescence (34, 55). Time-lapse images are shown for (top) Phase, (middle) rDNA-GFP, and (bottom) nuc. iRFP of the same cells. Replicative age of the mother cell is shown at the top left corner of each image. For phase images, aging and dead mother cells are marked by light grey and dark grey arrows, respectively. In fluorescence images, aging and dead mother cells are circled. FIGS.6A-6C. A mathematical model of the gene oscillator circuit. FIG.6A: Diagram of the gene oscillator model with a synthetic negative feedback loop. FIG. 6B: Ordinary differential equations of the gene oscillator model. FIG.6C: Example of sustained oscillations in Sir2 and HAP from model simulation. FIGS.7A-7B. Exploration of the parameter regime that favored oscillation. FIG.7A: Boxplots show the ranges of parameter values that generated oscillation
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 (grey) vs no oscillation (black). The Monte Carlo method was used to explore parameter regimes for the model from FIG.6. Specifically, 1 million different sets of parameter values were randomly generated and were categorized into two groups - the ones that generated sustained oscillation and the ones that do not generate sustained oscillation. For each parameter, the grey boxplot shows the range of parameter values from the parameter group that generate oscillations and the black boxplot shows the range of parameter values from the group that do not generate oscillations. The left two columns show the parameters that governed the synthetic negative feedback loop. The right column shows the parameters that governed mRNA/protein production and degradation. FIG.7B: Bifurcation plots show the dependence of oscillations on key parameters identified from the Monte Carlo method. Top: the plot shows how oscillations depended on the strength of SIR2 induction by HAP (aS) and the capacity of HAP transcription (aH). Middle: the plot shows the how oscillations depended on the basal expression of SIR2 (aS0). Bottom: the plot shows how oscillations depended on the basal expression of HAP upon full Sir2-mediated repression (leakiness from Sir2-mediated transcriptional repression of HAP) (aH0). FIGS.8A-8D. Effects of the mCherry tag to Sir2 and the rDNA-GFP reporter on yeast aging and growth. FIG.8A: Replicative lifespans of WT with (+) rDNA-GFP and with (+) mCherry tag to Sir2 (n=131), WT with (+) rDNA-GFP and without (-) mCherry tag to Sir2 (n=109), WT without (-) rDNA-GFP and with (+) mCherry tag to Sir2 (n=107), and WT without (-) rDNA-GFP and without (-) mCherry tag to Sir2 (n=121) are shown. FIG.8B: Age-dependent changes of cell cycle length in WT with (+) rDNA-GFP and with (+) mCherry tag to Sir2, WT with (+) rDNA-GFP and without (-) mCherry tag to Sir2, WT without (-) rDNA-GFP and with (+) mCherry tag to Sir2, and WT without (-) rDNA-GFP and without (-) mCherry tag to Sir2 are shown. FIG.8C: Single-cell color map trajectories of rDNA- GFP (top) and nuclear- anchored iRFP (bottom) for WT with (+) rDNA-GFP and with (+) mCherry tag to Sir2 and WT with (+) rDNA-GFP and without (-) mCherry tag to Sir2 are shown. Each row represents the time trace of a single cell throughout its lifespan. Color represents the fluorescence intensity as indicated in the color bar. FIG.8D: Boxplots show the distributions of Sir2 abundance averaged over the lifetimes of single aging
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 cells in WT with Sir2-mCherry, (left) with or (right) without rDNA- GFP. The difference is not significant with p = 0.41 in unpaired t-test. FIG.9. Color map aging trajectories of Sir2-mCherry for WT (n=93) and the synthetic strain (n=113). Each row represents the time trace of a single cell throughout its lifespan. Color represents the fluorescence intensity as indicated in the color bar. Cells are sorted based on their replicative lifespan (RLS). FIGS.10A-10C. Quantification of the amplitudes and periods of Sir2 oscillatory pulses. FIG.10A: Raw time trace data of Sir2-mCherry in a representative cell to illustrate the process of trace smoothing. Black dots are raw data; the curve is the smoothed time trace. FIG.10B: Illustration of the quantification of the amplitude and period of oscillatory pulses using the representative time trace from FIG.10A: Peaks (downward triangle) and valleys (upward triangle) were determined using iPeak (from MathWorks File Exchange). Dashed line represents the baseline which connects all valleys. The amplitude (Amp) of a pulse was calculated as the distance from the peak to the point crossed by the vertical line from the peak to the baseline. The period (T) of a pulse was calculated as the time span between two valleys. FIG. 10C: Left: Bar graph shows the amplitudes of each pulse in the time trace in FIG. 10B: Only the pulses with amplitudes over the threshold (dash line - 5 times of the average amplitude of fluctuation pulses in WT) were considered as true oscillatory pulses, as opposed to small fluctuations. Right: Bar graph shows the periods of each pulse in the time trace in FIG.10B. FIGS.11A-11B. Spectral analysis of Sir2 oscillations. FIG.11A: Illustration of the power spectral computation using single-cell time traces of (top) a representative oscillator cell and (bottom) a WT cell as examples. The time trace of Sir2-mCherry fluorescence was detrended from raw data (no data smoothing) then Fast Fourier transformed (FFT) and squared. The same parameters were used for both the synthetic oscillator strain and WT. FIG.11B: Average power spectrum for (left) the oscillator strain and (right) WT. Boxplots show the frequency-dependent
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 distributions of power spectrum. The bottom and top of the box are first and third quartiles, respectively. The band inside is the median. FIGS.12A-12C. Stability determination for Sir2 oscillations. FIG.12A: Defining the threshold for deviation from oscillations. The changepoints detection method was performed and the changing ratio (mend/mend-1) was calculated for Sir2- mCherry time trace for each single aging cell from the oscillator strain. The cells with changing ratios larger than 1 were then sorted based on their changing ratios (n=91 out of 113). The changepoints detection method was applied to the resulting changing ratio trajectory across cells to identify the turning point on the trajectory, which served as the threshold (THR; horizontal red dash line) for sustained oscillations vs deviations. FIGS.12B: A representative Sir2-mCherry time trace illustrating the deviation from sustained oscillation with the changing ratio larger than THR. The time trace was separated by the change point into sustained region and deviated region. FIGS.12C: A representative Sir2-mCherry time trace illustrating sustained oscillation with the changing ratio smaller than THR. FIGS.13A-13D. Synthetic Sir2-HAP circuits with broken or weakened feedback interactions. FIG.13A: Diagrams illustrate gene interactions in different versions of the Sir2-HAP circuit. Circuit without HAP-activated expression of Sir2 - SIR2 is expressed under its native promoter and hence is not regulated by HAP. Circuit without Sir2-mediated repression of HAP – HAP4 is expressed under its native promoter and is not inserted at rDNA-NTS. Circuit with a weaker transcriptional capacity of HAP – HAP4 is expressed under the ADH1 promoter, weaker than the oscillator’s TDH3 promoter. FIG.13B: Color map aging trajectories of Sir2-mCherry for the strains carrying the synthetic Sir2-HAP circuit without HAP- activated expression of Sir2 (n=110), without Sir2-mediated repression of HAP (n=103), or with a weaker transcriptional capacity of HAP (n=84). FIG.13C: Proportions of aging cells with different versions of the synthetic circuit that showed sustained oscillation or a deviation from oscillation late in life (late-deviated), or no oscillation. FIG.13D: Power spectral analysis for aging cells with different versions of the synthetic circuit. For FIGS.13C-13D, single-cell data from different strains
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 were processed through the same analytical pipeline used for the oscillator strain in FIG.2D and FIG.11. FIG.14. Sir2 abundance in WT and the oscillator strain. Boxplots show the distributions of Sir2 abundance averaged over the lifetimes of single aging cells in WT and synthetic oscillator strain. The mean Sir2 expression level in WT is 439.7 ± 117.6 AU. The mean Sir2 expression level in the oscillator strain is 950 ± 284 AU. FIGS.15A-15C. Comparison of the synthetic oscillator strain with strains constitutively overexpressing SIR2 and HAP4. FIG.15A: Replicative lifespans of WT (n=131), the synthetic oscillator strain (n=120), SIR2 twofold overexpression (2 x SIR2, n=92), HAP4 overexpression (O/E HAP4, n=95), and combined HAP4 overexpression and SIR2 twofold overexpression (O/E HAP4 + 2 x SIR2, n=97) are shown. FIG.15B: Lifespan curves of WT, the synthetic oscillator strain, SIR2 twofold overexpression (2 x SIR2), HAP4 overexpression (O/E HAP4), and combined HAP4 overexpression and SIR2 twofold overexpression (O/E HAP4 + 2 x SIR2), scaled by the median are shown. The Coefficient of Variation (CV) of lifespans was calculated for each strain. FIG.15C: Age-dependent changes of cell cycle length in WT, the synthetic oscillator strain, SIR2 twofold overexpression (2 x SIR2), HAP4 overexpression (O/E HAP4), and combined HAP4 overexpression and SIR2 twofold overexpression (O/E HAP4 + 2 x SIR2) are shown. FIGS.16A-16C. Comparison of the synthetic oscillator strain with strains carrying synthetic Sir2- HAP circuits with broken or weakened feedback interactions. FIG.16A: Replicative lifespans of WT (n=131), the synthetic oscillator strain (n=120), the strain without HAP-activated expression of Sir2 (n=110), the strain without Sir2-mediated repression of HAP (n=103), and the strain with a weaker transcriptional capacity of HAP (n=84) are shown. The genetic circuits of these strains are shown in FIG.13A. FIG.16B: Lifespan curves of WT, the synthetic oscillator strain, the strain without HAP- activated expression of Sir2, the strain without Sir2-mediated repression of HAP, and the strain with a weaker transcriptional capacity of HAP, scaled by the median are shown. The Coefficient of Variation (CV) of lifespans was calculated for each strain. FIG.16C: Age-dependent changes of cell cycle length in WT, the synthetic oscillator strain, the strain without HAP-activated
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 expression of Sir2, the strain without Sir2-mediated repression of HAP, and the strain with a weaker transcriptional capacity of HAP are shown. FIGS.17A-17C. Comparison of the synthetic oscillator strain with long-lived mutants identified in genetic screens. FIG.17A: Replicative lifespans of WT (n=131), the synthetic oscillator strain (n=120), fob1Δ (n=93), sgf73Δ (n=134), sch9Δ fob1 Δ (n=151), and hxk2Δ fob1Δ (n=60) are shown. The lifespan of the synthetic oscillator strain was significantly longer than that of sch9 Δ fob1 Δ (p = 0.0045 with Gehan- Breslow-Wilcoxon test). FIG.17B: Lifespan curves of WT, the synthetic oscillator strain, fob1Δ, sgf73Δ, sch9Δ fob1Δ, and hxk2Δ fob1Δ, scaled by the median are shown. The Coefficient of Variation (CV) of lifespans was calculated for each strain. FIG.17C: Age-dependent changes of cell cycle length in WT, the synthetic oscillator strain, fob1Δ, sgf73Δ, sch9Δ fob1Δ, and hxk2Δfob1 Δ are shown. FIGS.18A-18B. Quantification of the continuous times at the rDNA silencing loss or heme depletion state. FIG.18A: Representative time traces of rDNA-GFP in WT (left) and the synthetic oscillator strain (right) illustrate the quantification of the continuous times at the rDNA silencing loss state for each single aging cell. The threshold (dash line) for the state of rDNA silencing loss was defined as the third quartile (75th percentile) of all the rDNA-GFP fluorescence values measured from WT and synthetic oscillator strain. The portions of time traces above the threshold represent the state of silencing loss. The mean value of the continuous time spans at this state (H1 for WT and H1-5 for the synthetic oscillator, respectively) was calculated for each single aging cell. FIG. 18B: Representative time traces of nuc. iRFP in WT (left) and the synthetic oscillator strain (right) illustrate the quantification of the continuous times at the heme depletion state for each single aging cell. The threshold (dash line) for the state of heme depletion was defined as the first quartile (25th percentile) of all the nuc. iRFP fluorescence values measured from the WT and synthetic oscillator strains. The portions of time traces below the threshold represent the state of heme depletion. The mean value of the continuous time spans at this state (L 1 for WT and L 1 for the synthetic oscillator) was calculated for each single aging cell.
