WO2025072640A1 - Targeted eradication of ebv-positive cells by crispr/cas-mediated ebv reactivation - Google Patents
Targeted eradication of ebv-positive cells by crispr/cas-mediated ebv reactivation Download PDFInfo
- Publication number
- WO2025072640A1 WO2025072640A1 PCT/US2024/048812 US2024048812W WO2025072640A1 WO 2025072640 A1 WO2025072640 A1 WO 2025072640A1 US 2024048812 W US2024048812 W US 2024048812W WO 2025072640 A1 WO2025072640 A1 WO 2025072640A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- grna
- ebv
- seq
- sequence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
- A61K31/52—Purines, e.g. adenine
- A61K31/522—Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- Epstein-Barr Virus also known as human herpesvirus 4 (HHV-4)
- HHV-4 human herpesvirus 4
- EBV like Kaposi’s sarcoma-associated herpesvirus (KSHV)
- KSHV sarcoma-associated herpesvirus
- Patel PD etal. The Association of Epstein-Barr Virus with Cancer. Cureus. 2022 Jun 25;14(6):e26314; Shechter O, et al. Epstein-Barr Virus (EBV) Epithelial Associated Malignancies: Exploring Pathologies and Current Treatments. Int J Mol Sci. 2022 Nov 19;23(22):14389; Cohen JI, et al. Epstein-Barr virus: an important vaccine target for cancer prevention. Sci Transl Med.
- EBV infection of B cells normally establishes latency with limited viral gene expression and is associated with lymphomas, such as Burkitt’s lymphoma.
- the virus occasionally reactivates during B cell development process.
- EBV-infected epithelial cells the virus typically undergoes lytic replication, but, in EBV-associated epithelial cell cancers, the virus remains in a latent state (see, e.g., Young LS, et al. 2016. Epstein- Barr virus: more than 50 years old and still providing surprises. Nat Rev Cancer 16:789-802).
- EBV may be treated with nucleoside analogs, such as ganciclovir, acyclovir, penciclovir, or fialuridine (FIAU, e.g., [ 131 l]2Mluoro-2’-deoxy-beta-D-5-iodouracil- arabinofuranoside
- FIAU fialuridine
- EBNA1 is a drug target.
- the nucleoside analogs are phosphorylated by EBV- encoded protein kinase (BGLF4), which modifies ganciclovir (GCV) into an active form (see, e.g., Meng Q, etal. 2010.
- Epstein-Barr virus (EBV)-encoded protein kinase EBV-PK, but not the thymidine kinase (EBV-TK)
- EBV-PK Epstein-Barr virus
- EBV-TK thymidine kinase
- Phosphorylated GCV inhibits both viral and cellular DNA polymerases.
- the inhibition of viral DNA polymerase will block EBV replication and prevent the release of infectious virus.
- the inhibition of cellular DNA polymerase results in cell death (Westphal EM, et al. 1999.
- Ganciclovir and penciclovir induce apoptosis in herpes simplex virus thymidine kinase-transformed baby hamster kidney cells. Antivir Chem Chemother. 2001 May;12(3):175-86). Therefore, reactivating EBV from latency will provide an opportunity to selectively kill virus- infected cells.
- Adenovirus vectors expressing EBV Immediate-Early (IE) genes have been used to induce reactivation in Burkitt lymphoma cells.
- IE EBV Immediate-Early
- y-irradiation, sodium butyrate, and chemotherapeutic agents e.g., Bortezomib, cis-platinum, 5-fluorouracil (5-FU), gemcitabine and taxol
- chemotherapeutic agents e.g., Bortezomib, cis-platinum, 5-fluorouracil (5-FU), gemcitabine and taxol
- chemotherapeutic agents e.g., Bortezomib, cis-platinum, 5-fluorouracil (5-FU), gemcitabine and taxol
- chemotherapeutic agents e.g., Bortezomib, cis-platinum, 5-fluorouracil (5-FU), gemcitabine and taxo
- EBV-positive cells such as EBV-positive cancer cells, for example associated with B- cell or epithelial malignancies.
- a method of killing an EBV-positive cell comprising inducing expression of an EBV IE gene in the EBV-positive cell by introducing into the cells a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to a promoter region of the EBV IE gene, and a corresponding non-cleaving Cas (dCas) transcriptional activator in an amount effective to induce expression of the IE gene, which subsequently induces an EBV protein kinase gene in the cell, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in the cell to the IE gene promoter region.
- gRNA CRISPR guide RNA
- dCas non-cleaving Cas
- a nucleic acid comprising a gene for expression of a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
- gRNA CRISPR guide RNA
- a nanoparticle, virus particle, or virus-like particle comprising the nucleic acid also is provided.
- a composition comprising the nucleic acid, gRNA, nanoparticle, virus particle, or virus-like particle is provided.
- a CRISPR guide RNA comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
- a nanoparticle, virus particle, or virus-like particle comprising the gRNA also is provided.
- a composition comprising the gRNA, nanoparticle, virus particle, or virus-like particle, and a pharmaceutically-acceptable excipient is provided.
- a method of killing an EBV-positive cell comprising inducing expression of an EBV IE gene in the EBV-positive cell by introducing into the cells a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to a promoter region of the EBV IE gene, and a corresponding non-cleaving Cas (dCas) transcriptional activator in an amount effective to induce expression of the IE gene, which subsequently induces an EBV protein kinase gene in the cell, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in the cell to the IE gene promoter region.
- gRNA CRISPR guide RNA
- dCas non-cleaving Cas
- Clause 3 The method of clause 1 or 2, in which the cell is a cell in a patient, and the CRISPR guide RNA and a corresponding Cas protein are administered to the patient in an amount effective to kill the EBV-positive cell in the patient.
- Clause 4 The method of any one of clauses 1 -3, further comprising administering an amount of an anti-EBV nucleoside analog drug to the cell in an amount effective to kill the EBV-positive cell.
- the anti-EBV nucleoside analog drug is acyclovir, pencyclovir, ganciclovir, or fialuridine (FIAU, e.g., ( 131 I]FIAU).
- the guide RNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
- Clause 14 The method of any one of clauses 1 -1 1 , wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT -3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
- Clause 15 The method of any one of clauses 1 -11 , wherein the gRNA comprises the sequence: 5’-AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
- Clause 16 The method of clause 1 , wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUU-3’ (SEQ ID NO 26).
- Clause 18 The method of any one of clauses 1 -17, wherein the gRNA and dCas transcriptional activator are delivered to the cell as one or two nucleic acids comprising genes for expressing the gRNA and the dCas transcriptional activator where the genes for expressing the gRNA and the dCas transcriptional activator are provided together on one nucleic acid, or separately in two nucleic acids.
- Clause 19 The method of any one of clauses 1 -17, wherein the dCas transcriptional activator is delivered to the cell as a nucleic acid comprising a gene for expressing the dCas transcriptional activator and the gRNA is delivered to the cell directly.
- Clause 20 The method of clause 18 or 19, wherein the nucleic acid(s) are delivered into the cell by transfection with a nanoparticle.
- Clause 21 The method of clause 18 or 19, wherein the nucleic acid comprising the gene for expressing the dCas transcriptional activator is incorporated into a viral transduction particle or virus-like particle, such as a recombinant adenovirus, adeno- associated virus, lentivirus, or herpesvirus transduction particle.
- a viral transduction particle or virus-like particle such as a recombinant adenovirus, adeno- associated virus, lentivirus, or herpesvirus transduction particle.
- Clause 22 The method of clause 21 , wherein a nucleic acid comprising a gene for expressing the gRNA is incorporated into a viral transduction particle or virus-like particle, such as a recombinant adenovirus, adeno-associated virus, lentivirus, or herpesvirus transduction particle.
- a viral transduction particle or virus-like particle such as a recombinant adenovirus, adeno-associated virus, lentivirus, or herpesvirus transduction particle.
- Clause 23 The method of clause 22, wherein the genes for expressing the gRNA and the dCas transcriptional activator are provided on a single nucleic acid.
- Clause 24 The method of any one of clauses 1 -23 for treatment of a cancer in a patient, wherein the cells are EBV-positive cancer cells.
- Clause 25 The method of clause 24, wherein the cancer is an epithelial or 13- cell cancer, such as a lymphoma (e.g., Burkitt’s lymphoma), gastric cancer, or nasopharyngeal carcinoma.
- a nucleic acid comprising a gene for expression of a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
- gRNA CRISPR guide RNA
- Clause 27 The nucleic acid of clause 26, wherein the gRNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
- Clause 28 The nucleic acid of clause 27, wherein the gRNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
- Clause 29 The nucleic acid of clause 26, wherein the gRNA comprises a guide target sequence selected from SEQ ID NOS: 33-42.
- Clause 30 The nucleic acid of clause 26, wherein the gRNA is selected from SEQ ID NOS: 22-31.
- Clause 31 The nucleic acid of any one of clauses 26-29, wherein the guide scaffold of the gRNA comprises a CAS9 gRNA guide scaffold.
- Clause 33 The nucleic acid of clause 26, wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT-3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
- Clause 34 The nucleic acid of clause 26, wherein the gRNA comprises the sequence: 5’-AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
- Clause 35 The nucleic acid of clause 26, wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUU-3’ (SEQ ID NO: 26).
- Clause 36 The nucleic acid of any one of clauses 26-35, further comprising gene for expressing a non-cleaving Cas (dCas) transcriptional activator, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in a cell to the EBV ZTA/BZLF1 promoter region.
- dCas non-cleaving Cas
- Clause 37 The nucleic acid of clause 36, wherein the dCas transcriptional activator is dCas9-VP64.
- a CRISPR guide RNA comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
- Clause 39 The gRNA of clause 38, wherein the gRNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
- Clause 40 The gRNA of clause 39, wherein the gRNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
- Clause 46 The gRNA of clause 38, comprising the sequence: 5’- AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
- Clause 48 A nanoparticle, virus particle, or virus-like particle comprising the nucleic acid or gRNA of any one of clauses 26-47.
- Clause 49 A composition comprising the nucleic acid, gRNA, nanoparticle, virus particle, or virus-like particle of any one of clauses 26-48, and a pharmaceutically-acceptable excipient.
- FIGS 1 A and 1 B The design of sgRNA targeting EBV ZTA promoter.
- FIG. 1A Schematic representation of CRISPR/dCas9-VP64 targeting EBV ZTA promoter. The relative positions of sgRNA targeting sites were labeled as indicated.
- sgRNA-1 and sgRNA-5 (sg-1 and sg-5) target the sense strand while the remaining sgRNAs target the anti-sense strand.
- FIG. 1 B Sequence alignment of the sgRNA targeting sequences from 10 different EBV strains. Polymorphisms are highlighted.
- FIG. 2 CMER promotes EBV reactivation in Akata (EBV+) Burkitt lymphoma cells.
- Akata (EBV+) cells were used to create cell lines using lentivirus carrying dCas9-VP64 with control (sg-NC) and 10 ZTA promoter-targeting sgRNAs. The cells were uninduced (0 hour) or induced using anti-IgG for 24 hours. The expression levels of ZTA and BGLF4 were monitored by Western Blot (WB). [3-actin blot was included as loading controls.
- B The relative extracellular EBV copy numbers were measured using qPCR as described in the method. The value of lane 1 was set as 1 . Results from three biological replicates are presented. Error bars Indicate the standard deviation (mean ⁇ SD, **p ⁇ 0.01 ; ***p ⁇ 0.001 ).
- FIG. 3. CMER triggers EBV reactivation in P3HR1 Burkitt lymphoma cells.
- EBV-positive P3HR1 cells were used to create cell lines carrying dCas9-VP64 with control (sg-NC) and two ZTA promoter-targeting sgRNAs, sg-1 and sg-5. The cells were uninduced (0 hour) or induced using TPA and Sodium Butyrate (TPA/NaBu) for 24 and 48 hours. The expression levels of ZTA and BGLF4 were monitored by WB. [3- actin blot was included as loading controls.
- B The relative intracellular EBV DNA copy numbers were measured using qPCR as described in the method.
- FIG. 4. CMER triggers EBV reactivation in SNU-719 gastric cancer cells.
- Lentiviruses carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were used to transduce EBV-positive SNU-719 cells.
- the relative EBV copy numbers that secreted to the medium (72 hrs post lentiviral transduction) were measured using qPCR as described in the method. The cells were subsequently transferred to T25 flask for cell line establishment.
- SNU-719 cells carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were either uninduced (0 hr) or induced using TPA and sodium butyrate (TPA/NaBu) for 24 and 48 hrs.
- the expression levels of ZTA and BGLF4 were monitored by WB. [3-actin blot was included as loading controls.
- C The relative intracellular EBV DNA copy numbers were measured using qPCR as described in the method.
- D The relative extracellular virion-derived DNA copy numbers were measured using qPCR as described in the method. The value of lane 1 was set as 1. Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ⁇ SD, *p ⁇ 0.05; **p ⁇ 0.01 ).
- FIG. 5 CMER triggers EBV reactivation in HK-1 (EBV+) nasopharyngeal carcinoma cells.
- Lentiviruses carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were used to transduce HK-1 (EBV+) cells.
- the relative EBV copy numbers that secreted to the medium (72 hrs post lentiviral transduction) were measured using qPCR as described in the method. The cells were subsequently transferred to T25 flask for cell line establishment.
- HK-1 (EBV+) cells carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were either uninduced (0 hr) or induced using TPA and sodium butyrate (TPA/NaBu) for 24 and 48 hrs.
- the expression levels of ZTA and BGLF4 were monitored by WB. [3-actin blot was included as loading controls.
- C The relative intracellular EBV DNA copy numbers were measured using qPCR as described in the method.
- D The relative extracellular virion-derived DNA copy numbers were measured using qPCR as described in the method. The value of lane 1 was set as 1 . Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ⁇ SD, *p ⁇ 0.05; **p ⁇ 0.01 ; ***p ⁇ 0.001 ).
- FIG. 6 CMER and GCV treatment selectively kill EBV-infected cells.
- A Akata (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg- NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 7 days. The cell viability (live to total cells ratio) was measured as described in the methods section.
- B Akata (EBV-) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 7 days.
- the cell viability (live to total cells ratio) was measured as described in the methods section.
- C P3HR1 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 13 days. The cell viability was measured as described in the methods section.
- D SNU-719 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 7 days. The relative live cell numbers were counted.
- the number of sg-5- expressing treated with GCV was set as 1.
- E HK-1 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 10 days. The relative live cell numbers were counted. The number of sg-5-expressing treated with GCV was set as 1 . Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ⁇ SD, ***p ⁇ 0.001 ). n.s., no significance.
- FIG. 7 Delivery of CRISRP/dCas9-VP64 by transient transfection triggers EBV reactivation and subsequent cell death induced by GCV.
- SNU-719 (EBV+) cells were transfected with pAC152-dual-dCas9VP64-sg-NC and pAC152- dual-dCas9VP64-sg-5 for 48 hrs. The expression levels of ZTA, RTA and BGLF4 were monitored by WB. [3-actin blot was included as loading controls.
- B The relative extracellular virion-derived DNA copy numbers were measured using qPCR as described in the method. The value of lane 1 was set as 1 .
- FIG. 8. CMER reactivates EBV with 100% efficiency.
- Akata (EBV+) cells (A- D) and SNU-719 (EBV+) cells (E-H) carrying CRISPR/dCAS9-VP64-sgNC or sg-5 were blocked with 3% BSA in PBS at room temperature for 1 h and then incubated with anti-ZTA (A, B, E, F) or anti-gp350/250 (C, D, G, H) antibodies. Subsequently, the Alexa Fluor 488-labeled goat anti-mouse IgG antibody was added to the cells. Cell nuclei were stained with DAPI and visualized using Nikon AXR microscope. DAPI: 4',6-diamidino-2-phenylindole.
- FIGS. 9A-9F CMER triggers the expression of both lytic and latent genes.
- Akata (EBV+) cells (FIGS. 9A-9C) and SNU-719 (EBV+) cells (FIGS. 9D-9F) carrying CRISPR/dCAS9-VP64-sgNC or sg-5 were lysed to extract protein and RNA.
- FIGS. 9A and 9D The expression levels of ZTA, RTA, p18 and EBNA1 were detected by WB. [3-actin blot was included as loading control.
- FIGS. 9B and 9E [3-actin blot was included as loading control.
- the mRNA levels of lytic genes (ZTA, RTA, BGLF4, BALF5, BMRF1 and BLLF1 ) were measured using RT-qPCR as described in the method. (FIGS. 9C and 9F).
- the mRNA levels of latent genes (EBNA1 , EBNA3A, EBNA3B, and LMP1 ) were measured using RT-qPCR as described in the method. Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ⁇ SD, *p ⁇ 0.05; **p ⁇ 0.01 ; ***p ⁇ 0.001 ).
- FIG. 10 Model summarizing CMER in promoting cell death by EBV reactivation and GCV-mediated DNA synthesis inhibition.
- Lentiviral delivery or transfection of CRISPR/dCas9-VP64 and ZTA promoter targeting sgRNA (Zp-sg-5) promotes the expression of EBV ZTA and the downstream viral protein kinase (BGLF4).
- BGLF4 downstream viral protein kinase
- FIG. 11 provides an exemplary 5’ promoter region sequence for EBV Akata ZTA gene (SEQ ID NO: 75). DETAILED DESCRIPTION
- the term “comprising” is open-ended and may be synonymous with “including”, “containing”, or “characterized by”.
- the term “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.
- the term “consisting of” excludes any element, step, or ingredient not specified in the claim.
- embodiments “comprising” one or more stated elements or steps also include, but are not limited to embodiments “consisting essentially of” and “consisting of” these stated elements or steps.
- those definitions refer to word forms, cognates and grammatical variants of those words or phrases.
- an EBV-positive cell is a cell comprising an EBV genome, e.g., an episome tethered by EBNA1 .
- a Cas-based transcriptional activator and a guide sequence are administered to a cell to induce EBV activation in the cell, and an antiherpesvirus nucleoside analog, such as acyclovir or ganciclovir, which are able to kill EBV-positive cancer cells is administered
- an antiherpesvirus nucleoside analog such as acyclovir or ganciclovir
- CRISPR/dCas9-VP64 system was used to target the ZTA promoter, achieving the reactivation of EBV through a strategy termed CRISPR/dCas9-Mediated EBV Reactivation (CMER).
- CMER CRISPR/dCas9-Mediated EBV Reactivation
- the CMER approach robustly induces EBV reactivation across various EBV-positive cell types, including Burkitt lymphoma, gastric cancer, and nasopharyngeal carcinoma cells.
- CMER selectively kills EBV-positive cells but not EBV-negative cells.
- This innovative strategy holds significant promise for further research and clinical applications.
- CRISPR/dCas9-Mediated EBV Reactivation (CMER) strategy which directly reactivates EBV without any lytic inducing agents
- CMER with single guide RNA, e.g., sg5 triggers robust EBV reactivation across various cell types, including lymphoma, gastric cancer, and nasopharyngeal carcinoma cells
- viruses generated from different cell lines, with different genetic variations provide a valuable source to test guide/CMER candidates
- CMER has unique advantages compared to a previous method by overexpressing EBV IE genes as only EBV-positive cells will respond to CMER and express EBV IE genes; the combination of CMER and
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeat
- gRNA or sgRNA single guide RNA
- CRISPR-associated nuclease a CRISPR-associated nuclease.
- engineered CRISPR systems are used for genomic engineering, but have also been adapted for transcriptional control.
- Cas enzymes are able to bind target DNA independently of their ability to cleave target DNA.
- Cas nuclease domains can be rendered inactive by point mutations.
- both RuvC and HNH nuclease domains can be rendered inactive by point mutations (D10A and H840A in S. pyogenes Cas9, SpCas9), resulting in a nuclease dead Cas9 (dCas9) molecule that cannot cleave target DNA.
- the dCas9 molecule retains the ability to bind to target DNA based on the gRNA targeting sequence (see, e.g., Addgene: CRISPR Guide, www.addgene.org/guides/crispr/).
- CRISPR/CRISPR-associated protein 9 (Cas9) has been extensively explored as a genome editor for mammalian cells (see, e.g., Cong L, etal. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819- 23 and Mali P, etal. 2013. RNA-guided human genome engineering via Cas9. Science 339:823-6).
- CRISPR/Cas9 has been adapted for gene activation or inhibition by fusing additional proteins and rendering the Cas9 catalytic site inactive (inactive Cas9, or dCas9).
- CRISPR-controlled transcription regulation systems such as CRISPR/dCas9-SAM, CRISPR/dCas9-VPR (a tripartite activator comprised of VP64TMp65-Rta), CRISPR/dCpfl , and CRISPR/dCasX have been studied and may find use in the present methods and compositions (see, e.g., blog.addgene.org/crispr-activators-dcas9-vp64-sam-suntag-vpr; Didovyk A, et al. Transcriptional regulation with CRISPR-Cas9: principles, advances, and applications. Curr Opin Biotechnol.
