WO2025160495A1 - Hematopoietic stem cells and uses thereof in treating cancer - Google Patents

Abstract

The present disclosure encompasses systems, methods, and compositions for for identifying a cellular or molecular target for therapy and/or predicting responsiveness to a therapy based on transcriptional and epigenetic signatures in circulating cells in peripheral blood of a subject. Particular methods relate to detecting transcriptional and epigenetic signatures related to anti-tumor immunity in circulating cells of a subject after administering a therapy, such as a microbial therapy and/or immunotherapy, and treating the subject based on the analysis.

Description

HEMATOPOIETIC STEM CELLS AND USES THEREOF IN TREATING CANCER

STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH

[0001] This invention was made with government support under Grant No. P50CA221745 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.

CROSS REFERENCE TO RELATED APPLICATION

[0002] The present application claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63/625,822, entitled ROLE OF INNATE IMMUNE MEMORY IN BCG- INDUCED ANTI-TUMOR IMMUNITY, filed on January 26, 2024, which is currently co-pending herewith and which is incorporated by reference in its entirety.

SEQUENCE LISTING

[0003] The present application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety for all purposes. The XML copy, created on January 22, 2025, is referred to as CRNU.P0029WO_SequenceListing.xml and is 2,800 bytes in size.

FIELD

[0004] The present disclosure relates generally to the field of immunology, and particularly relates to systems and methods for obtaining and using blood stem cells to diagnose and treat disease.

BACKGROUND

[0005] The embodiments disclosed herein are generally directed towards methods of identifying suitable patients for treatment with the various cancer therapies (and, in particular, with attenuated mycobacterium AT. bovis bacillus Calmette-Guerin (BCG)), methods of treatment involving the same, and improving outcomes in patients who are candidates for or receiving said cancer therapies.

[0006] BCG is both a widely used vaccine against tuberculosis, and the first immunotherapy and the only bacterial therapy of cancer. BCG is also a well-recognized stimulant, when administered systemically, of central innate immune memory through its effects on bone marrow hematopoietic stem cells and their myeloid progeny, an activity that provides heterologous protection against infection.

[0007] Although intravesical BCG therapy has been the post-resection standard of care for nonmuscle- invasive bladder cancers (NMIBC) for over thirty years, approximately 50% of patients will experience tumor recurrence, many of whom need major surgery and are at risk for metastatic disease. The contribution of HSC reprogramming to the anti -turn or effects of bladder BCG, previously shown to be due to induction of tumor specific T cell immunity, are unknown. Despite substantial efforts, there are currently no reliable pretreatment predictors of BCG response, partially due to an incomplete understanding of BCG’s mechanism of action.

[0008] To meet this need, the disclosure relates to elucidating BCG’s mechanism of action and predicting BCG response, to improve outcomes in patients who are candidates for or receiving BCG treatment. An understanding of BCG’s mechanism of action can additionally lead to determining additional conditions where BCG treatment to generate an anti-tumor immune response can be beneficial. Furthermore, the present disclosure also expands BCG’s mechanism of action to encompass the mechanism of action of other cancer therapies (including immunotherapies), to improve outcomes in patients who are candidates for or receiving these other cancer therapies.

SUMMARY

[0009] Various aspects of the present disclosure relate to methods for predicting responsiveness of a subject to a therapy. In various embodiments, the methods may comprise detecting the presence or absence of one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in peripheral blood of the subject, wherein the subject has been diagnosed with cancer and has been administered the therapy; and predicting responsiveness of the subject for the therapy, wherein the subject is predicted to be responsive to the therapy if the one or more circulating cell populations are detected and the subject is predicted to be non-responsive to the therapy if the one or more circulating cell populations are not detected.

[0010] In various embodiments, the therapy induces enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in the one or more circulating cell populations.

[0011] In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation, interferon gamma-mediated signaling, platelet aggregation, cell-cell adhesion, cytokine production and signaling, positive regulation of ATP biosynthesis, activation, differentiation, and/or anti-tumor response. For example, in various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses.

[0012] In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 1 to 7. In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 5 to 7. In various embodiments, the epigenetic and transcription signatures comprise enrichment for the or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, BST2, HLAC, AREG, CIITA, MX2, TNFRSF1B, HLA-A, HLA-B, HLA-C. HLA-F, IRF2, S100A9, IL6R, H3F3A, H3F3B, and S100A. In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, and BST2.

[0013] In various embodiments, the epigenetic and transcriptional signatures associated with antitumor immunity correspond to altered cellular molecular features and/or functional characteristics of the one or more cells. For example, in various embodiments, the cellular molecular features and/or functional characteristics comprise increased antigen presentation, increased TNF production, increased interferon gamma production, increased granulopoiesis, increased neutrophil reprogramming into an anti-tumor phenotype, increased macrophage or monocyte expression of genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses, , altered proportions or phenotypes of pHSPC subsets related to changes in granulopoeisis, altered or augmented activation states, altered or augmented inflammatory programs, altered or augmented antigen presentation, and/or altered or augmented cytokine responsiveness.

[0014] In various embodiments, the one or more circulating cell populations comprise a rare circulating cell population.

[0015] In various embodiments, the methods further comprise a step of enriching circulating cells from the peripheral blood sample or from peripheral blood mononuclear cells (PBMC) from the peripheral blood sample to provide an enriched population of circulating cells.

[0016] In various embodiments, enriching circulating cells comprises: isolating one or more types of circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample from the subject; and enriching the one or more types of circulating cell in the PBMC and/or in the peripheral blood sample, thereby providing the enriched population of circulating cells from the peripheral blood and/or PBMC; and optionally introducing or re-introducing the enriched population of circulating cells into a sample comprising peripheral blood and/or PBMC.

[0017] In various embodiments, enriching circulating cells comprises either antibody-conjugated bead-based enrichment or FACS sorting, or sequential antibody-conjugated bead-based enrichment and FACS sorting; optionally wherein enriching circulating cells comprises FACS-sorting circulating cells into one or more tubes prior to cell isolation; optionally wherein enriching circulating cells comprises pooling multiple samples into a single assay tube and demultiplexing after analysis (in silic ) based on oligo-conjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals. [0018] In various embodiments, the peripheral blood and/or PBMC comprises one or more peripheral hematopoietic stem and progenitor cell (pHSPC), CD14+ monocyte (CD14 M.), CD16+ monocyte (CD 16 M ), CD34+ HSPC, CD34- HSPC, B cell (B), CD4+ T cell (CD4), CD8+ T cell (CD8), dendritic cell (DC), natural killer cell (NK), plasma B cell (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cell (HSC/MPP), lymphoid-primed multipotent progenitor cell (LMPP), megakaryocyte-erythroid progenitor cell (MEP), erythroid progenitor cell (Ery), granulocyte- monocyte progenitor cell (GMP), basophil-eosinophil-mast cell progenitor cell (BEM), granulocyte (GRA), neutrophil progenitor cell (NEUP), common myeloid progenitor (CMP), or neutrophils (NEU).

[0019] In various embodiments, the enriched population of circulating cells comprise peripheral hematopoietic stem and progenitor cells (pHSPC), CD14+ monocytes (CD14 M.), CD16+ monocytes (CD 16 M.), B cells (B), CD4+ T cells (CD4), CD8+ T cells (CD8), dendritic cells (DC), natural killer cells (NK), plasma B cells (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cells (HSC/MPP), lymphoid-primed multipotent progenitor cells (LMPP), megakaryocyte-erythroid progenitor cells (MEP), erythroid progenitor cells (Ery), granulocytemonocyte progenitor cells (GMP), basophil-eosinophil-mast cell progenitor cells (BEM), common myeloid progenitors (CMP), granulocytes (GRA), neutrophil progenitor cells (NEUP), and/or neutrophils (NEU) In various embodiments, the enriched population of circulating cells comprises a peripheral hematopoietic stem and progenitor cell (pHSPC), CD14+ monocyte (CD14 M.), dendritic cell (DC), and/or neutrophil (NEU) population. In various embodiments, the enriched population of circulating cells comprises a peripheral hematopoietic stem and progenitor cell (pHSPC), CD14+ monocyte (CD14 M.), and/or dendritic cell (DC) population. In various embodiments, the enriched population of circulating cells comprises a pHSPC population.

[0020] In various embodiments, the enriched population of circulating cells comprises an enriched population of rare circulating cells.

[0021] In various embodiments, the one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population, a CD14+ monocyte (CD14 M.) population, a CD16+ monocyte (CD16 M.) population, a B cell (B) population, a CD4+ T cell (CD4) population, a CD8+ T cell (CD8) population, a dendritic cell (DC) population, a natural killer cell (NK) population, plasma B cell (PC) population, a plasmacytoid dendritic cell (pDC) population, a hematopoietic stem cells/multipotent progenitor cell (HSC/MPP) population, a lymphoid-primed multipotent progenitor cell (LMPP) population, a megakaryocyte-erythroid progenitor cell (MEP) population, an erythroid progenitor cell (Ery) population, a granulocyte- monocyte progenitor cells (GMP) population, a basophil-eosinophil-mast cell progenitor cells (BEM) population, a granulocyte (GRA) propulation, a neutrophil progenitor cell (NEUP) population, a neutrophil (NEU) population, and/or a common myeloid progenitor (CMP) population.

[0022] In various embodiments, the one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population, a CD14+ monocyte (CD14 M.) population, a neutrophil (NEU) population, or dendritic cell (DC) population. In various embodiments, the one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population.

[0023] In various embodiments, one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population and the therapy targets the pHSPC population and/or hematopoietic stem and progenitor cells (HSPCs) in bone marrow of the subject.

[0024] In various embodiments, the method further comprises a step of analyzing the enriched population of circulating cells by downstream analysis of cellular molecular features and/or cell functional characteristics to detect the one or more circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity.

[0025] In various embodiments, downstream analysis of cellular molecular features and/or cell functional characteristics comprises: acquiring single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data for the enriched population of circulating cells; analyzing the circulating cell transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data to identify cellular molecular features and/or functional characteristics; and generating an output comprising transcriptional, genetic, protein, metabolic, epigenomic, and/or functional characteristic signatures for the one or more types of circulating cells.

[0026] In various embodiments, acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more bulk and/or single cell assay; optionally wherein the bulk and/or single cell assay comprises bulk and/or single cell RNA and/or ATACseq analysis; optionally wherein acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more single cell assay and is combined with one or more single cell-based workflows. [0027] In various embodiments, the methods further comprise parallel sample preparation and scale up enabled by pooling of multiple samples and demultiplexing after analysis (in silico) based on oligoconjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals; optionally further comprising subject genome sequencing to generate a reference genotype for genotype-based demultiplexing of single cell datasets from pooled samples; optionally wherein genome sequencing comprises whole genome sequencing, exome sequencing, bulk ATACseq, and/or SNP microarray.

[0028] In various embodiments, analyzing the enriched circulating cells comprises analyzing expression of one or more of protein, mRNA, DNA (sequence or post-translational modifications), chromatin (e.g. histone modifications, accessibility, 3D structure/looping, etc.), metabolites, and/or lipids; optionally wherein analyzing the enriched circulating cells comprises analyzing chromatin, DNA, mRNA expression, and/or ATAC-seq data; optionally wherein analyzing the enriched circulating cell mRNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) data comprises combined single cell mRNA/ ATAC-seq data processing; UMAP visualization; single cell and/or bulk ATAC-seq; demultiplexing; and/or identifying differentially accessible regions, differentially expressed genes, and/or ATAC peak-gene/transcript associations; optionally wherein transcriptional, genetic, protein, and/or epigenomic signatures are determined by gene ontology (GO) analysis.

[0029] In various embodiments, analyzing the enriched circulating cells comprises combined single nuclei (sn) RNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) (chromium single cell multiome ATAC + gene expression) for PBMC, sorted PBMC subset “bulk” ATAC-seq, multiplexed immunoassay-based quantitation of plasma proteins, and/or immunophenotyping by flow cytometry.

[0030] In accordance with various embodiments, further aspects of the disclosure relate to methods for predicting responsiveness of a subject to a therapy, the methods comprising: detecting the presence or absence of one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in peripheral blood of the subject, wherein the subject has been diagnosed with cancer and has been administered the therapy; and predicting responsiveness of the subject for the therapy, wherein the subject is predicted to be responsive to the therapy if the one or more circulating cell populations are detected and the subject is predicted to be non-responsive to the therapy if the one or more circulating cell populations are not detected; wherein the method further comprises a step of enriching circulating cells from the peripheral blood sample or from peripheral blood mononuclear cells (PBMC) from the peripheral blood sample to provide an enriched population of circulating cells, and enriching the circulating cells comprises: isolating one or more types of circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample from the subject; and enriching the one or more types of circulating cell in the PBMC and/or in the peripheral blood sample, thereby providing the enriched population of circulating cells from the peripheral blood and/or PBMC; and optionally introducing or re-introducing the enriched population of circulating cells into a sample comprising peripheral blood and/or PBMC; and wherein the enriched population of circulating cells comprises a pHSPC, CD14 M., DC and/or NEU population.

[0031] In accordance with various embodiments, further aspects of the disclosure relate to methods for predicting responsiveness of a subject to a therapy, the methods comprising: detecting the presence or absence of one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in peripheral blood of the subject, wherein the subject has been diagnosed with cancer and has been administered the therapy; and predicting responsiveness of the subject for the therapy, wherein the subject is predicted to be responsive to the therapy if the one or more circulating cell populations are detected and the subject is predicted to be non-responsive to the therapy if the one or more circulating cell populations are not detected; wherein the method further comprises a step of enriching circulating cells from the peripheral blood sample or from peripheral blood mononuclear cells (PBMC) from the peripheral blood sample to provide an enriched population of circulating cells, and enriching the circulating cells comprises: isolating one or more types of circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample from the subject; and enriching the one or more types of circulating cell in the PBMC and/or in the peripheral blood sample, thereby providing the enriched population of circulating cells from the peripheral blood and/or PBMC; and optionally introducing or re-introducing the enriched population of circulating cells into a sample comprising peripheral blood and/or PBMC; and wherein the enriched population of circulating cells comprises pHSPC, CD14 M., and/or DC population.

[0032] In accordance with various embodiments, further aspects of the disclosure relate to methods for predicting responsiveness of a subject to a therapy, the method comprising: detecting the presence or absence of one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in peripheral blood of the subject, wherein the subject has been diagnosed with cancer and has been administered the therapy; and predicting responsiveness of the subject for the therapy, wherein the subject is predicted to be responsive to the therapy if the one or more circulating cell populations are detected and the subject is predicted to be non-responsive to the therapy if the one or more circulating cell populations are not detected; wherein the method further comprises a step of enriching circulating cells from the peripheral blood sample or from peripheral blood mononuclear cells (PBMC) from the peripheral blood sample to provide an enriched population of circulating cells, and enriching the circulating cells comprises: isolating one or more types of circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample from the subject; and enriching the one or more types of circulating cell in the PBMC and/or in the peripheral blood sample, thereby providing the enriched population of circulating cells from the peripheral blood and/or PBMC; and optionally introducing or re-introducing the enriched population of circulating cells into a sample comprising peripheral blood and/or PBMC; and wherein the enriched population of circulating cells comprises a pHSPC population.

[0033] In various embodiments, the therapy induces or promotes innate immune memory and/or a systemic anti-tumor response and/or wherein the therapy contributes to HSPC and/or immune progenitor phenotypic changes/reprogramming and/or wherein the therapy induces enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune progenitor cells.

[0034] In various embodiments, the populations of immune progenitor cells are in circulation and/or in the bone marrow of the subject.

[0035] In various embodiments, the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs), hematopoietic stem cells (HSCs), and/or intermediate progenitor cells.

[0036] In various embodiments, the therapy comprises a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

[0037] In various embodiments, the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part. In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof.

[0038] In various embodiments, the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof. In various embodiments, the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG). [0039] In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0040] In various embodiments, the cytokine therapy comprises a type 1 IFN, a type 2 IFN , IL-lbeta, IL-6, or TNFa. In various embodiments, the cytokine therapy does not comprise IL-15 or a IL-15 agonist. In various embodiments, the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

[0041] In various embodiments, the cytolytic peptide toxin comprises candidalysin.

[0042] In various embodiments, the polysaccharide comprises beta-glucan.

[0043] In various embodiments, the immunotherapy comprises a checkpoint inhibitor, a bispecific antibody, a microbial immunotherapy, or any combination thereof.

[0044] In various embodiments, the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-4 inhibitor, an anti-CTLA-4 antibody, or any combination thereof. In various embodiments, the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

[0045] In various embodiments, the therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

[0046] In various embodiments, the therapy comprises a microbial therapy and/or an immunotherapy. In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and/or an immunotherapy.

[0047] In various embodiments, the therapy comprises a microbial therapy and/or one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide . In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and/or one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide. In various embodiments, the one or more immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide are selected from beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

[0048] In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof.

[0049] In various embodiments, the method further comprises determining whether the subject is a candidate for a combination therapy wherein the combination therapy comprises two or more of a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

[0050] In various embodiments, the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part. In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof.

[0051] In various embodiments, the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof. In various embodiments, the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0052] In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0053] In various embodiments, the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa. In various embodiments, the cytokine therapy does not comprise IL-15 or a IL-15 agonist. In various embodiments, the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

[0054] In various embodiments, the cytolytic peptide toxin comprises candidalysin.

[0055] In various embodiments, the polysaccharide comprises beta-glucan.

[0056] In various embodiments, the immunotherapy comprises a checkpoint inhibitor, a bispecific antibody, a microbial immunotherapy, or any combination thereof.

[0057] In various embodiments, the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, a anti-CTLA-1 antibody, or any combination thereof. In various embodiments, the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

[0058] In various embodiments, the combination therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

[0059] In various embodiments, the combination therapy comprises a microbial therapy and an immunotherapy. In various embodiments, the combination therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof and an immunotherapy.

[0060] In various embodiments, the combination therapy comprises a microbial therapy and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, and/or a polysaccharide. In various embodiments, the combination therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide. In various embodiments, the combination therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof and one or more of beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

[0061] In various embodiments, the methods provided herein may further comprise (i) predicting response or refractoriness by the subject to an innate immune memory inducing therapy; (ii) determining ongoing responsiveness to therapy or risk of tumor reemergence in the subject; and/or (iii) determining responsiveness or candidacy for augmented therapy with additional cancer therapies.

[0062] In various embodiments, predicting response or refractoriness by the subject to an innate immune memory inducing therapy comprises predicting one or more adverse clinical event. In various embodiments, the methods comprise predicting one or more adverse clinical event following treatment of the subject with an immunotherapy; optionally wherein the immunotherapy is an immune checkpoint inhibitor.

[0063] In various embodiments, the methods further comprise determining a cellular or molecular target for therapy based on the epigenetic and transcriptional signatures of the detected cells.

[0064] Further aspects of the present disclosure relate to methods for identifying a cellular or molecular target for therapy, the method comprising: isolating one or more types of circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample obtained from a subject with cancer; enriching the one or more types of circulating cells in the PBMC and/or in the peripheral blood sample, thereby providing an enriched population of circulating cells from the peripheral blood and/or PBMC; acquiring single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data for the enriched population of circulating cells; analyzing the enriched circulating cell transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data to identify one or more cellular or molecular targets for the therapy; and generating an output comprising transcriptional, genetic, protein, metabolic, epigenomic, and/or functional characteristic signatures, thereby identifying one or more cellular or molecular targets for the therapy.

[0065] In various embodiments, the enriched circulating cells have differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity. In various embodiments, the one or more targets for the cancer therapy are determined based on the epigenetic and transcriptional signatures associated with anti-tumor immunity.

[0066] In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation, interferon gamma-mediated signaling, platelet aggregation, cell-cell adhesion, cytokine production and signaling, positive regulation of ATP biosynthesis, activation, differentiation, and/or anti-tumor response; and/or wherein the epigenetic and transcriptional signatures associated with anti-tumor immunity correspond to altered cellular molecular features and/or functional characteristics of the one or more cells.

[0067] In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 1 to 7. In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 5 to 7.

[0068] In various embodiments, the epigenetic and transcription signatures comprise enrichment for the or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, BST2, HLAC, AREG, CIITA, MX2, TNFRSF1B, HLA-A, HLA-B, HLA-C. HLA-F, IRF2, S100A9, IL6R, H3F3A, H3F3B, and S100A. In various embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA- DQB1, B2M, CD74, and BST2

[0069] In various embodiments, the cellular molecular features and/or functional characteristics comprise increased antigen presentation, increased TNF production, increased interferon gamma production, increased granulopoiesis, increased neutrophil reprogramming into an anti-tumor phenotype, increased macrophage or monocyte expression of genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses, altered proportions or phenotypes of pHSPC subsets related to changes in granulopoeisis, altered or augmented activation states, altered or augmented inflammatory programs, altered or augmented antigen presentation, and/or altered or augmented cytokine responsiveness.

[0070] In various embodiments, the one or more types of circulating cells are rare circulating cells.

[0071] In various embodiments, circulating cell enrichment comprises either antibody-conjugated bead-based enrichment or FACS sorting, or sequential antibody-conjugated bead-based enrichment and FACS sorting; optionally wherein circulating cell enrichment comprises FACS-sorting circulating cells into one or more tubes prior to cell isolation; optionally wherein circulating cell enrichment comprises pooling multiple samples into a single assay tube and demultiplexing after analysis (in silico) based on oligo-conjugated antibody -based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals.

[0072] In various embodiments, the enriched population of circulating cells are introduced or reintroduced into a sample comprising peripheral blood and/or PBMC.

[0073] In various embodiments, the peripheral blood and/or PBMC comprises one or more peripheral hematopoietic stem and progenitor cell (pHSPC), CD14+ monocyte (CD14 M.), CD16+ monocyte (CD 16 M ), CD34+ HSPC, CD34- HSPC, B cell (B), CD4+ T cell (CD4), CD8+ T cell (CD8), dendritic cell (DC), natural killer cell (NK), plasma B cell (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cell (HSC/MPP), lymphoid-primed multipotent progenitor cell (LMPP), megakaryocyte-erythroid progenitor cell (MEP), erythroid progenitor cell (Ery), granulocyte- monocyte progenitor cell (GMP), basophil-eosinophil-mast cell progenitor cell (BEM), granulocytes (GRA), neutrophil progenitor cells (NEUP), neutrophils (NEU), or common myeloid progenitor (CMP).

[0074] In various embodiments, the circulating cell is a peripheral hematopoietic stem and progenitor cell (pHSPC), CD14+ monocyte (CD14 M ), CD16+ monocyte (CD16 M ), B cell (B), CD4+ T cell (CD4), CD8+ T cell (CD8), dendritic cell (DC), natural killer cell (NK), plasma B cell (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cell (HSC/MPP), lymphoid-primed multipotent progenitor cell (LMPP), megakaryocyte-erythroid progenitor cell (MEP), erythroid progenitor cell (Ery), granulocyte- monocyte progenitor cell (GMP), basophil- eosinophil-mast cell progenitor cell (BEM), common myeloid progenitor (CMP), granulocyte (GRA), neutrophil progenitor cell (NEUP), or neutrophil (NEU). In various embodiments, the circulating cell is a peripheral hematopoietic stem and progenitor cell (pHSPC), CD 14+ monocyte (CD 14 M.), dendritic cell (DC), or neutrophil (NEU). In various embodiments, the circulating cell is a pHSPC. In various embodiments, the pHSPC is a CD34+ or CD34- pHSPC.

[0075] In various embodiments, the peripheral blood sample is obtained directly from a subject or is from cryopreserved PBMC and/or cryopreserved peripheral blood.

[0076] In various embodiments, the enriched population of circulating cells comprises a peripheral hematopoietic stem and progenitor cell (pHSPC) population, and wherein the therapy targets the pHSPC population and/or a hematopoietic stem and progenitor cell (HSPC) population in bone marrow.

[0077] In various embodiments, acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more bulk and/or single cell assay; optionally wherein the bulk and/or single cell assay comprises bulk and/or single cell RNA and/or ATACseq analysis; wherein acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more single cell assay and is combined with one or more single cell-based workflows. In various embodiments, the methods further comprise parallel sample preparation and scale up enabled by pooling of multiple samples and demultiplexing after analysis (in silico) based on oligo-conjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals; optionally further comprising subject genome sequencing to generate a reference genotype for genotype-based demultiplexing of single cell datasets from pooled samples; optionally wherein genome sequencing comprises whole genome sequencing, exome sequencing, bulk ATACseq, and/or SNP microarray.

[0078] In various embodiments, analyzing the enriched circulating cells comprises analyzing expression of one or more of protein, mRNA, DNA (sequence or post-translational modifications), chromatin (e.g. histone modifications, accessibility, 3D structure/looping, etc.), metabolites, and/or lipids; optionally wherein analyzing the enriched circulating cells comprises analyzing chromatin, DNA, mRNA expression, and/or ATAC-seq data; optionally wherein analyzing the enriched circulating cell mRNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) data comprises combined single cell mRNA/ ATAC-seq data processing; UMAP visualization; single cell and/or bulk ATAC-seq; demultiplexing; and/or identifying differentially accessible regions, differentially expressed genes, and/or ATAC peak-gene/transcript associations; optionally wherein transcriptional, genetic, protein, and/or epigenomic signatures are determined by gene ontology (GO) analysis. In various embodiments, analyzing the enriched circulating cells comprises combined single nuclei (sn) RNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) (chromium single cell multiome ATAC + gene expression) for PBMC, sorted PBMC subset “bulk” ATAC-seq, multiplexed immunoassay-based quantitation of plasma proteins, and/or immunophenotyping by flow cytometry.

[0079] In various embodiments, the therapy induces or promotes innate immune memory and/or a systemic anti-tumor response and/or wherein the therapy contributes to HSPC and/or immune progenitor phenotypic changes/reprogramming and/or wherein the therapy induces enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune progenitor cells.

[0080] In various embodiments, the populations of immune progenitor cells are in circulation and/or in the bone marrow of the subject. In various embodiments, the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs), hematopoietic stem cells (HSCs), and/or intermediate progenitor cells.

[0081] In various embodiments, the therapy comprises a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

[0082] In various embodiments, the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part. [0083] In various embodiments, the therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

[0084] In various embodiments, the therapy comprises an immunotherapy.

[0085] Further aspects of the present disclosure relate to methods for treating a cancer in a subject, the methods comprising: predicting responsiveness of a subject to a therapy according to any method herein and administering the therapy to the subject.

[0086] Further aspects of the present disclosure relate to methods for treating a cancer in a subject, the method comprising: identifying one or more cellular or molecular targets for therapy according to any method described herein, and administering a therapy targeting the one or more cellular or molecular targets to the subject.

[0087] Further aspects of the present disclosure relate to methods for systemically treating a cancer in a subject, the method comprising: administering a therapy to a subject diagnosed with cancer, wherein the therapy induces epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune progenitor cells in the subject.

[0088] In various embodiments, the immune progenitor cells are in circulation and/or in the bone marrow of the subject. In various embodiments, the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs), hematopoietic stem cells (HSCs), and/or intermediate progenitor cells.

[0089] Further aspects of the present disclosure relate to methods of systemically treating a subject for cancer, the method comprising administering a therapy to a subject diagnosed with cancer, wherein the subject has been determined to be responsive to the therapy via a classifier based at least in part on analyzing expression levels in the subject of epigenetic and transcriptional signatures associated with anti -tumor immunity in one or more populations of circulating cells in the subject.

[0090] In various embodiments, the therapy comprises a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

[0091] In various embodiments, the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part. In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof.

[0092] In various embodiments, the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof. In various embodiments, the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0093] In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof, and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0094] In various embodiments, the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa. In various embodiments, the cytokine therapy does not comprise IL-15 or an IL-15 agonist. In various embodiments, the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

[0095] In various embodiments, the cytolytic peptide toxin comprises candidalysin.

[0096] In various embodiments, the polysaccharide comprises beta-glucan.

[0097] In various embodiments, the immunotherapy comprises a checkpoint inhibitor.

[0098] In various embodiments, the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, an anti-CTLA-1 antibody, or any combination thereof. In various embodiments, the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

[0099] In various embodiments, the therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

[0100] In various embodiments, the therapy comprises a microbial therapy and, optionally, an immunotherapy. In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and, optionally, an immunotherapy.

[0101] In various embodiments, the therapy comprises a microbial therapy and, optionally, one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide. In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and, optionally, one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide. In various embodiments, the one or more immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide are selected from beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

[0102] In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof. [0103] In various embodiments, the therapy is administered via localized injection, intravesicularly, intratumorally, intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally.

[0104] In various embodiments, the therapy is administered via localized injection.

[0105] In various embodiments, the methods further comprise administering to the subject a combination therapy comprising two or more of a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

[0106] In various embodiments, the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part. In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof.

[0107] In various embodiments, the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof. In various embodiments, the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0108] In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0109] In various embodiments, the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa. In various embodiments, the cytokine therapy does not comprise IL-15 or an IL-15 agonist. In various embodiments, the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

[0110] In various embodiments, the cytolytic peptide toxin comprises candidalysin.

[OHl] In various embodiments, the polysaccharide comprises beta-glucan.

[0112] In various embodiments, the immunotherapy comprises a checkpoint inhibitor, a bispecific antibody, a microbial immunotherapy, or any combination thereof.

[0113] In various embodiments, the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, an anti-CTLA-1 antibody, or any combination thereof. In various embodiments, the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof. [0114] In various embodiments, the combination therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

[0115] In various embodiments, the combination therapy comprises a microbial therapy and an immunotherapy. In various embodiments, the combination therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof and an immunotherapy.

[0116] In various embodiments, the combination therapy comprises a microbial therapy and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, and/or a polysaccharide. In various embodiments, the combination therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, and/or a polysaccharide. In various embodiments, the combination therapy comprises Bacillus Calmette- Guerin (BCG) and/or a derivative thereof and one or more of beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

[0117] In various embodiments, at least one component of the combination therapy is administered locally, and wherein at least one component of the combination therapy is administered systemically. [0118] In various embodiments, the combination therapy comprises localized administration of a microbial therapy and systemic administration of one or more of an immunostimulator and/or adjuvant, an immunotherapy, cytokine therapy, and/or polysaccharide. In various embodiments, the combination therapy comprises localized administration of Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and systemic administration of beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, IFN-I, and/or an immunotherapy.

[0119] In various embodiments, the combination therapy comprises localized administration of a microbial therapy, and localized administration of one or more of an immunostimulator and/or adjuvant, an immunotherapy, cytokine therapy, and/or polysaccharide. In various embodiments, the combination therapy comprises localized administration of Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and localized administration of beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, IFN-I, and/or an immunotherapy.

[0120] In various embodiments, the cancer comprises a solid tumor. In various embodiments, the solid tumor comprises a sarcoma, a carcinoma, a carcinosarcinoma, a lymphoma, melanoma, or any combination thereof, optionally wherein the solid tumor comprises an adenocarcinoma, a basal cell carcinoma, a squamous cell carcinoma, a transitional cell carcinoma, a ductal carcinoma, an angiosarcoma, a bone sarcoma, a fibroblastic sarcoma, a rhabdomyosarcoma, a lymphoma, melanoma, a carcinonosarcoma, a blastoma, or any combination thereof, and further optionally wherein the solid tumor comprises a bladder tumor, melanoma, a subcutaneous epithelial tumor, a testicular tumor, a ovarian tumor, a breast tumor, a triple negative breast cancer, a cervical tumor, a kidney tumor, a liver tumor, hepatocellular carcinoma, a head-and-neck tumor, a head and neck squamous cell carcinoma (HNSCC), a stomach tumor, a gastrointestinal tumor, a lung tumor, a non-small cell lung cancer (NSCLC), an endometrial tumor, an esophageal tumor, a central nervous system tumor, a glioblastoma, a spinal cord tumor, an ocular tumor, a germ cell tumor, a prostate tumor, a colon tumor, a colorectal tumor, a rectal tumor, mesothelioma, an osteogenic sarcoma, Non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, or any combination thereof.

[0121] In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and the cancer comprises a solid tumor; optionally wherein the cancer comprises bladder cancer.

[0122] In various embodiments, the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and the cancer comprises a solid tumor and does not comprise bladder cancer.

[0123] In various embodiments, administration of the therapy has a systemic (pan-anti-cancer) activity.

[0124] In various embodiments, the methods further comprise (i) predicting response or refractoriness by the subject to the therapy and/or combination therapy; (ii) determining ongoing responsiveness to the therapy and/or combination therapy or risk of tumor reemergence in the subject; and/or (iii) determining responsiveness or candidacy for augmented therapy with additional cancer therapies.

[0125] Further aspects of the present disclosure relate to methods of systemically treating a cancer in a subject in need thereof, the methods comprising localized administration of a microbial therapy to the subject.

[0126] In various embodiments, the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part. In various embodiments, the microbial therapy is a live attenuated pathogen. In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof.

[0127] In various embodiments, the microbial therapy is locally administered to a bladder of the subject.

[0128] In various embodiments, the method further comprises administering one or more secondary agents selected from an immunostimulator and/or adjuvant, a cytokine therapy, a cytotoxic peptide, a polysaccharide, or an immunotherapy to the subject.

[0129] In various embodiments, the immunostimulator and/or adjuvant comprise Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof. [0130] In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

[0131] In various embodiments, the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa. In various embodiments, the cytokine therapy does not comprise IL-15 or an IL-15 agonist. In various embodiments, the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

[0132] In various embodiments, the cytolytic peptide comprises candidalysin.