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Continuous times at the silencing loss state and the heme depletion state are shown for each single aging cell in FIG.4C. FIG.19. Bar graphs show the continuous durations (as percentage of the lifetime) of single cells at the rDNA silencing loss or heme depletion state for (left) WT and (right) the synthetic oscillator strain. Each bidirectional bar represents a single cell, in which the upward portion indicates its continuous duration of the rDNA silencing loss state and the downward portion indicates the continuous duration of the heme depletion state, as percentages of its lifetime. The graphs were generated using the data in FIG.4C. Continuous times for each cell were normalized by its lifetime to facilitate the comparison among strains with different lifetimes. FIGS.20A-20C. Synthetic Sir2-HAP circuits with broken or weakened feedback interactions are less able to maintain the balance between rDNA silencing and heme biogenesis. FIG.20A: Diagrams illustrate the synthetic Sir2-HAP circuits with broken or weakened interactions. FIG.20B: Single-cell color map trajectories of rDNA-GFP (top) and nuclear-anchored iRFP (bottom) in cells carrying the synthetic Sir2-HAP circuits without HAP-activated expression of Sir2 (n=110), without Sir2- mediated repression of HAP (n=103), and with a weaker transcriptional capacity of HAP (n=84) are shown. FIG.20C: Bar graphs show continuous durations (as percentage of the lifetime) of single cells at the rDNA silencing loss or heme depletion state for strains carrying the synthetic Sir2-HAP circuits without HAP- activated expression of Sir2, without Sir2-mediated repression of HAP, and with a weaker transcriptional capacity of HAP are shown. FIG.21. Scatter plot shows the mean lifespan versus coefficient of variance (CV) of lifespans for all the strains tested in this study. Data are from FIGS.15 - FIGS.17. FIGS.22A-22B. Strains constitutively overexpressing SIR2 and HAP4 are less able to maintain the balance between rDNA silencing and heme biogenesis. FIG. 22A: Single-cell color map trajectories of rDNA-GFP (top) and nuclear-anchored iRFP (bottom) in cells with HAP4 overexpression (O/E HAP4, n=95), SIR2 twofold overexpression (2 x SIR2, n=92), and combined HAP4 overexpression and SIR2 twofold overexpression (O/E HAP4 + 2 x SIR2, n=97) are shown. FIG.22B: Bar
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 graphs show continuous durations (as percentage of the lifetime) of single cells at the rDNA silencing loss state or the heme depletion state for O/E HAP4, 2 x SIR2, and O/E HAP4 + 2 x SIR2. FIGS.23A-23B. Illustrations of strain construction. FIG.23A: Diagram illustrates the steps for replacing the native SIR2 promoter by P CYC1 . FIG. 23B: Diagram illustrates the steps for constructing the single-copy rDNA-GFP reporter. DETAILED DESCRIPTION Cellular aging is a fundamental and complex biological process that is an underlying driver for many diseases (20). Genomic sequencing has generated a huge body of knowledge that defines molecular components and interactions within gene networks that control such cellular functions. However, further advances in understanding how these networks confer biological functions have been hindered by the complexity of related regulatory interactions (1). One strategy in synthetic biology is to build simple orthogonal networks analogous to the core parts of natural systems that can be used to uncover key design principles of biological functions embedded in sophisticated network connections (2, 3). For example, synthetic networks have been constructed to enable specific dynamic behaviors or functions, such as toggle switches, genetic oscillators, cellular counters, homeostasis, and multistability (4–12). Synthetic biology is a powerful approach to rewire and perturb intricate endogenous networks and to interrogate the relationship between network structure and cellular functions (e.g., cellular aging) (3, 13–19). The methods and materials herein discloses an oscillatory gene network that can effectively promote cellular longevity. Existing genetic approaches slow cellular aging by simply overexpressing or deleting aging-related genes. The present methods and materials show that engineering a synthetic gene oscillator by rewiring the endogenous Sir2-HAP circuit into a feedback loop can slow the cellular aging. In addition, modifying the genetic interactions between Sir2 and HAP4 resulted in altered temporal dynamics of their expression which enhanced homeostasis in processes that drive aging. This synthetic system is advantageous in its robustness and effectiveness on life-span extension over longevity mutants from genetic screens and simple over expression of Sir2, HAP, or both. The overexpression of longevity factors such as Sir2 or HAP led to variations in gene expression that inevitably drive cell fate
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 commitment and deterioration in a fraction of cells leading to short-lived cell subpopulations (34). The present methods and materials demonstrate that the synthetic gene oscillator developed by genetically rewiring the endogenous Sir2-HPA circuit into a negative feedback loop induced periodic oscillations between nucleolar and mitochondrial aging processes in yeast cells, thereby significantly extending their lifespan. Such oscillations enable a dynamic balance in Sir2 and HAP expression during cellular aging and delays committing to aging. Thus, the synthetic gene oscillator described herein can effectively promote longevity in animals. Cellular Aging Aging is a natural and a complex biological process that has been a focal point of research due to its implications in health, disease, and overall lifespan. Replicative aging of the yeast Saccharomyces cerevisiae has been shown to be a genetically tractable model for the aging of mitotic cell types such as stem cells and has led to identification of well-conserved genetic factors that influence longevity in eukaryotes (21-26). For example, the lysine deacetylase Sir2 and heme-activated protein (HAP) complex are deeply conserved and well-characterized transcriptional regulators that control yeast aging and life span. Isogenic wild-type yeast cells age toward two discrete terminal states (34): one with decreased rDNA silencing (light grey dots FIG. 1A and FIG.5A), which leads to nucleolar enlargement and fragmentation (34), and another with decreased heme abundance (FIG.1A and FIG.5B) which causes mitochondrial aggregation and dysfunction (34). Sir2 mediates chromatin silencing at ribosomal DNA (rDNA) to maintain the stability of this fragile genomic locus and the integrity of the nucleolus (27–30). HAP regulates the expression of genes that are important for heme biogenesis and mitochondrial function (31). Cells The methods and materials described herein can be used to modulate cellular aging processes, extend the lifespan of a cell, slow age-related decline, or age-induced cell deterioration and/or promote longevity effects in a cell. In some embodiments, the cell is a eukaryotic cell. For example, the cell can be an animal cell, a plant cell, a fungus cell, or a protist cell. In some embodiments, the fungus cell is a yeast. For example, the yeast can be Saccharomyces cerevisiae, Saccharomyces boulardii,
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Saccharomyces pastorianus, Pichia pastoris, Pichia angusta, Kluyveromyces lactis, Kluyveromyces marxianus, Rhodotorula graminis, or Yarrowia lipolytica. In some embodiments, the yeast is a saccharomyces cerevisiae. In some embodiments, the yeast is a Saccharomyces cerevisiae strain identified in Table 1, or the yeast strain includes one or more plasmids as identified in Table 2. In some cases, the yeast is an engineered yeast strain comprising NH1574 and/or NH1524. In some cases, the animal cell is a human cell, mouse cell, rat cell, other rodent cell, rabbit cell, dog cell, cat cell, swine cell, cattle cell, sheep cell, horse cell, or primate cell. In other cases, the protist cell is an alga cell. The Synthetic Oscillator Provided herein are cells (e.g., yeast) comprising a synthetic SIR2-HAP circuit construct including (a) a polynucleotide encoding a HAP-inducible promoter operably linked to SIR2, and (b) a polynucleotide encoding a strong constitutive promoter operably linked to HAP4. In some embodiments, the polynucleotide is a DNA or an RNA. The HAP-inducible promoter operably linked to SIR2 can include a CCAAT nucleotide sequence in an upstream activation sequence (UAS). In some embodiments, the HAP-inducible promoter operably linked to SIR2 includes CYC1 or COX5a. The strong constitutive promoter operably linked to HAP4 can include Triose-phosphate dehydrogenase 3 (TDH3), TEF1, PGK1, CCW12, ADH1, or ENO2. In some cases, the strong constitutive promoter operably linked to HAP4 is TDH3. In some embodiments, a mutual inhibition circuit of Sir2 and HAP resembles a toggle switch that can drive cellular fate decisions and commitment to either of these two detrimental states, contributing to cell deterioration and aging. In some embodiments, a polynucleotide encoding a HAP4-inducible promoter operably linked to SIR2 is CYC1. In other cases, a polynucleotide encoding a strong constitute promoter operably linked to HAP4 is TDH3. In some embodiments, the synthetic SIR2-HAP circuit construct can be modeled using ordinary differential equation-based or stochastic differential equation-based mathematical models. In some embodiments, the Sir2-HAP circuit construct is rewired into a negative feedback loop. The synthetic SIR2-HAP circuit construct can slow cell aging by periodically cycling between the two aging paths and can prevent prolonged commitment of the cell (e.g., yeast) to either the silencing or heme depletion state. In