- CRISPR-based transcription activation refers to the use of a CRISPR mechanism to activate transcription according to any useful embodiment, such as the CRISPR/Cas9-VP64 system as shown in the examples herein, or other systems, for example as in the preceding paragraph that employ a CRISPR guide RNA (gRNA) to target a promoter region or transcription response element (TRE) of a gene and the target-bound guide RNA recruits a transcriptional activator that binds to the DNA-bound guide RNA (e.g., a dCas transcriptional activator), thereby activating transcription of the gene.
- gRNA CRISPR guide RNA
- TRE transcription response element
- Suitable guide sequences may be determined using any useful tool based on the sequence of the target promoter or TRE, and its efficacy can be readily determined, for example using the methods described in the examples below for the evaluated sgRNAs.
- Engineered CRISPR systems contain two components: a guide RNA (gRNA, such as an sgRNA) and a CRISPR-associated endonuclease (Cas protein).
- gRNA guide RNA
- Cas protein CRISPR-associated endonuclease
- dCas protein also referred to as “non-cleaving Cas”
- corresponding it is meant a gRNA, e.g., an sgRNA is able to complex with its “corresponding” Cas protein, such as a dCas transcription activator, to produce a desired effect, which, in the case of a dCas transcription activator, is activating transcription of a targeted gene in a cell.
- the gRNA is a short synthetic RNA composed of a guide scaffold sequence necessary for Cas-binding and a user-defined ⁇ 20 nucleotide, e.g. ranging from 18- 22 nucleotide, spacer that defines the genomic target to be modified.
- a user-defined ⁇ 20 nucleotide e.g. ranging from 18- 22 nucleotide, spacer that defines the genomic target to be modified.
- the guide scaffold sequence is arranged in the gRNA 3’ to the target sequence.
- the EBV genomic target of the target sequence of the gRNA typically includes a compatible protospacer adjacent motif (PAM).
- PAM protospacer adjacent motif
- spCas9 is used, so the PAM sequence located adjacent to the target of the gRNA is NGG, with the understanding that such PAM sequences may differ, depending on the Cas protein used.
- Examples include (Cas proteimPam sequence): SpCas9:NGG; SaCas9:NNGRRT; CjCas9:NNNNACAC; AsCas12a:TTTN; LbCas12a:TTTN; AsCas12f1 :NTTR; and PlmCas12e:TTCN, for example and without limitation (See also, Kleinstiver BP, et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jul 23;523(7561 ):481 -5; but see, Kiattisewee C, et al.
- Suitable target sequences in the EBV IE or EBV protein kinase gene promoters may be identified, taking into consideration the required PAM sequence and the absence of the same sequence in the human genome or in more than one location in the EBV genome, which can be readily ascertained using BLAST or equivalent sequence analysis.
- the sgRNAs may have the overall structure 5’-N-TARGETING SEQUENCE-gRNA scaffold-3’.
- N is A,G,C, or T
- N is G
- the gRNA scaffold is: 5’- GUUUUAGAGC UAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGC-UUUUU-3’ (SEQ ID NO: 21 ), yielding full sgRNAs as provided below in Table A.
- Other gRNA scaffold sequences may be used so long as it is compatible with the Cas protein used.
- gRNA such as two-part guide RNAs or a ribonucleoprotein complex (RNP) comprising the gRNA and Cas- transcriptional activator
- RNP ribonucleoprotein complex
- expression it is meant the overall flow of information from a gene.
- a “gene” is a functional genetic unit for producing a gene product, such as RNA or a protein in a cell, or other expression system encoded on a nucleic acid and generally comprising: a transcriptional control sequence, such as a promoter and other c/s-acting elements, such as transcriptional response elements (TREs) and/or enhancers; an expressed sequence that typically encodes a protein (referred to as an open-reading frame or ORF) or functional/structural RNA; and a polyadenylation sequence).
- a gene produces a gene product (typically a protein, optionally post- translationally modified or a functional/structural RNA, such as a gRNA) when transcribed.
- genes under transcriptional control of or alternately “subject to control by,” a designated sequence such as a promotor, it is meant gene expression from a gene containing the designated sequence operably linked (functionally attached, typically in cis) to the gene.
- a gene that is “under transcriptional control” of a promotor or transcription control element is a gene that is transcribed at detectably different levels in the presence of a transcription factor, e.g., in the presence of a suitable chemical compound, such as doxycycline in the case of a dox-responsive promoter, such as a tet-inducible promoter.
- a "gene for expression of" a stated gene product such as an sg RNA or a dCas transcription activator is a gene capable of expressing that stated gene product when placed in a suitable environment, that is, for example, when transformed, transfected, transduced, etc. into a cell, and subjected to suitable conditions for expression.
- suitable conditions means that the gene typically need only be introduced into a host cell.
- suitable conditions means when factors that regulate transcription, such as DNA-binding proteins, are present or absent, for example, an amount of the respective inducer is available to the expression system (e.g., cell), or factors causing suppression of a gene are unavailable or displaced - effective to cause expression of the gene.
- Transcriptional control elements include promoters, enhancers, transcription factor-responsive elements (TREs, e.g., transcription factor binding sequences), suppressors, introns, etc., as are broadly-known. Additional transcription control elements, such as a WPRE (woodchuck hepatitis virus post-transcriptional regulatory element) can be included in a gene.
- TREs transcription factor-responsive elements
- WPRE woodchuck hepatitis virus post-transcriptional regulatory element
- a gene may be introduced into a cell, such as an EBV-positive cell, such as a cancer cell, by any useful method, such as by viral transduction (e.g., AAV or lentiviral transduction), PiggyBac transposon, or any other useful transformation or transduction method.
- viral transduction e.g., AAV or lentiviral transduction
- PiggyBac transposon e.g., PiggyBac transposon
- a person of ordinary skill in the molecular biology art would be able to introduce a gene for expression of gRNAs and dCas transcription activators without undue experimentation.
- Various cloning and transformation/transduction vehicles, such as plasmids, that contain genes for the expression of gRNAs and/or dCas transcription activators are broadly available, such as from Addgene, among many other vendors.
- an “isolated” or “purified” biological component refers to a component that has been substantially separated, produced apart from, or purified away from other components in a preparation or other biological components in the cell of the organism in which the component occurs, that is, other chromosomal and extrachromosomal DNA and RNA, and proteins.
- an isolated biological component is one in which the biological component is more enriched than the biological component is in its natural environment within a cell, or other production vessel.
- a preparation may be purified such that the biological component represents at least 50%, such as at least 70%, at least 90%, at least 95%, or greater, of the total biological component content of the preparation.
- a nucleic acid molecule refers to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, gRNA, plasmid DNA, viral DNA, and synthetic forms and mixed polymers of the above.
- a nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide.
- the term “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.” The term includes single- and double-stranded forms of DNA.
- a polynucleotide may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
- a first nucleic acid is said to be operably linked to a second nucleic acid when the first nucleic acid is placed in a functional relationship with the second nucleic acid.
- operably linked DNA sequences are contiguous (e.g., in cis) and, where the sequences act to join two protein coding regions, in the same reading frame (e.g., open reading frame or ORF), for example to produce a fusion protein.
- Operably linked nucleic acids include a first nucleic acid contiguous with the 5' or 3' end of a second nucleic acid.
- a second nucleic acid may be considered operably linked to a first nucleic acid when it is embedded within the first nucleic acid, for example, where the nucleic acid construct includes (in order) a portion of the first nucleic acid, the second nucleic acid, and the remainder of the first nucleic acid.
- a “codon-optimized” nucleic acid refers to a nucleic acid sequence that has been altered such that the codons are optimal for expression in a particular system (such as a particular species of group of species).
- a nucleic acid sequence can be optimized for expression in human cells. Codon optimization does not alter the amino acid sequence of the encoded protein.
- Complementary refers to the ability of polynucleotides (nucleic acids) to hybridize to one another, forming inter-strand base pairs. Base pairs are formed by hydrogen bonding between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair (hybridize) in the Watson-Crick manner (e.g., A to T, Ato U, C to G), or in any other manner that allows for the formation of duplexes. When using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine.
- Two sequences comprising complementary sequences can hybridize if they form duplexes under specified conditions, such as in water, saline (e.g., normal saline, or 0.9% w/v saline) or phosphate-buffered saline), or under other stringency conditions, such as, for example and without limitation, 0.1 X SSC (saline sodium citrate) to 10X SSC, where 1 X SSC is 0.15M NaCI and 0.015M sodium citrate in water.
- Hybridization of complementary sequences is dictated, e.g., by salt concentration and temperature, with the melting temperature (Tm) lowering with increased mismatches and increased stringency.
- a sequence that “specifically hybridizes” to another sequence does so in a hybridization solution containing 0.5M sodium phosphate buffer, pH 7.2, containing 7% SDS, 1 mM EDTA, and 100 mg/ml of salmon sperm DNA at 65° C for 16 hours and washing twice at 65° C for twenty minutes in a washing solution containing 0.5xSSC and 0.1 % SDS, or does so under conditions more stringent than 2X SSC at 65 Q C, for example, in 0.2X SSC at 55 Q C.
- a sequence that specifically hybridizes to another typically has at least 80%, 85%, 90%, 95%, OR 99% sequence identity with the other sequence.
- a conservative substitution is a substitution of one amino acid residue in a protein sequence for a different amino acid residue having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide.
- a Gas polypeptide sequence may include one or more conservative substitutions (for example 1 -10, 2-5, or 10-20, or no more than 2, 5, 10, 20, 30, 40, or 50 substitutions) yet retains function of the wild-type protein.
- a polypeptide can be produced to contain one or more conservative substitutions by manipulating the nucleotide sequence that encodes that polypeptide using, for example, standard procedures such as site-directed mutagenesis or PGR.
- a polypeptide is a polymer in which the monomers are amino acid residues which are joined together through amide bonds.
- the amino acids are alphaamino acids, either the L-optical isomer or the D-optical isomer can be used.
- the terms “polypeptide”, “peptide”, or “protein” as used herein are intended to encompass any amino acid sequence and include proteins and modified sequences such as glycoproteins.
- the term “polypeptide” is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.
- the term “residue” or “amino acid residue” includes reference to an amino acid that is incorporated into a protein, polypeptide, or peptide.
- Conservative amino acid substitutions may be identified by use of matrices, such as the BLOSUM series of matrices, and other matrices. Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
- substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.
- a hydrophilic residue for example, seryl or threonyl
- a recombinant nucleic acid refers to a nucleic acid molecule (or protein or virus) that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids.
- the term recombinant includes nucleic acids and proteins that have been altered solely by addition, substitution, or deletion of a portion of a natural nucleic acid molecule or protein.
- Sequence identity refers to the similarity between nucleic acid or amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity may be measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs, orthologs, or variants of a polypeptide will possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well-known in the art.
- reference to “at least 80% identity” refers to “at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity” to a specified reference sequence.
- reference to “at least 90% identity” refers to “at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity” to a specified reference sequence. Sequence identity may be measured by any acceptable algorithm.
- An anti-EBV nucleoside analog drug may be any nucleoside analog drug useful as an anti-herpesvirus or anti-EBV therapy.
- anti-EBV nucleoside analog drug include: ganciclovir, acyclovir, penciclovir, or fialuridine (FIAU, e.g., [ 131 l]2'-fluoro-2'-deoxy-beta-D-5-iodouracilarabinofuranoside ([ 131 I]FIAU), see, e.g., Fu DX, et al. Bortezomib-induced enzyme-targeted radiation therapy in herpesvirus-associated tumors. Nat Med.
- contacting refers to placement in direct physical association; includes both in solid and liquid form. “Contacting” is often used interchangeably with “exposed.” In some cases, “contacting” includes transfecting, such as transfecting a nucleic acid molecule into a cell. In other examples, “contacting” refers to incubating a molecule (such as an antibody) with a biological sample.
- terapéuticaally effective amount means a dosage which is sufficient to be effective for the treatment of the patient compared with no treatment.
- a therapeutically effective dose of an active agent can vary from patient to patient based on many different factors, including, but not limited to, age, weight, gender, genotype, other medical conditions, etc.
- a doctor or medical provider overseeing the treatment of a patient is best suited to determine the therapeutically effective dose based on their knowledge and experience working with that patient.
- a therapeutically-effective amount may be an amount of a therapeutic agent effective to improve one or more symptoms of the disease, or normalize one or more markers of a disease in a patient. By normalize, it is meant to bring values of a marker in a patient towards or into a range considered as normal for a patient.
- treatment means the management and care of a patient having developed a disease, condition, or disorder.
- the purpose of treatment is to combat the disease, condition, or disorder.
- Treatment includes, but is not limited to, the administration of a pharmaceutical composition to alleviate one or more symptoms associated with the disease, medical condition, or disorder. Treatment may result in the partial or full alleviation of all symptoms, or curing of said disease, medical condition, or disorder.
- treatment can mean that a pharmaceutical composition as described herein is administered to a patient in need of such treatment.
- a therapeutically effective amount may result in an improvement in a biomarker associated with a cancer, and may be reflected in lowered tumor cell counts, or reduction in tumor size, number, or cancer stage in a patient.
- the term “pharmaceutical composition” describes a composition that comprises one or more active agents and one or more pharmaceutically acceptable excipients.
- the excipient(s) must be acceptable in the sense of being compatible with the other ingredients of the composition and not deleterious to the recipient thereof.
- the pharmaceutical compositions can be for use in the treatment of any of the conditions described herein, including cancer.
- the excipient(s) may be suitable for use in a parenteral formulation and administration of the active agent(s).
- the excipient(s) may be suitable for use in an intravenous formulation for administration of the active agent(s).
- the excipient(s) may be suitable for use in a subcutaneous, intramuscular, intratumoral, or other suitable formulation for administration of the active agent(s).
- compositions adapted for parental administration include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, buffers, bacteriostats, and solutes which render the composition isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- the compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injection or sterile lipid in oil solution, immediately prior to use.
- the pharmaceutical composition may comprise non-aqueous liquid excipients that may optionally be combined with water to form an emulsion.
- a pharmaceutical composition may comprise a gRNA and at least one pharmaceutically acceptable excipient.
- the composition may further comprise a corresponding dCas transcriptional activator protein or a gene for expression of a corresponding dCas transcriptional activator protein.
- a pharmaceutical composition may comprise a nucleic acid comprising a gene for expression of a gRNA and at least one pharmaceutically acceptable excipient.
- the nucleic acid may also comprise a gene for expression of a corresponding dCas transcriptional activator or the composition may further comprise a second nucleic acid comprising a gene for expression of a corresponding dCas transcriptional activator.
- the composition may comprise a corresponding dCas transcriptional activator protein.
- a patient may receive from 0.1 ng to 100 mg of the gRNA, protein, and/or nucleic acid(s) per dose, including any increment therebetween.
- the patient may receive, per dose, 0.1 mg, 1 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of the miRNA, or mimic thereof.
- the patient may receive, per dose, approximately or about 0.1 mg, 1 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of the gRNA, protein, and/or nucleic acid(s).
- the patient may receive, per dose, from 0.001 to 1.00 mg/kg of the gRNA, protein, and/or nucleic acid(s) (based on patient body weight) including any increment therebetween.
- the patient may receive, per dose, 0.01 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, or 1 .0 mg/kg of the gRNA, protein, and/or nucleic acid(s).
- the patient may receive, per dose, approximately or about 0.01 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, or 1.0 mg/kg of the gRNA, protein, and/or nucleic acid(s).
- a pharmaceutical composition comprises a carrier or vehicle that includes at least one pharmaceutically acceptable excipient that is compatible for administration to a human patient.
- excipient can refer to a pharmaceutically-acceptable material or composition, such as a liquid or solid filler, diluent, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting a therapeutic agent to a patient.
- manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
- solvent encapsulating material involved in carrying or transporting a therapeutic agent to a patient.
- Each excipient can be "acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated.
- materials which can serve as pharmaceutically-acceptable carriers or excipients include: (1 ) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11 ) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl
- a nucleic acid such as a gRNA, sgRNA, or a nucleic acid comprising a gene for expression of a gene product may be delivered using any effective carrier.
- the carrier is aqueous, such as water, saline, or PBS.
- the carrier may be a lipid-based vehicle (See, e.g., Baumann V, Winkler J. miRNA-based therapies: strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents. Future Med Chem. 2014;6(17): 1967-84 and Bulcha JT, et al. Viral vector platforms within the gene therapy landscape. Signal Transduct Target Ther.
- At least one excipient may be a non-aqueous liquid.
- examples of vehicles employing non-aqueous lipid excipients include, but are not limited to, the MaxSuppressorTM In Vivo RNA-LANCEr II (Lucerna-Chem AG, Luzern, Switzerland) that comprises a neutral lipid, a non-ionic detergent, an oil, and a proprietary mixture of small molecules.
- the lipid based carrier may be mixed with water to form an emulsion.
- the specific excipients can be selected based on the mode of administration of the composition and compatibility with the one or more miRNAs, or mimic thereof, present therein.
- the composition may comprise a lipid based carrier.
- the lipid based carrier may be suitable for intravenous or subcutaneous administration to the patient.
- the lipid-based carrier may be a lipid nanoparticle (LNP) composition and/or compositions, e.g., as described in U.S. Patent Nos. 10,844,028, 10,189,802, 9,872,911 , 9,556,110, 9,439,968, 9,227,917, 8,969,353, and 8,450,298, as well as in U.S. Patent Application Publication Nos.
- LNP lipid nanoparticle
- lipid nanoparticles and methods of making lipid nanoparticles are described in Whitehead KA, et aL, Degradable lipid nanoparticles with predictable in vivo siRNA delivery activity. Nat Commun. 2014 Jun 27; 5:4277.
- Virus-like particles also are useful in delivering nucleic acids and proteins, such as CRISPR/Cas proteins or gRNAs, and/or nucleic acid(s) comprising gene(s) for expression of a gRNA or a dCas transcriptional activator, as described herein (see, e.g., Hamilton JR, et al. Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering. Cell Rep. 2021 Jun 1 ;35(9): 109207 and Banskota S, et al. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell. 2022 Jan 20;185(2):250-265.e16).
- nucleic acid constructs such as recombinant viral vectors for production of nucleic acids, such as the genetic constructs and recombinant viral genomes described herein, is routine, in that molecular cloning and gene assembly methods are routine. Further, a number of companies can custom-synthesize and verify multi-kilobase genes, making the production of genes or genomes as described herein, such as rAAV or scAAV genomes, routine (See, e.g., Gene Synthesis Handbook, 2d Edition, 2014, GenScript USA, Inc.).
- a vector is a nucleic acid molecule allowing insertion of foreign nucleic acid without disrupting the ability of the vector to replicate and/or integrate in a host cell.
- a vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication.
- An insertional vector is capable of inserting itself into a host nucleic acid.
- a vector can also include one or more selectable marker genes and other genetic elements.
- An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of inserted gene or genes.
- a variety of viral vectors have found use in the delivery of genes for expression of a protein in a cell, such as a cancer cell as described herein.
- Adeno-associated virus particles for delivery of genes.
- AAV described in further detail below, is but one of many robust and well-characterized viral vectors suited for gene therapy, which also includes, without limitation, gammaretroviruses, lentiviruses, adenovirus, and herpes simplex virus. While AAV may be preferred in instances, other safe and effective viral transducing particles can be developed based on the genes described herein for use in the devices, systems and methods described herein.
- the AAV virion shell is approximately 25 nanometers (nm) in diameter and encapsulates a single-stranded DNA genome that consists of two large open reading frames (ORFs) flanked by inverted terminal repeats (ITR).
- the ITRs are the only cis- acting elements required for genome replication and packaging.
- the left ORF encodes four replication proteins responsible for site-specific integration, nicking, and helicase activity, as well as regulation of promoters within the AAV genome.
- AAV possesses a 4.7 kb genome, and as such, efficient packaging of recombinant AAV (rAAV) vectors can be performed with constructs ranging from 4.1 kb to 4.9 kb in size.
- Helper-free production of the rAAV requires transfection of the following components into host cells, typically 293 cells (HEK293 cells), which are broadly available, or similar cell lines: (1 ) an rAAV vector containing the transgene expression cassette flanked by the two ITRs; (2) expression of Rep and Cap proteins, typically provided by a helper plasmid in trans', and (3) adenovirus genes encoding E1 , E2A, E4, and virus-associated RNA, also provided, at least in part by another helper plasmid in trans (293 cells produce the Ad E1 gene in trans).
- Rep and Cap proteins which are necessary for viral packaging, are replication proteins and capsid proteins, respectively.
