WO2025038398A1 - Methods of preventing or treating liver disease - Google Patents
Methods of preventing or treating liver disease Download PDFInfo
- Publication number
- WO2025038398A1 WO2025038398A1 PCT/US2024/041547 US2024041547W WO2025038398A1 WO 2025038398 A1 WO2025038398 A1 WO 2025038398A1 US 2024041547 W US2024041547 W US 2024041547W WO 2025038398 A1 WO2025038398 A1 WO 2025038398A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pnpla3
- subject
- liver
- human
- liver disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/12—Ketones
- A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
- A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline
- A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
- A61K31/355—Tocopherols, e.g. vitamin E
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4164—1,3-Diazoles
- A61K31/4174—Arylalkylimidazoles, e.g. oxymetazolin, naphazoline, miconazole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4412—Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/444—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/50—Pyridazines; Hydrogenated pyridazines
- A61K31/501—Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/04—Sulfur, selenium or tellurium; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/06—Tripeptides
- A61K38/063—Glutathione
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/44—Oxidoreductases (1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y111/00—Oxidoreductases acting on a peroxide as acceptor (1.11)
- C12Y111/01—Peroxidases (1.11.1)
- C12Y111/01009—Glutathione peroxidase (1.11.1.9)
Definitions
- FIELD OF THE DISCLOSURE This relates to the inhibiting of liver disease, specifically to the use of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA) to prevent or treat liver failure in a subject, such as a subject that is homozygous for the rs738409:G mutation in the PNPLA3 gene.
- PDE phosphodiesterase
- TDYA 10,12-tricosadiynoic acid
- MAFLD metabolic-associated fatty liver disease
- DDLT deceased donor liver transplantation
- SUMMARY Methods are disclosed for inhibiting a liver disease in a subject. These methods include administering to the subject an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12- tricosadiynoic acid (TDYA), thereby inhibiting the liver disease in the subject.
- PDE phosphodiesterase
- TDYA 10,12- tricosadiynoic acid
- the PDEIII inhibitor is Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, or a pharmaceutically acceptable salt thereof.
- the subject is at risk of developing a liver disease, and the disclosed method prevents the liver disease.
- the subject has the liver disease, and the disclosed method treats the liver disease.
- Compositions are also disclosed that include an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA), or a pharmaceutically acceptable salt thereof, for use in inhibiting liver disease in a subject. These compositions are of use in any of the methods disclosed herein.
- FIGs.1A-1F Ramifications of the PNPLA3 rs738409 genetic variant in LDLT recipients.
- Human symbols represent 10% prevalence. (FIG.1A).
- N refers to the number of donors or recipients for each genotype (FIG.1C).
- the minor genotype’s survival function is shown in red.
- FIGs.3A-3I Alterations in bile acid metabolism contribute to the production of ER stress.
- FIG.3A Bubble plot showing flux propensity analysis result zoomed on metabolic pathway reactions involved in cholesterol and bile acids synthesis.
- FIGs.4A-4K Alterations in ⁇ -oxidation and bile acid synthesis contribute to the production of reactive oxygen species and ferroptosis. Hypothesizing crosstalk between mitochondria and peroxisomes suggests increased peroxisome ⁇ -oxidation due to reduced mitochondria ⁇ -oxidation in primary human hepatocytes homozygous for the PNPLA3 rs738409:G variant. ⁇ -oxidation in peroxisomes produces reactive oxygen species (FIG.4A). Western blot analysis of ACOX1 intensity was normalized to GAPDH.
- the single-guide RNA (sgRNA) sequence (SEQ ID NO: 4) was designed to cut at the chr22:43,928,854 position to replace the minor allele -G- with the major allele -C- using a donor template.
- Sanger trace sequences of the PNPLA3 genotypes, SEQ ID NO: 5 and SEQ ID NO: 6 (FIG.4C).
- Viability of human hepatoma cell line (HepG2) and gene edited control Heps-PNPLA3-C Cas9 exposed to enoximone (250 ⁇ M) for 24h after ferroptosis induction with FINO2 (20 ⁇ M) for 6h (mean ⁇ SD, ****p ⁇ 0.0001, ANOVA, n 5).
- FIGs 5A-5F Primary human hepatocytes positive for the PNPLA3 rs738409:G variant show signs of ferroptosis. Histological micrographs (Adipophilin 2) of donor livers.
- FIGs.6A-6G Fluorescence micrographs of C11-BODIPYTM lipid peroxidation in human hepatocytes under the presence and absence of DFO (100 ⁇ M) and FINO2 (50 ⁇ M).
- FIG.7 Flow diagram of a clinical approach, illustrating bench and bedside.
- SEQ ID NOs: 1 and 2 are nucleotide sequences of primers.
- SEQ ID NO: 3 is a nucleotide sequence of donor DNA.
- SEQ ID NO: 4 is a gRNA nucleotide sequence shown in FIG.4C.
- SEQ ID NO: 5 is the nucleotide sequence of PNPLA3 rs738409-CC- Sanger trace genotype shown in FIG.4C.
- SEQ ID NO: 6 is the nucleotide sequence of PNPLA3 rs738409-CC- Sanger trace genotype shown in FIG.4C.
- DETAILED DESCRIPTION Genetic variants in lipid metabolism influence the risk of developing metabolic associated fatty liver disease (MAFLD), cirrhosis, and ESLD.
- the mechanisms responsible for generating disease induced by these variants are poorly understood, and their presence could affect post-transplant liver function following liver transplantation.
- the MAFLD-associated genetic variant, PNPLA3 rs738409 was genotyped in ESLD patients and living liver donors and the recipients of these grafts.
- the presence of PNPLA3 rs738409 in donor liver grafts was associated with development of MAFLD and reduced postoperative 5-year survival.
- metabolomic and transcriptomic analysis of human hepatocytes carrying the PNPLA3 rs738409 variant revealed increased peroxisomal ⁇ -oxidation and increased lipid peroxidation driven by elevated levels of bile acids and mitochondrial shrinkage that ultimately led to cell death via ferroptosis.
- a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA) can be used for inhibiting liver disease.
- PDE phosphodiesterase
- TDYA 10,12-tricosadiynoic acid
- an antigen includes singular or plural antigens and can be considered equivalent to the phrase “at least one antigen.”
- the term “comprises” means “includes.” It is further to be understood that any and all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for descriptive purposes, unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described herein. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
- Control A reference standard.
- the control is a negative control sample obtained from a healthy patient.
- the control is a positive control sample obtained from a patient diagnosed with liver disease.
- the control is a historical control or standard reference value or range of values (such as a previously tested control sample, such as a group of patients with known prognosis or outcome, or group of samples that represent baseline or normal values).
- a difference between a test sample and a control can be an increase or conversely a decrease.
- the difference can be a qualitative difference or a quantitative difference, for example a statistically significant difference.
- a difference is an increase or decrease, relative to a control, of at least about 5%, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or greater than 500%.
- End-Stage Liver disease A disease of the liver designated by a Child-Pugh score wherein five clinical measures, levels of total bilirubin, serum albumin, prothrombin time prolongation, ascites, and hepatic encephalopathy, are scored using a point system of 1 point, 2 point, and 3 point values for varying levels of each clinical measure, with 3 point values being assigned to the most severe levels of each measure. The total points for all five measures are added to arrive at a Child-Pugh score and classification. Scores of 5-6 designate Child-Pugh Class A, scores of 7-9 designate Child-Pugh Class B, and scores of 10- 15 designate Child-Pugh Class C.
- Child-Pugh Class A indicates the least severe liver disease and Child-Pugh Class C indicates the most severe liver disease. Accordingly, the method disclosed herein can be used to treat a subject having a Child-Pugh Class B or Child-Pugh Class C liver disease. The method disclosed here in can be used to treat a subject having a Child-Pugh Class A liver disease as well.
- the liver disease includes alcoholic hepatitis and/or or simple accumulation of fat in the hepatocytes (steatosis), macrovescicular steatosis, periportal and lobular inflammation (steatohepatitis), cirrhosis, fibrosis and/or liver ischemia.
- Ferroptosis pathway Ferroptosis is a form of oxidative cell death that is characterized by iron- dependent oxidative damage and subsequent plasma membrane rupture and the release of damage-associated molecular patterns. It is induced by the accumulation of iron-mediated lipid peroxidation. Ferroptotic cells show typical necrotic morphology, such as an incomplete plasma membrane and the release of intracellular contents, especially damage-associated molecular patterns (DAMPs). Due to the role of iron in mediating the production of reactive oxygen species and enzyme activity in lipid peroxidation, ferroptosis is controlled by regulators involved in many aspects of iron metabolism, such as iron uptake, storage, utilization, and efflux.
- DAMPs damage-associated molecular patterns
- Ferroptosis can be caused by the collapse of the glutathione (GSH)-glutathione peroxidase 4 (GPX4) antioxidant systems.
- System xc- is a heterodimeric transmembrane complex composed of light chain, solute carrier family 7 member 11 (SLC7A11/xCT), and heavy chain, solute carrier family 3 member 2 (SLC3A2).
- cystine is quickly reduced to cysteine, which is mainly utilized for the synthesis of GSH.
- GSH is utilized by GPX4, which uses highly nucleophilic selenocysteine to reduce lipid peroxides into lipid alcohols.
- GPX4 e.g., RSL3
- AIFM2 apoptosis-inducing factor mitochondria-associated 2
- ESCRT-III endosomal sorting complex required for transport-III
- An impaired antioxidant system can cause or accelerate lethal lipid peroxidation, which is inhibited by various synthetic antioxidants (e.g., ferrostatin-1 and liproxstatin-1).
- Acyl-CoA synthetase long-chain family member 4 (ACSL4) is a crucial pro-ferroptotic regulator that catalyzes the synthesis of long-chain polyunsaturated CoAs, especially arachidonic acid, thus enriching cellular membranes with PUFA.
- nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOXs), lipoxygenases (ALOXs), and cytochrome P450 oxidoreductase (POR) coupled to cytochrome P450 (CYP) monooxygenases are all involved in the ferroptosis pathway.
- a “component” of the ferroptosis pathway is any enzyme or other protein that plays a role in ferroptosis.
- Glutathione peroxidase 4 (GPX4) A phospholipid hydroperoxidase that protects cells against membrane lipid peroxidation.
- GPX4 belongs to the family of glutathione peroxidases, which consists of eight known mammalian isoenzymes (GPX1–8). GPX4 catalyzes the reduction of hydrogen peroxide, organic hydroperoxides, and lipid peroxides at the expense of reduced glutathione, and functions in the protection of cells against oxidative stress.
- the oxidized form of glutathione (glutathione disulfide), which is generated during the reduction of hydroperoxides by GPX4, is recycled by glutathione reductase and NADPH/H+.
- GPX4 differs from the other GPX family members in terms of its monomeric structure, a less restricted dependence on glutathione as reducing substrate, and the ability to reduce lipid-hydroperoxides inside biological membranes. Inactivation of GPX4 leads to an accumulation of lipid peroxides, resulting in ferroptotic cell death.
- Exemplary GPX4 nucleic acid sequences are provided in GENBANK® Accession Nos. NM_001039847, NM_001039848, NM_001367832, and NM_002085, as available on November 12, 2021.
- Exemplary GPX4 amino acid sequences are provided in GENBANK® Accession Nos.
- Hepatocyte A cell of the main parenchymal tissue of the liver, that make up 70-85% of the mass of the liver.
- the typical hepatocyte is cubical with sides of 20-30 ⁇ m, and produces serum albumin, fibrinogen, and the prothrombin group of clotting factors (except for Factors 3 and 4).
- Hepatocytes also synthesize lipoproteins, ceruloplasmin, transferrin, complement, and glycoproteins.
- a hepatocyte is a normal (non- malignant) cell.
- Effective amount A quantity of a specific substance sufficient to achieve a desired effect in a subject to whom the substance is administered, such as a therapeutically effective amount, for treatment. For instance, this can be the amount of a humanized monoclonal antibody necessary to inhibit tumor growth and/or metastasis, or to measurably alter signs and/or symptoms of a liver disease.
- Fibrosis of the liver Excessive accumulation of extracellular matrix proteins including collagen that occurs in most types of chronic liver diseases. Advanced liver fibrosis results in cirrhosis, liver failure, and portal hypertension and often requires liver transplantation. The main causes of liver fibrosis in industrialized countries include chronic hepatitis infection, alcohol abuse, and nonalcoholic steatohepatitis (NASH).
- NASH nonalcoholic steatohepatitis
- Inhibiting or treating a disease Inhibiting the full development of a disease or condition, for example, in a subject who is at risk for a disease, such as liver disease. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition, such as end stage liver disease, after it has begun to develop.
- the term “ameliorating,” with reference to a disease or pathological condition, refers to any observable beneficial effect of the treatment.
- the beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular disease, such as when the method increases serum albumin, decreases serum ammonia, improve coagulation activity, decreases ascites production, improves neuropsychological status, decreases bilirubin, improves apolipoprotein and/or improves portal vein or systemic blood flow clearance of cholate.
- Treatment may be assessed by objective or subjective parameters; including, but not limited to, the results of a physical examination, imaging, or a blood test.
- a “prophylactic” treatment is a preventative treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology, such as to prevent liver disease.
- Liver cirrhosis A chronic disease of the liver marked by a fibrous thickening of the liver tissue histologically, regenerative nodules.
- Liver disease Diseases and conditions of the liver including liver cirrhosis, alcoholic and non- alcoholic fibrosis as well as to liver disease or changes associated with obesity, diabetes and metabolic syndrome.
- liver diseases include: hepatitis, fatty liver, toxic liver failure, hepatic cirrhosis, diabetes-associated liver disease, liver steatosis, liver fibrosis, liver cirrhosis, chronic hepatitis and the like. Liver disease does not include liver cancer.
- Metabolic dysfunction associated fatty liver disease or Metabolic associated fatty liver disease MAFLD: A common liver disease affecting a quarter of the global population and is often associated with adverse health outcomes. The increasing prevalence of MAFLD occurs in parallel to that of metabolic syndrome (MetS). The MAFLD spectrum ranges from simple steatosis to steatohepatitis and ultimately development of fibrosis and cirrhosis in the long term.
- MAFLD triglycerides
- Nonalcoholic fatty liver disease A condition in which excess fat builds up on the liver that is not caused by alcohol use.
- the two types of NAFLD are nonalcoholic fatty liver (NAFL), where there is little or no inflammation or liver damage, and nonalcoholic steatohepatitis (NASH), in which there is inflammation, which can lead to fibrosis, cirrhosis, scarring and liver cancer.
- Patatin-like phospholipase domain-containing protein 3 (PNPLA3), and rs738409:G mutation:
- the PNPLA3 gene encodes a triacylglycerol lipase that mediates triacylglycerol hydrolysis in adipocytes.
- the highly conserved patatin-like domain of the encoded PNPLA3 protein exhibits lipolytic activity toward triglycerides.
- PNPLA3 which appears to be membrane bound, may be involved in the balance of energy usage/storage in adipocytes.
- PNPLA3 catalyzes coenzyme A (CoA)-dependent acylation of 1-acyl-sn-glycerol 3- phosphate (2-lysophosphatidic acid/LPA) to generate phosphatidic acid (PA), an important metabolic intermediate and precursor for both triglycerides and glycerophospholipids.
- CoA coenzyme A
- LPA phosphatidic acid
- the PNPLA3 rs738409:G variant is also associated with fatty liver and alcoholic liver diseases, as well as fibrosis, histological disease severity, steatosis, and elevated levels of liver enzymes in healthy adults.
- the rs738409 variant is also a risk factor for cirrhosis (Shen et al. J Lipid Res.56(1):167–175, 2015).
- Exemplary HMGCR nucleic acid and amino acid sequences are provided in GENBANK® Accession Nos. NM_025225 and NP_079501, respectively, as available on November 12, 2021.
- Pharmaceutically acceptable carriers The pharmaceutically acceptable carriers useful in the methods and compositions of this disclosure are conventional. Remington’s Pharmaceutical Sciences, by E. W.
- compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed are compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed.
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- solid compositions e.g., powder, pill, tablet, or capsule forms
- conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch or magnesium stearate.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Pharmaceutically acceptable salt A biologically compatible salt of a compound that can be used as an active compound, and are derived from a variety of organic and inorganic counter ions and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, and the like. “Pharmaceutically acceptable acid addition salts” are a subset of “pharmaceutically acceptable salts” that retain the biological effectiveness of the free bases while formed by acid partners.
- the compounds form salts with a variety of pharmaceutically acceptable acids, including, without limitation, inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids such as formic acid, acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, benzene sulfonic acid, isethionic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, xinafoic acid and the like.
- inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like
- “Pharmaceutically acceptable base addition salts” are a subset of “pharmaceutically acceptable salts” that are derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Exemplary salts are the ammonium, potassium, sodium, calcium, and magnesium salts.
- Salts derived from pharmaceutically acceptable organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, tris(hydroxymethyl)aminomethane (Tris), ethanolamine, 2- dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like.
- Tris tris(hydroxymethyl)aminomethane
- ethanolamine 2- dimethylaminoethanol
- Exemplary organic bases are isopropylamine, diethylamine, tris(hydroxymethyl)aminomethane (Tris), ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
- Tris tris(hydroxymethyl)aminomethane
- the compounds may be a formate, trifluoroactate, hydrochloride or sodium salt.
- Pharmaceutical agent A chemical compound or composition, including a nucleic acid molecule, capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject or a cell.
- PDE Phosphodiesterase
- cAMP cyclic adenosine monophosphate
- cGMP cyclic guanosine monophosphate
- PDEIII isoforms are structurally similar, and have similar pharmacological and kinetic properties, but the distinction is in expression profiles and affinity for cGMP.
- a “PDEIII inhibitor” is specific for PDEIII, and reduces the activity of PDEIII, such that there is a significant reduction in the production of AMP and/or GMP.
- PDEIII inhibitors include Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, and pharmaceutically acceptable salts thereof.
- Subject Human and non-human animals, including all vertebrates, such as mammals and non- mammals, such as non-human primates, mice, rabbits, sheep, dogs, cats, horses, cows, chickens, amphibians, and reptiles.
- the subject is a human.
- Phosphodiesterase (PDE) III Inhibitors and TDYA PDEs are a class of intracellular enzymes involved in the metabolism of the second messenger nucleotides, cyclic adenosine monophosphate (cAMP), and cyclic guanosine monophosphate (cGMP).
- cAMP cyclic adenosine monophosphate
- cGMP cyclic guanosine monophosphate
- Numerous phosphodiesterase inhibitors have therapeutic uses, including treatment of obstructive lung disease, allergies, hypertension, angina, congestive heart failure, and depression.
- the presently disclosed methods utilize inhibitors of PDE-III to treat liver disease, such as ESLD and MAFLD.
- Enoximone (1,3-Dihydro-4-methyl-5-[4-(methylthio)benzoyl]-2H-imidazol-2-one) is a small organic molecule that inhibits phosphodiesterase type III (PDE-III), both against the cAMP and cGMP conversion reactions. Enoximone also causes vasodilation, an increase in the diameter of blood vessels, through its effects on smooth muscle cells that surround blood vessels, which results in lower pressure against which the heart must pump. Enoximone can be administered at dosages of 50 mg to 150 mg, up to three times a day.
- PERFAN I.V.TM is an intravenous formulation of enoximone. Clinical studies supporting the use of PERFAN I.V.TM were completed in the late 1980s, and the drug was first approved in Europe in 1989. PERFAN I.V.TM is used in a hospital setting to treat patients with acute decompensated heart failure (Classes III and IV) and to wean patients from cardiopulmonary bypass following open-heart surgery.
- Enoximone can be prepared according to the following method (U.S. Published Application No. 2006/0292213). A solution of 25.0 g of 4-(methylthio)-benzoic acid and 22 ml of thionyl chloride in 50 ml of benzene is refluxed for 4 hrs. Excess reagent and solvent is evaporated and the residue is azeotroped 3 times with benzene to remove all thionyl chloride.
- Enoximone can also be administered orally, see U.S. Published Application No.2006/029221, which discloses micronized forms of enoximone and their use in treating cardiac disease.
- Enoximone is available as a 100mg/20 ml concentrate solution for injection.
- Perfan is also available as a 5mg/ml concentrate for solution for injection or infusion, and is diluted 1:1 with either 0.9% sodium chloride injection or water for injection before administration.
- a loading dose can be administered of 0.5mg/kg initially at a rate not greater than 12.5mg/min. This dose may be repeated in 30 minutes. the maintenance dose can be given as an infusion, 2.5 to 5 ⁇ g/kg/minute following the loading dose.
- a loading dose can be administered of 0.05-5mg/kg initially.
- the maintenance dose can be given as an infusion, 0.25 to 50 ⁇ g/kg/minute following the loading dose.
- Intermediate ranges are also of use.
- Amrinone also known as imamrinone, is a pyridine PDEIII inhibitor. The drug inhibits the breakdown of both cAMP and cGMP which increases cardiac output; thus, amrinone can be used to treat short-term congestive heart failure. Lesher and Opalka U.S.
- Patent No.4,004,012 shows the synthesis of amrinone and its use as a cardiotonic agent.
- Amrinone is sold as an injectable solution of 5 mg/ML. In aspects, it is administered as an intravenous bolus at 0.75 mg.kg over two to three minutes, and then 5-10 mcg/kg/min intravenously.
- the therapeutic dosage range is about 0.5 to about 7 mcg/mL. in other aspects, the dosage can be reduced or increased by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10-fold.
- the therapeutic dosage range is 0.05 to about 70 mcg/mL, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60 or 70 mcg/mL. inhibitor, approved for use in an oral formulation for treating symptoms of intermittent claudication in peripheral vascular disease.
- Pimobendan is provided as an oral medication. In aspects, it is used at doses of 0.2 mg to 0.6 mg pimobendan/kg body weight, divided into two daily doses.
- 10,12-tricosadiynoic acid (TDYA) is s a highly specific, selective, high affinity and orally active acyl- CoA oxidase-1 (ACOX1) inhibitor.
- TDYA is used to treat high fat diet- or obesity-induced metabolic diseases.
- the dosage can be used at oral doses of 37.5 mg/kg, 75 mg/kg, and 150 mg/kg. In other aspects, the dosage can be reduced or increased by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 fold. In further aspects, the therapeutic dosage is 3.75 mg/kg, 7.5 mg/kg, 15 mg/kg, 375 mg/kg, 750 mg/kg, or 1500 mg/kg, or any range between these values.
- TDYA is shown below: These PDEIII inhibitors, TDYA, and pharmaceutically acceptable salts thereof, are of use in the disclosed methods.
- references to compounds also include the pharmaceutically acceptable salts, as well as alternative pharmaceutical compositions comprising metabolites or purified enantiomers of metabolites or the pharmaceutical itself (for example, enoximone which is metabolically converted to a sulfoxide metabolite that is chiral, and thus the S or R enantiomer of that sulfoxide could be used in a pharmaceutical preparation).
- pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
- Formulations can be an oral suspension in either the solid or liquid form.
- the liquid forms can be used as infusions.
- the formulation can be prepared for delivery via parenteral delivery, or used as a suppository, or be formulated for subcutaneous, intravenous, intramuscular, intraperitoneal, sublingual, transdermal, or nasopharyngeal delivery.
- the pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
- compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
- Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients, which are suitable for the manufacture of tablets.
- excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc.
- the tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
- a time delay material such as glyceryl monostearate or glyceryl distearate may be employed.
- Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
- Aqueous suspensions contain an active material in admixture with excipients suitable for the manufacture of aqueous suspensions.
- excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxy-propylmethycellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene-oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate.
- dispersing or wetting agents may be a naturally-occurring phosphatide, for example lec
- the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl, p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
- Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
- the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation.
- compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
- Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
- Pharmaceutical compositions may also be in the form of oil-in-water emulsions.
- the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
- Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
- the emulsions may also contain sweetening and flavoring agents. Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative and flavoring and coloring agents.
- compositions may be in the form of a sterile injectable aqueous or oleaginous suspension.
- Suspensions may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
- the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
- acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil may be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid find use in the preparation of injectables.
- PDEIII inhibitors and TDYA may also be administered in the form of suppositories for rectal administration of the drug.
- These compositions can be prepared by mixing a therapeutic agent with a suitable non-irritating excipient which is solid at ordinary temperatures, but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
- a suitable non-irritating excipient which is solid at ordinary temperatures, but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
- Such materials are cocoa butter and polyethylene glycols.
- Formulations may also be administered as nanoparticles, liposomes, granules, inhalants, nasal solutions, or intravenous admixtures.
- compositions including a PDEIII inhibitor and/or TYDA can be formulated for injection, such as for intrahepatic or intravenous administration.
- Such compositions are formulated generally by mixing a PDEIII inhibiotr, or a pharmaceutically accceptble salt therof, at the desired degree of purity in a unit dosage injectable form (solution, suspension, or emulsion) with a pharmaceutically acceptable carrier, for example, one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- Pharmaceutical compositions can include an effective amount of the PDEIII inhibitor (for example, dissolved or suspended) and/or TYDA in a pharmaceutically acceptable carrier or excipient.
- compositions usually contain injectable fluids that include pharmaceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like, as a vehicle.
- compositions to be administered can contain minor amounts of non- toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate.
- a PDEIII inhibitor, or pharmaceutically acceptable salt thereof can be suspended in an aqueous carrier, for example, in an isotonic or hypotonic buffer solution at a pH of about 3.0 to about 8.5, such as about 4.0 to about 8.0, about 6.5 to about 8.5, or about 7.4.