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 some embodiments, activation of the synthetic SIR2-HAP negative feedback loop in the cell generates a periodic oscillation in the abundance of the SIR2 gene product (e.g., protein) and the HAP4 gene product (e.g., protein), delaying the cell’s commitment to an aging pathway (e.g., nucleolar enlargement and fragmentation or mitochondrial aggregation and dysfunction). In some embodiments, the polynucleotide (e.g., DNA) encoding a strong constitutive promoter (e.g., TDH3) operably linked to HAP4 is inserted at an rDNA locus or a silent HML locus in the cell. In some cases, the HAP-inducible promoter (e.g., CYC1) is transcriptionally induced by the HAP4 gene product. The polynucleotide encoding a strong constitutive promoter (e.g., TDH3) can be transcriptionally repressed by the SIR2 gene product. In some embodiments, the engineered yeast strain NH1574 comprises a polynucleotide encoding a strong constitutive promoter operably linked to HAP4 is inserted at an rDNA locus. In some embodiments, the engineered yeast strain NH1524 comprises a polynucleotide encoding a strong constitutive promoter operably linked to HAP4 is inserted at a silent HML locus. The HAP-inducible CYC1 promoter can include PCYC1. The strong constitutive TDH3 promoter can include PTDH3. In some cases, the polynucleotide encoding a HAP-inducible CYC1 promoter operably linked to SIR2 further comprises a fluorescence marker. The fluorescence marker can be mCherry, green fluorescent protein (GFP), yellow fluorescent protein (YFP), or red fluorescent protein (RFP). For example, SIR2 can be C-terminally tagged with mCherry. Method of Use The methods and materials described herein (e.g., the cells and/or circuits described herein) include methods for slowing age-related decline. In some embodiments, the age related decline is caused by nucleolar enlargement and degradation or mitochondrial aggregation and dysfunction. Provided herein are methods and materials for modulating cellular aging in a cell (e.g., yeast cell), the method including introducing into the cell a synthetic SIR2- HAP circuit construct (e.g., a polynucleotide encoding a HAP-inducing CYC1 promoter operably linked to SIR2, and a polynucleotide encoding a strong constitutive TDH3 promoter operably linked to HAP4). Also provided here are methods and materials for modulating cellular aging in a cell, the method comprising introducing a
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 synthetic gene oscillator into the cell, thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. In some embodiments, the methods and materials described herein slows age-related nucleolar and mitochondrial deterioration. In some embodiments, the methods and materials described herein are effective to prevent aging cells from committing to either the nucleolar deterioration or mitochondrial dysfunction state. Modulating cellular aging can include slowing down age-related decline, age-induced cell deterioration, or promoting longevity factors. Also provided herein are methods and materials of extending the lifespan of a cell (e.g., yeast), the method including introducing a synthetic gene oscillator into the cell, thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. Nucleolar cellular aging process can include nucleolar enlargement and fragmentation. Mitochondrial cellular aging process can include mitochondrial aggregation and/or dysfunction. Periodic oscillation can enable a dynamic balance in Sir2 and HAP during aging, avoiding a prolonged duration or cell-fate commitment to either rDNA silencing-loss or a heme-depletion state, and can thus slow down cell deterioration and can extend life span. In some embodiments, the oscillator includes a first genetic construct (e.g., SIR2) for modulating nucleolar aging processes, and a second genetic construct (e.g., HAP4, HAP1, HAP2) for modulating mitochondrial aging processes, wherein the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct. In some embodiments, the cells and/or engineered circuits described herein can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) by about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to wild type cells. In some embodiments, the methods and materials provided herein (e.g., the cells and/or engineered circuits) can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) between about 60% and about 90%, about 60% and about 65%, about 60% and about 70%, about 60% and about 75%, about 60% and about 80%, about 60% and about 85%, about 85% and about 65%, about 85% and about 70%, about 85% and about 75%, about 85% and about 80%, about 80% and about 65%, about 80% and about 70%, about 80% and
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 about 75%, about 75% and about 65%, about 75% and about 70%, or about 70% and about 65% compared to a wild type cells. The cells and/or engineered circuits described herein include cells with sustained oscillations. As used herein, “sustained oscillations” can include an oscillation over the majority of the lifespan of the cell. In some cases, sustained oscillations in the cell can be effective to extend the lifespan of the cell by about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% compared to wild type cells. In some embodiments, the sustained oscillations provided herein can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) between about 50% and about 150%, about 50% and about 135%, about 50% and about 125%, about 50% and about 115%, about 50% and about 105%, about 60% and about 150%, about 60% and about 135%, about 50% and about 115%, about 60% and about 105% compared to a wild type cell. For example, the sustained oscillations in the cell can extend the lifespan of a cell by about 90% to about 125% compared to wild type cells. The engineered cells described herein include cells with deviated oscillations. As used herein, “deviated oscillations” can include an oscillation over the majority of the lifespan of the cell, and wherein the cell accumulates an increasing amount of Sir2 gene product leading to nucleolar enlargement and degradation. In some cases, deviated oscillations in the cell can be effective to extend the lifespan of the cell by about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, or about 65% compared to wild type cells. In some embodiments, the deviated oscillations provided herein can be effective to extend the lifespan of a cell (e.g., an engineered yeast strain expressing Sir2-HAP oscillator circuit) between about 10% and about 60%, about 10% and about 50%, about 15% and about 65%, about 15% and about 55%, about 20% and about 50%, about 25% and about 50%, or about 30% to about 55% compared to wild type cells. For example, cells with deviated oscillations can extend the lifespan of a cell by about 30% to about 50% compared to the wild type cells. In some instances, the methods and materials described herein can be effective to increase the cell cycle rate of a cell (e.g., engineered yeast strain expressing Sir2-
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 HAP oscillator circuit) by about 10% to about 90%, about 10% to about 70%, about 10% to about 50%, about 10% to about 30%, about 30% to about 90%, about 30% to about 70%, about 30% to about 50%, about 50% to about 90%, about 50% to about 70%, or about 70% to about 90% compared to wild type cells. For example, sustained oscillations in the cell can be effective to retain a fast cell cycle rate of about 70 to about 90 minute per cell cycle throughout the entire life span. EXAMPLES The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. Example 1: Methods and Materials Strain and plasmid construction Standard protocols were used for molecular cloning. All yeast strain used in this study were constructed based on BY4741 (MATa his3Δ^ leu2Δ0 met15Δ0 ura3Δ0). Details of strains, plasmids, and primers are included in Tables 1-3. To make the plasmid for replacing the native SIR2 promoter by PCYC1 (NHB1075), Gibson Assembly (NEB) was used with a 451 bp DNA fragment that is 468 bp upstream of the SIR2 start codon (F1), URA3 from pRS306 plasmid (F2), a 501 bp DNA fragment that is 410 bp upstream from the SIR2 start codon (F3), the CYC1 promoter (F4: 468 bp), a 474 bp fragment of the SIR2 open reading frame (ORF) starting from the start codon (F5), a fragment from pRS306 containing an autonomously replicating sequence (ARS) and ampicillin resistance gene (F6), to yield the plasmid NHB1075 (FIG.23A). To make the plasmid for the single-copy rDNA-GFP reporter (NHB0730), a DNA fragment containing the unique sequence at the left edge of the rDNA region (52) and an XhoI restriction site at 5’ end (F7), a 680 bp fragment of the TDH3 promoter (F8), a 717 bp GFP ORF (F9), a 420 bp DNA fragment that is 196 bp downstream from the left edge of the rDNA region (F10), the URA3 expression cassette (F11), the F10 fragment with a BamHI restriction site (F12), were assembled together with F6 to make the plasmid (NHB0730) (FIG.23B). To make the plasmid for integration of PTDH3-HAP4 or PADH1-HAP4 fragment into the non- transcribed spacer 1 (NTS1) at the rDNA region, the PTDH3-GFP fragment of the rDNA-GFP reporter (NHB0200) (32) was replaced by PTDH3-HAP4 or
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 PADH1-HAP4 by Gibson assembly, yielding the plasmid NHB1048 and NHB1333, respectively. The HindIII (AAGCTT) restriction site at HAP4 ORF was synonymously mutated to ATGCTT, so that the plasmid has a unique HindIII site located within the NTS1 homologous part of the plasmid for further linearization and integration into the rDNA region in the genome. The synthetic oscillator strain NH1574 was constructed by following 5 steps: 1, In the WT strain with nuc. iRFP (NH0263), mCherry-LEU2 was amplified by PCR and integrated at the C-terminus of SIR2 by homologous recombination to create the SIR2-mCherry strain (NH1378) ; 2, To replace the native SIR2 promoter with PCYC1, the strain NH1378 was transformed with the DNA fragment F1-F5 amplified by PCR from NHB1075 to replace PSIR2 with fragment containing F1-F4, URA3 was replaced through homologous recombination of F1 and F3, and the strain was selected on 5’- FOA plate to create the PCYC1-SIR2-mCherry strain (NH1382) (FIG.23A); 3, In the strain NH1382, the HAP4 ORF was replaced by HIS3 by homologous recombination (NH1391); 4, The strain NH1391 was transformed with the DNA fragment F7-F12 from NHB0730 by BamHI and XhoI digestion. URA3 was removed through homologous recombination of F10 and F12 with selection on 5’-FOA to incorporate the single-copy rDNA-GFP reporter (NH1571) (FIG.23B); 5, The strain NH1571 was transformed with NHB1048 linearized by HindIII digestion at the NTS1 homologous part of the plasmid to insert PTDH3-HAP4 into the rDNA region, creating the synthetic oscillator strain NH1574. The synthetic oscillator strain NH1524 was constructed as follows: polynucleotide construct with HAP4 under the TDH3 promoter was inserted at the silent HML locus between E and I elements by replacing HMLalpha1/2 genes. The endogenous promoter of SIR2 was replaced by an enhanced pCYC1 promoter (pCYC1-2UP), which was modified by inserting two copies of Hap4 binding sequence between pCYC1 UAS and the minimal pCYC1promoter to increase the efficiency of HAP4 activation. To make the strain with two copies of SIR2 (NH1855), NH1545 was transformed with SphI digested plasmids from NHB0638; To make the strain of O/E HAP4 (NH1857), NH1545 was transformed with BsmI digested plasmids from NHB0659; To make 2x SIR2 + O/E HAP4 strain (NH1802), NH1545 was