[0133] In various embodiments, the polysaccharide comprises beta-glucan.

[0134] In various embodiments, the immunotherapy comprises a checkpoint inhibitor.

[0135] In various embodiments, the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, an anti-CTLA-1 antibody, or any combination thereof. In various embodiments, the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

[0136] In various embodiments, the one or more secondary agents are administered systemically to the subject. In various embodiments, the one or more secondary agents comprises an adjuvant and/or immunotherapy administered systemically to the subject.

[0137] In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and wherein beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), and/or IFN-I is administered systemically.

[0138] In various embodiments, the one or more secondary agents are administered locally to the subject. In various embodiments, the one or more secondary agent comprises immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or a polysaccharide administered locally to the subject.

[0139] In various embodiments, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and wherein beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I is administered locally.

[0140] In various embodiments, the cancer comprises a solid tumor. In various embodiments, the solid tumor comprises a sarcoma, a carcinoma, a carcinosarcinoma, a lymphoma, melanoma, or any combination thereof, optionally wherein the solid tumor comprises an adenocarcinoma, a basal cell carcinoma, a squamous cell carcinoma, a transitional cell carcinoma, a ductal carcinoma, an angiosarcoma, a bone sarcoma, a fibroblastic sarcoma, a rhabdomyosarcoma, a lymphoma, melanoma, a carcinonosarcoma, a blastoma, or any combination thereof, and further optionally wherein the solid tumor comprises a bladder tumor, melanoma, a subcutaneous epithelial tumor, a testicular tumor, a ovarian tumor, a breast tumor, a triple negative breast cancer, a cervical tumor, a kidney tumor, a liver tumor, hepatocellular carcinoma, a head-and-neck tumor, a head and neck squamous cell carcinoma (HNSCC), a stomach tumor, a gastrointestinal tumor, a lung tumor, a non-small cell lung cancer (NSCLC), an endometrial tumor, an esophageal tumor, a central nervous system tumor, a glioblastoma, a spinal cord tumor, an ocular tumor, a germ cell tumor, a prostate tumor, a colon tumor, a colorectal tumor, a rectal tumor, mesothelioma, an osteogenic sarcoma, Non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, or any combination thereof.

[0141] In various embodiments, the cancer is not a bladder cancer. In various embodiments, the cancer is not a bladder cancer, and wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof locally administered to a bladder of the subject.

[0142] In various embodiments, the cancer comprises bladder cancer, and wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof locally administered to a bladder of the subject.

BRIEF DESCRIPTION OF THE DRAWINGS

[0143] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0144] FIG. 1. An example computer system, upon which embodiments, or portions of the embodiments, may be implemented, in accordance with various embodiments.

[0145] FIGS. 2A-2I. Bladder BCG reprograms HSPCs and myeloid progeny in human bladder cancer patients. FIG. 2A shows an Experimental Schematic. Whole blood was collected from non-muscle- invasive bladder cancer patients prior to their first dose of BCG and immediately before their 6th dose of BCG (top). Cryopreserved PBMCs were analyzed by PBMC-PIE (40), which enriches rare HSPCs from peripheral blood, followed by mixing with the PBMC at a greater ratio (bottom). Paired single nucleus ATAC- and RNA-seq were performed on all samples. FIG. 2B shows UMAP visualization of snRNA data from the experiment described in A, colored by cell type annotation, with the PBMC-PIE enriched HSPC population highlighted. FIG. 2C shows Fold change in expression post- versus preBCG from Cohort 1 for all significant differentially expressed (fdr < 0.01) genes in HSPCs, CD14+ monocytes, or conventional dendritic cells (eDCs). Relevant genes are labelled. The x-axis is the coefficient of change in expression in the MAST differential expression model. FIGS. 2D-2E show Scatterplots of fold change in expression from the combined cohort dataset for all genes post- versus pre-BCG in HSPCs versus eDCs (FIG. 2D) or HSPCs versus CD14+ monocytes (FIG. 2E). Points are colored by significance (fdr <0.01) in one cell type or both, and relevant genes are labeled. FIG. 2F shows a volcano plot of differential chromVAR motif accessibility from the combined dataset. MeanDiff is the difference in average chromVAR score for accessible peaks in conventional dendritic cells post- versus pre- BCG, and p-values were determined by Wilcoxon rank-sum test. Significant motifs (p < 0.05) are colored by direction of change (red=up with BCG and grey=down). FIG. 2G shows plots of chromVAR predicted enrichment of the most differentiated individual transcription factors in HSPCs, CD14+ monocytes, CD16+ monocytes, or eDCs. Color indicates statistical significance according to the scale to the right of each panel. FIG. 2H shows gene tracks depicting pseudobulk ATAC-seq accessibility peaks in HSPCs pre- (top, grey) and post-BCG (bottom, red) treatment for the HLA-C and HLA-DRB5 genes. FIG. 21 show pre- and post-BCG interferon gamma (IFNy) and antigen presentation module scores in CD14 monocytes and eDCs in individual subjects. [0146] FIGS. 3A-3J show bladder BCG directly colonizes the bone marrow and reprograms HSPCs. FIG. 3A shows an experimental schematic where mice were treated with 1, 2, 3, 4, or 5 weekly doses of bladder BCG. A week after the last dose, bone marrow from both femurs and tibiae was harvested and cultured on 7H10 agar for 3 weeks to quantify BCG colonies, as depicted on the right. The proportion of culture positive versus culture negative mice according to number of weekly BCG treatments received is displayed on the right. Quantification of the number of colonies from each mouse’s bone marrow is provided in FIG 9A. FIG. 3B shows another experimental schematic. Mice were administered 5 doses of bladder PBS, 5 doses of bladder BCG, or a single dose of intravenous BCG. Bone marrow was harvested 24 hours after the fifth dose of bladder PBS or bladder BCG and HSPC subsets were quantified by flow cytometry. Intravenous BCG samples were from an independent reference experiment and were not compared statistically with bladder PBS or bladder BCG samples. FIG. 3C shows plots of HSPC subsets quantified in the experiment of FIG. 3B. FIG. 3D shows results from colony forming assays. Morphologic quantification of colonies of the indicated types from single cell suspensions of bone marrow of mice treated with five weekly administrations of bladder PBS or bladder BCG. FIG. 3E shows an experimental schematic (left panel). Mice were implanted with MB49 tumors on Day 0 and administered 3 weekly doses of bladder PBS or bladder BCG beginning on Day 2. Bone marrow was harvested 7 days after the final administration, sorted for Lineagecells (CD3-, B220-, Terl l9-, GR1-, NK1.1-), and paired single nucleus ATAC- and RNA-seq was performed. In right panel, UMAP demonstrates cellular lineages. Cells were annotated using cell type references from SingleR. FIG. 3F shows density of PBS- or BCG-treated cells projected onto the UMAP, showing differential density in the monocyte and neutrophil precursor lineages in BCG-treated mice. FIG. 3G shows volcano plots depicting predicted differential transcription factor activity inferred from snATAC-seq for HSC/MPP, monocyte, and neutrophil populations. Red indicates significant enrichment in BCG-treated cells while gray indicates significant enrichment in PBS-treated cells. FIG. 3H shows correlation plots depicting conserved predicted differential transcription factor activity between human and mouse cell subsets. Human HSPC versus mouse HSC/MPP populations are shown on the left, human monocytes versus mouse monocytes are shown on the right. Regions of significant predicted transcription factor activity common to both humans and mice are highlighted in red. FIG. 31 shows comparison of ATAC-seq tracks generated from bulk ATAC-seq of sorted mouse LSK cells (Lineage- Scsl+ Kit+ cells) and pseudo-bulk ATAC-seq generated by concatenating all ATAC-seq reads from the HSC/MPP cluster in the single nucleus bone marrow data. Comparisons for two significant differentially accessible chromatin regions associated with antigen presentation are displayed: CD74 (top) and H2-Ebl (bottom). FIG. 3 J shows levels of cytokines in mice following five weekly doses of bladder BCG or PBS. Four days after the last dose serum was collected and levels of cytokines were measured by a Luminex immunoassay. Levels of IFN-y (top panel), G-CSF (middle panel), and TNF (bottom panel) in BCG- and PBS-treated mice are shown. P values were derived by Student’s t-test. P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P <0.001 = ***, P < 0.0001 = ****.

[0147] FIGS. 4A-4H show BCG induced HSPC reprogramming through interferon gamma encodes tumor immunity. FIG. 4A is an experimental schematic. Congenically-marked bone marrow chimeras were generated by transferring sorted bone marrow LSK cells from CD45.2^+/+ donor mice treated with 5 weekly doses of bladder PBS, 5 weekly doses of bladder BCG, or single dose intravenous BCG, into CD45.1^+/+ naive irradiated recipient mice. After confirmation of full immune cell reconstitution from donor LSK cells, mice were challenged with subcutaneous MB49 tumors and growth was monitored longitudinally. FIG. 4B shows enhancement of bone marrow myeloid output by BCG-reprogrammed HSPCs. CD45.1^+/+ naive irradiated mice were transferred bulk bone marrow from bladder PBS- or bladder BCG-treated CD45.2^+/+ donor mice. After 8 weeks, circulating CDl lb+ myeloid cells were quantified. FIG. 4C shows MB49 tumor growth curves from the experiment described in A in chimeric mice reconstituted with LSKs from bladder PBS, bladder BCG treated, or IV BCG treated. Statistical comparisons for Days 12, 14, 16, and 18 are displayed (right). FIG. 4D shows B16F10 melanoma challenge in chimeric mice from HSPCs from bladder PBS or BCG as in (FIG. 4C). FIG. 4E shows BCG induced, HSPC encoded tumor immunity depends on interferon gamma. Chimeric mice who received bone marrow from BCG treated mice with or without donor treatment with neutralizing antibodies to interferon gamma (IFN-y) or the type I interferon receptor (IFNAR1) were challenged with MB49 tumors and tumor size measured at the indicated time points. FIG. 4F shows an experimental schematic. Mixed bone marrow chimeras were generated by transferring a 1 : 1 mix of bone marrow from CD45.2^+/+ donors treated with 5 weekly doses of bladder BCG and CD45.1^+/' CD45.2^+/' naive donors (Group 1), or CD45.2^+/+ donors treated with single-dose intravenous BCG and CD45.1^+/" CD45.2^+/' naive donors (Group 2), into naive irradiated CD45.1^+/+ recipient mice. After immune reconstitution from donor bone marrow, recipient mice were challenged with MB49 bladder tumors. Tumors, spleens, and bone marrow were harvested 2 weeks post-implantation and analyzed by flow cytometry. FIG. 4G shows quantification of bone marrow HSPC populations from bladder or intravenous BCG- experienced origin versus naive origin in Group 1 and Group 2, respectively. FIG. 4H shows quantification of tumor-infiltrating myeloid cell populations from bladder or intravenous BCG-experienced origin versus naive origin in Group 1 and Group 2, respectively (top). Values represent fold change of cell frequency in the tumor compared to cell frequency in the spleen within each congenically-marked cell type. Representative flow plots are shown (bottom). Percentages shown represent the frequency of the parent gate within each congenic marker. Monocytes (left) were gated by CD45 congenic marker, CDl lb+, F4/80-, Ly6G-, and Ly6C+. Macrophages (middle) were gated by CD45 congenic marker, CD1 lb+, F4/80+, Ly6G-, and Ly6C-. Dendritic cells were gated by CD45 congenic marker, F4/80-, CD1 lc+, and MHC-II+. P values were derived by Student’s t-test. P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = **** .

[0148] FIGS. 5 A-5I show tumor control by BCG reprogramming of HSPCs depends on enhanced TNF production and phenotype of tumor neutrophils. FIG. 5 A shows an experimental schematic (left panel) and UMAP showing cellular lineages (right panel). For the experimental schematic (left panel): mice were implanted with MB49-YFP bladder tumors on Day 0 and treated with 3 weekly doses of bladder PBS or BCG on days 2, 9, and 16. On day 21 tumors were removed, and single cell suspensions were stained with a BUV395 CD45 antibody. CD45+YFP- cells were sorted and characterized by singlecell RNA sequencing. For the UMAP showing cellular lineages (right panel): cells were annotated using cell type references from SingleR. FIG. 5B shows density of TNF expression projected onto UMAP of cells from PBS (right) or BCG (left) treated mice. FIG. 5C shows mixed bone marrow chimeras were generated as described in FIG. 4F and challenged with bladder tumors after reconstitution. After 3 weeks, mice were euthanized. Tumor and spleen cells were cultured for 4 hours in the presence of brefeldin A in the absence of further stimulation, and intracellular flow cytometry was performed for TNF. Grey indicates cell derived from control bone marrow and red indicates cells derived from BCG treated bone marrow. FIG. 5D shows congenically-marked bone marrow chimeras were generated by transferring sorted bone marrow LSK cells from CD45.2^+/+ donor mice treated with a single-dose of intravenous BCG or PBS, into CD45.1^+/+ naive irradiated recipient mice. After confirmation of full immune cell reconstitution from donor cells, mice were challenged with subcutaneous MB49 tumors on day 0. A subset of each group was treated with 200ug of a TNF-blocking antibody on days -2, 0, 3, 5, 7, and 9. Longitudinal tumor growth is shown. FIG. 5E shows transcript levels of the chemokine CXCL10 and the cytokines IL-6 and TNF relative to GAPDH in mice that were given 5 weekly doses of bladder PBS or bladder BCG. Bone marrow was harvested 1 week after the final bladder treatment and bone marrow-derived macrophages (BMDMs) were generated and stimulated with LPS after 10 days of differentiation. BMDMs were stimulated with LPS for 1. RNA was extracted and qPCR was performed for the chemokine CXCL10 and the cytokines IL-6 and TNF. Data is plotted relative to GAPDH. FIG. 5F shows Longitudinal tumor growth in bone marrow chimeric mice challenged with subcutaneous MB49 tumors and receiving Ly6G depleting antibody. Bone marrow chimeras were generated by transferring bulk bone marrow from donor mice treated with one dose of intravenous BCG or PBS 6 weeks prior into naive irradiated recipient mice. After reconstitution, chimeric mice were challenged with subcutaneous MB49 tumors on day 0. A subset of mice from each group received 250ug of Ly6G depleting antibody on days -2, 0, 2, 5, 7, and 9. Longitudinal tumor growth is shown. FIG. 5G shows average gene score of T3 neutrophils BCG or PBS treated tumors. Neutrophils are boxed in red. FIG. 5H shows dot plot of genes representing Tl, T2, or T3 neutrophils. FIG. 51 shows stacked bar plot of frequency of Tl, T2, or T3 neutrophils (left) and ratio of T3 to T2 neutrophils in tumors from PBS- and BCG-treated mice.

[0149] FIGS. 6A-6H show BCG reprogramming of HSPCs augments MHC expression in myeloid cells and improves T cell activation and recruitment. FIG. 6A shows correlation plots depicting relative expression of RNA transcripts in BCG versus PBS conditions in neutrophil progenitors versus tumor neutrophils (left panel) and in monocyte progenitors versus tumor monocytes (right panel). FIG. 6B shows correlation plot between human circulating monocytes and mouse tumor monocytes showing shared transcriptional signature in the BCG-treated conditions. FIG. 6C shows proportion of tumor neutrophils expressing MHC II in mice implanted with MB49 bladder tumors and treated with BCG or PBS . Mice were implanted with MB49 bladder tumors on Day 0 and treated with 3 weekly doses of BCG or PBS on days 2, 9, and 16. On day 21 tumors were removed and single cell suspensions made and stained for flow cytometry. Proportion of tumor neutrophils expressing MHC II is shown. FIG. 6D shows expression of MHC II in splenic monocytes and neutrophils from mixed chimera experiment shown in FIG. 4F. FIG. 6E shows averaged gene score from T cells (GO: 0042110) in the single-cell RNAseq data from the experiment shown in FIG. 5A. FIG. 6F shows an experimental Schematic. Bone marrow chimeras were generated by transferring bulk bone marrow from CD45.2^+/+donor mice treated with 5 weekly doses of bladder BCG, 5 weekly doses of bladder PBS, or single-dose intravenous BCG, into naive irradiated CD45.1^+/' recipient mice. After 9 weeks to allow for full reconstitution of the immune system from donor bone marrow, chimeric mice were challenged with bladder MB49^OVA tumors, and CD45.1^+/+ OT-I and OT-II T cells 10 days later. Bladder tumors were harvested 5 days after T cell transfer to assess tumor-specific T cell frequency. FIG. 6G shows representative histograms depicting the frequency of OT-I T cells in bladder tumors among total CD8+ cells in bladder PBS-, bladder BCG-, and intravenous BCG- experienced bone marrow recipients are shown at left. Quantification of OT-I and OT-II T cell frequency for all groups is shown at right. FIG. 6H shows proportion of OT-I and OT-II cells that had proliferated out of total tumor OT-I and OT-II cells in the experiment shown in FIG. 6F.

[0150] FIGS. 7A-7D shows HSPC encoded tumor immunity depends on eDCs and T cells and synergizes with T cell directed immunotherapies. FIG. 7A shows tumor growth in chimeric mice challenged with subcutaneous MB49 tumors and treated with bladder BCG or PBS. Bone marrow chimeras were generated by transferring bulk bone marrow from donor mice treated with 5 weekly doses of bladder BCG or PBS into naive irradiated recipient mice. After reconstitution, chimeric mice were challenged with subcutaneous MB49 tumors on day 0. One group of recipients with bone marrow from a BCG treated mouse received 250ng of CD4 and CD8 depleting antibodies on days -2, 0, 2, 5, 7, and 9. Tumor growth was measured. FIG. 7B shows tumor growth in bone marrow chimeric mice generated by bone marrow transfer from ZBTB46-DTR mice treated with intravenous BCG or PBS. Specifically, bone marrow chimeras were generated by transferring bulk bone marrow from ZBTB46- DTR donor mice treated with one dose of intravenous BCG or PBS 6 weeks prior into naive C57BL/6 irradiated recipient mice. After reconstitution, chimeric mice were challenged with subcutaneous MB49 tumors on day 0. A subset of each group was injected intraperitoneally with diphtheria toxin 200ng per mouse on days -2, 1, 4, 7, 11, 14, 17, and 20. Tumor growth on day 11 and 14 was measured. FIG. 7C shows growth in chimeric mice (generated as in FIG. 7A) and challenged with subcutaneous or bladder MB49 tumors followed by 5 doses of anti-PD-1 or PBS every 2 days following. Mice were euthanized if tumor measurement surpassed 14mm in any dimension or if tumors were ulcerated. FIG. 7D shows survival of mice from the experiment described in FIG. 7C. P values for bar graphs were derived by Student’s t-test. P values for survival curves were derived by log-rank test. P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = ****.

[0151] FIGS. 8A-8J shows that multiomic analysis reveals trained HSPC phenotypes in BCG-treated bladder cancer patients at two separate institutions. FIG. 8 A shows (left): dot plot of marker gene expression (columns) in each RNA PhenoGraph cluster (rows) and (right): UMAP visualization of RNA data. On the left, clusters are labeled by cluster number and the corresponding annotated cell type association. Dots are colored by mean expression per cluster, and dot size corresponds to the fraction of cells in the cluster with non-zero expression of that gene. On the right, UMAP visualization of RNA data is colored by HSPC score. FIG. 8B shows volcano plots of differentially expressed genes post- versus pre-BCG in HSPCs, eDCs, and CD14+ monocytes in Cohort 2. Significant differentially expressed genes (fdr < 0.05) are colored according to their relative enrichment up or down, and the number of cells analyzed per group is given above each plot. FIG. 8C shows UMAP visualizations of RNA and ATAC data modalities from all collected samples, from both cohorts colored by (top to bottom) sample entropy score, patient cohort, RNA PhenoGraph cluster, and pre- or post-BCG treatment status. FIG. 8D shows histograms of entropy score per cell in the RNA (left) and ATAC (right) datasets from both cohorts. Shannon entropy is used as a measure of sample mixing in the local neighborhood (30 nearest neighbors) of a cell, calculated from the distribution of cells from each sample in that neighborhood. FIG. 8E shows heatmap depicting all differentially expressed genes (FDR <0.01 in at least one cell type) post- versus pre-BCG in HSPCs, CD14+ monocytes, and eDCs from both cohorts. FIG. 8F shows gene ontology terms shared by HSPCs and eDCs based on significant differentially expressed genes in the combined RNA-seq dataset. FIG. 8G shows heat map of enrichment scores from ChromVAR for IRF transcription factors by cell type from combined cohorts. FIG. 8H shows volcano plots of differential chromVAR motif accessibility in HSPCs, eDCs, and CD14+ monocytes from both patient cohorts. MeanDiff is the difference in average chromVAR score for accessible peaks post- versus pre- BCG, and p-values were determined by Wilcoxon ranksum test. Significant motifs (p < 0.05) are colored according to relative enrichment up or down. FIG. 81 shows average gene score from Interferon gamma (GO: 0034341) category in CD 14 monocytes, eDCs and HSPCs pre- (left) and post- (right) BCG. FIG. 8J shows average gene score from antigen presentation (G0:0019882) category in CD14 monocytes, eDCs and HSPCs pre- (left) and post- (right) BCG.

[0152] FIGS. 9A-9F show that BCG colonizes the bone marrow after direct bladder administration and improves survival against bladder tumors. FIG. 9A shows individual colony forming units (CFU) data points from 100% of bone marrow from both femurs and tibiae from the time-course experiment depicted in FIG. 3 A. Error bars represent SEM. FIG. 9B shows BCG-specific PCR of genomic DNA extracted from 10% of the bone marrow of both femurs and tibiae of mice treated with one dose of IV BCG (lane #1), five weekly doses of bladder PBS (lanes #2,3), or five weekly doses of bladder BCG (lanes #4-12). Ladder shown in lane #13. Expected band size 150bp. FIG. 9C shows gating hierarchy used to assess bone marrow hematopoietic stem and progenitor cell subsets in FIG. 3. FIG. 9D shows quantification of Lineage- SCA1+ KIT+ (LSK) HSPC expansion following PBS, subcutaneous BCG, or bladder BCG administration. Error bars represent SD. FIG. 9E shows an experimental schematic. Mice were implanted with MB49 bladder tumors on Day 0 and administered one of the following regimens beginning on Day 2: 5 weekly doses of bladder PBS, 5 weekly doses of bladder BCG, a single dose of intravenous BCG, or a combination of single-dose intravenous BCG and 5 weekly doses of bladder BCG. Survival was monitored throughout. FIG. 9G shows survival curve from the experiment depicted in FIG. 9E. P values for bar graphs were derived by Student’s t-test. P values for survival curves were derived by log-rank test.

P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = **** . [0153] FIGS. 10A-10I show bladder BCG administration induces a systemic immune response resulting in altered chromatin accessibility and immune function in mice consistent with human BCG- treated bladder cancer patient phenotypes. FIG. 10A shows dot plot of marker gene expression (columns) in each RNA PhenoGraph cluster (rows). Clusters are labeled by corresponding annotated cell type association, dots are colored by mean expression per cluster, and dot size corresponds to the fraction of cells in the cluster with non-zero expression of that gene. FIG. 10B shows neutrophil module score from snRNA-seq of HSPCs from pre- and post- BCG human bladder cancer patients. FIG. 10C shows volcano plots from snRNA-seq showing significant differentially expressed genes for HSC MPP, monocytes, and neutrophils in mice with or without bladder BCG treatment. FIG. 10D shows correlation plots depicting differentially expressed genes conserved between human and mouse cell subsets. Human monocyte versus mouse monocyte populations are shown on the left, human conventional dendritic cells versus mouse monocyte precursor populations are shown on the right. Significant differentially expressed genes common to both humans and mice are highlighted in red. FIG. 10E shows an experimental schematic. Mice were administered one of the following regimens beginning on Day 0: 5 weekly doses of bladder PBS, 5 weekly doses of bladder BCG, or a single dose of intravenous BCG. On Day 30, bone marrow was harvested and ATAC-seq was performed on sorted LSK cells. FIG. 10F shows Principal Component Analysis (PCA) of ATAC-seq data from sorted LSKs from the bone marrow of mice treated with five doses of bladder BCG. FIG. 10G shows volcano plot showing fold change of ATAC-seq peaks in LSKs from bladder PBS- versus bladder BCG-treated mice. FIG. 10H shows HOMER motif enrichment analysis of differential ATAC-seq peaks in bladder PBS- versus bladder BCG-treated mice. FIG. 101 shows levels of IL-12p70, CXCL5, CXCL10, and IL-10 in BCG- and PBS-treated mice. Mice received five weekly doses of bladder BCG or PBS. Four days after the last dose serum was collected and levels of cytokines and chemokines were measured by a Luminex immunoassay. Error bars represent SD. P values for bar graphs were derived by Student’s t-test.

P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = **** .

[0154] FIGS. 11A-11F show BCG-experienced HSPC transplantable model improves tumor control and alters HSPC subsets and tumor infiltrating immune cells. FIG. 11A shows from left to right: Tumor growth in naive irradiated recipient mice that received whole bone marrow from bladder PBS- or bladder BCG-treated donors, followed by subcutaneous challenge with MB49 tumors (left panel); mid-curve time points quantified for each cell line (middle panel); and proportion of donor-derived leukocytes out of total leukocytes in the bone marrow chimeric mice (right panel). Error bars represent SD. FIG. 1 IB shows subcutaneous tumor growth in naive irradiated recipient mice that received a transfer of sorted LSK cells expanded for 3 weeks on PVA media and treated with isoniazid for the entire duration. FIG. 11C shows quantification of additional bone marrow HSPC populations in mice from the experiment depicted in FIG. 4G. Representative flow plots for each population are shown on bottom. Error bars represent SD. FIG. 1 ID shows proportion of leukocytes derived from host, or either of the two donors in the mixed bone marrow chimeric mice. Error bars represent SD. FIG. 1 IE shows (Top) equation used to normalize tumor immune cell populations to relative engraftment efficiency and (Bottom): Representative flow plots of tumors from mixed chimeric mice from FIG. 4H. FIG. 1 IF shows quantification of T cell subsets from the mixed bone marrow chimera experiment depicted in FIG. 4H. Error bars represent SD. P values for bar graphs were derived by Student’s t-test. P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = ****.

[0155] FIGS. 12A-12G show BCG-experienced HSPCs confer increased augmented function in myeloid cells and drive increased lymphocyte recruitment and proliferation. FIG. 12A shows, on the left, a dot plot of marker genes utilized for cell-type annotation and, on the right, UMAP of all cells colored by treatment condition. FIG. 12B shows volcano plots of differentially expressed genes post BCG from the tumor single cell RNA sequencing in monocytes, neutrophils, and T cells. FIG. 12C shows representative flow plots from data shown in FIG. 5C. FIG. 12D shows macrophage foldexpansion from bone marrow cells in the experiment shown in FIG. 5E. Error bars represent SD. FIG. 12E shows representative flow plots from the experiment shown in FIG. 6C. FIG. 12F shows a fraction of OT-II cells of total CD4 cells in tumors from bladder PBS, bladder BCG, or intravenous BCG treated mice. Error bars represent SD. FIG. 12G shows representative flow plots from the experiment shown in FIG. 6G. P values for bar graphs were derived by Student’s t-test. P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = ****.

[0156] FIGS. 13A-13B shows HSPC encoded tumor immunity depends on eDCs and T cells and synergizes with T cell directed immunotherapies. FIG. 13 A shows validation of dendritic cell depletion after DT administration in the ZBTB46-DTR bone marrow chimeric mice. Error bars represent SD. FIG. 13B shows tumor sizes in specific time points from the experiment shown in FIG. 7C. Error bars represent SD. P values for bar graphs were derived by Student’s t-test. P > 0.05 = ns, P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = ****.

DETAILED DESCRIPTION

I. Overview

[0157] The present disclosure is based, in part, on the discovery that levels of circulating cells in peripheral blood can capture diversity of HSPC in bone marrow, and importantly, capture epigenetic changes and other alterations to hematopoiesis induced by therapies (e.g., cancer therapies). As described further below, this discovery allowed for the discovery of persistent epigenetic and transcription programs in these circulating cells that are indicative of responsiveness to various therapies (e.g., cancer therapies). Further, the discovery that local administration of certain therapies (e.g., microbial therapies like Bacillus Calmette-Guerin (BCG)), induce systemic epigenetic changes and alterations to hematopoiesis in bone marrow derived circulating cells demonstrates that these local therapies can now be applied to treat systemic conditions.

[0158] Bacillus Calmette-Guerin (BCG) is an attenuated strain of Mycobacterium bovis used worldwide as a live vaccine for tuberculosis. BCG is also the first cancer immunotherapy and the only bacterial therapy for cancer. Intravesical BCG therapy, the instillation of live BCG directly into the bladder, is the standard of care for non-muscle-invasive bladder cancers (NMIBC) due to its ability to reduce recurrence rates and improve overall survival when compared with surgical resection alone. However, approximately 50% of bladder cancer patients fail to maintain durable responses to BCG therapy, and there are no well-established biomarkers to predict responses in advance of treatment initiation, in part due to an incomplete understanding of the mechanism by which BCG mediates tumor clearance.

[0159] Following bladder instillation, BCG attaches to urothelial cells, resulting in recruitment and tumor infiltration of myeloid and lymphoid cells in both humans and mice. In mouse models, bladder tumor rejection is mediated by tumor specific CD4 and CD8 T cell immunity. Complementary evidence from human studies has identified tumor-specific CD4 T cells in BCG-treated patients with NMIBC. These effects of BCG are presumed to be mediated locally within the bladder, but the upstream events stimulated by BCG that enable tumor-specific immunity remain poorly defined.

[0160] The development of BCG as the first cancer immunotherapy emerged from studies of the effect of microbes and microbial products on tumor growth. Despite its well- established clinical efficacy, the detailed mechanisms by which BCG controls tumors have remained elusive. Recent evidence in mouse models and human patients indicated that BCG-mediated tumor rejection is dependent on tumor specific T cells. Prior to the discoveries by the inventors, outlined in the Examples below, the accepted model of anti-tumor effects of BCG, and the rationale for its administration in the bladder, was that it acts as a local immunotherapy at the site of administration to improve anti-tumor T cell priming. Upstream immunologic events stimulated by BCG that enable this immunity were unknown.

[0161] Adding to the confusion in the state of the field prior to the present disclosure, it was well understood that a fundamental principle of vaccination is the induction of antigen-specific T and B cell immunity. However, it had become clear that BCG vaccination elicited innate immune responses that could cross-protect against antigenically unrelated pathogens, including viruses. Aspects of this phenomenon was attributed to innate immune memory or trained immunity which is the reprogramming of hematopoietic progenitors in the bone marrow and subsequent skewing of the abundance and function of myeloid cell progeny. However, at the time of the present disclosure, it was not known if administration of BCG directly into the bladder was capable of inducing central innate immune memory and if this progenitor encoded or “central” innate immune memory contributes to the anti -tumor effects of BCG.

[0162] Microbes and their products, including BCG, can lead to epigenetic changes in innate immune cells that confer an increased capacity to respond not only to homologous but to heterologous immune stimuli, a process termed innate immune memory or trained immunity. The persistence of these phenotypes in short lived innate immune cells is explained by microbe-induced epigenetic changes in hematopoietic stem and progenitor cells (HSPCs) in the bone marrow. Epigenetic changes in HSPCs (central innate immune memory) are associated with skewed hematopoiesis toward myeloid cell production (myelopoiesis) and can be passed to progeny cells, poising mature myeloid cells for heterologous immunity. Single-cell analysis of gene expression in human monocytes following BCG vaccination revealed that increased activity of type II versus type I interferon programs is associated with augmented innate immune function. This augmented innate immune activity can confer heterologous protection against infection, including against respiratory viruses in BCG vaccinated children or elderly nursing home residents. Both the fungal cell wall component beta-glucan and a synthetic bone marrow targeted peptidoglycan have been shown to augment antitumor immunity in mouse models of melanoma via myeloid-reprogramming, highlighting the potential of therapeutically tuning these pathways. Although intravenous BCG administration also generates innate immune memory at the level of HSPCs, it was unknown at the time of the disclosure, whether HSPC- reprogramming occurs upon BCG administration in the bladder and whether this effect contributes to anti-tumor immunity. At the same time, whether any immunological effects following intra-bladder administration of BCG (e.g., increased circulating cytokines, modified monocyte phenotypes, and reduced frequency of upper respiratory infections) could relate to anti-tumor immunity was unknown. Equally unknown were any mechanisms involved, including whether certain cell populations (e.g., HSPC) were altered. To this end, the inventors sought, in part, to understand how bladder BCG, as a long-standing human immunotherapy, contributes to anti-tumor immunity, including if it acts systemically to reprogram HSPCs and, if so, how this reprogramming contributes to a functional antitumor response.