- Useful buffers include saline-buffered phosphate or an ionic boric acid buffer.
- the active ingredient can also be in the form of a lyophilisate and can be made into a solution prior to administration by the addition of suitable solvents.
- suitable solvents include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well-known in the art.
- Supplementary active ingredients also can be incorporated into the compositions.
- certain pharmaceutical compositions can include the vectors or viruses in water, mixed with a suitable surfactant, such as hydroxy-propylcellulose.
- Dispersions also can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof as well as in oils.
- these preparations contain a preservative to prevent the growth of microorganisms.
- Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
- auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
- the amount of active ingredient in any formulation may vary to produce a dosage form that will depend on the particular treatment and mode of administration.
- doses are typically not less than an amount required to produce a measurable effect on the subject and may be determined based on the pharmacokinetics and pharmacology of the subject composition or its by-products, and thus based on the disposition of the composition within the subject. This includes consideration of the route of administration as well as dosage amount, which can be adjusted for intraveinous or intrahepatic applications.
- Effective amounts of dose and/or dose regimen can readily be determined empirically from preclinical assays, from safety and escalation and dose range trials, individual clinician-patient relationships, as well as in vitro and in vivo assays.
- IV. Methods of Treatment Methods are disclosed for inhibiting a liver disease in a subject. These methods include administering to the subject an effective amount of a PDE III inhibitor or TDYA, thereby inhibiting the liver disease in the subject.
- the PDEIII inhibitor is Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, or a pharmaceutically acceptable salt thereof.
- the subject is at risk of developing a liver disease, and the disclosed method prevents the liver disease.
- the subject has the liver disease, and the disclosed method treats the liver disease.
- the liver disease is as ESLD.
- the liver disease is MAFLD.
- the liver disease is fibrosis of the liver, cirrhosis, or nonalcoholic fatty liver disease (NALFD).
- NALFD nonalcoholic fatty liver disease
- the liver disease is inflammatory metabolic dysfunction-associated steatohepatitis.
- the compositions of the invention are particularly useful for treating a subject (e.g., a mammalian subject, e.g., human, child or adult) with end stage liver disease, metabolic associated fatty liver disease, fibrosis of the liver, cirrhosis, nonalcoholic fatty liver disease, or inflammatory metabolic dysfunction-associated steatohepatitis.
- the subject can have liver failure as a result of cirrhosis.
- the subject can have cirrhosis resulting from alcohol-related liver disease.
- the subject can have a disease that destroys bile ducts (such as biliary cirrhosis).
- the subject can have a genetic abnormality, such as cystic fibrosis, alpha-1 antitrypsin deficiency, hemochromatosis, Wilson disease, galactosemia, or a glycogen storage disease.
- the subject can have liver failure as a result of an exposure, such as to a drug or toxic chemical.
- the subject can have a parasitic infection that results in liver failure. Any of these subjects can be selected for treatment.
- the subject can have cirrhosis.
- the subject can have alcoholic liver cirrhosis, or liver cirrhosis caused by chronic infection after acute inflammation of the liver or immunological liver diseases characterized by chronic inflammation.
- the subject is an alcoholic or a recovering alcoholic.
- the development of cirrhosis hepatitis is preceded by a state of increasing accumulation of fat in the liver (steatosis hepatitis). This state is reversible and the liver can be normalized if consumption of alcohol is terminated. However, if the abuse goes on then the liver tissue will gradually be transformed to connective tissue which leads to badly working liver tissue and consequently reduced function of the liver.
- Chronic liver disease refers to diseases of the liver that last over a period of six months. These subjects can be selected for treatment.
- Chronic liver disease includes of a wide range of liver pathologies which include inflammation (chronic hepatitis), liver cirrhosis, and hepatocellular carcinoma.
- Alcoholic liver disease (ALD) typically occurs after years of heavy drinking. Over time, scarring and cirrhosis can occur.
- Cirrhosis is the final phase of alcoholic liver disease. There may be no symptoms, or symptoms may come on slowly, depending on how well the liver is working. Symptoms tend to be worse after a period of heavy drinking. Early symptoms include: fatigue and loss of energy; poor appetite and weight loss; nausea or belly pain; small, or red spider-like blood vessels on the skin.
- symptoms may include: fluid buildup of the legs (edema) and in the abdomen (ascites); yellow color in the skin, mucous membranes, or eyes (jaundice); redness on the palms of the hands; easy bruising and abnormal bleeding; confusion or problems thinking; or pale or clay-colored stools.
- symptoms may also include impotence, shrinking of the testicles, and breast swelling.
- subjects are treated that have liver disease wherein there are very low concentrations of the proteins and hormones which are produced in the liver. A reduced concentration of the protein albumin in the blood is of importance for the development of edema in the abdominal cavity such as ascites and in the legs caused by chronic liver disease.
- Subjects with liver disease can be treated that have a reduced capability of production of coagulation factors, which are important for the normal coagulation of blood, and an increased tendency of bleeding.
- the disclosed methods include selecting subject with one or more of these features.
- these methods include administering to the subject an effective amount of a PDEIII inhibitor or TDYA, thereby treating the liver disease in the subject.
- the liver disease is ESLD or MAFLD.
- the method increases serum albumin, decreases serum ammonia, improves coagulation activity, decreases ascites production, improves neuropsychological status, decreases bilirubin, improves apolipoprotein, and/or improves portal vein or systemic blood flow clearance of cholate in the subject.
- the subject is homozygous for rs738409:G mutation in the patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene. These subjects can be selected.
- the PNPLA3 gene refers to NCBI Gene ID: 80339.
- WO 2023/092134 shows the sequence of wild type PNPLA3 gene as well as the sequence of the rs738409 C>G (I148M) variant of the PNPLA3 gene.
- Genome-wide association studies GWAS have identified the rs738409 C>G (I148M) variant of the PNPLA3 gene as the strongest genetic risk allele for NAFLD/NASH, influencing degree of steatosis, grade of inflammation, stage of fibrosis and risk of HCC among all examined populations.
- Other studies have also demonstrated the strong association between 148M allele and ALD (Buch et al., Nature Genetics, 47(12):1443-1447, 2015, incorporated by reference herein in its entirety).
- these methods include administering to the selected subject an effective amount of Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, or a pharmaceutically acceptable salt thereof, thereby treating liver disease in the subject.
- these methods include administering to the subject an effective amount of TDYA, or a pharmaceutically acceptable salt thereof.
- the methods include methods include administering to the subject an effective amount of Enoximone or a pharmaceutically acceptable salt thereof.
- the methods include administering to the subject an effective amount of Amrinone or a pharmaceutically acceptable salt thereof.
- the methods include administering to the subject an effective amount of Cilostazol or a pharmaceutically acceptable salt thereof.
- the methods include administering to the subject an effective amount of Milrinone or a pharmaceutically acceptable salt thereof.
- the methods include administering to the subject an effective amount of Pimobendan or a pharmaceutically acceptable salt thereof.
- the methods include administering to the subject an effective amount of dipyridamole or a pharmaceutically acceptable salt thereof. In more aspects, the methods include administering to the subject an effective amount of TDYA or a pharmaceutically acceptable salt thereof. In some aspects, the method increases serum albumin, decreases serum ammonia, improves coagulation activity, decreases ascites production, improves neuropsychological status, decreases bilirubin, improves apolipoprotein, and/or improves portal vein or systemic blood flow clearance of cholate in the subject. The methods can improve other symptoms, such as weakness, fatigue, loss of appetite, nausea, vomiting, weight loss, abdominal pain, bloating, or itching.
- Treatment can also result in improvements in creatine level, bilirubin level, or an international normalized ratio (INR)-test for the clotting tendency of blood, increase serum albumin, decrease serum ammonia, improve ascites, neuropsychological status, improve levels of apolipoproteins and/or portal vein blood flow clearance of cholate.
- these parameters are improved compared to a control, such as the parameter as measured in a subject prior to treatment.
- the control also can be a standard value, or the value obtained for a population of subjects with the liver disease.
- the subject can be selected using Child-Pugh scoring.
- the Child- Pugh score utilizes five clinical measures, wherein levels of total bilirubin, serum albumin, prothrombin time prolongation, ascites, and hepatic encephalopathy, are scored using a point system of 1 point, 2 point, and 3 point values for varying levels of each clinical measure, with 3 point values being assigned to the most severe levels of each measure. The total points for all five measures are added to arrive at a Child-Pugh score and classification. Scores of 5-6 designate Child-Pugh Class A, scores of 7-9 designate Child-Pugh Class B, and scores of 10- 15 designate Child-Pugh Class C. I n general, Child-Pugh Class A indicates the least severe liver disease and Child-Pugh Class C indicates the most severe liver disease.
- the method disclosed herein can be used to treat a subject having a Child-Pugh Class A, Child-Pugh Class B or Child- Pugh Class C liver disease.
- the method disclosed here in can be used to treat a subject having a Child-Pugh Class C liver disease.
- the method improves the Child-Pugh score of the subject.
- the method can include determining the Child-Pugh score of the subject.
- the disclosed methods can include measuring liver function and/or survival using a quantitative and/or qualitative test.
- the degree of liver impairment is assessed using tests which evaluate structure (e.g., biopsy), cellular permeability (e.g., transaminases) and synthetic ability (e.g., albumin, bilirubin and prothrombin time) (see Jalan and Hayes (1995) Aliment. Pharmacol. Ther.9:263- 270).
- structure e.g., biopsy
- cellular permeability e.g., transaminases
- synthetic ability e.g., albumin, bilirubin and prothrombin time
- the method can also include measuring the lipid profile of a subject.
- the method can include measuring liver size, such as using ultrasound.
- Provided herein are methods of promoting survival of a donor liver in a recipient subject, wherein the donor liver is homozygous for rs738409:G mutation in the PNPLA3 gene.
- the method includes detecting the rs738409:G mutation in the PNPLA3 gene in a sample from the donor.
- the sample from the donor is a blood or tissue sample.
- the sample from the donor is a liver tissue sample.
- PCR polymerase chain reaction
- PCR methods are described in, for example, U.S. Patent No.4,683,195; Mullis et al., Cold Spring Harbor Symp. Quant. Biol.51:263, 1987; and Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).
- the subject can have a partial liver resection.
- the subject can be a recipient of a liver transplant, such as a cadaveric transplant or a transplant from a living donor.
- the subject can be a mammal, such as a domestic animal or a primate.
- the subject is a human.
- the individual has undergone a partial hepatectomy or liver resection.
- the partial hepatectomy or liver resection removed 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% by mass of the subject’s liver.
- the subject is the recipient of a liver transplant from a liver donor.
- the hepatectomy is anatomic, so that the lines of resection match the limits of one or more functional segments of the liver as defined by the Couinaud classification.
- the subject can be an adult (over 18 years old), or a child (under 13 years old) or a teenager (13 to 19 years old).
- the subject can be over 20, 30, 40, 50, or 60 years old.
- a subject is treated using the method disclosed herein that has undergone a liver transplant, and is a transplant recipient.
- the subject has undergone a small-for-size liver transplant.
- the subject has undergone a liver transplant due to liver damage caused by toxic injury, traumatic injury, microvesicular steatosis, or macrovesicular steatosis.
- the toxic injury results from acetaminophen overdose, exposure to carbon tetrachloride (CCl 4 ), bacterial endotoxin, use or abuse of intravenous or prescription drugs, chemotherapy, excessive consumption of alcohol, or infection with hepatitis virus A, B, or C.
- Traumatic injury can result from surgical resection or blunt force trauma, such as that occurring in an automobile accident.
- the subject has received an extended criteria liver, such as, but not limited to, a liver harvested from a subject that is greater than about 45 years old, such as about 45 to about 55 years old, such as about 45 to old 50 years old.
- the subject has received a cadaveric liver.
- the subject has received a liver transplant from a living donor.
- These subjects can be evaluated using the Child-Pugh classification system.
- the disclosed methods can be performed to the subject any time throughout their evaluation of liver function using the Child-Pugh classification and/or if the subject undergo liver resection and transplant.
- the disclosed methods can be employed 5, 4, 3, 2, or 1 years;12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 months; 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 days; 60, 48, 36, 30, 24, 18, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3, or 2 hours prior to the operation of liver resection or transplant; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 75, 90, 105, 120 minutes; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18, 24, 30, 36, 48, 60 hours; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 45, 60, 90 or more days; 4, 5, 6, 7, 8, 9, 10, 11, 12 or more months; 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38
- the disclosed methods can include measuring liver function and/or survival (for transplant patients) using a quantitative and/or qualitative test.
- the degree of liver impairment is assessed using tests which evaluate structure (e.g., biopsy), cellular permeability (e.g., transaminases) and synthetic ability (e.g., albumin, bilirubin and prothrombin time) (see Jalan and Hayes (1995) Aliment. Pharmacol. Ther. 9:263-270).
- structure e.g., biopsy
- cellular permeability e.g., transaminases
- synthetic ability e.g., albumin, bilirubin and prothrombin time
- the method can also include measuring the lipid profile of a subject.
- the method can include measuring liver size, such as using ultrasound.
- the disclosed methods promote survival of a donor liver in a subject in need thereof an effective amount of a phosphodiesterase (PDE) III inhibitor or TDYA, or a pharmaceutically acceptable salt thereof.
- the subject can be administered additional therapeutic agents.
- Additional agents that can be administered to the subject include immunosuppresive therapeutics, antibacterial and antifungal antibiotics, as well as non-steroidal anti-inflammatory agents to reduce risk of infection and inflammation. Additional agents of use include an effective amount of deferoxamine, selenium, vitamin E (alpha-tocopherol), CoQ10, or a combination thereof. Additional agents can be administered by any route. The additional agents can be formulated separately, or in the same composition. In specific non-limiting aspects, the subject is also administered an effective amount of GSH or a nucleic acid molecule encoding GPX4.
- the dose and dosing schedule for administration of GSH or a nucleic acid molecule encoding GPX4 can vary and is determined in part by the clinical status of the subject or the donor liver, and the age, such as the weight and general health of the subject, and the route of administration. Suitable formulations, and dosing regiments, are disclosed in PCT Publication No. WO 2023/092134. Briefly, polynucleotides include DNA, cDNA and RNA sequences which encode a protomer and a component of the ferroptosis pathway, such as GPX4, as well as vectors including the DNA, cDNA, and RNA sequences, such as a DNA or RNA vector, are of use in the methods disclosed herein.
- the genetic code can be used to construct a variety of functionally equivalent nucleic acids, such as nucleic acids which differ in sequence but which encode the same protein sequence (degenerate variants).
- the nucleic acid molecule encodes GPX4.
- the nucleic acid molecule encodes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to a nucleotide sequence set forth as SEQ ID NO: 3 or 4.
- Polynucleotides encoding a component of the ferroptosis pathway, such as a GPX4 protein, are of use in the disclosed methods.
- the polynucleotides encode GPX4. These polynucleotides include DNA, cDNA, and RNA sequences that encode the protein. Silent mutations in the coding sequence result from the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue.
- leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA.
- Nucleic acid molecules encoding a GPX4 protein can readily be produced by one of skill in the art using the amino acid sequences provided herein and the genetic code. Nucleic acid sequences encoding the GPX4 can be prepared by any suitable method including, for example, cloning of appropriate sequences or by direct chemical synthesis by methods such as the phosphotriester method of Narang et al., Meth.
- ss single-strand oligonucleotide
- ds double-strand DNA
- exemplary nucleic acids that include sequences encoding a GPX4 protein can be prepared by cloning techniques.
- a nucleic acid molecule encoding a GPX4 protein can be cloned or amplified by in vitro methods, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system (TAS), the self-sustained sequence replication system (3SR), and the Q ⁇ replicase amplification system (QB).
- PCR polymerase chain reaction
- LCR ligase chain reaction
- TAS transcription-based amplification system
- 3SR self-sustained sequence replication system
- QB Q ⁇ replicase amplification system
- a polynucleotide encoding the protein can be isolated by a polymerase chain reaction of cDNA using primers based on the DNA sequence of the molecule.
- a wide variety of cloning and in vitro amplification methodologies are well-known to persons skilled in the art. PCR methods are described in, for example, U.S. Patent No.4,683,195; Mullis et al., Cold Spring Harbor Symp. Quant. Biol.51:263, 1987; and Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).
- Polynucleotides also can be isolated by screening genomic or cDNA libraries with probes selected from the sequences of the desired polynucleotide under stringent hybridization conditions.
- a polynucleotide sequence encoding a GPX4 protein is operably linked to transcriptional control sequences including, for example a promoter and a polyadenylation signal.
- Any promoter can be used that is a polynucleotide sequence recognized by the transcriptional machinery of the host cell (or introduced synthetic machinery) that is involved in the initiation of transcription.
- a polyadenylation signal is a polynucleotide sequence that directs the addition of a series of nucleotides on the end of the mRNA transcript for proper processing and trafficking of the transcript out of the nucleus into the cytoplasm for translation.
- promoters include viral promoters, such as cytomegalovirus immediate early gene promoter (“CMV”), herpes simplex virus thymidine kinase (“tk”), SV40 early transcription unit, polyoma, retroviruses, papilloma virus, hepatitis B virus, and human and simian immunodeficiency viruses.
- CMV cytomegalovirus immediate early gene promoter
- tk herpes simplex virus thymidine kinase
- SV40 early transcription unit polyoma
- retroviruses papilloma virus
- hepatitis B virus hepatitis B virus
- human and simian immunodeficiency viruses include cytomegalovirus immediate early gene promoter (“CMV”), herpes simplex virus thymidine kinase (“tk”), SV40 early transcription unit, polyoma, retroviruses, papilloma virus, hepatitis
- promoters include promoters isolated from mammalian genes, such as the immunoglobulin heavy chain, immunoglobulin light chain, T cell receptor, HLA-DQ ⁇ and HLA-DQ ⁇ , ⁇ -interferon, interleukin-2, interleukin-2 receptor, MHC class II, HLA-DR ⁇ , ⁇ -actin, muscle creatine kinase, prealbumin (transthyretin), elastase I, metallothionein, collagenase, albumin, fetoprotein, ⁇ -globin, c-fos, c-HA-ras, neural cell adhesion molecule (NCAM), ⁇ 1-antitrypsin, H2B (TH2B) histone, type I collagen, glucose-regulated proteins (GRP94 and GRP78), rat growth hormone, human serum amyloid A (SAA), troponin I (TNI), platelet-derived growth factor, and dystrophin, as well as promoters specific for liver cells.
- the promoter can be either inducible or constitutive.
- An inducible promoter is a promoter that is inactive or exhibits low activity except in the presence of an inducer substance. Additional examples of promoters include, but are not limited to, MT II, MMTV, collagenase, stromelysin, SV40, murine MX gene, ⁇ -2-macroglobulin, MHC class I gene h-2kb, HSP70, proliferin, tetracycline inducible, tumor necrosis factor, or thyroid stimulating hormone gene promoter.
- an inducible promoter is the interferon inducible ISG54 promoter (see Bluyssen et al., Proc. Natl Acad.
- the promoter is a constitutive promoter that results in high levels of transcription upon introduction into a host cell in the absence of additional factors.
- the protein can be a liver specific promoter, such as an albumin promoter, ⁇ 1-antitrypsin (AAT) promoter (Serpina1), apolipoprotein E promoter, liver-specific promoter 1 (LP1), thyroxine-binding globulin (TBG) promoter, phosphoglycerate kinase 1 (PGK) promoter, cytochrome P4502E1 (CYP2E1) promoter, ⁇ -fetoprotein (AFP) promoter, transthyretin (TTR) promoter, ⁇ 1 -microglobulin enhancer, DC190 promoter, DC172 promoter, light strand promoter, liver-specific promoter (LSPs), hepatic control region-1 (HCR) promoter, liver-muscle promoter (AAT) promoter (Serpina1), apolipoprotein E promote
- transcription control sequences include one or more enhancer elements, which are binding recognition sites for one or more transcription factors that increase transcription above that observed for the minimal promoter alone, and also be operably linked to the polynucleotide encoding the promoter and/or the nucleic acid molecule encoding the GPX4 protein.
- enhancer elements are binding recognition sites for one or more transcription factors that increase transcription above that observed for the minimal promoter alone
- introns can also be included that help stabilize mRNA and increase expression. This mRNA can then be isolated and used in the methods disclosed herein.
- mRNA encoding GPX4 is used in the methods disclosed herein.
- nucleic acid sequence that encodes a GPX4 protein is incorporated into a vector capable of expression in a host cell, using established molecular biology procedures.
- nucleic acids, such as cDNAs that encode a GPX4 protein can be manipulated with standard procedures, such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence-alteration via single-stranded bacteriophage intermediate, or use of specific oligonucleotides in combination with PCR or other in vitro amplification.
- These vectors can include a promoter operably linked to a nucleic acid molecule encoding a GPX4 protein.
- Exemplary procedures sufficient to guide one of ordinary skill in the art through the production of a vector capable of expression in a host cell that includes a promoter, and/or a polynucleotide sequence encoding a GPX4 protein can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2003); and Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999.
- a polyadenylation signal may be desirable to include a polyadenylation signal to effect proper termination and polyadenylation of the gene transcript.
- exemplary polyadenylation signals have been isolated from beta globin, bovine growth hormone, SV40, and the herpes simplex virus thymidine kinase genes.
- the nucleic acid molecules can be included in a nanodispersion system, see, e.g., U.S. Pat. No. 6,780,324; U.S. Pat. Publication No.2009/0175953.
- a nanodispersion system includes a biologically active agent and a dispersing agent (such as a polymer, copolymer, or low molecular weight surfactant).
- Exemplary polymers or copolymers include polyvinylpyrrolidone (PVP), poly(D,L-lactic acid) (PLA), poly(D,L-lactic-co-glycolic acid (PLGA), poly(ethylene glycol).
- Exemplary low molecular weight surfactants include sodium dodecyl sulfate, hexadecyl pyridinium chloride, polysorbates, sorbitans, poly(oxyethylene) alkyl ethers, poly(oxyethylene) alkyl esters, and combinations thereof.
- the nanodispersion system includes PVP and ODP or a variant thereof (such as 80/20 w/w).
- the nanodispersion is prepared using the solvent evaporation method, see for example, Kanaze et al., Drug Dev. Indus. Pharm.36:292-301, 2010; Kanaze et al., J. Appl. Polymer Sci.102:460-471, 2006.
- Dendrimers are synthetic three-dimensional macromolecules that are prepared in a step-wise fashion from simple branched monomer units, the nature and functionality of which can be easily controlled and varied. Dendrimers consist of an initiator core, surrounded by a layer of a selected polymer that is grafted to the core, forming a branched macromolecular complex.
- Dendrimers are typically produced using polymers such as poly(amidoamine) or poly(L-lysine).
- a dendrimer can be synthesized from the repeated addition of building blocks to a multifunctional core (divergent approach to synthesis), or towards a multifunctional core (convergent approach to synthesis) and each addition of a three-dimensional shell of building blocks leads to the formation of a higher generation of the dendrimers.
- Polypropylenimine dendrimers contain 100% protonable nitrogens and up to 64 terminal amino groups. Protonable groups are usually amine groups which are able to accept protons at neutral pH.
- dendrimers can be formed from polyamidoamine and phosphorous containing compounds with a mixture of amine/ amide or N-P(O 2 )S as the conjugating units. Dendrimers of use for delivery of nucleic acid molecules is disclosed, for example, in PCT Publication No.2003/033027.
- the polynucleotides encoding the GPX4 protein include a recombinant DNA which is incorporated into a vector in an autonomously replicating plasmid or virus or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (such as a cDNA) independent of other sequences.
- Viral vectors that include the GPX4 protein can also be prepared.
- Numerous viral vectors are known in the art, including polyoma; SV40 (Madzak et al., 1992, J. Gen. Virol., 73:15331536); adenovirus (Berkner, 1992, Cur. Top. Microbiol. Immunol., 158:39-6; Hopkins et al., 1988, Bio Techniques, 6:616-629; Gorziglia et al., 1992, J. Virol., 66:4407-4412; Quantin et al., 1992, Proc. Natl. Acad. Sci.
- Baculovirus vectors are also known in the art and may be obtained from commercial sources (such as PharMingen, San Diego, Calif.; Protein Sciences Corp., Meriden, Conn.; Stratagene, La Jolla, Calif.).
- the nucleic acid molecule encoding the GPX4 protein is included in a viral vector.
- Suitable vectors include retrovirus vectors, orthopox vectors, avipox vectors, fowlpox vectors, capripox vectors, suipox vectors, adenoviral vectors, herpes virus vectors, alpha virus vectors, baculovirus vectors, Sindbis virus vectors, vaccinia virus vectors, lentivirus vectors and poliovirus vectors.
- Specific exemplary vectors are poxvirus vectors, such as vaccinia virus, fowlpox virus and a highly attenuated vaccinia virus (MVA), adenovirus, baculovirus, yeast, and the like.
- Adeno-associated virus vectors are disclosed in additional detail below, and are of use in the disclosed methods.
- methods and compositions that include utilizing one or more vectors, such as a viral vector, such as a retroviral vector, lentiviral vector, or an adenoviral vector, or an AAV vector that includes a nucleic acid molecule including a GPX4 protein.
- a viral vector such as a retroviral vector, lentiviral vector, or an adenoviral vector, or an AAV vector that includes a nucleic acid molecule including a GPX4 protein.
- Defective viruses that entirely or almost entirely lack viral genes, can be used.
- the vector can be a lentiviral vector. Use of defective viral vectors allows for administration to specific cells without concern that the vector can infect other cells.