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 transformed with BsmI digested plasmids from NHB0659 and SphI digested plasmids from NHB0299 sequentially. To make the strain without negative feedback loop, NH1382 was transformed HindIII digested plasmid from NHB0730. To make the strain without feedforward loop, the very basic strain (NH268) was firstly transformed with BamHI and XhoI double digested plasmid from NHB0730 to make single copy rDNA reporter strain (NH1545); HAP4 was deleted in NH1545 to make NH1725 and SIR2 was then tagged with mCherry to make NH1851; finally, NH1851 was transformed with HindIII digested plasmid from NHB1048. To make the strain with weak feedforward loop, NH1571 was transformed with HindIII digested plasmid from NHB1333. To make fob1 Δ sch9 Δ double mutants, the URA3 and HIS3 fragments were amplified from pRS306 and pRS303, respectively, to replace the FOB1 and SCH9 ORFs in WT, respectively, by homologous recombination. The processes for making other single or double mutants were the same as described above. All transformations were performed with the standard lithium acetate method, and integration was confirmed by PCR. Table 1. Exemplary yeast strains Strain Name Description NH0268 BY4741 MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 NHP6a-iRFP-
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Strain Name Description BY4741 MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0, NHP6a-iRFP- k nMX P -SIR2-mCh rr -LEU2 h 4 Δ HIS3 NTS1 -P 3- - y-
Table 2. Exemplary plasmids Plasmid Name Description
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 NHB0638 pRS303-P SIR2 -SIR2 NHB0659 pRS303-P TDH3 -HAP4 NHB0730 ZZ-rDNA-GFP-re orter20-URA3 (for sin le co rDNA
Primer Sequence (5'-3') Description ir2 s r2 1 1 2 2 3 3 4 4
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Primer Sequence (5'-3') Description Sir2dw@p CACTAAATTAATAATGACCATCCC Forward primer for F5 5 6 6 7- 7-8 9
. p Parameter Value Description ^S 30.5 h-1 Rate constant of Sir2 transcription of f - -
Computational modeling For the synthetic oscillator, the circuit is described as the following delay differential equations (DDEs):
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 protein and
protein, respectively. For plotting the phase plane in FIG.1B, the same deterministic model was used for the Sir2- HAP toggle switch circuit, as described elsewhere (34). For plotting the phase plane in FIG.1C, the synthetic oscillator circuit is described by two delay differential equations from the semi-stable equilibrium of equation (1) and (2). Basically, assuming mRNA transcription is a fast process, so that both dmS dmH dt and dt equal 0. Then (1) and (2) become:
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Parameters, except two new parameters τH and τS, were used with the same values as those used in the ordinary differential equations (ODEs) in FIG.6 to generate oscillations (Table 4). The Monte Carlo method for parameter exploration The physiological ranges of parameter values for the ODE model of the synthetic oscillator (FIG.6B) were roughly estimated based on the information of gene expression and protein concentrations from SGD (www.yeastgenome.org/). One million different sets of parameter values were randomly generated within physiological parameter ranges and were tested for oscillation generation. For oscillation identification, the method described previously in Pušnik’s work was used (53). Specifically, to eliminate the possibility of damped oscillation, only the last 50% of the time trace from each simulation were taken into consideration. Fast Fourier Transformation (FFT) was used to transfer the signal to the frequency domain, in which the indexes of peaks (Pi) were recorded. The oscillation occurs if the cost function of the vector of parameters meets such criteria:
signal in the frequency domain at frequency Pi of the i-th peak, ^^ is standard deviation for the i-th peak in the neighboring window of size 1 (^^=1), ^^ is the vector of candidate parameters, C0 is the threshold for categorizing candidates as oscillation or not. Since a large pulse could also generate a “fat” peak in the frequency domain, a narrow window was used to promote sharp peaks, avoiding such a scenario. For each parameter, all parameter values that gave rise to oscillation were recorded and showed in the grey boxplots in FIG.7A, whereas the values that failed to generate oscillation were shown in the black boxplots. About 0.3% of the 1 million parameter sets tested generated oscillations. Bifurcation diagram To investigate the dependence of oscillation on the parameters identified using the Monte Carlo method, bifurcation analysis was performed with MatCont (54). The parameter values are listed in Table 4 and the values of parameters of interest were changed with other parameters fixed (FIG.7B).
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Setting up microfluidic experiments The microfluidic devices and experimental setup were described elsewhere (32, 34, 47, 55, 56). Yeast cells were inoculated into 2 ml of synthetic complete medium (SD, 2% glucose) and cultured overnight at 30℃. From this culture, 2µl of the saturated culture was diluted into 20 mL of fresh SD medium until its OD600 reached ~ 0.9. The chip containing four microfluidic devices was placed under vacuum for 20 minutes. Meanwhile, 50 mL of SD medium with 0.04% Tween-20 (Sigma) was filled into a 60 ml syringe (Luer-Lok Tip, BD) to which plastic tubing (TYGON, ID 0.020 IN, OD0.060 IN, wall 0.020 IN) was connected. After vacuum, the device was quickly connected to the prepared syringe through plastic tubing from its inlet port. The outlet of the microfluidic device was also connected to plastic tubing. The chip with inlet and outlet connected was then fixed onto the motorized stage of the microscope ready for cell loading. For cell loading, cells were transferred into a 60 ml syringe with plastic tubing connected. The media supply tubing into the inlet was then replaced with the tubing connected to the cell loading syringe. The flow of medium in the device was maintained by gravity to drive cells into traps. After loading, the media supply syringe and tubing were switched back to the inlet of the device. Heights of all tubing were adjusted to make the height difference around 240 cm. Tween-20 is a non-ionic surfactant that helps reduce cell friction on the PDMS of the chip. Low concentration of Tween-20 has been shown to have no significant effect on cellular lifespan or physiology (32). Time-lapse microscopy Time-lapse microscopy experiments were conducted using a Nikon Ti-E inverted fluorescence microscope with an EMCCD camera (Andor iXon X3 DU897). The light source was a spectra X LED system. Images were taken using a CFI plan Apochromat Lambda DM 60X oil immersion objective (NA 1.40 WD 0.13MM). In all experiments, the images were acquired for each fluorescence channel every 15 minute for a total of 90 to 110 hours. The exposure and intensity setting for each channel were set as follows: Phase 50 ms, GFP 3 ms at 10% lamp intensity with an EM Gain of 50, mCherry 90 ms at 10% lamp intensity with an EM Gain of 200, and iRFP 300 ms at 15% lamp intensity with an EM Gain of 300.
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Quantification of single-cell aging traces Image processing was conducted using a custom MATLAB code (32, 34). The background of images from each fluorescence channel were subtracted. Cell nuclei were masked by thresholding iRFP or Sir2-mCherry signal. The mean intensity value of the top 40% of the pixels of fluorescence reporters was quantified, as described elsewhere (32, 34). The time traces of reporters were smoothed using MATLAB function smooth data with specification of the Gaussian method through a 15-element sliding window (FIG. 10A). To plot the cell cycle length changes as a function of the percentage of lifetime, the vector of cell cycle length was interpolated to a new vector of 100 elements at evenly distributed 100 query points. For single cell aging dynamics and replicative lifespan (RLS) analyses, data were collected from at least 3 independent experiments. Any cells showing obvious abnormal morphologies upon cell loading were filtered out for RLS analysis. Any cells showing dislocation of reporter mask were filtered out for time trace analysis but included in RLS analysis. Significant numbers for RLS changes were calculated with Gehan-Breslow-Wilcoxon test by using Prism GraphPad 7 (GraphPad Software, CA). Quantification of the amplitude and period of Sir2 oscillatory pulses Peaks (Pi) and valleys (Vi) of oscillations of Sir2 trajectories for each single cell were identified by iPeak (from MathWorks File Exchange), where i denotes the i-th peak or valley. The baseline was formed by connecting all valleys with the polyline (FIG.10B, black dashed line). The amplitude (Ai) was measured as the vertical distance from Pi to the baseline between Vi-1 and Vi (FIG.10B). To define the peaks of oscillation, only the peaks with an amplitude at least five times higher than the average amplitude of fluctuation pulses in WT cells were considered as the “oscillatory pulses” that came from the synthetic oscillation circuit (FIGS.10B-10C). The period (Ti) for each oscillatory pulse was measured as the time span between valley Vi-1 and Vi (FIGS.10B-10C). Spectral analysis of Sir2 oscillations Time traces of Sir2-mCherry were detrended (with Matlab function “detrend(x,n), n=2” ) from raw data without smoothing and then Fast Fourier transformed (FFT) and squared (FIG.11A). The power spectrum of an individual time trace was calculated
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 2 |FF ^^ as ^^^^^^ ൌ T൫D t ൯| . Based on the periods of single pulses of oscillator and WT cells
to 23 hours), time traces shorter than 23 hours or deviated before 23 hours were not applied to FFT. To plot average power spectrum for all cells, P(f) of each cell was firstly linear interpolated at 5000 query frequency points which were uniformly distributed along the frequency range. Average power <P(fi)> was then calculated at each query frequency point fi.