[0163] As described in Examples 1-13 herein, the inventors demonstrate that that intra-bladder BCG reprograms HSPC, which pass on augmented antigen presentation and migratory potential to mature innate immune cells to remodel the tumor microenvironment and drive anti-tumor T cell responses. These studies highlight the potential of tuning HSPC phenotypes to enhance the innate drivers of T cell dependent anti -tumor immunity. Further, this discovery revises the understanding of BCG’s anti- tumor effects, including in the context of its active and longstanding clinical use as the first microbial immunotherapy, demonstrating potent systemic effects. It is shown that bladder administration modifies the epigenetic and transcriptional landscape of bone marrow hematopoietic stem cells in both mice and humans. BCG administered to the bladder mucosal epithelium in mice traffics to the bone marrow, a finding that can be directly demonstrated by cultivating viable BCG from the bone marrow. These data indicate that the hematopoietic-reprogramming previously implicated in the heterologous protection from infection conferred by early life intradermal BCG vaccination in human and by intravenous administration in mice is a shared and intrinsic part of BCG-mediated immunotherapy of cancer. Furthermore, it was surprisingly found that BCG-reprogrammed HSPCs were sufficient to confer anti-tumor immunity to recipient mice, indicating a durable and persistent cell- intrinsic memory in progenitor cells that is conveyed through differentiation to mature myeloid cells. Singlecell ATAC and RNA sequencing data from mice and humans, coupled with functional characterization of mixed bone marrow chimeras, further indicate that a broad enhancement of myeloid function contributes to the antitumor effects of innate immune memory.

[0164] Functionally, myeloid cells derived from BCG reprogrammed HSPCs broadly remodel the tumor microenvironment. The tumor microenvironment (TME) changes that drive BCG stimulated tumor immunity include a functional dependence on and reprogramming of neutrophils, a critical role for TNF, as well as enhanced infiltration of tumors with inflammatory monocytes and DCs. Importantly, the inventors also show that tumor neutrophils derived from BCG- reprogrammed HSPC are resistant to conversion to pro-tumor, pro-angiogenic T3 neutrophils by the tumor microenvironment, supporting the idea that central trained immunity may also interfere with the ability of the tumor to co-opt neutrophils. Further, anti-tumor HSPC reprogramming was dependent on IFN- y but not type I IFN and featured prominent epigenetic priming of antigen presentation pathways with augmented expression in mature myeloid progeny cells and driving increased antitumor T cell responses. Of substantial clinical significance, the myeloid cell progeny of BCG-experienced HSPCs strongly amplify the response to PD-1 blockade, thereby directly coupling innate immune memory to the anti-tumor T cell response.

[0165] These findings have implications for the use of BCG in bladder cancer but also as a broad immunotherapy against other cancers. BCG remains the standard of care for non-muscle-invasive bladder cancers, but a substantial minority of treated patients will experience tumor recurrence and there are no reliable pre-treatment predictors of response. The data in Examples 1-13, below, indicate that inter-individual differences in either pretreatment or BCG-induced innate immune memory is indicative of an individual’s response to BCG and that these differences can be tracked using PBMC- PIE (described in PCT/US2023/062066, incorporated herein by reference in its entirety). [0166] More broadly, the data in Examples 1-13 suggest that augmenting the abundance and function of the myeloid compartment through HSPC-reprogramming is an effective method to improve antitumor immunity, including and especially in combination with immune checkpoint blockade. There is substantial evidence that dendritic cell abundance and function are important determinants of checkpoint blockade activity, but harnessing this knowledge for DC- derived therapies is limited by the short lifespan of these cells. Reprogramming DC activity at the level of progenitors may represent an approach to overcome their short lifespan and TME-mediated suppression of DC maturation and antigen presentation. A recent meta-analysis showed that in patients receiving BCG for bladder cancer a high neutrophil to lymphocyte ratio in the peripheral blood pretreatment was associated with worse recurrence free survival, supporting a pro-tumorigenic role for neutrophils in the pre-BCG setting. Relating to TME-mediated reprogramming of immune cells, it was also demonstrated that BCG experienced HSPCs generate neutrophils that resist pro-tumor and angiogenic programming and instead directly contribute to tumor control. These findings demonstrate that this FDA approved immunotherapy of cancer (in use for half a century) works in part through creating resilient anti-tumor neutrophil programs. More broadly, the data shown herein below suggests that HSPC-reprogramming, including by BCG administered to the bladder, may provide a strategy for more durable alterations in myeloid function to enable successful anti-tumor immune responses systemically and across a range of anatomical locations and tumor types.

[0167] In view of the above, this specification describes various exemplary embodiments of systems, software and methods for enriching and characterizing circulating cells, including hematopoietic stem and progenitor cells (HSPCs), innate lymphoid cell progenitors (ILCP), CD14+ monocytes (CD14 M.), dendritic cells (DC), and neutrophils (NEU), from peripheral blood. This can be used, for example to assess innate immune cell epigenetic alterations induced by different therapies in humans. In particular, embodiments of the disclosure encompass methods of enriching and characterizing the rare circulating cells to identify epigenetic and transcriptional signatures associated with anti-tumor immunity. These signatures can then be used to predict responsiveness of a subject with cancer to a therapy, identify a therapeutic target for a therapy (e.g., a cancer therapy), and/or to treat a subject with cancer. The disclosure, however, is not limited to these exemplary embodiments and applications or to the manner in which the exemplary embodiments and applications operate or are described herein. [0168] As noted, the inventors have discovered key epigenetic and transcriptional signatures associated with anti-tumor immunity in rare circulating cells following administration of certain therapies, that are indicative of an altered innate immune responsiveness. These durable epigenetic and transcription programs following administration of certain therapies (e.g., BCG) are described further below and were linked to increased antigen presentation, increased TNF production, increased interferon gamma production, increased granulopoiesis, increased neutrophil reprogramming into an anti-tumor phenotype, increased macrophage or monocyte expression of genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gammamediated signaling, and/or anti-tumor responses, altered proportions or phenotypes of pHSPC subsets related to changes in granulopoeisis, altered or augmented activation states, altered or augmented inflammatory programs, altered or augmented antigen presentation, and/or altered or augmented cytokine responsiveness and/or included enrichment for one or more genes related to antigen presentation, interferon gamma-mediated signaling, platelet aggregation, cell-cell adhesion, cytokine production and signaling, positive regulation of ATP biosynthesis, activation, differentiation, and/or anti-tumor response.

[0169] In accordance with various embodiments, non-limiting examples of systems and methods are provided for identifying a cellular or molecular target for therapy and/or predicting responsiveness to a therapy based on transcriptional and epigenetic signatures in circulating cells in peripheral blood of a subject.

[0170] In accordance with various embodiments, methods for systemically treating a subject for cancer are provided, the methods comprising administering a therapy to a subject diagnosed with cancer, wherein the subject has been determined to be responsive to the therapy via a classifier based at least in part on analyzing expression levels in the subject of epigenetic and transcriptional signatures associated with anti -tumor immunity in one or more populations of circulating cells in the subject. Also in accordance with various embodiments, further methods for systemically treating a subject are provided, the methods comprising localized administration of a microbial therapy to the subject.

[0171] In various embodiments, a system of one or more computers can be provided that can be configured to perform particular operations or actions by virtue of having software, firmware, hardware, or a combination of them installed on the system that in operation causes or cause the system to perform the actions. One or more computer programs can be configured to perform particular operations or actions by virtue of including instructions that, when executed by data processing apparatus, cause the apparatus to perform the actions. In accordance with various embodiments, a method can be provided wherein the system of one or more computers is used to characterize transcriptional and epigenetic signatures in one or more circulating cells based on transcriptomic and epigenomic analysis.

[0172] In various embodiments, a non-transitory computer-readable medium storing computer instructions can be provided that performs a method for characterizing transcriptional and epigenetic signatures in one or more circulating cells based on transcriptomic and epigenomic analysis. The method can include receiving a set of single cell and/or bulk mRNA and ATACset data for one or more circulating cells; analyzing the circulating cells mRNA and ATACseq data via in depth transcriptomic and epigenomic analysis to identify differentially accessible regions (DARs); and generating an output comprising differentially expressed genes (DEG) and differential activity in domains of regulatory chromatin (DORC) for the one or more circulating cells to determine DEG transcriptional enrichment and DORC epigenetic enrichment, thereby characterizing transcriptional and epigenetic signatures of the circulating cells.

[0173] In various embodiments, a system can be provided for characterizing transcriptional and epigenetic signatures in one or more circulating cells based on transcriptomic and epigenomic analysis. The system can include a data store configured to store a set of single cell and/or bulk mRNA and ATACset data for one or more circulating cells. The system can also include a computing device communicatively connected to the data store, including a multi-layer training engine configured to generate a trained multi-layer model for transcriptional and epigenetic signature characterization.

[0174] Other embodiments of these aspects include corresponding computer systems, apparatus, and computer programs recorded on one or more computer storage devices, each configured to perform the actions of the methods.

[0175] In the present disclosure, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols generally identify similar components, unless context dictates otherwise. The illustrative alternatives described in the detailed description, drawings, and claims are not meant to be limiting. Other alternatives may be used and other changes may be made without departing from the spirit or scope of the subject matter presented here. It will be readily understood that the aspects, as generally described herein, and illustrated in the Figures (FIGS.), can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are explicitly contemplated and make part of this application.

[0176] The practice of the present disclosure will employ, unless otherwise indicated, techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology. Such techniques are explained fully in the literature, such as Sambrook, J., & Russell, D. W. (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, D. W. (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as “Sambrook”); Ausubel, F. M. (1987). Current Protocols in Molecular Biology . New York, NY: Wiley (including supplements through 2014); Bollag, D. M. et al. (1996). Protein Methods. New York, NY: Wiley -Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, M. G. et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, K. B., Ferre, F. & Gibbs, R. (1994). PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, E. A. (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, S. L. et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements through 2014); and Makrides, S. C. (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences B.V., the disclosures of which are incorporated herein by reference.

[0177] All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing devices, compositions, formulations and methodologies which are described in the publication and which might be used in connection with the present disclosure.

[0178] The disclosure, however, is not limited to these exemplary embodiments and applications or to the manner in which the exemplary embodiments and applications operate or are described herein. Moreover, the figures may show simplified or partial views, and the dimensions of elements in the figures may be exaggerated or otherwise not in proportion.

II. Exemplary Descriptions of Terms

[0179] Unless otherwise defined, all terms of art, notations, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this application pertains. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.

[0180] It should be understood that any use of subheadings herein are for organizational purposes, and should not be read to limit the application of those subheaded features to the various embodiments herein. Each and every feature described herein is applicable and usable in all the various embodiments discussed herein and that all features described herein can be used in any contemplated combination, regardless of the specific example embodiments that are described herein. It should further be noted that exemplary description of specific features are used, largely for informational purposes, and not in any way to limit the design, subfeature, and functionality of the specifically described feature. [0181] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0182] Reference throughout this specification to “one embodiment,” “an embodiment,” “a particular embodiment,” “a related embodiment,” “a certain embodiment,” “an additional embodiment,” or “a further embodiment” or combinations thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in various embodiments.

[0183] In addition, as the terms “on”, “attached to”, “connected to”, “coupled to”, or similar words are used herein, one element (e.g., a material, a layer, a substrate, etc.) can be “on”, “attached to”, “connected to”, or “coupled to” another element regardless of whether the one element is directly on, attached to, connected to, or coupled to the other element or there are one or more intervening elements between the one element and the other element. In addition, where reference is made to a list of elements (e.g., elements a, b, c), such reference is intended to include any one of the listed elements by itself, any combination of less than all of the listed elements, and/or a combination of all of the listed elements. Section divisions in the specification are for ease of review only and do not limit any combination of elements discussed.

[0184] Use of ordinal terms such as “first”, “second”, “third”, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements. Similarly, the use of these terms in the specification does not by itself connote any required priority, precedence, or order.

[0185] As used herein, “substantially” means sufficient to work for the intended purpose. The term “substantially” thus allows for minor, insignificant variations from an absolute or perfect state, dimension, measurement, result, or the like such as would be expected by a person of ordinary skill in the field but that do not appreciably affect overall performance. When used with respect to numerical values or parameters or characteristics that can be expressed as numerical values, “substantially” means within ten percent.

[0186] The term “ones” means more than one.

[0187] As used herein, the term “plurality” can be 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.

[0188] As used herein, the term “set of’ means one or more. For example, a set of items includes one or more items.

[0189] As used herein, the phrase “at least one of,” when used with a list of items, means different combinations of one or more of the listed items may be used and only one of the items in the list may be needed. The item may be a particular object, thing, step, operation, process, or category. In other words, “at least one of’ means any combination of items or number of items may be used from the list, but not all of the items in the list may be required. For example, without limitation, “at least one of item A, item B, or item C” means item A; item A and item B; item B; item A, item B, and item C; item B and item C; or item A and C. In some cases, “at least one of item A, item B, or item C” means, but is not limited to, two of item A, one of item B, and ten of item C; four of item B and seven of item C; or some other suitable combination.

[0190] As used herein, the terms “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “have”, “having”, “include”, “includes”, and “including” and their variants are not intended to be limiting, are inclusive or open-ended and do not exclude additional, unrecited additives, components, integers, elements or method steps. For example, a process, method, system, composition, kit, or apparatus that comprises a list of features is not necessarily limited only to those features but may include other features not expressly listed or inherent to such process, method, system, composition, kit, or apparatus. By “consisting of’ is meant including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of’ indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of’ is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of’ indicates that the listed elements are required or mandatory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

[0191] Where values are described as ranges, it will be understood that such disclosure includes the disclosure of all possible sub-ranges within such ranges, as well as specific numerical values that fall within such ranges irrespective of whether a specific numerical value or specific sub-range is expressly stated.

[0192] As used herein the specification, “a”, “an”, and “the,” may mean one or more. These terms generally refer to singular and plural references unless the context clearly dictates otherwise. As used herein in the claim(s), when used in conjunction with the word “comprising,” the words “a” or “an” may mean one or more than one. Some embodiments of the disclosure may consist of or consist essentially of one or more elements, method steps, and/or methods of the disclosure. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. “A and/or B” is used herein to include all of the following alternatives: “A”, “B”, “A or B”, and “A and B”.

[0193] The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.” For example, “x, y, and/or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.” It is specifically contemplated that x, y, or z may be specifically excluded from an embodiment. As used herein “another” may mean at least a second or more.

[0194] Whenever the term “at least,” “greater than,” or “greater than or equal to” precedes the first numerical value in a series of two or more numerical values, the term “at least,” “greater than” or “greater than or equal to” applies to each of the numerical values in that series of numerical values. For example, greater than or equal to 1, 2, or 3 is equivalent to greater than or equal to 1, greater than or equal to 2, or greater than or equal to 3.

[0195] Whenever the term “no more than,” “less than,” or “less than or equal to” precedes the first numerical value in a series of two or more numerical values, the term “no more than,” “less than,” or “less than or equal to” applies to each of the numerical values in that series of numerical values. For example, less than or equal to 3, 2, or 1 is equivalent to less than or equal to 3, less than or equal to 2, or less than or equal to 1.

[0196] As used herein, a “subject” or an “individual” includes animals, such as human (e.g., human individuals) and non-human animals. The term “non-human animals” includes all vertebrates, e.g., mammals, e.g., rodents, e.g., mice, non-human primates, and other mammals, such as e.g., rat, mouse, cat, dog, cow, pig, sheep, horse, goat, rabbit; and non-mammals, such as amphibians, reptiles, etc. A subject can be a mammal, preferably a human or humanized animal. The subject may be in need of prevention and/or treatment of a disease or disorder such as cancer. The subject may have cancer or be predisposed to developing cancer. [0197] The term “patient,” as used herein, generally refers to a mammalian subject. The mammal can be a human, or an animal including, but not limited to an equine, porcine, canine, feline, ungulate, and primate animal. In one embodiment, the individual is a human. The methods and uses described herein are useful for both medical and veterinary uses. A “patient” is a human subject unless specified to the contrary.

[0198] “Treating” or treatment of a disease or condition refers to executing a protocol, which may include administering one or more drugs to an individual, such as a patient (or subject), in an effort to alleviate signs or symptoms of the disease. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis. Alleviation can occur prior to signs or symptoms of the disease or condition appearing, as well as after their appearance. Thus, “treating” or “treatment” may include “preventing” or “prevention” of disease or undesirable condition. In addition, “treating” or “treatment” does not require complete alleviation of signs or symptoms, does not require a cure, and specifically includes protocols that have only a marginal effect on the patient.

[0199] The term “therapeutically effective” as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of one or more signs or symptoms of a disease, including a cancer. In some embodiments, administering a therapeutically effective amount results in treating the condition to some degree.

[0200] The term “sample,” as used herein, generally refers to a sample from a subject of interest and may include a biological sample of a subject. The sample may include a cell sample. The sample may include a cell line or cell culture sample. The sample can include one or more cells. The sample can include one or more microbes. The sample may include a nucleic acid sample or protein sample. The sample may also include a carbohydrate sample or a lipid sample. The sample may be derived from another sample. The sample may include a tissue sample, such as a biopsy, core biopsy, needle aspirate, or fine needle aspirate. The sample may include a fluid sample, such as a blood sample, urine sample, or saliva sample. The sample may include a skin sample. The sample may include a cheek swab. The sample may include a plasma or serum sample. The sample may include a cell-free or cell free sample. A cell-free sample may include extracellular polynucleotides. The sample may originate from blood, plasma, serum, urine, saliva, mucosal excretions, sputum, stool, or tears. The sample may originate from red blood cells or white blood cells. The sample may originate from feces, spinal fluid, CNS fluid, gastric fluid, amniotic fluid, cyst fluid, peritoneal fluid, marrow, bile, other body fluids, tissue obtained from a biopsy, skin, or hair. [0201] Similarly, the terms “biological sample,” “biological specimen,” or “biospecimen” as used herein, generally refers to a specimen taken by sampling so as to be representative of the source of the specimen, typically, from a subject. A biological sample can be representative of an organism as a whole, specific tissue, cell type, or category or sub-category of interest. Biological samples may include, but are not limited to stool, synovial fluid, whole blood, blood serum, blood plasma, urine, sputum, tissue, saliva, tears, spinal fluid, tissue section(s) obtained by biopsy; cell(s) that are placed in or adapted to tissue culture; sweat, mucous, gastric fluid, abdominal fluid, amniotic fluid, cyst fluid, peritoneal fluid, pancreatic juice, breast milk, lung lavage, marrow, gastric acid, bile, semen, pus, aqueous humor, transudate, and the like including derivatives, portions and combinations of the foregoing. In some examples, biological samples include, but are not limited, to stool, biopsy, blood and/or plasma. In some examples, biological samples include, but are not limited, to urine or stool. Biological samples include, but are not limited, to biopsy. Biological samples include, but are not limited, to tissue dissections and tissue biopsies. Biological samples include, but are not limited, any derivative or fraction of the aforementioned biological samples. The biological sample can include a macromolecule. The biological sample can include a small molecule. The biological sample can include a virus. The biological sample can include a cell or derivative of a cell. The biological sample can include an organelle. The biological sample can include a cell nucleus. The biological sample can include a rare cell from a population of cells. The biological sample can include any type of cell, including without limitation prokaryotic cells, eukaryotic cells, bacterial, fungal, plant, mammalian, or other animal cell type, mycoplasmas, normal tissue cells, tumor cells, or any other cell type, whether derived from single cell or multicellular organisms. The biological sample can include a constituent of a cell. The biological sample can include nucleotides (e.g., ssDNA, dsDNA, RNA), organelles, amino acids, peptides, proteins, carbohydrates, glycoproteins, or any combination thereof. The biological sample can include a matrix (e.g., a gel or polymer matrix) comprising a cell or one or more constituents from a cell (e.g., cell bead), such as DNA, RNA, organelles, proteins, or any combination thereof, from the cell. The biological sample may be obtained from a tissue of a subject. The biological sample can include a hardened cell. Such hardened cells may or may not include a cell wall or cell membrane. The biological sample can include one or more constituents of a cell but may not include other constituents of the cell. An example of such constituents may include a nucleus or an organelle. The biological sample may include a live cell. The live cell can be capable of being cultured.

[0202] The term “marker” or “biomarker,” as used herein, generally refers to any measurable substance taken as a sample from a subject whose presence is indicative of some phenomenon. Nonlimiting examples of such phenomenon can include a disease state, a condition, or exposure to a compound or environmental condition. In various embodiments described herein, markers or biomarkers may be used for diagnostic purposes (e.g., to diagnose a health state, a disease state). The term “biomarker” can be used interchangeably with the term “marker.”

[0203] The term “sequence,” as used herein, generally refers to a biological sequence including onedimensional monomers that can be assembled to generate a polymer. Non-limiting examples of sequences include nucleotide sequences (e.g., ssDNA, dsDNA, and RNA), amino acid sequences (e.g., proteins, peptides, and polypeptides), and carbohydrates (e.g., compounds including Cm (H2O)„).

[0204] The term “disease state” as used herein, generally refers to a condition that affects the structure or function of an organism. Non-limiting examples of causes of disease states may include pathogens, immune system dysfunctions, cell damage caused by aging, cell damage caused by other factors (e.g., trauma and cancer). Disease states can include any state of a disease whether symptomatic or asymptomatic. Disease states can include disease stages of a disease progression. Disease states can cause minor, moderate, or severe disruptions in structure or function of an organism (e.g., a subject).

[0205] As used herein, the term “functional assay” relates to an assay whereby a cell or cells is/are observed for functional behavior in vitro. This includes, for example, stimulation responsiveness (e.g. cytokine production), differentiation potential (e.g. colony forming assay), metabolism (e.g. measurements of oxygen consumption), migration (e.g. motility in migration assays), and the like.

[0206] As used herein, the term “rare circulating cell” refers to a cell that comprises less than 5% of the total cell population in a peripheral blood sample. Rare circulating cells include cells that comprise less than 5% of the total population of peripheral blood mononuclear cells (PBMCs) in a peripheral blood sample. Rare circulating cells are typically at a level less than 5%, less than 4%, less than 3%, less than 2%, less than 1% or less than 0.5% of the total cell population in a peripheral blood sample. Rare circulating cells are typically at a level less than 5%, less than 4%, less than 3%, less than 2%, less than 1% or less than 0.5% of peripheral blood mononuclear cells (PBMCs) An exemplary rare circulating cell, comprising less than 0.5% of PBMCs, is peripheral blood HSPC (also referred to herein interchangeably as “peripheral HSPC”, “pHSPC”, “circulating HSPC”, and “HSPC”).

[0207] A used herein, the term “microbial therapy” comprises any therapy that comprises a microbe, a product produced by and/or derived from the microbe (e.g., a protein, a nucleic acid, a signaling molecule). The microbe may comprise a pathogen or a non-pathogen, may be attenuated or nonattenuated, and may or may not be engineered, in whole or in part. One exemplary microbial therapy contemplated herein includes attenuated live pathogens such as Bacillus Calmette-Guerin (BCG), and/or a derivative thereof. Another exemplary microbial therapy contemplated herewith includes engineered bacteria, such as bacteria engineered to deliver various payloads to a tumor including nanobodies that act like checkpoint inhibitors. These engineered microbes may have engineered circuits to control their behavior. [0208] As used herein, the term “antibody” refers to any antigen binding moiety derived from an immunoglobulin. An antibody can be whole immunoglobulins of any isotype or classification, chimeric antibodies, or hybrid antibodies with specificity to two or more antigens. An antibody may also be a fragments (e.g., F(ab’)2, Fab’, Fab, Fv, and the like), including hybrid fragments. An immunoglobulin also includes natural, synthetic, or genetically engineered proteins that act like an antibody by binding to specific antigens to form a complex. The term antibody includes genetically engineered or otherwise modified forms of immunoglobulins. The term antibody further includes all bivalent and/or bi-specific antibodies. The term “bivalent antibody” means an antibody that comprises two antigen-binding sites. The two binding sites may have the same antigen specificities, or they may be bi-specific, meaning the two antigen-binding sites have different antigen specificities.Bispecific antibodies are a class of antibodies that have paratopes (z.e., antigen-binding sites) for two or more distinct epitopes. Bispecific antibodies can be biparatopic, wherein a bispecific antibody may specifically recognize a different epitope from the same antigen. Bispecific antibodies can be constructed from a pair of different single domain antibodies termed “nanobodies.” Single domain antibodies may be sourced and modified from cartilaginous fish and camelids. Nanobodies can be joined together by a linker using techniques typical to a person skilled in the art; such methods for selection and joining of nanobodies are described in PCT Publication No. WO2015044386A1, No. W02010037838A2, and Bever etal.,AnalChem. 86:7875-7882 (2014), each of which are specifically incorporated herein by reference in their entirety. Bispecific antibodies can be constructed as: a whole IgG, Fab’2, Fab’PEG, a diabody, or alternatively as a single chain variable fragment (scFv). Diabodies and scFvs can be constructed without an Fc region, using only variable domains. Bispecific antibodies may be produced by a variety of methods including, but not limited to, fusion of hybridomas or linking of Fab’ fragments. See, e.g., Songsivilai and Lachmann, Clin. Exp. Immunol. 79:315-321 (1990); Kostelny et al., J. Immunol. 148: 1547-1553 (1992), each of which are specifically incorporated by reference in their entirety.

[0209] As used herein, the term “CpG oligodeoxynucleotide” refers to an unmethylated CpG motif (defined as a cytosine nucleotide is followed by a guanine nucleotide in the linear sequence of bases in the 5’ to 3’ direction); such CpG oligodeoxynucleotides can be used as an immunoadjuvant and/or anticancer agent, as would be appreciated by one skilled in the art. As used herein, the term “CpG” refers to cytosine phosphoguanine, a synthetic form of DNA that mimics bacterial and viral genetic material and can be used as an immunoadjuvant as would be appreciated by one skilled in the art. An exemplary “CpG” adjuvant is CpG 1018. Unless otherwise indicated, the terms “CpG oligodeoxynucleotide” and “CpG” also encompass any CpG nucleotide, CpG deoxyribonucleotide, and/or CpG oligodeoxynucleotide, and/or polynucleotides comprising the same that can be used as an immunoadjuvant and/or anticancer agent as would be appreciated by one skilled in the art.

[0210] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subj ect to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0211] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. If the degree of approximation is not otherwise clear from the context, “about” means either within plus or minus 10% of the provided value, or rounded to the nearest significant figure, in all cases inclusive of the provided value. In various embodiments, the term “about” indicates the designated value ± up to 10%, up to ± 5%, or up to ± 1%.

[0212] The term “training data,” as used herein generally refers to data that can be input into models, statistical models, algorithms and any system or process able to use existing data to make predictions. [0213] As used herein, a “model” may include one or more algorithms, one or more mathematical techniques, one or more machine learning algorithms, or a combination thereof.

[0214] As used herein, “machine learning” may be the practice of using algorithms to parse data, learn from it, and then make a determination or prediction about something in the world. Machine learning uses algorithms that can learn from data without relying on rules-based programming. A machine learning algorithm may include a parametric model, a nonparametric model, a deep learning model, a neural network, a linear discriminant analysis model, a quadratic discriminant analysis model, a support vector machine, a random forest algorithm, a nearest neighbor algorithm, a combined discriminant analysis model, a k-means clustering algorithm, a supervised model, an unsupervised model, logistic regression model, a multivariable regression model, a penalized multivariable regression model, or another type of model.

[0215] As used herein, an “artificial neural network” or “neural network” (NN) may refer to mathematical algorithms or computational models that mimic an interconnected group of artificial nodes or neurons that processes information based on a connectionistic approach to computation. Neural networks, which may also be referred to as neural nets, can employ one or more layers of nonlinear units to predict an output for a received input. Some neural networks include one or more hidden layers in addition to an output layer. The output of each hidden layer is used as input to the next layer in the network, z.e., the next hidden layer or the output layer. Each layer of the network generates an output from a received input in accordance with current values of a respective set of parameters. In the various embodiments, a reference to a “neural network” may be a reference to one or more neural networks.

[0216] A neural network may process information in two ways: when it is being trained it is in training mode and when it puts what it has learned into practice it is in inference (or prediction) mode. Neural networks learn through a feedback process (eg., backpropagation) which allows the network to adjust the weight factors (modifying its behavior) of the individual nodes in the intermediate hidden layers so that the output matches the outputs of the training data. In other words, a neural network learns by being fed training data (learning examples) and eventually learns how to reach the correct output, even when it is presented with a new range or set of inputs. A neural network may include, for example, without limitation, at least one of a Feedforward Neural Network (FNN), a Recurrent Neural Network (RNN), a Modular Neural Network (MNN), a Convolutional Neural Network (CNN), a Residual Neural Network (ResNet), an Ordinary Differential Equations Neural Networks (neural-ODE), or another type of neural network.

[0217] It should be understood that while deep learning may be discussed in conjunction with various embodiments herein, the various embodiments herein are not limited to being associated only with deep learning tools. As such, machine learning and/or artificial intelligence tools generally may be applicable as well. Moreover, the terms deep learning, machine learning, and artificial intelligence may even be used interchangeably in generally describing the various embodiments of systems, software and methods herein.

III. Overview of Exemplary Workflow

[0218] Exemplary workflows for various embodiments in accordance with the present disclosure, used for characterizing cellular molecular features and/or functional characteristics in an enriched population of circulating cells, including progenitor cells, from peripheral blood, such as for characterizing cellular molecular features and/or functional characteristics in accordance with various embodiments, are described herein below.

[0219] The workflow may include various operations including, for example, sample collection, sample intake, sample preparation and processing, data analysis, and output generation. [0220] Sample collection may include, for example, obtaining a biological sample of one or more subjects. The biological sample may take the form of a specimen obtained via one or more sampling methods. The biological sample may be a peripheral blood sample, and or a PBMC sample. The biological sample may be obtained in any of a number of different ways. In various embodiments, the biological sample includes whole blood sample obtained via a blood draw. In various embodiments, the biological sample includes a cryopreserved whole blood sample or a cryopreserved PBMC sample. In other embodiments, the biological sample includes a set of aliquoted samples that includes, for example, a serum sample, a plasma sample, a blood cell (e.g., white blood cell (WBC), red blood cell (RBC)) sample, another type of sample, or a combination thereof. Biological samples may include nucleotides (e.g., ssDNA, dsDNA, RNA), organelles, amino acids, peptides, proteins, carbohydrates, glycoproteins, or any combination thereof.

[0221] Sample intake may include one or more various operations such as, for example, aliquoting, registering, processing, storing, thawing, and/or other types of operations.

[0222] Sample preparation and processing may include, for example, one or more operations to isolate and/or enrich one or more rare circulating cells, including progenitor cells. Sample preparation and processing can include, for example pooling multiple samples into a single assay tube and “demultiplexing” after analysis (in silica based on individual subject genotype — genotype-based demultiplexing of single cell analysis. Employing these types of approaches provides a rapidly scalable and economic workflow for research-phase single cell dataset building for multiple diseases. Sample preparation and processing can also include working with a single sample in a single assay tube.

[0223] Further, sample preparation and processing may include, for example, data acquisition based on enriched rare circulating cells, including progenitor cells. For example, data acquisition may include use of, for example, but is not limited to, single nuclei (sn) RNA and assay for transposase- accessible chromatin (ATAC) sequencing (chromium single cell multiome ATAC + gene expression) for PBMC, sorted PBMC subset “bulk” ATAC-seq, multiplexed immunoassay-based quantitation of plasma proteins, and/or immunophenotyping by flow cytometry.

[0224] Data analysis may include, for example, in depth transcriptomic and epigenomic analysis to identify differentially accessible regions. In some embodiments, data analysis also includes output generation. In other embodiments, output generation may be considered a separate operation from data analysis. Output generation may include, for example, generating final output based on the results of transcriptional enrichment and epigenetic enrichment. In various embodiments, final output may be used for determining the research, diagnosis, and/or treatment of a state associated with cancer.

[0225] In various embodiments, final output is comprised of one or more outputs. Final output may take various forms. For example, final output may be a report that includes, for example, a diagnosis output, a treatment output (e.g., a treatment design output, a treatment plan output, or combination thereof), analyzed data (e.g., relativized and normalized) or combination thereof. In some embodiments, the report can comprise a characterization of the cellular molecular features and/or functional characteristics and/or a characterization of transcriptional and epigenetic signatures. In some embodiments, final output may be sent to a remote system for processing. The remote system may include, for example, a computer system, a server, a processor, a cloud computing platform, cloud storage, a laptop, a tablet, a smartphone, some other type of mobile computing device, or a combination thereof.

[0226] In other embodiments, any workflow as described herein may optionally exclude one or more of the operations described herein and/or may optionally include one or more other steps or operations other than those described herein (e.g., in addition to and/or instead of those described herein). Accordingly, any workflow as described herein may be implemented in any of a number of different ways for use in the research, diagnosis, and/or treatment of, for example, cancer.

IV. Epigenetic and transcriptional signatures associated with anti-tumor immunity in circulating cells

[0227] The disclosure herein includes the discovery of epigenetic and transcriptional signatures associated with anti-tumor immunity. In various embodiments, the epigenetic and transcriptional signatures associated with anti-tumor immunity correspond to altered cellular molecular features and/or functional characteristics of one or more circulating cells enriched from peripheral blood.

[0228] As described herein below, the inventors have made the surprising discovery that an anti-tumor signature may be induced in certain circulating cells or in immune progenitor cells in the bone marrow. This anti-tumor signature is characterized by a broad enhancement in myeloid function that contributes to anti-tumor effects of innate immune memory, and importantly, directly impacts the anti-tumor phenotype of progeny cells. For instance, it was found that myeloid cells derived from progenitor cells bearing this anti-tumor signature, broadly remodel tumor micro-environment. Further, neutrophil progeny are found to have an anti-tumor phenotype, in direct contrast to neutrophils derived from progenitors without this anti -tumor signature. This suggests, surprisingly, that central trained immunity can interfere with the ability of a tumor to co-opt neutrophils.