- the adenovirus vectors of use include replication competent, replication deficient, gutless forms thereof.
- the AAV vectors of use are replication deficient.
- adenovirus vectors are known to exhibit strong expression in vitro, excellent titer, and the ability to transduce dividing and non-dividing cells in vivo (Hitt et al., Adv in Virus Res 55:479-505, 2000). When used in vivo these vectors lead to strong but transient gene expression due to immune responses elicited to the vector backbone.
- a vector of use is an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. (J. Clin.
- Recombinant AAV vectors are characterized in that they are capable of directing the expression and the production of the selected transgenic products in targeted cells.
- the recombinant vectors comprise at least all of the sequences of AAV essential for encapsidation and the physical structures for infection of target cells.
- AAV belongs to the family Parvoviridae and the genus Dependovirus.
- AAV is a small, non- enveloped virus that packages a linear, single-stranded DNA genome. Both sense and antisense strands of AAV DNA are packaged into AAV capsids with equal frequency.
- the AAV DNA includes a nucleic acid including a promoter operably linked to a nucleic acid molecule encoding a GPX4 protein.
- recombinant vectors such as recombinant adenovirus vectors and recombinant adeno- associated virus (rAAV) vectors comprising a nucleic acid molecule(s) disclosed herein.
- the AAV is rAAV8, and/or AAV2.
- the AAV serotype can be any other suitable AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV9, AAV10, AAV11 or AAV12, or a hybrid of two or more AAV serotypes.
- the AAV genome is characterized by two inverted terminal repeats (ITRs) that flank two open reading frames (ORFs).
- ITRs inverted terminal repeats
- ORFs open reading frames
- the first 125 nucleotides of the ITR are a palindrome, which folds upon itself to maximize base pairing and forms a T-shaped hairpin structure.
- the other 20 bases of the ITR called the D sequence, remain unpaired.
- the ITRs are cis-acting sequences important for AAV DNA replication; the ITR is the origin of replication and serves as a primer for second- strand synthesis by DNA polymerase.
- the double-stranded DNA formed during this synthesis which is called replicating-form monomer, is used for a second round of self-priming replication and forms a replicating-form dimer.
- These double-stranded intermediates are processed via a strand displacement mechanism, resulting in single-stranded DNA used for packaging and double-stranded DNA used for transcription.
- Located within the ITR are the Rep binding elements and a terminal resolution site (TRS). These features are used by the viral regulatory protein Rep during AAV replication to process the double- stranded intermediates.
- the ITR is also essential for AAV genome packaging, transcription, negative regulation under non-permissive conditions, and site-specific integration (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008). In some aspects, these elements are included in the AAV vector.
- the left ORF of AAV contains the Rep gene, which encodes four proteins – Rep78, Rep 68, Rep52 and Rep40.
- the right ORF contains the Cap gene, which produces three viral capsid proteins (VP1, VP2 and VP3).
- the AAV capsid contains 60 viral capsid proteins arranged into an icosahedral symmetry.
- VP1, VP2 and VP3 are present in a 1:1:10 molar ratio (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008). In some aspects, these elements are included in the AAV vector.
- AAV vectors can be used for gene therapy. Exemplary AAV of use are AAV2, AAV5, AAV6, AAV8 and AAV9. Adenovirus, AAV2 and AAV8 are capable of transducing cells in the liver. Thus, any of a rAAV2 or rAAV8 vector can be used in the methods disclosed herein. However, rAAV6 and rAAV9 vectors are also of use.
- AAV infects humans and some other primate species, it is not known to cause disease and elicits a very mild immune response.
- Gene therapy vectors that utilize AAV can infect both dividing and quiescent cells and persist in an extrachromosomal state without integrating into the genome of the host cell. Because of the advantageous features of AAV, the present disclosure contemplates the use of an rAAV for the methods disclosed herein.
- AAV possesses several additional desirable features for therapy, including the ability to bind and enter target cells, enter the nucleus, the ability to be expressed in the nucleus for a prolonged period of time, and low toxicity.
- AAV can be used to transfect cells, and suitable vector are known in the art, see for example, U.S.
- the vector is a rAAV8 vector, a rAAV2 vector, a rAAV9 vector.
- the vector is an AAV8 vector.
- AAV8 vectors are disclosed, for example, in U.S.
- Patent No.8,692,332 which is incorporated by reference herein.
- the location and sequence of the capsid, rep 68/78, rep 40/52, VP1, VP2 and VP3 are disclosed in this U.S. Patent No.8,692,332.
- the location and hypervariable regions of AAV8 are also provided.
- the vector is an AAV2 variant vector, such as AAV7m8.
- the vectors of use in the methods disclosed herein can contain nucleic acid sequences encoding an intact AAV capsid which may be from a single AAV serotype (e.g., AAV2, AAV6, AAV8 or AAV9). As disclosed in U.S.
- vectors of use can also be recombinant, and thus can contain sequences encoding artificial capsids which contain one or more fragments of the AAV8 capsid fused to heterologous AAV or non-AAV capsid proteins (or fragments thereof).
- artificial capsid proteins are selected from non-contiguous portions of the AAV2, AAV6, AAV8 or AAV9 capsid or from capsids of other AAV serotypes.
- a rAAV vector may have a capsid protein comprising one or more of the AAV8 capsid regions selected from the VP2 and/or VP3, or from VP1, or fragments thereof selected from amino acids 1 to 184, amino acids 199 to 259; amino acids 274 to 446; amino acids 603 to 659; amino acids 670 to 706; amino acids 724 to 738 of the AAV8 capsid, which is presented as SEQ ID NO: 2 in U.S. Patent No.8,692,332.
- the rAAV may contain one or more of the AAV serotype 8 capsid protein hypervariable regions, for example aa 185- 198; aa 260-273; aa447-477; aa495-602; aa660-669; and aa707- 723 of the AAV8 capsid which is presented as SEQ ID NO: 2 in U.S. Patent No.8,692,332.
- a recombinant adeno-associated virus is generated having an AAV serotype 2 capsid.
- a host cell which can be cultured that contains a nucleic acid sequence encoding an AAV serotype 2 capsid protein, or fragment thereof, as defined herein; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene, such as encoding a GPX4 protein and sufficient helper functions to permit packaging in the AAV2 capsid protein.
- ITRs AAV inverted terminal repeats
- transgene such as encoding a GPX4 protein and sufficient helper functions to permit packaging in the AAV2 capsid protein.
- the biological molecules required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans.
- any one or more of the required biological molecules may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
- a stable host cell will contain the required biological molecules s(s) under the control of an inducible promoter or a tissue specific promoter. Similar methods can be used to generate a rAAV2, rAAV8 or rAAV9 vector and/or virion.
- a liver specific promoter can be included in the AAV vectors.
- promoters include, but are not limited to, an A1AT promoter ( ⁇ 1 -antitrypsin, Serpina1), apolipoprotein E promoter, LP1 promoter, TBG promoter, PGK promoter, CYP2E1 promoter, Afp promoter, TTR promoter, ⁇ 1 - microglobulin enhancer, DC190 promoter, DC172 promoter, LSP, liver-specific promoter, HCR promoter, LiMP promoter, PEPCK promoter, or HNF3 promoter.
- a liver-specific promoter as disclosed above, is operably linked to a nucleic acid molecule encoding the GPX4 protein, and included in the AAV vector.
- a nucleic acid molecule encoding a component of the ferroptosis pathway can be under the control of a constitutive promoter.
- a constitutive promoter is the cytomegalovirus promoter. Additional non-limiting examples are the ubiquitin or a chicken ⁇ -actin promoter.
- Promoters of use include liver specific promoters, such as an A1AT promoter ( ⁇ 1-antitrypsin, Serpina1), apolipoprotein E promoter, LP1 promoter, TBG promoter, PGK promoter, CYP2E1 promoter, Afp promoter, TTR promoter, ⁇ 1- microglobulin enhancer, DC190 promoter, DC172 promoter, LSP, liver-specific promoter, HCR promoter, LiMP promoter, PEPCK promoter, or HNF3 promoter.
- A1AT promoter ⁇ 1-antitrypsin, Serpina1
- apolipoprotein E promoter apolipoprotein E promoter
- LP1 promoter LP1 promoter
- TBG promoter TBG promoter
- PGK promoter CYP2E1 promoter
- Afp promoter CYP2E1 promoter
- TTR promoter ⁇ 1- microglobulin enhancer
- DC190 promoter DC172 promoter
- a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters, such as for the production of rAAV in a packaging host cell.
- a stable host cell may be generated which is derived from 293 cells (which contain E1 helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters.
- Still other stable host cells may be generated by one of skill in the art.
- the minigene, rep sequences, cap sequences, and helper functions required for producing a rAAV can be delivered to the packaging host cell in the form of any genetic element which transfer the sequences carried thereon.
- the selected genetic element may be delivered by any suitable method, including those described herein.
- the methods used to construct vectors are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, J. Virol., 70:520-532 (1993) and U.S. Patent No.5,478,745.
- elements of the selected AAV can be readily isolated using techniques available to those of skill in the art from an AAV serotype, including AAV8.
- AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.).
- the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GENBANK®.
- an mRNA can be used to deliver a nucleic acid encoding GPX4 directly into cells.
- nucleic acid-based vaccines based on mRNA may provide a potent alternative to the previously mentioned approaches.
- RNA delivery precludes safety concerns about DNA integration into the host genome and can be directly translated in the host cell cytoplasm. Moreover, the simple cell-free, in vitro synthesis of RNA avoids the manufacturing complications associated with viral vectors.
- Two exemplary forms of RNA that can be used to deliver a nucleic acid include conventional non-amplifying mRNA (see, e.g., Petsch et al., “Protective efficacy of in vitro synthesized, specific mRNA vaccines against influenza A virus infection,” Nature biotechnology, 30(12):1210–6, 2012) and self-amplifying mRNA (see, e.g., Geall et al., “Nonviral delivery of self-amplifying RNA vaccines,” PNAS, 109(36): 14604-14609, 2012; Magini et al., “Self-Amplifying mRNA Vaccines Expressing Multiple conserveed Influenza Antigens Confer Protection against Homologous and Heter
- compositions including a nucleic acd moleucle can be formulated and administered in a variety of ways depending on the type of disease to be treated (see, e.g., U.S. Published Application No.2005/0054567, which discloses pharmaceutical compositions as well as administration of such compositions and is incorporated herein by reference).
- the pharmaceutical compositions can include a nanoparticle or dendrimer. These pharmaceutical compositions are of use in the methods disclosed herein.
- the pharmaceutical compositions include a nucleic acid molecule encoding GPX4.
- Pharmaceutical compositions including a nucleic acid molecule are provided that are formulated for local delivery to the liver.
- compositions including nucleci acid molecules can be formulated for injection, such as for intrahepatic or intravenous administration. Such compositions are formulated generally by mixing a disclosed nucleic acid molecule at the desired degree of purity in a unit dosage injectable form (solution, suspension, or emulsion) with a pharmaceutically acceptable carrier, for example, one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- a pharmaceutically acceptable carrier for example, one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- Pharmaceutical compositions can include an effective amount of the nucleic acid molecule dispersed (for example, dissolved or suspended) in a pharmaceutically acceptable carrier or excipient.
- Pharmaceutically acceptable carriers and/or pharmaceutically acceptable excipients are known in the art and are described, for example, in Remington’s Pharmaceutical Sciences by E. W.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate.
- a disclosed nucleic acid molecule can be suspended in an aqueous carrier, for example, in an isotonic or hypotonic buffer solution at a pH of about 3.0 to about 8.5, such as about 4.0 to about 8.0, about 6.5 to about 8.5, or about 7.4.
- Useful buffers include saline-buffered phosphate or an ionic boric acid buffer.
- the active ingredient optionally together with excipients, can also be in the form of a lyophilisate and can be made into a solution prior to administration by the addition of suitable solvents.
- the pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like.
- compositions can include the vectors or viruses in water, mixed with a suitable surfactant, such as hydroxy-propylcellulose.
- Dispersions also can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof as well as in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
- the excipients confer a protective effect to a virus including the nucleic acid molecules, such as AAV virion or lentivirus virion, such that loss of AAV virions or lentivirus virions, as well as transduceability resulting from formulation procedures, packaging, storage, transport, and the like, is minimized.
- viruses including the nucleic acid molecules, such as AAV virion or lentivirus virion, such that loss of AAV virions or lentivirus virions, as well as transduceability resulting from formulation procedures, packaging, storage, transport, and the like, is minimized.
- These excipient compositions are therefore considered "virion-stabilizing" in the sense that they provide higher virion titers and higher transduceability levels than their non-protected counterparts, as measured using standard assays, see, for example, Published U.S. Application No.2012/0219528, incorporated herein by reference.
- compositions therefore demonstrate "enhanced transduceability levels" as compared to compositions lacking the particular excipients described herein and are therefore more stable than their non-protected counterparts.
- excipients that can used to protect a virion from activity degradative conditions include, but are not limited to, detergents, proteins, e.g., ovalbumin and bovine serum albumin, amino acids, e.g., glycine, polyhydric and dihydric alcohols, such as but not limited to polyethylene glycols (PEG) of varying molecular weights, such as PEG-200, PEG-400, PEG-600, PEG-1000, PEG-1450, PEG-3350, PEG-6000, PEG-8000 and any molecular weights in between these values, with molecular weights of 1500 to 6000 preferred, propylene glycols (PG), sugar alcohols, such as a carbohydrate, preferably, sorbitol.
- PEG polyethylene glycols
- PG propy
- the detergent when present, can be an anionic, a cationic, a zwitterionic or a nonionic detergent.
- An exemplary detergent is a nonionic detergent.
- One suitable type of nonionic detergent is a sorbitan ester, e.g., polyoxyethylenesorbitan monolaurate (TWEEN®-20) polyoxyethylenesorbitan monopalmitate (TWEEN®- 40), polyoxyethylenesorbitan monostearate (TWEEN®-60), polyoxyethylenesorbitan tristearate (TWEEN®- 65), polyoxyethylenesorbitan monooleate (TWEEN®-80), polyoxyethylenesorbitan trioleate (TWEEN®- 85), such as TWEEN®-20 and/or TWEEN®-80.
- sorbitan ester e.g., polyoxyethylenesorbitan monolaurate (TWEEN®-20) polyoxyethylenesorbitan monopalmitate (TWEEN®- 40), polyoxyethylenesorbitan monostearate (T
- excipients are commercially available from a number of vendors, such as Sigma, St. Louis, Mo.
- the amount of the various excipients in any of the disclosed compositions including virus, such as AAV, varies and is readily determined by one of skill in the art.
- a protein excipient such as BSA, if present, will can be present at a concentration of between 1.0 weight (wt.) % to about 20 wt. %, such as 10 wt. %.
- an amino acid such as glycine is used in the formulations, it can be present at a concentration of about 1 wt. % to about 5 wt. %.
- a carbohydrate, such as sorbitol, if present, can be present at a concentration of about 0.1 wt % to about 10 wt. %, such as between about 0.5 wt. % to about 15 wt. %, or about 1 wt. % to about 5 wt. %.
- polyethylene glycol it can generally be present on the order of about 2 wt. % to about 40 wt. %, such as about 10 wt. % top about 25 wt. %.
- propylene glycol is used in the subject formulations, it will typically be present at a concentration of about 2 wt. % to about 60 wt. %, such as about 5 wt.
- an aqueous virion-stabilizing formulation comprises a carbohydrate, such as sorbitol, at a concentration of between 0.1 wt. % to about 10 wt. %, such as between about 1 wt. % to about 5 wt.
- Virions are generally present in the composition in an amount sufficient to provide a therapeutic effect when given in one or more doses, as defined above.
- Local modes of administration include intrahepatic routes, such as adminitration to a donor liver prior to transplantation, or adminstration to the donor liver at the time of transplantion.
- significantly smaller amounts may exert an effect when administered locally (for example, intrahepatically) compared to when administered systemically (for example, intravenously).
- nucleic acid molecules to the liver are known in the medical arts and can be used in the methods described herein. Administration may be provided as a single administration, a periodic bolus (for example, intrahepatically) or as continuous infusion from an internal reservoir (for example, from an implant disposed at an intrahepatic location or from an external reservoir (for example, from an intravenous bag). Intrahepatic injection of the nucleic acid molecules disclosed herein can be performed once, or can be performed repeatedly, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 or more times.
- Administration can be performed biweekly, weekly, every other week, monthly, or every 2, 3, 4, 5, or 6 months.
- the nucleic acid molecule encodes GPX4.
- Individual doses are typically not less than an amount required to produce a measurable effect on the subject and may be determined based on the pharmacokinetics and pharmacology of the subject composition or its by-products, and thus based on the disposition of the composition within the subject. This includes consideration of the route of administration as well as dosage amount, which can be adjusted for intraveinous or intrahepatic applications.
- an AAV is administered to the recipient and/or to the donor liver (such as in an ex vivo perfusion system for these aspects) at a dose of about 1 x 10 11 to about 1 x 10 14 viral particles (vp)/kg.
- the AAV is administered to the recipient at a dose of about 1 x 10 12 to about 8 x 10 13 vp/kg.
- the AAV is administered to the recipient or to the donor liver at a dose of about 1 x 10 13 to about 6 x 10 13 vp/kg.
- the AAV is administered to the recipient or to the donor liver at a dose of at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vp/kg.
- the AAV is administered to the recipient or to the donor liver at a dose of no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vp/kg.
- the AAV is administered to the recipient or to the donor liver at a dose of about 1 x 10 12 vp/kg.
- the AAV can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more doses) as needed for the desired therapeutic results.
- a lentivirus is administered to the recipient and/or to the donor liver (such as in an ex vivo perfusion system in these aspects) at a dose of about 1 x 10 11 to about 1 x 10 14 viral particles (vp)/kg.
- the lentivirus is administered to the recipient or to the donor liver at a dose of about 1 x 10 12 to about 8 x 10 13 vp/kg.
- the lentivirus is administered to the recipient or to the donor liver at a dose of about 1 x 10 13 to about 6 x 10 13 vp/kg.
- the lentivirus is administered to the recipient or to the donor liver at a dose of at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vp/kg.
- the lentivirus is administered to the recipient or to the donor liver at a dose of no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vp/kg.
- the lentivirus is administered to the recipient or to the donor liver at a dose of about 1 x 10 12 vp/kg.
- the lentivirus can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more doses) as needed for the desired therapeutic results.
- GSH and/or a supplement that increases GSH in the subject such as Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S-Adenosylhomocysteine, S-Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, Guanadinoacetate, a pharmaceutically acceptable salt thereof, or any combination thereof, can be used.
- GSH and supplements that increases GSH in the subject such as Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S-Adenosylhomocysteine, S-Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, Guanadinoacetate, a pharmaceutically acceptable salt thereof, and combinations thereof, and their administration, are disclosed in PCT Publication No. WO 2023/092134, incorporated herein by reference.
- one or more of these compounds is used to increase survival of a donor liver in a liver transplant recipient, wherein the donor liver is homozygous for rs738409:G mutation.
- GSH is administered to the subject.
- administering GSH to the subject inhibits lipid peroxidation and/or mitochondrial shrinkage.
- compositions that include GSH and/or a supplement that increases glutathione in the subject, wherein the supplement is Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S-Adenosylhomocysteine, S- Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, Guanadinoacetate, a pharmaceutically acceptable salt thereof, or any combination thereof, can be formulated with an appropriate pharmaceutically acceptable carrier and used in the methods disclosed herein.
- the supplement is Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthio
- the dosage form of the pharmaceutical composition will be determined by the mode of administration chosen.
- exemplary administration methods include, but are not limited to, topical, oral, subcutaneous, transdermal, intrathecal, intramuscular, intravenous, intraperitoneal, and similar administration routes, or combinations thereof.
- topical, inhalation, oral, infusion, and suppository formulations can be employed.
- Oral formulations can be liquid (such as syrups, solutions, or suspensions) or solid (such as powders, pills, tablets, or capsules).
- Suppository preparations can also be solid, gel, or in a suspension form.
- Infusion preparations, administered by catheter are generally administered as liquids.
- Inhalation preparations can be liquid (such as solutions or suspensions) and include mists, sprays, and the like.
- conventional non-toxic solid carriers can include pharmaceutical grades of mannitol, lactose, cellulose, starch, or magnesium stearate. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art.
- the pharmaceutical composition can be formulated for oral, intramuscular, or intravenous administration.
- GSH glutathione
- Glutamine glutathione
- Glutamate glutathione
- GSSG Cysteine
- Cys-Gly Choline, Phosphatidylcholine, Sorbitol
- Palmitoylcarnitine Methylthioadenosine, S-Adenosylhomocysteine, S-Adenosylmethionine
- Cystine Methionine Creatine
- Gamma-aminobutyrate Guanadinoacetate
- a pharmaceutically acceptable salt thereof, or any combination that is administered, will be dependent on the subject being treated, the severity of the affliction, and the manner of administration and is best left to the judgment of the prescribing clinician.
- the formulation to be administered will contain a quantity of the active ingredient(s)in amounts effective to achieve the desired effect in the subject being treated.
- An effective amount can be the amount that is necessary to treat or lower the risk of a subject for decreased liver function of a transplant, or increase the size of the transplant.
- the administration results in improved survival of the transplanted liver.
- compositions that include GSH and/or a supplement that increases glutathione in the subject, wherein the supplement is at least one of Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S- Adenosylhomocysteine, S-Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, or Guanadinoacetate, a pharmaceutically acceptable salt thereof, or any combination, can be formulated in unit dosage form, suitable for individual administration of precise dosages.
- the supplement is at least one of Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine,
- a unit dosage (such as intravenous dosage or an oral dosage) can be used.
- the subject is administered (for example, orally) about 50 to about 1500 mg of GSH, such as about 50 mg to about 150 mg, about 150 mg to about 300 mg, about 300 mg to about 450 mg, about 450 mg to about 600 mg, about 600 mg to about 750 mg, about 750 mg to about 900 mg, about 900 mg to about 1150 mg, about 1150 mg to about 1300 mg, or about 1300 mg to about 1500 mg.
- the subject is administered (for example, orally) about 300 mg of GSH per day.
- the subject is administered (for example, intravenously) about 1400 mg in a single dose or in more than dose.
- the dose administered to a subject should be sufficient to induce a beneficial therapeutic response in a subject over time, or to promote survival of a donor liver in a recipient subject.
- the beneficial therapeutic response may require one or more doses, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, or 500, or more doses, administered at the same or different times.
- the dose may vary from subject to subject or may be the same. An appropriate dose can be determined by one of ordinary skill in the art using routine experimentation.
- Pharmaceutically acceptable salts and hydrates are also of use in the disclosed methods. In one aspect, and pharmaceutically acceptable salt is a chloride salt.
- salts can be utilized, such as alkali metal salts; esters such as acetate, butyrate, octinoate, palmitate, chlorobenzoates, benzoates, C 1 -C 6 benzoates, succinates, and mesylate; salts of such esters; and nitrile oxides.
- esters such as acetate, butyrate, octinoate, palmitate, chlorobenzoates, benzoates, C 1 -C 6 benzoates, succinates, and mesylate
- salts of such esters and nitrile oxides.
- a variety of administration regimens are possible (for example, Kilpatrick et al., International Immunopharmacology, 3:541–548, 2003; Khan et al., Blood, 106(13):4253-4260, 2005, both of which are incorporated herein by reference in their entireties).
- Administration with an effective amount can be a single administration or multiple administrations.
- Administration can involve daily or multi-daily or less than daily (such as weekly, monthly, etc.) doses over a period of a few days to weeks or months, or even years.
- administration involves once daily dose or twice daily dose.
- the particular mode/manner of administration and the dosage regimen will be selected by the attending clinician, taking into account the particulars of the case (such as the subject, the disease, the disease state/severity involved, the particular administration, and whether the treatment is prophylactic).
- administration can be oral, intramuscular, or by intravenous delivery.
- the composition is administered daily for the use of GSH, and/or a supplement that increases glutathione in the subject, the composition is administered daily.
- the composition is administered more than once a day, such as twice a day, three time a day or four times a day. In yet other aspects, the composition is administered once a day, every other day, every three days or once a week.
- the GSH or a supplement that increases glutathione in the subject is administered by an intravenous (IV) infusion, such as within one day after transplantation or resection, and continued for at least 7 days, such as 8, 9, 10, 11, 12, 13 or 14 days, such as for about 7 to about 14 days.
- IV infusion can be continued for longer periods, such as for up to three weeks.
- IV infusion can be administered before and/or after a resection procedure.
- GSH or a supplement that increases glutathione in the subject is administered intravenously, such as using an infusion.
- the PNPLA3 rs738409 variant is of especial interest due to its wide and significant ubiquitous association with every step on the MAFLD spectrum (including hepatocellular carcinoma) and alcohol-related liver disease and the lack of tractable mechanistic targets (Mann et al., 2017, Nat Rev Gastroenterol Hepatol 14, 506-507). Most of the gene variant associations examined including PNPLA3 highlight the role of lipid droplet biology, intracellular lipid synthesis and degradation, and secretion of very-low-density lipoproteins (Trepo et al., 2020, J Hepatol 72, 1196-1209) as potential mechanisms behind the development of MAFLD.
- PNPLA3 rs738409 variant was analyzed in healthy donors, patients with ESLD, and donor and recipients undergoing LDLT. It was found that PNPLA3 rs738409 variant is present in 28% of ESLD patients in a US cohort and nearly 50% of ESLD patients in Asian cohort.
- the PNPLA3 rs738409 variant in the donor graft was associated with reduced recipient survival.