- Rep proteins consist of rep 78, 68, 52, and 40. They specifically are involved with the replication of AAV. Cap proteins are comprised of three proteins, VP1 , VP2 and VP3, with molecular weight of 87, 72 and 62 kDa, respectively. These capsid proteins assemble into a near-spherical protein shell of 60 subunits. Helper- free AAV packaging systems are broadly available commercially, and see, e.g., U.S. Patent Nos. 6,093,570, 6,458,587, 6,951 ,758, and 7,439,065.
- scAAV self- complementary AAV
- the right ITR contains a deletion of D-sequence (the packaging signal) and a terminal resolution site mutation (Atrs), which prevent Rep-mediated nicking and force packaging of dimer or self-complementary genomes.
- AdsAAV self- complementary AAV
- Making dsAAV from scAAV vector renders much improved transduction both in vitro and in vivo.
- the virus Once the virus has been produced in the, e.g., 293 cells, the cells are collected, lysed, and the resultant virus is purified. Density gradient ultracentrifugation, e.g., in cesium chloride or nonionic iodixanol (VISIPAQTM) gradients and column chromatography, such as ion-exchange, heparin-affinity, or mucin-affinity column chromatography, depending on the AAV serotype. Once the rAAV has been purified and concentrated to a suitable concentration, the virus can be used for in vitro cell transduction or for in vivo animal injection at an appropriate MOI (Multiplicity of Infection).
- MOI Multiplicity of Infection
- Epstein-Barr virus is a ubiquitous human tumor virus that establishes lifelong persistent infections in B cells.
- the presence of EBV in cancer cells presents an opportunity to target these cells by reactivating the virus from latency.
- CRISPR/dCas9- Mediated EBV Reactivation termed CRISPR/dCas9- Mediated EBV Reactivation (CMER) strategy.
- CRISPR/dCas9- Mediated EBV Reactivation termedCas9- Mediated EBV Reactivation (CMER) strategy.
- CRISPR/dCas9- Mediated EBV Reactivation CRISPR/dCas9- Mediated EBV Reactivation
- sgRNAs single guide RNAs
- CMER sgRNA-5 triggered robust reactivation across various cell types, including lymphoma, gastric cancer, and nasopharyngeal carcinoma cells.
- CMER CRISPR/dCas9-Mediated EBV Reactivation
- EBV Epstein-Barr virus
- dCas9 CRISPR-associated protein 9
- sgRNAs single guide RNAs
- EBV ZTA promoter by CRISPR/dCas9.
- the transition of EBV from latency to reactivation is regulated by the IE gene ZTA and, in some cases, RTA.
- the power of the CRISPR/dCas9-VP64 gene activation system is used herein to specifically target the promoter of the EBV ZTA.
- sgRNAs single guide RNAs targeting the ZTA promoter within the Akata EBV+ genome (90554- 90877 bp) was designed.
- Ten unique sgRNA candidates were chosen from an array of designed sgRNAs to assess their potential for reactivating EBV (FIG. 1A).
- sgRNA targeting sites 10 EBV strains derived from different cancer cells were analyzed. Sequences targeted by sgRNAs such as sg-1 , sg-5, sg-6, sg-9, and sg-10 are highly conserved, while those targeted by sg-2, sg-3, sg-4, sg-7, and sg-8 display single nucleotide polymorphisms (FIG. 1 B). Therefore, sg-1 , sg-5, sg-6, sg-9, and sg-10 are anticipated to target a wider range of EBV strains.
- sgRNAs such as sg-1 , sg-5, sg-6, sg-9, and sg-10 are highly conserved, while those targeted by sg-2, sg-3, sg-4, sg-7, and sg-8 display single nucleotide polymorphisms (FIG. 1 B). Therefore, sg-1 , sg-5
- EBV ZTA expression level was monitored in cells that were either untreated or treated with anti-human IgG to induce lytic replication. Interestingly, even without lytic trigger, it was found that ZTA is induced in cells carrying sgRNAs sg-1 to sg-6, sg-8 to sg-10 (FIG. 2A, ZTA blot, lanes 3, 5, 7, 9, 1 1 , 13, 17, 19, and 21 ). ZTA was not induced in cells carrying control sg-NC and sg-7 (FIG. 2A, ZTA blot, lanes 1 and 15). Because EBV protein kinase BGLF4 is the protein responsive for the phosphorylation of anti-viral nucleoside analogs, Its expression was also monitored.
- BGLF4 was also induced in cells carrying sgRNAs sg-1 to sg-6, and sg-8 to sg-10 (FIG. 2A, BGLF4 blot, lanes 3, 5, 7, 9, 1 1 , 13, 17, 19, and 21 ).
- the treatment with anti-human IgG induced the expression of ZTA and BGLF4 in all cell lines (FIG. 2 (A), lanes 2, 4, 6, 8, 10, 12, 14 16, 18, 20, and 22).
- CMER triggers EBV reactivation in epithelial cells.
- the process of EBV reactivation involves different signaling pathways in B cells and epithelial cells.
- an EBV-positive gastric cancer cell line SNU-719 was first tested. After lentiviral transduction of SNU-719 cells, it was found that cells carrying sg-1 and sg-5 start to detach from the plate (72 hrs post-lentiviral transduction). Medium was collected for examining extracellular viral copy numbers. The results showed that CMER strongly triggers EBV reactivation 3 days post-lentiviral transduction (FIG. 4 (A)).
- HK-1 (EBV+) cell line was used to demonstrate the applicability of CMER in nasopharyngeal carcinoma cells. Similar to observations in SNU-719 cells, HK-1 (EBV+) cells exhibited cell death approximately 72 hours after lentivirus transduction, especially when transitioning from a 6-well plate to a T-25 flask. At the 72-hour post- lentiviral transduction, the released EBV copy numbers were examined and significant reactivation from the HK-1 (EBV+) cells by CMER with sg-1 and, more strongly, sg-5 (FIG. 5 (A)) was observed.
- CMER and GCV treatment selectively kill EBV-infected cells.
- CMER with sg-5 consistently induced EBV reactivation regardless of lytic induction. This provides an opportunity to kill EBV infected cells with nucleoside analogs.
- GCV is recognized for its antiviral properties, particularly its ability to inhibit DNA synthesis. GCV enters cells in an inactive state and becomes phosphorylated by viral kinases, including EBV protein kinase BGLF4. Given the observations of active BGLF4 expression by CMER with sg-5 (FIGS. 2 (A), 3 (A), 4 (B), and 5 (B)), it was then determined whether cells that have undergone EBV reactivation will be susceptible to GCV-induced cell death.
- lentiviruses containing dCas9-VP64 with sg-NC or sg-5 were used to transduce Akata (EBV+) cells and then cultured the cells for 2 days. Subsequently, the cells were treated with puromycin and vehicle (DMSO) or GCV for 7 days. Notably, cells treated DMSO displayed comparable viability between sg-NC and sg-5. Remarkably, when the cells were treated with GCV, sg-NC-carrying cells exhibited 40% viable cells, while sg-5-carrying cells almost died out (less than 1 % viable cells) (FIG. 6 (A)).
- lentiviruses containing dCas9-VP64 with sg-NC or sg-5 were employed to transduce Akata (EBV-) cells. These cells were subsequently treated with puromycin and DMSO or GCV for 7 days, and cell viability was assessed. Interestingly, no differences in viability were observed between the sg-NC- and sg-5-expressing cells treated with GCV (FIG. 6 (B)).
- P3HR1 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5.
- these P3HR1 cells were treated with GCV for a longer time (13 days) to observe cell killing phenotype. It was noticed that sg-NC-carrying cells exhibited more than 90% viable cells, while sg-5-carrying cells nearly reached extinction (less than 1 % viable cells) (FIG. 6 (C)).
- a transient transfection-based method was evaluated to determine if EBV could be reactivated in that manner.
- Two plasmids were created for the transient transfection assay, namely pAC152-dual-dCas9VP64- sg-NC and pAC152-dual-dCas9VP64-sg-5.
- SNU-719 (EBV+) cells were selected to test the reactivation by CMER because those cells can be transfected with high efficiency. The cells were transfected with different amount of the plasmids and it was found that EBV is strongly reactivated at 48h post transfection at a higher amount of the sg-5 plasmid (FIG.
- CRISPR/Cas9 Since its application to edit mammalian genome in 2013, the CRISPR/Cas9 technology has demonstrated remarkable potential across various fields. For example, CRISPR/Cas9 gene editing has been used to treat sickle cell disease (SCD) and transfusion-dependent [3-thalassemia (TDT). The autologous CD34+ cells were edited with CRISPR-Cas9 targeting the BCL1 1 A enhancer to de-repress fetal hemoglobin expression.
- SCD sickle cell disease
- TTT transfusion-dependent [3-thalassemia
- This strategy utilizes an adeno-associated virus serotype 9 (AAV9) for intravenous (IV) administration to deliver CRISPR-Cas9 and guide RNAs, enabling a cleavage of multiple sites within the HIV-1 genome.
- AAV9 adeno-associated virus serotype 9
- IV intravenous
- This strategy facilitates the removal of substantial segments from the HIV-1 genome, reducing the likelihood of viral evasion.
- CRISPR/dCas9 fused with activator or repressor can be used to enhance or repress gene expression, respectively (Wang LW, etal. 2018. Modulating Gene Expression in Epstein-Barr Virus (EBV)-Positive B Cell Lines with CRISPRa and CRISPRi. Curr Protoc Mol Biol 121 :31 .13.1 -31 .13.18).
- EBV Epstein-Barr Virus
- a CMER strategy was developed by harnessing a CRISPR/dCas9-VP64-mediated gene activation approach to induce EBV reactivation.
- CMER with sg-5 can strongly reactivate EBV by enhancing ZTA expression, even though the number of EBV episome varies and the viral genomes are organized differently in B cells and epithelial cells (FIGS. 2-5).
- CRISPR/dCas9 synergistic activation mediator SAM was used to induce reactivation of HIV-1 latent reservoirs (Zhang Y, et al. 2015.
- CRISPR/gRNA-directed synergistic activation mediator (SAM) induces specific, persistent, and robust reactivation of the HIV-1 latent reservoirs. Sci Rep 5:16277) with rare off-target effects (Zhang Y, et al. 2018.
- EBV reactivation is accompanied by caspase activation and subsequent cell death. This explains the rapid decline of SNU-719 (EBV+) and HK-1 (EBV+) cells shortly after lentivirus infection, coupled with the substantial release of extracellular EBV particles into the culture media (FIGS. 4 and 5). Additionally, it was observed that spontaneous EBV reactivation also results in elevated expression of viral protein kinase BGLF4 (FIGS. 2-5). BGFL4 is the major kinase responsible for GCV phosphorylation (Meng Q, et al. 2010.
- Epstein-Barr virus (EBV)-encoded protein kinase EBV-PK
- EBV-TK thymidine kinase
- Phosphorylated GCV not only inhibits viral DNA replication but also cellular DNA replication, which leads to cell death (Westphal EM, et al. 1999. Induction of lytic Epstein-Barr virus (EBV) infection in EBV-associated malignancies using adenovirus vectors in vitro and in vivo. Cancer Res 59:1485-91 ).
- CMER and GCV combination kills EBV-positive Burkitt lymphoma cells without affecting cells without EBV (FIG. 6A- C). In addition to EBV-positive Burkitt lymphoma cells, it was also demonstrated that CMER and GCV combination kills EBV-positive gastric cancer and nasopharyngeal carcinoma cells (FIGS. 6D-E and 7).
- CMER showed partial killing activity, it could not kill all the cells by itself. Because CMER reactivates EBV with 100% efficiency while most of the cells are still viable, it was reasoned that cancer cells may tolerate viral reactivation and replication. This explains why GCV was needed to completely kill EBV-positive cells.
- Lytic induction by IgG-crosslinking of B cell receptors or TPA/sodium butyrate promotes EBV reactivation and cell death. However, it has been shown that the cell death is likely compounded by the lytic triggers, which promote caspase activation. In addition to lytic genes (FIGS.
- latent genes are higher in cells carrying CRISPR/dCas9-VP64-sg1 and -sg5 (FIGS. 9C and 9F).
- Some latent genes e.g., LMP1 and EBNA1 , also have been seen to contribute to EBV lytic replication process. The contribution of other latent genes in lytic replication remains to be defined.
- CMER does not target EBV-negative cells, it will have less adverse effects compared to chemotherapy drugs as lytic inducing agents.
- the described strategy also has unique advantages compared to a previous method by overexpressing EBV IE genes (ZTA and RTA) as only EBV-positive cells will respond to CMER and express EBV IE genes.
- CMER provides a novel way to reactivate EBV with 100% efficiency without the need for other lytic-inducing agents. It will be interesting to test the percentage of the released viruses triggered by CMER that are infectious in the future. This not only provides a novel method to generate viruses from diverse sources for assessing EBV vaccine candidates but also, when combined with nucleoside analogs, lays a foundation for applications of the CRISPR/dCas9 activation system in clinical settings (FIG. 10).
- various vectors like adenoviral vectors, adeno-associated viral vectors, and lentiviral vectors could be employed (Asmamaw Mengstie M., 2022.
- Adenoviral vectors for the in Vivo Delivery of CRISPR Components: Advances and Challenges. Front Bioeng Biotechnol 10:895713).
- Adenoviral vectors have been used to deliver EBV ZTA and RTA with anti-tumor effects (Feng WH, et al. 2002.
- Use of adenovirus vectors expressing Epstein-Barr virus (EBV) immediate-early protein BZLF1 or BRLF1 to treat EBV- positive tumors. J Virol 76:10951 -9).
- the delivery of Cas9 protein through non- integrating lentiviral vectors have been used in treating SCD (Uchida N, et al. 2021.
- Akata (EBV+), Akata (EBV-), HK-1 (EBV+), SNU-719, and P3HR-1 cells were cultured in Roswell Park Memorial Institute medium (RPMI 1640) supplemented with 10% FBS (catalog no. 26140079, Thermo Fisher Scientific) at 37 °C in a humidified 5% CO2 incubator.
- HK1 cells with the EBV recombinant Akata strain were supplemented with 800 pg/mL G418 in the culture medium.
- HEK293T cells were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FBS in 5% CO2 at 37 Q C.
- DMEM Dulbecco modified Eagle medium
- FBS FBS in 5% CO2 at 37 Q C.
- Lipofectamine 2000 was used following the manufacturer protocols (catalog no. 1 1668019, Life Technologies).
- sgRNAs single guide RNAs targeting ZTA/BZLF1 promoter were designed using CHOPCHOP (chopchop.cbu.uib.no/) and the primers were synthesized by Invitrogen. These 10 sgRNAs were cloned into the pLentiV2-dCas9-VP64 vector (gifts from Igor Ulitsky; Addgene: 141104). Escherichia coll Stbl3 stain was used to amply the plasmids. Purified plasmids were co-transfected with psPAX2 and pMD2G (Addgene: 12259 and 12260) into HEK293T for 48 hours to generate the lentivirus.
- the sgRNA primers for cloning are: sg-1 F: 5’-caccgaaaccatgacatcacagagg- 3’ (SEQ ID NO: 1 ); sg1 -R: 5’-aaaccctctgtgatgtcatggtttc-3’ (SEQ ID NO: 2); sg-2F: 5’- caccgtaaatttaggtgtgtctctg-3’ (SEQ ID NO: 3); sg2-R: 5’-aaaccagagacacacctaaatttac-3’ (SEQ ID NO: 4); sg-3F: 5’-caccgaggcacattagcaatgcctg-3’ (SEQ ID NO: 5); sg3-R: 5’- aaaccaggcattgctaatgtgcctc-3’ (SEQ ID NO: 6); sg-4F: 5’-caccgt
- the PGR product target sequences were cloned into the pLentiV2-dCas9- VP64 vector for expression of a sgRNA having the scaffold sequence: 5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC-UUUUU-3’ (SEQ ID NO: 21 ), with the target sequence at the 3’ end of the gRNA.
- Table A provides exemplary full gRNA sequences evaluated.
- the sgRNAs have the overall structure 5’-N-TARGETING SEQUENCE- gRNA scaffold-3’. In the exemplary sgRNAs, N is G and the gRNA is (SEQ ID NO: 21 ).
- Lentiviruses isolated from HEK293T medium were used to infect the Akata (EBV+), HK-1 (EBV+), SNU-719 and P3HR-1 cells. 48 hours post-transduction, the cells were cultured in the presence of puromycin (2 pg/mL) for cell line establishment.
- Anti-ZTA(BZI ) antibody was purchased from Santa Cruz (catalog no. sc- 53904, Santa Cruz) and Mouse anti-
- Anti-BGLF4 antibody was a gift from Mei-Ru Chen (47).
- Anti-RTA antibody was from Argene (discontinued).
- Anti-p18 was purchased from Thermo Fisher (catalog no. PA1 -73003, Thermo Fisher).
- Anti- EBNA1 (1 EB12) antibody was purchased from Santa Cruz (catalog no. sc-81581 , Santa Cruz).
- Akata (EBV+) cells were treated with IgG (1 :200; catalog no. 55087, MP Biomedicals) to induce lytic replication for up to 48 hrs.
- IgG 1 :200; catalog no. 55087, MP Biomedicals
- the cells were triggered with 12-0- Tetradecanoylphorbol-13-acetate (TPA; 20 ng/ml; catalog no. NC9325685, Fisher Scientific) and sodium butyrate (3 mM; catalog no. 19137, Millipore) for up to 48 hrs.
- TPA 12-0- Tetradecanoylphorbol-13-acetate
- HK-1 (EBV+) cells we used TPA at 40ng/ml and sodium butyrate at 5 mM to trigger EBV reactivation.
- EBV Replication levels of intracellular EBV DNA and virion-associated DNA were determined by quantitative polymerase chain reaction (qPCR).
- qPCR quantitative polymerase chain reaction
- total genomic DNA was extracted using a genomic DNA purification kit (catalog no. A1 120, Promega) according to manufacturer’s instructions.
- Extracellular viral DNA was extracted and measured as follows. Briefly, the culture medium was treated with RQ1 DNase (catalog no. M6101 , Promega) to remove free DNA at 37 °C for 1 hour. The reaction was then deactivated by RQ1 DNase stop solution, followed by proteinase K and SDS treatment. The DNA was then purified by phenol-chloroform-isoamyl alcohol extraction. The relative viral DNA copy numbers were determined by qPCR using primers to the BALF5 gene. The reference [3-actin gene was used for data normalization.
- Cell Viability Assay Cells were infected with lentivirus for 48 hours and then selected under puromycin. Concurrently, GCV (10 pg/mL) was added to the culture medium. Fresh medium, puromycin, and GCV were replenished every 48 hours. The cells were harvested at various time points and subjected to the trypan blue exclusion assay (catalog no. 15250-061 ; Gibco).
- sg-NC and sg5 sequences were cloned into pAC152-dual-dCas9VP64-sg Expression vector (Cheng AW, et al. 2013. Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res 23:1 163-71 ) (a gift from Rudolf Jaenisch; addgene: 48238). Escherichia coli DH5a was used to amplify and extract the plasmids.
- Purified plasmids were transfected to SNU-719 (3x10 5 cells/mL) that have been grown overnight in RPMI containing 10% FBS using PEI-Max reagent (catalog no. 24765-100, Polysciences). The cells were harvested after 48 h after transfection. Expression of ZTA, RTA, BGLF4, [3-actin were detected using WB. For cell killing assay, after 48h transfection, the culture media were changed with fresh media containing GCV (10 pg/mL) and replenished every 48 hours. The cells were harvested 7 days later and subjected to the trypan blue exclusion assay.
- Akata (EBV+) cells carrying CRISPR/dCas9- VP64-sg-NC and sg-5 were transferred to a 12-well plate containing poly-L-Lysine- treated coverslip and washed 3 times with PBS.
- SNU-719 (EBV+) cells carrying CRISPR/dCas9-VP64-sg-NC and sg-5 were grown in UV-sterilized coverslip in a 12-well culture plate. The cells were fixed with cold methanol and washed 3 times with PBS. Cells were permeabilized with 0.5% Triton X-100 for 5 mins and blocked with 3% bovine serum albumin (BSA) for 1 hr at room temperature.
- BSA bovine serum albumin
- the cells were washed 3 times with PBS and then incubated with anti-ZTA mouse monoclonal antibody (1 :500) or anti-EBV MA-gp350/250 mouse antibody (1 :500) (catalog no. MAB8183, Millipore Sigma) overnight at 4 °C.
- the cells were washed 3 times with PBS and incubated with Alexa Fluor 488-conjugated goat anti-mouse IgG antibody (1 :500) (catalog no. A1 1001 , Invitrogen) for 1 h at room temperature. After washing with PBS for 3 times, the cell nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI, DU082040) and visualized using Nikon AXR microscope.