[0229] Accordingly, in various embodiments, cellular and molecular features and/or functional characteristics of cells having this anti-tumor immunity signature may comprise increased antigen presentation, increased TNF production, increased interferon gamma production, increased granulopoiesis, increased neutrophil reprogramming into an anti-tumor phenotype, increased macrophage or monocyte expression of genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses, altered proportions or phenotypes of pHSPC subsets related to changes in granulopoeisis, altered or augmented activation states, altered or augmented inflammatory programs, altered or augmented antigen presentation, and/or altered or augmented cytokine responsiveness.

[0230] These cellular, molecular, and functional characteristics, in turn, may be detected by measuring epigenetic and transcription signatures in the cells. For instance, cells bearing the epigenetic and transcription signature associated with anti-tumor immunity are shown herein to have one or more differentially expressed genes. Exemplary genes shown to be differentially expressed in cells with this epigenetic and transcription signature associated with anti-tumor immunity are provided in the following tables. As shown below, certain exemplary cell types (e.g., murine and human HSPCs and murine or human monocytes) were used to identify these genes but as shown in Examples 1-13 herein, these genetic signatures persist through progenitor lineages indicating that these gene signatures may be detected in other cells, such as those described in sections below. Accordingly, in various embodiments, the epigenetic and transcriptional signatures associated with anti-tumor immunity comprises differential expression of one or more genes listed in Tables 1-7 below. In some embodiments, the epigenetic and transcriptional signatures associated with anti-tumor immunity comprise differential expression of one or more genes listed in Tables 5-7 below. In various embodiments, the epigenetic and transcriptional signatures associated with anti-tumor immunity comprises enrichment for one or more genes listed in Tables 1-7 below. In some embodiments, the epigenetic and transcriptional signatures associated with anti-tumor immunity comprise enrichment for one or more genes listed in Tables 5-7 below. In some embodiments, the epigenetic and transcriptional signatures associated with anti-tumor immunity comprise enrichment for one or more genes indicated as having “increased expression” in Tables 5 to 7 below.

Table 1: Genes Differentially Expressed in Murine HSPC Table 2: Genes Differentially Expressed in Murine Monocytes (isolated from BM)

Table 3: Genes Differentially Expressed in Murine Tumor Neutrophils

Table 4: Genes Differentially Expressed in Murine Tumor Monocytes

Table 5: Genes Differentially Expressed in Human and Mice Monocytes

Table 6: Genes Differentially Expressed in Human HSPC

Table 7: Genes Differentially Expressed in Human Monocytes

[0231] As noted, the anti-tumor immunity signature corresponds to epigenetic and transcription signatures in, for example, circulating immune progenitor cells, such as by differential expression of one or more of the genes listed in the tables above. As would be appreciated by one of skill in the art, many of the genes listed in the tables above relate to one or more processes related to antigen presentation, interferon gamma-mediated signaling, platelet aggregation, cell-cell adhesion, cytokine production and signaling, positive regulation of ATP biosynthesis, activation, differentiation, and/or anti-tumor response. Accordingly, in some embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation, interferon gammamediated signaling, platelet aggregation, cell-cell adhesion, cytokine production and signaling, positive regulation of ATP biosynthesis, activation, differentiation, and/or anti-tumor response. In some embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses.

[0232] In some embodiments, the epigenetic and transcription signatures comprise enrichment for the or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, BST2, HLAC, AREG, CIITA, MX2, TNFRSF1B, HLA-A, HLA-B, HLA-C. HLA-F, IRF2, S100A9, IL6R, H3F3A, H3F3B, and S100A. In some embodiments, the epigenetic and transcription signatures comprise enrichment for one or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, and BST2.

[0233] Methods of isolating and detecting cells, especially peripheral blood monocuclear cells, with this signature are described further below.

V. Peripheral Blood Mononuclear Cell analysis with Progenitor Input Enrichment (“PBMC-PIE”). [0234] Various embodiments of the present disclosure relate to detecting epigenetic and transcription signatures associated with anti-tumor immunity in a circulating cell population. Accordingly, the present disclosure comprises methods that enable the discovery of stem cell disease states, including epigenetic scars, in circulating cells, such as HSPC, derived from peripheral blood (peripheral blood HSPCs, also termed pHSPC herein). In particular, the cellular molecular features and/or functional characteristics, such as transcriptional and epigenetic signatures, characterized from peripheral blood mononuclear cells (PBMCs) can be derived from single-cell profiling of human pHSPCs. In addition, cell function assays on pHSPC can reveal functional changes. These methods all relate to a system called “Peripheral Blood Mononuclear Cell analysis with Progenitor Input Enrichment” (PBMC-PIE) described in PCT/US2023/062066 which is incorporated herein by reference in its entirety.

Enriching a Cell Population

[0235] In various aspects, the PBMC-PIE platform comprises enriching a circulating cell population to provide an enriched population of circulating cells. This population may be enriched from a peripheral blood sample or from a peripheral blood mononuclear cells (PBMC) from a peripheral blood sample. In some embodiments, enriching the circulating cells comprise isolating one or more types of rare circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample from the subject; and enriching the one or more types of rare circulating cell in the PBMC and/or in the peripheral blood sample, thereby providing the enriched population of circulating cells from the peripheral blood and/or PBMC; and optionally introducing or re-introducing the enriched population of circulating cells into a sample comprising peripheral blood and/or PBMC.

[0236] In some embodiments, enriching circulating cells comprises either antibody-conjugated beadbased enrichment or FACS sorting, or sequential antibody-conjugated bead-based enrichment and FACS sorting; optionally wherein enriching circulating cells comprises FACS-sorting rare circulating cells into one or more tubes prior to cell isolation; optionally wherein enriching circulating cells comprises pooling multiple samples into a single assay tube and demultiplexing after analysis (in silico) based on oligo-conjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals. [0237] In any of these steps, the circulating cells and/or the enriched cell population may comprise rare circulating cells.

Downstream Analysis of an Enriched Cell Population

[0238] In further embodiments of the present disclosure, the enriched populations of cells described above may be further analyzed to detect the aforementioned epigenetic and transcription signatures associated with anti-tumor immunity. In various embodiments, this downstream analysis comprises analyzing the enriched population of circulating cells by downstream analysis of cellular molecular features and/or cell functional characteristics to detect the one or more circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity.

[0239] In further embodiments, the downstream analysis of cellular molecular features and/or cell functional characteristics comprises: acquiring single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data for the enriched population of rare circulating cells; analyzing the rare circulating cell transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data to identify cellular molecular features and/or functional characteristics; and generating an output comprising transcriptional, genetic, protein, metabolic, epigenomic, and/or functional characteristic signatures for the one or more types of rare circulating cells.

[0240] In some embodiments, acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more bulk and/or single cell assay; optionally wherein the bulk and/or single cell assay comprises bulk and/or single cell RNA and/or ATACseq analysis; optionally wherein acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more single cell assay and is combined with one or more single cell-based workflows.

[0241] These methods may further comprise parallel sample preparation and scale up enabled by pooling of multiple samples and demultiplexing after analysis (in silico) based on oligo-conjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals; optionally further comprising subject genome sequencing to generate a reference genotype for genotype-based demultiplexing of single cell datasets from pooled samples; optionally wherein genome sequencing comprises whole genome sequencing, exome sequencing, bulk ATACseq, and/or SNP microarray.

[0242] Any of the embodiments herein comprising analyzing an enriched population of circulating cells for epigenetic and transcriptional signatures associated with anti-tumor immunity can comprise analyzing expression of one or more of protein, mRNA, DNA (sequence or post-translational modifications), chromatin (e.g. histone modifications, accessibility, 3D structure/looping, etc.), metabolites, and/or lipids; optionally wherein analyzing the enriched rare circulating cells comprises analyzing chromatin, DNA, mRNA expression, and/or ATAC-seq data; optionally wherein analyzing the enriched rare circulating cell mRNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) data comprises combined single cell mRNA/ATAC-seq data processing; UMAP visualization; single cell and/or bulk ATAC-seq; demultiplexing; and/or identifying differentially accessible regions, differentially expressed genes, and/or ATAC peak-gene/transcript associations; optionally wherein transcriptional, genetic, protein, and/or epigenomic signatures are determined by gene ontology (GO) analysis.

[0243] In further embodiments, analyzing the enriched circulating cells comprises combined single nuclei (sn) RNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) (chromium single cell multiome ATAC + gene expression) for PBMC, sorted PBMC subset “bulk” ATAC-seq, multiplexed immunoassay-based quantitation of plasma proteins, and/or immunophenotyping by flow cytometry.

[0244] In any of the analysis steps described herein, the enriched circulating cells may comprise rare circulating cells.

VI. Cell Populations

[0245] As noted, various embodiments of the present disclosure relate to detecting epigenetic and transcription signatures associated with anti-tumor immunity in a circulating cell population. Any cell populations are encompassed by these methods. However, in certain aspects, the cell population comprises peripheral hematopoietic stem and progenitor cells (pHSPC), innate lymphoid cell progenitors (ILCP), CD14+ monocytes (CD14 M.), CD16+ monocytes (CD16 M.), B cells (B), CD4+ T cells (CD4), CD8+ T cells (CD8), dendritic cells (DC), natural killer cells (NK), plasma B cells (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cells (HSC/MPP), lymphoid-primed multipotent progenitor cells (LMPP), megakaryocyte-erythroid progenitor cells (MEP), erythroid progenitor cells (Ery), granulocyte- monocyte progenitor cells (GMP), basophil-eosinophil-mast cell progenitor cells (BEM), common myeloid progenitors (CMP), granulocytes (GRA), neutrophil progenitor cells (NEUP), and/or neutrophils (NEU). In some embodiments, the population of circulating cells, detected, analyzed and/or enriched by methods herein comprises a pHSPC, ILCP, CD 14 M., NEU, and/or DC populations. In some embodiments, the population of circulating cells, detected, analyzed and/or enriched by methods herein comprises a pHSPC, ILCP, CD14 M., and/or DC populations. In some embodiments, the population of circulating cells, detected, analyzed and/or enriched by methods herein comprises a pHSPC population. In various embodiments, the pHSPC population comprises CD34+ or CD34- pHSPC.

[0246] In various embodiments, certain methods are directed to administering therapies that induce epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune progenitor cells. These immune progenitor cells are distinct from the populations of circulating cells described throughout this specification. While they can comprise any of the aforementioned progenitor cell types, including peripheral hematopoietic stem and progenitor cells (pHSPC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cells (HSC/MPP), lymphoid-primed multipotent progenitor cells (LMPP), megakaryocyte-erythroid progenitor cells (MEP), erythroid progenitor cells (Ery), granulocyte- monocyte progenitor cells (GMP), basophil-eosinophil-mast cell progenitor cells (BEM), common myeloid progenitors (CMP), and neutrophil progenitor cells (NEUP), they are not necessarily in circulation. Instead, these cell populations may be in circulation or may be in the bone marrow. In some embodiments, then, the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs), hematopoietic stem cells (HSCs), and/or intermediate progenitor cells.

VII. Applications of Epigenetic and Transcription Signatures Associated with Anti-Tumor Immunity

[0247] Further aspects of the present disclosure relate to methods and systems of applying epigenetic and transcription signatures associated with anti-tumor immunity to improve therapy outcomes. Encompassed in this are methods for predicting responsiveness of a subject to a therapy, methods for identifying new therapeutic targets, and methods of treatment.

[0248] In some embodiments, methods are provided for predicting responsiveness of a subject to a therapy. In various aspects, these methods may comprise detecting the presence or absence of one or more circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity (as described herein above) in peripheral blood of the subject. In some embodiments, the subject is considered responsive to the given therapy if these cells are detected. In some embodiments, the subject is considered non-responsive to the therapy if these cells are not detected. In some aspects, the methods further comprise determining whether a subject will be responsive to a combination therapy, such as any combination therapy described herein below. [0249] Any of the methods disclosed herein may comprise, or further comprise, (i) predicting response or refractoriness by the subject to an innate immune memory inducing therapy; (ii) determining ongoing responsiveness to therapy or risk of tumor reemergence in the subject; and/or (iii) determining responsiveness or candidacy for augmented therapy with additional cancer therapies. In some embodiments, predicting response or refractoriness by the subject to an innate immune memory inducing therapy comprises predicting one or more adverse clinical event. In some embodiments, the methods comprise predicting one or more adverse clinical event following treatment of the subject with an immunotherapy; optionally wherein the immunotherapy is an immune checkpoint inhibitor.

[0250] In various embodiments, detecting the presence or absence of one or more circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti -tumor immunity in a peripheral blood sample from a subject may comprise enriching and/or analyzing the circulating cell populations using, for example, the PBMC-PIE platform as described herein.

[0251] Further methods are provided for identifying a cellular or molecular target for therapy, the methods generally comprising acquiring, analyzing, and generating an output of single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data for one or more enriched populations of circulating cells, wherein the output identifies a cellular or molecular target for therapy. In various aspects, acquiring, analyzing and generating the output of this data may involve using, for example, the PBMC-PIE platform as described herein.

[0252] Further methods are provided for treating a disease or condition (e.g., a cancer) in a subject in need thereof.

[0253] Further methods are provided for treating cancer in a subj ect in need thereof. In various aspects, the methods of treatment may comprise: (i) predicting responsiveness of a subject to a therapy according to any method herein and administering the therapy to the subject; (ii) identifying one or more cellular or molecular targets for therapy according to any method described herein, and administering a therapy targeting the one or more cellular or molecular targets to the sub; (iii) administering a therapy to a subject diagnosed with cancer, wherein the therapy induces epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune progenitor cells in the subject.

[0254] In various embodiments, the methods provided herein comprise: predicting responsiveness of a subject to a therapy based on the presence or absence of circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity; and administering the therapy to the subject. In various embodiments, the methods provided herein comprise administering a therapy to a subject, wherein the subject has previously been found responsive to the therapy based on the presence of circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity following an earlier administration of said therapy. In various aspects, the methods further comprise administering a combination therapy to a subject that had been predicted to be responsive to said combination therapy, based again, on the presence or absence of circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity.

[0255] Further embodiments are directed to methods of treating cancer in a subject in need thereof by identifying one or more cellular or molecular targets for therapy based, at least in part, on epigenetic and transcriptional signatures associated with anti-tumor immunity in circulating cell populations and administering a therapy to the subject targeting the one or more cellular or molecular targets. Also provided are methods of treating cancer in a subject in need thereof comprising administering a therapy to the subject, wherein the therapy targets one or more cellular or molecular targets identified by analyzing circulating cell populations comprising epigenetic and transcriptional signatures associated with anti -turn or immunity in the subject.

[0256] Further embodiments are directed to methods of systemically treating a subject for cancer, the methods comprising administering a therapy to a subject diagnosed with cancer, wherein the therapy induces epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune cells in the subject. In some aspects, the populations of immune cells may comprise any of hematopoietic stem and progenitor cells (including peripheral hematopoietic stem and progenitor cells (pHSPC) or HSPC in bone marrow), CD14+ monocytes (CD14 M.), CD16+ monocytes (CD 16 M.), B cells (B), CD4+ T cells (CD4), CD8+ T cells (CD8), dendritic cells (DC), natural killer cells (NK), plasma B cells (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cells (HSC/MPP), lymphoid-primed multipotent progenitor cells (LMPP), megakaryocyte-erythroid progenitor cells (MEP), erythroid progenitor cells (Ery), granulocytemonocyte progenitor cells (GMP), basophil-eosinophil-mast cell progenitor cells (BEM), common myeloid progenitors (CMP), granulocytes (GRA), neutrophil progenitor cells (NEUP), and/or neutrophils (NEU). In some embodiments, the immune cells are immune progenitor cells. In some embodiments, the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs) either in circulation (pHSPCs) or in bone marrow.

[0257] Further embodiments are also directed to methods of systemically treating a subject for cancer, the method comprising administering a therapy to a subject diagnosed with cancer, wherein the subject has been determined to be responsive to the therapy via a classifier based at least in part on analyzing expression levels in the subject of epigenetic and transcriptional signatures associated with anti -tumor immunity in one or more populations of circulating cells in the subject.

[0258] Exemplary therapies and cancers that may be used and treated, respectively, according to the methods provided herein are described in the following sections, with certain exemplary combinations discussed herein. In some aspects, the therapy comprises a microbial therapy and the methods herein provide for systemically treating a cancer in a subject in need thereof by locally administering a microbial therapy. In some aspects, the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof. In some aspects, Bacillus Calmette-Guerin (BCG), and/or a derivative thereof is locally administered to a bladder of the subject. In some embodiments, the cancer to be treated does not comprise bladder cancer. In some embodiments, the cancer to be treated does comprise bladder cancer. In these methods, the subject may be further administered one or more additional agents selected from any of the therapies provided herein below. These additional agents may be administered systemically or locally.

VIII. Methods of Treatment

[0259] Some embodiments of the disclosure further comprise administering a treatment to a subject. Some embodiments of the disclosure further comprise administering to the subject a treatment in combination with one or more additional therapies.

[0260] Exemplary therapies that may be evaluated and/or developed according to these methods are described herein below. In general, therapies evaluated and/or developed according to methods herein below, induce or promote innate immune memory, and/or a systemic anti-tumor response. For example, in some aspects, the therapies lead to HSPC and/or immune progenitor cell phenotypic changes and/or reprogramming. In various embodiments, the therapy induces enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in immune progenitor cells, including, for instance, circulating immune progenitor cells or those located in the bone marrow of a subject.

[0261] Suitable therapies may include, but are not limited to, a small molecule, a cytolytic peptide, a protein, an antibody (including a bispecific antibody), a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, any other agent that contributes to HSPC and/or immune progenitor cell phenotypic changes and/or reprogramming, or any combination thereof.

[0262] Illustrative examples of many of these therapies are described further below. However, those skilled in the art can determine appropriate therapy options, including treatments that have been approved and those that in clinical trials or otherwise under development. Any relevant treatment strategies, alone or in combination with one or more additional therapy, can be utilized in the practice of the present disclosure.

Microbial Therapies

[0263] A used herein, the term “microbial therapy” comprises any therapy that comprises a microbe, a product produced by and/or derived from the microbe (e.g., a protein, a nucleic acid, a signaling molecule). The microbe may comprise a pathogen or a non-pathogen, may be attenuated or nonattenuated, and may or may not be engineered, in whole or in part. One exemplary microbial therapy contemplated herein includes attenuated live pathogens such as Bacillus Calmette-Guerin (BCG), and/or a derivative thereof. Another exemplary microbial therapy contemplated herewith includes engineered bacteria, such as bacteria engineered to deliver various payloads to a tumor including nanobodies that act like checkpoint inhibitors. These engineered microbes may have engineered circuits to control their behavior.

Cytolytic peptide

[0264] The therapy may comprise a cytolytic peptide, and in particular, a cytolytic peptide that induces an innate immune response. One exemplary cytolytic peptide is candidalysin. Candidalysin, also known as “Ecel-III62-92K” is a cytolytic 31-amino acid a-helical amphipathic peptide toxin secreted by the opportunistic pathogen Candida albicans. Such cytolytic peptides can be used to activate and propagate innate immune responses, as would be appreciated by one skilled in the art. Other peptides that act similarly to Candidalysin are also contemplated as therapies herein. Accordingly, in some aspects, the therapy comprises candidalysin.

Polysaccharides

[0265] In some embodiments, the therapy comprises polysaccharides. Certain compounds found in mushrooms, primarily polysaccharides, can up-regulate the immune system and may have anti-cancer properties. For example, beta-glucans such as lentinan have been shown in laboratory studies to stimulate macrophage, NK cells, T cells and immune system cytokines and have been investigated in clinical trials as immunologic adjuvants. Additionally, peptidoglucan derived compounds are known to be immunoreactive. The smallest immunoreactive peptidoglycan derived molecular structure is muramyl dipeptide (MDP) and its 6-O-derivative, Lis-MDP with a stearoyl fatty acide, as well as muramyl tripeptide phosphatidylethanolamine (MTP-PE) are able to induce trained immunity, as would be appreciated by one skilled in the art. Accordingly, in some aspects, the therapy comprises beta-glucan, muramyl dipeptide (MDP), Lis-MDP, MTP-PE, or any derivative thereof (including, synthetically modified MDP nanoparticles as is appreciated by one skilled in the art). In some aspects, the therapy comprises beta-glucan.

Cytokine Therapies

[0266] The therapy may comprise a cytokine therapy. Cytokines are proteins produced by many types of cells present within a tumor which can modulate immune responses. The tumor often employs them to allow it to grow and reduce the immune response. These immune-modulating effects allow them to be used as drugs to provoke an immune response. Two commonly used cytokines are interferons and interleukins. Interferons are produced by the immune system. They are usually involved in anti-viral response, but also have use for cancer. They fall in three groups: type I (IFNa and IFNP), type II (IFNy) and type III (IFNk). Interleukins have an array of immune system effects. IL-2 is an exemplary interleukin cytokine therapy. As used herein, exemplary cytokines include a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa. Further exemplary cytokines include TNFa, IFN-I, and/or IFNy. In various aspects, the cytokine therapies used herein do not comprise IL-15 or IL-15 agonists.

Immunostimulators and/or Adjuvants

[0267] The therapy may comprise an immunostimulator and/or adjuvant. The term “immunostimulator” as used herein refers to a compound that can stimulate an immune response in a subject, and may include an adjuvant. In some embodiments, an immunostimulator is an agent that does not constitute a specific antigen, but can boost the strength and longevity of an immune response to an antigen. Such immunostimulators may include, but are not limited to stimulators of pattern recognition receptors, such as Toll-like receptors, RIG-1 andNOD-like receptors (NLR), mineral salts, such as alum, alum combined with monphosphoryl lipid (MPL) A of Enterobacteria, such as Escherihia coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri or specifically with MPL (ASO4), MPL A of above-mentioned bacteria separately, saponins, such as QS-21, Quil-A, ISCOMs, ISCOMATRIX, emulsions such as MF59, Montanide, ISA 51 and ISA 720, AS02 (QS21+squalene+MPL.), liposomes and liposomal formulations such as AS01, synthesized or specifically prepared microparticles and microcarriers such as bacteria-derived outer membrane vesicles (OMV) of N. gonorrheae, Chlamydia trachomatis and others, or chitosan particles, depotforming agents, such as Pluronic block co-polymers, specifically modified or prepared peptides, such as muramyl dipeptide, aminoalkyl glucosaminide 4-phosphates, such as RC529, or proteins, such as bacterial toxoids or toxin fragments.

[0268] The immunostimulator and/or adjuvant may comprise an agonist for pattern recognition receptors (PRR), including, but not limited to Toll-Like Receptors (TLRs), specifically TLRs 2, 3, 4, 5, 7, 8, 9 and/or combinations thereof. The additional anti-cancer therapy may comprise agonists for Toll-Like Receptors 3, agonists for Toll-Like Receptors 7 and 8, or agonists for Toll-Like Receptor 9; preferably the recited immunostimulators comprise imidazoquinolines; such as R848; adenine derivatives, such as those disclosed in U.S. Pat. No. 6,329,381, U.S. Published Patent Application 2010/0075995, or WO 2010/018132; immunostimulator DNA; or immunostimulator RNA. In some embodiments, the additional anti-cancer therapies also may comprise immunostimulator RNA molecules, such as but not limited to dsRNA, poly EC or poly Lpoly C12U (available as Ampligen.RTM., both poly EC and poly LpolyC12U being known as TLR3 stimulants), and/or those disclosed in F. Heil et al., "Species-Specific Recognition of Single-Stranded RNA via Toll-like Receptor 7 and 8" Science 303(5663), 1526-1529 (2004); J. Vollmer et al., "Immune modulation by chemically modified ribonucleosides and oligoribonucleotides" WO 2008033432 A2; A. Forsbach et al., "Immunostimulator oligoribonucleotides containing specific sequence motif(s) and targeting the Toll-like receptor 8 pathway" WO 2007062107 A2; E. Uhlmann et al., "Modified oligoribonucleotide analogs with enhanced immunostimulator activity" U.S. Pat. Appl. Publ. US 2006241076; G. Lipford et al., "Immunostimulator viral RNA oligonucleotides and use for treating cancer and infections" WO 2005097993 A2; G. Lipford et al., "Immunostimulator G,U-containing oligoribonucleotides, compositions, and screening methods" WO 2003086280 A2. In some embodiments, an additional anticancer therapy may be a TLR-4 agonist, such as bacterial lipopolysaccharide (LPS), VSV-G, and/or HMGB-1. In some embodiments, additional therapies may comprise TLR-5 agonists, such as flagellin, or portions or derivatives thereof, including but not limited to those disclosed in U.S. Pat. Nos. 6,130,082, 6,585,980, and 7,192,725.

[0269] In some embodiments, the immunostimulators and/or adjuvants may be proinflammatory stimuli released from necrotic cells (e.g., urate crystals). In some embodiments, additional immunostimulators and/or adjuvants may be activated components of the complement cascade (e.g., CD21, CD35, etc.). In some embodiments, the immunostimulators and/or adjuvants may be activated components of immune complexes. The immunostimulators and/or adjuvants also include complement receptor agonists, such as a molecule that binds to CD21 or CD35. In some embodiments, the complement receptor agonist induces endogenous complement opsonization of the synthetic nanocarrier. In some embodiments, immunostimulators are cytokines, which are small proteins or biological factors (in the range of 5 kD-20 kD) that are released by cells and have specific effects on cell-cell interaction, communication and behavior of other cells. In some embodiments, the cytokine receptor agonist is a small molecule, antibody, fusion protein, or aptamer.

[0270] In certain embodiments, the immunostimulator or adjuvant comprises an adjuvant system such as AS04, AS03, AS01, or MF59. In some embodiments, the immunostimulator and/or adjuvant can comprise any one or more components from these systems, such as monophosphoryl lipid A (MPL), squalene, and QS-21 as described below. In some embodiments, the immunostimulator comprises an aluminum containing adjuvant such as aluminum hydroxide, aluminum phosphate, or potassium aluminum sulfate (Alum). In some embodiments, the immunostimulator and/or adjuvant comprises a nucleic acid based adjuvant such as a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG) or RNA.

[0271] As noted, the immunostimulator and/or adjuvant can comprise an adjuvant system like AS04, AS03, AS01, or MF59 the adjuvant AS04 (Adjuvant System 04) is an adjuvant system comprising aluminum hydroxide and monophosphoryl lipid A (MPL) which can be used in hepatitis and human papillomavirus (HPV) vaccines, as would be appreciated by one skilled in the art. AS03 (Adjuvant System 03) is a squalene based adjuvant which can be used in certain influenza vaccines, as would be appreciated by one skilled in the art. AS01 (Adjuvant System 01) is an adjuvant system comprising monophosphoryl lipid A (MPL) and QS-21, a natural compound extracted from the Chilean soapbark tree, combined in a liposomal formulation. MF59 (NOVARTIS) is a proprietary adjuvant that comprises squalene.

[0272] Accordingly, the immunostimulator and/or adjuvant can comprise Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof.

Cancer Vaccines

[0273] Cancer vaccines or oncovaccines are vaccines that either treat existing cancer or prevent development of cancer. Vaccines that treat existing cancer are known as therapeutic cancer vaccines or tumor antigen vaccines. Cancer vaccines can be autologous - that is, prepared from samples taken from a patient and administered back to the patient.

Immunotherapies

[0274] In some embodiments, the therapy comprises an immunotherapy. As used herein, the term “immunotherapy” refers to any therapy that harnesses the immune system to treat a condition (e.g., cancer). Immunotherapies can be categorized as active, passive or hybrid (active and passive). These approaches exploit the fact that cancer cells often have molecules on their surface that can be detected by the immune system, known as tumor-associated antigens (TAAs); they are often proteins or other macromolecules (e.g. carbohydrates). Active immunotherapy directs the immune system to attack tumor cells by targeting TAAs. Passive immunotherapies enhance existing anti-tumor responses and include the use of monoclonal antibodies, lymphocytes and cytokines. Immunotherapies are known in the art, and can include, but are not limited to, inhibition of co-stimulatory molecules, dendritic cell therapies, modified cell therapies (e.g., CAR-T cells), cytokine therapies, adoptive T-cell therapy, checkpoint inhibitors, and any combinations thereof. The immunotherapies can be in various forms, including antibodies (including bispecific antibodies), or microbial immunotherapies.

[0275] In some embodiments, the immunotherapy comprises an inhibitor of a co-stimulatory molecule. In some embodiments, the inhibitor comprises an inhibitor of B7-1 (CD80), B7-2 (CD86), CD28, ICOS, 0X40 (TNFRSF4), 4-1BB (CD 137; TNFRSF9), CD40L (CD40LG), GITR (TNFRSF18), and combinations thereof. Inhibitors include inhibitory antibodies, polypeptides, compounds, and nucleic acids.

[0276] In some embodiments, the immunotherapy comprises dendritic cell therapy. Dendritic cell therapy provokes anti-tumor responses by causing dendritic cells to present tumor antigens to lymphocytes, which activates them, priming them to kill other cells that present the antigen. Dendritic cells are antigen presenting cells (APCs) in the mammalian immune system. In cancer treatment they aid cancer antigen targeting. One example of cellular cancer therapy based on dendritic cells is sipuleucel-T.

[0277] One method of inducing dendritic cells to present tumor antigens is by vaccination with autologous tumor lysates or short peptides (small parts of protein that correspond to the protein antigens on cancer cells). These peptides are often given in combination with adjuvants (highly immunogenic substances) to increase the immune and anti-tumor responses. Other adjuvants include proteins or other chemicals that attract and/or activate dendritic cells, such as granulocyte macrophage colony-stimulating factor (GM-CSF).

[0278] Dendritic cells can also be activated in vivo by making tumor cells express GM-CSF. This can be achieved by either genetically engineering tumor cells to produce GM-CSF or by infecting tumor cells with an oncolytic virus that expresses GM-CSF.

[0279] Another strategy is to remove dendritic cells from the blood of a patient and activate them outside the body. The dendritic cells are activated in the presence of tumor antigens, which may be a single tumor-specific peptide/protein or a tumor cell lysate (i.e. a solution of broken down tumor cells). These cells (with optional adjuvants) are infused and provoke an immune response.

[0280] Dendritic cell therapies include the use of antibodies that bind to receptors on the surface of dendritic cells. Antigens can be added to the antibody and can induce the dendritic cells to mature and provide immunity to the tumor. Dendritic cell receptors such as TLR3, TLR7, TLR8 or CD40 have been used as antibody targets.

[0281] In some embodiments, the immunotherapy comprises a modified immune cell. An exemplary modified immune cell is CAR-T cell which is used in a form of immunotherapy called “CAR-T cell therapy”. Chimeric antigen receptors (CAR), also known as chimeric immunoreceptors, chimeric T cell receptors or artificial T cell receptors) are engineered receptors that combine a new specificity with an immune cell to target cancer cells. Typically, these receptors graft the specificity of a monoclonal antibody onto a T cell. The receptors are called chimeric because they are fused of parts from different sources. CAR-T cell therapy refers to a treatment that uses such transformed cells for cancer therapy.

[0282] The basic principle of CAR-T cell design involves recombinant receptors that combine antigenbinding and T-cell activating functions. The general premise of CAR-T cells is to artificially generate T-cells targeted to markers found on cancer cells. Scientists can remove T-cells from a person, genetically alter them, and put them back into the patient for them to attack the cancer cells. Once the T cell has been engineered to become a CAR-T cell, it acts as a “living drug”. CAR-T cells create a link between an extracellular ligand recognition domain to an intracellular signaling molecule which in turn activates T cells. The extracellular ligand recognition domain is usually a single-chain variable fragment (scFv). An important aspect of the safety of CAR-T cell therapy is how to ensure that only cancerous tumor cells are targeted, and not normal cells. The specificity of CAR-T cells is determined by the choice of molecule that is targeted.

[0283] In some embodiments, the immunotherapy comprises adoptive T-cell therapy. Adoptive T cell therapy is a form of passive immunization by the transfusion of T-cells (adoptive cell transfer). They are found in blood and tissue and usually activate when they find foreign pathogens. Specifically, they activate when the T-cell's surface receptors encounter cells that display parts of foreign proteins on their surface antigens. These can be either infected cells, or antigen presenting cells (APCs). They are found in normal tissue and in tumor tissue, where they are known as tumor infiltrating lymphocytes (TILs). They are activated by the presence of APCs such as dendritic cells that present tumor antigens. Although these cells can attack the tumor, the environment within the tumor is highly immunosuppressive, preventing immune-mediated tumor death.

[0284] Multiple ways of producing and obtaining tumor targeted T-cells have been developed. T-cells specific to a tumor antigen can be removed from a tumor sample (TILs) or filtered from blood. Subsequent activation and culturing is performed ex vivo, with the results reinfused. Activation can take place through gene therapy, or by exposing the T cells to tumor antigens.

[0285] In some embodiments, the immunotherapy comprises checkpoint inhibitors. These therapies are defined as targeting and inhibiting one or more checkpoint pathways in the immune system, thereby increasing the immune response against a target (i.e., a tumor). In various aspects, the checkpoint inhibitors can target PD-1 and/or cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), two key “checkpoint” molecules.