- the molecular and metabolic consequences of PNPLA3 rs738409 variants was studied using an integrated multiomics approach encompassing semi-targeted metabolomics and transcriptomics.
- the effect of these variants on mitochondrial morphology, peroxisomal fatty acid oxidation, lipid peroxidation, and cell death via ferroptosis using primary human hepatocytes and cell lines was also studied.
- peroxisomal fatty acid oxidation, ferroptosis, and bile salt export were targeted to increase the survival of primary hepatocytes.
- EXAMPLE 1 Materials and Methods Study population As part of a retrospective cohort study, 85 recipients and 85 donors who underwent living donor liver transplantation. The mean ( ⁇ SD) follow-up time was 48 ⁇ 39 months. DNA was available for 83 recipients and 79 donors. Only recipients undergoing liver transplantation due to NASH, Alcoholic cirrhosis, and cryptogenic cirrhosis were included in this study.
- LDLT low-density lipoprotein
- the selection criteria for performing LDLT were published previously (Yoshizumi et al., 2021, J Hepatol 74, 372-379). In brief, LDLT was indicated when no other potentially curative modality was available, and no other organ dysfunction present. The selection criteria for performing LDLT on patients with hepatocellular carcinoma were no other potentially curative modality available, no extrahepatic metastasis, and no major vascular infiltration. The recipient’s age was not a factor. Donors were selected from candidates who volunteered to be living donors. They were required to be within 3 degrees of kinship or the recipient’s spouse and between 20 and 65 years of age.
- graft types were based on the preoperatively predicted GW-to- SLW (GW/SLW) ratio. When the preoperatively projected GW/SLW ratio was greater than 35 percent, left lobe + caudate lobe grafts were chosen, but when the donor was younger than 30 years old, a smaller graft, one with a GW/SLW ratio between 30 and 35 percent, was used.
- GW/SLW GW-to- SLW
- Human hepatocytes De-identified healthy controls were acquired, and adult human hepatocytes were also obtained. Primary human hepatocytes were isolated using a three-step collagenase digestion technique as previously described (Faccioli et al., 2021, Organogenesis 17, 117-125). Briefly, the cell isolation was initiated by perfusion with 37 o C calcium-free HBSS supplemented with 0.5 mM EGTA and collagenase solution (VitaCyte, Indianapolis, IN) until the tissue was fully digested. The digested liver was cooled with ice-cold Leibovitz’s L-15 medium and strained through serial progressively smaller stainless-steel sieves with a final filtration through a 100 ⁇ m mesh.
- the final crude cell suspension was centrifuged twice, and the post-digest medium was aspirated. Cell viability was assessed after isolation using trypan blue exclusion, and only cell preparations with viability greater than 80% were cryopreserved. Single vials of cryopreserved hepatocytes were obtained from In Vitro ADMET Laboratories (Malden, MA) and Novabiosis (Durham, NC).
- Genotyping DNA was extracted with the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany), and samples were genotyped using TaqMan SNP genotyping assays for PNPLA3 (rs738409), (Thermo Fisher Scientific, San Jose, CA) (Yang et al., 2019, Hepatology 70, 231-240). Amplification and genotype clustering was performed using a StepOnePlus system (Applied Biosystems, Foster City, CA). Sanger sequencing DNA extraction was performed with the KAPA Express Extract DNA Extraction Kit (Kapa Biosystems, London, UK).
- PCR Polymerase chain reaction
- removing unincorporated sequencing reagents is performed using CleanSeq magnetic beads (Agencourt, Beckman Coulter, Brea, CA). Two control samples were included with every sequencing to ensure the proper performance of reagents and equipment. Production of High Titer Lentivirus Vector cloning, vector sequencing, and production of high-titer lentivirus were performed by Vectorbuilder (Chicago, IL).
- lentiviruses were produced by co-transfecting 293T cells with the expression vectors pLV[Exp]-CMV>EGFP or pLV[Exp]-CMV>hGPX4 (transcript variant NM_001039848.4 containing a selenocysteine insertion sequence (SECIS) element to ensure proper incorporation of selenocysteine), envelope plasmid (pMD2. G) and packaging plasmids (pMDLg/pRRE and pRSV-Rev) using FuGENE 6 transfection reagent (Promega Corporation, Madison, WI, USA).
- SECIS selenocysteine insertion sequence
- GSH reduced L-Glutathione
- GCA glycocholate, Sigma-Aldrich, Saint-Louis, MO
- GCDCA 100 ⁇ M glycochenodeoxycholate, Sigma-Aldrich, Saint-Louis, MO
- Obeticholic acid SML3096, Sigma- Aldrich, Saint-Louis, MO
- OCA Obeticholic acid
- the cell viability was normalized to non-treated samples and measured at 3, 6, 12, 24 and 48 hours after adding the ferroptosis inducers.10 ⁇ M of 3-amino- 4-(cyclohexylamino)-benzoic acid, ethyl ester (Ferrostatin-1, #17729) and 5 ⁇ M N-[(3- chlorophenyl)methyl]-spiro[piperidine-4,2'(1'H)-quinoxalin]-3'-amine (Liproxstatin-1, #17730) were used as ferroptosis inhibitors. Briefly, primary human hepatocytes were plated in a collagen-coated plate and kept overnight at 37 °C in 5% CO2.
- a hepatocellular cell line was obtained from ATCC (HepG2, ATCC, Manassas, VA), maintained in EMEM medium (ATCC, Manassas, VA) supplemented with 10% HyClone fetal bovine serum (ThermoFisher Scientific, Waltham, MA), 1% Penicillin/Streptomycin (ThermoFisher Scientific, Waltham, MA) and kept at 37°C in 5% CO2.
- Enoximone (Tocris, Bristol, UK) dissolved in DMSO was added to the medium at a final concentration of 250 ⁇ M 24h before collecting the cells.
- FBS-containing medium was replaced with serum-free medium that remained in contact with the cells for an additional 48 h.
- GCA at 250 ⁇ M (glycocholate, Sigma-Aldrich, Saint-Louis, MO) and GCDCA 100 ⁇ M (glycochenodeoxycholate, Sigma-Aldrich, Saint-Louis, MO) dissolved in medium were added for the last 24 h of the study. Quality control tests included viability and mycoplasma testing (Lonza, Walkersville, MD).
- the single-guide RNA (sgRNA) sequence was designed to cut the human PNPLA3 gene at the position chr22:43,928,854 to replace the minor allele (G) to the major allele (C).
- the sgRNA sequence can be found in the FIG.4C.
- the sgRNA was cloned into plasmid vector and nucleofected into a hepatocellular cell line together with the donor DNA (ACTTCTCTCTCCTTTGCTTTCACAGGCCTTGGTATGTTCCTGCTTCATCCCCTTTTACAGTGGCC TTATCCCTCCTTCCTTCAGAGGCGTGGTAAGT (SEQ ID NO: 3)).
- Post-isolation and post-thaw viability of primary human hepatocytes was evaluated by Trypan blue dye exclusion counting using a Countess 3 automated cell counter (Invitrogen, Carlsbad, CA). Analysis of Reactive oxygen species An oxidation-sensitive probe C11-BODIPYTM (581/591) (Invitrogen, Carlsbad, CA) was used to evaluate lipid peroxidation under a fluorescence microscope. Untreated hepatocytes were prepared with a cytocentrifuge and incubated for 30 min with 10 ⁇ M C11-BODIPYTM and washed with PBS.
- MDA Malondialdehyde
- Sigma-Aldrich Saint-Louis, MO
- Cryopreserved primary human hepatocytes were pelleted and analyzed directly, or they were cultured for 3h in suspension before the analysis.
- H2O2 hydrogen peroxide
- HyPerRed vector Additional Red vector
- live cells were imaged with a Nikon Inverted Research Fluorescence Microscope ECLIPSE Ti (Ermakova, Yulia G., et al. Nat. Comm.5.1 (2014): 5222).
- Total ROS in live cells was measured using the Cellular ROS Assay Kit (#ab186027, Abcam, Cambridge, UK).
- RNA sequencing RNA extraction, library preparation, and sequencing were performed at the University of Pittsburgh HSCRF Genomics Research Core. Briefly, total RNA was extracted from isolated primary human hepatocytes using RNeasy Plus Micro Kit (Qiagen). RNA integrity was assessed using the High Sensitivity RNA ScreenTape system on an Agilent 2200 TapeStation (Agilent).
- the SMART-Seq HT Kit (Takara Bio) was used to generate cDNA from 10 ng of total RNA, and the cDNA product was checked by an Agilent Fragment Analyzer system (Agilent) for quality control.
- the sequencing library was constructed by following the Illumina Nextera XT Sample Preparation Guide. One nanogram of input cDNA was fragmented and amplified using the Illumina Nextera XT kit. Equimolar amounts of each sample were finally pooled and sequenced on an Illumina Nextseq 500 system, using a paired-end 75-bp strategy. RNA-seq data analysis All memory-intensive computation were performed on clusters from the University of Michigan Greatlakes Advanced Research Computing resources.
- the quality of the raw fastq files were checked using FASTQC (version 0.11.9).
- the FastQC reports shows that the guanine-cytosine content of the samples ranges from 47% to 54%.
- a guanine-cytosine content between 30-40% is considered as too low as the DNA will be unstable, while a guanine-cytosine content between 70 -80% is considered too high because it makes PCR amplification more difficult. So, a guanine-cytosine content of about 50 to 60% is desirable (Amr et al., 2015, Clinical Genomics, 251-269).
- Another metric evaluated was the mean quality scores. All the samples had a score that falls within the acceptable threshold of 30.
- the QC-passed raw reads were then aligned to genome with STAR (version 2.7.5a) (Dobin et al., 2013, Bioinformatics 29, 15-21).
- the quality of the aligned reads was assessed using QoRTs (version 1.3.6) (Hartley et al., 2015, BMC bioinformatics 16, 1-7).
- the quality of the aligned reads was assessed based on the percentage of novel splice events. For all the samples, the percentage of novel splice events was about 1%. This value is within acceptable limits.
- RNAseq2 Downstream analysis was performed using DESeq2 in R (CRAN 4.04), BEAVR (a Browser-based tool for the Exploration and Visualization of RNAseq data) (Perampalam et al., 2020, BMC bioinformatics 21, 1-14), GSEA (Mootha et al., 2003, Nature genetics 34, 267-273; Subramanian et al., 2005, PNAS 102, 15545- 15550) and GraphPad prism version 8. The p-value were computed based on Wald test statistics. Genes with fold change greater than 1.5 and p-value less than 0.05 are considered significant.
- Flux propensity analysis The flux propensity of hepatocytes was computed by integrating RNA Seq data with the reconstructed genome-scale model of human metabolism (also known as Recon 2.2) (Swainston et al., 2016, Metabolomics 12, 1-7) based on COMPASS algorithm (Wagner et al., 2021, Cell 184, 4168-4185).
- x r opt the vector of maximum flux, through each and every metabolic reactions in Recon 2.2 was computed. This was achieved by solving the following optimization problem: Where, x is a vector through each metabolic pathway in Recon 2.2. m is the number of metabolic reactions in Recon 2.2.
- A is the stoichiometry matrix of all metabolites with respect to their metabolic reactions, ⁇ and ⁇ are the lower and upper bound of the flux, x. The bounds are set to a default value of ⁇ 1000.
- xrev denotes the reverse fluxes of reversible reactions which at this stage was set to zero to ensure only forward reactions were used in computing the maximum fluxes.
- gene expression data from samples were utilized to design a penalty variable for each metabolic reaction such that the numerical value of the penalty variable is inversely proportional to the level of expression of genes that participate in such reaction. The implication of this is that genes with low expression will impose stricter penalty on its corresponding reaction.
- M1 and M2 are the means of propensity score for group 1 (PNPLA3 rs738409:G homozygous hepatocytes) and group 2 (non-homozygous group), respectively.
- s 1 and s 2 are the standard deviations of group 1 and group 2, respectively.
- a positive Cohen’s D value indicate a reaction that’s is relatively more active in PNPLA3 rs738409:G homozygous hepatocytes while a negative value indicates relative higher activity in non- homozygous group.
- Mobile phase A was water with 0.1% formic acid while mobile phase B contains acetonitrile with 0.1% formic acid.
- the gradient method is as follows: 0 min: 1% B; 1 min: 1% B; 8 min: 99% B, 13 min: 85% B; 13.1 min: 1%B; 16 min: 1%B.
- 5 ⁇ L (2 ⁇ L for negative mode) of the samples were injected for analysis on an Agilent 6520 QTOF LC/MS machine using XBridgeBEH Amide XP Column (130 ⁇ , 2.5 ⁇ m, 4.6 mm X 150 mm) coupled with 5 mm VanGuard Cartridge. The column compartment was set at 40 ° C and the analysis was performed in both positive and negative modes.
- Mobile phase A was 10mM ammonium formate in water with 0.1% formic acid while mobile phase B contains 10mM ammonium formate in acetonitrile with 0.1% formic acid.
- the gradient method is as follows: 0 min: 1% B; 1 min: 1% B; 11.8 min: 80% B, 12.5 min: 1% B; 14.7 min: 1%B; 16 min: 1%B.
- the metabolite peaks were extracted using Agilent Masshunter Profinder based on an in-house library. Any metabolites whose RSD is greater than 30% in the QC measurements are removed from further analysis. The peak areas were normalized with cell numbers. Other downstream analysis was performed with Metaboanalyst® and GraphPad prism version 8.
- the cell pellets were transferred to the pre- chilled 2mL Precellys homogenizer tubes preloaded with 300-350mg of the small ceramic beads (1.4 mm OD).
- 200 ⁇ L of pre-chilled extraction solvent: 10% (wt/vol) trichloroacetic acid (TCA) in optimal grade water was added to each sample.
- samples were homogenized to disintegrate the cellular organelles using the Precellys + Cyrolys Evolution Homogenizer with the following settings: Speed 6000 RPM; Cycle 4 x 20s, Pause 120 s; Cyolys On; Temp 4 °C; Mode Auto.
- the MRMs for isotopologue measurements are in Supplementary Table 10. The data was corrected for natural abundance using IsoCorrectorR (v3.18) 99 .
- Pex2 and PNPLA3 knockdown The following siRNAs were ordered from GE Dharmacon: Accell Human Pex2 siRNA SMARTpool (E-006548-00-0050), Accell Human PNPLA3 siRNA SMARTpool (E-009564-00-0050) and Accell Non-targeting Pool (D-001910-10-50). siRNAs were reconstituted in siRNA Buffer (B-002000-UB- 100, Dharmacon, CO) at 100 ⁇ M. Hepatocytes were plated into collagen coated plates.
- ATP measurement The intracellular ATP content was measured on hepatocytes by using the ATP Determination Kit (A22066, Thermo Fisher Scientific, Waltham, MA) following the manufacturer’s instructions. The cells were incubated at 37°C during 1 hour in the absence or presence of 10 ⁇ g/ml oligomycin A (#11342, Cayman Chemical, Ann Arbor, MI), and 10 mM 2- deoxyglucose (#14325,Cayman Chemical, Ann Arbor, MI).
- the ATP content was measured by luminescence with an integration time of 1s per well.
- Apoptosis and Necrosis detection REALTIME-GLOTM Annexin V Apoptosis and Necrosis Assay (JA1011, Promega Corporation, Madison, WI, USA) was used to detect apoptosis and necrosis in primary human hepatocytes.
- the hepatocytes were treated with 10 ⁇ M staurosporine (STA, #1285, Tocris, Bristol, UK) and 10 ⁇ g/ml LPS (L2630, Sigma-Aldrich, Saint Louis, Missouri) for 6 hours and the luminescence signal was measured with an integration time of 1s per well (apoptosis) followed by a fluorescence measurement (Ex/Em: 485/525– 530nm) on a synergy HTX microplate reader (Biotek, Winooski, VT).
- Quantitative Real-Time PCR Total cellular RNA was isolated using the RNeasy Mini kit (QIAGEN, Hilden, Germany) and reverse transcribed using SuperScript III (Invitrogen, Carlsbad, CA) following the manufacturers’ instructions. The qPCR was performed with a StepOnePlus system (Applied Biosystems, Foster City, CA) using TaqMan Fast Advanced Master Mix (Life Technologies, Waltham, MA). Relative gene expression was normalized to ⁇ -actin (ACTB) mRNA. Relative expression was calculated using the ⁇ CT method. Western Blot Cells were trypsinized, pelleted, and washed with PBS.
- Lysis was performed with RIPA buffer (Sigma- Aldrich, Saint Louis, Missouri) and 1x HaltTM Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, Waltham, MA) for 30 min at 4°C, followed by centrifuging at 13,000g for 10 min at 4°C. Protein concentrations of the supernatant were determined by comparison with a known concentration of bovine serum albumin using a Pierce BCA Protein Assay Kit (ThermoFisher Scientific, Waltham, MA).30 ⁇ g of lysate were loaded per well into 10% Mini-PROTEAN TGXTM gel (BioRad, Hercules, CA).
- Proteins were transferred onto a PVFD Transfer Membrane (Thermo Fisher Scientific, Waltham, MA). Membranes were incubated with a primary antibody solution overnight and then washed before incubation in secondary antibody solution for 1 hour. Target antigens were finally detected using SuperSignalTM West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, Waltham, MA). Images were scanned and analyzed using ImageJ software. Immunostaining Human liver tissue was fixed in 4% paraformaldehyde for 12 h and 70% ethanol overnight at 4°C and then embedded in paraffin. Cut sections (5-7 microns) were mounted on glass slides for immunofluorescence and immunohistochemistry.
- Tissue sections were then incubated with the secondary biotinylated antibody corresponding to the animal species of the primary antibody (BA-1000; Vector Laboratories, Burlingame, CA) and exposed to 3,3 ’ -diaminobenzidine (SK-4105; Vector Laboratories) to visualize the peroxidase activity. Counterstaining was performed with Richard-Allan Scientific Signature Series Hematoxylin (Thermo Scientific, Waltham, MA). All procedures followed the kit instructions. Images were captured with a Nikon Eclipse Ti microscope. Following that, images were analyzed using ImageJ software. RGB stacks were generated, pre-processed to equalize the illumination within the stack, thresholded, and measured.
- ATF6 and E-Cadherin immunohistochemistry images were acquired using the PE Opera Phenix using the Harmony 5.1 software. Images were acquired with a 40X/1.1 NA Water Immersion objective. Fluorescence images were acquired with the following channels (Hoechst Ex.405/ Em.435-480, ATF6640 Ex./ Em.650-760, E-Cadherin Ex.488/ Em.500-550). To gather maximum intensity projections, a z-stack was acquired in confocal mode with 14 planes and a distance between each plane of 1.2 um. To determine the number of ATF6-positive nuclei we used Harmony 5.1 to create an analysis protocol that identifies nuclei based on Hoechst signal.
- ATF6 signal we sampled a ring region of 1.5X the outer border of the nuclear region. ATF6-positive cells were then quantified by thresholding signal above the ATF6 negative control well average signal. The overall percent of ATF6-positive cells was then determined by taking the total count of ATF6-positive cells and expressing it as a percent of the total number of nuclei (Hoechst-positive cells) in 49 fields per condition. Patients’ hepatic paraffin sections were analyzed by two different pathologists. Pathologic findings were assessed according to the Liver Cancer Study Group of Japan.
- Liver steatosis was graded based on the percentage of fat: grade 0 (healthy, ⁇ 5%), grade 1 (mild, 5%-33%), grade 2 (moderate, 34%-66%), and grade 3 (severe, >66%). Inflammation and fibrosis were evaluated according to the New Inuyama Classification for histological assessment score for chronic hepatitis.
- XBP1 splicing quantification Total cellular RNA was isolated using the RNeasy Mini kit (QIAGEN, Hilden, Germany) and reverse transcribed using SUPERSCRIPTTM III (Invitrogen, Carlsbad, CA) following the manufacturers’ instructions.
- Complementary DNA was amplified using two sets of primers: a total XBP1 (tXBP1) and sequence that recognized between the unspliced (uXBP1) and spliced XBP1 (sXBP1) (Yoon et al., PLoS One 14, e0219978 (2019)).
- the amplification products were resolved in a 2% agarose gel and the quantification was performed using ImageJ software. Quantification and Statistical Analysis Analysis of survival: the primary outcome of interest was the recipient’s overall survival, defined as the time from transplantation to the date of death or most recent follow-up. Mendelian randomization was performed and the effect of the genetic variant on the outcome was evaluated in a recessive genetic model.
- Variables were tested for normal distribution prior to statistical testing. Comparisons of two groups were performed using a non- parametric Mann-Whitney U test or a parametric two-tailed t-test (indicated in the corresponding figure legends). For groups of three or more, the test for significance was performed using either a parametric one- way analysis of variance (ANOVA) if all samples were normally distributed, or a non-parametric Kruskal- Wallis test for non-normal distributions. Both tests were accompanied with a post-test analysis for multiple comparison correction (indicated in the corresponding figure legends). Simple linear regression was used for correlation analysis. Categorical variables were expressed using numbers and percentages (%). These were compared using Fisher exact tests.
- EXAMPLE 2 Patient Characteristics The impact of PNPLA3 rs738409 minor allele frequency in healthy subjects and ESLD patients in a US cohort was first assessed.
- PNPLA3 rs738409 variant in donors and recipients have been linked with GWAS to a spectrum of liver diseases ranging from steatosis to non-alcoholic steatohepatitis, hepatic fibrosis, ESLD and increased risk of mortality in the general population (FIG.1A).
- PNPLA3 rs738409:G minor allele was found at higher frequencies in ESLD (28%) individuals compared to healthy individuals (6%).
- the PNPLA3 rs738409:G gene variant was present (minor homozygosity) in about 50% of recipients and 28% of donors (FIG.1B). In contrast, the frequency of the PNPLA3 rs738409:G gene variant in the general population in US is about 6-8% (Lazo et al., 2021, Clin Gastroenterol Hepatol 19: 2606-2614).
- the PNPLA3 variant minor allele >G was clearly more frequent among recipients compared to the general public and the donor population (FIG.1A) in this Japanese cohort since the PNPLA3 rs738409:G variant in transplant recipients is expected to be associated with the development of ESLD (Trepe et al., 2020, Hepatol 72: 1196-1209). Also, the increased frequency of this variant in the LDLT program donors may be a consequence related to the fact that most living donors are genetically related to their LDLT relative with liver disease.
- EXAMPLE 3 Relative association of PNPLA3 rs738409 variant in recipients to signs of ESLD Individuals with decreased hepatic lipolysis, conferred by the presence of the PNPLA3 variant, have been reported to reduced release of triglycerides and cholesterol into the circulation less compared to controls (Ruschenbaum, 2018, Hepatol Commun 2: 798-806). Indeed, the presence of PNPLA3 variant was associated with reduced serum cholesterol levels at the time of LDLT compared to patients who did not have this genetic variant. Moreover, explanted livers from recipients positive for PNPLA3 variant showed significant hepatic steatosis and moderate-to-severe necroinflammation in the liver (FIG.1B).
- the dual LDLT was performed to avoid two potential LDLT-associated complications: development of small-for-size donor liver hemodynamic instability in the recipient and production of a small remnant liver that could produce liver failure in the donor.
- the right liver lobe graft (donor 1) was heterozygous for the PNPLA3 variant, and the left liver lobe (donor 2) graft was homozygous for the PNPLA3 rs738409:G.
- neither donor graft had significant hepatic steatosis ( ⁇ 0.5% hepatic steatosis).
- EXMAPLE 5 PNPLA3 rs738409:G variant in human hepatocytes modulates metabolism, cellular stress and death through alterations in metabolic function
- PNPLA3 rs738409 variant causing reduced capacity to adapt to stressors of hepatocytes from LDLT-patients
- ACADL acyl-CoA dehydrogenase, long chain
- HSPA5 heat shock 70 KDa protein 5
- DDIT3 DNA damage inducible transcript 3
- the flux propensity analysis indicates a relative increase in metabolic activity involving pyruvate flux into the peroxisome in human Heps-PNPLA3-G (pyruvate peroxisomal transport via proton symport, PYRt2p_pos (Fig.2B).
- An increase in lactate dehydrogenase activity was observed in the human Heps- PNPLA3-G group (r0173_neg and LDH_L in Fig.2B).
- GCA and GCDCA bile acid metabolites
- FOG.2A bile acids efflux transporter SLC51A
- ER stress is a critical consequence of the presence of PNPLA3 rs738409:G variant in human primary hepatocytes.
- transcript and protein analysis was performed. Upon mRNA expression and immunohistochemistry analyses, a significantly higher expression of HSPA5 was found at both the mRNA and protein levels in human Heps-PNPLA3-G (Fig.3C).
- ER stress can suppress bile acid synthesis by regulating CYP7A1, a rate-limiting enzyme in the synthesis of new bile acids (Henkel et al., Cell Mol Gastroenterol Hepatol 3, 261-271 (2017)).
- CYP7A1 is significantly downregulated in human Heps-PNPLA3-G compared to controls in the transcriptome analysis (Fig.2A, heatmap panel). Additionally, after analyzing genes involved in cholesterol synthesis (HMGCR), bile acid synthesis (CYP7A1, CYP27A1 and CYP8B1), and bile acid homeostasis (FXR, BSEP and NTCP) only FXR was significantly downregulated in human Heps-PNPLA3-G when compared to controls (Fig.3C & Suppl. Fig.4A).