- DAPI 4',6-diamidino-2-phenylindole
- RNA isolation and RT-qPCR Total RNA were extracted by Isolate II RNA minikit (Bioline) and analyzed by RT-qPCR with specific primers for EBV lytic and latent genes: ZTA-F: 5’-aggccagctaactgcctatc-3’ (SEQ ID NO: 43); ZTA-R: 5’- tgattctgggttatgtcgga-3’ (SEQ ID NO: 44); RTA-F: 5’-acactcccggctgtaaattc-3’ (SEQ ID NO: 45); RTA-R: 5’-tggcttggaagactttctga-3’ (SEQ ID NO: 46); BGLF4-F: 5’- ggcaatagaggcgatagagc-3’ (SEQ ID NO: 47); BGLF4-R: 5’-tggtcctgactgattatggg-3’ (SEQ ID NO: 48); BA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Virology (AREA)
- Epidemiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Provided herein are methods of killing EBV-positive cells, such as EBV-positive cancer cells in a patient, comprising using a CRISPR/Cas transcriptional activator targeting an IE promoter of EBV, such as the ZTA/BZLF1 promoter, to transition the virus from latent phase to lytic phase, and optionally administering an anti-herpesvirus nucleoside analog, such as ganciclovir, to the cell to kill the cell. Also provided herein are nucleic acids, CRISPR guide RNAs, and compositions useful for delivering the guide RNA and a corresponding CRISPR/Cas transcriptional activator to a cell, such as a patient's cell, where the guide RNA targets an IE promoter of EBV, such as the ZTA/BZLF1 promoter.
Description
TARGETED ERADICATION OF EBV-POSITIVE CELLS BY CRISPR/CAS- MEDIATED EBV REACTIVATION
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to United States Provisional Patent Application No. 63/586,649 filed September 29, 2023, the disclosure of which is hereby incorporated by reference in its entirety.
STATEMENT REGARDING FEDERAL FUNDING
[0002] This invention was made with government support under AI141410 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0003] The Sequence Listing associated with this application is filed in electronic format via Patent Center and is hereby incorporated by reference into the specification in its entirety. The name of the file containing the Sequence Listing is 2403712.xmL The size of the file is 69,322 bytes, and the file was created on September 26, 2024. [0004] Epstein-Barr Virus (EBV), also known as human herpesvirus 4 (HHV-4), is one of the 8 human herpesviruses that infect more than 90% of the adult population globally. EBV, like Kaposi’s sarcoma-associated herpesvirus (KSHV), is a member of a gamma-herpesvirus subgroup that is associated with various types of cancer (see, e.g., Patel PD, etal. The Association of Epstein-Barr Virus with Cancer. Cureus. 2022 Jun 25;14(6):e26314; Shechter O, et al. Epstein-Barr Virus (EBV) Epithelial Associated Malignancies: Exploring Pathologies and Current Treatments. Int J Mol Sci. 2022 Nov 19;23(22):14389; Cohen JI, et al. Epstein-Barr virus: an important vaccine target for cancer prevention. Sci Transl Med. 201 1 Nov 2 ;3( 107):107fs7). EBV infection of B cells normally establishes latency with limited viral gene expression and is associated with lymphomas, such as Burkitt’s lymphoma. The virus occasionally reactivates during B cell development process. In EBV-infected epithelial cells, the virus typically undergoes lytic replication, but, in EBV-associated epithelial cell cancers, the virus remains in a latent state (see, e.g., Young LS, et al. 2016. Epstein- Barr virus: more than 50 years old and still providing surprises. Nat Rev Cancer 16:789-802).
[0005] EBV may be treated with nucleoside analogs, such as ganciclovir, acyclovir, penciclovir, or fialuridine (FIAU, e.g., [131 l]2Mluoro-2’-deoxy-beta-D-5-iodouracil-
arabinofuranoside
In latently infected cancer cells, EBNA1 is a drug target. Upon reactivation, the nucleoside analogs are phosphorylated by EBV- encoded protein kinase (BGLF4), which modifies ganciclovir (GCV) into an active form (see, e.g., Meng Q, etal. 2010. The Epstein-Barr virus (EBV)-encoded protein kinase, EBV-PK, but not the thymidine kinase (EBV-TK), is required for ganciclovir and acyclovir inhibition of lytic viral production. (J Virol 84:4534-42 and Crumpacker CS. Ganciclovir. N Engl J Med. 1996 Sep 5;335(10):721 -9). Phosphorylated GCV inhibits both viral and cellular DNA polymerases. The inhibition of viral DNA polymerase will block EBV replication and prevent the release of infectious virus. The inhibition of cellular DNA polymerase results in cell death (Westphal EM, et al. 1999. Induction of lytic Epstein-Barr virus (EBV) infection in EBV-associated malignancies using adenovirus vectors in vitro and in vivo. Cancer Res 59:1485-91 ; Tomicic MT, et al. Ganciclovir-induced apoptosis in HSV-1 thymidine kinase expressing cells: critical role of DNA breaks, Bcl-2 decline and caspase-9 activation. Oncogene. 2002 Mar 28;21 (14):2141 -53; Shaw MM, et al. Ganciclovir and penciclovir, but not acyclovir, induce apoptosis in herpes simplex virus thymidine kinase-transformed baby hamster kidney cells. Antivir Chem Chemother. 2001 May;12(3):175-86). Therefore, reactivating EBV from latency will provide an opportunity to selectively kill virus- infected cells.
[0006] Various methods have been developed to trigger EBV reactivation and kill virus infected cells with nucleoside analogs. Adenovirus vectors expressing EBV Immediate-Early (IE) genes (ZTA/BZLF1 and RTA/BRLF1) have been used to induce reactivation in Burkitt lymphoma cells. In addition, y-irradiation, sodium butyrate, and chemotherapeutic agents (e.g., Bortezomib, cis-platinum, 5-fluorouracil (5-FU), gemcitabine and taxol) induce EBV reactivation in B cell or epithelial cell tumors. One potential concern is that these inducers lack specificity, as they not only target EBV- infected cells but also impact normal cells with toxicity.
[0007] There is a need for specific therapeutics and therapies that specifically target EBV-positive cells, such as EBV-positive cancer cells, for example associated with B- cell or epithelial malignancies.
SUMMARY
[0008] A method of killing an EBV-positive cell is provided, comprising inducing expression of an EBV IE gene in the EBV-positive cell by introducing into the cells a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically
to a promoter region of the EBV IE gene, and a corresponding non-cleaving Cas (dCas) transcriptional activator in an amount effective to induce expression of the IE gene, which subsequently induces an EBV protein kinase gene in the cell, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in the cell to the IE gene promoter region.
[0009] A nucleic acid is provided, comprising a gene for expression of a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region. A nanoparticle, virus particle, or virus-like particle comprising the nucleic acid also is provided. Further, a composition comprising the nucleic acid, gRNA, nanoparticle, virus particle, or virus-like particle is provided.
[0010] A CRISPR guide RNA (gRNA) is provided comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region. A nanoparticle, virus particle, or virus-like particle comprising the gRNA also is provided. Further, a composition comprising the gRNA, nanoparticle, virus particle, or virus-like particle, and a pharmaceutically-acceptable excipient is provided.
[0011] The following numbered clauses outline various aspects, embodiments, or examples of the present invention.
[0012] Clause 1. A method of killing an EBV-positive cell, comprising inducing expression of an EBV IE gene in the EBV-positive cell by introducing into the cells a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to a promoter region of the EBV IE gene, and a corresponding non-cleaving Cas (dCas) transcriptional activator in an amount effective to induce expression of the IE gene, which subsequently induces an EBV protein kinase gene in the cell, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in the cell to the IE gene promoter region.
[0013] Clause 2. The method of clause 1 , wherein the cell is an EBV-positive cancer cell.
[0014] Clause 3. The method of clause 1 or 2, in which the cell is a cell in a patient, and the CRISPR guide RNA and a corresponding Cas protein are administered to the patient in an amount effective to kill the EBV-positive cell in the patient.
[0015] Clause 4. The method of any one of clauses 1 -3, further comprising administering an amount of an anti-EBV nucleoside analog drug to the cell in an amount effective to kill the EBV-positive cell.
[0016] Clause 5. The method of clause 4, wherein the anti-EBV nucleoside analog drug is acyclovir, pencyclovir, ganciclovir, or fialuridine (FIAU, e.g., (131 I]FIAU).
[0017] Clause 6. The method of any one of clauses 1 -5, wherein the guide RNA comprises a targeting sequence of a promoter of an EBV IE gene that causes activation of latent EBV infection.
[0018] Clause 7. The method of clause 6, wherein the guide RNA comprises a target sequence of an EBV ZTA/BZLF1 promoter such that when bound to an EBV genome in a cell, the gRNA complexes with its corresponding Cas protein and activates expression of the ZTA gene.
[0019] Clause 8. The method of clause 7, wherein the guide RNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
[0020] Clause 9. The method of clause 7, wherein the guide RNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
[0021] Clause 10. The method of clause 7, wherein the gRNA comprises a guide target sequence selected from SEQ ID NOS: 33-42.
[0022] Clause 1 1 . The method of clause 7, wherein the gRNA is selected from SEQ ID NOS: 22-31.
[0023] Clause 12. The method of any one of clauses 1 -10, wherein the guide scaffold of the guide RNA comprises a CAS9 gRNA guide scaffold and the corresponding Cas protein is dCas9.
[0024] Clause 13. The method of clause 12, wherein the CAS9 gRNA guide scaffold has the sequence:
5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU-3’ (SEQ ID NO: 21 ).
[0025] Clause 14. The method of any one of clauses 1 -1 1 , wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT -3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
[0026] Clause 15. The method of any one of clauses 1 -11 , wherein the gRNA comprises the sequence: 5’-AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
[0027] Clause 16. The method of clause 1 , wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUU-3’ (SEQ ID NO 26).
[0028] Clause 17. The method of any one of clauses 1 -16, wherein the dCas transcriptional activator is a non-cleaving Cas9-VP64 (dCas9-VP64) protein.
[0029] Clause 18. The method of any one of clauses 1 -17, wherein the gRNA and dCas transcriptional activator are delivered to the cell as one or two nucleic acids comprising genes for expressing the gRNA and the dCas transcriptional activator where the genes for expressing the gRNA and the dCas transcriptional activator are provided together on one nucleic acid, or separately in two nucleic acids.
[0030] Clause 19. The method of any one of clauses 1 -17, wherein the dCas transcriptional activator is delivered to the cell as a nucleic acid comprising a gene for expressing the dCas transcriptional activator and the gRNA is delivered to the cell directly.
[0031] Clause 20. The method of clause 18 or 19, wherein the nucleic acid(s) are delivered into the cell by transfection with a nanoparticle.
[0032] Clause 21 . The method of clause 18 or 19, wherein the nucleic acid comprising the gene for expressing the dCas transcriptional activator is incorporated into a viral transduction particle or virus-like particle, such as a recombinant adenovirus, adeno- associated virus, lentivirus, or herpesvirus transduction particle.
[0033] Clause 22. The method of clause 21 , wherein a nucleic acid comprising a gene for expressing the gRNA is incorporated into a viral transduction particle or virus-like particle, such as a recombinant adenovirus, adeno-associated virus, lentivirus, or herpesvirus transduction particle.
[0034] Clause 23. The method of clause 22, wherein the genes for expressing the gRNA and the dCas transcriptional activator are provided on a single nucleic acid.
[0035] Clause 24. The method of any one of clauses 1 -23 for treatment of a cancer in a patient, wherein the cells are EBV-positive cancer cells.
[0036] Clause 25. The method of clause 24, wherein the cancer is an epithelial or 13- cell cancer, such as a lymphoma (e.g., Burkitt’s lymphoma), gastric cancer, or nasopharyngeal carcinoma.
[0037] Clause 26. A nucleic acid comprising a gene for expression of a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
[0038] Clause 27. The nucleic acid of clause 26, wherein the gRNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
[0039] Clause 28. The nucleic acid of clause 27, wherein the gRNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
[0040] Clause 29. The nucleic acid of clause 26, wherein the gRNA comprises a guide target sequence selected from SEQ ID NOS: 33-42.
[0041] Clause 30. The nucleic acid of clause 26, wherein the gRNA is selected from SEQ ID NOS: 22-31.
[0042] Clause 31. The nucleic acid of any one of clauses 26-29, wherein the guide scaffold of the gRNA comprises a CAS9 gRNA guide scaffold.
[0043] Clause 32. The nucleic acid of clause 31 , wherein the CAS9 gRNA guide scaffold has the sequence:
5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU-3’ (SEQ ID NO: 21 ).
[0044] Clause 33. The nucleic acid of clause 26, wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT-3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
[0045] Clause 34. The nucleic acid of clause 26, wherein the gRNA comprises the sequence: 5’-AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
[0046] Clause 35. The nucleic acid of clause 26, wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUU-3’ (SEQ ID NO: 26).
[0047] Clause 36. The nucleic acid of any one of clauses 26-35, further comprising gene for expressing a non-cleaving Cas (dCas) transcriptional activator, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in a cell to the EBV ZTA/BZLF1 promoter region.
[0048] Clause 37. The nucleic acid of clause 36, wherein the dCas transcriptional activator is dCas9-VP64.
[0049] Clause 38. A CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
[0050] Clause 39. The gRNA of clause 38, wherein the gRNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
[0051] Clause 40. The gRNA of clause 39, wherein the gRNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
[0052] Clause 41 . The gRNA of clause 38, wherein the gRNA comprises a guide target sequence selected from SEQ ID NOS: 33-42.
[0053] Clause 42. The gRNA of clause 38, wherein the gRNA is selected from SEQ ID NOS: 22-31.
[0054] Clause 43. The gRNA of any one of clauses 38-41 , wherein the guide scaffold of the gRNA comprises a CAS9 gRNA guide scaffold.
[0055] Clause 44. The gRNA of clause 38, wherein the CAS9 gRNA guide scaffold has the sequence:
5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU-3’ (SEQ ID NO: 21 ).
[0056] Clause 45. The gRNA of clause 38, wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT-3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
[0057] Clause 46. The gRNA of clause 38, comprising the sequence: 5’- AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
[0058] Clause 47. The gRNA of clause 38, wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUU-3’ (SEQ ID NO 26).
[0059] Clause 48. A nanoparticle, virus particle, or virus-like particle comprising the nucleic acid or gRNA of any one of clauses 26-47.
[0060] Clause 49. A composition comprising the nucleic acid, gRNA, nanoparticle, virus particle, or virus-like particle of any one of clauses 26-48, and a pharmaceutically-acceptable excipient.
BRIEF DESCRIPTION OF THE DRAWINGS
[0061] FIGS 1 A and 1 B. The design of sgRNA targeting EBV ZTA promoter. (FIG. 1A) Schematic representation of CRISPR/dCas9-VP64 targeting EBV ZTA promoter. The relative positions of sgRNA targeting sites were labeled as indicated. sgRNA-1 and sgRNA-5 (sg-1 and sg-5) target the sense strand while the remaining sgRNAs target the anti-sense strand. (FIG. 1 B). Sequence alignment of the sgRNA targeting sequences from 10 different EBV strains. Polymorphisms are highlighted. There are no polymorphisms in the Protospacer Adjacent Motif (PAM) sequences of the 10 sgRNAs (Sg-1 (SEQ ID NO: 65); Sg-2 (SEQ ID NO: 66); Sg-3 (SEQ ID NO: 67); Sg-4 (SEQ ID NO: 68); Sg-5 (SEQ ID NO: 69); Sg-6 (SEQ ID NO: 70); Sg-7 (SEQ ID NO: 71 ); Sg-8 (SEQ ID NO: 72); Sg-9 (SEQ ID NO: 73); and Sg-10 (SEQ ID NO: 74)). [0062] FIG. 2. CMER promotes EBV reactivation in Akata (EBV+) Burkitt lymphoma cells. (A) Akata (EBV+) cells were used to create cell lines using lentivirus carrying dCas9-VP64 with control (sg-NC) and 10 ZTA promoter-targeting sgRNAs. The cells were uninduced (0 hour) or induced using anti-IgG for 24 hours. The expression levels of ZTA and BGLF4 were monitored by Western Blot (WB). [3-actin blot was included as loading controls. (B) The relative extracellular EBV copy numbers were measured using qPCR as described in the method. The value of lane 1 was set
as 1 . Results from three biological replicates are presented. Error bars Indicate the standard deviation (mean ± SD, **p<0.01 ; ***p < 0.001 ).
[0063] FIG. 3. CMER triggers EBV reactivation in P3HR1 Burkitt lymphoma cells. (A) EBV-positive P3HR1 cells were used to create cell lines carrying dCas9-VP64 with control (sg-NC) and two ZTA promoter-targeting sgRNAs, sg-1 and sg-5. The cells were uninduced (0 hour) or induced using TPA and Sodium Butyrate (TPA/NaBu) for 24 and 48 hours. The expression levels of ZTA and BGLF4 were monitored by WB. [3- actin blot was included as loading controls. (B) The relative intracellular EBV DNA copy numbers were measured using qPCR as described in the method. (C) The relative extracellular virion-derived DNA copy numbers were measured using qPCR as described in the method. The value of lane 1 was set as 1 . Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ± SD, *p<0.05; **p<0.01 ; ***p < 0.001 ).
[0064] FIG. 4. CMER triggers EBV reactivation in SNU-719 gastric cancer cells. (A) Lentiviruses carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were used to transduce EBV-positive SNU-719 cells. The relative EBV copy numbers that secreted to the medium (72 hrs post lentiviral transduction) were measured using qPCR as described in the method. The cells were subsequently transferred to T25 flask for cell line establishment. (B) SNU-719 cells carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were either uninduced (0 hr) or induced using TPA and sodium butyrate (TPA/NaBu) for 24 and 48 hrs. The expression levels of ZTA and BGLF4 were monitored by WB. [3-actin blot was included as loading controls. (C) The relative intracellular EBV DNA copy numbers were measured using qPCR as described in the method. (D) The relative extracellular virion-derived DNA copy numbers were measured using qPCR as described in the method. The value of lane 1 was set as 1. Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ± SD, *p<0.05; **p<0.01 ).
[0065] FIG. 5. CMER triggers EBV reactivation in HK-1 (EBV+) nasopharyngeal carcinoma cells. (A) Lentiviruses carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were used to transduce HK-1 (EBV+) cells. The relative EBV copy numbers that secreted to the medium (72 hrs post lentiviral transduction) were measured using qPCR as described in the method. The cells were subsequently transferred to T25 flask for cell line establishment. (B) HK-1 (EBV+) cells carrying dCas9-VP64 with control (sg-NC), sg-1 or sg-5 sgRNAs were either uninduced (0 hr)
or induced using TPA and sodium butyrate (TPA/NaBu) for 24 and 48 hrs. The expression levels of ZTA and BGLF4 were monitored by WB. [3-actin blot was included as loading controls. (C) The relative intracellular EBV DNA copy numbers were measured using qPCR as described in the method. (D) The relative extracellular virion-derived DNA copy numbers were measured using qPCR as described in the method. The value of lane 1 was set as 1 . Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ± SD, *p<0.05; **p<0.01 ; ***p < 0.001 ).
[0066] FIG. 6. CMER and GCV treatment selectively kill EBV-infected cells. (A) Akata (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg- NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 7 days. The cell viability (live to total cells ratio) was measured as described in the methods section. (B) Akata (EBV-) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 7 days. The cell viability (live to total cells ratio) was measured as described in the methods section. (C) P3HR1 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 13 days. The cell viability was measured as described in the methods section. (D) SNU-719 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 7 days. The relative live cell numbers were counted. The number of sg-5- expressing treated with GCV was set as 1. (E) HK-1 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. The cells were grown under puromycin selection together with DMSO or GCV for 10 days. The relative live cell numbers were counted. The number of sg-5-expressing treated with GCV was set as 1 . Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ± SD, ***p < 0.001 ). n.s., no significance.
[0067] FIG. 7. Delivery of CRISRP/dCas9-VP64 by transient transfection triggers EBV reactivation and subsequent cell death induced by GCV. (A) SNU-719 (EBV+) cells were transfected with pAC152-dual-dCas9VP64-sg-NC and pAC152- dual-dCas9VP64-sg-5 for 48 hrs. The expression levels of ZTA, RTA and BGLF4 were monitored by WB. [3-actin blot was included as loading controls. (B) The relative extracellular virion-derived DNA copy numbers were measured using qPCR as
described in the method. The value of lane 1 was set as 1 . (C) The transfected cells were treated with DMSO or GCV for 7 days. The relative live cell numbers were counted. The number of sg-5-expressing treated with GCV was set as 1 . Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ± SD, *p<0.05; **p<0.01 ; ***p < 0.001 ). n.s., no significance.