Stability determination for Sir2 oscillations In the synthetic oscillator strain, a fraction of the cells showed a deviation from Sir2 oscillation with an abrupt increase of Sir2 level late in their lifespan (FIG.9). To quantitatively determine the stability of Sir2 oscillation for each single cell, the changepoints detection method was applied as described in elsewhere (57, 58). The changepoints were calculated with MATLAB findchangept function. In brief, the time trace of Sir2 (s0:w) was assumed to have a set of K change points Tw={t:0=t0<…< tK- 1<tK=w}, then the function minimizes.
added for each changepoint, and S is the time trace of Sir2 within ^^௧^ and str+1-1. ∆ is the deviation measurement following the cost function. had 1
2 or more changepoints. For each cell, the Sir2 time trace was therefore divided into 2 or more sections by the changepoint(s) where the standard deviation of the trajectory changed the most (FIG.12). The mean of each section was calculated (mi). The ratio for the mean value of the last section divided by that of the next to last section ( mend mend-1 ) was defined as the changing ratio for the Sir2 trace. The cells with changing ratios larger than 1 (n=91 out 113) were sorted based on their changing ratios in an increased order. The changepoints detection method was applied to the resulting changing ratio trajectory across cells to identify the turning point on the trajectory, which served as the threshold
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 (THR; horizontal dash line in FIG.12A) for sustained oscillations versus deviations. The cells with changing ratios above the threshold were considered deviations from the oscillation. Quantification of the continuous times at the rDNA silencing loss or heme depletion state The threshold (dash line in FIG.18A) for the state of rDNA silencing loss was defined as the third quartile (75th percentile) of all the rDNA-GFP fluorescence values measured from WT and synthetic oscillator strain. The portions of time traces above the threshold represented the state of silencing loss (FIG.18A). The mean value of the continuous time spans at this state was calculated for each single aging cell. The threshold (FIG.18B) for the state of heme depletion was defined as the first quartile (25th percentile) of all the nuc. iRFP fluorescence values measured from the WT and synthetic oscillator strains. The portions of time traces below the threshold represented the state of heme depletion (FIG.18B). The mean value of the continuous time spans at this state was calculated for each single aging cell. Continuous times at the silencing loss state and the heme depletion state were shown for each single aging cell in FIG.4C. Continuous durations as a percentage of the cell’s lifetime were also calculated to facilitate the comparison among strains with different lifetimes (FIG.19, FIG.20, and FIG.22). References for Example 1 1. R. Milo, S. Shen-Orr, S. Itzkovitz, N. Kashtan, D. Chklovskii, U. Alon, Network motifs: Simple building blocks of complex networks. Science 298, 824–827 (2002). doi:10.1126/science.298.5594.824 Medline 2. M. Elowitz, W. A. Lim, Build life to understand it. Nature 468, 889–890 (2010). doi:10.1038/468889a Medline 3. C. J. Bashor, J. J. Collins, Understanding biological regulation through synthetic biology. Annu. Rev. Biophys.47, 399–423 (2018). doi:10.1146/annurev-biophys- 070816-033903 Medline 4. T. S. Gardner, C. R. Cantor, J. J. Collins, Construction of a genetic toggle switch in Escherichia coli. Nature 403, 339–342 (2000). doi:10.1038/35002131 Medline 5. M. B. Elowitz, S. Leibler, A synthetic oscillatory network of transcriptional regulators. Nature 403, 335–338 (2000). doi:10.1038/35002125 Medline 6. J. Stricker, S. Cookson, M. R. Bennett, W. H. Mather, L. S. Tsimring, J. Hasty, A fast, robust and tunable synthetic gene oscillator. Nature 456, 516–519 (2008). doi:10.1038/nature07389 Medline 7. A. E. Friedland, T. K. Lu, X. Wang, D. Shi, G. Church, J. J. Collins, Synthetic gene networks that count. Science 324, 1199–1202 (2009). doi:10.1126/science.1172005 Medline
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 8. T. Danino, O. Mondragón-Palomino, L. Tsimring, J. Hasty, A synchronized quorum of genetic clocks. Nature 463, 326–330 (2010). doi:10.1038/nature08753 Medline 9. A. Becskei, L. Serrano, Engineering stability in gene networks by autoregulation. Nature 405, 590–593 (2000). doi:10.1038/35014651 Medline 10. R. Zhu, J. M. Del Rio-Salgado, J. Garcia-Ojalvo, M. B. Elowitz, Synthetic multistability in mammalian cells. Science 375, eabg9765 (2022). doi:10.1126/science.abg9765 Medline 11. F. Wu, R. Q. Su, Y. C. Lai, X. Wang, Engineering of a synthetic quadrastable gene network to approach Waddington landscape and cell fate determination. eLife 6, e23702 (2017). doi:10.7554/eLife.23702 Medline 12. M. Tigges, T. T. Marquez-Lago, J. Stelling, M. Fussenegger, A tunable synthetic mammalian oscillator. Nature 457, 309–312 (2009). doi:10.1038/nature07616 Medline 13. C. J. Bashor, A. A. Horwitz, S. G. Peisajovich, W. A. Lim, Rewiring cells: Synthetic biology as a tool to interrogate the organizational principles of living systems. Annu. Rev. Biophys.39, 515–537 (2010). doi:10.1146/annurev.biophys.050708.133652 Medline 14. F. Wu, J. H. Bethke, M. Wang, L. You, Quantitative and synthetic biology approaches to combat bacterial pathogens. Curr. Opin. Biomed. Eng.4, 116–126 (2017). doi:10.1016/j.cobme.2017.10.007 Medline 15. L. Bintu, J. Yong, Y. E. Antebi, K. McCue, Y. Kazuki, N. Uno, M. Oshimura, M. B. Elowitz, Dynamics of epigenetic regulation at the single-cell level. Science 351, 720–724 (2016). doi:10.1126/science.aab2956 Medline 16. A. J. Keung, C. J. Bashor, S. Kiriakov, J. J. Collins, A. S. Khalil, Using targeted chromatin regulators to engineer combinatorial and spatial transcriptional regulation. Cell 158, 110– 120 (2014). doi:10.1016/j.cell.2014.04.047 Medline 17. S. Toda, L. R. Blauch, S. K. Y. Tang, L. Morsut, W. A. Lim, Programming self- organizing multicellular structures with synthetic cell-cell signaling. Science 361, 156–162 (2018). doi:10.1126/science.aat0271 Medline 18. S. Huang, A. J. Lee, R. Tsoi, F. Wu, Y. Zhang, K. W. Leong, L. You, Coupling spatial segregation with synthetic circuits to control bacterial survival. Mol. Syst. Biol.12, 859 (2016). doi:10.15252/msb.20156567 Medline 19. A. H. Ng, T. H. Nguyen, M. Gómez-Schiavon, G. Dods, R. A. Langan, S. E. Boyken, J. A. Samson, L. M. Waldburger, J. E. Dueber, D. Baker, H. El-Samad, Modular and tunable biological feedback control using a de novo protein switch. Nature 572, 265–269 (2019). doi:10.1038/s41586-019-1425-7 Medline 20. A. V. Belikov, Age-related diseases as vicious cycles. Ageing Res. Rev.49, 11– 26 (2019). doi:10.1016/j.arr.2018.11.002 Medline 21. L. Fontana, L. Partridge, V. D. Longo, Extending healthy life span—From yeast to humans. Science 328, 321–326 (2010). doi:10.1126/science.1172539 Medline 22. V. D. Longo, B. K. Kennedy, Sirtuins in aging and age-related disease. Cell 126, 257–268 (2006). doi:10.1016/j.cell.2006.07.002 Medline 23. B. M. Wasko, M. Kaeberlein, Yeast replicative aging: A paradigm for defining conserved longevity interventions. FEMS Yeast Res.14, 148–159 (2014). doi:10.1111/1567-1364.12104 Medline 24. M. Kaeberlein, B. K. Kennedy, Large-scale identification in yeast of conserved ageing genes. Mech. Ageing Dev.126, 17–21 (2005). doi:10.1016/j.mad.2004.09.013 Medline
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 25. C. He, C. Zhou, B. K. Kennedy, The yeast replicative aging model. Biochim. Biophys. Acta Mol. Basis Dis.1864 (9 Pt A), 2690–2696 (2018). doi:10.1016/j.bbadis.2018.02.023 Medline 26. E. D. Smith, M. Tsuchiya, L. A. Fox, N. Dang, D. Hu, E. O. Kerr, E. D. Johnston, B. N. Tchao, D. N. Pak, K. L. Welton, D. E. L. Promislow, J. H. Thomas, M. Kaeberlein, B. K. Kennedy, Quantitative evidence for conserved longevity pathways between divergent eukaryotic species. Genome Res.18, 564–570 (2008). doi:10.1101/gr.074724.107 Medline 27. M. R. Gartenberg, J. S. Smith, The nuts and bolts of transcriptionally silent chromatin in Saccharomyces cerevisiae. Genetics 203, 1563–1599 (2016). doi:10.1534/genetics.112.145243 Medline 28. M. Kaeberlein, M. McVey, L. Guarente, The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev.13, 2570–2580 (1999). doi:10.1101/gad.13.19.2570 Medline 29. K. Saka, S. Ide, A. R. Ganley, T. Kobayashi, Cellular senescence in yeast is regulated by rDNA noncoding transcription. Curr. Biol.23, 1794–1798 (2013). doi:10.1016/j.cub.2013.07.048 Medline 30. D. A. Sinclair, L. Guarente, Extrachromosomal rDNA circles—A cause of aging in yeast. Cell 91, 1033–1042 (1997). doi:10.1016/S0092-8674(00)80493-6 Medline 31. S. Buschlen, J.-M. Amillet, B. Guiard, A. Fournier, C. Marcireau, M. Bolotin- Fukuhara, The S. Cerevisiae HAP complex, a key regulator of mitochondrial function, coordinates nuclear and mitochondrial gene expression. Comp. Funct. Genomics 4, 37–46 (2003). doi:10.1002/cfg.254 Medline 32. Y. Li, M. Jin, R. O’Laughlin, P. Bittihn, L. S. Tsimring, L. Pillus, J. Hasty, N. Hao, Multigenerational silencing dynamics control cell aging. Proc. Natl. Acad. Sci. U.S.A.114, 11253–11258 (2017). doi:10.1073/pnas.1703379114 Medline 33. G. S. Filonov, K. D. Piatkevich, L.-M. Ting, J. Zhang, K. Kim, V. V. Verkhusha, Bright and stable near-infrared fluorescent protein for in vivo imaging. Nat. Biotechnol.29, 757–761 (2011). doi:10.1038/nbt.1918 Medline 34. Y. Li, Y. Jiang, J. Paxman, R. O’Laughlin, S. Klepin, Y. Zhu, L. Pillus, L. S. Tsimring, J. Hasty, N. Hao, A programmable fate decision landscape underlies single-cell aging in yeast. Science 369, 325–329 (2020). doi:10.1126/science.aax9552 Medline 35. J. Olesen, S. Hahn, L. Guarente, Yeast HAP2 and HAP3 activators both bind to the CYC1 upstream activation site, UAS2, in an interdependent manner. Cell 51, 953–961 (1987). doi:10.1016/0092-8674(87)90582-4 Medline 36. L. Guarente, T. Mason, Heme regulates transcription of the CYC1 gene of S. cerevisiae via an upstream activation site. Cell 32, 1279–1286 (1983). doi:10.1016/0092-8674(83)90309-4 Medline 37. S. Hahn, L. Guarente, Yeast HAP2 and HAP3: Transcriptional activators in a heteromeric complex. Science 240, 317–321 (1988). doi:10.1126/science.2832951 Medline 38. C. Li, J. E. Mueller, M. Bryk, Sir2 represses endogenous polymerase II transcription units in the ribosomal DNA nontranscribed spacer. Mol. Biol. Cell 17, 3848–3859 (2006). doi:10.1091/mbc.e06-03-0205 Medline 39. C. M. Gallo, D. L. Smith Jr., J. S. Smith, Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity. Mol. Cell. Biol.24, 1301–1312 (2004). doi:10.1128/MCB.24.3.1301-1312.2004 Medline