[0286] PD -1 can act in the tumor microenvironment where T cells encounter an infection or tumor. Activated T cells upregulate PD-1 and continue to express it in the peripheral tissues. Cytokines such as IFN-gamma induce the expression of PDL1 on epithelial cells and tumor cells. PDL2 is expressed on macrophages and dendritic cells. The main role of PD-1 is to limit the activity of effector T cells in the periphery and prevent excessive damage to the tissues during an immune response. Additional anti-cancer therapies of the disclosure may block one or more functions of PD-1 and/or PDL1 activity [0287] Alternative names for “PD-1” include CD279 and SLEB2. Alternative names for “PDL1” include B7-H1, B7-4, CD274, and B7-H. Alternative names for “PDL2” include B7-DC, Btdc, and CD273. In some embodiments, PD-1, PDL1, and PDL2 are human PD-1, PDL1 and PDL2.

[0288] In some embodiments, the PD-1 inhibitor is a molecule that inhibits the binding of PD-1 to its ligand binding partners. In a specific aspect, the PD-1 ligand binding partners are PDL1 and/or PDL2. In another embodiment, a PDL1 inhibitor is a molecule that inhibits the binding of PDL1 to its binding partners. In a specific aspect, PDL1 binding partners are PD-1 and/or B7-1. In another embodiment, the PDL2 inhibitor is a molecule that inhibits the binding of PDL2 to its binding partners. In a specific aspect, a PDL2 binding partner is PD-1. The inhibitor may be an antibody, an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. 8,735,553, 8,354,509, and 8,008,449, all incorporated herein by reference. Other PD- 1 inhibitors for use in the methods and compositions provided herein are known in the art such as described in U.S. Patent Application Nos. US2014/0294898, US2014/022021, and US2011/0008369, all incorporated herein by reference.

[0289] In some embodiments, the PD-1 inhibitor is an anti -PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti -PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and pidilizumab. In some embodiments, the PD-1 inhibitor is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PDL1 or PDL2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence). In some embodiments, the PDL1 inhibitor comprises AMP- 224. Nivolumab, also known as MDX-1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO®, is an anti-PD-1 antibody described in W02006/121168. Pembrolizumab, also known as MK-3475, Merck 3475, lambrolizumab, KEYTRUDA®, and SCH-900475, is an anti-PD-1 antibody described in W02009/114335. Pidilizumab, also known as CT-011, hBAT, or hBAT-1, is an anti-PD-1 antibody described in W02009/101611. AMP -224, also known as B7-DCIg, is a PDL2-Fc fusion soluble receptor described in W02010/027827 and WO2011/066342. Additional anti-cancer PD-1 inhibitors include MEDI0680, also known as AMP-514, and REGN2810.

[0290] In some embodiments, the immune checkpoint inhibitor is a PDL1 inhibitor such as Durvalumab, also known as MEDI4736, atezolizumab, also known as MPDL3280A, avelumab, also known as MSB00010118C, MDX-1105, BMS-936559, or combinations thereof. In certain aspects, the immune checkpoint inhibitor is a PDL2 inhibitor such as rHIgM12B7.

[0291] In some embodiments, the inhibitor comprises the heavy and light chain CDRs or VRs of nivolumab, pembrolizumab, or pidilizumab. Accordingly, in one embodiment, the inhibitor comprises the CDR1, CDR2, and CDR3 domains of the VH region of nivolumab, pembrolizumab, or pidilizumab, and the CDR1, CDR2 and CDR3 domains of the VL region of nivolumab, pembrolizumab, or pidilizumab. In another embodiment, the antibody competes for binding with and/or binds to the same epitope on PD-1, PDL1, or PDL2 as the above- mentioned antibodies. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any derivable range therein) variable region amino acid sequence identity with the above-mentioned antibodies. [0292] Another immune checkpoint that can be targeted in the methods provided herein as an additional anti-cancer therapy is the cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), also known as CD 152. The complete cDNA sequence of human CTLA-4 has the Genbank accession number LI 5006. CTLA-4 is found on the surface of T cells and acts as an “off’ switch when bound to B7-1 (CD80) or B7-2 (CD86) on the surface of antigen-presenting cells. CTLA4 is a member of the immunoglobulin superfamily that is expressed on the surface of Helper T cells and transmits an inhibitory signal to T cells. CTLA4 is similar to the T-cell co-stimulatory protein, CD28, and both molecules bind to B7-1 and B7-2 on antigen-presenting cells. CTLA-4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA-4 is also found in regulatory T cells and may be important to their function. T cell activation through the T cell receptor and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for B7 molecules. Inhibitors of the disclosure may block one or more functions of CTLA-4, B7-1, and/or B7-2 activity. In some embodiments, the inhibitor blocks the CTLA-4 and B7-1 interaction. In some embodiments, the inhibitor blocks the CTLA-4 and B7-2 interaction.

[0293] In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide.

[0294] Anti-human-CTLA-4 antibodies (or VH and/or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art recognized anti-CTLA-4 antibodies can be used. For example, the anti-CTLA-4 antibodies disclosed in: US 8,119,129, WO 01/14424, WO 98/42752; WO 00/37504 (CP675,206, also known as tremelimumab; formerly ticilimumab), U.S. Patent No. 6,207,156; Hurwitz et al., 1998; can be used in the methods disclosed herein. The teachings of each of the aforementioned publications are hereby incorporated by reference. Antibodies that compete with any of these art-recognized antibodies for binding to CTLA-4 also can be used. For example, a humanized CTLA-4 antibody is described in International Patent Application No. W02001/014424, W02000/037504, and U.S. Patent No. 8,017,114; all incorporated herein by reference.

[0295] A further anti-CTLA-4 antibody useful as a checkpoint inhibitor in the methods and compositions of the disclosure is ipilimumab (also known as 10D1, MDX- 010, MDX- 101, and Yervoy®) or antigen binding fragments and variants thereof (see, e.g., WOO 1/14424).

[0296] In some embodiments, the inhibitor comprises the heavy and light chain CDRs or VRs of tremelimumab or ipilimumab. Accordingly, in one embodiment, the inhibitor comprises the CDR1, CDR2, and CDR3 domains of the VH region of tremelimumab or ipilimumab, and the CDR1, CDR2 and CDR3 domains of the VL region of tremelimumab or ipilimumab. In another embodiment, the antibody competes for binding with and/or binds to the same epitope on PD-1, B7-1, or B7-2 as the above- mentioned antibodies. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any derivable range therein) variable region amino acid sequence identity with the above-mentioned antibodies.

[0297] Other contemplated checkpoint inhibitors that may be used as immunotherapies in the present disclosure include bispecific antibodies that, for example, target one or more checkpoint molecules (e.g., PD-1 and/or CTL-4).

[0298] In various aspects, the immunotherapy comprises any of the following: cell-based immunotherapies, such as those involving cells which effect an immune response (such as, for example, lymphocytes, macrophages, natural killer (NK) cells, dendritic cells, cytotoxic T lymphocytes (CTL), antibodies and antibody derivatives (such as, for example, monoclonal antibodies, conjugated monoclonal antibodies, polyclonal antibodies, antibody fragments, radiolabeled antibodies, chemolabeled antibodies, etc.), immune checkpoint inhibitors, vaccines (such as, for example, cancer vaccines (e.g. tumor cell vaccines, antigen vaccines, dendritic cell vaccines, vector-based vaccines, etc.), e.g. oncophage, sipuleucel-T, and the like), immunomodulators (such as, for example, interleukins, cytokines, chemokines, etc.), topical immunotherapies (such as, for example, imiquimod, and the like), injection immunotherapies, adoptive cell transfer, oncolytic virus therapies (such as, for example, talimogene laherparepvec (T-VEC), and the like), immunosuppressive drugs, helminthic therapies, other non-specific immunotherapies, and the like. Immune checkpoint inhibitor immunotherapies are those that target one or more specific proteins or receptors, such as PD-1, PD- Ll, CTLA-4, and the like. Immune checkpoint inhibitor immunotherapies include ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), and the like. Non-specific immunotherpaies include cytokines, interleukins, interferons, and the like. In some embodiments, an immunotherapy assigned or administered to a subject can include an interleukin, and/or interferon (IFN), and/or one or more suitable antibody-based reagent, such as denileukin diftitox and/or administration of an antibody-based reagent selected from the group consisting of ado- trastuzumab emtansine, alemtuzumab, atezolizumab, bevacizumab, blinatumomab, brentuximab vedotin, cetuximab, catumaxomab, gemtuzumab, ibritumomab tiuxetan, ilipimumab, natalizumab, nimotuzumab, nivolumab, ofatumumab, panitumumab, pembrolizumab, rituximab, tositumomab, trastuzumab, vivatuxin, and the like. In some embodiments, an immunotherapy assigned or administered to a subject can include an indoleamine 2,3 -dioxygenase (IDO) inhibitor, adoptive T-cell therapy, virotherapy (T-VEC), and/or any other immunotherapy whose efficacy extensively depends on anti -turn or immunity. [0299] In various aspects, the immunotherapy may comprise a checkpoint inhibitor, a bispecific antibody, or a microbial immunotherapy. In various embodiments, the checkpoint inhibitor may comprise a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-4 inhibitor and/or an anti-CTLA-4 antibody. In various embodiments, the checkpoint inhibitor may comprise nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

[0300] In accordance with the foregoing, the therapy may be selected from: a microbial therapy such as an attenuated live bacterium like Bacillus Calmette-Guerin (BCG) or any derivative thereof or an engineered bacteria designed for delivering payloads to a tumor; an adjuvant or immunostimulator such as Adjuvant System 04 (AS 04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS- 21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof; a cytokine such as type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa, optionally, comprising TNFa and/or IFNy; and further optionally not comprising IL- 15 or an IL-15 agonist; a cytolytic peptide such as candidalysin, a polysaccharide such as beta-glucan, and/or an immunotherapy, including a checkpoint inhibitor such as PD-1 or CTL-4 inhibitor.

Combination Therapies

[0301] Also contemplated are combination therapies comprising two or more components from the lists above. In some aspects, the combination therapies comprise a microbial therapy, a cancer vaccine, a vaccine component or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy. In some aspects, the combination therapy comprises a microbial therapy and an immunotherapy. In some aspects, the combination therapy comprises a microbial therapy and an immunostimulator and/or adjuvant. In some aspects, the combination therapy comprises a microbial therapy and a polysaccharide. In some aspects, the combination therapy comprises a microbial therapy and a cytokine therapy.

[0302] In some aspects, the combination therapy comprises a Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and an immunotherapy. In some aspects, the combination therapy comprises a Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and an immunostimulator and/or adjuvant. In some aspects, the combination therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and a polysaccharide. In some aspects, the combination therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and a cytokine therapy. In some aspects, the combination therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and one or more of an immunostimulator and/or adjuvant, a polysaccharide, and/or a cytokine therapy.

[0303] In some aspects, the combination therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof and one or more of beta-glucan, a CpG oligodeoxynucleotide, IFN-y, and/or IFN-I. In some aspects, the combination therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof and a checkpoint inhibitor.

Chemotherapies / Targeted Therapies / Alternative Therapies

[0304] Cancers are commonly treated with chemotherapy and/or targeted therapy and/or alternative therapy. Chemotherapies act by indiscriminately targeting rapidly dividing cells, including healthy cells as well as tumor cells, whereas targeted cancer therapies rather act by interfering with specific molecules, or molecular targets, which are involved in cancer growth and progression. Targeted therapy generally targets cancer cells exclusively, having minimal damage to normal cells. Chemotherapies and targeted therapies which are approved and/or in the clinical trial stage are known to those skilled in the art. Any such compound can be utilized in the practice of the present disclosure. [0305] For example, approved chemotherapies include abitrexate (Methotrexate Injection), abraxane (Paclitaxel Injection), adcetris (Brentuximab Vedotin Injection), adriamycin (Doxorubicin), adrucil Injection (5-FU (fluorouracil)), afinitor (Everolimus), afinitor Disperz (Everolimus), alimta (PEMETREXED), alkeran Injection (Melphalan Injection), alkeran Tablets (Melphalan), aredia (Pamidronate), arimidex (Anastrozole), aromasin (Exemestane), arranon (Nelarabine), arzerra (Ofatumumab Injection), avastin (Bevacizumab), beleodaq (Belinostat Injection), bexxar (Tositumomab), BiCNU (Carmustine), blenoxane (Bleomycin), blincyto (Blinatumoma b Injection), bosulif (Bosutinib), busulfex Injection (Busulfan Injection), campath (Alemtuzumab), camptosar (Irinotecan), caprelsa (Vandetanib), casodex (Bicalutamide), CeeNU (Lomustine), CeeNU Dose Pack (Lomustine), cerubidine (Daunorubicin), clolar (Clofarabine Injection), cometriq (Cabozantinib), cosmegen (Dactinomycin), cotellic (Cobimetinib), cyramza (Ramucirumab Injection), cytosarU (Cytarabine), cytoxan (Cytoxan), cytoxan Injection (Cyclophosphamide Injection), dacogen (Decitabine), daunoXome (Daunorubicin Lipid Complex Injection), decadron (Dexamethasone), depoCyt (Cytarabine Lipid Complex Injection), dexamethasone Intensol (Dexamethasone), dexpak Taperpak (Dexamethasone), docefrez (Docetaxel), doxil (Doxorubicin Lipid Complex Injection), droxia (Hydroxyurea), DTIC (Decarbazine), eligard (Leuprolide), ellence (Ellence (epirubicin)), eloxatin (Eloxatin (oxaliplatin)), elspar (Asparaginase), emcyt (Estramustine), erbitux (Cetuximab), erivedge (Vismodegib), erwinaze (Asparaginase Erwinia chrysanthemi), ethyol (Amifostine), etopophos (Etoposide Injection), eulexin (Flutamide), fareston (Toremifene), farydak (Panobinostat), faslodex (Fulvestrant), femara (Letrozole), firmagon (Degarelix Injection), fludara (Fludarabine), fol ex (Methotrexate Injection), folotyn (Pralatrexate Injection), FUDR (FUDR (floxuridine)), gazyva (Obinutuzumab Injection), gemzar (Gemcitabine), gilotrif (Afatinib), gleevec (Imatinib Mesylate), Gliadel Wafer (Carmustine wafer), Halaven (Eribulin Injection), Herceptin (Trastuzumab), Hexal en (Altretamine), Hycamtin (Topotecan), Hycamtin (Topotecan), Hydrea (Hydroxyurea), Ibrance (Palbociclib), Iclusig (Ponatinib), Idamycin PFS (Idarubicin), If ex (Ifosfamide), Imbruvica (Ibrutinib), Inlyta (Axitinib), Intron A alfab (Interferon alfa-2a), Iressa (Gefitinib), Istodax (Romidepsin Injection), Ixempra (Ixabepilone Injection), Jakafi (Ruxolitinib), Jevtana (Cabazitaxel Injection), Kadcyla (Ado- trastuzumab Emtansine), Keytruda (Pembrolizumab Injection), Kyprolis (Carfilzomib), Lanvima (Lenvatinib), Leukeran (Chlorambucil), Leukine (Sargramostim), Leustatin (Cladribine), Lonsurf (Trifluridine and Tipiracil), Lupron (Leuprolide), Lupron Depot (Leuprolide), Lupron DepotPED (Leuprolide), Lynparza (Olaparib), Lysodren (Mitotane), Marqibo Kit (Vincristine Lipid Complex Injection), Matulane (Procarbazine), Megace (Megestrol), Mekinist (Trametinib; for more information, see Borthakur, G. et al., Blood, 2012, 120:677, which is incorporated by reference herein), Mesnex (Mesna), Mesnex (Mesna Injection), Metastron (Strontium-89 Chloride), Mexate (Methotrexate Injection), Mustargen (Mechlorethamine), Mutamycin (Mitomycin), Myleran (Busulfan), Mylotarg (Gemtuzumab Ozogamicin, for more information, see Norsworthy, K. J. et al., Oncologist, 2018, 23: 1103-1108, which is incorporated herein by reference), Navelbine (Vinorelbine), Neosar Injection (Cyclophosphamide Injection), Neulasta (filgrastim), Neulasta (pegfilgrastim), Neupogen (filgrastim), Nexavar (Sorafenib), Nilandron (Nilandron (nilutamide)), Nipent (Pentostatin), Nolvadex (Tamoxifen), Novantrone (Mitoxantrone, for more information, see Fox, E. J., Neurology, 2004, 28(12 Suppl 6): SI 5-8, which is incorporated herein by reference), Odomzo (Sonidegib), Oncaspar (Pegaspargase), Oncovin (Vincristine), Ontak (Denileukin Diftitox), onxol (Paclitaxel Injection), opdivo (Nivolumab Injection), panretin (Alitretinoin), paraplatin (Carboplatin), perjeta (Pertuzumab Injection), platinol (Cisplatin), platinol (Cisplatin Injection), platinolAQ (Cisplatin), platinolAQ (Cisplatin Injection), pomalyst (Pomalidomide), prednisone Intensol (Prednisone), proleukin (Aldesleukin), purinethol (Mercaptopurine), reclast (Zoledronic acid), revlimid (Lenalidomide; for more information see Krbnke, J. et al., Nature, 2015, 523: 183-188, which is incorporated by reference herein), actimid (Pomalidomid), rheumatrex (Methotrexate), rituxan (Rituximab), roferonA alfaa (Interferon alfa-2a), rubex (Doxorubicin), sandostatin (Octreotide), sandostatin LAR Depot (Octreotide), sol tarn ox (Tamoxifen), spry cel (Dasatinib; formore information, see Duong, V. H. et al., Leukemia Research, 2013, 37:300-304, which is incorporated herein by reference), sterapred (Prednisone), sterapred DS (Prednisone), stivarga (Regorafenib), supprelin LA (Histrelin Implant), sutent (Sunitinib), sylatron (Peginterferon Alfa-2b Injection (Sylatron)), sylvant (Siltuximab Injection), synribo (Omacetaxine Injection), tabloid (Thioguanine), taflinar (Dabrafenib), tarceva (Erlotinib), targretin Capsules (Bexarotene), tasigna (Decarbazine), taxol (Paclitaxel Injection), taxotere (Docetaxel), temodar (Temozolomide), temodar (Temozolomide Injection), tepadina (Thiotepa), thalomid (Thalidomide), theraCys BCG (BCG), thioplex (Thiotepa), TICE BCG (BCG), toposar (Etoposide Injection), torisel (Temsirolimus), treanda (Bendamustine hydrochloride), trelstar (Triptorelin Injection), trexall (Methotrexate), trisenox (Arsenic tri oxide), tykerb (lapatinib), unituxin (Dinutuximab Injection), valstar (Valrubicin Intravesical), vantas (Histrelin Implant), vectibix (Panitumumab), velban (Vinblastine), velcade (Bortezomib), vepesid (Etoposide), vepesid (Etoposide Injection), vesanoid (Tretinoin), vidaza (Azacitidine), vincasar PFS (Vincristine), vincrex (Vincristine), votrient (Pazopanib), vumon (Teniposide), wellcovorin IV (Leucovorin Injection), xalkori (Crizotinib), xeloda (Capecitabine), xtandi (Enzalutamide), yervoy (Ipilimumab Injection), yondelis (Trabectedin Injection), zaltrap (Ziv-aflibercept Injection), zanosar (Streptozocin), zelboraf (Vemurafenib), zevalin (Ibritumomab Tiuxetan), zoladex (Goserelin), zolinza (Vorinostat), zometa (Zoledronic acid), zortress (Everolimus), zydelig (Idelali sib), zykadia (Ceritinib), zytiga (Abiraterone), and the like, in addition to analogs and derivatives thereof. For example, approved targeted therapies include ado-trastuzumab emtansine (Kadcyla), afatinib (Gilotrif), aldesleukin (Proleukin), alectinib (Alecensa), alemtuzumab (Campath), axitinib (Inlyta), bosutinib (Bosulif), brentuximab vedotin (Adcetris), cabozantinib (Cabometyx [tablet], Cometriq [capsule]), canakinumab (Haris), carfilzomib (Kyprolis), ceritinib (Zykadia), cetuximab (Erbitux), cobimetinib (Cotellic), crizotinib (Xalkori), dabrafenib (Tafinlar), daratumumab (Darzalex), dasatinib (Spry cel), denosumab (Xgeva), dinutuximab (Unituxin), elotuzumab (Empliciti), erlotinib (Tarceva, for more information, see Boehrer, S. et al., Blood, 2008, 111 :2170-2180, which is incorporated by reference herein), everolimus (Afinitor), gefitinib (Iressa), ibritumomab tiuxetan (Zevalin), ibrutinib (Imbruvica), idelalisib (Zydelig), imatinib (Gleevec), ipilimumab (Yervoy), ixazomib (Ninlaro), lapatinib (Tykerb), lenvatinib (Lenvima), necitumumab (Portrazza), nilotinib (Tasigna), nivolumab (Opdivo), obinutuzumab (Gazyva), ofatumumab (Arzerra, HuMax-CD20), olaparib (Lynparza),osimertinib (Tagrisso), palbociclib (Ibrance), panitumumab (Vectibix), panobinostat (Farydak), pazopanib (Votrient), pembrolizumab (Keytruda), pertuzumab (Peijeta), ponatinib (Iclusig), ramucirumab (Cyramza), rapamycin, regorafenib (Stivarga), rituximab (Rituxan, Mabthera), romidepsin (Istodax), ruxolitinib (Jakafi), siltuximab (Sylvant), sipuleucel-T (Provenge), sirolimus, sonidegib (Odomzo), sorafenib (Nexavar), sunitinib, tamoxifen, temsirolimus (Torisel), tocilizumab (Actemra), tofacitinib (Xeljanz), tositumomab (Bexxar), trametinib (Mekinist), trastuzumab (Herceptin), vandetanib (Caprelsa), vemurafenib (Zelboraf), venetoclax (Venclexta), vismodegib (Erivedge), vorinostat (Zolinza), ziv-aflibercept (Zaltrap), and the like, in addition to analogs and derivatives thereof. In an embodiment, the approved chemotherapy is an anthracycline, such as Doxorubicen, Daunarubicin, Epirubicin, and/or Idarubicin.

Those skilled in the art can determine appropriate chemotherapy and/or targeted therapy and/or alternative therapy options, including treatments that have been approved and those that in clinical trials or otherwise under development. Some targeted therapies are also immunotherapies. Any relevant chemotherapy, target therapy, and alternative therapy treatment strategies can be utilized, alone or in combination with one or more additional cancer therapy, in the practice of the present disclosure, thereof.

Other Treatments

[0306] In addition to conventional therapies, including chemotherapies and immunotherapies, as described above, cancers can additionally be treated by other strategies. These include surgery, radiation therapy, hormone therapy, stem cell transplant, precision medicine, and the like; such treatments and the compounds and compositions utilized therein are known to those skilled in the art. Any such treatment strategies can be utilized in the practice of the present disclosure.

[0307] In some embodiments, the treatments can also include one or more of surgical intervention, chemotherapy, radiation therapy, hormone therapies, immunotherapy, and adjuvant systematic therapies. Adjuvants may include but are not limited to chemotherapy (e.g., temozolomide), radiation therapy, anti angiogenic therapy (e.g., bevacizumab), and hormone therapies, such as administration of LHRH agonists; antiestrogens, such as tamoxifen; high-dose progestogens; aromatase inhibitors; and/or adrenalectomy. Chemotherapy can be used as a single- agent or as a combination with known or new therapies.

[0308] Adjuvant treatments include treatments by the mechanisms disclosed herein and of cancers as disclosed herein, including, but not limited to tumors. Corresponding primary therapies can include, but are not limited to, surgery, chemotherapy, or radiation therapy. In some instances, the adjuvant treatment can be a combination of chemokine receptor antagonists with traditional chemotoxic agents or with immunotherapy that increases the specificity of treatment to the cancer and potentially limits additional systemic side effects.

[0309] In some embodiments, the administration to a subject may decrease the incidence of one or more symptoms associated with a disease or disorder, such as inflammatory and/or autoimmune disorders, and/or type of cancers. In some embodiments, the administration may decrease the incidence of one or more symptoms in said subject, as compared to a subject not receiving said composition.

[0310] In some embodiments, the method may decrease a marker of viability of cancer cells in a subject. In one aspect, the method may decrease a marker of viability of cancer cells. The marker may be selected from survival over time, proliferation, growth, migration, formation of colonies, chromatic assembly, DNA binding, RNA metabolism, cell migration, cell adhesion, inflammation, or a combination thereof.

[0311] Alternative treatment strategies have also been used with various types of cancers. Such treatments can be used alone or in combination with any other treatment modality. These include exercise, massage, relaxation techniques, yoga, acupuncture, aromatherapy, hypnosis, music therapy, dietary changes, nutritional and dietary supplements, and the like; such treatments are known to those skilled in the art. Any such treatment strategies can be utilized, alone or in combination with one or more additional therapy, in the practice of the present disclosure.

Dosage and Administration Routes

[0312] Other embodiments of the disclosure can include methods of administering or treating an animal, which can involve administering an amount of at least one treatment that is effective to treat the disease, condition, or disorder that the organism has, or is suspected of having, or is susceptible to, or to bring about a desired physiological effect. In some embodiments, the composition or pharmaceutical composition comprises at least one treatment, which can be administered to an animal (e.g., mammals, primates, monkeys, or humans) in an amount of about 0.005 to about 50 mg/kg body weight, about 0.01 to about 15 mg/kg body weight, about 0.1 to about 10 mg/kg body weight, about 0.5 to about 7 mg/kg body weight, about 0.005 mg/kg, about 0.01 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 3 mg/kg, about 5 mg/kg, about 5.5 mg/kg, about 6 mg/kg, about 6.5 mg/kg, about 7 mg/kg, about 7.5 mg/kg, about 8 mg/kg, about 10 mg/kg, about 12 mg/kg, or about 15 mg/kg. In regard to some conditions, the dosage can be about 0.5 mg/kg human body weight or about 6.5 mg/kg human body weight. In some instances, some subjects (e.g., mammals, mice, rabbits, feline, porcine, or canine) can be administered a dosage of about 0.005 to about 50 mg/kg body weight, about 0.01 to about 15 mg/kg body weight, about 0.1 to about 10 mg/kg body weight, about 0.5 to about 7 mg/kg body weight, about 0.005 mg/kg, about 0.01 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, about 1 mg/kg, about 5 mg/kg, about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, about 50 mg/kg, about 80 mg/kg, about 100 mg/kg, or about 150 mg/kg. Of course, those skilled in the art will appreciate that it is possible to employ many concentrations in the methods of the present disclosure, and using, in part, the guidance provided herein, will be able to adjust and test any number of concentrations in order to find one that achieves the desired result in a given circumstance. In some embodiments, a dose or a therapeutically effective dose of a compound disclosed herein will be that which is sufficient to achieve a plasma concentration of the compound or its active metabolite(s) within a range set forth herein, e.g., about 1-10 nM, 10-100 nM, 0.1-1 pM, 1- 10 pM, 10-100 pM, 100-200 pM, 200-500 pM, or even 500-1000 pM, preferably about 1-10 nM, 10- 100 nM, or 0.1-1 pM.

[0313] In other embodiments, a treatment can be administered in combination with one or more other therapeutic agents for a given disease, condition, or disorder.

[0314] The compounds and pharmaceutical compositions are preferably prepared and administered in dose units. Solid dose units are tablets, capsules and suppositories. For treatment of a subject, depending on activity of the compound, manner of administration, nature and severity of the disease or disorder, age and body weight of the subject, different daily doses can be used.

[0315] Under certain circumstances, however, higher or lower daily doses can be appropriate. The administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administrations of subdivided doses at specific intervals.

[0316] A treatment as described herein can be administered locally or systemically in a therapeutically effective dose. Amounts effective for this use will, of course, depend on the severity of the disease or disorder and the weight and general state of the subject. Typically, dosages used in vitro can provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models can be used to determine effective dosages for treatment of particular disorders.

[0317] Various considerations are described, e. g. , in Langer, 1990, Science, 249: 1527; Goodman and Gilman's (eds.), 1990, Id., each of which is herein incorporated by reference and for all purposes. Dosages for parenteral administration of active pharmaceutical agents can be converted into corresponding dosages for oral administration by multiplying parenteral dosages by appropriate conversion factors. As to general applications, the parenteral dosage in mg/mL times 1.8 = the corresponding oral dosage in milligrams (“mg”). As to oncology applications, the parenteral dosage in mg/mL times 1.6 = the corresponding oral dosage in mg. An average adult weighs about 70 kg. See e.g., Miller-Keane, 1992, Encyclopedia & Dictionary of Medicine, Nursing & Allied Health, 5th Ed., (W. B. Saunders Co.), pp.1708 and 1651.

[0318] It will be understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy.

[0319] In some embodiments, the administration can include a unit dose of one or more treatments in combination with a pharmaceutically acceptable carrier and, in addition, can include other medicinal agents, pharmaceutical agents, carriers, adjuvants, diluents, and excipients. In certain embodiments, the carrier, vehicle or excipient can facilitate administration, delivery and/or improve preservation of the composition. In other embodiments, the one or more carriers, include but are not limited to, saline solutions such as normal saline, Ringer's solution, PBS (phosphate-buffered saline), and generally mixtures of various salts including potassium and phosphate salts with or without sugar additives such as glucose. Carriers can include aqueous and non-aqueous sterile injection solutions that can contain antioxidants, buffers, bacteriostats, bactericidal antibiotics, and solutes that render the formulation isotonic with the bodily fluids of the intended recipient; and aqueous and non-aqueous sterile suspensions, which can include suspending agents and thickening agents. In other embodiments, the one or more excipients can include, but are not limited to water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. Nontoxic auxiliary substances, such as wetting agents, buffers, or emulsifiers may also be added to the composition. Oral formulations can include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate. The quantity of active component in a unit dose preparation can be varied or adjusted from 0.1 mg to 10000 mg, more typically 1.0 mg to 1000 mg, most typically 10 mg to 500 mg, according to the particular application and the potency of the active component. The composition can, if desired, also contain other compatible therapeutic agents.

[0320] A treatment can be administered to subjects by any number of suitable administration routes or formulations. The treatment, such as an immunotherapy, can also be used to treat subjects for a variety of diseases. Subjects include but are not limited to mammals, primates, monkeys (e.g., macaque, rhesus macaque, or pig tail macaque), humans, canine, feline, bovine, porcine, avian (e.g., chicken), mice, rabbits, and rats. As used herein, the term “subject”, unless stated otherwise, encompasses both human and non-human subjects.

[0321] The route of administration of the compounds of the treatments described herein can be of any suitable route. Administration routes can be, but are not limited to the oral route, the parenteral route, the cutaneous route, the nasal route, the rectal route, the vaginal route, and the ocular route. In other embodiments, administration routes can be parenteral administration, a mucosal administration, intravenous administration, subcutaneous administration, topical administration, intradermal administration, oral administration, sublingual administration, intranasal administration, or intramuscular administration. The choice of administration route can depend on the compound identity (e.g., the physical and chemical properties of the compound) as well as the age and weight of the animal, the particular disease, and the severity of the disease. Of course, combinations of administration routes can be administered, as desired.

[0322] Some embodiments of the disclosure include a method for providing a subject with a treatment which comprises one or more administrations of one or more compositions; the compositions may be the same or different if there is more than one administration.

Exemplary Routes of Administration

[0323] In certain aspects, the therapies described herein delivered to a subject via one or more routes of administration. These routes of administration may be local or systemic. Local administration refers to routes of administration intended to directly deliver a therapy to a chosen organ or region of the body. In most cases, local administration is not intended to allow for systemic reach of the therapeutic agent. Conversely, systemic administration refers to administering via a route intended to distribute the agent throughout the body, without necessarily targeting a particular region. In general, suitable routes of administration may, for example, include intravenous, intracranial, intrathecal, subcutaneous, intranasal route, cranial, transmucosal, trans-nasal, transcranial, intracerebroventricular, intestinal, and/or parenteral delivery. In some aspects, therapies may be administered parenterally. In some aspects, therapies may be administered via localized injection, intravesicularly, intratumorally, intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. In various embodiments, local administration may comprise intravesical administration into a bladder of the subject. In various embodiments, systemic administration may comprise intravenous administration.

[0324] Certain methods of the present disclosure comprise administering two or more therapies (i.e., a combination therapy described above) and in such instances, the two or more therapies may be administered via different routes. In some instances, one therapy (e.g., a microbial therapy, such as Bacillus Calmette-Guerin (BCG), and/or a derivative thereof) is administered locally and another therapy (e.g., an immunostimulator and/or adjuvant, a cytokine therapy, a cytotoxic peptide, a polysaccharide, or an immunotherapy) is administered systemically. In some instances, one therapy (e.g., a microbial therapy, such as Bacillus Calmette-Guerin (BCG), and/or a derivative thereof) is administered locally and another therapy (e.g., an immunostimulator and/or adjuvant, a cytokine therapy, a cytotoxic peptide, a polysaccharide, or an immunotherapy) is administered locally.

Toxicity

[0325] The ratio between toxicity and therapeutic effect for a particular treatment is its therapeutic index and can be expressed as the ratio between LD50 (the amount of compound lethal in 50% of the population) and ED50 (the amount of compound effective in 50% of the population). Compounds that exhibit high therapeutic indices are preferred. Therapeutic index data obtained from in vitro assays, cell culture assays and/or animal studies can be used in formulating a range of dosages for use in humans. The dosage of such compounds preferably lies within a range of plasma concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. See, e.g. Fingl et al., In: THE PHARMACOLOGICAL BASIS OF THERAPEUTICS, Ch. l, p.l, 1975. The exact formulation, route of administration, and dosage can be chosen by the individual practitioner in view of the patient’s condition and the particular method in which the compound is used. For in vitro formulations, the exact formulation and dosage can be chosen by the individual practitioner in view of the patient’s condition and the particular method in which the compound is used. IX. Diseases and Conditions

[0326] In various embodiments, the methods and therapies disclosed herein may be used to treat various conditions in a subject in need thereof. Accordingly, in any of the methods, systems, and other embodiments described herein, the subject has been diagnosed, will be diagnosed, is suspected of having, or has the disease or condition. In various embodiments, the disease or condition comprises a cancer. Therefore, in some embodiments, the subject may have been diagnosed with, or be suspected of having, or has a cancer.