[0068] FIG. 8. CMER reactivates EBV with 100% efficiency. Akata (EBV+) cells (A- D) and SNU-719 (EBV+) cells (E-H) carrying CRISPR/dCAS9-VP64-sgNC or sg-5 were blocked with 3% BSA in PBS at room temperature for 1 h and then incubated with anti-ZTA (A, B, E, F) or anti-gp350/250 (C, D, G, H) antibodies. Subsequently, the Alexa Fluor 488-labeled goat anti-mouse IgG antibody was added to the cells. Cell nuclei were stained with DAPI and visualized using Nikon AXR microscope. DAPI: 4',6-diamidino-2-phenylindole.
[0069] FIGS. 9A-9F. CMER triggers the expression of both lytic and latent genes. Akata (EBV+) cells (FIGS. 9A-9C) and SNU-719 (EBV+) cells (FIGS. 9D-9F) carrying CRISPR/dCAS9-VP64-sgNC or sg-5 were lysed to extract protein and RNA. (FIGS. 9A and 9D). The expression levels of ZTA, RTA, p18 and EBNA1 were detected by WB. [3-actin blot was included as loading control. (FIGS. 9B and 9E). The mRNA levels of lytic genes (ZTA, RTA, BGLF4, BALF5, BMRF1 and BLLF1 ) were measured using RT-qPCR as described in the method. (FIGS. 9C and 9F). The mRNA levels of latent genes (EBNA1 , EBNA3A, EBNA3B, and LMP1 ) were measured using RT-qPCR as described in the method. Results from three biological replicates are presented. Error bars indicate the standard deviation (mean ± SD, *p<0.05; **p<0.01 ; ***p < 0.001 ).
[0070] FIG. 10. Model summarizing CMER in promoting cell death by EBV reactivation and GCV-mediated DNA synthesis inhibition. Lentiviral delivery or transfection of CRISPR/dCas9-VP64 and ZTA promoter targeting sgRNA (Zp-sg-5) promotes the expression of EBV ZTA and the downstream viral protein kinase (BGLF4). Strong lytic replication and the phosphorylation of nucleoside analog GCV by BGLF4 lead to the eradication of EBV-infected cancer cells.
[0071] FIG. 11 provides an exemplary 5’ promoter region sequence for EBV Akata ZTA gene (SEQ ID NO: 75).
DETAILED DESCRIPTION
[0072] Other than in the operating examples, or where otherwise indicated, the use of numerical values in the various ranges specified in this application are stated as approximations as though the minimum and maximum values within the stated ranges are both preceded by the word “about”. In this manner, slight variations above and below the stated ranges can be used to achieve substantially the same results as values within the ranges. Also, unless indicated otherwise, the disclosure of ranges is intended as a continuous range including every value between the minimum and maximum values. As used herein “a” and “an” refer to one or more.
[0073] As used herein, the term “comprising” is open-ended and may be synonymous with “including”, “containing”, or “characterized by”. The term “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. The term “consisting of” excludes any element, step, or ingredient not specified in the claim. As used herein, embodiments “comprising” one or more stated elements or steps also include, but are not limited to embodiments “consisting essentially of” and “consisting of” these stated elements or steps. For definitions provided herein, those definitions refer to word forms, cognates and grammatical variants of those words or phrases.
[0074] Provided herein are methods and reagents useful for treatment of a cancer associated with Epstein Barr Virus, e.g., killing a cell, such as a cancer cell harboring an EBV genome, which is typically episomal and linked to host chromosome via EBNA1. An EBV-positive cell is a cell comprising an EBV genome, e.g., an episome tethered by EBNA1 . A Cas-based transcriptional activator and a guide sequence are administered to a cell to induce EBV activation in the cell, and an antiherpesvirus nucleoside analog, such as acyclovir or ganciclovir, which are able to kill EBV-positive cancer cells is administered In the example below, a CRISPR/dCas9-VP64 system was used to target the ZTA promoter, achieving the reactivation of EBV through a strategy termed CRISPR/dCas9-Mediated EBV Reactivation (CMER). The CMER approach robustly induces EBV reactivation across various EBV-positive cell types, including Burkitt lymphoma, gastric cancer, and nasopharyngeal carcinoma cells. Importantly, when combined with GCV, CMER selectively kills EBV-positive cells but not EBV-negative cells. This innovative strategy holds significant promise for further research and clinical applications.
[0075] Features of the described methods and compositions, for example and without limitation as shown in the proof-of-concept study in the Example, include: a novel approach for EBV reactivation termed CRISPR/dCas9-Mediated EBV Reactivation (CMER) strategy, which directly reactivates EBV without any lytic inducing agents; CMER with single guide RNA, e.g., sg5, triggers robust EBV reactivation across various cell types, including lymphoma, gastric cancer, and nasopharyngeal carcinoma cells; viruses generated from different cell lines, with different genetic variations, provide a valuable source to test guide/CMER candidates; CMER has unique advantages compared to a previous method by overexpressing EBV IE genes as only EBV-positive cells will respond to CMER and express EBV IE genes; the combination of CMER and ganciclovir selectively kills EBV-positive cells, regardless of their cell origin; and CMER does not target EBV-negative cells, so it will have no or far less adverse effects compared to chemotherapy drugs as lytic inducing agents.
[0076] Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems have been modified for genome engineering and other purposes are based on an adaptive immune system in bacteria. CRISPR systems are two-component systems that include a guide RNA or single guide RNA (gRNA or sgRNA, respectively) and a CRISPR-associated nuclease. Traditionally, engineered CRISPR systems are used for genomic engineering, but have also been adapted for transcriptional control. Cas enzymes are able to bind target DNA independently of their ability to cleave target DNA. For transcriptional control, Cas nuclease domains can be rendered inactive by point mutations. For example, in Cas9, both RuvC and HNH nuclease domains can be rendered inactive by point mutations (D10A and H840A in S. pyogenes Cas9, SpCas9), resulting in a nuclease dead Cas9 (dCas9) molecule that cannot cleave target DNA. The dCas9 molecule retains the ability to bind to target DNA based on the gRNA targeting sequence (see, e.g., Addgene: CRISPR Guide, www.addgene.org/guides/crispr/).
[0077] For example, CRISPR/CRISPR-associated protein 9 (Cas9) has been extensively explored as a genome editor for mammalian cells (see, e.g., Cong L, etal. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819- 23 and Mali P, etal. 2013. RNA-guided human genome engineering via Cas9. Science 339:823-6). CRISPR/Cas9 has been adapted for gene activation or inhibition by fusing additional proteins and rendering the Cas9 catalytic site inactive (inactive Cas9, or dCas9). VP64 is a transcriptional activator composed of four tandem copies of Herpes
Simplex Viral Protein 16 (VP16) activation domain (amino acids 437-447: DALDDFDLDML (SEQ ID NO: 76)). VP64 is an example of CRISPR-controlled transcription regulation systems. Other CRISPR-controlled transcription regulation systems, such as CRISPR/dCas9-SAM, CRISPR/dCas9-VPR (a tripartite activator comprised of VP64™p65-Rta), CRISPR/dCpfl , and CRISPR/dCasX have been studied and may find use in the present methods and compositions (see, e.g., blog.addgene.org/crispr-activators-dcas9-vp64-sam-suntag-vpr; Didovyk A, et al. Transcriptional regulation with CRISPR-Cas9: principles, advances, and applications. Curr Opin Biotechnol. 2016 Aug; 40:177-184; Sajwan S and Mannervik M. Gene activation by dCas9-CBP and the SAM system differ in target preference. Sci Rep. 2019 Dec 2;9(1 ):18104; Makarova KS, et al. Evolutionary classification of CRISPR- Cas systems: a burst of class 2 and derived variants. Nat Rev Microbiol. 2020 Feb;18(2):67-83; and Zhang, X, et al. Gene activation in human cells using CRISPR/Cpf1 -p300 and CRISPR/Cpf1 -SunTag systems, Protein & Cell, Volume 9, Issue 4, April 2018, Pages 380-383), and may be multiplexed (see, e.g., McCarty NS, Graham AE, Studena L, Ledesma-Amaro R. Multiplexed CRISPR technologies for gene editing and transcriptional regulation. Nat Commun. 2020 Mar 9 ; 1 1 (1 ):1281 ).
[0078] As such, as used herein CRISPR-based transcription activation refers to the use of a CRISPR mechanism to activate transcription according to any useful embodiment, such as the CRISPR/Cas9-VP64 system as shown in the examples herein, or other systems, for example as in the preceding paragraph that employ a CRISPR guide RNA (gRNA) to target a promoter region or transcription response element (TRE) of a gene and the target-bound guide RNA recruits a transcriptional activator that binds to the DNA-bound guide RNA (e.g., a dCas transcriptional activator), thereby activating transcription of the gene. As above, non-limiting examples of such include Cas9-VP64-based systems, as well as CRISPR/dCas9- SAM-based systems, CRISPR/dCas9-VPR-based systems, CRISPR/dCpfl -based systems, and CRISPR/dCasX-based systems. Suitable guide sequences may be determined using any useful tool based on the sequence of the target promoter or TRE, and its efficacy can be readily determined, for example using the methods described in the examples below for the evaluated sgRNAs.
[0079] Engineered CRISPR systems contain two components: a guide RNA (gRNA, such as an sgRNA) and a CRISPR-associated endonuclease (Cas protein). For transcriptional activation, a nuclease-deficient Cas protein (dCas protein, also referred
to as “non-cleaving Cas”) is used to target a corresponding gRNA. By “corresponding”, it is meant a gRNA, e.g., an sgRNA is able to complex with its “corresponding” Cas protein, such as a dCas transcription activator, to produce a desired effect, which, in the case of a dCas transcription activator, is activating transcription of a targeted gene in a cell. The gRNA is a short synthetic RNA composed of a guide scaffold sequence necessary for Cas-binding and a user-defined ~20 nucleotide, e.g. ranging from 18- 22 nucleotide, spacer that defines the genomic target to be modified. Thus, one can change the genomic target of the Cas protein by simply changing the target sequence present in the gRNA. The guide scaffold sequence is arranged in the gRNA 3’ to the target sequence. The EBV genomic target of the target sequence of the gRNA typically includes a compatible protospacer adjacent motif (PAM). In the examples below, spCas9 is used, so the PAM sequence located adjacent to the target of the gRNA is NGG, with the understanding that such PAM sequences may differ, depending on the Cas protein used. Examples include (Cas proteimPam sequence): SpCas9:NGG; SaCas9:NNGRRT; CjCas9:NNNNACAC; AsCas12a:TTTN; LbCas12a:TTTN; AsCas12f1 :NTTR; and PlmCas12e:TTCN, for example and without limitation (See also, Kleinstiver BP, et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jul 23;523(7561 ):481 -5; but see, Kiattisewee C, et al. Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. ACS Synth Biol. 2022 Dec 16; 1 1 (12):4103-41 12). Suitable target sequences in the EBV IE or EBV protein kinase gene promoters may be identified, taking into consideration the required PAM sequence and the absence of the same sequence in the human genome or in more than one location in the EBV genome, which can be readily ascertained using BLAST or equivalent sequence analysis.
[0080] As indicated below in the Example, the sgRNAs may have the overall structure 5’-N-TARGETING SEQUENCE-gRNA scaffold-3’. N is A,G,C, or T, and in the exemplary sgRNAs, N is G and the gRNA scaffold is: 5’- GUUUUAGAGC UAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGC-UUUUUU-3’ (SEQ ID NO: 21 ), yielding full sgRNAs as provided below in Table A. Other gRNA scaffold sequences may be used so long as it is compatible with the Cas protein used. Other forms of gRNA, such as two-part guide RNAs or a ribonucleoprotein complex (RNP) comprising the gRNA and Cas- transcriptional activator, may be delivered to a cell, as is understood in the relevant arts.
[0081] By "expression" or “gene expression,” it is meant the overall flow of information from a gene. A “gene” is a functional genetic unit for producing a gene product, such as RNA or a protein in a cell, or other expression system encoded on a nucleic acid and generally comprising: a transcriptional control sequence, such as a promoter and other c/s-acting elements, such as transcriptional response elements (TREs) and/or enhancers; an expressed sequence that typically encodes a protein (referred to as an open-reading frame or ORF) or functional/structural RNA; and a polyadenylation sequence). A gene produces a gene product (typically a protein, optionally post- translationally modified or a functional/structural RNA, such as a gRNA) when transcribed. By "expression of genes under transcriptional control of," or alternately "subject to control by," a designated sequence such as a promotor, it is meant gene expression from a gene containing the designated sequence operably linked (functionally attached, typically in cis) to the gene. A gene that is “under transcriptional control” of a promotor or transcription control element, is a gene that is transcribed at detectably different levels in the presence of a transcription factor, e.g., in the presence of a suitable chemical compound, such as doxycycline in the case of a dox-responsive promoter, such as a tet-inducible promoter. Another promoter example is a Pol III promoter, which are useful for production of small RNA molecules, such as gRNAs (see, e.g., Ma H, et al. Wu H. Pol III Promoters to Express Small RNAs: Delineation of Transcription Initiation. Mol Ther Nucleic Acids. 2014 May 6;3(5):e161 ). The Example below employs the U6 promoter of the pLentiV2-dCas9-VP64 vector to produce sg RN A. A "gene for expression of" a stated gene product, such as an sg RNA or a dCas transcription activator is a gene capable of expressing that stated gene product when placed in a suitable environment, that is, for example, when transformed, transfected, transduced, etc. into a cell, and subjected to suitable conditions for expression. In the case of a constitutive promoter "suitable conditions" means that the gene typically need only be introduced into a host cell. In the case of an inducible promoter, such as a tissue-specific promoter, "suitable conditions" means when factors that regulate transcription, such as DNA-binding proteins, are present or absent, for example, an amount of the respective inducer is available to the expression system (e.g., cell), or factors causing suppression of a gene are unavailable or displaced - effective to cause expression of the gene.
[0082] Transcriptional control elements include promoters, enhancers, transcription factor-responsive elements (TREs, e.g., transcription factor binding sequences),
suppressors, introns, etc., as are broadly-known. Additional transcription control elements, such as a WPRE (woodchuck hepatitis virus post-transcriptional regulatory element) can be included in a gene.
[0083] A gene may be introduced into a cell, such as an EBV-positive cell, such as a cancer cell, by any useful method, such as by viral transduction (e.g., AAV or lentiviral transduction), PiggyBac transposon, or any other useful transformation or transduction method. A person of ordinary skill in the molecular biology art would be able to introduce a gene for expression of gRNAs and dCas transcription activators without undue experimentation. Various cloning and transformation/transduction vehicles, such as plasmids, that contain genes for the expression of gRNAs and/or dCas transcription activators are broadly available, such as from Addgene, among many other vendors.
[0084] An “isolated” or “purified” biological component (such as a nucleic acid, peptide, protein, protein complex, or particle) refers to a component that has been substantially separated, produced apart from, or purified away from other components in a preparation or other biological components in the cell of the organism in which the component occurs, that is, other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins that have been “isolated” or “purified”, thus, include, for example and without limitation, nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins. The term “isolated” or “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated biological component is one in which the biological component is more enriched than the biological component is in its natural environment within a cell, or other production vessel. A preparation may be purified such that the biological component represents at least 50%, such as at least 70%, at least 90%, at least 95%, or greater, of the total biological component content of the preparation.
[0085] A nucleic acid molecule (a nucleic acid) refers to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, gRNA, plasmid DNA, viral DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide. The term “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.” The term includes
single- and double-stranded forms of DNA. A polynucleotide may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
[0086] A first nucleic acid is said to be operably linked to a second nucleic acid when the first nucleic acid is placed in a functional relationship with the second nucleic acid. Generally, operably linked DNA sequences are contiguous (e.g., in cis) and, where the sequences act to join two protein coding regions, in the same reading frame (e.g., open reading frame or ORF), for example to produce a fusion protein. Operably linked nucleic acids include a first nucleic acid contiguous with the 5' or 3' end of a second nucleic acid. In examples, a second nucleic acid may be considered operably linked to a first nucleic acid when it is embedded within the first nucleic acid, for example, where the nucleic acid construct includes (in order) a portion of the first nucleic acid, the second nucleic acid, and the remainder of the first nucleic acid.
[0087] A “codon-optimized” nucleic acid refers to a nucleic acid sequence that has been altered such that the codons are optimal for expression in a particular system (such as a particular species of group of species). For example, a nucleic acid sequence can be optimized for expression in human cells. Codon optimization does not alter the amino acid sequence of the encoded protein.
[0088] Complementary refers to the ability of polynucleotides (nucleic acids) to hybridize to one another, forming inter-strand base pairs. Base pairs are formed by hydrogen bonding between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair (hybridize) in the Watson-Crick manner (e.g., A to T, Ato U, C to G), or in any other manner that allows for the formation of duplexes. When using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. Two sequences comprising complementary sequences can hybridize if they form duplexes under specified conditions, such as in water, saline (e.g., normal saline, or 0.9% w/v saline) or phosphate-buffered saline), or under other stringency conditions, such as, for example and without limitation, 0.1 X SSC (saline sodium citrate) to 10X SSC, where 1 X SSC is 0.15M NaCI and 0.015M sodium citrate in water. Hybridization of complementary sequences is dictated, e.g., by salt concentration and temperature, with the melting temperature (Tm) lowering with increased mismatches and increased stringency. Perfectly matched sequences are said to be fully complementary, or have 100% sequence identity (gaps are not counted and the measurement is in relation to
the shorter of the two sequences). In one example, a sequence that “specifically hybridizes” to another sequence, does so in a hybridization solution containing 0.5M sodium phosphate buffer, pH 7.2, containing 7% SDS, 1 mM EDTA, and 100 mg/ml of salmon sperm DNA at 65° C for 16 hours and washing twice at 65° C for twenty minutes in a washing solution containing 0.5xSSC and 0.1 % SDS, or does so under conditions more stringent than 2X SSC at 65QC, for example, in 0.2X SSC at 55QC. A sequence that specifically hybridizes to another typically has at least 80%, 85%, 90%, 95%, OR 99% sequence identity with the other sequence.
[0089] A conservative substitution is a substitution of one amino acid residue in a protein sequence for a different amino acid residue having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide. For example, a Gas polypeptide sequence may include one or more conservative substitutions (for example 1 -10, 2-5, or 10-20, or no more than 2, 5, 10, 20, 30, 40, or 50 substitutions) yet retains function of the wild-type protein. A polypeptide can be produced to contain one or more conservative substitutions by manipulating the nucleotide sequence that encodes that polypeptide using, for example, standard procedures such as site-directed mutagenesis or PGR.
[0090] A polypeptide is a polymer in which the monomers are amino acid residues which are joined together through amide bonds. When the amino acids are alphaamino acids, either the L-optical isomer or the D-optical isomer can be used. The terms “polypeptide”, “peptide”, or “protein” as used herein are intended to encompass any amino acid sequence and include proteins and modified sequences such as glycoproteins. The term “polypeptide” is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced. The term “residue” or “amino acid residue” includes reference to an amino acid that is incorporated into a protein, polypeptide, or peptide.
[0091] Conservative amino acid substitutions may be identified by use of matrices, such as the BLOSUM series of matrices, and other matrices. Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a
hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.
[0092] A recombinant nucleic acid refers to a nucleic acid molecule (or protein or virus) that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids. The term recombinant includes nucleic acids and proteins that have been altered solely by addition, substitution, or deletion of a portion of a natural nucleic acid molecule or protein.
[0093] “Sequence identity” refers to the similarity between nucleic acid or amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity may be measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs, orthologs, or variants of a polypeptide will possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well-known in the art. As used herein, reference to “at least 80% identity” (or similar language) refers to “at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity” to a specified reference sequence. As used herein, reference to “at least 90% identity” (or similar language) refers to “at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity” to a specified reference sequence. Sequence identity may be measured by any acceptable algorithm.
[0094] An anti-EBV nucleoside analog drug may be any nucleoside analog drug useful as an anti-herpesvirus or anti-EBV therapy. Non-limiting examples of such anti-EBV nucleoside analog drug include: ganciclovir, acyclovir, penciclovir, or fialuridine (FIAU, e.g., [131 l]2'-fluoro-2'-deoxy-beta-D-5-iodouracilarabinofuranoside ([131 I]FIAU), see, e.g., Fu DX, et al. Bortezomib-induced enzyme-targeted radiation therapy in herpesvirus-associated tumors. Nat Med. 2008 Oct; 14(10):11 18-22).
[0095] The term “contacting” refers to placement in direct physical association; includes both in solid and liquid form. “Contacting” is often used interchangeably with “exposed.” In some cases, “contacting” includes transfecting, such as transfecting a nucleic acid molecule into a cell. In other examples, “contacting” refers to incubating a molecule (such as an antibody) with a biological sample.