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 40. B. Ho, A. Baryshnikova, G. W. Brown, Unification of protein abundance datasets yields a quantitative Saccharomyces cerevisiae proteome. Cell Syst.6, 192– 205.e3 (2018). doi:10.1016/j.cels.2017.12.004 Medline 41. L. Xiong, Y. Zeng, R.-Q. Tang, H. S. Alper, F.-W. Bai, X.-Q. Zhao, Condition- specific promoter activities in Saccharomyces cerevisiae. Microb. Cell Fact.17, 58 (2018). doi:10.1186/s12934-018-0899-6 Medline 42. W. Dang, K. K. Steffen, R. Perry, J. A. Dorsey, F. B. Johnson, A. Shilatifard, M. Kaeberlein, B. K. Kennedy, S. L. Berger, Histone H4 lysine 16 acetylation regulates cellular lifespan. Nature 459, 802–807 (2009). doi:10.1038/nature08085 Medline 43. T. Smeal, J. Claus, B. Kennedy, F. Cole, L. Guarente, Loss of transcriptional silencing causes sterility in old mother cells of S. cerevisiae. Cell 84, 633–642 (1996). doi:10.1016/S0092- 8674(00)81038-7 Medline 44. M. A. McCormick, A. G. Mason, S. J. Guyenet, W. Dang, R. M. Garza, M. K. Ting, R. M. Moller, S. L. Berger, M. Kaeberlein, L. Pillus, A. R. La Spada, B. K. Kennedy, The SAGA histone deubiquitinase module controls yeast replicative lifespan via Sir2 interaction. Cell Rep.8, 477–486 (2014). doi:10.1016/j.celrep.2014.06.037 Medline 45. M. Kaeberlein, K. T. Kirkland, S. Fields, B. K. Kennedy, Sir2-independent life span extension by calorie restriction in yeast. PLOS Biol.2, e296 (2004). doi:10.1371/journal.pbio.0020296 Medline 46. M. Kaeberlein, R. W. Powers 3rd, K. K. Steffen, E. A. Westman, D. Hu, N. Dang, E. O. Kerr, K. T. Kirkland, S. Fields, B. K. Kennedy, Regulation of yeast replicative life span by TOR and Sch9 in response to nutrients. Science 310, 1193–1196 (2005). doi:10.1126/science.1115535 Medline 47. M. Jin, Y. Li, R. O’Laughlin, P. Bittihn, L. Pillus, L. S. Tsimring, J. Hasty, N. Hao, Divergent aging of isogenic yeast cells revealed through single-cell phenotypic dynamics. Cell Syst.8, 242–253.e3 (2019). doi:10.1016/j.cels.2019.02.002 Medline 48. L. Guarente, C. Kenyon, Genetic pathways that regulate ageing in model organisms. Nature 408, 255–262 (2000). doi:10.1038/35041700 Medline 49. M. Kuningas, S. P. Mooijaart, D. van Heemst, B. J. Zwaan, P. E. Slagboom, R. G. J. Westendorp, Genes encoding longevity: From model organisms to humans. Aging Cell 7, 270–280 (2008). doi:10.1111/j.1474-9726.2008.00366.x Medline 50. M. A. McCormick, J. R. Delaney, M. Tsuchiya, S. Tsuchiyama, A. Shemorry, S. Sim, A. C.- Z. Chou, U. Ahmed, D. Carr, C. J. Murakami, J. Schleit, G. L. Sutphin, B. M. Wasko, C.F. Bennett, A. M. Wang, B. Olsen, R. P. Beyer, T. K. Bammler, D. Prunkard, S. C. Johnson, J. K. Pennypacker, E. An, A. Anies, A. S. Castanza, E. Choi, N. Dang, S. Enerio, M. Fletcher, L. Fox, S. Goswami, S. A. Higgins, M. A. Holmberg, D. Hu, J. Hui, M. Jelic, K.-S. Jeong, E. Johnston, E. O. Kerr, J. Kim, D. Kim, K. Kirkland, S. Klum, S. Kotireddy, E. Liao, M. Lim, M. S. Lin, W. C. Lo, D. Lockshon, H. A. Miller, R. M. Moller, B. Muller, J. Oakes, D. N. Pak, Z. J. Peng, K. M. Pham, T. G. Pollard, P. Pradeep, D. Pruett, D. Rai, B. Robison, A. A. Rodriguez, B. Ros, M. Sage, M. K. Singh, E. D. Smith, K. Snead, A. Solanky, B. L. Spector, K. K. Steffen, B. N. Tchao, M. K. Ting, H. Vander Wende, D. Wang, K. L. Welton, E. A. Westman, R. B. Brem, X. G. Liu, Y. Suh, Z. Zhou, M. Kaeberlein, B. K. Kennedy, A comprehensive analysis of replicative lifespan in 4,698 single-gene deletion strains uncovers conserved mechanisms of aging. Cell Metab.22, 895–906 (2015). doi:10.1016/j.cmet.2015.09.008 Medline
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 51. Z. Zhou, zhoutopo/science_aging_model: science, Zenodo (2021); https://doi.org/10.5281/zenodo.7407339. 52. S. W. Buck, J. J. Sandmeier, J. S. Smith, RNA polymerase I propagates unidirectional spreading of rDNA silent chromatin. Cell 111, 1003–1014 (2002). doi:10.1016/S0092- 8674(02)01193-5 Medline 53. Ž. Pušnik, M. Mraz, N. Zimic, M. Moškon, Computational analysis of viable parameter regions in models of synthetic biological systems. J. Biol. Eng.13, 75 (2019). doi:10.1186/s13036-019-0205-0 Medline 54. A. Dhooge, W. Govaerts, Y. A. Kuznetsov, H. G. E. Meijer, B. Sautois, New features of the software MatCont for bifurcation analysis of dynamical systems. Math. Comput. Model. Dyn. Syst.14, 147–175 (2008). doi:10.1080/13873950701742754 55. J. Paxman, Z. Zhou, R. O’Laughlin, Y. Liu, Y. Li, W. Tian, H. Su, Y. Jiang, S. E. Holness, E. Stasiowski, L. S. Tsimring, L. Pillus, J. Hasty, N. Hao, Age- dependent aggregation of ribosomal RNA-binding proteins links deterioration in chromatin stability with challenges to proteostasis. eLife 11, e75978 (2022). doi:10.7554/eLife.75978 Medline 56. R. O’Laughlin, M. Jin, Y. Li, L. Pillus, L. S. Tsimring, J. Hasty, N. Hao, Advances in quantitative biology methods for studying replicative aging in Saccharomyces cerevisiae. Transl. Med. Aging 4, 151–160 (2020). doi:10.1016/j.tma.2019.09.002 Medline 57. M. Lavielle, Using penalized contrasts for the change-point problem. Signal Processing 85, 1501–1510 (2005). doi:10.1016/j.sigpro.2005.01.012 58. R. Killick, P. Fearnhead, I. A. Eckley, Optimal detection of changepoints with a linear computational cost. J. Am. Stat. Assoc.107, 1590–1598 (2012). doi:10.1080/01621459.2012.737745 Example 2: Design of a synthetic oscillator for longevity To track rDNA silencing during aging of wild-type (WT) yeast cells, a green fluorescent protein (GFP) reporter was inserted at the rDNA locus (rDNA-GFP). Its expression and fluorescence reflected the state of rDNA silencing: decreased fluorescence indicated enhanced silencing (32). To track heme abundance, a nuclear- anchored infrared fluorescent protein (nuc. iRFP) was used, the fluorescence of which depended on biliverdin, a product of heme catabolism, and correlated with the abundance of cellular heme (33, 34). To observe these two reporters, microfluidics was coupled with time-lapse microscopy of single cells. Isogenic WT cells aged toward two discrete terminal states (34): one with decreased rDNA silencing (FIG.1A (light grey dots) and FIG.5A), which led to nucleolar enlargement and fragmentation (34), and one with decreased heme abundance (FIG.1A (dark grey dots) and FIG.5B) and hence, mitochondrial aggregation and dysfunction (34). A mutual inhibition circuit of Sir2 and HAP that resembled a toggle switch was identified that drove
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 cellular fate decisions and commitment to either of these two detrimental states, contributing to cell deterioration and aging (34) (FIG.1B). The possibility of altering Sir2-HAP circuit to reprogram aging trajectories toward a longer life span was tested. Specifically, the introduction of a synthetic negative feedback loop between Sir2 and HAP led to sustained oscillations in the abundance of these two factors (FIG.1C). Such periodic cycling could enable a dynamic balance in Sir2 and HAP during aging, avoiding a prolonged duration or cell-fate commitment to either rDNA silencing–loss or a heme-depletion state, and thus slowing cell deterioration and extend life span. A simple computational model was devised to generate design specifications. The model consisted of positive transcriptional regulation of SIR2 by HAP and Sir2- mediated transcriptional repression of HAP, which formed a delayed negative feedback loop (FIGS.6A-6B). With appropriate parameter values, the model generated sustained limit-cycle oscillations (FIG.1C and FIG.6C). Monte Carlo simulations was used to systematically explore the parameter space and to analyze the dependence of sustained oscillatory behaviors on the parameter values (FIG.7A). Oscillations were favored by strong HAP- activated transcription of SIR2, high capacity of transcription of HAP, and tight transcriptional repression of HAP by Sir2 (FIG.7). To enable strong positive transcriptional regulation of SIR2 by HAP, the native promoter of SIR2 was replaced with a CYC1 (Cyto- chrome C1) promoter, which is bound and activated by HAP (35–37). To monitor dynamic behaviors of the engineered circuit, SIR2 was C-terminally tagged with the fluorescent reporter protein mCherry, which did not affect cell growth or aging (FIG.8). To ensure a high capacity for transcription of HAP, a construct was built that contained the HAP4 gene, encoding a major component of the HAP complex, under a strong, constitutive TDH3 (triose- phosphate dehydrogenase 3) promoter. To enable dynamic transcriptional repression of HAP by Sir2, the HAP4 construct was integrated at the nontranscribed spacer (NTS) region within the rDNA, which was subjected to transcriptional silencing mediated by Sir2 (29, 38) (FIG.1D). The endogenous copy of HAP4 was deleted in the synthetic strain to minimize leakiness of HAP4 expression. HAP4 was not tagged with a fluorescent reporter because its protein abundance was below the detection limit of fluorescence microscopy. These regulatory parts were selected