- BAAT amino acid N-acyltransferase
- activating transcription factor 6 (ATF6), an ER bound protein that translocate to the nucleus in response to stress (Hetz et al., Nat Rev Mol Cell Biol 21, 421-438 (2020)), demonstrated increased positive staining within the nucleus of hepatocytes from donor human livers carrying the PNPLA3-G rs738409 gene variant as compared to control donor human livers (Fig.3G).
- XBP1 X-box-binding protein 1
- palmitoylcarnitine an intermediate metabolite in the carnitine carrier system
- CPT1 carnitine palmitoyltransferase 1
- CPT2 CPT2
- ACADL acyl-CoA dehydrogenase long chain
- the flux propensity analysis reveals an upregulation of pyruvate flux into the peroxisome (PYRt2p_pos on FIG.2B).
- ACOX1 is synthesized as a 70 kDa precursor protein, however, inside peroxisomes, it is processed into a 50 kDa protein (Klouwer et al., 2021, Front Cell Dev Biol 9: 661298).
- a significant increase in the ratio of the protein levels of the peroxisomal ACOX1 (50 kDa) to precursor ACOX1 (70 kDa) in human Heps-PNPLA3-G was found (FIG.4B), indicating increased peroxisomal ⁇ - oxidation in human Heps-PNPLA3-G when compared to human Heps-PNPLA3-C/G controls.
- HepG2 human hepatoma cell line
- HepG2 isogenic human Heps-PNPLA3-G variant (minor homozygous) and gene edited control human Heps-PNPLA3-C Cas9 (major homozygous) were generated (FIG.4C).
- acetyl-Coenzyme A acyltransferase 1 was analyzed (Fig. 4G).
- the mitochondria and peroxisomal ⁇ -oxidation activities in human Heps-PNPLA3-G and Heps- PNPLA3-C/G controls were investigated.
- Stable isotope tracing experiment was done using C1-labelled palmitic acid, a long chain fatty acid that are predominantly oxidized via mitochondria ⁇ -oxidation and Docosanoic-1,2,3,4- 13 C4 acid, a very long chain fatty acid preferred by peroxisome ⁇ -oxidation.
- PEX2 peroxisomal biogenesis factor 2
- a protein located in the peroxisomal membrane that mediates the detection of ROS within the peroxisome and the process of fatty acids break down (Ding et al., Nat Metab 3, 1648-1661 (2021)). Reducing PEX2 would potentially heighten lipolysis, releasing fatty acids that would be subsequently metabolized through ⁇ -oxidation and increase ROS production.
- reducing PEX2 expression in human Heps-PNPLA3-G and human Heps-PNPLA3-C/G controls resulted in a significant increase of ROS production in human Heps-PNPLA3-G compared to controls (Fig.4K).
- PNPLA3-G rs738409 gene variant confers an elevated level of ⁇ - oxidation specifically in peroxisomes.
- EXAMPLE 7 Human donor livers and hepatocytes carrying PNPLA3 rs738409:G variant are susceptible to ferroptosis It was investigated whether the PNPLA3 rs738409:G variant is associated with metabolic capacity to adapt to ferroptosis which, is a unique cell death modality that is the result interaction between cellular metabolism, specifically, amino acids, lipids, iron and redox reactions (Jiang et al., 2021, Nat Rev Mol Cell Biol 22: 266-282).
- ATP levels in the presence of either an inhibitor of mitochondrial oxidative phosphorylation, oligomycin A, a F1F0-ATP synthase inhibitor or an inhibitor of glycolysis, 2- deoxyglucose (2DG) were measured.
- 2DG 2- deoxyglucose
- hepatic triglycerides are significantly enriched in polyunsaturated fatty acids (PUFA) in carriers with the PNPLA3 rs738409:G variant (Luukkonen et al., 2016, J Hepatol 64: 1167- 1175).
- PUFA polyunsaturated fatty acids
- long-chain PUFAs are highly susceptible to lipid peroxidation, a crucial driver of ferroptosis (Yang et al., 2016, PNAS 113, E4966-4975).
- PNPLA3 rs738409:G variant mediates compensatory changes in iron metabolism and high baseline levels of lipid peroxidation in human hepatocytes
- FINO2 was used, a direct inducer of iron oxidation that ultimately causes widespread lipid peroxidation and ferroptosis (Gaschler et al., 2018, Nat Chem Bio 14: 507-515).
- Human Heps-PNPLA3-G treated with ferroptosis inhibitors exhibited both increased cellular viability and lower level of ROS when compared to human Heps-PNPLA3-C/G controls (Fig.5E).
- gene-knockdown of PNPLA3 in both human Heps-PNPLA3-G and Heps- PNPLA3-C/G was done and it was found that human Heps-PNPLA3-C/G exhibited an increase in lipid peroxidation when compared to human Heps-PNPLA3-G which maintained ongoing lipid peroxidation (Fig. 5F).
- EXAMPLE 9 Rescue of ferroptosis-driven programmed cell death in hepatocytes homozygous for the PNPLA3 rs738409:G variant Three approaches were evaluated: i) a pharmacological approach using an FDA-approved iron chelator Deferoxamine (DFO); ii) a nutritional supplementation using reduced L-Glutathione (GSH); and iii) a gene therapy approach directed to increasing GPX4-expression using a viral vector (FIGs.6A-6G).
- DFO iron chelator Deferoxamine
- GSH reduced L-Glutathione
- FIGS.6A-6G a gene therapy approach directed to increasing GPX4-expression using a viral vector
- GPX4 protein expression of GPX4 in human livers.
- overexpressing GPX4 in human Heps-PNPLA3-G without exogenous supplementation enables these cells to utilize endogenous GSH to reduce lipid peroxidation and ferroptosis, and enhance cell viability (FIG.6F).
- FOG.6F enhance cell viability
- PNPLA3 rs738409:G variant was profiled in a US cohort of 126 healthy donor livers, 54 ESLD livers and 79 liver graft donors and 83 LDLT recipients.
- the PNPLA3 rs738409:G variant was significantly frequent in ESLD livers and linked to poor recipient survival following LDLT and progressive liver disease in one donor graft in a patient who required two donor grafts for LDLT.
- the presence of the PNPLA3 rs738409:G variant increases lipid peroxidation, induces mitochondrial shrinkage and significant metabolic and transcriptomic alterations, upregulates peroxisomal ⁇ -oxidation and elevates bile acids levels. There is a survival advantage of genetic screening of LDLT donors.
- the PNPLA3 gene encodes for the patatin-like phospholipase domain-containing protein 3, located on hepatocyte lipid droplets and has lipase activity for long chain PUFAs (Li et al., 2012, J clin Invest 122: 4130-4144; He et al., 2010, J Biol Chem 285: 6706-6715).
- the PNPLA3 rs738409:G variant promotes triglyceride accumulation in the lipid droplet of the hepatocyte (He et al., 2010, J Biol Chem 285: 6706- 6715; Tilson et al., 2021, Hepatology 74: 2998-3017).
- PNPLA3 rs738409:G variant is also associated with hepatic fibrosis, inflammation (independent of diabetes or obesity) (Valenti et al., 2010, Hepatol 51: 1209-1217; Liu et al., 2014, Hepatol 61: 75-81; Sookoian et al., 2009, J Lipid Res 50: 2111-2116), and reduced serum levels of very low density lipoprotein and cholesterol in patients with metabolic syndrome (Pirazzi et al., 2012, J Hepatol 57: 1276-1282; Krarup et al., 2012, PLoS One 7: e40376; Mancina et al., 2015, J Clin Endocrinol Metab 100: E821-825).
- the PNPLA3 rs738409:G variant has also been associated with the development of post-transplant hepatic steatosis and steatohepatitis in the chronic hepatitis C infected population (Miyaaki et al., 2018, Hepatol Res 48: E335- 339).
- the present results document that the presence of the PNPLA3 rs738409:G variant in the donor graft is associated with decreased recipient survival.
- donors homozygous for the PNPLA3 rs738409:G variant were significantly younger than non-homozygous donors, age was not a confounding variable in the Cox proportional hazards model.
- isolated primary human hepatocytes were genetically profiled for MAFLD-related polymorphic sites and employed metabolomics, transcriptomic analysis and integrated both omics approaches using the flux propensity analysis, COMPASS, computation pipeline to uncover precise alterations in human hepatocyte function that carried the PNPLA3 rs738409:G variant.
- COMPASS flux propensity analysis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Diabetes (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Engineering & Computer Science (AREA)
- Inorganic Chemistry (AREA)
- Molecular Biology (AREA)
- Emergency Medicine (AREA)
- Endocrinology (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Methods are disclosed for inhibiting a liver disease in a subject. These methods include administering to the subject an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA), or a pharmaceutically acceptable salt thereof, thereby treating or preventing the liver disease in the subject. Also disclosed are compositions including an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA), or a pharmaceutically acceptable salt thereof, for use in inhibiting liver disease in a subject.
Description
METHODS OF PREVENTING OR TREATING LIVER DISEASE CROSS REFERENCE TO RELATED APPLICATION(S) This claims the benefit of U.S. Provisional Application No.63/532,314, filed August 11, 2023, which is incorporated herein by reference. ACKNOWLEDGMENT OF GOVERNMENT SUPPORT This invention was made with government support under DK099257 awarded by the National Institutes of Health. The government has certain rights in the invention. FIELD OF THE DISCLOSURE This relates to the inhibiting of liver disease, specifically to the use of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA) to prevent or treat liver failure in a subject, such as a subject that is homozygous for the rs738409:G mutation in the PNPLA3 gene. SEQUENCE LISTING The contents of the electronic sequence listing (Sequence.xml; Size 6,222 bytes; and Date of Creation: July 5, 2024) is herein incorporated by reference in its entirety. BACKGROUND Globally, end-stage liver disease (ESLD) claims over two million lives each year. In addition, there is no approved drug therapy for metabolic-associated fatty liver disease (MAFLD), which is the most rapidly increasing cause of ESLD in the US. Development and progression of MAFLD is affected by genetic and environmental factors, inflammatory cytokines, adipokines, bacterial products, and metabolites originating from the intestine and adipose tissue. Aggressive clinical management of ESLD can extend life, but the only definitive therapy is liver transplantation. Widespread use of liver transplantation, however, is limited by a shortage of donor organs, primary graft dysfunction, the need for long-term immune suppression, and high cost. Living donor liver transplantation (LDLT) can offer superior recipient outcomes in some settings when compared with deceased donor liver transplantation (DDLT). These include better timing of the transplant and improved quality of the donor organ with reduced organ ischemia time. However, 10%-22% of liver transplant recipients ultimately require re-transplantation, and survival following re-transplantation is significantly worse. There is a need for agents that inhibit liver disease, including ESLD and MAFLD. SUMMARY Methods are disclosed for inhibiting a liver disease in a subject. These methods include administering to the subject an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12- tricosadiynoic acid (TDYA), thereby inhibiting the liver disease in the subject. In some aspects, the PDEIII inhibitor is Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, or a pharmaceutically
acceptable salt thereof. In some aspects, the subject is at risk of developing a liver disease, and the disclosed method prevents the liver disease. In other aspects, the subject has the liver disease, and the disclosed method treats the liver disease. Compositions are also disclosed that include an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA), or a pharmaceutically acceptable salt thereof, for use in inhibiting liver disease in a subject. These compositions are of use in any of the methods disclosed herein. The foregoing and other features of this disclosure will become more apparent from the following detailed description of several aspects which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE FIGURES FIGs.1A-1F: Ramifications of the PNPLA3 rs738409 genetic variant in LDLT recipients. Genotype frequency of the PNPLA3 rs738409 variant in a US cohort (healthy individuals n=126 and 39% with Body Mass Index >30, End-stage liver disease patients n=54 and 58% with Body Mass Index >30) and a Japanese patient cohort (healthy individuals n=79 and 1% with Body Mass Index >30, End-stage liver disease patients n=83 and 8% with Body Mass Index >30). Human symbols represent 10% prevalence. (FIG.1A). Forest plot displaying a subgroup analysis of recipient’s minor PNPLA3 rs738409:G genotypes associated with recipient’s hepatic steatosis (>5%), hepatic necroinflammation (A2-A3, New Inuyama Classification), diabetes, and overweight (BMI>25) at the time point of transplantation (n=83) (Odds ratio [95% confidence interval], Fisher’s exact test) (FIG.1B). Sankey diagram visualizes organ allocation broken down by donor’s (left) and recipient’s (right) genotype (donors n=77, recipients n=77). The widths of the arrows are proportional to the flow quantity. N refers to the number of donors or recipients for each genotype (FIG.1C). Kaplan-Meier estimates of death from any cause at 5 years among recipients who received a donor graft positive for a minor homozygous genotype (PNPLA3 rs738409 p=0.03, Log-rank Mantel-Cox test, n=79). The minor genotype’s survival function is shown in red. HRs and 95% CIs for predictors of death in univariable Cox regression model (hazard ratio, 3.38 [95% CI, 1.03 to 11.1]) (FIG. 1D). Isolated primary human hepatocytes were grouped according to their PNPLA3 rs738409 genotype for analysis (n=175) and subsets of samples utilized for metabolic, transcriptomic and flux propensity analysis. (FIG.1E) Untargeted metabolomic profiles comparing primary human hepatocytes homozygous for the PNPLA3 rs738409:G variant with non-homozygous hepatocytes (CC/CG n=6, GG n=6) coupling transcriptomic analysis of related gene expression (CC/CG n=4, GG n=4) (FIG.1F). FIGs.2A-2C: Transcriptomic profiles and flux propensity analysis of primary human hepatocytes homozygous the PNPLA3 rs738409:G variant. Transcriptomic analysis of genes involved in hepatocellular ferroptosis and iron metabolism comparing primary human hepatocytes homozygous for the PNPLA3 rs738409:G variant with non-homozygous hepatocytes (CC/CG n=4, GG n=4). Heatmap showing differential expression based on z-score of genes related to oxidative stress, ferroptosis and iron metabolism comparing primary human hepatocytes homozygous for the PNPLA3 rs738409:G variant with non-
homozygous hepatocytes (CC/CG n=4, GG n=4). (FIG.2A & 2C). Bubble plot showing the flux propensity analysis of reactions in metabolic pathways of human hepatocytes (CC/CG: n=4, GG: n=4. The analysis is based on COMPASS algorithm using Recon 2.2 (FIG.2B). FIGs.3A-3I: Alterations in bile acid metabolism contribute to the production of ER stress. Overlay of flux propensity analysis results on cholesterol and bile acids synthesis pathway. Pathway are curled from Kyoto Encyclopedia of Genes and Genomes (KEGG). Pathways indicated in green are downregulated in PNPLA3 rs738409:G homozygous human hepatocytes compared to non-homozygous controls. ((FIG.3A). Bubble plot showing flux propensity analysis result zoomed on metabolic pathway reactions involved in cholesterol and bile acids synthesis. (FIG.3B). Immunofluorescence micrographs of HSPA5 in human hepatocytes. HSPA5 Immunofluorescence intensity quantification (mean ± SD, *p=0.02, Mann-Whitney test, CC/CG: n=6, GG: n=6). Quantitative gene expression analysis of CYP7A1, BSEP, FXR and HSPA5 in human hepatocytes normalized to actb (mean ± SD, *p=0.03, p=0.1944, p=0.1255, p=0.1195, Welch’s t-test, CC/CG: n=6, GG: n=6) (FIG.3C). Immunofluorescence micrographs of HSPA5 in human hepatocytes exposed to GCA (250μM) and GCDCA (100μM) for 24h. Quantitative gene expression analysis of HSPA5 in human hepatocytes exposed to GCA (250μM) and GCDCA (100μM) for 24h (mean ± SD, p=0.77, *p=0.01, Welch’s t-test, CC/CG: n=6, GG: n=6). Quantitative gene expression analysis of BSEP in human hepatocytes exposed to GCA (250μM) and GCDCA (100μM) for 24h (mean ± SD, *p<0.05, **p<0.01, Welch’s ANOVA with Dunnett’s multiple comparisons, CC/CG: n=3, GG: n=3). (FIG.3D Histological micrographs (BAAT) of donor livers. BAAT immunohistochemistry signal quantification (p<0.001, Mann-Whitney test, CC/CG: n=6, GG: n=6). (FIG.3E). Histological micrographs (CHOP) of donor livers. CHOP immunohistochemistry signal quantification (p=0.0144, Mann-Whitney test, CC/CG: n=6, GG: n=6). (FIG.3F). Histological micrographs (ATF6) of donor livers. Quantification of immunofluorescent signal in the cell nucleus (p<0.01, Mann-Whitney test, CC/CG: n=6, GG: n=6) (FIG. 3G). XBP1 splice detection. Quantification of unspliced XBP1 in percentage of total XBP1 (mean ± SD, p=0.005, Welch’s t-test, CC/CG: n=9, GG: n=9) and spliced XBP1 normalized to the total XBP1 (mean ± SD, p=0.005, Welch’s t-test, CC/CG: n=9, GG: n=9) (FIG.3H) Quantitative gene expression analysis of FXR downstream (SHP, CYP7A1 and BSEP) genes after Obeticholic acid (OCA) treatment in primary hepatocytes (one-way ANOVA, CC/CG: n=4, GG: n=4). Immunofluorescence micrographs and quantification of HSPA5 in human hepatocytes exposed to OCA (10μM) and for 72h (FIG.3I). FIGs.4A-4K: Alterations in β-oxidation and bile acid synthesis contribute to the production of reactive oxygen species and ferroptosis. Hypothesizing crosstalk between mitochondria and peroxisomes suggests increased peroxisome β-oxidation due to reduced mitochondria β-oxidation in primary human hepatocytes homozygous for the PNPLA3 rs738409:G variant. β-oxidation in peroxisomes produces reactive oxygen species (FIG.4A). Western blot analysis of ACOX1 intensity was normalized to GAPDH. Intensity ratio of the peroxisomal 50kDA ACOX1 and precursor 70kDa ACOX1 (mean ± SD, *p=0.04, Welch’s t- test, CC/CG: n=3, GG: n=3) (FIG.4B). The single-guide RNA (sgRNA) sequence (SEQ ID NO: 4) was designed to cut at the chr22:43,928,854 position to replace the minor allele -G- with the major allele -C-
using a donor template. Sanger trace sequences of the PNPLA3 genotypes, SEQ ID NO: 5 and SEQ ID NO: 6 (FIG.4C). Fluorescent micrographs of HyPerRed in transiently transfected HepG2 cells exposed to enoximone (250μM) at 1h between the micrographs. Quantification of H2O2 by HyPer-Red intensity (****p<0.001, ANOVA, CC: n=15 GG: n=15) (FIG.4D). Quantitative analysis of lipid peroxidation by MDA (mean ± SD, *p=0.03, **p=0.005, ****p<0.0001, one-way ANOVA, n=4) in human hepatoma cell line (HepG2) and gene edited control Heps-PNPLA3-CCas9 to enoximone (250μM) for 24h. Lipid peroxidation rescue % of enoximone (mean ± SD, *p=0.045, Welch’s t-test, CC: n=4, GG: n=4). Viability of human hepatoma cell line (HepG2) and gene edited control Heps-PNPLA3-CCas9 exposed to enoximone (250μM) for 24h after ferroptosis induction with FINO2 (20μM) for 6h (mean ± SD, ****p<0.0001, ANOVA, n=5). Cell death rescue % of enoximone (mean ± SD, **p=0.003, Welch’s t-test, CC: n=6, GG: n=6) (FIG.4E). Fluorescence micrographs of C11-BODIPY™ oxidation in human hepatoma cell line (HepG2) and gene edited control Heps-PNPLA3-CCas9 exposed to enoximone (250μM) for 24h and FINO2 (20μM) for 3h. Quantitative analysis of lipid peroxidation by MDA (*p=0.01,**p=0.003, Brown-Forsythe ANOVA, n=5) in human hepatoma cell line (HepG2) and gene edited control Heps-PNPLA3-CCas9 to enoximone (250μM) for 24h and FINO2 (20μM) for 3h. Lipid peroxidation induction % of FINO2 (mean ± SD, *p=0.02, Welch’s t-test, CC: n=5, GG: n=5). Lipid peroxidation rescue % of enoximone (mean ± SD, *p=0.04, Welch’s t-test, CC: n=5, GG: n=5) (FIG.4F). Histological micrographs (ACAA1) of donor livers. ACAA1 immunofluorescent signal quantification (p=0.001, Mann-Whitney test, CC/CG: n=6, GG: n=6) (FIG.4G). Schematic of the generation of the M+1 Acetyl-coA from C1-labelled palmitic acid via mitochondria β-oxidation. Inserted is the scatter plot indicating the enrichment of M+1 Acetyl-CoA in hepatocyte extracts homozygous for PNPLA3 rs738409:G variant (GG, n=9) compared to non-homozygous control (CC/CG, n=8). Horizontal bar indicates the mean and data are analyzed using two-tailed Mann Whitney U-test (FIG.4H). Schematic of the generation of the M+2 Acetyl-coA from Docosanoic-1,2,3,4- 13C4 acid via peroxisomal β-oxidation. Inserted is the scatter plot indicating the enrichment of M+2 Acetyl- CoA in hepatocyte extracts homozygous for PNPLA3 rs738409:G variant (GG, n=9) compared to non- homozygous control (CC/CG, n=8). Horizontal bar indicates the mean and data are analyzed using two- tailed Mann Whitney U-test. Created with BioRender.com (FIG.4I). Total ROS measurement in primary human hepatocytes resulted from the peroxisomal beta-oxidation of 0.1 mM of Phytanic Acid (*p=0.029. ***p=0.002, Brown-Forsythe ANOVA, CC/CG: n=9, GG: n=9) (FIG.4J). Total ROS measurement in primary human hepatocytes after Pex2 knockdown **p=0.0056. ***p=0.0005, Brown-Forsythe ANOVA, CC/CG: n=9, GG: n=9) (FIG.4K). FIGs 5A-5F: Primary human hepatocytes positive for the PNPLA3 rs738409:G variant show signs of ferroptosis. Histological micrographs (Adipophilin 2) of donor livers. Adipophilin 2 immunohistochemistry positive hepatocytes quantification (p<0.001, Welch’s t-test, CC/CG: n=6, GG: n=6). Nile Red staining micrographs and quantification of lipid droplet positive human hepatocytes comparing between PNPLA3 rs738409:G homozygous and non-homozygous hepatocytes (mean ± SD, *p=0.01, Mann- Whitney test, CC/CG: n=10, GG: n=6). Lipid peroxidation in human hepatocytes shown by representative
C11-BODIPY™ (581/591) micrographs and malondialdehyde (MDA) quantification (mean ± SD, *p=0.04, Welch’s t-test, CC/CG: n=6, GG: n=6). Transmission electron microscopy (TEM) images of mitochondria in human hepatocytes (scale bar: 400nm, LD: Lipid droplet) and the mitochondria form factor ([perimeter]2 / 4π [area]) (mean ± SD, ****p<0.0001, Mann-Whitney test, CC/CG: n=122, GG: n=104). Total endogenous ATP quantification in primary human hepatocytes (**p=0.0012, Welch’s t-test, CC/CG: n=6, GG: n=6) and relative ATP contribution of the glycolytic and oxidative phosphorylation systems in energy production (***p<0.001). (FIG.5B-5C) Histological micrographs (FSP1, TrF1 and ACSL4) of donor livers. Immunohistochemistry signal quantification (FSP1: p<0.001, TrF1: p=0.0032, ACSL4: p<0.0001, Welch’s t-test, CC/CG: n=6, GG: n=6). Quantitative gene expression analysis of FADS2, ACSL4 and SCD in human hepatocytes normalized to ACTB (mean ± SD, *p=0.02, p=0.28, *p=0.02, Welch’s t-test, CC/CG: n=6, GG: n=6). Western blot analysis of ACSL4 intensity was normalized to GAPDH (mean ± SD, *p=0.03, Welch’s t-test, CC/CG: n=3, GG: n=3). (FIG.5D) Lipid peroxidation of human hepatocytes evaluated by MDA and C11-BODIPY™ 3h after treatment with FINO2 (50μM) (mean ± SD, **p=0.01, p=0.055, paired t-test, CC/CG: n=6, GG: n=6). Viability of human hepatocytes in the presence of FINO2 (50μM) 24 hours after compound treatment (mean ± SD, CC/CG: ***p=0.001, GG: *p=0.01, paired t-test, CC/CG: n=6, GG: n=6). Simple linear regression analysis of induced lipid peroxidation (MDA) and human hepatocyte viability after treatment with FINO2 (50μM) (CC/CG: R2=0.51, p=0.02, n=5; GG: R2=0.76 p=0.001, n=5). Transmission electron microscopy (TEM) images of mitochondria in human hepatocytes (scale bar = 400nm). Mitochondrial form factor ([perimeter]2 / 4π [area]) 6h after incubation with FINO2 (50μM) (mean ± SD, CC/CG: ****p<0.0001, GG: p=0.07, Mann-Whitney test, CC/CG: n=59, GG: n=56). (FIG.5E) Viability of human hepatocytes in the presence of 10 μM Fer1 (***p=0.0006, Welch’s t-test, CC/CG: n=6, GG: n=6) and 5 μM Lipro1 (***p=0.0001, Welch’s t-test, CC/CG: n=6, GG: n=6) and ROS production after treatment with 10 μM Fer1 (**p=0.0021, Welch’s t-test, CC/CG: n=6, GG: n=6). (FIG.5F) PNPLA3 knockdown increases lipid peroxidation in CC/CG primary hepatocytes (*p=0.049, Welch’s t-test, CC/CG: n=6, GG: n=6 FIGs.6A-6G. Fluorescence micrographs of C11-BODIPY™ lipid peroxidation in human hepatocytes under the presence and absence of DFO (100μM) and FINO2 (50μM). Quantitative measurement of lipid peroxidation by MDA in human hepatocytes after treatment with DFO (100μM) when cultured with FINO2 (50μM) for 3h (*p<0.01, **p<0.001, Welch’s t-test, CC/CG: n=6, GG: n=6). Viability of human hepatocytes treated with DFO (100μM) for 24h and exposed to FINO2 (50 μM) for 3h (*p<0.04, **p<0.001, paired t-test, Welch’s t-test, CC/CG: n=6, GG: n=6). Transmission electron microscopy micrographs of hepatocyte mitochondria and the mitochondrial form factor ([perimeter]2 / 4π [area]) upon incubation with DFO (100μM) and FINO2 (50μM) for 6h (mean ± SD, *p=0.04, Mann-Whitney test, CC/CG: n=43, GG: n=77, scale bar = 400 nm) (FIG.6A,6C,6E). C11-BODIPY™ micrographs of lipid peroxidation in human hepatocytes cultured in the presence of GSH (10µM) for 24h and FINO2 (50μM) for 3h. Lipid peroxidation quantification in primary human hepatocytes exposed to GSH (10µM) for 24h and then to FINO2 (50μM) for 3h. (mean ± SD, *p<0.01, **p<0.001, paired t-test, Welch’s t-test, CC/CG: n=3,
GG: n=3). Viability of human hepatocytes treated with GSH (10µM) (mean ± SD,*p=0.0145, **p=0.002, paired t-test, Welch’s t-test, CC/CG: n=3, GG: n=3) (FIG.6B,6D). Histological micrographs (GPX4) of donor livers. GPX4 immunofluorescent signal quantification (p=0.1276, Mann-Whitney test, CC/CG: n=6, GG: n=6). Quantitative gene expression analysis of GPX4 in human hepatocytes normalized to ACTB (mean ± SD, *p=0.02, Welch’s t-test, CC/CG: n=6, GG: n=6). Western blot analysis of endogenous GPX4 protein in primary human hepatocytes. Relative intensity of GPX4 expression was normalized to GAPDH (mean ± SD, p=0.0935, Welch’s t-test, CC/CG: n=5, GG: n=5) (FIG.6F). GPX4 protein expression after lentivirus transduction. Quantitative gene expression of GPX448h after viral transduction (mean ± SD, *p<0.03, Welch’s ANOVA, CC/CG: n=3, GG: n=3). Primary human hepatocyte viability 72h after lentivirus transduction and exposed or not to FINO2 (50μM) for 3h (mean ± SD, *p=0.049, **p<0.01, Welch’s t-test, CC/CG: n=3, GG: n=3) (FIG.6G). FIG.7. Flow diagram of a clinical approach, illustrating bench and bedside. SEQUENCES SEQ ID NOs: 1 and 2 are nucleotide sequences of primers. SEQ ID NO: 3 is a nucleotide sequence of donor DNA. SEQ ID NO: 4 is a gRNA nucleotide sequence shown in FIG.4C. SEQ ID NO: 5 is the nucleotide sequence of PNPLA3 rs738409-CC- Sanger trace genotype shown in FIG.4C. SEQ ID NO: 6 is the nucleotide sequence of PNPLA3 rs738409-CC- Sanger trace genotype shown in FIG.4C. DETAILED DESCRIPTION Genetic variants in lipid metabolism influence the risk of developing metabolic associated fatty liver disease (MAFLD), cirrhosis, and ESLD. The mechanisms responsible for generating disease induced by these variants are poorly understood, and their presence could affect post-transplant liver function following liver transplantation. The MAFLD-associated genetic variant, PNPLA3 rs738409 was genotyped in ESLD patients and living liver donors and the recipients of these grafts. The presence of PNPLA3 rs738409 in donor liver grafts was associated with development of MAFLD and reduced postoperative 5-year survival. Markedly, metabolomic and transcriptomic analysis of human hepatocytes carrying the PNPLA3 rs738409 variant revealed increased peroxisomal β-oxidation and increased lipid peroxidation driven by elevated levels of bile acids and mitochondrial shrinkage that ultimately led to cell death via ferroptosis. It was determined that an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA) can be used for inhibiting liver disease.