[0096] The term “therapeutically effective amount” as used herein means a dosage which is sufficient to be effective for the treatment of the patient compared with no treatment. As is known in the art, a therapeutically effective dose of an active agent can vary from patient to patient based on many different factors, including, but not limited to, age, weight, gender, genotype, other medical conditions, etc. A doctor or medical provider overseeing the treatment of a patient is best suited to determine the therapeutically effective dose based on their knowledge and experience working with that patient. A therapeutically-effective amount may be an amount of a therapeutic agent effective to improve one or more symptoms of the disease, or normalize one or more markers of a disease in a patient. By normalize, it is meant to bring values of a marker in a patient towards or into a range considered as normal for a patient.
[0097] The term “treatment” or “treat” or “treating” with respect to a disease or medical condition as used herein means the management and care of a patient having developed a disease, condition, or disorder. The purpose of treatment is to combat the disease, condition, or disorder. Treatment includes, but is not limited to, the administration of a pharmaceutical composition to alleviate one or more symptoms associated with the disease, medical condition, or disorder. Treatment may result in the partial or full alleviation of all symptoms, or curing of said disease, medical condition, or disorder. With respect to EBV-positive cancers as described herein, treatment can mean that a pharmaceutical composition as described herein is administered to a patient in need of such treatment. A therapeutically effective amount may result in an improvement in a biomarker associated with a cancer, and may be reflected in lowered tumor cell counts, or reduction in tumor size, number, or cancer stage in a patient.
[0098] As used herein, the term “pharmaceutical composition” describes a composition that comprises one or more active agents and one or more pharmaceutically acceptable excipients. The excipient(s) must be acceptable in the sense of being compatible with the other ingredients of the composition and not deleterious to the recipient thereof. The pharmaceutical compositions can be for use
in the treatment of any of the conditions described herein, including cancer. The excipient(s) may be suitable for use in a parenteral formulation and administration of the active agent(s). The excipient(s) may be suitable for use in an intravenous formulation for administration of the active agent(s). The excipient(s) may be suitable for use in a subcutaneous, intramuscular, intratumoral, or other suitable formulation for administration of the active agent(s).
[0099] In one example, pharmaceutical compositions adapted for parental administration include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, buffers, bacteriostats, and solutes which render the composition isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injection or sterile lipid in oil solution, immediately prior to use. The pharmaceutical composition may comprise non-aqueous liquid excipients that may optionally be combined with water to form an emulsion.
[00100] In one example, a pharmaceutical composition may comprise a gRNA and at least one pharmaceutically acceptable excipient. The composition may further comprise a corresponding dCas transcriptional activator protein or a gene for expression of a corresponding dCas transcriptional activator protein.
[00101] In one example, a pharmaceutical composition may comprise a nucleic acid comprising a gene for expression of a gRNA and at least one pharmaceutically acceptable excipient. The nucleic acid may also comprise a gene for expression of a corresponding dCas transcriptional activator or the composition may further comprise a second nucleic acid comprising a gene for expression of a corresponding dCas transcriptional activator. Alternatively, the composition may comprise a corresponding dCas transcriptional activator protein.
[00102] A patient may receive from 0.1 ng to 100 mg of the gRNA, protein, and/or nucleic acid(s) per dose, including any increment therebetween. The patient may receive, per dose, 0.1 mg, 1 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of the miRNA, or mimic thereof. The patient may receive, per dose, approximately or about 0.1 mg, 1 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of the gRNA, protein, and/or nucleic acid(s).
[00103] The patient may receive, per dose, from 0.001 to 1.00 mg/kg of the gRNA, protein, and/or nucleic acid(s) (based on patient body weight) including any increment therebetween. The patient may receive, per dose, 0.01 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, or 1 .0 mg/kg of the gRNA, protein, and/or nucleic acid(s). The patient may receive, per dose, approximately or about 0.01 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, or 1.0 mg/kg of the gRNA, protein, and/or nucleic acid(s).
[00104] A pharmaceutical composition comprises a carrier or vehicle that includes at least one pharmaceutically acceptable excipient that is compatible for administration to a human patient. “Excipient” can refer to a pharmaceutically-acceptable material or composition, such as a liquid or solid filler, diluent, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting a therapeutic agent to a patient. Each excipient can be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some nonlimiting examples of materials which can serve as pharmaceutically-acceptable carriers or excipients include: (1 ) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11 ) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21 ) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents; (23) serum component, such as serum albumin, HDL and LDL; (24) rheology modifiers; and (25) other non-toxic compatible substances employed in pharmaceutical formulations.
[00105] A nucleic acid such as a gRNA, sgRNA, or a nucleic acid comprising a gene for expression of a gene product may be delivered using any effective carrier. In one example, the carrier is aqueous, such as water, saline, or PBS. The carrier may be a
lipid-based vehicle (See, e.g., Baumann V, Winkler J. miRNA-based therapies: strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents. Future Med Chem. 2014;6(17): 1967-84 and Bulcha JT, et al. Viral vector platforms within the gene therapy landscape. Signal Transduct Target Ther. 2021 Feb 8;6(1 ):53, and see below), for example, where at least one excipient may be a non-aqueous liquid. Examples of vehicles employing non-aqueous lipid excipients include, but are not limited to, the MaxSuppressor™ In Vivo RNA-LANCEr II (Lucerna-Chem AG, Luzern, Switzerland) that comprises a neutral lipid, a non-ionic detergent, an oil, and a proprietary mixture of small molecules. The lipid based carrier may be mixed with water to form an emulsion. The specific excipients can be selected based on the mode of administration of the composition and compatibility with the one or more miRNAs, or mimic thereof, present therein. The composition may comprise a lipid based carrier. The lipid based carrier may be suitable for intravenous or subcutaneous administration to the patient. The lipid-based carrier may be a lipid nanoparticle (LNP) composition and/or compositions, e.g., as described in U.S. Patent Nos. 10,844,028, 10,189,802, 9,872,911 , 9,556,110, 9,439,968, 9,227,917, 8,969,353, and 8,450,298, as well as in U.S. Patent Application Publication Nos. 2017/0204075, 2019/0177289, 2017/0152213, 2016/0114042, 2015/0203439, 2014/0322309, 2014/0161830, 2011 /0293703, and 2010/0331234, each of which incorporated herein by reference for its technical disclosure relating to compounds and compositions useful in delivery of nucleic acid cargoes, and to the extent it is consistent with the present disclosure. Additional examples of LNPs are described in U.S. Patent Nos. 9,404,127, 9,364,435, and US 8,058,069, each of which incorporated herein by reference for its technical disclosure relating to compounds and compositions useful in delivery of nucleic acid cargoes, and to the extent it is consistent with the present disclosure (see, also, e.g., Sabnis S, et aL, A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates. Mol Ther. 2018; 26(6): 1509-1519 and Yonezawa S, et aL, Recent advances in siRNA delivery mediated by lipid-based nanoparticles. Adv Drug Deliv Rev. 2020; 154-155:64-78). Examples of lipid nanoparticles and methods of making lipid nanoparticles are described in Whitehead KA, et aL, Degradable lipid nanoparticles with predictable in vivo siRNA delivery activity. Nat Commun. 2014 Jun 27; 5:4277. Virus-like particles also are useful in delivering nucleic acids and proteins, such as CRISPR/Cas proteins or gRNAs, and/or nucleic acid(s) comprising gene(s) for expression of a gRNA or a
dCas transcriptional activator, as described herein (see, e.g., Hamilton JR, et al. Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering. Cell Rep. 2021 Jun 1 ;35(9): 109207 and Banskota S, et al. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell. 2022 Jan 20;185(2):250-265.e16).
[00106] Production of useful nucleic acid constructs, such as recombinant viral vectors for production of nucleic acids, such as the genetic constructs and recombinant viral genomes described herein, is routine, in that molecular cloning and gene assembly methods are routine. Further, a number of companies can custom-synthesize and verify multi-kilobase genes, making the production of genes or genomes as described herein, such as rAAV or scAAV genomes, routine (See, e.g., Gene Synthesis Handbook, 2d Edition, 2014, GenScript USA, Inc.).
[00107] A vector is a nucleic acid molecule allowing insertion of foreign nucleic acid without disrupting the ability of the vector to replicate and/or integrate in a host cell. A vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. An insertional vector is capable of inserting itself into a host nucleic acid. A vector can also include one or more selectable marker genes and other genetic elements. An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of inserted gene or genes. [00108] A variety of viral vectors have found use in the delivery of genes for expression of a protein in a cell, such as a cancer cell as described herein. See, e.g., Butt MH, Zaman M, Ahmad A, Khan R, Mallhi TH, Hasan MM, Khan YH, Hafeez S, Massoud EES, Rahman MH, Cavalu S. Appraisal for the Potential of Viral and Nonviral Vectors in Gene Therapy: A Review. Genes (Basel). 2022 Jul 30; 13(8): 1370. The following paragraphs describe use of Adeno-associated virus particles for delivery of genes. AAV, described in further detail below, is but one of many robust and well-characterized viral vectors suited for gene therapy, which also includes, without limitation, gammaretroviruses, lentiviruses, adenovirus, and herpes simplex virus. While AAV may be preferred in instances, other safe and effective viral transducing particles can be developed based on the genes described herein for use in the devices, systems and methods described herein.
[00109] AAV (adeno-associated virus), is a virus belonging to the genus Dependoparvovirus, and family Parvoviridae. The virus is a small replicationdefective, non-enveloped virus. AAV is not currently known to cause any disease by
itself. AAV requires a helper virus, such as adenovirus or herpes simplex virus, to facilitate productive infection and replication. In the absence of helper virus, AAVs establish a latent infection within the cell, either by site-specific integration into the host genome or by persisting in episomal forms. Gene therapy vectors using AAV can infect both dividing and quiescent cells. Furthermore, AAV serotypes have different tropism and can infect cells of multiple diverse tissue types. While eleven serotypes of AAV have been identified to date, AAV2 was among the first to be identified and has been consistently used for the generation of recombinant AAV vectors. Further certain natural or modified AAVs transduce specific organs or cell populations.
[00110] The AAV virion shell is approximately 25 nanometers (nm) in diameter and encapsulates a single-stranded DNA genome that consists of two large open reading frames (ORFs) flanked by inverted terminal repeats (ITR). The ITRs are the only cis- acting elements required for genome replication and packaging. In wild-type AAV, the left ORF encodes four replication proteins responsible for site-specific integration, nicking, and helicase activity, as well as regulation of promoters within the AAV genome. AAV possesses a 4.7 kb genome, and as such, efficient packaging of recombinant AAV (rAAV) vectors can be performed with constructs ranging from 4.1 kb to 4.9 kb in size.
[00111] Helper-free production of the rAAV requires transfection of the following components into host cells, typically 293 cells (HEK293 cells), which are broadly available, or similar cell lines: (1 ) an rAAV vector containing the transgene expression cassette flanked by the two ITRs; (2) expression of Rep and Cap proteins, typically provided by a helper plasmid in trans', and (3) adenovirus genes encoding E1 , E2A, E4, and virus-associated RNA, also provided, at least in part by another helper plasmid in trans (293 cells produce the Ad E1 gene in trans). Rep and Cap proteins, which are necessary for viral packaging, are replication proteins and capsid proteins, respectively. Rep proteins consist of rep 78, 68, 52, and 40. They specifically are involved with the replication of AAV. Cap proteins are comprised of three proteins, VP1 , VP2 and VP3, with molecular weight of 87, 72 and 62 kDa, respectively. These capsid proteins assemble into a near-spherical protein shell of 60 subunits. Helper- free AAV packaging systems are broadly available commercially, and see, e.g., U.S. Patent Nos. 6,093,570, 6,458,587, 6,951 ,758, and 7,439,065. In scAAV (self- complementary AAV), the right ITR contains a deletion of D-sequence (the packaging signal) and a terminal resolution site mutation (Atrs), which prevent Rep-mediated
nicking and force packaging of dimer or self-complementary genomes. Making dsAAV from scAAV vector renders much improved transduction both in vitro and in vivo.
[00112] Preparation of rAAV transducing particles, such as scAAV transducing particles is routine. Since the transfection method is often considered unsuitable for large-scale production, the infection of cell lines stably expressing Rep and Cap with adenovirus carrying a vector genome has afforded the ability to scale-up. Another option includes infection of proviral cell lines with adenovirus or herpes simplex virus vector carrying an AAV Rep and Cap expression cassette. These methods still require the complete elimination of adenovirus (or herpesvirus) during the production process. However, in baculovirus expression vector systems for rAAV vector production in insect SF9 cells, the components of AAV production, including Rep and Cap proteins, as well as vector genomes are provided by separate recombinant baculoviruses. Numerous robust rAAV production methods are available (see, e.g., Merten OW. Development of Stable Packaging and Producer Cell Lines for the Production of AAV Vectors. Microorganisms. 2024 Feb 13;12(2):384; Gray S J, et al. (2011 ) Production of recombinant adeno-associated viral vectors and use in in vitro and in vivo administration. Curr Protoc Neurosci. doi:10.1002/0471142301 ,ns0417s57; and Guo P, et al. (2012) Rapid and simplified purification of recombinant adeno-associated virus. J Virol Methods 183(2):139-146).
[00113] Once the virus has been produced in the, e.g., 293 cells, the cells are collected, lysed, and the resultant virus is purified. Density gradient ultracentrifugation, e.g., in cesium chloride or nonionic iodixanol (VISIPAQ™) gradients and column chromatography, such as ion-exchange, heparin-affinity, or mucin-affinity column chromatography, depending on the AAV serotype. Once the rAAV has been purified and concentrated to a suitable concentration, the virus can be used for in vitro cell transduction or for in vivo animal injection at an appropriate MOI (Multiplicity of Infection).
[00114] Numerous rAAV vectors have been made containing genes for expressing proteins, and are commercially available. Due to size limitations, genes for use in rAAV vectors typically do not include introns. rAAV vectors also include the 5’ ITR and 3’ ITR flanking the gene, which is referred to as a transgene. Thus, a typical rAAV genome has the following structure, in order from 5’ to 3’ on the sense strand: ITR - promoter - transgene ORF - pA - ITR. Methods of molecular cloning of rAAV transgene constructs, preparation of rAAV particles, and storage and use thereof are
broadly-known and further technical details are unnecessary for one of ordinary skill in the art to be able to construct useful rAAV vectors, and produce and use rAAV particles as described herein. As indicated above, so long as the gene sequence is less than the packaging limit of rAAV or scAAV, it is useful for production of a transduction particle as described herein. As stated above, AAV is merely an example of the many methods and compositions useful for delivering nucleic acids to a patient.
Examples
[00115] Epstein-Barr virus (EBV) is a ubiquitous human tumor virus that establishes lifelong persistent infections in B cells. The presence of EBV in cancer cells presents an opportunity to target these cells by reactivating the virus from latency. In this study, we developed a novel approach for EBV reactivation termed CRISPR/dCas9- Mediated EBV Reactivation (CMER) strategy. Using modified CRISPR-associated protein 9 (dCas9) fused with VP64, we designed ten single guide RNAs (sgRNAs) to target and activate the EBV IE gene promoter. Nine out of ten CMER sgRNAs effectively reactivated EBV in Akata Burkitt lymphoma cells. Among these, CMER sgRNA-5 triggered robust reactivation across various cell types, including lymphoma, gastric cancer, and nasopharyngeal carcinoma cells. Importantly, the combination of CMER and ganciclovir selectively eliminated EBV-positive cells, regardless of their cell origin. These findings indicate that targeted virus reactivation by CMER, combined with nucleoside analog therapy, holds promise for EBV-associated cancer treatment. [00116] This study explores a novel strategy called CRISPR/dCas9-Mediated EBV Reactivation (CMER) to reactivate the Epstein-Barr virus (EBV) in cancer cells. EBV is associated with various cancers, and reactivating EBV from latency offers a potential therapeutic strategy. We utilized an enzymatically inactivated CRISPR-associated protein 9 (dCas9) fused with VP64 and designed 10 single guide RNAs (sgRNAs) to target the EBV IE gene promoter. Nine of these sgRNAs effectively reactivated EBV in Burkitt lymphoma cells, with CMER sgRNA-5 demonstrating strong reactivation across different cancer cell types. Combining CMER with ganciclovir selectively eliminated EBV-positive cells, showing promise for EBV-associated cancer treatment.
[00117] Targeting EBV ZTA promoter by CRISPR/dCas9. The transition of EBV from latency to reactivation is regulated by the IE gene ZTA and, in some cases, RTA. The power of the CRISPR/dCas9-VP64 gene activation system is used herein to specifically target the promoter of the EBV ZTA. To do so, a series of single guide
RNAs (sgRNAs) targeting the ZTA promoter within the Akata EBV+ genome (90554- 90877 bp) was designed. Ten unique sgRNA candidates were chosen from an array of designed sgRNAs to assess their potential for reactivating EBV (FIG. 1A).
[00118] To determine the sequence conservation of these sgRNA targeting sites, 10 EBV strains derived from different cancer cells were analyzed. Sequences targeted by sgRNAs such as sg-1 , sg-5, sg-6, sg-9, and sg-10 are highly conserved, while those targeted by sg-2, sg-3, sg-4, sg-7, and sg-8 display single nucleotide polymorphisms (FIG. 1 B). Therefore, sg-1 , sg-5, sg-6, sg-9, and sg-10 are anticipated to target a wider range of EBV strains.
[00119] CMER triggers EBV reactivation in B cells. To test whether EBV could be reactivated using a CRISPR/dCas9-VP64 gene activation system, namely CRISPR/dCas9-Mediated EBV Reactivation (CMER), the ten sgRNAs targeting ZTA promoter and a non-targeting control sgRNA were cloned into a lentiviral system. Subsequently, Akata (EBV+) Burkitt lymphoma cells were transduced with lentlvirus and established cell lines carrying individual sgRNA. The cells were either untreated or treated with anti-human IgG to induce lytic replication. EBV ZTA expression level was monitored in cells that were either untreated or treated with anti-human IgG to induce lytic replication. Interestingly, even without lytic trigger, it was found that ZTA is induced in cells carrying sgRNAs sg-1 to sg-6, sg-8 to sg-10 (FIG. 2A, ZTA blot, lanes 3, 5, 7, 9, 1 1 , 13, 17, 19, and 21 ). ZTA was not induced in cells carrying control sg-NC and sg-7 (FIG. 2A, ZTA blot, lanes 1 and 15). Because EBV protein kinase BGLF4 is the protein responsive for the phosphorylation of anti-viral nucleoside analogs, Its expression was also monitored. Consistent with ZTA expression, BGLF4 was also induced in cells carrying sgRNAs sg-1 to sg-6, and sg-8 to sg-10 (FIG. 2A, BGLF4 blot, lanes 3, 5, 7, 9, 1 1 , 13, 17, 19, and 21 ). The treatment with anti-human IgG induced the expression of ZTA and BGLF4 in all cell lines (FIG. 2 (A), lanes 2, 4, 6, 8, 10, 12, 14 16, 18, 20, and 22).
[00120] To test whether EBV can complete its life cycle triggered by CMER, the relative amount of EBV particles released to the culture media was measured. It was found that the extracellular viral copy numbers were significantly increased in all cells with sgRNAs targeting ZTA promoter, except sg-7 (FIG. 2 (B)). The treatment of cells with anti-human IgG further enhanced viral copy numbers in all except sg-7 expressing cells. These results correlated well with the ZTA and BGLF4 expression. Excitingly, sg-5 triggers the highest viral particle production (90-fold higher than control sg-NC),
followed by sg-9 and sg-1 (FIG. 2 (B)). These results together suggested that EBV can be reactivated by CMER, which provides an opportunity to target EBV for anticancer therapy.
[00121] The strong reactivation of EBV by CMER with most of the sgRNAs in Akata (EBV+) cells suggested that CMER can be applied to other EBV-positive cells. In addition to Akata (EBV+) cells, EBV reactivation by CMER was tested using another Burkitt lymphoma cell line, P3HR1 . Two sgRNAs, sg-1 and sg-5, were selected due to target conservation and reactivation efficiency to establish stable cell lines. Without lytic induction, ZTA and BGLF4 were induced by CMER in cells carrying sg-5 and, to a lesser extent, sg-1 (FIG. 3 (A), lane 7 vs 4 and 1 ). After lytic induction, cells carrying sg-5 displayed highest ZTA and BGLF4 expression (FIG. 3 (A), lanes 8 and 9) while sg-1 -expressing cells had similar ZTA and BGLF4 expression as control cells (FIG. 3 (A), lanes 5 and 6 vs 2 and 3). These results suggest that CMER with sg-5 can trigger the reactivation in P3HR1 cells. To further confirm these results, intracellular EBV DNA copy numbers (FIG. 3 (B)) and extracellular virion-derived DNA copy numbers (FIG. 3 (C)) were measured. Consistently, it was found that EBV copy numbers are much higher in sg-5-expressing P3HR1 cells than the control cells (FIG. 3 (B and C)).