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 based on the model-guided design specifications: The CYC1 promoter and transcriptional silencing at rDNA were selected because both were previously characterized to have low leakiness (36, 39). The TDH3 promoter was selected to drive HAP4 expression because it is one of the strongest constitutive promoters in yeast (40, 41). Example 3: Sustained oscillations during aging Microfluidics coupled with time-lapse microscopy was used to track dynamic changes in Sir2- mCherry fluorescence throughout the life span of single cells. Engineered cells (n = 113) exhibited oscillations in abundance of Sir2 during aging (FIG.2A, FIG.9). WT control cells (n = 93) did not show such oscillations (FIG.2A and FIG.9). The amplitude and period of oscillatory pulses in the engineered cells were quantified (FIG.10). The average amplitude of oscillations was 309 ± 108 arbitrary units (FIG.2B), which was much larger than fluctuations in WT cells (36 ± 30 AU). The average period was 557 ± 151 min (FIG.2C), longer than the typical cell doubling times (~90 to 120 min), which indicated that the oscillations were not driven by cell cycle. Spectral analysis of Sir2 time traces was also performed (FIG.11). For the engineered strain, a spectral power peak was observed around a frequency of 2.33 × 10–5 Hz corresponding to a period of 12 hours. By contrast, the spectrum of WT was flat and white noise–like, without a clear peak (FIG.11B). Oscillations in the synthetic strain were heterogeneous among individual cells. Of the engineered cells, 65% exhibited sustained oscillations throughout their entire lifespans, whereas 35% deviated from oscillations late in their lifespans and showed increased accumulation of Sir2 before cell death (FIG.2D and FIG.12). This deviation could have arisen from an age-induced decrease in Sir2-mediated silencing activity (32, 42, 43) in some cells, which could lead to increased HAP expression from the rDNA locus and in turn, a continuous increase in Sir2 expression driven by HAP. During the process of circuit engineering, versions of the synthetic circuit with broken or weakened feedback interactions were constructed and characterized. These included (i) a circuit without HAP-activated expression of Sir2; (ii) a circuit without Sir2-mediated repression of HAP; and (iii) a circuit with a weaker transcriptional
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 capacity of HAP. None of these circuits enabled sustained oscillations in a major fraction of cells (FIG.13), which demonstrated the importance of connectivity and strength of feedback interactions in generating oscillations. Example 4: The synthetic oscillator extends life span The synthetic oscillator strain showed an 82% increase in life span compared to that of WT control cells (FIG.3A). This was the most pronounced life-span extension in yeast that was observed with genetic perturbations. Among the engineered cells, those aging with sustained oscillations had greater life-span extension (105% increase in life span, doubling that of WT) than those that deviated from oscillations late in life (45% increase relative to that of WT) (FIG.3A, right versus left dashed curves). The alternative oscillator strain, NH1524 also produced periodic oscillations between nucleolar and mitochondrial cellular aging processes and thereby slowing age-dependent cellular deterioration and dramatically extended the lifespan. Thus, maintaining Sir2 oscillation appeared to be important for maximally extending life span. The synthetic oscillator strain exhibited a fast cell cycle rate and the elongation of cell cycles during aging was delayed and decreased compared to that in WT cells (FIG.3B). Engineered cells with sustained oscillations retained a fast cell cycle rate (70 to 90 minutes per cell cycle) throughout their entire lifespans, whereas those that deviated from oscillations had much slower cell cycles late in life (FIG.3B, lower vs upper dashed curves). Thus, maintaining Sir2 oscillation slowed age-induced cell deterioration. WT cells showed a large cell-to-cell variation in life span (coefficient of variation (CV) = 0.48), in part because of the stochasticity and divergence of the Sir2 and HAP deterioration pathways (34). In agreement with this, the synthetic oscillator strain showed a more uniform life span among cells (CV = 0.29) and less increase in cell cycle length during aging compared to WT (FIGS.3C-3D), demonstrating that the synthetic negative feedback loop could function to avoid or delay pathway divergence. In the synthetic oscillator strain, the abundance of Sir2, averaged over the lifetime, was elevated by about twofold relative to that of WT (FIG.14). To test
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 whether the life-span extension was because of the increased Sir2 abundance, the strain with twofold constitutive overexpression of Sir2 was examined. A~23% increase in life span was observed compared to the WT (FIG.15A). Twofold overexpression of Sir2 in combination with Hap4 overexpression resulted in a more notable life- span extension (~42% increase compared to WT), which was still substantially less than the life-span extension from the oscillator strain (82% increase compared to WT) (FIG.15). The oscillator strain also had a faster cell cycle rate than the overexpression mutants (FIG.15C). These results confirmed that the oscillatory dynamics of Sir2, in addition to its increased expression, contributed to the life span extension and fast cell cycle rate in the synthetic strain. In line with this, the oscillator strain was also much more long- lived than strains with engineered Sir2-HAP circuits that could not generate oscillations because of broken or weakened feedback interactions (FIG.16). To further assess the performance of the synthetic oscillator strain, the synthetic oscillator strain was compared with the longest-lived single and double mutants identified from genetic screens (44–46). These included the deletion mutants fob1Δ (“forkblocking less,” which encodes a protein required for replication fork blocking), sgf73Δ (SAGA-associated factor 73, which encodes a component of the SAGA/SLIK complex deubiquitination module), fob1Δ hxk2Δ (the double mutant of genes that encode forkblocking less and hexokinase 2), and fob1Δ sch9Δ (the double mutant of genes that encode forkblocking less and an ortholog of the mammalian S6 kinase). Under the genetic background and experimental conditions used (32, 34, 47), the synthetic oscillator strain had a longer and more uniform life span than most mutants (FIGS.17A-17B). Moreover, some longevity mutants displayed impaired cell cycle progression even in young cells, which suggested moderate physiological defects associated with the genetic perturbations. In contrast, the oscillator strain had faster cell cycles than WT and mutants throughout the entire aging process, which indicated a healthier cellular life span (FIG.17C).
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 Example 5: The synthetic oscillator avoids fate commitment to deterioration states To test whether sustained oscillations in the engineered Sir2-HAP circuit could prevent aging cells from committing to either the rDNA silencing–loss or heme- depletion state, rDNA silencing and heme abundance were simultaneously monitored in the synthetic strain with the rDNA-GFP and iRFP reporters. In WT cells, about half of the cells showed continuously increased GFP fluorescence at the later stages of aging, which indicated a sustained loss of rDNA silencing and ended life in a state with low rDNA silencing and a high abundance of heme. The other cells showed decreased iRFP fluorescence, indicating that heme was depleted, and ended life in a state with high rDNA silencing and a low abundance of heme (FIG.4A). In contrast, most synthetic oscillator cells exhibited short, intermittent pulses of rDNA-GFP and iRFP signals throughout the life span without a prolonged commitment to either a state of rDNA silencing loss or of heme depletion (FIG.4B). The continuous times in the states of rDNA silencing–loss and heme depletion during the aging of each individual cells was further quantified (FIG.18). Almost all of WT aging cells experienced a prolonged duration in rDNA silencing loss or heme depletion, whereas the oscillator cells showed shorter durations in either state (FIG.4C and FIG.19). Thus, the engineered negative feedback loop in the Sir2- HAP circuit enabled a time-based balance between the rDNA silencing and heme biogenesis that promoted longevity. In further support of this balance, synthetic Sir2- HAP circuits with broken or weakened feedback interactions failed to maintain such a balance, which resulted in prolonged commitments to detrimental states (FIG.20) and thereby, shorter lifespans (FIG.16). References 1. R. Milo et al., Science 298, 824–827 (2002). 2. M. Elowitz, W. A. Lim, Nature 468, 889–890 (2010). 3. C. J. Bashor, J. J. Collins, Annu. Rev. Biophys.47, 399–423 (2018). 4. T. S. Gardner, C. R. Cantor, J. J. Collins, Nature 403, 339–342 (2000). 5. M. B. Elowitz, S. Leibler, Nature 403, 335–338 (2000). 6. J. Stricker et al., Nature 456, 516–519 (2008). 7. A. E. Friedland et al., Science 324, 1199–1202 (2009). 8. T. Danino, O. Mondragón-Palomino, L. Tsimring, J. Hasty, Nature 463, 326– 330 (2010). 9. A. Becskei, L. Serrano, Nature 405, 590–593 (2000).