I. Abbreviations ACAA1 acetyl-Coenzyme A acyltransferase 1 acyl-CoA dehydrogenase long chain ACOX1 acyl-coenzyme A oxidase 1 ACSL4 acyl-CoA synthetase long-chain family member 4 ANOVA a parametric one-way analysis of variance ATG5 autophagy-related gene 5 BAAT Bile acid-coenzyme A:amino acid N-acyltransferase BH Benjamini-Hochberg CI confidence interval CPT1 carnitine palmitoyltransferase 1 CPT2 carnitine palmitoyltransferase 2 DDLT deceased donor liver transplantation DDIT3 DNA damage inducible transcript 3 DFO deferoxamine ESLD end-stage liver disease FADS2 fatty acid desaturase 2 FINO2 (5α,8α)-8-(1,1-dimethylethyl)-3-methyl-1,2-dioxaspiro[4.5]decane-3- ethanol FPN Ferroportin GCA glycocholate GCDCA glycochenodeoxycholate GPX4 glutathione peroxidase 4 GSH L-Glutathione GWAS Genome-wide association studies GW/SLW graft weight to standard liver weight H2O2 hydrogen peroxide HepG2 human hepatoma cell line Heps-PNPLA3-C/G donor human hepatocytes heterozygous-CG/major homozygous-CC for PNPLA3 rs738409 Heps-PNPLA3-G donor human hepatocytes carrying PNPLA3 rs738409: G variant HMOX1 Heme Oxygenase 1 HSPA5 heat shock 70 KDa protein 5 KEGG Kyoto Encyclopedia of Genes and Genomes LDLT Living donor liver transplantation MAFLD metabolic-associated fatty liver disease MDA malondialdehyde
MOI multiplicity of infection NAFLD nonalcoholic fatty liver disease NCOA4 nuclear receptor coactivator 4 NGE2L3 Nuclear factor erythroid 2-related factor 2 PCR polymerase chain reactions PDEIII phosphodiesterase III PNPLA3 patatin-like phospholipase domain-containing protein 3 PUFA polyunsaturated fatty acids SCD stearoyl CoA desaturase SECIS selenocysteine insertion sequence sgRNA single-guide RNA TBA thiobarbituric acid TEM Transmission electron microscopy TF transferrin TFR1 transferrin receptor TFRC transferrin receptor II. Summary of Terms Unless otherwise noted, technical terms are used according to conventional usage. Definitions of many common terms in molecular biology may be found in Krebs et al. (eds.), Lewin’s genes XII, published by Jones & Bartlett Learning, 2017. As used herein, the singular forms “a,” “an,” and “the,” refer to both the singular as well as plural, unless the context clearly indicates otherwise. For example, the term “an antigen” includes singular or plural antigens and can be considered equivalent to the phrase “at least one antigen.” As used herein, the term “comprises” means “includes.” It is further to be understood that any and all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for descriptive purposes, unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described herein. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. To facilitate review of the various aspects, the following explanations of terms are provided: Administration: To provide or give a subject an agent, such as a therapeutic agent (e.g. a PDE III inhibitor), by any effective route. Exemplary routes of administration are described herein. Control: A reference standard. In some aspects, the control is a negative control sample obtained from a healthy patient. In other aspects, the control is a positive control sample obtained from a patient diagnosed with liver disease. In still other aspects, the control is a historical control or standard reference
value or range of values (such as a previously tested control sample, such as a group of patients with known prognosis or outcome, or group of samples that represent baseline or normal values). A difference between a test sample and a control can be an increase or conversely a decrease. The difference can be a qualitative difference or a quantitative difference, for example a statistically significant difference. In some examples, a difference is an increase or decrease, relative to a control, of at least about 5%, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or greater than 500%. End-Stage Liver disease: A disease of the liver designated by a Child-Pugh score wherein five clinical measures, levels of total bilirubin, serum albumin, prothrombin time prolongation, ascites, and hepatic encephalopathy, are scored using a point system of 1 point, 2 point, and 3 point values for varying levels of each clinical measure, with 3 point values being assigned to the most severe levels of each measure. The total points for all five measures are added to arrive at a Child-Pugh score and classification. Scores of 5-6 designate Child-Pugh Class A, scores of 7-9 designate Child-Pugh Class B, and scores of 10- 15 designate Child-Pugh Class C. In general, Child-Pugh Class A indicates the least severe liver disease and Child-Pugh Class C indicates the most severe liver disease. Accordingly, the method disclosed herein can be used to treat a subject having a Child-Pugh Class B or Child-Pugh Class C liver disease. The method disclosed here in can be used to treat a subject having a Child-Pugh Class A liver disease as well. The liver disease includes alcoholic hepatitis and/or or simple accumulation of fat in the hepatocytes (steatosis), macrovescicular steatosis, periportal and lobular inflammation (steatohepatitis), cirrhosis, fibrosis and/or liver ischemia. Ferroptosis pathway: Ferroptosis is a form of oxidative cell death that is characterized by iron- dependent oxidative damage and subsequent plasma membrane rupture and the release of damage-associated molecular patterns. It is induced by the accumulation of iron-mediated lipid peroxidation. Ferroptotic cells show typical necrotic morphology, such as an incomplete plasma membrane and the release of intracellular contents, especially damage-associated molecular patterns (DAMPs). Due to the role of iron in mediating the production of reactive oxygen species and enzyme activity in lipid peroxidation, ferroptosis is controlled by regulators involved in many aspects of iron metabolism, such as iron uptake, storage, utilization, and efflux. Ferroptosis can be caused by the collapse of the glutathione (GSH)-glutathione peroxidase 4 (GPX4) antioxidant systems. System xc- is a heterodimeric transmembrane complex composed of light chain, solute carrier family 7 member 11 (SLC7A11/xCT), and heavy chain, solute carrier family 3 member 2 (SLC3A2). After entering the cells by system xc-, cystine is quickly reduced to cysteine, which is mainly utilized for the synthesis of GSH. As a potent, low molecular weight antioxidant in cells, GSH is utilized by GPX4, which uses highly nucleophilic selenocysteine to reduce lipid peroxides into lipid alcohols. The pharmacological inhibitors of system xc- (e.g., erastin) and GPX4 (e.g., RSL3) are the two classical ferroptosis inducers. In addition, several GPX4-independent anti-ferroptosis pathways have recently been identified, such as the
apoptosis-inducing factor mitochondria-associated 2 (AIFM2)-mediated CoQ10 production pathway and the endosomal sorting complex required for transport-III (ESCRT-III)-dependent membrane repair pathway. Lipid peroxidation results in the oxidation of polyunsaturated fatty acids (PUFAs) of membrane lipids. An impaired antioxidant system can cause or accelerate lethal lipid peroxidation, which is inhibited by various synthetic antioxidants (e.g., ferrostatin-1 and liproxstatin-1). Acyl-CoA synthetase long-chain family member 4 (ACSL4) is a crucial pro-ferroptotic regulator that catalyzes the synthesis of long-chain polyunsaturated CoAs, especially arachidonic acid, thus enriching cellular membranes with PUFA. By way of further examples, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOXs), lipoxygenases (ALOXs), and cytochrome P450 oxidoreductase (POR) coupled to cytochrome P450 (CYP) monooxygenases, are all involved in the ferroptosis pathway. A “component” of the ferroptosis pathway is any enzyme or other protein that plays a role in ferroptosis. Glutathione peroxidase 4 (GPX4): A phospholipid hydroperoxidase that protects cells against membrane lipid peroxidation. GPX4 belongs to the family of glutathione peroxidases, which consists of eight known mammalian isoenzymes (GPX1–8). GPX4 catalyzes the reduction of hydrogen peroxide, organic hydroperoxides, and lipid peroxides at the expense of reduced glutathione, and functions in the protection of cells against oxidative stress. The oxidized form of glutathione (glutathione disulfide), which is generated during the reduction of hydroperoxides by GPX4, is recycled by glutathione reductase and NADPH/H+. GPX4 differs from the other GPX family members in terms of its monomeric structure, a less restricted dependence on glutathione as reducing substrate, and the ability to reduce lipid-hydroperoxides inside biological membranes. Inactivation of GPX4 leads to an accumulation of lipid peroxides, resulting in ferroptotic cell death. Exemplary GPX4 nucleic acid sequences are provided in GENBANK® Accession Nos. NM_001039847, NM_001039848, NM_001367832, and NM_002085, as available on November 12, 2021. Exemplary GPX4 amino acid sequences are provided in GENBANK® Accession Nos. NP_001034936, NP_001034937, NP_001354761, and NP_002076, as available on November 12, 2021. Hepatocyte: A cell of the main parenchymal tissue of the liver, that make up 70-85% of the mass of the liver. The typical hepatocyte is cubical with sides of 20-30 µm, and produces serum albumin, fibrinogen, and the prothrombin group of clotting factors (except for Factors 3 and 4). Hepatocytes also synthesize lipoproteins, ceruloplasmin, transferrin, complement, and glycoproteins. A hepatocyte is a normal (non- malignant) cell. Effective amount: A quantity of a specific substance sufficient to achieve a desired effect in a subject to whom the substance is administered, such as a therapeutically effective amount, for treatment. For instance, this can be the amount of a humanized monoclonal antibody necessary to inhibit tumor growth and/or metastasis, or to measurably alter signs and/or symptoms of a liver disease. Fibrosis of the liver: Excessive accumulation of extracellular matrix proteins including collagen that occurs in most types of chronic liver diseases. Advanced liver fibrosis results in cirrhosis, liver failure, and portal hypertension and often requires liver transplantation. The main causes of liver fibrosis in industrialized countries include chronic hepatitis infection, alcohol abuse, and nonalcoholic steatohepatitis
(NASH). The accumulation of ECM proteins distorts the hepatic architecture by forming a fibrous scar. See Bataller and Brenner, J. Clin. Invest.115(2): doi: 10.1172/JCI24282 (2005). Inhibiting or treating a disease: Inhibiting the full development of a disease or condition, for example, in a subject who is at risk for a disease, such as liver disease. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition, such as end stage liver disease, after it has begun to develop. The term “ameliorating,” with reference to a disease or pathological condition, refers to any observable beneficial effect of the treatment. The beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular disease, such as when the method increases serum albumin, decreases serum ammonia, improve coagulation activity, decreases ascites production, improves neuropsychological status, decreases bilirubin, improves apolipoprotein and/or improves portal vein or systemic blood flow clearance of cholate. Treatment may be assessed by objective or subjective parameters; including, but not limited to, the results of a physical examination, imaging, or a blood test. A “prophylactic” treatment is a preventative treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology, such as to prevent liver disease. Liver cirrhosis: A chronic disease of the liver marked by a fibrous thickening of the liver tissue histologically, regenerative nodules. Liver disease: Diseases and conditions of the liver including liver cirrhosis, alcoholic and non- alcoholic fibrosis as well as to liver disease or changes associated with obesity, diabetes and metabolic syndrome. Other examples of liver diseases include: hepatitis, fatty liver, toxic liver failure, hepatic cirrhosis, diabetes-associated liver disease, liver steatosis, liver fibrosis, liver cirrhosis, chronic hepatitis and the like. Liver disease does not include liver cancer. Metabolic dysfunction associated fatty liver disease or Metabolic associated fatty liver disease (MAFLD): A common liver disease affecting a quarter of the global population and is often associated with adverse health outcomes. The increasing prevalence of MAFLD occurs in parallel to that of metabolic syndrome (MetS). The MAFLD spectrum ranges from simple steatosis to steatohepatitis and ultimately development of fibrosis and cirrhosis in the long term. As many as 30% of subjects with fatty liver disease have histologic evidence of liver inflammation, which in turn is associated with increased risk of progression to cirrhosis. The onset of MAFLD begins with benign steatosis with the accumulation of triglycerides (TG) in the hepatocytes, which, if not reversed, progresses to non-alcoholic steatohepatitis. Steatohepatitis is characterized by lobular inflammation, hepatocyte ballooning, fibrosis and cirrhosis. Approximately one third of patients with MAFLD progress to steatohepatitis (“inflammatory metabolic dysfunction- associated steatohepatitis”) and a smaller percentage of that group progresses to cirrhosis. See Carnagarin et al., Int. J. Mol. Sci.22(8) 4241, doi: 10.3390/ijms22084241 (April 2021).
Nonalcoholic fatty liver disease: A condition in which excess fat builds up on the liver that is not caused by alcohol use. The two types of NAFLD are nonalcoholic fatty liver (NAFL), where there is little or no inflammation or liver damage, and nonalcoholic steatohepatitis (NASH), in which there is inflammation, which can lead to fibrosis, cirrhosis, scarring and liver cancer. Patatin-like phospholipase domain-containing protein 3 (PNPLA3), and rs738409:G mutation: The PNPLA3 gene encodes a triacylglycerol lipase that mediates triacylglycerol hydrolysis in adipocytes. The highly conserved patatin-like domain of the encoded PNPLA3 protein exhibits lipolytic activity toward triglycerides. PNPLA3, which appears to be membrane bound, may be involved in the balance of energy usage/storage in adipocytes. PNPLA3 catalyzes coenzyme A (CoA)-dependent acylation of 1-acyl-sn-glycerol 3- phosphate (2-lysophosphatidic acid/LPA) to generate phosphatidic acid (PA), an important metabolic intermediate and precursor for both triglycerides and glycerophospholipids. The rs738409 C>G polymorphism of PNPLA3, which encodes I148M, is strongly associated with hepatic fat content and confers susceptibility to nonalcoholic fatty liver disease (NAFLD). The PNPLA3 rs738409:G variant is also associated with fatty liver and alcoholic liver diseases, as well as fibrosis, histological disease severity, steatosis, and elevated levels of liver enzymes in healthy adults. The rs738409 variant is also a risk factor for cirrhosis (Shen et al. J Lipid Res.56(1):167–175, 2015). Exemplary HMGCR nucleic acid and amino acid sequences are provided in GENBANK® Accession Nos. NM_025225 and NP_079501, respectively, as available on November 12, 2021. Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in the methods and compositions of this disclosure are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. Pharmaceutically acceptable salt: A biologically compatible salt of a compound that can be used as an active compound, and are derived from a variety of organic and inorganic counter ions and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, and the like. “Pharmaceutically acceptable acid addition salts” are a subset of “pharmaceutically acceptable salts” that retain the biological
effectiveness of the free bases while formed by acid partners. In particular, the compounds form salts with a variety of pharmaceutically acceptable acids, including, without limitation, inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids such as formic acid, acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, benzene sulfonic acid, isethionic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, xinafoic acid and the like. “Pharmaceutically acceptable base addition salts” are a subset of “pharmaceutically acceptable salts” that are derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Exemplary salts are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, tris(hydroxymethyl)aminomethane (Tris), ethanolamine, 2- dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. Exemplary organic bases are isopropylamine, diethylamine, tris(hydroxymethyl)aminomethane (Tris), ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. (See, for example, S. M. Berge, et al., “Pharmaceutical Salts,” J. Pharm. Sci., 1977; 66:1-19 which is incorporated herein by reference.) In particular aspects, the compounds may be a formate, trifluoroactate, hydrochloride or sodium salt. Pharmaceutical agent: A chemical compound or composition, including a nucleic acid molecule, capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject or a cell. “Incubating” includes a sufficient amount of time for a compound to interact with a cell. “Contacting” includes incubating a compound, in solid or in liquid form, with a cell. Phosphodiesterase (PDE): An enzyme that breaks a phosphodiester bond. The PDEs belong to at least eleven related gene families, which are different in their primary structure, substrate affinity, responses to effectors, and regulation mechanism. PDEIII is involved in the conversion of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) to AMP and GMP, respectively. PDEIII has two isoforms, PDEIIIA and PDEIIIB. The PDEIII isoforms are structurally similar, and have similar pharmacological and kinetic properties, but the distinction is in expression profiles and affinity for cGMP. A “PDEIII inhibitor” is specific for PDEIII, and reduces the activity of PDEIII, such that there is a significant reduction in the production of AMP and/or GMP. PDEIII inhibitors include Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, and pharmaceutically acceptable salts thereof. Subject: Human and non-human animals, including all vertebrates, such as mammals and non- mammals, such as non-human primates, mice, rabbits, sheep, dogs, cats, horses, cows, chickens, amphibians, and reptiles. In many aspects of the described methods, the subject is a human.
III. Phosphodiesterase (PDE) III Inhibitors and TDYA PDEs are a class of intracellular enzymes involved in the metabolism of the second messenger nucleotides, cyclic adenosine monophosphate (cAMP), and cyclic guanosine monophosphate (cGMP). Numerous phosphodiesterase inhibitors have therapeutic uses, including treatment of obstructive lung disease, allergies, hypertension, angina, congestive heart failure, and depression. The presently disclosed methods utilize inhibitors of PDE-III to treat liver disease, such as ESLD and MAFLD. Enoximone (1,3-Dihydro-4-methyl-5-[4-(methylthio)benzoyl]-2H-imidazol-2-one) is a small organic molecule that inhibits phosphodiesterase type III (PDE-III), both against the cAMP and cGMP conversion reactions. Enoximone also causes vasodilation, an increase in the diameter of blood vessels, through its effects on smooth muscle cells that surround blood vessels, which results in lower pressure against which the heart must pump. Enoximone can be administered at dosages of 50 mg to 150 mg, up to three times a day. Dosages include 50 mg, 75 mg, 100 mg.125 mg, and 150 mg, three times a day, see Uretsky et al., Circulation 82(3): 774-780, 1990. The structure of Enoximone is shown below:
PERFAN I.V.™ is an intravenous formulation of enoximone. Clinical studies supporting the use of PERFAN I.V.™ were completed in the late 1980s, and the drug was first approved in Europe in 1989. PERFAN I.V.™ is used in a hospital setting to treat patients with acute decompensated heart failure (Classes III and IV) and to wean patients from cardiopulmonary bypass following open-heart surgery. This treatment, along with the use of powerful intravenous diuretics, and vasodilators, serves to increase the efficiency of the circulatory system and provide symptomatic relief to the heart failure patient. Enoximone can be prepared according to the following method (U.S. Published Application No. 2006/0292213). A solution of 25.0 g of 4-(methylthio)-benzoic acid and 22 ml of thionyl chloride in 50 ml of benzene is refluxed for 4 hrs. Excess reagent and solvent is evaporated and the residue is azeotroped 3 times with benzene to remove all thionyl chloride. The residue is added dropwise to a mixture of 11.8 g of 1,3-dihydro-4-methyl-2H-imidazol-2-one, 40.0 g of anhydrous aluminum chloride and 100 ml of nitrobenzene. The resulting mixture is stirred at 60°-65° C. for 5 hrs, poured on ice and the precipitate that forms is collected, washed with ethyl ether and water, and recrystallized from isopropanol-water to give the title compound. M.P.255°-258° C. (dec.). Enoximone formulations are further described in detail in U.S. Pat. No.2006/0292213 which is hereby incorporated by reference. Enoximone can also be administered orally, see U.S. Published Application No.2006/029221, which discloses micronized forms of enoximone and their use in treating cardiac disease. Enoximone is available as a 100mg/20 ml concentrate solution for
injection. Perfan is also available as a 5mg/ml concentrate for solution for injection or infusion, and is diluted 1:1 with either 0.9% sodium chloride injection or water for injection before administration. A loading dose can be administered of 0.5mg/kg initially at a rate not greater than 12.5mg/min. This dose may be repeated in 30 minutes. the maintenance dose can be given as an infusion, 2.5 to 5 μg/kg/minute following the loading dose. In clinical use, some patients have received up to 20 μg/kg/minute. In other aspects, the dosage can be reduced or increased by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 fold.” In further aspects, a loading dose can be administered of 0.05-5mg/kg initially. In more aspects, the maintenance dose can be given as an infusion, 0.25 to 50 μg/kg/minute following the loading dose. Intermediate ranges are also of use. Amrinone, also known as imamrinone, is a pyridine PDEIII inhibitor. The drug inhibits the breakdown of both cAMP and cGMP which increases cardiac output; thus, amrinone can be used to treat short-term congestive heart failure. Lesher and Opalka U.S. Patent No.4,004,012, issued January 18, 1977, shows the synthesis of amrinone and its use as a cardiotonic agent. U.S. Patent Nos.4,305,948, 4,335,131, incorporated herein by reference, also disclose Amrinone. In aspects, Amrinone is sold as an injectable solution of 5 mg/ML. In aspects, it is administered as an intravenous bolus at 0.75 mg.kg over two to three minutes, and then 5-10 mcg/kg/min intravenously. The therapeutic dosage range is about 0.5 to about 7 mcg/mL. in other aspects, the dosage can be reduced or increased by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10-fold. In further aspects, the therapeutic dosage range is 0.05 to about 70 mcg/mL, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60 or 70 mcg/mL.
inhibitor, approved for use in an oral formulation for treating symptoms of intermittent claudication in peripheral vascular disease. U.S. Patent No.4,277,479, issued July 7, 1981, incorporated herein by reference, shows the synthesis and cardiac functions. In aspects, it can be administered as an oral medication for adults, at about 50 to about 100 mg, such as 50 mg or 100 mg, two times a day.
asodilator in patients with heart failure. Lesher and Philion U.S. Patent No.4,313,951, issued on February 2, 1982, incorporated herein by reference, describes the preparation and use of milrinone as a cardiotonic agent. U.S. Patent No.4,264, 612 and U.S. Patent No. 4,264,603, incorporated by reference herein, also disclose Milrinone. In aspects, Milrinone is dosed at continuous infusion rates from 0.375 to 0.75 μg/kg/min, with the option of a 50 μg/kg loading dose.