[00122] CMER triggers EBV reactivation in epithelial cells. The process of EBV reactivation involves different signaling pathways in B cells and epithelial cells. To determine whether CMER could promote EBV reactivation in epithelial cancer cells, an EBV-positive gastric cancer cell line SNU-719 was first tested. After lentiviral transduction of SNU-719 cells, it was found that cells carrying sg-1 and sg-5 start to detach from the plate (72 hrs post-lentiviral transduction). Medium was collected for examining extracellular viral copy numbers. The results showed that CMER strongly triggers EBV reactivation 3 days post-lentiviral transduction (FIG. 4 (A)). Therefore, it was initially difficult to establish stable cell line carrying sg-1 and sg-5, as most of the cells failed to attach to the plate when transferred from 6-wells plate to T-25 (72 hrs post-lentiviral transduction). To obtain the cell lines, the cells were cultured until they reached high confluency (17 days for sg-1 and a month for sg-5). EBV gene expression was examined and cells carrying sg-1 and sg-5 but not sg-NC still express ZTA and BGLF4 even without lytic induction (FIG. 4 (B), lanes 4 and 7 vs 1 ). Lytic induction by TPA and sodium butyrate further enhanced ZTA and BGLF4 expression in sg-5-expressing cells, and to a lesser extent, sg-1 -expressing cells (FIG. 4 (B),
lanes 8 and 9 vs 5 and 6 vs 2 and 3). To validate these findings, intracellular EBV DNA copy numbers (FIG. 4 (C)) as well as extracellular virion-derived DNA copy numbers (FIG. 4 (D)) were quantified. These results demonstrated significantly higher EBV copy numbers in SNU-719 cells expressing sg-5 compared to the control cells, regardless of whether lytic induction was present or not (FIG. 4 (C and D)).
[00123] The HK-1 (EBV+) cell line was used to demonstrate the applicability of CMER in nasopharyngeal carcinoma cells. Similar to observations in SNU-719 cells, HK-1 (EBV+) cells exhibited cell death approximately 72 hours after lentivirus transduction, especially when transitioning from a 6-well plate to a T-25 flask. At the 72-hour post- lentiviral transduction, the released EBV copy numbers were examined and significant reactivation from the HK-1 (EBV+) cells by CMER with sg-1 and, more strongly, sg-5 (FIG. 5 (A)) was observed.
[00124] It took around a month to establish a confluent HK-1 (EBV+) cell population with ZTA promoter-targeting sgRNAs, sg-1 and sg-5. After achieving cellular confluence, the cells were induced for reactivation for 24 and 48 hours. Intriguingly, sg-1 and sg-5 expressed high levels of ZTA and BGLF4 compared to sg-NC, irrespective of lytic induction (FIG. 5 (B)). These results were corroborated by measuring intracellular (FIG. 5 (C)) and extracellular (FIG. 5 (D)) viral copy numbers. The consistent findings demonstrated that sg-1 and, more strongly, sg-5 can spontaneously induce EBV reactivation in HK-1 (EBV+) cells and lytic induction further enhanced EBV replication (FIG. 5 (C and D)).
[00125] CMER and GCV treatment selectively kill EBV-infected cells. For all EBV- positive cancer cell lines, CMER with sg-5 consistently induced EBV reactivation regardless of lytic induction. This provides an opportunity to kill EBV infected cells with nucleoside analogs.
[00126] GCV is recognized for its antiviral properties, particularly its ability to inhibit DNA synthesis. GCV enters cells in an inactive state and becomes phosphorylated by viral kinases, including EBV protein kinase BGLF4. Given the observations of active BGLF4 expression by CMER with sg-5 (FIGS. 2 (A), 3 (A), 4 (B), and 5 (B)), it was then determined whether cells that have undergone EBV reactivation will be susceptible to GCV-induced cell death.
[00127] First, lentiviruses containing dCas9-VP64 with sg-NC or sg-5 were used to transduce Akata (EBV+) cells and then cultured the cells for 2 days. Subsequently, the cells were treated with puromycin and vehicle (DMSO) or GCV for 7 days. Notably,
cells treated DMSO displayed comparable viability between sg-NC and sg-5. Remarkably, when the cells were treated with GCV, sg-NC-carrying cells exhibited 40% viable cells, while sg-5-carrying cells almost died out (less than 1 % viable cells) (FIG. 6 (A)).
[00128] To rule out the potential off-target effects of sg-5 in inducing cell death, lentiviruses containing dCas9-VP64 with sg-NC or sg-5 were employed to transduce Akata (EBV-) cells. These cells were subsequently treated with puromycin and DMSO or GCV for 7 days, and cell viability was assessed. Interestingly, no differences in viability were observed between the sg-NC- and sg-5-expressing cells treated with GCV (FIG. 6 (B)). These findings strongly suggest that the combination of CMER and GCV has the potential to selectively eliminate EBV-positive cells, leaving EBV- negative cells unaffected.
[00129] To further demonstrate the utility of CMER and GCV combination in killing other EBV-positive B cells P3HR1 (EBV+) cells were transduced with lentiviruses containing dCas9-VP64 with sg-NC or sg-5. Similarly, these P3HR1 cells were treated with GCV for a longer time (13 days) to observe cell killing phenotype. It was noticed that sg-NC-carrying cells exhibited more than 90% viable cells, while sg-5-carrying cells nearly reached extinction (less than 1 % viable cells) (FIG. 6 (C)).
[00130] The promising outcome achieved through the combination of CMER and GCV in eliminating EBV-positive B cells led to exploration of its potential application in EBV- positive epithelial cells. During the course of CMER and GCV treatment for adherent cell lines, it was noticed that dying cells tend to detach from the culture plates. To monitor this process over multiple cell passages, a live cell counting approach was adopted. Notably, in the case of EBV-positive SNU-719 gastric cancer cells, it was observed that sg-5-espressing cells grew much slower than sg-NC-expressing cells when treated with the vehicle (DMSO). The addition of GCV resulted in the elimination of sg-5-expressing cells within 7 days of treatment (FIG. 6 (D)). Similarly, the application of CMER and GCV to HK-1 (EBV+) nasopharyngeal cells led to the eradication of sg-5-expressing cells within 10 days of treatment (FIG. 6 (E)).
[00131] In addition to lentiviral transduction, a transient transfection-based method was evaluated to determine if EBV could be reactivated in that manner. Two plasmids were created for the transient transfection assay, namely pAC152-dual-dCas9VP64- sg-NC and pAC152-dual-dCas9VP64-sg-5. SNU-719 (EBV+) cells were selected to test the reactivation by CMER because those cells can be transfected with high
efficiency. The cells were transfected with different amount of the plasmids and it was found that EBV is strongly reactivated at 48h post transfection at a higher amount of the sg-5 plasmid (FIG. 7 (A and B)). It was also observed that the transfection of pAC152-dual-dCas9VP64-sg-5 and subsequent treatment with GCV kills SNU-719 (EBV+) cells (FIG. 7 (C)). These results suggest that CRISPR/dCas9-VP64 can be delivered into cells via multiple methods to trigger EBV reactivation.
[00132] There were around 1 % of GCV-treated sg-5 containing cells surviving at the end of our study (FIGS. 6 and 7). There are several possibilities: first, those cells may eventually die after a longer incubation time. Second, these cells are resistant to GCV, which could be a concern for therapy. Third, there are small portion of EBV-negative cells that cannot be killed.
[00133] Although the combination of CMER and GCV can kill EBV-positive cells, it was a mystery that CMER itself cannot completely kill EBV-positive cells. To address this question, immunofluorescence experiments were performed targeting ZTA (CRISPR/dCas9 target gene product) and gp350 (late protein) (FIG. 8). It was determined that both Akata (EBV+) cells (FIG. 8 (B and D)) and SNU-719 (EBV+) cells (FIG. 8 (F and H)) are reactivated by CRISPR/dCas9-sgRNA-5 with 100% efficiency while most of the cells are still viable at the time of the experiment. Based on these results, it was reasoned that cancer cells may tolerate viral reactivation and replication. This also explains why GCV is needed to completely kill EBV-positive cells.
[00134] This study suggested that CMER can trigger ZTA protein expression and EBV reactivation (FIGS. 2-5). To test whether other lytic genes and latent genes are regulated by CMER, levels of RTA (IE protein), p18 (late protein) and EBNA1 (latent protein) were monitored by WB using Akata (EBV+) and SNU-719 (EBV+) cells. It was observed that all these proteins were upregulated by CMER with sg-1 or sg-5 (FIGS. 9A and 9D). We also measured the mRNA levels of several lytic and latent genes by reverse transcription (RT)-qPCR. It was found that all these genes were upregulated by CMER with sg-1 and, more strongly, sg-5 regardless of cell types (FIGS. 9B, 9C, 9E, and 9F). These results suggestion that both latent and lytic genes are upregulated by CMER.
[00135] Together, this study showed that CMER and GCV combination can selectively kill EBV-infected cancer cells regardless of cell type. In epithelial cells, CMER itself can lead to partial cell death due to strong lytic induction efficiency (FIG. 10).
[00136] Since its application to edit mammalian genome in 2013, the CRISPR/Cas9 technology has demonstrated remarkable potential across various fields. For example, CRISPR/Cas9 gene editing has been used to treat sickle cell disease (SCD) and transfusion-dependent [3-thalassemia (TDT). The autologous CD34+ cells were edited with CRISPR-Cas9 targeting the BCL1 1 A enhancer to de-repress fetal hemoglobin expression. Ongoing clinical trials were initiated to evaluate the utility of this approach in treating SCD and TDT (ClinicalTrials.gov identifiers: NCT03655678 for TDD and NCT03745287 for SCD). On December 8, 2023, U.S. Food and Drug Administration (FDA) approved Casgevy and Lyfgenia as the first therapies utilizing CRISPR/Cas9 to treat SCD in patients 12 years of age and older. Recently, in vivo CRISPR-based therapeutic strategy, EBT-101 , was used to treat HIV-1 infections in clinical trials (ClinicalTrials.gov identifiers: NCT05144386 for Phase 1/2 trial and NCT05143307 for long-term follow up). This strategy utilizes an adeno-associated virus serotype 9 (AAV9) for intravenous (IV) administration to deliver CRISPR-Cas9 and guide RNAs, enabling a cleavage of multiple sites within the HIV-1 genome. This strategy facilitates the removal of substantial segments from the HIV-1 genome, reducing the likelihood of viral evasion.
[00137] In addition to CRISPR/Cas9-mediated gene editing, CRISPR/dCas9 fused with activator or repressor can be used to enhance or repress gene expression, respectively (Wang LW, etal. 2018. Modulating Gene Expression in Epstein-Barr Virus (EBV)-Positive B Cell Lines with CRISPRa and CRISPRi. Curr Protoc Mol Biol 121 :31 .13.1 -31 .13.18). In this study, a CMER strategy was developed by harnessing a CRISPR/dCas9-VP64-mediated gene activation approach to induce EBV reactivation. Remarkably, it was demonstrated that CMER with sg-5 can strongly reactivate EBV by enhancing ZTA expression, even though the number of EBV episome varies and the viral genomes are organized differently in B cells and epithelial cells (FIGS. 2-5). Previously, CRISPR/dCas9 synergistic activation mediator (SAM) was used to induce reactivation of HIV-1 latent reservoirs (Zhang Y, et al. 2015. CRISPR/gRNA-directed synergistic activation mediator (SAM) induces specific, persistent, and robust reactivation of the HIV-1 latent reservoirs. Sci Rep 5:16277) with rare off-target effects (Zhang Y, et al. 2018. Comprehensive off-target analysis of dCas9-SAM-mediated HIV reactivation via long noncoding RNA and mRNA profiling. BMC Med Genomics 1 1 :78). dCas9-fused to a destabilization domain and 12 copies of the VP16 activation domain (VP192) targeting KSHV ORF50 promoter also
triggered an efficient KSHV lytic replication (Elbasani E, et al. Kaposi's Sarcoma- Associated Herpesvirus Reactivation by Targeting of a dCas9-Based Transcription Activator to the ORF50 Promoter. Viruses. 2020 Aug 27;12(9):952) (24). These findings together with our results suggested that CRISPR activation system can be utilized to reactivate latent viruses with therapeutic potentials.
[00138] EBV reactivation is accompanied by caspase activation and subsequent cell death. This explains the rapid decline of SNU-719 (EBV+) and HK-1 (EBV+) cells shortly after lentivirus infection, coupled with the substantial release of extracellular EBV particles into the culture media (FIGS. 4 and 5). Additionally, it was observed that spontaneous EBV reactivation also results in elevated expression of viral protein kinase BGLF4 (FIGS. 2-5). BGFL4 is the major kinase responsible for GCV phosphorylation (Meng Q, et al. 2010. The Epstein-Barr virus (EBV)-encoded protein kinase, EBV-PK, but not the thymidine kinase (EBV-TK), is required for ganciclovir and acyclovir inhibition of lytic viral production. J Virol 84:4534-42). Phosphorylated GCV not only inhibits viral DNA replication but also cellular DNA replication, which leads to cell death (Westphal EM, et al. 1999. Induction of lytic Epstein-Barr virus (EBV) infection in EBV-associated malignancies using adenovirus vectors in vitro and in vivo. Cancer Res 59:1485-91 ). Motivated by this idea, we conducted a cell killing assay combining CMER and GCV. Excitingly, we found that CMER and GCV combination kills EBV-positive Burkitt lymphoma cells without affecting cells without EBV (FIG. 6A- C). In addition to EBV-positive Burkitt lymphoma cells, it was also demonstrated that CMER and GCV combination kills EBV-positive gastric cancer and nasopharyngeal carcinoma cells (FIGS. 6D-E and 7).
[00139] A previous study from the Quake group utilized CRISPR/Cas9 approach to target EBV latent genome (Wang J, Quake SR. 2014. RNA-guided endonuclease provides a therapeutic strategy to cure latent herpesviridae infection. Proc Natl Acad Sci U S A 1 11 :13157-62). EBV-positive cells will undergo apoptosis if a large part of the EBV genome is deleted by CRISPR/Cas9. However, EBV-positive cancer cells contain multiple episomes [20-50 copies in Burkitt lymphoma cells and around 800 copies in EBV-positive gastric cancer cells, including SNU-719]. Therefore, it is very challenging, if ever possible, to completely edit all EBV genomes. In contrast, the study described herein takes advantage of EBV genomes in the cancer cells and utilizes CRISPR/dCas9 activation system to target the ZTA promoter and reactivate EBV. Hence, a higher number of EBV genomes per cell makes them more susceptible to
targeting by CRISPR/dCas9. Indeed, immunofluorescence analysis (FIG. 8) demonstrated that CMER with sgRNA-5 reaches 100% reactivation efficiency.
[00140] Although CMER showed partial killing activity, it could not kill all the cells by itself. Because CMER reactivates EBV with 100% efficiency while most of the cells are still viable, it was reasoned that cancer cells may tolerate viral reactivation and replication. This explains why GCV was needed to completely kill EBV-positive cells. [00141] Lytic induction by IgG-crosslinking of B cell receptors or TPA/sodium butyrate promotes EBV reactivation and cell death. However, it has been shown that the cell death is likely compounded by the lytic triggers, which promote caspase activation. In addition to lytic genes (FIGS. 9B and 9E)., we also found that all latent genes are higher in cells carrying CRISPR/dCas9-VP64-sg1 and -sg5 (FIGS. 9C and 9F). Some latent genes, e.g., LMP1 and EBNA1 , also have been seen to contribute to EBV lytic replication process. The contribution of other latent genes in lytic replication remains to be defined.
[00142] Because CMER does not target EBV-negative cells, it will have less adverse effects compared to chemotherapy drugs as lytic inducing agents. The described strategy also has unique advantages compared to a previous method by overexpressing EBV IE genes (ZTA and RTA) as only EBV-positive cells will respond to CMER and express EBV IE genes.
[00143] In summary, CMER provides a novel way to reactivate EBV with 100% efficiency without the need for other lytic-inducing agents. It will be interesting to test the percentage of the released viruses triggered by CMER that are infectious in the future. This not only provides a novel method to generate viruses from diverse sources for assessing EBV vaccine candidates but also, when combined with nucleoside analogs, lays a foundation for applications of the CRISPR/dCas9 activation system in clinical settings (FIG. 10). For delivering CRISPR/dCas9 in vivo, various vectors like adenoviral vectors, adeno-associated viral vectors, and lentiviral vectors could be employed (Asmamaw Mengstie M., 2022. Viral Vectors for the in Vivo Delivery of CRISPR Components: Advances and Challenges. Front Bioeng Biotechnol 10:895713). Adenoviral vectors have been used to deliver EBV ZTA and RTA with anti-tumor effects (Feng WH, et al. 2002. Use of adenovirus vectors expressing Epstein-Barr virus (EBV) immediate-early protein BZLF1 or BRLF1 to treat EBV- positive tumors. J Virol 76:10951 -9). The delivery of Cas9 protein through non-
integrating lentiviral vectors have been used in treating SCD (Uchida N, et al. 2021. Cas9 protein delivery non-integrating lentiviral vectors for gene correction in sickle cell disease. Mol Ther Methods Clin Dev 21 :121 -132). A thorough assessment of the advantages and limitations of viral vectors may be performed. Factors such as cell tropism, packaging capability, potential for viral integration into the host genome, and pre-existing immunities in the target population may be evaluated to ensure the selection of the most suitable vector for achieving the desired therapeutic outcomes while minimizing potential risks and complications.
Material and Methods
[00144] Cell Culture and Transfection. Akata (EBV+), Akata (EBV-), HK-1 (EBV+), SNU-719, and P3HR-1 cells were cultured in Roswell Park Memorial Institute medium (RPMI 1640) supplemented with 10% FBS (catalog no. 26140079, Thermo Fisher Scientific) at 37 °C in a humidified 5% CO2 incubator. HK1 cells with the EBV recombinant Akata strain (courtesy of Dr. George Tsao, Hong Kong University) were supplemented with 800 pg/mL G418 in the culture medium. HEK293T cells were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FBS in 5% CO2 at 37 QC. To transfect plasmid DNA into the HEK293T cells, Lipofectamine 2000 was used following the manufacturer protocols (catalog no. 1 1668019, Life Technologies).
[00145] Generation of DNA Constructs and Lentiviruses. 10 single guide RNAs (sgRNAs) targeting ZTA/BZLF1 promoter were designed using CHOPCHOP (chopchop.cbu.uib.no/) and the primers were synthesized by Invitrogen. These 10 sgRNAs were cloned into the pLentiV2-dCas9-VP64 vector (gifts from Igor Ulitsky; Addgene: 141104). Escherichia coll Stbl3 stain was used to amply the plasmids. Purified plasmids were co-transfected with psPAX2 and pMD2G (Addgene: 12259 and 12260) into HEK293T for 48 hours to generate the lentivirus.
[00146] The sgRNA primers for cloning are: sg-1 F: 5’-caccgaaaccatgacatcacagagg- 3’ (SEQ ID NO: 1 ); sg1 -R: 5’-aaaccctctgtgatgtcatggtttc-3’ (SEQ ID NO: 2); sg-2F: 5’- caccgtaaatttaggtgtgtctctg-3’ (SEQ ID NO: 3); sg2-R: 5’-aaaccagagacacacctaaatttac-3’ (SEQ ID NO: 4); sg-3F: 5’-caccgaggcacattagcaatgcctg-3’ (SEQ ID NO: 5); sg3-R: 5’- aaaccaggcattgctaatgtgcctc-3’ (SEQ ID NO: 6); sg-4F: 5’-caccgtgcatagtttccaaaagagg- 3’ (SEQ ID NO: 7); sg4-R: 5’-aaaccctcttttggaaactatgcac-3’ (SEQ ID NO: 8); sg-5F: 5’- caccgatgccatgcatatttcaact-3’ (SEQ ID NO: 9); sg5-R: 5’-aaacagttgaaatatgcatggcatc-3’ (SEQ ID NO: 10); sg-6F: 5’-caccgcagcccagttgaaatatgca-3’ (SEQ ID NO: 1 1 ); sg6-R:
5’-aaactgcatatttcaactgggctgc-3’ (SEQ ID NO: 12); sg-7F: 5’- caccgcaagatttcattaagttctg-3’ (SEQ ID NO: 13); sg7-R: 5’-aaaccagaacttaatgaaatcttgc- 3’ (SEQ ID NO: 14); sg-8F: 5’-caccgattaagttctggggtcaggg-3 (SEQ ID NO: 15)’; sg8-R: 5’-aaacccctgaccccagaacttaatc-3’ (SEQ ID NO: 16); sg-9F: 5’- caccgtcatgcatagtttccaaaag-3’ (SEQ ID NO: 17); sg9-R: 5’-aaaccttttggaaactatgcatgac- 3’ (SEQ ID NO: 18); sg-10F: 5’-caccgacatctcccctttaaagcca-3’ (SEQ ID NO: 19); and sg10-R: 5’-aaactggctttaaaggggagatgtc-3’ (SEQ ID NO: 20).