[0327] The term “cancer,” as used herein, may be used to describe a solid tumor, hematological malignancy, metastatic cancer, or non-metastatic cancer. In certain aspects, the cancer may originate in the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, duodenum, small intestine, large intestine, lymph nodes, colon, rectum, anus, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus. In some aspects, the cancer is a Stage I cancer. In some aspects, the cancer is a Stage II cancer. In some aspects, the cancer is a Stage III cancer. In some aspects, the cancer is a Stage IV cancer.

[0328] The cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget’s disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi’s sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing’s sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; hodgkin’s disease; hodgkin’s; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-hodgkin’s lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.

[0329] In certain embodiments, the cancer is a solid tumor. In various embodiments, the solid tumor (that is, the cancer) comprises adenocarcinoma, a basal cell carcinoma, a squamous cell carcinoma, a transitional cell carcinoma, a ductal carcinoma, an angiosarcoma, a bone sarcoma, a fibroblastic sarcoma, a rhabdomyosarcoma, a lymphoma, melanoma, a carcinonosarcoma, a blastoma, or any combination thereof, and further optionally wherein the solid tumor comprises a bladder tumor, melanoma, a subcutaneous epithelial tumor, a testicular tumor, a ovarian tumor, a breast tumor, a triple negative breast cancer, a cervical tumor, a kidney tumor, a liver tumor, hepatocellular carcinoma, a head-and-neck tumor, a head and neck squamous cell carcinoma (HNSCC), a stomach tumor, a gastrointestinal tumor, a lung tumor, a non-small cell lung cancer (NSCLC), an endometrial tumor, an esophageal tumor, a central nervous system tumor, a glioblastoma, a spinal cord tumor, an ocular tumor, a germ cell tumor, a prostate tumor, a colon tumor, a colorectal tumor, a rectal tumor, mesothelioma, an osteogenic sarcoma, Non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, or any combination thereof.

[0330] In some embodiments, the cancer comprises basal cell carcinoma, bone cancer, brain cancer and metastasis, breast cancer, lymphoma, cervical cancer, colon cancer, colorectal cancer, esophageal cancer, glioma, head and neck cancer, renal cell cancer, liver cancer, liver metastases, lung cancer, melanoma, myeloma, ovarian cancer, pancreatic cancer, prostate cancer, squamous cell carcinoma, gastric cancer, testicular cancer, thyroid cancer, or uterine cancer.

[0331] The inventors have made the surprising discovery that certain therapies (e.g., microbial therapies like Bacillus Calmette-Guerin (BCG), and/or a derivative thereof) have surprising systemic effects against many different solid tumors, even when locally administered. For example, a microbial therapy administered to the bladder has surprisingly been found effective for treating cancers outside the bladder (e.g., not bladder cancer). In some embodiments, then, the cancer does not comprise a bladder cancer. In some embodiments, the cancer does not comprise bladder cancer and the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof locally administered to a bladder of the subject. In some embodiments, the cancer comprises bladder cancer and the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof locally administered to a bladder of the subject.

X. Computer Implemented System

[0332] In various embodiments, the systems and methods for characterizing cellular molecular features and/or functional characteristics in an enriched population of rare circulating cells, including progenitor cells, from peripheral blood can be implemented via computer software or hardware.

[0333] FIG. 1 is a block diagram illustrating a computer system 100 upon which embodiments of the present teachings may be implemented. In various embodiments of the present teachings, computer system 100 can include a bus 102 or other communication mechanism for communicating information and a processor 104 coupled with bus 102 for processing information. In various embodiments, computer system 100 can also include a memory, which can be a random-access memory (RAM) 106 or other dynamic storage device, coupled to bus 102 for determining instructions to be executed by processor 104. Memory can also be used for storing temporary variables or other intermediate information during execution of instructions to be executed by processor 104. In various embodiments, computer system 100 can further include a read only memory (ROM) 108 or other static storage device coupled to bus 102 for storing static information and instructions for processor 104. A storage device 110, such as a magnetic disk or optical disk, can be provided and coupled to bus 102 for storing information and instructions.

[0334] In various embodiments, computer system 100 can be coupled via bus 102 to a display 112, such as a cathode ray tube (CRT) or liquid crystal display (LCD), for displaying information to a computer user. An input device 114, including alphanumeric and other keys, can be coupled to bus 102 for communication of information and command selections to processor 104. Another type of user input device is a cursor control 116, such as a mouse, a trackball or cursor direction keys for communicating direction information and command selections to processor 104 and for controlling cursor movement on display 112. This input device 114 typically has two degrees of freedom in two axes, a first axis (i.e., x) and a second axis (i.e., y), that allows the device to specify positions in a plane. However, it should be understood that input devices 114 allowing for 3 -dimensional (x, y and z) cursor movement are also contemplated herein.

[0335] Consistent with certain implementations of the present teachings, results can be provided by computer system 100 in response to processor 104 executing one or more sequences of one or more instructions contained in memory 106. Such instructions can be read into memory 106 from another computer-readable medium or computer-readable storage medium, such as storage device 110. Execution of the sequences of instructions contained in memory 106 can cause processor 104 to perform the processes described herein. Alternatively, hard-wired circuitry can be used in place of or in combination with software instructions to implement the present teachings. Thus, implementations of the present teachings are not limited to any specific combination of hardware circuitry and software. [0336] The term “computer-readable medium” (e.g., data store, data storage, etc.) or “computer- readable storage medium” as used herein refers to any media that participates in providing instructions to processor 104 for execution. Such a medium can take many forms, including but not limited to, non-volatile media, volatile media, and transmission media. Examples of non-volatile media can include, but are not limited to, dynamic memory, such as memory 106. Examples of transmission media can include, but are not limited to, coaxial cables, copper wire, and fiber optics, including the wires that comprise bus 102.

[0337] Common forms of computer-readable media include, for example, a floppy disk, a flexible disk, hard disk, magnetic tape, or any other magnetic medium, a CD-ROM, any other optical medium, punch cards, paper tape, any other physical medium with patterns of holes, a RAM, PROM, and EPROM, a FLASH-EPROM, another memory chip or cartridge, or any other tangible medium from which a computer can read.

[0338] In addition to computer-readable medium, instructions or data can be provided as signals on transmission media included in a communications apparatus or system to provide sequences of one or more instructions to processor 104 of computer system 100 for execution. For example, a communication apparatus may include a transceiver having signals indicative of instructions and data. The instructions and data are configured to cause one or more processors to implement the functions outlined in the disclosure herein. Representative examples of data communications transmission connections can include, but are not limited to, telephone modem connections, wide area networks (WAN), local area networks (LAN), infrared data connections, NFC connections, etc.

[0339] It should be appreciated that the methodologies described herein, flow charts, diagrams and accompanying disclosure can be implemented using computer system 100 as a standalone device or on a distributed network or shared computer processing resources such as a cloud computing network. [0340] The methodologies described herein may be implemented by various means depending upon the application. For example, these methodologies may be implemented in hardware, firmware, software, or any combination thereof. For a hardware implementation, the processing unit may be implemented within one or more application specific integrated circuits (ASICs), digital signal processors (DSPs), digital signal processing devices (DSPDs), programmable logic devices (PLDs), field programmable gate arrays (FPGAs), processors, controllers, micro-controllers, microprocessors, electronic devices, other electronic units designed to perform the functions described herein, or a combination thereof.

[0341] In various embodiments, the methods of the present teachings may be implemented as firmware and/or a software program and applications written in conventional programming languages such as C, C++, Python, etc. If implemented as firmware and/or software, the embodiments described herein can be implemented on a non-transitory computer-readable medium in which a program is stored for causing a computer to perform the methods described above. It should be understood that the various engines described herein can be provided on a computer system, such as computer system 100, whereby processor 104 would execute the analyses and determinations provided by these engines, subject to instructions provided by any one of, or a combination of, memory components 106/108/110 and user input provided via input device 114.

[0342] Although specific embodiments and applications of the disclosure have been described in this specification, these embodiments and applications are exemplary only, and many variations are possible. Having described the disclosure in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing from the scope of the disclosure defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples. XI. Examples

[0343] The following non-limiting examples are provided to further illustrate embodiments of the disclosure herein. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches that have been found to function well in the practice of the disclosure, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure.

EXAMPLE 1

Cellular samples and assays for Examples 2-13

[0344] The cellular samples and assays used in Examples 2-13 are described below.

Cell lines:

[0345] The mouse bladder cancer cell line MB49, expressing luciferase under G418 selection, was a gift from Yi Luo, University of Iowa, Iowa City, IA. The mouse melanoma cell line B 16 was obtained from Taha Merghoub, Memorial Sloan Kettering Cancer Center, New York, NY. MB49 and B 16 were grown in RPMI supplemented with 10% FBS, and 2 mM L-glutamine. MB49-YFP was constructed as previously described. Cells were cultured at 37 °C in a humidified atmosphere of 5% CO2. All cell lines used were confirmed to be negative for mycoplasma by annual testing using MycoAlert Plus (Lonza).

BCG:

[0346] The Pasteur strain of BCG was grown at 37°C in Middlebrook 7H9 supplemented with 10% albumin/dextrose/saline, 0.5% glycerol, and 0.05% Tween 80. To create titered stocks for infection, BCG was grown to mid-log phase (OD600 0.4 to 0.6), washed twice in PBS with 0.05 Tween 80, resuspended in PBS with 25% glycerol, aliquoted, and stored at -80°C To measure the final bacterial titer, an aliquot was thawed and serial dilutions were cultured on 7H10 agar. The bacterial titer was determined by counting colonies after 3 weeks of incubation.

Mouse strains:

[0347] Wild-Type C57BL/6 (Strain #: 000664), CD45.1 (Strain #: 002014), OT- 1 (Strain #: 003831), OT-II (Strain #: 004194), and ZBTB46-DTR (Strain #019506) mice were purchased from The Jackson Laboratory. All mouse strains were bred and housed in Memorial Sloan Kettering Cancer Centers (MSKCC) Research Animal Resource Center under specific pathogen-free conditions. All animal studies were performed with approval from the MSKCC Institutional Animal Care and Use Committee Under Protocol 01-11-030 and were compliant with all applicable provisions established by the Animal Welfare Act and the Public Health Services Policy on the Human Care and Use of Laboratory Animals.

MB49 orthotopic implantation:

[0348] Seven- to eight-week-old female mice (The Jackson Laboratory) were placed under anesthesia in an isoflurane chamber. Mice were transferred from the chamber to a nose cone for the procedure and returned to the chamber for incubation steps. For each mouse, a 24-gauge catheter (Terumo) was inserted into the bladder through the urethra. Next, 100 pL of poly-L-lysine (Sigma) was injected through the catheter, the catheter was capped using an injection plug (Terumo), and the mice were kept under anesthesia for 30 minutes. After 30 minutes, catheters were removed from one mouse at a time in the same order as they were implanted. The catheter was then flushed with a solution containing 500,000 MB49 cells/mL in RPMI. Each mouse was then removed from the isoflurane chamber in turn, the bladder was manually emptied, and the catheter was re-inserted. 100 pL of the MB49 solution (50,000 cells/mouse, unless otherwise noted) was injected into the bladder and the catheter was recapped. The mice were kept under anesthesia for 1 additional hour. At the end of the hour, catheters were removed, and the mice were allowed to recover from anesthesia. Mice were observed daily and were euthanized if they displayed signs of distress, such as dull fur, apathy, or visible signs of growing tumor.

BCG administration:

[0349] Frozen titered stocks of BCG (prepared as detailed above) were thawed and resuspended in PBS for a final concentration of 3xl0⁷ colony forming units/mL (CFU/mL). PBS alone was used as a control. Mice were placed under anesthesia in an isoflurane chamber, transferred from the chamber to a nose cone for the procedure, and returned to the chamber for incubation steps. For bladder administration, a 24-gauge catheter (Terumo) was inserted into the bladder through the urethra, 100 pL of BCG (3xl0⁶ CFU/mouse) was injected into the bladder, and the catheter was capped using an injection plug (Terumo). The mice were kept under anesthesia for 2 hours, after which catheters were removed and mice were allowed to recover from anesthesia. For intravenous BCG (administered via retro-orbital injection), mice were placed in a left lateral position, and gentle pressure was applied above and below the eye to protrude the ocular globe. A 30-gauge needle was carefully inserted approximately 2 mm into the posterior eye socket, and 100 pL of BCG (3xl0⁶ CFU/mouse) was injected into the retro-orbital sinus. The needle was removed, and the mice were allowed to recover from anesthesia.

Measurement of subcutaneous tumors:

[0350] Subcutaneous tumor measurements were obtained using a caliper by measuring the longest axis of the tumor first, followed by the perpendicular axis. Flow cytometry:

[0351] Cell suspensions were analyzed on a LSR Fortessa (BD Biosciences) or Aurora (Cytek), using FACS DiVa software (BD Biosciences) or SpectroFlo (Cytek), respectively. Data analysis was performed using the FlowJo software package (Tree Star). For determination of cytokine production by T cells, single cell suspensions were restimulated with IX Cell Stimulation Cocktail (plus protein transport inhibitors) (eBioscience) for 6 h at 37°C Cells were first stained with a fixable viability dye, followed by surface markers, then fixed and permeabilized using Foxp3 Fixation/Permeabilization Buffer (eBioscience) according to the manufacturer’s instructions, and finally stained for intracellular antigens. Antibodies used for this study are detailed in Table 8.

Table 8

Bone marrow chimeras:

[0352] Whole body irradiation using a cesium source was used to induce hematopoietic ablation of live recipient mice. Mice were placed in a rotating pie-shaped holder then placed in the machine where they received a 9 Gy dose of radiation. Each irradiated mouse received 10⁶ to 10⁷ donor cells (whole bone marrow or sorted LSK cells, as appropriate) in 0.1 mL sterile PBS via retro-orbital injection within 24 hours post-irradiation. Mice were monitored 3 to 4 times per week for 2 weeks postirradiation to ensure no acute illness occurred. All recipient mice were rested for a minimum of 8 weeks to allow full immune reconstitution before further experimentation as described throughout this manuscript. After 8 weeks, a small amount of blood was drawn to confirm full reconstitution of the immune system from donor cells by flow cytometric analysis of immune cell lineages.

T Cell Isolation and Adoptive Transfer:

[0353] Donor spleens were harvested, and single-cell suspensions were made. CD4 and CD8 T cells were isolated using mouse T Cell Isolation Kits (Miltenyi). After cells were counted, recipient mice were placed under anesthesia in an isoflurane chamber and 3 to 5 million cells per mouse were transferred via retro-orbital injection.

PBMC-PIE: [0354] For each human sample, two conical tubes were prepared with RPMI (labeled as tubel and tube2). Frozen PBMCs were thawed in a 37°C water bath and transferred them into tubel. Subsequently, 10% of this suspension was transferred to tube2 for genotyping and sorting viable PBMCs into enriched CD34+ HSPC. Both tubes were centrifuged at 300g for 10 minutes. The resulting pellets were resuspended in MACS buffer. The pellets from 6-8 samples were combined into one tube before proceeding with CD34+ cell enrichment using CD34 microbeads (Miltenyi #: 130-046-702). To optimize the yield of HSPC, the MACS column was not washed, the CD34- fraction (flowthrough) was readded to the column and then cells were removed from the magnet and eluted. The enriched cells collected in the conical tube were then centrifuged and resuspended in FACS staining buffer containing the following antibodies: FITC anti-CD34 (Miltenyi #: 130-113-178, 1 : 100), Pacific Blue anti-CD49f (Biolegend #: 313620, 1 :200), PE anti- CD90 (Biolegend #: 328110, 1 : 100), PE-Cy7 anti- CD38 (Biolegend #: 303516, 1 : 100), APC-Cy7 anti-CD45RA (Biolegend #: 304128, 1 :400), and antilineage (cat number). Staining was performed for 30 minutes in the dark. Post-staining, cells in both tubel (CD34+ enriched cells) and tube2 were resuspended in 7-AAD-containing MACS buffer for sorting. Initially, viable lineage-negative cells were sorted into a PCR tube, followed by sorting PBMCs from tube2 into the same PCR tube. The number of PBMCs sorted was determined based on the desired ratio of PBMC and CD34+ cells in the data.

Mouse progenitor enrichment:

[0355] For bone marrow isolations, bone marrow was harvested from tibia and femurs, after RBC lysis, cells were stained for lineage markers (CD3, NK1.1, Gr-1, B220, Teri 19), cKit and Sca-1. 90k viable, lineage-negative cells were sorted into a PCR tube, and then 10k of lineage positive cells were sorted into the same PCR tube, allowing for a small representation of lineage positive cells in the dataset.

10X Multiome:

[0356] Following sorting, the inventors immediately proceeded with the 10X Multiome protocol. Nuclei isolation was conducted following the low-yield nuclei procedures in the appendix of the nuclei isolation protocol provided by 10X Genomics. The rest of the steps were performed as per the manufacturer’s manual. Sequencing libraries for ATAC-seq and RNA-seq were generated and sequenced using Novaseq6000.

Mouse antibody administration:

[0357] For depleting or blocking experiments mice were treated 2 days before tumor cell challenge, and then every 2-3 days subsequently with 200ug of TNF (BE0058), 250ug of Ly6G(BE00775-l) or 250ug of CD4 (BE0003-1) and 250ug of CD8 (BE0061) anti- mouse antibody per mouse administered IP. All antibodies were purchased from BioXCell. Diphtheria toxin (DT) treatment:

[0358] Recipients of bone marrow from ZBTB46-DTR mice were treated with DT 200ng per mouse diluted in PBS every 3 days

BCG PCR:

[0359] Bone marrow was centrifuged at 4000 RCF for 10 minutes. To lyse eukaryotic cells, the pellet was resuspended in ImL of 5% Triton-XlOO in PBS and incubated at room temperature for 10 minutes. The sample was centrifuged at 10,000 RCF for 10 minutes. Genomic DNA was extracted, and PCR was performed using the primers GGACCAGAGCCAACGATGATG (SEQ ID NO: 1) and AAACTGACTGCCGCCGGATTC (SEQ ID NO: 2) which target the mycobacterial gene pknB.

Colony forming assay:

[0360] Single cell suspensions were isolated from femurs of mice and counted on a Countess II. Cells were resuspended in 10X working stock of 2.5 xl0^A5 cells/ml in IMDM +2% FBS media. 300ul was then added to 3mL complete MethoCult Media (StemCell Technologies catalog no M3434). 1.1ml of media was dispensed using 3ml Syringe (StemCell Technologies catalog no 28240) into one well of a meniscus free 6 well plate (StemCell Technologies catalog no 27370) in technical duplicates. After 12 days colonies were quantified based on their morphology and technical duplicates were averaged and plotted.

Luminex assay:

[0361] Blood was collected via terminal cardiac puncture, and serum was isolated by centrifugation. Luminex assay was performed on serum using the Mouse 48- plex ProcartaPlex kit (Thermo Fisher Scientific, catalog no. EPX480-20834-901) according to manufacturer’s protocol with modifications as described below. Samples were added to the plate containing antibody-linked beads and incubated at 4°C overnight. Following overnight incubation, the plate was incubated at room temperature for 30 minutes with orbital shaking, then subsequent steps were performed per manufacturer’s protocol. Wash buffer was added to wells prior to loading on a Luminex 200 instrument. Each sample was read in duplicates, with a lower bound of 50 beads per sample per analyte.

EXAMPLE 2

Analytical methods for Examples 3-13

[0362] The data analysis methods used in Examples 3-13 are described below.

Preprocessing of single-cell multiome sequenced data:

[0363] The Cell Ranger ARC 2.0.2 pipeline was used for initial processing (sample demultiplexing, barcode processing, alignment of reads, counting of transcripts, cell filtering) of all human and mouse single-cell multiome data with the hg38 and mm 10 reference genome. Human single-cell multiome data processing and basic analysis:

[0364] Starting from initial Cell Ranger filtered cells, additional manual filtering was performed per sample to ensure only high-quality cells remained the data: iteratively embedding and clustering the data, removing clusters with poor quality-control (QC) metrics, and then re-embedding and clustering. RNA data was processed using Scanpy 1.9.3 (median and log normalization of counts, PCA, and UMAP), and AT AC data was processed using ArchR 1.0.1 (iterative LSI, UMAP). Clustering was run on the respective PCA and LSI matrices using PhenoGraph. Cluster QC metrics evaluated included standard Scanpy and ArchR-calculated metrics, DoubletDetection score, and mitochondrial and ribosomal fraction.

[0365] Data from separate samples was integrated without additional data harmonization. For the RNA modality, count matrices from each sample were concatenated into a full data matrix, which was then median and log-normalized. Ribosomal and mitochondrial genes were removed. The top 45 PCs were calculated using 1500 highly variable genes (HVG). PhenoGraph clustering and UMAP were run using 30 nearest neighbors. For the AT AC modality, the inventors applied ArchR’ s implementation of iterative LSI to the tile matrix using 100,000 variable features and ran PhenoGraph on the 30 nearest neighbors in LSI embedding coordinates. Cells were annotated based on manual evaluation of PBMC marker gene expression in RNA clusters. These steps were performed first on cohort 1 and cohort 2 samples independently, and then on all samples combined.

Entropy analysis for the evaluation of single-cell multiome batch effect:

[0366] Entropy was calculated as follows. First a k-NN(k=30) graph in RNA PCA space was constructed using euclidean distance. Given a cell i and its 30 nearest neighbors, the fraction of cells from each sample was computed s = 1, ... ,10 as pf. The Shannon entropy per cell was found as: io

H, = ~ ^ P‘ log₂(P‘)

[0367] High entropy indicates that a cell’s neighborhood in RNA space is made up of a well- mixed set of samples, whereas low entropy indicates that nearby cells mostly come from the same sample.

Single-cell multiome/RNA differential gene expression:

[0368] To determine differentially expressed genes post-BCG treatment, MAST was used, a hurdle model that accounts for the many zero-counts in scRNA-seq data. For each cell type, the MAST model was fit to log-normalized RNA counts of post vs. pre-treatment cells, returning a false discovery rate (fdr) and Natural log fold change, labeled as coefficient (Coef.), per gene per cell type. For mouse single cell RNA-seq analysis, the mast model was fit to long-normalized RNA counts of cells sorted from BCG vs PBS treated animals, returning a FDR and L2FC, per gene per cell type. [0369] Due to an overrepresentation of female cells in the HSPC cluster, it was found significant genes in MAST results for that cluster were dominated by sex-linked genes. For HSPC, MAST was run a second time excluding the genes XIST, TSIX, and all genes on the Y- chromosome.

[0370] Gene set enrichment analysis was performed on notable genesets throughout this project using EnrichR, comparing a given set of genes to the GO Biological Process 2021 reference.

Chromvar motif accessibility:

[0371] A reproducible peak set was constructed for each iteration of a human multi ome dataset (cohort 1, cohort 2, and combined) using ArchR, grouping cells by AT AC PhenoGraph clusters before calling and merging peaks. Motifs within peaks were annotated using the CISBP motif database and determined chromVAR score per cell using ArchR’ s addBgdPeaks() and addDeviationsMatrix() functions.

[0372] To evaluate changes in motif accessibility post-treatment, chromVAR scores in all posttreatment vs. pre-treatment cells were compared for each motif and cell type using a Wilcoxon ranksum test. Statistical significance of motifs was decided based on an p- value cutoff of 0.05. The mean difference (MeanDiff) in chromVAR score post v. pre-treatment was also calculated as the mean of cell scores for a given celltype and motif pretreatment subtracted from the mean of scores posttreatment.

Tumor single cell RNA sequencing:

[0373] Single cell suspensions of MB49-YFP bladder tumors were stained with a BUV-CD45 antibody. Live YFP-negative BUV395-positive cells were sorted on a BD FACSAria Fusion cell sorter.

Mouse Bladder single cell RNA processing and analysis:

[0374] Starting from initial Cell Ranger filtered cells, cells were filtered heuristically based on distributions of QC metrics per sample, eliminating cells with either excessively high or low RNA counts per cell or excessively high mitochondrial RNA content. RNA from high quality cells was processed, CPM normalized, and log transformed per biological sample with Scanpy 1.9.3. All samples were integrated without additional data harmonization, embedded, and clustered (clusters with high doublet scores were removed). Scanpy was used to identify 2000 highly variable genes, which were used to calculate the top 50 PCs, which were used to calculate the nearest neighbors distance matrix. Cells were clustered and visualized using Scanpy’ s implementation of the Leiden algorithm and UMAP from the nearest neighbor’s distance matrix. Cells were then annotated based on manual evaluation of marker gene expression in unsupervised clusters.

T1/T2/T3 Neutrophil Assignment: [0375] Scanpy score genes function was used to score neutrophils on published gene sets for Tl, T2, T3 neutrophils. Cells were identified as T1/T2/T3 based on which neutrophil subtype score was highest, and any cell with a gene score below 0.5 for all gene sets was classified as ‘Other’.

Mouse single-cell multiome data processing and basic analysis

[0376] For the analysis of mouse single-nuclei multiome datasets, R packages Seurat and Signac were employed. The process was initiated by utilizing Cell Ranger outputs for filtered cells to create Seurat objects for each sample. Subsequently, manual cell filtering was conducted for each sample, eliminating cells with either excessively high or low fragment numbers or RNA counts per cell, along with cells exhibiting low TSS enrichment scores. Cells with RNA count less than 100, ATAC fragment count less than 1000, or cells with unusually high counts were filtered out.

[0377] Next, the ATAC-seq assay within the Seurat object was utilized to call peaks for each sample using MACS2. These peaks were then combined using the ‘reduce’ function of GenomicRanges. Following this step, peak count matrices were generated once again for each sample and created a merged Seurat object. Then, the standard Signac workflow, including TF-IDF normalization and SVD with default parameters was applied. UMAP embeddings were generated from the first 50 dimensions obtained through the LSI reduction method. Finally, nearest neighbors were computed using the default settings of the Signac package.

[0378] Utilizing the RNA-seq assay of Seurat objects for each sample, another merged Seurat object was created, which was then divided into layers by sample using the ‘split’ function. Standard Seurat preprocessing workflow steps such as normalization, scaling, and PCA were carried out. The split layers were integrated using ‘integrateLayers,’ resulting in a new dimensional reduction labeled ‘integrated. cca.’ The layers were subsequently rejoined using the ‘JoinLayers’ function within the Seurat package. The RNA-seq dataset was not further processed for UMAP embedding and clustering analysis.

[0379] For motif analysis, motif information was incorporated into the merged object using the ‘AddMotifs’ function in Signac. Motif information for mm 10 was obtained from the JASPAR2020 database. Additionally, per-cell TF motif activity scores were added using chromVAR with the ‘RunChromVAR’ function in Signac as a separate assay to the object.

[0380] Due to the limited depth of the RNA-seq dataset, meaningful clusters were not able to be derived based on transcriptome data. Consequently, the cluster information derived from the ATAC- seq assay was relied on to identify cell types. When annotating each cluster, the cell type calling results were referenced from SingleR package, and with the expression of cluster marker genes and major cell type-specific chromVAR TF activity. Integration and in-depth analyses of snRNA was avoided because low read depth in the snRNA libraries was observed, a common feature of bone marrow multi ome; communications with 10X Genomics.

[0381] To analyze differential TF activity (chromVAR scores) across groups, the ‘FindMarkers’ function in Seurat was utilized, applying the Wilcoxon test. For differential gene expression analysis, the Wilcoxon test was also employed, enabling us to generate volcano plots that highlight significantly differentially expressed genes with adjusted p- values less than 0.05. To correlate differential gene expression with differential chromVAR TF activity, the MAST test was employed to identify genes that were significantly differentially expressed.

Human-mouse differential gene expression comparison:

[0382] Human-mouse orthologous genes were matched based on the HGNC Comparison of Orthology Predictions (HCOP) search tool. Not all matches were one-to-one; a number of mouse genes in the data were mapped to multiple human orthologs. For each gene-gene pair, differential expression results were compared from mouse and human single-cell multiome datasets: specifically, comparing MAST Coef. in humans to Log2FC in mouse.

Bulk ATAC sequencing of mouse LSKs:

[0383] For ATAC-seq, the Omni- ATAC-seq protocol was followed, working with 50,000 LSK cells sorted directly into PCR tubes.

Bulk ATAC-seq Data Processing:

[0384] ATAC-seq fastq files were processed using an in-house pipeline implemented in nextflow () at github.com/michaelbale/jlabflow. Briefly, paired-end reads were trimmed for low-quality base-calls and adapter contamination using the Cutadapt () wrapper Trim Galore (). Remaining reads were then mapped to mm 10 using Bowtie2 () with parameters “-no-mixed — no-unal -no-discordant —local - very sensitive-local -X 1000 -k 4 —mm” retaining only properly mapped fragments with a MAPQ score of at least 30. Mitochondrial reads and improperly paired reads or secondary alignments were removed with Samtools () and Picard () was used to remove duplicate fragments. Finally, all mapped fragments that were associated with the ENCODE Forbidden list () were removed.

Genome Browsing Tracks:

[0385] Genome browsing tracks were generated as bigwigs files using Deeptools bamCoverage () with reads per genomic content normalization using an effective genome size of 2648000000. For figures XXX, bigwigs from individual replicates were averaged together using Deeptools bigwigAverage.

Analysis of ATAC-Seq Data:

[0386] Peak calls for individual samples were made using Genrich () in ATACseq mode (“-j”). Reproducible peaks within each treatment condition were determined using ChlP-r () and optimal peak calls between conditions were merged to form an atlas of 25,245 total peaks. Reads in peaks were generated by Deeptools multiB am Summary and read in to R v4.3.0 for differential analysis using DESeq2 vl.40.2 (). Finally, motif bias analysis was performed using H0MER2 fmdMotifsGenome.pl () with input peaks as peaks that were differentially accessible in BCG-treated LSK over PBS-treated (as defined by DESeq2 analysis) using differentially accessible peaks in PBS-treated LSK over BCG- treated as the custom background set (-bg).

EXAMPLE 3

Bladder BCG induces central innate immune memory

[0387] Intradermal administration of BCG in human adults and intravenous administration in mice induce innate immune memory programs in HSPCs with prominent interferongamma (IFN-Y) signatures. In contrast, administration of BCG into the bladder has long been presumed to act locally by modifying the tumor microenvironment. To determine if bladder BCG stimulates innate immune memory in HSPCs of human NMIBC patients, blood samples were collected from two independent longitudinal post- resection cohorts (Memorial Sloan Kettering Cancer Center, n=8; and McGill University, n=13) before initial BCG administration and one week after the 5th administration of BCG into the bladder (FIG. 2A, Example 1).

[0388] Bladder BCG-induced changes to HSPCs and mature immune cells were interrogated by employing Peripheral Blood Mononuclear Cell analysis with Progenitor Input Enrichment (PBMC- PIE), a workflow recently established by the inventors and described PCT/US2023/062066, which is incorporated herein by reference in its entirety. An overview of this platform is depicted in FIG. 2A. This workflow allows for combined single nucleus RNA and AT AC sequencing of human HSPCs via isolation and enrichment of rare circulating CD34+ cells in the blood, which has been shown faithfully captures the extensive diversity and phenotypes of bone marrow CD34+ cells. Using PBMC-PIE and several well-defined HSPC marker genes including MEIS1 alongside a panel of standard immune cell type markers, a total of 58,652 cells were captured (57,543 from mature peripheral blood immune cell types and 1,118 circulating HSPCs, (FIG. 2B, FIG. 8A).

[0389] To identify molecular programs stimulated by bladder BCG, analysis was focused of the HSPC (MEIS1+) cluster and mature myeloid populations, namely CD 14+ monocytes (CD14+, LYZ+) and classical dendritic cells (eDC) (FCER1A+, CST3+) independently in each cohort. Analysis of all significantly differentially expressed genes pre- and postBCG therapy in either HSPC, CD 14+ monocytes, or eDCs revealed prominent and broadly consistent changes in transcription following bladder BCG treatment (FIG. 2C, FIG. 8B). Similar results were observed between both clinical cohorts. In HSPCs from cohort 1, significant post-BCG transcriptional upregulation of genes and pathways associated with antigen presentation was observed, including HLA-C, HLA-DRB5, HLA- DRA, HLA- DQB1, and B2M (FIG. 2C-2E). Analysis of HSPC from cohort 2 was largely consistent with cohort 1, including upregulation of antigen presentation genes HLA-DRA, HLA- DRB1, B2M, and CD74 (invariant chain) as well as genes with other immune-related functions such as BST2, a regulator of HSPC activation downstream of IFN-Y47 (FIG. 8B).