Pimobendan (VETMEDIN®, ACARDI®) is a veterinary medicine in the U.S., but is approved for human use in Japan. The methods of preparing this compound and pharmaceutical compositions is detailed in U.S. Patent No.4,361,563, incorporated by reference. Canadian Patent No.1134362, incorporated herein by reference, also disclosed Pimobendan. Pimobendan is provided as an oral medication. In aspects, it is used at doses of 0.2 mg to 0.6 mg pimobendan/kg body weight, divided into two daily doses.
10,12-tricosadiynoic acid (TDYA) is s a highly specific, selective, high affinity and orally active acyl- CoA oxidase-1 (ACOX1) inhibitor. TDYA is used to treat high fat diet- or obesity-induced metabolic diseases. In aspects, it can be used at oral doses of 37.5 mg/kg, 75 mg/kg, and 150 mg/kg. In other aspects, the dosage can be reduced or increased by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 fold. In further aspects, the
therapeutic dosage is 3.75 mg/kg, 7.5 mg/kg, 15 mg/kg, 375 mg/kg, 750 mg/kg, or 1500 mg/kg, or any range between these values. TDYA is shown below:
These PDEIII inhibitors, TDYA, and pharmaceutically acceptable salts thereof, are of use in the disclosed methods. It will be understood that in the discussion of formulations and methods of treatment, references to compounds also include the pharmaceutically acceptable salts, as well as alternative pharmaceutical compositions comprising metabolites or purified enantiomers of metabolites or the pharmaceutical itself (for example, enoximone which is metabolically converted to a sulfoxide metabolite that is chiral, and thus the S or R enantiomer of that sulfoxide could be used in a pharmaceutical preparation). Where clinical applications are contemplated, pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals. Formulations can be an oral suspension in either the solid or liquid form. The liquid forms can be used as infusions. In further aspects, it is contemplated that the formulation can be prepared for delivery via parenteral delivery, or used as a suppository, or be formulated for subcutaneous, intravenous, intramuscular, intraperitoneal, sublingual, transdermal, or nasopharyngeal delivery. The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients, which are suitable for the manufacture of tablets. These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed. They
may also be coated by the technique described in the U.S. Pat. Nos.4,256,108; 4,166,452; and 4,265,874 to form osmotic therapeutic tablets for control release (hereinafter incorporated by reference). Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil. Aqueous suspensions contain an active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxy-propylmethycellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene-oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl, p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame. Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid. Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. Pharmaceutical compositions may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavoring agents. Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative and flavoring
and coloring agents. Pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension. Suspensions may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example as a solution in 1,3-butane diol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. PDEIII inhibitors and TDYA may also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing a therapeutic agent with a suitable non-irritating excipient which is solid at ordinary temperatures, but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are cocoa butter and polyethylene glycols. Formulations may also be administered as nanoparticles, liposomes, granules, inhalants, nasal solutions, or intravenous admixtures. Pharmaceutical compositions including a PDEIII inhibitor and/or TYDA can be formulated for injection, such as for intrahepatic or intravenous administration. Such compositions are formulated generally by mixing a PDEIII inhibiotr, or a pharmaceutically accceptble salt therof, at the desired degree of purity in a unit dosage injectable form (solution, suspension, or emulsion) with a pharmaceutically acceptable carrier, for example, one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation. Pharmaceutical compositions can include an effective amount of the PDEIII inhibitor (for example, dissolved or suspended) and/or TYDA in a pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable carriers and/or pharmaceutically acceptable excipients are known in the art and are described, for example, in Remington’s Pharmaceutical Sciences by E. W. Martin, Mack Publishing Co., Easton, PA, 19th Edition (1995). The nature of the carrier will depend on the particular mode of administration being employed. For example, formulations usually contain injectable fluids that include pharmaceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like, as a vehicle. In addition, pharmaceutical compositions to be administered can contain minor amounts of non- toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate. A PDEIII inhibitor, or pharmaceutically acceptable salt thereof, can be suspended in an aqueous carrier, for example, in an isotonic or hypotonic buffer solution at a pH of about 3.0 to about 8.5, such as about 4.0 to about 8.0, about 6.5 to about 8.5, or about 7.4. Useful buffers include saline-buffered phosphate or an ionic boric acid buffer. The active ingredient, optionally together with excipients, can also be in the form of a lyophilisate and can be made into a solution prior to administration by the addition of suitable solvents.
The pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well-known in the art. Supplementary active ingredients also can be incorporated into the compositions. For example, certain pharmaceutical compositions can include the vectors or viruses in water, mixed with a suitable surfactant, such as hydroxy-propylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof as well as in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles. The amount of active ingredient in any formulation may vary to produce a dosage form that will depend on the particular treatment and mode of administration. It is further understood that specific dosing for a patient will depend upon a variety of factors including age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy. Individual doses are typically not less than an amount required to produce a measurable effect on the subject and may be determined based on the pharmacokinetics and pharmacology of the subject composition or its by-products, and thus based on the disposition of the composition within the subject. This includes consideration of the route of administration as well as dosage amount, which can be adjusted for intraveinous or intrahepatic applications. Effective amounts of dose and/or dose regimen can readily be determined empirically from preclinical assays, from safety and escalation and dose range trials, individual clinician-patient relationships, as well as in vitro and in vivo assays. IV. Methods of Treatment Methods are disclosed for inhibiting a liver disease in a subject. These methods include administering to the subject an effective amount of a PDE III inhibitor or TDYA, thereby inhibiting the liver disease in the subject. In some aspects, the PDEIII inhibitor is Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, or a pharmaceutically acceptable salt thereof. In some aspects, the subject is at risk of developing a liver disease, and the disclosed method prevents the liver disease. In other aspects, the subject has the liver disease, and the disclosed method treats the liver disease. In some aspects, the liver disease is as ESLD. In further aspects, the liver disease is MAFLD. In other aspects, the liver disease is fibrosis of the liver, cirrhosis, or nonalcoholic fatty liver disease (NALFD). In more aspects, the liver disease is inflammatory metabolic dysfunction-associated steatohepatitis. The compositions of the invention are particularly useful for treating a subject (e.g., a mammalian subject, e.g., human, child or adult) with end stage liver disease, metabolic associated fatty liver disease, fibrosis of the
liver, cirrhosis, nonalcoholic fatty liver disease, or inflammatory metabolic dysfunction-associated steatohepatitis. In some aspects, the subject can have liver failure as a result of cirrhosis. The subject can have cirrhosis resulting from alcohol-related liver disease. The subject can have a disease that destroys bile ducts (such as biliary cirrhosis). In more aspects, the subject can have a genetic abnormality, such as cystic fibrosis, alpha-1 antitrypsin deficiency, hemochromatosis, Wilson disease, galactosemia, or a glycogen storage disease. In other aspects, the subject can have liver failure as a result of an exposure, such as to a drug or toxic chemical. The subject can have a parasitic infection that results in liver failure. Any of these subjects can be selected for treatment. In some aspects, the subject can have cirrhosis. The subject can have alcoholic liver cirrhosis, or liver cirrhosis caused by chronic infection after acute inflammation of the liver or immunological liver diseases characterized by chronic inflammation. In some aspects, the subject is an alcoholic or a recovering alcoholic. The development of cirrhosis hepatitis is preceded by a state of increasing accumulation of fat in the liver (steatosis hepatitis). This state is reversible and the liver can be normalized if consumption of alcohol is terminated. However, if the abuse goes on then the liver tissue will gradually be transformed to connective tissue which leads to badly working liver tissue and consequently reduced function of the liver. These subjects can be treated using the methods disclosed herein. Chronic liver disease refers to diseases of the liver that last over a period of six months. These subjects can be selected for treatment. Chronic liver disease includes of a wide range of liver pathologies which include inflammation (chronic hepatitis), liver cirrhosis, and hepatocellular carcinoma. Alcoholic liver disease (ALD) typically occurs after years of heavy drinking. Over time, scarring and cirrhosis can occur. Cirrhosis is the final phase of alcoholic liver disease. There may be no symptoms, or symptoms may come on slowly, depending on how well the liver is working. Symptoms tend to be worse after a period of heavy drinking. Early symptoms include: fatigue and loss of energy; poor appetite and weight loss; nausea or belly pain; small, or red spider-like blood vessels on the skin. As liver function worsens, symptoms may include: fluid buildup of the legs (edema) and in the abdomen (ascites); yellow color in the skin, mucous membranes, or eyes (jaundice); redness on the palms of the hands; easy bruising and abnormal bleeding; confusion or problems thinking; or pale or clay-colored stools. In men, symptoms may also include impotence, shrinking of the testicles, and breast swelling. In some aspects, subjects are treated that have liver disease wherein there are very low concentrations of the proteins and hormones which are produced in the liver. A reduced concentration of the protein albumin in the blood is of importance for the development of edema in the abdominal cavity such as ascites and in the legs caused by chronic liver disease. Subjects with liver disease can be treated that have a reduced capability of production of coagulation factors, which are important for the normal coagulation of blood, and an increased tendency of bleeding. Thus, in some aspects, the disclosed methods include selecting subject with one or more of these features.
In some aspects, these methods include administering to the subject an effective amount of a PDEIII inhibitor or TDYA, thereby treating the liver disease in the subject. In certain non-limiting examples, the liver disease is ESLD or MAFLD. In some aspects, the method increases serum albumin, decreases serum ammonia, improves coagulation activity, decreases ascites production, improves neuropsychological status, decreases bilirubin, improves apolipoprotein, and/or improves portal vein or systemic blood flow clearance of cholate in the subject. In aspects, the subject is homozygous for rs738409:G mutation in the patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene. These subjects can be selected. The PNPLA3 gene refers to NCBI Gene ID: 80339. FIG.1 of PCT Publication No. WO 2023/092134, incorporated herein by reference, shows the sequence of wild type PNPLA3 gene as well as the sequence of the rs738409 C>G (I148M) variant of the PNPLA3 gene. Genome-wide association studies (GWAS) have identified the rs738409 C>G (I148M) variant of the PNPLA3 gene as the strongest genetic risk allele for NAFLD/NASH, influencing degree of steatosis, grade of inflammation, stage of fibrosis and risk of HCC among all examined populations. Other studies have also demonstrated the strong association between 148M allele and ALD (Buch et al., Nature Genetics, 47(12):1443-1447, 2015, incorporated by reference herein in its entirety). Notably, NAFLD patients and diabetic patients carrying the 148M mutant allele have over 12- and 19-fold higher risk for the development of HCC, respectively, as compared to those who are 148I carriers, making this mutant allele the single largest genetic risk factor for HCC in the context of NASH. See Liu et al. (Journal of Hepatology, 61:75-81, 2014). See also U.S. Patent No.11,028,393, incorporated herein by reference. In further aspects, these methods include administering to the selected subject an effective amount of Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, or a pharmaceutically acceptable salt thereof, thereby treating liver disease in the subject. In other aspects, these methods include administering to the subject an effective amount of TDYA, or a pharmaceutically acceptable salt thereof. In yet additional aspects, the methods include methods include administering to the subject an effective amount of Enoximone or a pharmaceutically acceptable salt thereof. In other aspects, the methods include administering to the subject an effective amount of Amrinone or a pharmaceutically acceptable salt thereof. In more aspects, the methods include administering to the subject an effective amount of Cilostazol or a pharmaceutically acceptable salt thereof. In aspects, the methods include administering to the subject an effective amount of Milrinone or a pharmaceutically acceptable salt thereof. In more aspects, the methods include administering to the subject an effective amount of Pimobendan or a pharmaceutically acceptable salt thereof. In other aspects, the methods include administering to the subject an effective amount of dipyridamole or a pharmaceutically acceptable salt thereof. In more aspects, the methods include administering to the subject an effective amount of TDYA or a pharmaceutically acceptable salt thereof. In some aspects, the method increases serum albumin, decreases serum ammonia, improves coagulation activity, decreases ascites production, improves neuropsychological status, decreases bilirubin, improves apolipoprotein, and/or improves portal vein or systemic blood flow clearance of cholate in the subject. The methods can improve other symptoms, such as weakness, fatigue, loss of appetite, nausea,
vomiting, weight loss, abdominal pain, bloating, or itching. Treatment can also result in improvements in creatine level, bilirubin level, or an international normalized ratio (INR)-test for the clotting tendency of blood, increase serum albumin, decrease serum ammonia, improve ascites, neuropsychological status, improve levels of apolipoproteins and/or portal vein blood flow clearance of cholate. Generally, these parameters are improved compared to a control, such as the parameter as measured in a subject prior to treatment. However, the control also can be a standard value, or the value obtained for a population of subjects with the liver disease. The subject can be selected using Child-Pugh scoring. The Child- Pugh score utilizes five clinical measures, wherein levels of total bilirubin, serum albumin, prothrombin time prolongation, ascites, and hepatic encephalopathy, are scored using a point system of 1 point, 2 point, and 3 point values for varying levels of each clinical measure, with 3 point values being assigned to the most severe levels of each measure. The total points for all five measures are added to arrive at a Child-Pugh score and classification. Scores of 5-6 designate Child-Pugh Class A, scores of 7-9 designate Child-Pugh Class B, and scores of 10- 15 designate Child-Pugh Class C. I n general, Child-Pugh Class A indicates the least severe liver disease and Child-Pugh Class C indicates the most severe liver disease. Accordingly, in some aspects, the method disclosed herein can be used to treat a subject having a Child-Pugh Class A, Child-Pugh Class B or Child- Pugh Class C liver disease. In some aspects, the method disclosed here in can be used to treat a subject having a Child-Pugh Class C liver disease. In various aspects, the method improves the Child-Pugh score of the subject. Thus, in some aspects, the method can include determining the Child-Pugh score of the subject. The disclosed methods can include measuring liver function and/or survival using a quantitative and/or qualitative test. In some aspects, the degree of liver impairment is assessed using tests which evaluate structure (e.g., biopsy), cellular permeability (e.g., transaminases) and synthetic ability (e.g., albumin, bilirubin and prothrombin time) (see Jalan and Hayes (1995) Aliment. Pharmacol. Ther.9:263- 270). A combination of various markers for liver injury can be measured to provide an analysis function. Commonly used tests for liver clearance capability are: indocyanine green (ICG), galactose elimination capacity (GEC), mono-ethyl-glycine-xylidide (MEG-X), antipryine clearance, aminopyrine breath test (ABT) and caffeine clearance. For assessment of graft function following transplantation, low ICG clearance and low MEG-X formation are predictive of a poor outcome. The method can also include measuring the lipid profile of a subject. The method can include measuring liver size, such as using ultrasound. Provided herein are methods of promoting survival of a donor liver in a recipient subject, wherein the donor liver is homozygous for rs738409:G mutation in the PNPLA3 gene. In some aspects, the method includes detecting the rs738409:G mutation in the PNPLA3 gene in a sample from the donor. In some aspects, the sample from the donor is a blood or tissue sample. In specific, non-limiting aspects, the sample from the donor is a liver tissue sample. A variety of techniques for detecting a mutation in a gene, such as a rs738409:G mutation in the PNPLA3 gene, are known to those of ordinary skill in the art, and can be used in the disclosed methods. Such methods can include, for example, polymerase chain reaction (PCR). PCR
methods are described in, for example, U.S. Patent No.4,683,195; Mullis et al., Cold Spring Harbor Symp. Quant. Biol.51:263, 1987; and Erlich, ed., PCR Technology, (Stockton Press, NY, 1989). In some aspects, the subject can have a partial liver resection. In some aspects, the subject can be a recipient of a liver transplant, such as a cadaveric transplant or a transplant from a living donor. The subject can be a mammal, such as a domestic animal or a primate. In some examples, the subject is a human. In some aspects, the individual has undergone a partial hepatectomy or liver resection. In some non- limiting examples, the partial hepatectomy or liver resection removed 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% by mass of the subject’s liver. In some aspects, the subject is the recipient of a liver transplant from a liver donor. In some aspects, the hepatectomy is anatomic, so that the lines of resection match the limits of one or more functional segments of the liver as defined by the Couinaud classification. The subject can be an adult (over 18 years old), or a child (under 13 years old) or a teenager (13 to 19 years old). The subject can be over 20, 30, 40, 50, or 60 years old. In further aspects, a subject is treated using the method disclosed herein that has undergone a liver transplant, and is a transplant recipient. In further aspects the subject has undergone a small-for-size liver transplant. In some aspects, the subject has undergone a liver transplant due to liver damage caused by toxic injury, traumatic injury, microvesicular steatosis, or macrovesicular steatosis. In some non-limiting examples, the toxic injury results from acetaminophen overdose, exposure to carbon tetrachloride (CCl4), bacterial endotoxin, use or abuse of intravenous or prescription drugs, chemotherapy, excessive consumption of alcohol, or infection with hepatitis virus A, B, or C. Traumatic injury can result from surgical resection or blunt force trauma, such as that occurring in an automobile accident. In some aspects, the subject has received an extended criteria liver, such as, but not limited to, a liver harvested from a subject that is greater than about 45 years old, such as about 45 to about 55 years old, such as about 45 to old 50 years old. In further aspects, the subject has received a cadaveric liver. In yet other aspects, the subject has received a liver transplant from a living donor. These subjects can be evaluated using the Child-Pugh classification system. The disclosed methods can be performed to the subject any time throughout their evaluation of liver function using the Child-Pugh classification and/or if the subject undergo liver resection and transplant. In one aspect, the disclosed methods can be employed 5, 4, 3, 2, or 1 years;12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 months; 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 days; 60, 48, 36, 30, 24, 18, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3, or 2 hours prior to the operation of liver resection or transplant; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 75, 90, 105, 120 minutes; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18, 24, 30, 36, 48, 60 hours; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 45, 60, 90 or more days; 4, 5, 6, 7, 8, 9, 10, 11, 12 or more months; 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 years after liver resection and transplant.