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 10. R. Zhu, J. M. Del Rio-Salgado, J. Garcia-Ojalvo, M. B. Elowitz, Science 375, eabg9765 (2022). 11. F. Wu, R. Q. Su, Y. C. Lai, X. Wang, eLife 6, e23702 (2017). 12. M. Tigges, T. T. Marquez-Lago, J. Stelling, M. Fussenegger, Nature 457, 309–312 (2009). 13. C. J. Bashor, A. A. Horwitz, S. G. Peisajovich, W. A. Lim, Annu. Rev. Biophys.39, 515–537 (2010). 14. F. Wu, J. H. Bethke, M. Wang, L. You, Curr. Opin. Biomed. Eng.4, 116–126 (2017). 15. L. Bintu et al., Science 351, 720–724 (2016). 16. A. J. Keung, C. J. Bashor, S. Kiriakov, J. J. Collins, A. S. Khalil, Cell 158, 110–120 (2014). 17. S. Toda, L. R. Blauch, S. K. Y. Tang, L. Morsut, W. A. Lim, Science 361, 156–162 (2018). 18. S. Huang et al., Mol. Syst. Biol.12, 859 (2016). 19. A. H. Ng et al., Nature 572, 265–269 (2019). 20. A. V. Belikov, Ageing Res. Rev.49, 11–26 (2019). 21. L. Fontana, L. Partridge, V. D. Longo, Science 328, 321–326 (2010). 22. V. D. Longo, B. K. Kennedy, Cell 126, 257–268 (2006). 23. B. M. Wasko, M. Kaeberlein, FEMS Yeast Res.14, 148–159 (2014). 24. M. Kaeberlein, B. K. Kennedy, Mech. Ageing Dev.126, 17–21 (2005). 25. C. He, C. Zhou, B. K. Kennedy, Biochim. Biophys. Acta Mol. Basis Dis.1864 (9 Pt A), 2690–2696 (2018). 26. E. D. Smith et al., Genome Res.18, 564–570 (2008). 27. M. R. Gartenberg, J. S. Smith, Genetics 203, 1563–1599 (2016). 28. M. Kaeberlein, M. McVey, L. Guarente, Genes Dev.13, 2570–2580 (1999). 29. K. Saka, S. Ide, A. R. Ganley, T. Kobayashi, Curr. Biol.23, 1794–1798 (2013). 30. D. A. Sinclair, L. Guarente, Cell 91, 1033–1042 (1997). 31. S. Buschlen et al., Comp. Funct. Genomics 4, 37–46 (2003). 32. Y. Li et al., Proc. Natl. Acad. Sci. U.S.A.114, 11253–11258 (2017). 33. G. S. Filonov et al., Nat. Biotechnol.29, 757–761 (2011). 34. Y. Li et al., Science 369, 325–329 (2020). 35. J. Olesen, S. Hahn, L. Guarente, Cell 51, 953–961 (1987). 36. L. Guarente, T. Mason, Cell 32, 1279–1286 (1983). 37. S. Hahn, L. Guarente, Science 240, 317–321 (1988). 38. C. Li, J. E. Mueller, M. Bryk, Mol. Biol. Cell 17, 3848–3859 (2006). 39. C. M. Gallo, D. L. Smith Jr., J. S. Smith, Mol. Cell. Biol.24, 1301–1312 (2004). 40. B. Ho, A. Baryshnikova, G. W. Brown, Cell Syst.6, 192–205.e3 (2018). 41. L. Xiong et al., Microb. Cell Fact.17, 58 (2018). 42. W. Dang et al., Nature 459, 802–807 (2009). 43. T. Smeal, J. Claus, B. Kennedy, F. Cole, L. Guarente, Cell 84, 633–642 (1996). 44. M. A. McCormick et al., Cell Rep.8, 477–486 (2014). 45. M. Kaeberlein, K. T. Kirkland, S. Fields, B. K. Kennedy, PLOS Biol.2, e296 (2004). 46. M. Kaeberlein et al., Science 310, 1193–1196 (2005). 47. M. Jin et al., Cell Syst.8, 242–253.e3 (2019).
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 48. L. Guarente, C. Kenyon, Nature 408, 255–262 (2000). 49. M. Kuningas et al., Aging Cell 7, 270–280 (2008). 50. M. A. McCormick et al., Cell Metab.22, 895–906 (2015). 51. Z. Zhou, zhoutopo/science_aging_model: science, Zenodo (2021). OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 WHAT IS CLAIMED IS: 1. A cell comprising a synthetic SIR2-HAP circuit construct comprising: (a) a polynucleotide encoding a HAP-inducible promoter operably linked to SIR2; and (b) a polynucleotide encoding a strong constitutive promoter operably linked to HAP4. 2. The circuit construct of claim 1, wherein the polynucleotide encoding a strong constitutive promoter operably linked to HAP4 is inserted at an rDNA locus or a silent HML locus in the cell. 3. The circuit construct of any one of claims 1 or 2, wherein the HAP-inducible promoter is transcriptionally induced by the HAP4 gene product. 4. The circuit construct of any one of claims 1 to 3, wherein the polynucleotide encoding a strong constitutive promoter is transcriptionally repressed by the SIR2 gene product. 5. The circuit construct of any one of claims 1 to 4, wherein the HAP-inducible promoter operably linked to SIR2 comprises a CCAAT nucleotide sequence in an upstream activation sequence (UAS). 6. The circuit construct of any one of claims 1 to 5, wherein the HAP-inducible promoter operably linked to SIR2 comprises CYC1 or COX5a. 7. The circuit construct of any one of claims 1 to 4, wherein the strong constitutive promoter operably linked to HAP4 comprises Triose-phosphate dehydrogenase 3 (TDH3), TEF1, PGK1, CCW12, ADH1, or ENO2. 8. The circuit construct of any one of claims 1 to 4, wherein the strong constitutive promoter operably linked to HAP4 comprises TDH3.
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 9. The circuit construct of any one of claims 1 to 8, wherein activation of the synthetic SIR2-HAP negative feedback loop in the cell generates a periodic oscillation in the abundance of the SIR2 gene product and the HAP4 gene product, delaying the cell’s commitment to an aging pathway. 10. The circuit construct of any one of claims 1 to 9, wherein the polynucleotide encoding a HAP-inducible promoter operably linked to SIR2 further comprises a fluorescence marker. 11. The circuit construct of claim 10, wherein the fluorescence marker is mCherry, CFP, GFP, YFP, or RFP. 12. A method of modulating cellular aging in a cell, the method comprising: introducing into the cell the synthetic SIR2-HAP circuit construct of any one of claims 1 to 11. 13. A method of modulating cellular aging in a cell, the method comprising: introducing a synthetic gene oscillator into the cell; thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. 14. The method of claim 13, the oscillator comprising a first genetic construct for modulating nucleolar aging processes, and a second genetic construct for modulating mitochondrial aging processes, wherein the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct. 15. A method of extending the lifespan of a cell, the method comprising: introducing a synthetic gene oscillator into the cell; thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. 16. A method of delaying age-related decline in a cell, the method comprising:
Attorney Docket No.15670-0396WO1 // SD-2024-130-1 introducing a synthetic gene oscillator into the cell; thereby inducing periodic oscillations between nucleolar and mitochondrial cellular aging processes. 17. The method of claim 15 or 16, the oscillator comprising a first genetic construct for modulating nucleolar aging processes, and a second genetic construct for modulating mitochondrial aging processes, wherein the product of the first genetic construct suppresses activation of the second genetic construct, and the product of the second genetic construct induces expression of the first genetic construct. 18. The method of any of claim 12-17, wherein the cell is a eukaryotic cell. 19. The method of claim 18, wherein the eukaryotic cell is selected from the group comprising: animal cells, plant cells, fungus cells, and protist cells. 20. The method of claim 19, wherein the fungus cell is a yeast. 21. The method of any of claims 20, wherein the yeast is an engineered yeast strain comprising NH1574 and/or NH1524.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202463552922P | 2024-02-13 | 2024-02-13 | |
| US63/552,922 | 2024-02-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2025174397A1 true WO2025174397A1 (en) | 2025-08-21 |
Family
ID=96773407
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2024/026023 Pending WO2025174397A1 (en) | 2024-02-13 | 2024-04-24 | Engineered long-lived yeast and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2025174397A1 (en) |
-
2024
- 2024-04-24 WO PCT/US2024/026023 patent/WO2025174397A1/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| LI YANG, JIANG YANFEI, PAXMAN JULIE, O’LAUGHLIN RICHARD, KLEPIN STEPHEN, ZHU YUELIAN, PILLUS LORRAINE, TSIMRING LEV S., HASTY JEFF: "A programmable fate decision landscape underlies single-cell aging in yeast", SCIENCE ADVANCES, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 369, no. 6501, 1 July 2020 (2020-07-01), US , pages 325 - 329, XP093350860, ISSN: 0036-8075, DOI: 10.1126/science.aax9552 * |
| ZHOU ZHEN, LIU YUTING, FENG YUSHEN, KLEPIN STEPHEN, TSIMRING LEV S., PILLUS LORRAINE, HASTY JEFF, HAO NAN: "Engineering longevity—design of a synthetic gene oscillator to slow cellular aging", SCIENCE ADVANCES, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 380, no. 6643, 1 April 2023 (2023-04-01), US , pages 376 - 381, XP093350859, ISSN: 0036-8075, DOI: 10.1126/science.add7631 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Turco et al. | Molecular mechanisms driving switch behavior in xylem cell differentiation | |
| Noonan et al. | Genomics of long-range regulatory elements | |
| Yu et al. | A survey of essential gene function in the yeast cell division cycle | |
| Kelwick et al. | Developments in the tools and methodologies of synthetic biology | |
| Tomé et al. | The low energy signaling network | |
| Haase et al. | Topology and control of the cell-cycle-regulated transcriptional circuitry | |
| Dadiani et al. | Two DNA-encoded strategies for increasing expression with opposing effects on promoter dynamics and transcriptional noise | |
| Ferrin et al. | Kinetic modeling predicts a stimulatory role for ribosome collisions at elongation stall sites in bacteria | |
| Oftadeh et al. | Genome-scale models of metabolism and expression predict the metabolic burden of recombinant protein expression | |
| Liu et al. | Enhanced cellular longevity arising from environmental fluctuations | |
| Li et al. | Temporal controls of the asymmetric cell division cycle in Caulobacter crescentus | |
| Muhammad et al. | More than meets the eye: Emergent properties of transcription factors networks in Arabidopsis | |
| Cuesta-Astroz et al. | Filtering of data-driven gene regulatory networks using Drosophila melanogaster as a case study | |
| Ananda et al. | Non-dominated sorting differential search algorithm for optimizing regulatory-metabolic networks by using probabilistic approach | |
| Jiao et al. | What can we learn when fitting a complex gene expression model to a simple telegraph model | |
| Boada et al. | Parameter identification in synthetic biological circuits using multi-objective optimization | |
| US11604198B2 (en) | Compositions and methods for programmable sensing and control through combinatorial molecular interactions | |
| Gokhale et al. | A systems view of the protein expression process | |
| Jashnsaz et al. | Phenotypic consequences of logarithmic signaling in MAPK stress response | |
| Joh et al. | Gene clustering coordinates transcriptional output of disparate biological processes in eukaryotes | |
| Droghetti et al. | Coupled ribosome allocation and nutrient sensing lead to incoherent feedback and oscillatory response in bacterial growth | |
| Higgins | Experimental evolution of environment dependent gene regulation. | |
| Zhu | Tools and Strategies for Gene Expression Control in Service of Understanding and Constructing Multicellular Systems | |
| Chadha | Single-cell imaging in Saccharomyces cerevisiae uncovers a critical role for the G1/S transition activator Bck2 in cell size adaptation | |
| Morgan et al. | Translation efficiency is maintained at elevated temperature in E. coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 24925042 Country of ref document: EP Kind code of ref document: A1 |