[0390] To validate that combining cohorts would not introduce additional bias into these datasets an entropy -based measure was applied to evaluate batch effect in combining cohorts (see Example 2) and found samples to be well mixed in RNA local cell neighborhoods (FIGS. 8C-8D). Because subsequent analysis is based on cell type clusters derived from the RNA neighbor graph, further batch correction methods were not applied. After combining datasets, RNA based analysis showed differential genes consistent with analysis of the cohorts individually, highlighting upregulation of an antigen presentation program shared between HSPCs, eDCs, and CD14+ cells, indicating an HSPC derived effect that is passed to monocyte and eDC progeny (FIG. 8E). To visualize this shared program, the fold change of significantly differentially expressed genes pre- and post-BCG in HSPCs was compared to the corresponding fold change in either eDCs or monocytes. This visualization highlights key genes associated with interferon-gamma-mediated signaling and antigen presentation (FIGS. 2D-2E), a finding that was confirmed by GO pathway analysis, with top enriched categories “interferon gamma mediated signaling pathway” (G0:0060333, p-value: 0.004) and “antigen processing and presentation of exogenous peptide antigen via MHC-I, TAPindependent” (G0:002480, p-value: 0.002) (FIG. 8F). [0391] Due to the relative sparsity of single cell ATAC-seq data and given the high degree of overlap in transcriptional changes between the two datasets, ATAC- seq data was analyzed by utilizing the combined datasets. Predicted transcription factor (TF) activity in HSPCs and mature immune cells that may be driving the altered gene expression programs observed above was examined, including those associated with augmented expression of antigen-presentation and IFN-Y pathways. In eDCs, significant enrichment of characteristic interferon response factor (IRF) family motif accessibility post-BCG was observed, as well as GATA and KLF motifs, previously associated with cellular survival and activation (FIG. 2F, FIG. 2G, FIG. 8G and FIG. 8H). In HSPCs, significant enrichment for the predicted activity of AP-1 (FOS/JUN), RUNX and TAL/ZEBZETS family members (FIG. 2G, FIG. 8H) was observed. AP-1 has previously been shown to be associated with the formation of stem cell innate immune memory, and the strong association of ETS family members with myelopoiesis indicates that these HSPCs are reprogrammed for increased myeloid output post-BCG. Pseudobulk ATACseq tracks from HSPCs pre- and post-BCG were generated and increased accessibility at the promoters of HLA genes related to antigen presentation was observed (FIG. 2H). Analysis of individual transcriptional responses of CD14 monocytes and eDCs to bladder BCG revealed a consistent upregulation of both IFN-y and antigen presentation gene modules in both cell types, with some interindividual variability (FIG. 21, FIG, 81 and FIG. 8J).

[0392] Collectively, these findings establish a BCG exposure signature in both HSPCs and their mature myeloid cell progeny (monocyte and eDC) following bladder administration of BCG in humans. Both chromatin accessibility and transcriptomic analyses indicate a signature consistent with interferon imprinting. The data further indicate that the previously characterized systemic effect of intravenous BCG on HSPC-driven innate immune memory is also a feature of BCG administered in the bladder as an immunotherapy for cancer.

EXAMPLE 4

Bladder BCG colonizes the bone marrow and alters HSPC composition

[0393] The changes observed in HSPCs after bladder BCG in humans indicate that locally administered BCG has systemic effects, possibly secondary to dissemination to the bone marrow, as has been reported with IV BCG in mice. Further to this, the MB49 murine model of bladder cancer was used to determine whether BCG can colonize the bone marrow after bladder administration, and to determine the functional consequences of BCG induced HSPC reprogramming. In these experiments, the syngeneic bladder tumor cell line MB49 was implanted into the bladder, followed by 5 weekly bladder installations of 3xl0⁶ colony-forming units (CFU) of live BCG. In this model, 20% to 50% of BCG-treated mice demonstrated long- term survival and subsequent tumor immunity, while 100% of control (PBS-treated) mice succumb to disease. Bone marrow at weekly intervals was harvested and cultured during a 5-week course of bladder BCG administration. Live BCG was observed in the bone marrow of all mice that had received 5 doses of bladder BCG, and in several of the mice that had received 3 or 4 doses (FIG. 3A, FIG. 9A), a finding that was corroborated by positivity of the bone marrow by PCR using BCG-specific primers (FIG. 9B).

[0394] Prior studies have established that intravenous BCG induces expansion and epigenetic modification of the lineage- Scal⁺ Kit⁺ (LSK) population of HSPC linked to the functional enhancement of mature myeloid cells. Mice were treated with IV BCG or five doses of bladder BCG (FIG. 3B) and flow cytometric analysis of HSPC subsets was performed (FIG. 9C). Expansion of the LSK population was observed with both routes of administration, decreases in the proportion of longterm hematopoietic stem cells (LT- HSC), increases in the proportion of short-term hematopoietic stem cells (ST-HSC), and an increase in the proportion of multipotent progenitor (MPP) cells and common myeloid progenitor cells (CMP) (FIG. 3C). Colony forming assays on bone marrow from PBS or bladder BCG treated mice revealed that BCG stimulates differentiation toward the granulocyte (CFU- G) and granulocyte-macrophage (CFU-GM) lineages (FIG. 3D). To further define the importance of the route of administration to this phenomenon, the effect of subcutaneous BCG was also profiled. Consistent with previously published results, subcutaneous BCG did not stimulate LSK expansion to the same degree as bladder administration (FIG. 9D). Intravenous and bladder BCG were similarly protective against bladder tumors, and there was no synergy when combining the two routes of administration (FIG. 9E, FIG. 9F). Taken together, these results indicate that BCG administered in the bladder colonizes the bone marrow and alters hematopoiesis by increasing immune cell production skewed toward the myeloid lineage, a hallmark of innate immune memory.

EXAMPLE 5

Bladder BCG remodels the HSC chromatin landscape

[0395] To determine the bladder BCG induced cellular and molecular programs in HSPCs and progeny cells, and to compare these responses to the human data, in depth single-cell epigenomic and transcriptomic analyses of HSPCs from mice bearing MB49 bladder tumors after 3 doses of bladder BCG was performed (FIG. 3E). After identifying HSPC and mature cell subsets based on marker genes (FIG. 3E, FIG. 10A), the distribution of cells from BCG- and PBS-treated mice was compared. A notable increase in the density of cells in the neutrophil progenitor cluster in BCG-treated mice (FIG. 3F) was observed, indicating that a component of the myeloid skewing induced by bladder BCG includes the neutrophil lineage. Similarly, an analysis of human HSPCs post-BCG revealed an enhancement of a neutrophil signature (FIG. 10B). To define epigenomic- reprogramming in HSPCs, further analyses was focused on the snATAC-seq data. Predicted TF activity analysis (motif accessibility by ChromVAR) revealed enriched IRF and STAT TF activity across stem cells and myeloid progenitors (HSC/MPP, neutrophil progenitor, and monocyte progenitor) (FIG. 3G), strongly indicating that bladder BCG causes a systemic response that exposes HSPCs to interferon signaling, similar to what has been characterized with intravenous administration of BCG. Differential gene expression analysis revealed transcriptional changes in HSC/MPP, neutrophil progenitor, and monocyte progenitor populations consistent with an interferon- responsive antigen presentation signature that is passed from HSCs to progeny myeloid cells (FIG. 10C).

[0396] To determine the concordance of the mouse and human BCG-induced reprogramming, myeloid cell TF activity programs were co-visualized from both mouse and human datasets. The fold change of each orthologous chromVAR score was plotted and those that were significantly different in both species were denoted (FIG. 3H). In HSC/MPP a consistent activation of TFs that regulate myelopoiesis was observed (PU. l, RUNX1, Zebl) (FIG. 3H). In monocytes and dendritic cells, a consistent activation of IRF family members and STAT1/3 was observed (FIG. 3H). Concordant mouse and human RNA upregulation of antigen presentation and IFN-Y responses in both monocytes and dendritic cells were also observed. (FIG. 10D).

[0397] To confirm these results in a purified bulk stem cell population, mice were treated with 5 doses of either bladder PBS or BCG and bulk ATAC sequencing was performed on sorted LSK cells (FIG. 10E). Principal Component Analysis revealed clustering of LSKs from BCG-treated replicates compared to PBS-treated mice, with PCI capturing chromatin accessibility associated with BCG treatment (FIG. 10F). Differential peak accessibility analysis showed an overall upregulation of accessibility after BCG treatment (FIG. 10G). Consistent with the findings from human and mouse single cell analysis, HOMER motif analysis of differential peak accessibility from bulk ATAC sequencing revealed increased inferred TF activity for IRF family members, along with NFY, a TF for MHC enhanceosome formation and transcription of MHC-II genes (FIG. 10H), and PU. l (Spil), a master regulator of hematopoiesis crucially important for myeloid cell development. Comparison of pseudobulk tracks from the HSC/MPP snATAC-seq data with bulk LSK ATAC-seq revealed concordance across single cell annotations of HSC/MPP with sorted LSK, and between these different experiments, with extensive similarities, including at genes involved in antigen presentation, such as CD74, and H2- Ebl (FIG. 31).

[0398] To confirm the systemic inflammatory effects of bladder BCG indicated by the transcriptomics results, levels of cytokines in the serum of mice treated with five doses of bladder BCG were assayed, An increase in the levels of key cytokines including IFN-y, and G-CSF (FIG. 3 J) was found, consistent with findings from the bone marrow showing neutrophil and interferon signatures. Additional cytokines elevated after BCG included TNF, CXCL5, CXCL10, ILip, and IL12-p70 (FIG. 3J, FIG. 101) indicating broad systemic inflammatory effects of BCG administered in the bladder.

EXAMPLE 6

BCG-experienced HSPCs are sufficient to limit tumor growth

[0399] Subsequent experiments next sought to determine the contribution of BCG-induced reprogramming of HSPCs and mature myeloid cells to tumor control. To this end, bone marrow from bladder or intravenous BCG-treated CD45.2^+/+ donor mice was transplanted into naive irradiated CD45.1^+/+ recipient mice (FIG. 4A). Flow cytometric analysis of PBMC subsets from bone marrow chimeric mice at 8-weeks post-transplant confirmed complete immune reconstitution, with approximately 95% of circulating immune cells of donor origin (FIG. 11 A). In line with previous observations of post-BCG myeloid skewing, and highlighting the HSPC origin of these changes, an increase in circulating myeloid cells derived from BCG-experienced donor bone marrow was observed as compared to PBS controls (FIG. 4B). To more directly assess the epigenetic programs and phenotypes of defined progenitors, parallel experiments were designed with chimeric animal protocols with sorted LSK populations rather than total bone marrow. Interferon gamma signaling on bone marrow cells, including Lin- Kit+ cells, has been shown to induce Sca-1 expression, thus confounding flow cytometry gating strategies utilizing this as a marker for murine HSPC populations. To mitigate this bias and heterogeneity of sorted LSK populations, the sorted LSK populations were cultured in media optimized for expanding the primitive self-renewing HSC population for three weeks before transplant. This system has the additional benefits of allowing for inflammatory programs to resolve and reducing potential for transfer of live BCG along with LSK cells which could induce training in the recipient mouse. It has previously been shown that intravenous administration of BCG does not result in direct infection of LSK cells.

[0400] Chimeric animals generated both from cultured LSK (FIG. 4C) and from whole bone marrow (FIG. 11 A) were challenged with subcutaneous tumors. BCG exposed donor LSKs conferred enhanced control of tumor growth, with no discernible difference between the two routes of BCG administration (FIG. 4C). Challenge of BCG LSK- reconstituted mice with B16 melanoma tumors revealed a similar effect on tumor control (FIG. 4D) establishing that the tumor control conferred by BCG-reprogrammed HSPCs is tumor and presumably antigen-independent. As an additional control to confirm that the tumor control conferred by transplanted LSKs is not the result of transfer of viable BCG, donor LSK cells were treated with the anti-mycobacterial antibiotic isoniazid prior to transfer into recipient mice. Similar tumor control was still observed in this experiment (FIG. 11B). Even in the absence of isoniazid, BCG was unable to be cultured from the BM of engrafted recipient mice (data not shown). These results confirm that the BCG exposed LSK HSPC subset alone, without contribution from mature populations co-transferred in bulk bone marrow, can confer a systemic anti-tumor effect.

EXAMPLE 7

BCG induced, HSPC encoded tumor immunity from IFN-y but not type I IFN signaling

[0401] To determine whether upregulation of interferon pathways observed in BCG exposed human and mouse HSPC and myeloid progeny (FIGS. 2-3) are functionally important for HSPC encoded tumor control, IFN-y or the interferon alpha receptor (IFNAR1) were neutralized during bladder BCG treatment. Bone marrow transplanted chimeric mice from these interferon neutralized donors were challenged with MB49 tumors. Neutralization of IFNAR1 in donor mice had no effect on BCG stimulated HSPC encoded tumor immunity (FIG. 4E). In contrast, neutralization of IFN-y in BCG treated HSPC donors abolished tumor control in recipient mice (FIG. 4E), demonstrating that the IFN- y pathway upregulation observed in HSPCs is functionally critical. EXAMPLE 8

BCG-reprogrammed hematopoietic stem cells confer enhanced tumor infdtration to mature innate immune cells

[0402] To characterize the effect of BCG-induced HSPC reprogramming and progeny cells on the bladder tumor microenvironment (TME), groups of congenically marked mixed bone marrow chimeras were generated according to the schematic shown in FIG. 4F, wherein bone marrow from CD45.2^+/+ donor mice treated with either bladder or intravenous BCG was mixed 1 : 1 with naive CD45.1^+/'CD45.2^+/- bone marrow. The 1 : 1 mixed donor bone marrow in all combinations was used to reconstitute naive irradiated CD45.1^+/+ recipient mice (FIG. 4F). After engraftment, greater than 95% immune reconstitution from mixed donor bone marrow in all mice was confirmed by flow cytometry, ensuring that subsequent hematopoiesis reflected the engrafted donor HSPCs. Analysis of the bone marrow revealed similar proportions of LSKs from each donor (FIG. 4G). However, preferential myeloid progenitor expansion originating from bladder or intravenous BCG-experienced bone marrow origin compared with cells of the naive donor origin was observed, consistent with prior findings of BCG-stimulated myelopoiesis (FIG. 4G, FIG. 11C). Specifically, common myeloid progenitor (CMP), common monocyte progenitor (cMoP), granulocyte-monocyte progenitor (GMP), and neutrophil progenitor (NP) originating from BCG-experienced stem cells were all more abundant, with a similar magnitude of enrichment between the two routes of BCG administration (FIG. 4G and FIG. 11C).

[0403] These chimeric animals were then challenged with bladder tumors to determine competitive cell-intrinsic phenotypes within the TME. Because myeloid skewing was observed in the BCG- experienced HSPCs (FIG. 4G, FIG. 11C), and to control for bone marrow output and estimate cell intrinsic differences in tumor migration and proliferation, the bladder infiltration of immune cells was analyzed by normalizing to cell abundance in the spleen. Mature tumor-infiltrating myeloid cells originating from BCG- reprogrammed HSPCs were preferentially enriched compared to tumorinfiltrating cells of naive HSPC origin. Specifically, an increased relative abundance of monocytes, macrophages, neutrophils, and DCs from both the bladder and intravenous BCG-experienced donor groups was found (FIG. 4H, FIG. 1 ID, FIG. 1 IE). In contrast, analysis of the bulk T cell populations revealed no significant differences in abundance of T cell subsets of naive or BCG-experienced origins in either group (FIG. 1 IF), indicating that the effects of BCG on HSPCs are not conveyed to T cell progeny in a manner that augments their tumor abundance. Together, these data indicate that reprogramming of HSPCs by BCG confers an augmented cell-intrinsic capacity for tumor infiltration to progeny myeloid cells. EXAMPLE 9

BCG remodels the function of the myeloid tumor microenvironment

[0404] To characterize the full effects of BCG on the bladder tumor microenvironment, bladder MB49 tumors were treated with BCG or PB S, tumor infiltrating CD45+ immune cells were sorted, and singlecell RNA (scRNA) sequencing was performed on the sorted cells (FIG. 5 A). After unbiased clustering, and cell type annotation of individual clusters (FIG. 12 A), differential expression of genes related to antigen presentation and interferon pathways were observed in monocytes and neutrophils and an activation signature was found in T cells, all consistent with the phenotypes observed in the bone marrow (FIG. 12B). A dramatic enhancement of TNF expression in tumor infiltrating monocytes (FIG. 5B) was observed. To validate this finding, a mixed chimera model (FIG. 4F) was utilized to compare a proportion of TNF-producing cells in mature immune cell subsets in the tumor or the spleen and an increase in TNF production in monocytes, neutrophils, and CD4 T cells derived from BCG reprogrammed HSPCs was found (FIG. 5C, FIG. 12C). This result is also consistent with the increased level of TNF seen in the serum of bladder BCG-treated mice (FIG. 3 J) and other studies that have identified TNF as a principal serum factor induced by BCG that confers resistance to tumor challenge. To investigate the role of TNF in conferring HSC transplantable tumor control, chimeric animals were treated with a TNF with blocking antibody and a loss of tumor control conferred by BCG-experience HSPCs was observed (FIG. 5D).

EXAMPLE 10

Bladder BCG activates HSPC-encoded macrophage hyper-responsiveness

[0405] It was next asked if the population-level and epigenetic changes stimulated by BCG in HSPCs and their myeloid progeny result in functional enhancement by comparing bone marrow-derived macrophages (BMDMs) from mice treated with bladder BCG versus PBS. Consistent with the increased myelopoiesis documented above in BCG-treated mice, a trend toward greater in vitro expansion of bone marrow-derived macrophages from mice treated with bladder BCG was observed (FIG. 12D). Stimulation of bone marrow-derived macrophages with LPS revealed enhancement of transcripts encoding the T cell-recruiting chemokine CXCL10, and the cytokines TNF and IL-6 in macrophages derived from bladder BCG-treated LSKs compared to control macrophages (FIG. 5E).

EXAMPLE 11

BCG Reprogramming of Neutrophils in the TME through HSPCs

[0406] The data shown in FIG. 3F, FIG. 3G, FIG. 10B, and FIG. 10C demonstrate that BCG results in skewing of myelopoiesis toward neutrophils and reprogramming of neutrophil progenitors. To assay the functional role of neutrophils in tumor control conferred by BCG reprogrammed HSPCs, chimeric animals were generated from either PBS or Bladder BCG donor mice, challenged with subcutaneous MB49, and neutrophils depleted with anti-Ly6G depleting antibody. Similar to previously published results, neutrophil depletion in control animals enhanced tumor control, consistent with loss of a protumorigenic neutrophil population (FIG. 5F). In contrast, the enhanced tumor control conferred by BCG reprogrammed HSPCs was lost when neutrophils were depleted (FIG. 5F), indicating that BCG driven conversion of neutrophils from a pro- tumor to antitumor function is a critical effector mechanism of BCG stimulated, HSPC encoded tumor immunity.

[0407] A recent study observed recruitment of pro-tumorigenic immunosuppressive CCL3^hl PDLl^hl neutrophils by IL-8 secreted by bladder cancer cells, consistent with another recent report characterizing a tumor enforced program that results in long-lived pro- angiogenic neutrophils termed T3 neutrophils. Based on the HSPC-derived neutrophil reprogramming observed in humans and mice after BCG (FIG. 10B, FIGS. 3C-3F), the inventors asked if BCG administration altered the phenotype of tumor infiltrating neutrophils. Analysis of gene expression and subsets of tumor-infiltrating neutrophils from bladder tumors in BCG or PBS treated mice revealed a shift in frequency from T3 pro-tumorigenic neutrophils (marked by increased expression of Ccl3, Ccl4, Vegfa, PDL1/CD274, and Zeb2), to mature T2 neutrophils (marked by expression of Isgl5, Ifitml, Gbp2, Cxcr2, and Osm) (FIGS. 5G-5I). This observation is also consistent with data from intra-dermal BCG vaccination, which induces granulopoiesis and functional reprogramming of neutrophils with increased antimicrobial capacity. These results suggest that BCG contributes to improved tumor control through modulation of HSPCs that results in neutrophils that are resistant to angiogenic, pro-tumor functional reprogramming induced by the tumor microenvironment.

EXAMPLE 12

Bladder BCG reprogrammed myeloid cells increase antigen presentation and drive T cell response [0408] The results from earlier Examples establish that administration of BCG into the bladder reprograms bone marrow HSPCs to produce myeloid progeny that preferentially populate tumors and mediate several essential functions for tumor control, including reprogramming of neutrophils and TNF production. Further to this, prominent upregulation of antigen presentation pathways was observed in myeloid cells after BCG in both mice and humans (FIG. 10D). Analysis of the correlation between antigen presentation pathways in tumor neutrophils and monocytes and progenitor cells in the bone marrow revealed expression of multiple transcripts related to antigen presentation (FIG. 6A). Similarly, correlation of BCG induced transcripts in human monocytes post-BCG and mouse BCG treated tumors revealed shared upregulation of antigen presentation pathways. (FIG. 6B). Flow cytometry confirmed enhanced MHC-II expression in tumor infiltrating neutrophils from BCG treated tumors (FIG. 6C, FIG. 12E) and on spleen monocytes and neutrophils in mixed chimeric mice reconstituted with BCG exposed HSPCs (FIG. 6D) all suggesting that BCG enhances antigen presentation across myeloid lineages derived from BCG exposed HSPCs in a cell intrinsic manner.

[0409] To determine if this effect drives enhanced tumor T cell responses, an average gene score was generated for each cell in the T cell cluster, utilizing the genes in the GO Category “T Cell Activation” (G0:0042110). Higher expression of these T cell activation genes was observed in T cells sorted from BCG treated tumors (FIG. 6E), despite no effect of BCG-reprogrammed HSPCs on bulk tumor T cell numbers (FIG. HE). To test whether tumor specific T cell responses were enhanced by BCG- reprogrammed HSPCs, bone marrow chimeric mice reconstituted with LSKs from bladder PBS-, bladder BCG-, and intravenous BCG-experienced donors were implanted with MB49 tumors expressing both MHC Class I (MHC-I) and Class II (MHC-II) epitopes of the model neoantigen ovalbumin (OVA) (FIG. 6F). Seven days after tumor implantation, mice received congenically-marked OT-I (CD8) and OT-II (CD4) transgenic T cells specific to the MHC-I and MHC-II epitopes of OVA, respectively. Transferring naive transgenic T cells ensured that any changes in T cell phenotype would arise via the observed epigenetic and transcriptional enhancements to the myeloid compartment. Analysis of tumor infiltrating T cells by flow cytometry revealed an increased infiltration of OVA- specific CD8 T cells, but not OVA- specific CD4 T cells, in both bladder and intravenous BCG- experienced bone marrow chimeras versus the control group (FIG. 6G, FIG. 12F), as well as enhanced T cell proliferation in animals reconstituted with BCG experienced HSPCs (FIG. 6H, FIG. 12G).

EXAMPLE 13

Myeloid reprogramming from BCG exposed HSPCs drives T cell mediated tumor clearance [0410] Prior data indicates that bladder tumor clearance by BCG is due to tumor specific T cell immunity. To determine whether HSPC-dependent tumor control also depends on T cells, chimeric animals were generated from either PBS or Bladder BCG donor mice, challenged with subcutaneous MB49, and then treated to deplete CD4 and CD8 T cells (FIG. 7A). It was found that depletion of CD4 and CD8 T cells resulted in a loss of the tumor control phenotype conferred by BCG bone marrow, confirming for the involvement of T cells in tumor control in this setting.

[0411] Next, to understand the contribution of the HSPC-dependent enhancement of antigen presentation on T cell activation and tumor control, the ZBTB46-DTR model was utilized. In this model, administration of DT results in specific depletion of classical dendritic cells. Chimeric animals were generated from either PBS or BCG treated donor ZBTB46-DTR mice, challenged with subcutaneous MB49, and then treated with DT to deplete dendritic cells (FIG. 13 A). DC depletion abolished the tumor control conferred by BCG bone marrow but had no independent effect on tumor control in PBS bone marrow chimeras (FIG. 7B). Overall, these data demonstrate a critical role for DCs in tumor control conferred by BCG training of HSPCs and, together with the T cell depletion data, suggests that reprogramming of DCs by BCG leads to improved tumor control by T cells.

[0412] This data supports a model in which BCG reprograms bone marrow stem cells to produce myeloid progeny with enhanced antigen presentation capacity, cytokine production, and neutrophil antitumor function. This broad reprogramming of the myeloid tumor microenvironment stimulates enhanced antitumor T cell responses, which are the ultimate mechanism of BCG induced tumor control. To test whether these BCG effects are synergistic with immunotherapy that directly targets T cells, bone marrow chimeric mice reconstituted with BCG-experienced or control HSPCs were challenged with subcutaneous MB49 tumors and then treated with a PD-1 blocking antibody. Mice that were reconstituted with BCG-experienced bone marrow demonstrated enhanced control of tumors over the PBS control group (FIG. 7C, FIG. 13B). Control bone marrow chimeras treated with the PD- 1 blocking antibody demonstrated a similar level of tumor control to the BCG-experienced bone marrow chimeras (FIG. 7C, FIG. 13B). However, the combination of BCG-experienced HSPCs and a PD-1 blocking antibody exhibited significant reductions in tumor volume and approximately 30% survival, demonstrating a strong synergistic effect of BCG-induced innate immune memory and checkpoint blockade (FIG. 7C, FIG. 7D, FIG. 13B).

XII. Additional Considerations

[0413] Any headers and/or subheaders between sections and subsections of this document are included solely for the purpose of improving readability and do not imply that features cannot be combined across sections and subsection. Accordingly, sections and subsections do not describe separate embodiments.

[0414] While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art. The present description provides preferred exemplary embodiments, and is not intended to limit the scope, applicability, or configuration of the disclosure. Rather, the present description of the preferred exemplary embodiments will provide those skilled in the art with an enabling description for implementing various embodiments.

[0415] It is understood that various changes may be made in the function and arrangement of elements without departing from the spirit and scope as set forth in the appended claims. Thus, such modifications and variations are considered to be within the scope set forth in the appended claims. Further, the terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the disclosure claimed.

[0416] In describing the various embodiments, the specification may have presented a method and/or process as a particular sequence of steps. However, to the extent that the method or process does not rely on the particular order of steps set forth herein, the method or process should not be limited to the particular sequence of steps described, and one skilled in the art can readily appreciate that the sequences may be varied and still remain within the spirit and scope of the various embodiments.

[0417] Some embodiments of the present disclosure include a system including one or more data processors. In some embodiments, the system includes a non-transitory computer readable storage medium containing instructions which, when executed on the one or more data processors, cause the one or more data processors to perform part or all of one or more methods and/or part or all of one or more processes disclosed herein. Some embodiments of the present disclosure include a computerprogram product tangibly embodied in a non-transitory machine-readable storage medium, including instructions configured to cause one or more data processors to perform part or all of one or more methods and/or part or all of one or more processes disclosed herein.

[0418] Specific details are given in the present description to provide an understanding of the embodiments. However, it is understood that the embodiments may be practiced without these specific details. For example, circuits, systems, networks, processes, and other components may be shown as components in block diagram form in order not to obscure the embodiments in unnecessary detail. In other instances, well-known circuits, processes, algorithms, structures, and techniques may be shown without unnecessary detail in order to avoid obscuring the embodiments.

[0419] The various methods and techniques described above provide a number of ways to carry out the disclosure. Of course, it is to be understood that not necessarily all objectives or advantages described can be achieved in accordance with any particular embodiment described herein. Thus, for example, those skilled in the art will recognize that the methods can be performed in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other objectives or advantages as taught or suggested herein. A variety of alternatives are mentioned herein. It is to be understood that some preferred embodiments specifically include one, another, or several features, while others specifically exclude one, another, or several features, while still others mitigate a particular feature by inclusion of one, another, or several advantageous features. [0420] Furthermore, the skilled artisan will recognize the applicability of various features from different embodiments. Similarly, the various elements, features and steps discussed above, as well as other known equivalents for each such element, feature or step, can be employed in various combinations by one of ordinary skill in this art to perform methods in accordance with the principles described herein. Among the various elements, features, and steps some will be specifically included and others specifically excluded in diverse embodiments.

[0421] Although the application has been disclosed in the context of certain embodiments and examples, it will be understood by those skilled in the art that the embodiments of the disclosure extend beyond the specifically disclosed embodiments to other alternative embodiments and/or uses and modifications and equivalents thereof.

[0422] In some embodiments, the numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments of the application are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the application are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable.

[0423] In some embodiments, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment of the application (especially in the context of certain of the following claims) can be construed to cover both the singular and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (for example, “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the application and does not pose a limitation on the scope of the application otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the application.

[0424] Preferred embodiments of this application are described herein. Variations on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is contemplated that skilled artisans can employ such variations as appropriate, and the application can be practiced otherwise than specifically described herein. Accordingly, many embodiments of this application include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the application unless otherwise indicated herein or otherwise clearly contradicted by context.

[0425] All patents, patent applications, publications of patent applications, and other material, such as articles, books, specifications, publications, documents, things, and/or the like, referenced herein are hereby incorporated herein by this reference in their entirety for all purposes, excepting any prosecution file history associated with same, any of same that is inconsistent with or in conflict with the present document, or any of same that may have a limiting affect as to the broadest scope of the claims now or later associated with the present document. By way of example, should there be any inconsistency or conflict between the description, definition, and/or the use of a term associated with any of the incorporated material and that associated with the present document, the description, definition, and/or the use of the term in the present document shall prevail.

[0426] In describing the various embodiments, the specification may have presented a method and/or process as a particular sequence of steps. However, to the extent that the method or process does not rely on the particular order of steps set forth herein, the method or process should not be limited to the particular sequence of steps described. As one of ordinary skill in the art would appreciate, other sequences of steps may be possible. Therefore, the particular order of the steps set forth in the specification should not be construed as limitations on the claims. In addition, the claims directed to the method and/or process should not be limited to the performance of their steps in the order written, and one skilled in the art can readily appreciate that the sequences may be varied and still remain within the spirit and scope of the various embodiments. Similarly, any of the various system embodiments may have been presented as a group of particular components. However, these systems should not be limited to the particular set of components, now their specific configuration, communication and physical orientation with respect to each other. One skilled in the art should readily appreciate that these components can have various configurations and physical orientations (e.g., wholly separate components, units and subunits of groups of components, different communication regimes between components).

[0427] In closing, it is to be understood that the embodiments of the application disclosed herein are illustrative of the principles of the embodiments of the disclosure. Although specific embodiments and applications of the disclosure have been described in this specification, these embodiments and applications are exemplary only, and many variations are possible. Other modifications that can be employed can be within the scope of the application. Thus, by way of example, but not of limitation, alternative configurations of the embodiments of the application can be utilized in accordance with the teachings herein. Accordingly, embodiments of the present application are not limited to that precisely as shown and described.

Claims

CLAIMS What is claimed is:

1. A method for predicting responsiveness of a subject to a therapy, the method comprising: detecting the presence or absence of one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in peripheral blood of the subject, wherein the subject has been diagnosed with cancer and has been administered the therapy; and predicting responsiveness of the subject for the therapy, wherein the subject is predicted to be responsive to the therapy if the one or more circulating cell populations are detected and the subject is predicted to be non-responsive to the therapy if the one or more circulating cell populations are not detected.

2 The method of claim 1, wherein the therapy induces enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in the one or more circulating cell populations.

3 The method of claim 1 or claim 2, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation, interferon gamma-mediated signaling, platelet aggregation, cell-cell adhesion, cytokine production and signaling, positive regulation of ATP biosynthesis, activation, differentiation, and/or anti-tumor response.

4 The method of claim 3, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses.

5 The method of any one of the preceding claims, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 1 to 7.

6 The method of any one of the preceding claims, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 5 to 7.

7 The method of any one of the preceding claims, wherein the epigenetic and transcription signatures comprise enrichment for the or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, BST2, HLAC, AREG, CIITA, MX2, TNFRSF1B, HLA-A, HLA-B, HLA-C. HLA-F, IRF2, S100A9, IL6R, H3F3A, H3F3B, and S100A.

8. The method of claim 7, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, and BST2.

9. The method of any one of the preceding claims, wherein the epigenetic and transcriptional signatures associated with anti-tumor immunity correspond to altered cellular molecular features and/or functional characteristics of the one or more cells.

10. The method of claim 9, wherein the cellular molecular features and/or functional characteristics comprise increased antigen presentation, increased TNF production, increased interferon gamma production, increased granulopoiesis, increased neutrophil reprogramming into an anti-tumor phenotype, increased macrophage or monocyte expression of genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses, , altered proportions or phenotypes of pHSPC subsets related to changes in granulopoeisis, altered or augmented activation states, altered or augmented inflammatory programs, altered or augmented antigen presentation, and/or altered or augmented cytokine responsiveness.

11. The method of any one of claims 1 to 10, wherein the one or more circulating cell populations comprise a rare circulating cell population.

12. The method of any of the preceding claims, further comprising a step of enriching circulating cells from the peripheral blood sample or from peripheral blood mononuclear cells (PBMC) from the peripheral blood sample to provide an enriched population of circulating cells.

13. The method of claim 12, wherein enriching circulating cells comprises: isolating one or more types of circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample from the subject; and enriching the one or more types of circulating cell in the PBMC and/or in the peripheral blood sample, thereby providing the enriched population of circulating cells from the peripheral blood and/or PBMC; and optionally introducing or re-introducing the enriched population of circulating cells into a sample comprising peripheral blood and/or PBMC.

14. The method of claim 13, wherein enriching circulating cells comprises either antibody- conjugated bead-based enrichment or FACS sorting, or sequential antibody-conjugated bead-based enrichment and FACS sorting; optionally wherein enriching circulating cells comprises FACS-sorting circulating cells into one or more tubes prior to cell isolation; optionally wherein enriching circulating cells comprises pooling multiple samples into a single assay tube and demultiplexing after analysis (in silico) based on oligo-conjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals.