[00147] The PGR product target sequences were cloned into the pLentiV2-dCas9- VP64 vector for expression of a sgRNA having the scaffold sequence: 5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC-UUUUUU-3’ (SEQ ID NO: 21 ), with the target sequence at the 3’ end of the gRNA. Table A provides exemplary full gRNA sequences evaluated. The sgRNAs have the overall structure 5’-N-TARGETING SEQUENCE- gRNA scaffold-3’. In the exemplary sgRNAs, N is G and the gRNA is (SEQ ID NO: 21 ).
[00148] Generation of Stable Cell Line. Lentiviruses isolated from HEK293T medium were used to infect the Akata (EBV+), HK-1 (EBV+), SNU-719 and P3HR-1 cells. 48 hours post-transduction, the cells were cultured in the presence of puromycin (2 pg/mL) for cell line establishment.
[00149] Immunoblotting. For cells lysis immunoblotting (Western Blotting, WB), whole cell lysates were separated using 4 to 20% TGX gels (Bio-Rad). The proteins were then transferred to polyvinylidene (PVDF) membranes using a semidry transfer system. Membranes were blocked in 5% milk and probed with primary antibody and horseradish peroxidase-conjugated secondary antibodies.
[00150] Anti-ZTA(BZI ) antibody was purchased from Santa Cruz (catalog no. sc- 53904, Santa Cruz) and Mouse anti-|3-actin antibody was purchased from MP Biomedicals (catalog no. 691001 , MP Biomedicals). Anti-BGLF4 antibody was a gift from Mei-Ru Chen (47). Anti-RTA antibody was from Argene (discontinued). Anti-p18 was purchased from Thermo Fisher (catalog no. PA1 -73003, Thermo Fisher). Anti- EBNA1 (1 EB12) antibody was purchased from Santa Cruz (catalog no. sc-81581 , Santa Cruz).
[00151] Lytic Induction. Akata (EBV+) cells were treated with IgG (1 :200; catalog no. 55087, MP Biomedicals) to induce lytic replication for up to 48 hrs. To induce the EBV lytic cycle in P3HR-1 and SNU-719 cells, the cells were triggered with 12-0- Tetradecanoylphorbol-13-acetate (TPA; 20 ng/ml; catalog no. NC9325685, Fisher
Scientific) and sodium butyrate (3 mM; catalog no. 19137, Millipore) for up to 48 hrs. For HK-1 (EBV+) cells, we used TPA at 40ng/ml and sodium butyrate at 5 mM to trigger EBV reactivation.
[00152] Quantification of EBV Replication. To measure EBV replication, levels of intracellular EBV DNA and virion-associated DNA were determined by quantitative polymerase chain reaction (qPCR). For intracellular EBV DNA, total genomic DNA was extracted using a genomic DNA purification kit (catalog no. A1 120, Promega) according to manufacturer’s instructions. Extracellular viral DNA was extracted and measured as follows. Briefly, the culture medium was treated with RQ1 DNase (catalog no. M6101 , Promega) to remove free DNA at 37 °C for 1 hour. The reaction was then deactivated by RQ1 DNase stop solution, followed by proteinase K and SDS treatment. The DNA was then purified by phenol-chloroform-isoamyl alcohol extraction. The relative viral DNA copy numbers were determined by qPCR using primers to the BALF5 gene. The reference [3-actin gene was used for data normalization.
[00153] Cell Viability Assay. Cells were infected with lentivirus for 48 hours and then selected under puromycin. Concurrently, GCV (10 pg/mL) was added to the culture medium. Fresh medium, puromycin, and GCV were replenished every 48 hours. The cells were harvested at various time points and subjected to the trypan blue exclusion assay (catalog no. 15250-061 ; Gibco).
[00154] For transient transfection assay, sg-NC and sg5 sequences were cloned into pAC152-dual-dCas9VP64-sg Expression vector (Cheng AW, et al. 2013. Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res 23:1 163-71 ) (a gift from Rudolf Jaenisch; addgene: 48238). Escherichia coli DH5a was used to amplify and extract the plasmids. Purified plasmids were transfected to SNU-719 (3x105 cells/mL) that have been grown overnight in RPMI containing 10% FBS using PEI-Max reagent (catalog no. 24765-100, Polysciences). The cells were harvested after 48 h after transfection. Expression of ZTA, RTA, BGLF4, [3-actin were detected using WB. For cell killing assay, after 48h transfection, the culture media were changed with fresh media containing GCV (10 pg/mL) and replenished every 48 hours. The cells were harvested 7 days later and subjected to the trypan blue exclusion assay.
[00155] Immunofluorescence Assay. Akata (EBV+) cells carrying CRISPR/dCas9- VP64-sg-NC and sg-5 were transferred to a 12-well plate containing poly-L-Lysine-
treated coverslip and washed 3 times with PBS. SNU-719 (EBV+) cells carrying CRISPR/dCas9-VP64-sg-NC and sg-5 were grown in UV-sterilized coverslip in a 12-well culture plate. The cells were fixed with cold methanol and washed 3 times with PBS. Cells were permeabilized with 0.5% Triton X-100 for 5 mins and blocked with 3% bovine serum albumin (BSA) for 1 hr at room temperature. The cells were washed 3 times with PBS and then incubated with anti-ZTA mouse monoclonal antibody (1 :500) or anti-EBV MA-gp350/250 mouse antibody (1 :500) (catalog no. MAB8183, Millipore Sigma) overnight at 4 °C. The cells were washed 3 times with PBS and incubated with Alexa Fluor 488-conjugated goat anti-mouse IgG antibody (1 :500) (catalog no. A1 1001 , Invitrogen) for 1 h at room temperature. After washing with PBS for 3 times, the cell nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI, DU082040) and visualized using Nikon AXR microscope.
[00156] RNA isolation and RT-qPCR. Total RNA were extracted by Isolate II RNA minikit (Bioline) and analyzed by RT-qPCR with specific primers for EBV lytic and latent genes: ZTA-F: 5’-aggccagctaactgcctatc-3’ (SEQ ID NO: 43); ZTA-R: 5’- tgattctgggttatgtcgga-3’ (SEQ ID NO: 44); RTA-F: 5’-acactcccggctgtaaattc-3’ (SEQ ID NO: 45); RTA-R: 5’-tggcttggaagactttctga-3’ (SEQ ID NO: 46); BGLF4-F: 5’- ggcaatagaggcgatagagc-3’ (SEQ ID NO: 47); BGLF4-R: 5’-tggtcctgactgattatggg-3’ (SEQ ID NO: 48); BALF5-F: 5’-agtccttcttggctagtctgttgac-3’ (SEQ ID NO: 49); BALF5- R: 5’-ctttggcgcggatcctc-3’ (SEQ ID NO: 50); BMRF1 -F: 5’- cgtgccaatcttgaggtttt-3’ (SEQ ID NO: 51 ); BMRF1 -R: 5’-cacccggggacttttatctt-3’ (SEQ ID NO: 52); BLLF1 -F: 5’- tactgcagtgggcatctctg-3’ (SEQ ID NO: 53); BLLF1 -R: 5’-tatggtggggtggtgtaggt-3’ (SEQ ID NO: 54); EBNA1 -F: 5’-ggacccggcccacaacctg-3’ (SEQ ID NO: 55); EBNA1 -R: 5’- ctcctgcccttcctcaccctcatc-3’ (SEQ ID NO: 56); EBNA3A-F: 5’-ctaatggcctgtcgaatgg-3’ (SEQ ID NO: 57); EBNA3A-R: 5’-tttcagcgcatcgacaca-3’ (SEQ ID NO: 58); EBNA3B-F: 5’-ggatcgtcaccaccattgt-3’ (SEQ ID NO: 59); EBNA3B-R: 5’-ggtgggatctgagcctattt-3’ (SEQ ID NO: 60); EBNA3C-F: 5’-ggcacattgtcttccgtgtc-3’ (SEQ ID NO: 61 ); EBNA3C- R: 5’-tacagactaccggcgagcat-3’ (SEQ ID NO: 62); LMP1 -F: 5’- tcctcctcttggggctactg-3’ (SEQ ID NO: 63); and LMP-R: 5’-tcatcactgtgtcgttgtcc-3’ (SEQ ID NO: 64).
[00157] Quantification and Statistics. Statistical analysis employed a two-tailed Student’s t-test using Microsoft Excel software for comparison of two groups. A p- value less than 0.05 was considered statistically significant.
[00158] Having described this invention, it will be understood to those of ordinary skill in the art that the same can be performed within a wide and equivalent range of conditions, formulations and other parameters without affecting the scope of the invention or any embodiment thereof.
Claims
1. A method of killing an EBV-positive cell, comprising inducing expression of an EBV immediate early (IE) gene in the EBV-positive cell by introducing into the cells a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to a promoter region of the EBV IE gene, and a corresponding noncleaving Cas (dCas) transcriptional activator in an amount effective to induce expression of the IE gene in the cell, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in the cell to the promoter region.
2. The method of claim 1 , wherein the cell is an EBV-positive cancer cell.
3. The method of claim 1 or 2, in which the cell is a cell in a patient, and the CRISPR guide RNA and a corresponding Cas protein are administered to the patient in an amount effective to kill the EBV-positive cell in the patient.
4. The method of any one of claims 1 -3, further comprising administering an amount of an anti-EBV nucleoside analog drug to the cell in an amount effective to kill the EBV-positive cell.
5. The method of claim 4, wherein the anti-EBV nucleoside analog drug is acyclovir, pencyclovir, ganciclovir, or fialuridine (FIAU, e.g., [131 I]FIAU).
6. The method of any one of claims 1 -5, wherein the guide RNA comprises a targeting sequence of a promoter of an EBV IE gene that causes activation of latent EBV infection.
7. The method of claim 6, wherein the guide RNA comprises a target sequence of an EBV ZTA/BZLF1 promoter such that when bound to an EBV genome in a cell, the gRNA complexes with its corresponding Cas protein and activates expression of the ZTA gene.
8. The method of claim 7, wherein the guide RNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
9. The method of claim 7, wherein the guide RNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
10. The method of claim 7, wherein the gRNA comprises a guide target sequence selected from SEQ ID NOS: 33-42.
1 1. The method of claim 7, wherein the gRNA is selected from SEQ ID NOS: 22-31.
12. The method of any one of claims 1 -10, wherein the guide scaffold of the guide RNA comprises a CAS9 gRNA guide scaffold and the corresponding Gas protein is dCas9.
13. The method of claim 12, wherein the CAS9 gRNA guide scaffold has the sequence:
5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU-3’ (SEQ ID NO: 21 ).
14. The method of any one of claims 1 -1 1 , wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT -3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
15. The method of any one of claims 1 -11 , wherein the gRNA comprises the sequence: 5’-AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
16. The method of claim 1 , wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUU-3’ (SEQ ID NO 26).
17. The method of any one of claims 1 -16, wherein the dCas transcriptional activator is a non-cleaving Cas9-VP64 (dCas9-VP64) protein.
18. The method of any one of claims 1 -17, wherein the gRNA and dCas transcriptional activator are delivered to the cell as one or two nucleic acids comprising genes for expressing the gRNA and the dCas transcriptional activator where the genes for expressing the gRNA and the dCas transcriptional activator are provided together on one nucleic acid, or separately in two nucleic acids.
19. The method of any one of claims 1 -17, wherein the dCas transcriptional activator is delivered to the cell as a nucleic acid comprising a gene for expressing the dCas transcriptional activator and the gRNA is delivered to the cell directly.
20. The method of claim 18 or 19, wherein the nucleic acid(s) are delivered into the cell by transfection with a nanoparticle.
21 . The method of claim 18 or 19, wherein the nucleic acid comprising the gene for expressing the dCas transcriptional activator is incorporated into a viral transduction particle or virus-like particle, such as a recombinant adenovirus, adeno- associated virus, lentivirus, or herpesvirus transduction particle.
22. The method of claim 21 , wherein a nucleic acid comprising a gene for expressing the gRNA is incorporated into a viral transduction particle or virus-like
particle, such as a recombinant adenovirus, adeno-associated virus, lentivirus, or herpesvirus transduction particle.
23. The method of claim 22, wherein the genes for expressing the gRNA and the dCas transcriptional activator are provided on a single nucleic acid.
24. The method of any one of claims 1 -23 for treatment of a cancer in a patient, wherein the cells are EBV-positive cancer cells.
25. The method of claim 24, wherein the cancer is an epithelial or B- cell cancer, such as a lymphoma (e.g., Burkitt’s lymphoma), gastric cancer, or nasopharyngeal carcinoma.
26. A nucleic acid comprising a gene for expression of a CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
27. The nucleic acid of claim 26, wherein the gRNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
28. The nucleic acid of claim 27, wherein the gRNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
29. The nucleic acid of claim 26, wherein the gRNA comprises a guide target sequence selected from SEQ ID NOS: 33-42.
30. The nucleic acid of claim 26, wherein the gRNA is selected from SEQ ID NOS: 22-31.
31 . The nucleic acid of any one of claims 26-29, wherein the guide scaffold of the gRNA comprises a CAS9 gRNA guide scaffold.
32. The nucleic acid of claim 31 , wherein the CAS9 gRNA guide scaffold has the sequence:
5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU-3’ (SEQ ID NO: 21 ).
33. The nucleic acid of claim 26, wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT-3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
34. The nucleic acid of claim 26, wherein the gRNA comprises the sequence: 5’-AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
35. The nucleic acid of claim 26, wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUU-3’ (SEQ ID NO: 26).
36. The nucleic acid of any one of claims 26-35, further comprising gene for expressing a non-cleaving Gas (dCas) transcriptional activator, wherein the gRNA and dCas transcriptional activator form a transcription activation complex when bound in a cell to the EBV ZTA/BZLF1 promoter region.
37. The nucleic acid of claim 36, wherein the dCas transcriptional activator is dCas9-VP64.
38. A CRISPR guide RNA (gRNA) comprising a target sequence selected to bind specifically to an EBV ZTA/BZLF1 promoter region.
39. The gRNA of claim 38, wherein the gRNA comprises a guide target sequence binding: from 18-22 consecutive bases of SEQ ID NO: 75; a sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75; or a sequence complementary to the from 18-22 consecutive bases of SEQ ID NO: 75 or the sequence having at least 90% sequence identity with 18-22 consecutive bases of SEQ ID NO: 75.
40. The gRNA of claim 39, wherein the gRNA comprises a guide target sequence binding at least 18 bases of any one of SEQ ID NOS: 65-74 or a sequence complementary thereto.
41. The gRNA of claim 38, wherein the gRNA comprises a guide target sequence selected from SEQ ID NOS: 33-42.
42. The gRNA of claim 38, wherein the gRNA is selected from SEQ ID NOS: 22-31.
43. The gRNA of any one of claims 38-41 , wherein the guide scaffold of the gRNA comprises a CAS9 gRNA guide scaffold.
44. The gRNA of claim 38, wherein the CAS9 gRNA guide scaffold has the sequence:
5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU-3’ (SEQ ID NO: 21 ).
45. The gRNA of claim 38, wherein the gRNA targets at least 18 consecutive bases of 5’-AGTTGAAATATGCATGGCAT-3’ (SEQ ID NO: 69), or a sequence fully complementary thereto.
46. The gRNA of claim 38, comprising the sequence: 5’-
AUGCCAUGCAUAUUUCAACU-3’ (SEQ ID NO: 37) linked to a guide RNA scaffold.
47. The gRNA of claim 38, wherein the gRNA comprises the sequence: 5’-GAUGCCAUGCAUAUUUCAACUGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUU-3’ (SEQ ID NO 26).
48. A nanoparticle, virus particle, or virus-like particle comprising the nucleic acid or gRNA of any one of claims 26-47.
49. A composition comprising the nucleic acid, gRNA, nanoparticle, virus particle, or virus-like particle of any one of claims 26-48, and a pharmaceutically- acceptable excipient.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363586649P | 2023-09-29 | 2023-09-29 | |
| US63/586,649 | 2023-09-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2025072640A1 true WO2025072640A1 (en) | 2025-04-03 |
Family
ID=95202225
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2024/048812 Pending WO2025072640A1 (en) | 2023-09-29 | 2024-09-27 | Targeted eradication of ebv-positive cells by crispr/cas-mediated ebv reactivation |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2025072640A1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018183808A1 (en) * | 2017-03-31 | 2018-10-04 | Agenovir Corporation | Antiviral therapeutic |
| WO2021173977A1 (en) * | 2020-02-28 | 2021-09-02 | The Jackson Laboratory | Activation of lytic genes in cancer cells |
-
2024
- 2024-09-27 WO PCT/US2024/048812 patent/WO2025072640A1/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018183808A1 (en) * | 2017-03-31 | 2018-10-04 | Agenovir Corporation | Antiviral therapeutic |
| WO2021173977A1 (en) * | 2020-02-28 | 2021-09-02 | The Jackson Laboratory | Activation of lytic genes in cancer cells |
Non-Patent Citations (1)
| Title |
|---|
| SUGIOKTO FEBRI GUNAWAN, LI RENFENG: "Targeted eradication of EBV-positive cancer cells by CRISPR/dCas9-mediated EBV reactivation in combination with ganciclovir", MBIO, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 15, no. 7, 1 July 2024 (2024-07-01), US , pages e0079524, XP093297176, ISSN: 2150-7511, DOI: 10.1128/mbio.00795-24 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020200041B2 (en) | Capsid-modified, rAAV3 vector compositions and uses in gene therapy of human liver cancer | |
| Goswami et al. | Gene therapy leaves a vicious cycle | |
| US11034974B2 (en) | Hairpin MRNA elements and methods for the regulation of protein translation | |
| CN112004925B (en) | Hybrid recombinant adeno-associated virus serotypes of AAV9 and AAVrh74 with reduced liver tropism | |
| RU2233333C2 (en) | Viral vectors and their application in genetic therapy | |
| KR20220155981A (en) | Methods and compositions for treating premature stop codon-mediated disorders | |
| US7026154B1 (en) | Method of inactivating enveloped viruses in a viral preparation of non-enveloped viruses | |
| KR20180091863A (en) | Extensible method for producing recombinant adeno-associated virus (AAV) vectors in serum-free suspension cell culture systems suitable for clinical use | |
| JP2017506893A (en) | Viral replication inactivating composition and method for producing and using the same | |
| KR20160026841A (en) | Vectors comprising stuffer/filler polynucleotide sequences and methods of use | |
| US20230235353A1 (en) | Compositions and methods for reducing reverse packaging of cap and rep sequences in recombinant aav | |
| KR20240025507A (en) | Methods and compositions for treating premature stop codon-mediated disorders | |
| WO2014016580A1 (en) | Transgene expression | |
| AU3129400A (en) | Adenovirus vectors and method for reducing homologous recombination phenomena | |
| JP2025148442A (en) | Eradication of herpes simplex virus type 1 and other related human herpesviruses by RNA | |
| Sugiokto et al. | Targeted eradication of EBV-positive cancer cells by CRISPR/dCas9-mediated EBV reactivation in combination with ganciclovir | |
| TW201837173A (en) | shRNA expression cassette, polynucleotide sequence carrying same and application thereof sequentially containing a DNA sequence for expressing shRNA and a filling sequence according to a sequence 5'-3' | |
| Nasimuzzaman et al. | Eradication of Epstein–Barr virus episome and associated inhibition of infected tumor cell growth by adenovirus vector-mediated transduction of dominant-negative EBNA1 | |
| WO2025072640A1 (en) | Targeted eradication of ebv-positive cells by crispr/cas-mediated ebv reactivation | |
| CN115485305A (en) | Activation of lytic genes in cancer cells | |
| US20210363522A1 (en) | Crispr/cas-related methods and compositions targeting virus genomes | |
| Chang et al. | Synthetic biology approach to developing all-in-one baculovirus vector using mammalian introns and miRNA binding sites | |
| Ibrišimović et al. | Combinatorial targeting of 2 different steps in adenoviral DNA replication by herpes simplex virus thymidine kinase and artificial microRNA expression for the inhibition of virus multiplication in the presence of ganciclovir | |
| EP4660308A1 (en) | Helper gene | |
| Kolibius et al. | Genome-replicating HC-AdV: A novel high-capacity adenoviral vector class featuring enhanced in situ payload expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 24873658 Country of ref document: EP Kind code of ref document: A1 |