15. The method of any one of claims 12 to 14, wherein the peripheral blood and/or PBMC comprises one or more peripheral hematopoietic stem and progenitor cell (pHSPC), CD14+ monocyte (CD14 M ), CD16+ monocyte (CD16 M ), CD34+ HSPC, CD34- HSPC, B cell (B), CD4+ T cell (CD4), CD8+ T cell (CD8), dendritic cell (DC), natural killer cell (NK), plasma B cell (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cell (HSC/MPP), lymphoid-primed multipotent progenitor cell (LMPP), megakaryocyte-erythroid progenitor cell (MEP), erythroid progenitor cell (Ery), granulocyte- monocyte progenitor cell (GMP), basophil- eosinophil-mast cell progenitor cell (BEM), common myeloid progenitor (CMP), granulocytes (GRA), neutrophil progenitor cells (NEUP), or neutrophils (NEU).

16. The method of any one of claims 12 to 15, wherein the enriched population of circulating cells comprise peripheral hematopoietic stem and progenitor cells (pHSPC), CD14+ monocytes (CD14 M.), CD 16+ monocytes (CD 16 M.), B cells (B), CD4+ T cells (CD4), CD8+ T cells (CD8), dendritic cells (DC), natural killer cells (NK), plasma B cells (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cells (HSC/MPP), lymphoid-primed multipotent progenitor cells (LMPP), megakaryocyte-erythroid progenitor cells (MEP), erythroid progenitor cells (Ery), granulocyte- monocyte progenitor cells (GMP), basophil-eosinophil-mast cell progenitor cells (BEM), common myeloid progenitors (CMP), granulocytes (GRA), neutrophil progenitor cells (NEUP), and/or neutrophils (NEU).

17. The method of claim 16, wherein the enriched population of circulating cells comprises a pHSPC, CD14 M., DC and/or NEU population.

18. The method of claim 16, wherein the enriched population of circulating cells comprises a pHSPC, CD14 M., and/or DC population.

19. The method of claim 16, wherein the enriched population of circulating cells comprises a pHSPC population.

20. The method of any one of claims 12 to 19, wherein the enriched population of circulating cells comprises an enriched population of rare circulating cells.

21. The method of any one of the preceding claims, wherein the one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population, a CD 14+ monocyte (CD 14 M.) population, a CD 16+ monocyte (CD 16 M.) population, a B cell (B) population, a CD4+ T cell (CD4) population, a CD8+ T cell (CD8) population, a dendritic cell (DC) population, a natural killer cell (NK) population, plasma B cell (PC) population, a plasmacytoid dendritic cell (pDC) population, a hematopoietic stem cells/multipotent progenitor cell (HSC/MPP) population, a lymphoid-primed multipotent progenitor cell (LMPP) population, a megakaryocyte-erythroid progenitor cell (MEP) population, an erythroid progenitor cell (Ery) population, a granulocyte- monocyte progenitor cells (GMP) population, a basophil-eosinophil-mast cell progenitor cells (BEM) population, a granulocyte (GRA) population, a neutrophil progenitor cell (NEUP) population, a neutrophil (NEU) population, and/or a common myeloid progenitor (CMP) population.

22. The method of any one of the preceding claims, wherein the one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population, a CD 14+ monocyte (CD 14 M.) population, a neutrophil (NEU) population, or dendritic cell (DC) population.

23. The method of any one of the preceding claims, wherein the one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population.

24. The method of any of the preceding claims, wherein one or more circulating cell populations characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity comprise a peripheral hematopoietic stem and progenitor cell (pHSPC) population and the therapy targets the pHSPC population and/or hematopoietic stem and progenitor cells (HSPCs) in bone marrow of the subject.

25. The method of any one of claims 12 to 24, wherein the method further comprises a step of analyzing the enriched population of circulating cells by downstream analysis of cellular molecular features and/or cell functional characteristics to detect the one or more circulating cells characterized by differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity.

26. The method of claim 25, wherein downstream analysis of cellular molecular features and/or cell functional characteristics comprises: acquiring single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data for the enriched population of circulating cells; analyzing the circulating cell transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data to identify cellular molecular features and/or functional characteristics; and generating an output comprising transcriptional, genetic, protein, metabolic, epigenomic, and/or functional characteristic signatures for the one or more types of circulating cells.

27. The method of claim 26, wherein acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more bulk and/or single cell assay; optionally wherein the bulk and/or single cell assay comprises bulk and/or single cell RNA and/or ATACseq analysis; optionally wherein acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more single cell assay and is combined with one or more single cell-based workflows.

28. The method of any one of claims 25 to 27, further comprising parallel sample preparation and scale up enabled by pooling of multiple samples and demultiplexing after analysis (in silico) based on oligo-conjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals; optionally further comprising subject genome sequencing to generate a reference genotype for genotype-based demultiplexing of single cell datasets from pooled samples; optionally wherein genome sequencing comprises whole genome sequencing, exome sequencing, bulk ATACseq, and/or SNP microarray.

29. The method of any one of claims 25 to 28, wherein analyzing the enriched circulating cells comprises analyzing expression of one or more of protein, mRNA, DNA (sequence or post- translational modifications), chromatin (e.g. histone modifications, accessibility, 3D structure/looping, etc.), metabolites, and/or lipids; optionally wherein analyzing the enriched circulating cells comprises analyzing chromatin, DNA, mRNA expression, and/or ATAC-seq data; optionally wherein analyzing the enriched circulating cell mRNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) data comprises combined single cell mRNA/ATAC-seq data processing; UMAP visualization; single cell and/or bulk ATAC-seq; demultiplexing; and/or identifying differentially accessible regions, differentially expressed genes, and/or ATAC peak-gene/transcript associations; optionally wherein transcriptional, genetic, protein, and/or epigenomic signatures are determined by gene ontology (GO) analysis.

30. The method of any one of claims 25 to 29, wherein analyzing the enriched circulating cells comprises combined single nuclei (sn) RNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) (chromium single cell multiome AT AC + gene expression) for PBMC, sorted PBMC subset “bulk” ATAC-seq, multiplexed immunoassay-based quantitation of plasma proteins, and/or immunophenotyping by flow cytometry.

31. The method of any one of the preceding claims, wherein the therapy induces or promotes innate immune memory and/or a systemic anti-tumor response and/or wherein the therapy contributes to HSPC and/or immune progenitor phenotypic changes/reprogramming and/or wherein the therapy induces enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune progenitor cells.

32. The method of claim 31, wherein the populations of immune progenitor cells are in circulation and/or in the bone marrow of the subject.

33. The method of claim 31 or 32, wherein the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs), hematopoietic stem cells (HSCs), and/or intermediate progenitor cells.

34. The method of any one of the preceding claims, wherein the therapy comprises a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

35. The method of claim 34, wherein the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part.

36. The method of claim 34 or 35, wherein the microbial therapy comprises Bacillus Calmette- Guerin (BCG) and/or a derivative thereof.

37. The method of any one of claims 34 to 36, wherein the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof.

38. The method of claim 37, wherein the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

39. The method of any one of claims 34 to 38, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

40. The method of any one of claims 34 to 39, wherein the cytokine therapy comprises a type 1 IFN, a type 2 IFN , IL-lbeta, IL-6, or TNFa.

41. The method of any one of claims 34 to 40, wherein the cytokine therapy does not comprise IL- 15 or a IL- 15 agonist.

42. The method of any one of claims 34 to 41, wherein the cytokine therapy comprises TNFa, IFN- I and/or IFNy.

43 The method of any one of claims 34 to 42, wherein the cytolytic peptide toxin comprises candidalysin.

44 The method of any one of claims 34 to 43, wherein the polysaccharide comprises beta-glucan.

45 The method of any one of claims 34 to 43, wherein the immunotherapy comprises a checkpoint inhibitor, a bispecific antibody, a microbial immunotherapy, or any combination thereof.

46 The method of claim 45, wherein the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-4 inhibitor, an anti-CTLA-4 antibody, or any combination thereof.

47 The method of claim 45 or 46, wherein the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

48 The method of any one of claims 34 to 47, wherein the therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

49 The method of claim 48, wherein the therapy comprises a microbial therapy and/or an immunotherapy.

50 The method of claim 49, wherein the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and/or an immunotherapy.

51 The method of any one of claims 34 to 48, wherein the therapy comprises a microbial therapy and/or one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide

52. The method of claim 51, wherein the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and/or one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide.

53. The method of claim 51 or 52, wherein the one or more immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide are selected from beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

54. The method of any one of claims 34 to 53, wherein the therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof.

55. The method of any one of the preceding claims, wherein the method further comprises determining whether the subject is a candidate for a combination therapy, wherein the combination therapy comprises two or more of a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

56. The method of claim 55, wherein the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part.

57. The method of claim 55 or claim 56, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof.

58. The method of any one of claims 55 to 57, wherein the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof.

59. The method of claim 58, wherein the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

60. The method of any one of claims 55 to 59, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

61. The method of any one of claims 55 to 60, wherein the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa.

62. The method of any one of claims 55 to 61, wherein the cytokine therapy does not comprise IL- 15 or a IL- 15 agonist.

63. The method of any one of claims 55 to 62, wherein the cytokine therapy comprises TNFa, IFN- I, and/or IFNy.

64. The method of any one of claims 55 to 63, wherein the cytolytic peptide toxin comprises candidalysin.

65. The method of any one of claims 55 to 64, wherein the polysaccharide comprises beta-glucan.

66. The method of any one of claims 55 to 65, wherein the immunotherapy comprises a checkpoint inhibitor, a bispecific antibody, a microbial immunotherapy, or any combination thereof.

67. The method of claim 66, wherein the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, an anti-CTLA-1 antibody, or any combination thereof.

68. The method of claim 66 or 67, wherein the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

69. The method of any one of claims 55 to 68, wherein the combination therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

70. The method of claim 69, wherein the combination therapy comprises a microbial therapy and an immunotherapy.

71. The method of claim 70, wherein the combination therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and an immunotherapy.

72. The method of claim 69, wherein the combination therapy comprises a microbial therapy and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, and/or a polysaccharide.

73. The method of claim 72, wherein the combination therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide.

74. The method of claim 73, wherein the combination therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof and one or more of beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

75. The method of any one of the preceding claims, comprising (i) predicting response or refractoriness by the subject to an innate immune memory inducing therapy; (ii) determining ongoing responsiveness to therapy or risk of tumor reemergence in the subject; and/or (iii) determining responsiveness or candidacy for augmented therapy with additional cancer therapies.

76. The method of claim 75, wherein predicting response or refractoriness by the subject to an innate immune memory inducing therapy comprises predicting one or more adverse clinical event.

77. The method of claim 76, comprising predicting one or more adverse clinical event following treatment of the subject with an immunotherapy; optionally wherein the immunotherapy is an immune checkpoint inhibitor.

78. The method of any one of the preceding claims, further comprising determining a cellular or molecular target for therapy based on the epigenetic and transcriptional signatures of the detected cells.

79. A method for identifying a cellular or molecular target for therapy, the method comprising: isolating one or more types of circulating cells from peripheral blood or from peripheral blood mononuclear cells (PBMC) from a peripheral blood sample obtained from a subject with cancer; enriching the one or more types of circulating cells in the PBMC and/or in the peripheral blood sample, thereby providing an enriched population of circulating cells from the peripheral blood and/or PBMC; acquiring single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data for the enriched population of circulating cells; analyzing the enriched circulating cell transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data to identify one or more cellular or molecular targets for the therapy; and generating an output comprising transcriptional, genetic, protein, metabolic, epigenomic, and/or functional characteristic signatures, thereby identifying one or more cellular or molecular targets for the therapy.

80. The method of claims 79, wherein the enriched circulating cells have differential enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity.

81. The method of claim 80, wherein the one or more targets for the cancer therapy are determined based on the epigenetic and transcriptional signatures associated with anti-tumor immunity.

82. The method of claim 80 or 81, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes related to antigen presentation, interferon gamma-mediated signaling, platelet aggregation, cell-cell adhesion, cytokine production and signaling, positive regulation of ATP biosynthesis, activation, differentiation, and/or anti-tumor response; and/or wherein the epigenetic and transcriptional signatures associated with anti -tumor immunity correspond to altered cellular molecular features and/or functional characteristics of the one or more cells.

83. The method of claim 82, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 1 to 7.

84. The method of claim 82 or 83, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes listed in Tables 5 to 7.

85. The method of any one of claims 82 to 84, wherein the epigenetic and transcription signatures comprise enrichment for the or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA- DQB1, B2M, CD74, BST2, HLAC, AREG, CIITA, MX2, TNFRSF1B, HLA-A, HLA-B, HLA-C. HLA- F IRF2, S100A9, IL6R, H3F3A, H3F3B, and S100A.

86 The method of claim 85, wherein the epigenetic and transcription signatures comprise enrichment for one or more genes selected from HLA-C, HLA-DRB5, HLA-DRA, HLA-DQB1, B2M, CD74, and BST2

87 The method of any one of claims 82 to 86, wherein the cellular molecular features and/or functional characteristics comprise increased antigen presentation, increased TNF production, increased interferon gamma production, increased granulopoiesis, increased neutrophil reprogramming into an anti-tumor phenotype, increased macrophage or monocyte expression of genes related to antigen presentation and processing, tumor necrosis factor (TNF)-mediated signaling, interferon gamma-mediated signaling, and/or anti-tumor responses, altered proportions or phenotypes of pHSPC subsets related to changes in granulopoeisis, altered or augmented activation states, altered or augmented inflammatory programs, altered or augmented antigen presentation, and/or altered or augmented cytokine responsiveness.

88 The method of any one of claims 79 to 87, wherein the one or more types of circulating cells are rare circulating cells.

89 The method of any one of claims 79 to 88, wherein circulating cell enrichment comprises either antibody-conjugated bead-based enrichment or FACS sorting, or sequential antibody- conjugated bead-based enrichment and FACS sorting; optionally wherein circulating cell enrichment comprises FACS-sorting circulating cells into one or more tubes prior to cell isolation; optionally wherein circulating cell enrichment comprises pooling multiple samples into a single assay tube and demultiplexing after analysis (in silico) based on oligo-conjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals.

90. The method of any one of claims 79 to 89, wherein the enriched population of circulating cells are introduced or re-introduced into a sample comprising peripheral blood and/or PBMC.

91. The method of any one of claims 79 to 90, wherein the peripheral blood and/or PBMC comprises one or more peripheral hematopoietic stem and progenitor cell (pHSPC), CD 14+ monocyte (CD 14 M ), CD 16+ monocyte (CD 16 M ), CD34+ HSPC, CD34- HSPC, B cell (B), CD4+ T cell (CD4), CD8+ T cell (CD8), dendritic cell (DC), natural killer cell (NK), plasma B cell (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cell (HSC/MPP), lymphoid- primed multipotent progenitor cell (LMPP), megakaryocyte-erythroid progenitor cell (MEP), erythroid progenitor cell (Ery), granulocyte- monocyte progenitor cell (GMP), basophil-eosinophil- mast cell progenitor cell (BEM), granulocyte (GRA), neutrophil progenitor cell (NEUP), neutrophil (NEU), or common myeloid progenitor (CMP).

92. The method of any one of claims 79 to 91, wherein the circulating cell is a peripheral hematopoietic stem and progenitor cell (pHSPC), CD14+ monocyte (CD14 M.), CD16+ monocyte (CD16 M ), B cell (B), CD4+ T cell (CD4), CD8+ T cell (CD8), dendritic cell (DC), natural killer cell (NK), plasma B cell (PC), plasmacytoid dendritic cells (pDC), hematopoietic stem cells/multipotent progenitor cell (HSC/MPP), lymphoid-primed multipotent progenitor cell (LMPP), megakaryocyte-erythroid progenitor cell (MEP), erythroid progenitor cell (Ery), granulocyte- monocyte progenitor cell (GMP), basophil-eosinophil-mast cell progenitor cell (BEM), granulocyte (GRA), neutrophil progenitor cell (NEUP), neutrophil (NEU), or common myeloid progenitor (CMP).

93. The method of any one of claims 79 to 92, wherein the circulating cell is a peripheral hematopoietic stem and progenitor cell (pHSPC), CD 14+ monocyte (CD 14 M.), dendritic cell (DC), or neutrophil (NEU).

94. The method of claim 93, wherein the circulating cell is a pHSPC.

95. The method of claim 94, wherein the pHSPC is a CD34+ or CD34- pHSPC.

96. The method of any one of claims 79 to 95, wherein the peripheral blood sample is obtained directly from a subject or is from cryopreserved PBMC and/or cryopreserved peripheral blood.

97. The method of any one of claims 79 to 96, wherein the enriched population of circulating cells comprises a peripheral hematopoietic stem and progenitor cell (pHSPC) population, and wherein the therapy targets the pHSPC population and/or a hematopoietic stem and progenitor cell (HSPC) population in bone marrow.

98. The method of any one of claims 79 to 97, wherein acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more bulk and/or single cell assay; optionally wherein the bulk and/or single cell assay comprises bulk and/or single cell RNA and/or ATACseq analysis; wherein acquiring the single cell and/or bulk transcriptomic, genetic, and/or protein expression, and/or metabolic, epigenomic, and/or other functional assay data comprises one or more single cell assay and is combined with one or more single cell-based workflows.

99. The method of any one of claims 79 to 98, further comprising parallel sample preparation and scale up enabled by pooling of multiple samples and demultiplexing after analysis (in silico) based on oligoconjugated antibody-based demultiplexing or genotype (SNP) based demultiplexing using genetic variance between individuals; optionally further comprising subject genome sequencing to generate a reference genotype for genotype-based demultiplexing of single cell datasets from pooled samples; optionally wherein genome sequencing comprises whole genome sequencing, exome sequencing, bulk ATACseq, and/or SNP microarray.

100. The method of any one of claims 79 to 99, wherein analyzing the enriched circulating cells comprises analyzing expression of one or more of protein, mRNA, DNA (sequence or post- translational modifications), chromatin (e.g. histone modifications, accessibility, 3D structure/looping, etc.), metabolites, and/or lipids; optionally wherein analyzing the enriched circulating cells comprises analyzing chromatin, DNA, mRNA expression, and/or ATAC-seq data; optionally wherein analyzing the enriched circulating cell mRNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) data comprises combined single cell mRNA/ATAC-seq data processing; UMAP visualization; single cell and/or bulk ATAC-seq; demultiplexing; and/or identifying differentially accessible regions, differentially expressed genes, and/or ATAC peak-gene/transcript associations; optionally wherein transcriptional, genetic, protein, and/or epigenomic signatures are determined by gene ontology (GO) analysis.

101. The method of any one of claims 79 to 100, wherein analyzing the enriched circulating cells comprises combined single nuclei (sn) RNA and assay for transposase-accessible chromatin sequencing (ATAC-seq) (chromium single cell multiome ATAC + gene expression) for PBMC, sorted PBMC subset “bulk” ATAC-seq, multiplexed immunoassay-based quantitation of plasma proteins, and/or immunophenotyping by flow cytometry.

102. The method of any one of claims 79 to 101, wherein the therapy induces or promotes innate immune memory and/or a systemic anti-tumor response and/or wherein the therapy contributes to HSPC and/or immune progenitor phenotypic changes/reprogramming and/or wherein the therapy induces enrichment of epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of immune progenitor cells.

103. The method of claim 102, wherein the populations of immune progenitor cells are in circulation and/or in the bone marrow of the subject.

104. The method of claim 102 or 103, wherein the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs), hematopoietic stem cells (HSCs), and/or intermediate progenitor cells.

105. The method of any one of claims 79 to 104, wherein the therapy comprises a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

106. The method of claim 105, wherein the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part.

107. The method of any one of claims 79 to 106, wherein the therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

108. The method of any one of claims 79 to 107, wherein the therapy comprises an immunotherapy.

109. A method for treating a cancer in a subject, the method comprising: predicting responsiveness of a subject to a therapy according to any method of claims 1 to 78, and administering the therapy to the subject.

110. A method for treating a cancer in a subject, the method comprising: identifying one or more cellular or molecular targets for therapy according to any method of claims 79 to 108, and administering a therapy targeting the one or more cellular or molecular targets to the subject.

111. A method of systemically treating a subject for cancer, the method comprising administering a therapy to a subject diagnosed with cancer, wherein the therapy induces epigenetic and transcriptional signatures associated with anti -tumor immunity in one or more populations of immune progenitor cells in the subj ect.

112. The method of claim 112, wherein the immune progenitor cells are in circulation and/or in the bone marrow of the subject.

113. The method of claim 111 or claim 112, wherein the immune progenitor cells comprise hematopoietic stem and progenitor cells (HSPCs), hematopoietic stem cells (HSCs), and/or intermediate progenitor cells.

114. A method of systemically treating a subject for cancer, the method comprising administering a therapy to a subject diagnosed with cancer, wherein the subject has been determined to be responsive to the therapy via a classifier based at least in part on analyzing expression levels in the subject of epigenetic and transcriptional signatures associated with anti-tumor immunity in one or more populations of circulating cells in the subject.

115. The method of any one of claims 109 to 114, wherein the therapy comprises a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

116. The method of claim 115, wherein the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part.

117. The method of claim 115 or 116, wherein the microbial therapy comprises Bacillus Calmette- Guerin (BCG) and/or a derivative thereof.

118. The method of any one of claims 115 to 117, wherein the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof.

119. The method of claim 118, wherein the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

120. The method of any one of claims 115 to 119, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG) and/or a derivative thereof, and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

121. The method of any one of claims 115 to 120, wherein the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa.

122. The method of any one of claims 115 to 121, wherein the cytokine therapy does not comprise IL- 15 or an IL- 15 agonist.

123. The method of any one of claims 115 to 122, wherein the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

124. The method of any one of claims 115 to 123, wherein the cytolytic peptide toxin comprises candidalysin.

125. The method of any one of claims 115 to 124, wherein the polysaccharide comprises betaglucan.

126. The method of any one of claims 115 to 125, wherein the immunotherapy comprises a checkpoint inhibitor.

127. The method of claim 126, wherein the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, an anti-CTLA-1 antibody, or any combination thereof.

128. The method of claim 126 or 127, wherein the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

129. The method of any one of claims 115 to 128, wherein the therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

130. The method of claim 129, wherein the therapy comprises a microbial therapy and, optionally, an immunotherapy.

131. The method of claim 130, wherein the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and, optionally, an immunotherapy.

132. The method of any one of claims 115 to 129, wherein the therapy comprises a microbial therapy and, optionally, one or more of one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide.

133. The method of claim 132, wherein the therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof and, optionally, one or more of one or more of an immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide.

134. The method of claim 132 or 133, wherein the one or more immunostimulator and/or adjuvant, a cytokine therapy, or a polysaccharide are selected from beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

135. The method of any one of claims 115 to 134, wherein the therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof.

136. The method of any one of claim 109 to 135, wherein the therapy is administered via localized injection, intravesicularly, intratum orally, intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally.

137. The method of claim 136, wherein the therapy is administered via localized injection.

138. The method of any one of claims 109 to 137, further comprising administering to the subject a combination therapy comprising two or more of a small molecule, a cytolytic peptide, a protein, an antibody, a therapeutic peptide, an oligonucleotide, a gene therapy vector, a nanoparticle, a liposome, a polysaccharide, an oncolytic virus, a neoantigen, a chemotherapy, a hormone therapy, a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or any combination thereof.

139. The method of claim 138, wherein the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part.

140. The method of claim 138 or 139, wherein the microbial therapy comprises Bacillus Calmette- Guerin (BCG) and/or a derivative thereof.

141. The method of claim 138 or 140, wherein the immunostimulator and/or adjuvant comprises Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof.

142. The method of claim 141, wherein the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

143. The method of any one of claims 138 to 142, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

144. The method of any one of claims 138 to 143, wherein the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa.

145. The method of any one of claims 138 to 144, wherein the cytokine therapy does not comprise IL- 15 or an IL- 15 agonist.

146. The method of any one of claims 138 to 145, wherein the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

147. The method of any one of claims 138 to 146, wherein the cytolytic peptide toxin comprises candidalysin.

148. The method of any one of claims 138 to 147, wherein the polysaccharide comprises betaglucan.

149. The method of any one of claims 138 to 148, wherein the immunotherapy comprises a checkpoint inhibitor, a bispecific antibody, a microbial immunotherapy, or any combination thereof.

150. The method of claim 149, wherein the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, an anti-CTLA-1 antibody, or any combination thereof.

151. The method of claim 149 or 150, wherein the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

152. The method of any one of claims 138 to 151, wherein the combination therapy comprises a microbial therapy, a cancer vaccine, an immunostimulator and/or adjuvant, a cytokine therapy, a cytolytic peptide, a polysaccharide, and/or an immunotherapy.

153. The method of claim 152, wherein the combination therapy comprises a microbial therapy and an immunotherapy.

154. The method of claim 153, wherein the combination therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof and an immunotherapy.

155. The method of any one of claims 138 to 152, wherein the combination therapy comprises a microbial therapy and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, and/or a polysaccharide.

156. The method of claim 155, wherein the combination therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof and one or more of an immunostimulator and/or adjuvant, a cytokine therapy, and/or a polysaccharide.

157. The method of claim 156, wherein the combination therapy comprises Bacillus Calmette- Guerin (BCG) and/or a derivative thereof and one or more of beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I.

158. The method of any one of claims 138 to 157, wherein at least one component of the combination therapy is administered locally, and wherein at least one component of the combination therapy is administered systemically.

159. The method of any one of claims 138 to 158, wherein the combination therapy comprises localized administration of a microbial therapy and systemic administration of one or more of an immunostimulator and/or adjuvant, an immunotherapy, cytokine therapy, and/or polysaccharide.

160. The method of claim 159, wherein the combination therapy comprises localized administration of Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and systemic administration of betaglucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, IFN-I, and/or an immunotherapy.

161. The method of any one of claims 138 to 158, wherein the combination therapy comprises localized administration of a microbial therapy, and localized administration of one or more of an immunostimulator and/or adjuvant, an immunotherapy, cytokine therapy, and/or polysaccharide.

162. The method of any one of claims 161, wherein the combination therapy comprises localized administration of Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and localized administration of beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, IFN-I, and/or an immunotherapy.

163. The method of any one of the preceding claims, wherein the cancer comprises a solid tumor.

164. The method of claim 163, wherein the solid tumor comprises a sarcoma, a carcinoma, a carcinosarcinoma, a lymphoma, melanoma, or any combination thereof, optionally wherein the solid tumor comprises an adenocarcinoma, a basal cell carcinoma, a squamous cell carcinoma, a transitional cell carcinoma, a ductal carcinoma, an angiosarcoma, a bone sarcoma, a fibroblastic sarcoma, a rhabdomyosarcoma, a lymphoma, melanoma, a carcinonosarcoma, a blastoma, or any combination thereof, and further optionally wherein the solid tumor comprises a bladder tumor, melanoma, a subcutaneous epithelial tumor, a testicular tumor, a ovarian tumor, a breast tumor, a triple negative breast cancer, a cervical tumor, a kidney tumor, a liver tumor, hepatocellular carcinoma, a head-and- neck tumor, a head and neck squamous cell carcinoma (HNSCC), a stomach tumor, a gastrointestinal tumor, a lung tumor, a non-small cell lung cancer (NSCLC), an endometrial tumor, an esophageal tumor, a central nervous system tumor, a glioblastoma, a spinal cord tumor, an ocular tumor, a germ cell tumor, a prostate tumor, a colon tumor, a colorectal tumor, a rectal tumor, mesothelioma, an osteogenic sarcoma, Non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, or any combination thereof.

165. The method of any one of claims 1 to 164, wherein the therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof, and the cancer comprises a solid tumor; optionally wherein the cancer comprises bladder cancer.

166. The method of any one of claims 1 to 164, wherein the therapy comprises Bacillus Calmette- Guerin (BCG), and/or a derivative thereof, and the cancer comprises a solid tumor and does not comprise bladder cancer.

167. The method of any one of claims 1 to 166, wherein administration of the therapy has a systemic (pan-anti-cancer) activity.

168. The method of any one of claims 109 to 167, further comprising (i) predicting response or refractoriness by the subject to the therapy and/or combination therapy; (ii) determining ongoing responsiveness to the therapy and/or combination therapy or risk of tumor reemergence in the subject; and/or (iii) determining responsiveness or candidacy for augmented therapy with additional cancer therapies.

169. A method of systemically treating a cancer in a subject in need thereof, the method comprising localized administration of a microbial therapy to the subject.

170. The method of claim 169, wherein the microbial therapy is a pathogen or a non-pathogen and/or is engineered in whole or in part.

171. The method of claim 170, wherein the microbial therapy is a live attenuated pathogen.

172. The method of any one of claims 169 to 171, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof.

173. The method of any one of claims 169 or 172, wherein the microbial therapy is locally administered to a bladder of the subject.

174. The method of any one of claims 169 to 173, wherein the method further comprises administering one or more secondary agents selected from an immunostimulator and/or adjuvant, a cytokine therapy, a cytotoxic peptide, a polysaccharide, or an immunotherapy to the subject.

175. The method of claim 174, wherein the immunostimulator and/or adjuvant comprise Adjuvant System 04 (AS04), Adjuvant System 03 (AS03), Adjuvant System 01 (AS01), QS-21, MF59, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), potassium aluminum sulfate (Alum), aluminum hydroxide, monophosphoryl lipid A (MPL), squalene, RNA, or any combination thereof.

176. The method of claim 175, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and the immunostimulator and/or adjuvant comprises a CpG oligodeoxynucleotide and/or cytosine phosphoguanine (CpG).

177. The method of any one of claims 174 to 176, wherein the cytokine therapy comprises a type 1 IFN, a type 2 IFN, IL-lbeta, IL-6, or TNFa.

178. The method of any one of claims 174 to 177, wherein the cytokine therapy does not comprise IL- 15 or an IL- 15 agonist.

179. The method of any one of claims 174 to 178, wherein the cytokine therapy comprises TNFa, IFN-I, and/or IFNy.

180. The method of any one of claims 174 to 179, wherein the cytolytic peptide comprises candidalysin.

181. The method of any one of claims 174 to 180, wherein the polysaccharide comprises betaglucan.

182. The method of any one of claims 174 to 181, wherein the immunotherapy comprises a checkpoint inhibitor.

183. The method of claim 182, wherein the checkpoint inhibitor comprises a PD-1 inhibitor or an anti-PD-1 antibody, a CTLA-1 inhibitor, an anti-CTLA-1 antibody, or any combination thereof.

184. The method of claim 182 or 183, wherein the checkpoint inhibitor comprises nivolumab, pembrolizumab, pidilizumab, tremelimumab, atezolizumab, ipilimumab, or any combination thereof.

185. The method of any one of claims 174 to 184, wherein the one or more secondary agents are administered systemically to the subject.

186. The method of claim 185, wherein the one or more secondary agents comprises an adjuvant and/or immunotherapy administered systemically to the subject.

187. The method of claim 186, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and wherein beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), and/or IFN-I is administered systemically.

188. The method of any one of claims 174 to 184, wherein the one or more secondary agents are administered locally to the subject.

189. The method of claim 188, wherein the one or more secondary agent comprises immunostimulator and/or adjuvant, a cytokine therapy, an immunotherapy, or a polysaccharide administered locally to the subject.

190. The method of claim 189, wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof, and wherein beta-glucan, a CpG oligodeoxynucleotide, cytosine phosphoguanine (CpG), IFN-y, and/or IFN-I is administered locally.

191. The method of any one of claims 169 to 190, wherein the cancer comprises a solid tumor.

192. The method of any one of claims 169 to 191, wherein the solid tumor comprises a sarcoma, a carcinoma, a carcinosarcinoma, a lymphoma, melanoma, or any combination thereof, optionally wherein the solid tumor comprises an adenocarcinoma, a basal cell carcinoma, a squamous cell carcinoma, a transitional cell carcinoma, a ductal carcinoma, an angiosarcoma, a bone sarcoma, a fibroblastic sarcoma, a rhabdomyosarcoma, a lymphoma, melanoma, a carcinonosarcoma, a blastoma, or any combination thereof, and further optionally wherein the solid tumor comprises a bladder tumor, melanoma, a subcutaneous epithelial tumor, a testicular tumor, a ovarian tumor, a breast tumor, a triple negative breast cancer, a cervical tumor, a kidney tumor, a liver tumor, hepatocellular carcinoma, a head-and-neck tumor, a head and neck squamous cell carcinoma (HNSCC), a stomach tumor, a gastrointestinal tumor, a lung tumor, a non-small cell lung cancer (NSCLC), an endometrial tumor, an esophageal tumor, a central nervous system tumor, a glioblastoma, a spinal cord tumor, an ocular tumor, a germ cell tumor, a prostate tumor, a colon tumor, a colorectal tumor, a rectal tumor, mesothelioma, an osteogenic sarcoma, Non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, or any combination thereof.

193. The method of any one of claims 169 to 192, wherein the cancer is not a bladder cancer.

194. The method of any one of claims 169 to 192, wherein the cancer comprises bladder cancer, and wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof locally administered to a bladder of the subject.

195. The method of any one of claims 169 to 193, wherein the cancer is not a bladder cancer, and wherein the microbial therapy comprises Bacillus Calmette-Guerin (BCG), and/or a derivative thereof locally administered to a bladder of the subject.