The disclosed methods can include measuring liver function and/or survival (for transplant patients) using a quantitative and/or qualitative test. In some aspects, the degree of liver impairment is assessed using tests which evaluate structure (e.g., biopsy), cellular permeability (e.g., transaminases) and synthetic ability (e.g., albumin, bilirubin and prothrombin time) (see Jalan and Hayes (1995) Aliment. Pharmacol. Ther. 9:263-270). A combination of various markers for liver injury can be measured to provide an analysis function. Commonly used tests for liver clearance capability are: indocyanine green (ICG), galactose elimination capacity (GEC), mono-ethyl-glycine-xylidide (MEG-X), antipryine clearance, aminopyrine breath test (ABT) and caffeine clearance. For assessment of graft function following transplantation, low ICG clearance and low MEG-X formation are predictive of a poor outcome. The method can also include measuring the lipid profile of a subject. The method can include measuring liver size, such as using ultrasound. In certain aspects, the disclosed methods promote survival of a donor liver in a subject in need thereof an effective amount of a phosphodiesterase (PDE) III inhibitor or TDYA, or a pharmaceutically acceptable salt thereof. The subject can be administered additional therapeutic agents. Additional agents that can be administered to the subject include immunosuppresive therapeutics, antibacterial and antifungal antibiotics, as well as non-steroidal anti-inflammatory agents to reduce risk of infection and inflammation. Additional agents of use include an effective amount of deferoxamine, selenium, vitamin E (alpha-tocopherol), CoQ10, or a combination thereof. Additional agents can be administered by any route. The additional agents can be formulated separately, or in the same composition. In specific non-limiting aspects, the subject is also administered an effective amount of GSH or a nucleic acid molecule encoding GPX4. The dose and dosing schedule for administration of GSH or a nucleic acid molecule encoding GPX4 can vary and is determined in part by the clinical status of the subject or the donor liver, and the age, such as the weight and general health of the subject, and the route of administration. Suitable formulations, and dosing regiments, are disclosed in PCT Publication No. WO 2023/092134. Briefly, polynucleotides include DNA, cDNA and RNA sequences which encode a protomer and a component of the ferroptosis pathway, such as GPX4, as well as vectors including the DNA, cDNA, and RNA sequences, such as a DNA or RNA vector, are of use in the methods disclosed herein. The genetic code can be used to construct a variety of functionally equivalent nucleic acids, such as nucleic acids which differ in sequence but which encode the same protein sequence (degenerate variants). In a specific, non- limiting aspect, the nucleic acid molecule encodes GPX4. In another specific, non-limiting aspect, the nucleic acid molecule encodes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to a nucleotide sequence set forth as SEQ ID NO: 3 or 4. Polynucleotides encoding a component of the ferroptosis pathway, such as a GPX4 protein, are of use in the disclosed methods. In some non-limiting examples, the polynucleotides encode GPX4. These polynucleotides include DNA, cDNA, and RNA sequences that encode the protein. Silent mutations in the
coding sequence result from the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue. Thus, for example, leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (e.g., L. Stryer, 1988, Biochemistry, 3.sup.rd Edition, W.H.5 Freeman and Co., NY). Degenerate variants are also of use in the methods disclosed herein. Nucleic acid molecules encoding a GPX4 protein can readily be produced by one of skill in the art using the amino acid sequences provided herein and the genetic code. Nucleic acid sequences encoding the GPX4 can be prepared by any suitable method including, for example, cloning of appropriate sequences or by direct chemical synthesis by methods such as the phosphotriester method of Narang et al., Meth. Enzymol.68:90-99, 1979; the phosphodiester method of Brown et al., Meth. Enzymol.68:109-151, 1979; the diethylphosphoramidite method of Beaucage et al., Tetra. Lett.22:1859-1862, 1981; the solid phase phosphoramidite triester method described by Beaucage & Caruthers, Tetra. Letts.22(20):1859-1862, 1981, for example, using an automated synthesizer as described in, for example, Needham-VanDevanter et al., Nucl. Acids Res.12:6159-6168, 1984 and the solid support method of U.S. Patent No.4,458,066. Chemical synthesis produces a single-strand (ss) oligonucleotide, which can be converted into double-strand (ds) DNA by hybridization with a complementary sequence or by polymerization with a DNA polymerase using the single strand as a template. Exemplary nucleic acids that include sequences encoding a GPX4 protein can be prepared by cloning techniques. A nucleic acid molecule encoding a GPX4 protein can be cloned or amplified by in vitro methods, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system (TAS), the self-sustained sequence replication system (3SR), and the Qβ replicase amplification system (QB). For example, a polynucleotide encoding the protein can be isolated by a polymerase chain reaction of cDNA using primers based on the DNA sequence of the molecule. A wide variety of cloning and in vitro amplification methodologies are well-known to persons skilled in the art. PCR methods are described in, for example, U.S. Patent No.4,683,195; Mullis et al., Cold Spring Harbor Symp. Quant. Biol.51:263, 1987; and Erlich, ed., PCR Technology, (Stockton Press, NY, 1989). Polynucleotides also can be isolated by screening genomic or cDNA libraries with probes selected from the sequences of the desired polynucleotide under stringent hybridization conditions. In some aspects, a polynucleotide sequence encoding a GPX4 protein is operably linked to transcriptional control sequences including, for example a promoter and a polyadenylation signal. Any promoter can be used that is a polynucleotide sequence recognized by the transcriptional machinery of the host cell (or introduced synthetic machinery) that is involved in the initiation of transcription. A polyadenylation signal is a polynucleotide sequence that directs the addition of a series of nucleotides on the
end of the mRNA transcript for proper processing and trafficking of the transcript out of the nucleus into the cytoplasm for translation. Exemplary promoters include viral promoters, such as cytomegalovirus immediate early gene promoter (“CMV”), herpes simplex virus thymidine kinase (“tk”), SV40 early transcription unit, polyoma, retroviruses, papilloma virus, hepatitis B virus, and human and simian immunodeficiency viruses. Other promoters include promoters isolated from mammalian genes, such as the immunoglobulin heavy chain, immunoglobulin light chain, T cell receptor, HLA-DQα and HLA-DQβ, β-interferon, interleukin-2, interleukin-2 receptor, MHC class II, HLA-DRα, β-actin, muscle creatine kinase, prealbumin (transthyretin), elastase I, metallothionein, collagenase, albumin, fetoprotein, β-globin, c-fos, c-HA-ras, neural cell adhesion molecule (NCAM), α1-antitrypsin, H2B (TH2B) histone, type I collagen, glucose-regulated proteins (GRP94 and GRP78), rat growth hormone, human serum amyloid A (SAA), troponin I (TNI), platelet-derived growth factor, and dystrophin, as well as promoters specific for liver cells. The promoter can be either inducible or constitutive. An inducible promoter is a promoter that is inactive or exhibits low activity except in the presence of an inducer substance. Additional examples of promoters include, but are not limited to, MT II, MMTV, collagenase, stromelysin, SV40, murine MX gene, α-2-macroglobulin, MHC class I gene h-2kb, HSP70, proliferin, tetracycline inducible, tumor necrosis factor, or thyroid stimulating hormone gene promoter. One example of an inducible promoter is the interferon inducible ISG54 promoter (see Bluyssen et al., Proc. Natl Acad. Sci.92: 5645-5649, 1995, herein incorporated by reference). In some aspects, the promoter is a constitutive promoter that results in high levels of transcription upon introduction into a host cell in the absence of additional factors. The protein can be a liver specific promoter, such as an albumin promoter, α1-antitrypsin (AAT) promoter (Serpina1), apolipoprotein E promoter, liver-specific promoter 1 (LP1), thyroxine-binding globulin (TBG) promoter, phosphoglycerate kinase 1 (PGK) promoter, cytochrome P4502E1 (CYP2E1) promoter, α-fetoprotein (AFP) promoter, transthyretin (TTR) promoter, α1-microglobulin enhancer, DC190 promoter, DC172 promoter, light strand promoter, liver-specific promoter (LSPs), hepatic control region-1 (HCR) promoter, liver-muscle promoter (LiMP), phosphoenolpyruvate carboxykinase (PEPCK) promoter, or hepatic nuclear factor-3 (HNF3) promoter. Optionally, transcription control sequences include one or more enhancer elements, which are binding recognition sites for one or more transcription factors that increase transcription above that observed for the minimal promoter alone, and also be operably linked to the polynucleotide encoding the promoter and/or the nucleic acid molecule encoding the GPX4 protein. Regarding the nucleic acid molecule encoding the GPX4 protein, introns can also be included that help stabilize mRNA and increase expression. This mRNA can then be isolated and used in the methods disclosed herein. In one aspect, mRNA encoding GPX4 is used in the methods disclosed herein. In some aspects of the compositions and methods described herein, a nucleic acid sequence that encodes a GPX4 protein is incorporated into a vector capable of expression in a host cell, using established molecular biology procedures. For example, nucleic acids, such as cDNAs, that encode a GPX4 protein can
be manipulated with standard procedures, such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence-alteration via single-stranded bacteriophage intermediate, or use of specific oligonucleotides in combination with PCR or other in vitro amplification. These vectors can include a promoter operably linked to a nucleic acid molecule encoding a GPX4 protein. Exemplary procedures sufficient to guide one of ordinary skill in the art through the production of a vector capable of expression in a host cell that includes a promoter, and/or a polynucleotide sequence encoding a GPX4 protein can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2003); and Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999. It may be desirable to include a polyadenylation signal to effect proper termination and polyadenylation of the gene transcript. Exemplary polyadenylation signals have been isolated from beta globin, bovine growth hormone, SV40, and the herpes simplex virus thymidine kinase genes. The nucleic acid molecules can be included in a nanodispersion system, see, e.g., U.S. Pat. No. 6,780,324; U.S. Pat. Publication No.2009/0175953. For example, a nanodispersion system includes a biologically active agent and a dispersing agent (such as a polymer, copolymer, or low molecular weight surfactant). Exemplary polymers or copolymers include polyvinylpyrrolidone (PVP), poly(D,L-lactic acid) (PLA), poly(D,L-lactic-co-glycolic acid (PLGA), poly(ethylene glycol). Exemplary low molecular weight surfactants include sodium dodecyl sulfate, hexadecyl pyridinium chloride, polysorbates, sorbitans, poly(oxyethylene) alkyl ethers, poly(oxyethylene) alkyl esters, and combinations thereof. In one example, the nanodispersion system includes PVP and ODP or a variant thereof (such as 80/20 w/w). In some examples, the nanodispersion is prepared using the solvent evaporation method, see for example, Kanaze et al., Drug Dev. Indus. Pharm.36:292-301, 2010; Kanaze et al., J. Appl. Polymer Sci.102:460-471, 2006. Dendrimers are synthetic three-dimensional macromolecules that are prepared in a step-wise fashion from simple branched monomer units, the nature and functionality of which can be easily controlled and varied. Dendrimers consist of an initiator core, surrounded by a layer of a selected polymer that is grafted to the core, forming a branched macromolecular complex. Dendrimers are typically produced using polymers such as poly(amidoamine) or poly(L-lysine). A dendrimer can be synthesized from the repeated addition of building blocks to a multifunctional core (divergent approach to synthesis), or towards a multifunctional core (convergent approach to synthesis) and each addition of a three-dimensional shell of building blocks leads to the formation of a higher generation of the dendrimers. Polypropylenimine dendrimers contain 100% protonable nitrogens and up to 64 terminal amino groups. Protonable groups are usually amine groups which are able to accept protons at neutral pH. For nucleic acid molecules, dendrimers can be formed from polyamidoamine and phosphorous containing compounds with a mixture of amine/ amide or
N-P(O2)S as the conjugating units. Dendrimers of use for delivery of nucleic acid molecules is disclosed, for example, in PCT Publication No.2003/033027. The polynucleotides encoding the GPX4 protein include a recombinant DNA which is incorporated into a vector in an autonomously replicating plasmid or virus or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (such as a cDNA) independent of other sequences. Viral vectors that include the GPX4 protein, can also be prepared. Numerous viral vectors are known in the art, including polyoma; SV40 (Madzak et al., 1992, J. Gen. Virol., 73:15331536); adenovirus (Berkner, 1992, Cur. Top. Microbiol. Immunol., 158:39-6; Berliner et al., 1988, Bio Techniques, 6:616-629; Gorziglia et al., 1992, J. Virol., 66:4407-4412; Quantin et al., 1992, Proc. Natl. Acad. Sci. USA, 89:2581-2584; Rosenfeld et al., 1992, Cell, 68:143-155; Wilkinson et al., 1992, Nucl. Acids Res., 20:2233-2239; Stratford-Perricaudet et al., 1990, Hum. Gene Ther., 1:241-256); vaccinia virus (Mackett et al., 1992, Biotechnology, 24:495-499); adeno-associated virus (Muzyczka, 1992, Curr. Top. Microbiol. Immunol., 158:91-123; On et al., 1990, Gene, 89:279-282); herpes viruses, including HSV and EBV (Margolskee, 1992, Curr. Top. Microbiol. Immunol., 158:67-90; Johnson et al., 1992, J. Virol., 66:29522965; Fink et al., 1992, Hum. Gene Ther.3:11- 19; Breakfield et al., 1987, Mol. Neurobiol., 1:337-371; Fresse et al., 1990, Biochem. Pharmacol., 40:2189- 2199); Sindbis viruses (H. Herweijer et al., 1995, Human Gene Therapy 6:1161-1167; U.S. Pat. Nos. 5,091,309 and 5,2217,879); alphaviruses (S. Schlesinger, 1993, Trends Biotechnol.11:18-22; I. Frolov et al., 1996, Proc. Natl. Acad. Sci. USA 93:11371-11377); and retroviruses of avian (Brandyopadhyay et al., 1984, Mol. Cell Biol., 4:749-754; Petropouplos et al., 1992, J. Virol., 66:3391-3397), murine (Miller, 1992, Curr. Top. Microbiol. Immunol., 158:1-24; Miller et al., 1985, Mol. Cell Biol., 5:431-437; Sorge et al., 1984, Mol. Cell Biol., 4:1730-1737; Mann et al., 1985, J. Virol., 54:401-407), and human origin (Page et al., 1990, J. Virol., 64:5370-5276; Buchschalcher et al., 1992, J. Virol., 66:2731-2739). Baculovirus (Autographa californica multinuclear polyhedrosis virus; AcMNPV) vectors are also known in the art and may be obtained from commercial sources (such as PharMingen, San Diego, Calif.; Protein Sciences Corp., Meriden, Conn.; Stratagene, La Jolla, Calif.). Thus, in one aspect, the nucleic acid molecule encoding the GPX4 protein, is included in a viral vector. Suitable vectors include retrovirus vectors, orthopox vectors, avipox vectors, fowlpox vectors, capripox vectors, suipox vectors, adenoviral vectors, herpes virus vectors, alpha virus vectors, baculovirus vectors, Sindbis virus vectors, vaccinia virus vectors, lentivirus vectors and poliovirus vectors. Specific exemplary vectors are poxvirus vectors, such as vaccinia virus, fowlpox virus and a highly attenuated vaccinia virus (MVA), adenovirus, baculovirus, yeast, and the like. Adeno-associated virus vectors (AAV) are disclosed in additional detail below, and are of use in the disclosed methods. Disclosed herein are methods and compositions that include utilizing one or more vectors, such as a viral vector, such as a retroviral vector, lentiviral vector, or an adenoviral vector, or an AAV vector that includes a nucleic acid molecule including a GPX4 protein. Defective viruses, that entirely or almost entirely lack viral genes, can be used. The vector can be a lentiviral vector. Use of defective viral vectors allows for administration to specific cells without concern that the vector can infect other cells. The
adenovirus vectors of use include replication competent, replication deficient, gutless forms thereof. The AAV vectors of use are replication deficient. Without being bound by theory, adenovirus vectors are known to exhibit strong expression in vitro, excellent titer, and the ability to transduce dividing and non-dividing cells in vivo (Hitt et al., Adv in Virus Res 55:479-505, 2000). When used in vivo these vectors lead to strong but transient gene expression due to immune responses elicited to the vector backbone. In some non- limiting examples, a vector of use is an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. (J. Clin. Invest., 90:626-6301992; La Salle et al., Science 259:988-990, 1993); or a defective AAV vector (Samulski et al., J. Virol., 61:3096-3101, 1987; Samulski et al., J. Virol., 63:3822- 3828, 1989; Lebkowski et al., Mol. Cell. Biol., 8:3988-3996, 1988). Recombinant AAV vectors are characterized in that they are capable of directing the expression and the production of the selected transgenic products in targeted cells. Thus, the recombinant vectors comprise at least all of the sequences of AAV essential for encapsidation and the physical structures for infection of target cells. AAV belongs to the family Parvoviridae and the genus Dependovirus. AAV is a small, non- enveloped virus that packages a linear, single-stranded DNA genome. Both sense and antisense strands of AAV DNA are packaged into AAV capsids with equal frequency. In some aspects, the AAV DNA includes a nucleic acid including a promoter operably linked to a nucleic acid molecule encoding a GPX4 protein. Further provided are recombinant vectors, such as recombinant adenovirus vectors and recombinant adeno- associated virus (rAAV) vectors comprising a nucleic acid molecule(s) disclosed herein. In some aspects, the AAV is rAAV8, and/or AAV2. However, the AAV serotype can be any other suitable AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV9, AAV10, AAV11 or AAV12, or a hybrid of two or more AAV serotypes. The AAV genome is characterized by two inverted terminal repeats (ITRs) that flank two open reading frames (ORFs). In the AAV2 genome, for example, the first 125 nucleotides of the ITR are a palindrome, which folds upon itself to maximize base pairing and forms a T-shaped hairpin structure. The other 20 bases of the ITR, called the D sequence, remain unpaired. The ITRs are cis-acting sequences important for AAV DNA replication; the ITR is the origin of replication and serves as a primer for second- strand synthesis by DNA polymerase. The double-stranded DNA formed during this synthesis, which is called replicating-form monomer, is used for a second round of self-priming replication and forms a replicating-form dimer. These double-stranded intermediates are processed via a strand displacement mechanism, resulting in single-stranded DNA used for packaging and double-stranded DNA used for transcription. Located within the ITR are the Rep binding elements and a terminal resolution site (TRS). These features are used by the viral regulatory protein Rep during AAV replication to process the double- stranded intermediates. In addition to their role in AAV replication, the ITR is also essential for AAV genome packaging, transcription, negative regulation under non-permissive conditions, and site-specific integration (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008). In some aspects, these elements are included in the AAV vector.
The left ORF of AAV contains the Rep gene, which encodes four proteins – Rep78, Rep 68, Rep52 and Rep40. The right ORF contains the Cap gene, which produces three viral capsid proteins (VP1, VP2 and VP3). The AAV capsid contains 60 viral capsid proteins arranged into an icosahedral symmetry. VP1, VP2 and VP3 are present in a 1:1:10 molar ratio (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008). In some aspects, these elements are included in the AAV vector. AAV vectors can be used for gene therapy. Exemplary AAV of use are AAV2, AAV5, AAV6, AAV8 and AAV9. Adenovirus, AAV2 and AAV8 are capable of transducing cells in the liver. Thus, any of a rAAV2 or rAAV8 vector can be used in the methods disclosed herein. However, rAAV6 and rAAV9 vectors are also of use. Although AAV infects humans and some other primate species, it is not known to cause disease and elicits a very mild immune response. Gene therapy vectors that utilize AAV can infect both dividing and quiescent cells and persist in an extrachromosomal state without integrating into the genome of the host cell. Because of the advantageous features of AAV, the present disclosure contemplates the use of an rAAV for the methods disclosed herein. AAV possesses several additional desirable features for therapy, including the ability to bind and enter target cells, enter the nucleus, the ability to be expressed in the nucleus for a prolonged period of time, and low toxicity. AAV can be used to transfect cells, and suitable vector are known in the art, see for example, U.S. Published Patent Application No.2014/0037585, incorporated herein by reference. Methods for producing rAAV suitable for gene therapy are well known in the art (see, for example, U.S. Published Patent Application Nos.2012/0100606; 2012/0135515; 2011/0229971; and 2013/0072548; and Ghosh et al., Gene Ther 13(4):321-329, 2006), and can be utilized with the methods disclosed herein. In some aspects, the vector is a rAAV8 vector, a rAAV2 vector, a rAAV9 vector. In a specific non- limiting example, the vector is an AAV8 vector. AAV8 vectors are disclosed, for example, in U.S. Patent No.8,692,332, which is incorporated by reference herein. The location and sequence of the capsid, rep 68/78, rep 40/52, VP1, VP2 and VP3 are disclosed in this U.S. Patent No.8,692,332. The location and hypervariable regions of AAV8 are also provided. In some aspects, the vector is an AAV2 variant vector, such as AAV7m8. The vectors of use in the methods disclosed herein can contain nucleic acid sequences encoding an intact AAV capsid which may be from a single AAV serotype (e.g., AAV2, AAV6, AAV8 or AAV9). As disclosed in U.S. Patent No.8,692,332, vectors of use can also be recombinant, and thus can contain sequences encoding artificial capsids which contain one or more fragments of the AAV8 capsid fused to heterologous AAV or non-AAV capsid proteins (or fragments thereof). These artificial capsid proteins are selected from non-contiguous portions of the AAV2, AAV6, AAV8 or AAV9 capsid or from capsids of other AAV serotypes. For example, a rAAV vector may have a capsid protein comprising one or more of the AAV8 capsid regions selected from the VP2 and/or VP3, or from VP1, or fragments thereof selected from amino acids 1 to 184, amino acids 199 to 259; amino acids 274 to 446; amino acids 603 to 659; amino acids 670 to 706; amino acids 724 to 738 of the AAV8 capsid, which is presented as SEQ ID NO: 2 in U.S.
Patent No.8,692,332. In another example, it may be desirable to alter the start codon of the VP3 protein to GTG. Alternatively, the rAAV may contain one or more of the AAV serotype 8 capsid protein hypervariable regions, for example aa 185- 198; aa 260-273; aa447-477; aa495-602; aa660-669; and aa707- 723 of the AAV8 capsid which is presented as SEQ ID NO: 2 in U.S. Patent No.8,692,332. In some aspects, a recombinant adeno-associated virus (rAAV) is generated having an AAV serotype 2 capsid. To produce the vector, a host cell which can be cultured that contains a nucleic acid sequence encoding an AAV serotype 2 capsid protein, or fragment thereof, as defined herein; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene, such as encoding a GPX4 protein and sufficient helper functions to permit packaging in the AAV2 capsid protein. The biological molecules required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required biological molecules (e.g., minigene, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art. In some aspects, a stable host cell will contain the required biological molecules s(s) under the control of an inducible promoter or a tissue specific promoter. Similar methods can be used to generate a rAAV2, rAAV8 or rAAV9 vector and/or virion. A liver specific promoter can be included in the AAV vectors. In some aspects, promoters include, but are not limited to, an A1AT promoter (α1-antitrypsin, Serpina1), apolipoprotein E promoter, LP1 promoter, TBG promoter, PGK promoter, CYP2E1 promoter, Afp promoter, TTR promoter, α1- microglobulin enhancer, DC190 promoter, DC172 promoter, LSP, liver-specific promoter, HCR promoter, LiMP promoter, PEPCK promoter, or HNF3 promoter. In specific non-limiting examples, a liver-specific promoter, as disclosed above, is operably linked to a nucleic acid molecule encoding the GPX4 protein, and included in the AAV vector. In other aspects, a nucleic acid molecule encoding a component of the ferroptosis pathway, such as, but not limited to, a transgene encoding a GPX4 protein, can be under the control of a constitutive promoter. A non-limiting example of a suitable constitutive promoter is the cytomegalovirus promoter. Additional non-limiting examples are the ubiquitin or a chicken β-actin promoter. Promoters of use include liver specific promoters, such as an A1AT promoter (α1-antitrypsin, Serpina1), apolipoprotein E promoter, LP1 promoter, TBG promoter, PGK promoter, CYP2E1 promoter, Afp promoter, TTR promoter, α1- microglobulin enhancer, DC190 promoter, DC172 promoter, LSP, liver-specific promoter, HCR promoter, LiMP promoter, PEPCK promoter, or HNF3 promoter. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters, such as for the production of rAAV in a packaging host cell. For example, a stable host cell may be generated which is derived from 293 cells (which contain E1 helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
The minigene, rep sequences, cap sequences, and helper functions required for producing a rAAV can be delivered to the packaging host cell in the form of any genetic element which transfer the sequences carried thereon. The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct vectors are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, J. Virol., 70:520-532 (1993) and U.S. Patent No.5,478,745. In some aspects, elements of the selected AAV can be readily isolated using techniques available to those of skill in the art from an AAV serotype, including AAV8. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GENBANK®. In another aspect, an mRNA can be used to deliver a nucleic acid encoding GPX4 directly into cells. In some aspects, nucleic acid-based vaccines based on mRNA may provide a potent alternative to the previously mentioned approaches. mRNA delivery precludes safety concerns about DNA integration into the host genome and can be directly translated in the host cell cytoplasm. Moreover, the simple cell-free, in vitro synthesis of RNA avoids the manufacturing complications associated with viral vectors. Two exemplary forms of RNA that can be used to deliver a nucleic acid include conventional non-amplifying mRNA (see, e.g., Petsch et al., “Protective efficacy of in vitro synthesized, specific mRNA vaccines against influenza A virus infection,” Nature biotechnology, 30(12):1210–6, 2012) and self-amplifying mRNA (see, e.g., Geall et al., “Nonviral delivery of self-amplifying RNA vaccines,” PNAS, 109(36): 14604-14609, 2012; Magini et al., “Self-Amplifying mRNA Vaccines Expressing Multiple Conserved Influenza Antigens Confer Protection against Homologous and Heterosubtypic Viral Challenge,” PLoS One, 11(8):e0161193, 2016; and Brito et al., “Self-amplifying mRNA vaccines,” Adv Genet., 89:179-233, 2015). The pharmaceutical compositions including a nucleic acd moleucle can be formulated and administered in a variety of ways depending on the type of disease to be treated (see, e.g., U.S. Published Application No.2005/0054567, which discloses pharmaceutical compositions as well as administration of such compositions and is incorporated herein by reference). The pharmaceutical compositions can include a nanoparticle or dendrimer. These pharmaceutical compositions are of use in the methods disclosed herein. In one non-limiting example, the pharmaceutical compositions include a nucleic acid molecule encoding GPX4. Pharmaceutical compositions including a nucleic acid molecule are provided that are formulated for local delivery to the liver. Pharmaceutical compositions including nucleci acid molecules can be formulated for injection, such as for intrahepatic or intravenous administration. Such compositions are formulated generally by mixing a disclosed nucleic acid molecule at the desired degree of purity in a unit dosage injectable form (solution,
suspension, or emulsion) with a pharmaceutically acceptable carrier, for example, one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation. Pharmaceutical compositions can include an effective amount of the nucleic acid molecule dispersed (for example, dissolved or suspended) in a pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable carriers and/or pharmaceutically acceptable excipients are known in the art and are described, for example, in Remington’s Pharmaceutical Sciences by E. W. Martin, Mack Publishing Co., Easton, PA, 19th Edition (1995). The nature of the carrier will depend on the particular mode of administration being employed. For example, formulations usually contain injectable fluids that include pharmaceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like, as a vehicle. In addition, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate. A disclosed nucleic acid molecule can be suspended in an aqueous carrier, for example, in an isotonic or hypotonic buffer solution at a pH of about 3.0 to about 8.5, such as about 4.0 to about 8.0, about 6.5 to about 8.5, or about 7.4. Useful buffers include saline-buffered phosphate or an ionic boric acid buffer. The active ingredient, optionally together with excipients, can also be in the form of a lyophilisate and can be made into a solution prior to administration by the addition of suitable solvents. The pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well-known in the art. Supplementary active ingredients also can be incorporated into the compositions. For example, certain pharmaceutical compositions can include the vectors or viruses in water, mixed with a suitable surfactant, such as hydroxy-propylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof as well as in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles. In some aspects, the excipients confer a protective effect to a virus including the nucleic acid molecules, such as AAV virion or lentivirus virion, such that loss of AAV virions or lentivirus virions, as well as transduceability resulting from formulation procedures, packaging, storage, transport, and the like, is minimized. These excipient compositions are therefore considered "virion-stabilizing" in the sense that they provide higher virion titers and higher transduceability levels than their non-protected counterparts, as measured using standard assays, see, for example, Published U.S. Application No.2012/0219528, incorporated herein by reference. These compositions therefore demonstrate "enhanced transduceability levels" as compared to compositions lacking the particular excipients described herein and are therefore more stable than their non-protected counterparts.
Exemplary excipients that can used to protect a virion from activity degradative conditions include, but are not limited to, detergents, proteins, e.g., ovalbumin and bovine serum albumin, amino acids, e.g., glycine, polyhydric and dihydric alcohols, such as but not limited to polyethylene glycols (PEG) of varying molecular weights, such as PEG-200, PEG-400, PEG-600, PEG-1000, PEG-1450, PEG-3350, PEG-6000, PEG-8000 and any molecular weights in between these values, with molecular weights of 1500 to 6000 preferred, propylene glycols (PG), sugar alcohols, such as a carbohydrate, preferably, sorbitol. The detergent, when present, can be an anionic, a cationic, a zwitterionic or a nonionic detergent. An exemplary detergent is a nonionic detergent. One suitable type of nonionic detergent is a sorbitan ester, e.g., polyoxyethylenesorbitan monolaurate (TWEEN®-20) polyoxyethylenesorbitan monopalmitate (TWEEN®- 40), polyoxyethylenesorbitan monostearate (TWEEN®-60), polyoxyethylenesorbitan tristearate (TWEEN®- 65), polyoxyethylenesorbitan monooleate (TWEEN®-80), polyoxyethylenesorbitan trioleate (TWEEN®- 85), such as TWEEN®-20 and/or TWEEN®-80. These excipients are commercially available from a number of vendors, such as Sigma, St. Louis, Mo. The amount of the various excipients in any of the disclosed compositions including virus, such as AAV, varies and is readily determined by one of skill in the art. For example, a protein excipient, such as BSA, if present, will can be present at a concentration of between 1.0 weight (wt.) % to about 20 wt. %, such as 10 wt. %. If an amino acid such as glycine is used in the formulations, it can be present at a concentration of about 1 wt. % to about 5 wt. %. A carbohydrate, such as sorbitol, if present, can be present at a concentration of about 0.1 wt % to about 10 wt. %, such as between about 0.5 wt. % to about 15 wt. %, or about 1 wt. % to about 5 wt. %. If polyethylene glycol is present, it can generally be present on the order of about 2 wt. % to about 40 wt. %, such as about 10 wt. % top about 25 wt. %. If propylene glycol is used in the subject formulations, it will typically be present at a concentration of about 2 wt. % to about 60 wt. %, such as about 5 wt. % to about 30 wt. %. If a detergent such as a sorbitan ester (TWEEN®) is present, it can be present at a concentration of about 0.05 wt. % to about 5 wt. %, such as between about 0.1 wt. % and about 1 wt %, see U.S. Published Patent Application No.2012/0219528, which is incorporated herein by reference. In one example, an aqueous virion-stabilizing formulation comprises a carbohydrate, such as sorbitol, at a concentration of between 0.1 wt. % to about 10 wt. %, such as between about 1 wt. % to about 5 wt. %, and a detergent, such as a sorbitan ester (TWEEN®) at a concentration of between about 0.05 wt. % and about 5 wt. %, such as between about 0.1 wt. % and about 1 wt. %. Virions are generally present in the composition in an amount sufficient to provide a therapeutic effect when given in one or more doses, as defined above. Local modes of administration include intrahepatic routes, such as adminitration to a donor liver prior to transplantation, or adminstration to the donor liver at the time of transplantion. In an aspect, significantly smaller amounts (compared with systemic approaches) may exert an effect when administered locally (for example, intrahepatically) compared to when administered systemically (for example, intravenously). Local modes of administration can reduce or eliminate the incidence of potential side
effects. Methods for administration of nucleic acid molecules to the liver are known in the medical arts and can be used in the methods described herein. Administration may be provided as a single administration, a periodic bolus (for example, intrahepatically) or as continuous infusion from an internal reservoir (for example, from an implant disposed at an intrahepatic location or from an external reservoir (for example, from an intravenous bag). Intrahepatic injection of the nucleic acid molecules disclosed herein can be performed once, or can be performed repeatedly, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 or more times. Administration can be performed biweekly, weekly, every other week, monthly, or every 2, 3, 4, 5, or 6 months. In some aspects, the nucleic acid molecule encodes GPX4. Individual doses are typically not less than an amount required to produce a measurable effect on the subject and may be determined based on the pharmacokinetics and pharmacology of the subject composition or its by-products, and thus based on the disposition of the composition within the subject. This includes consideration of the route of administration as well as dosage amount, which can be adjusted for intraveinous or intrahepatic applications. Effective amounts of dose and/or dose regimen can readily be determined empirically from preclinical assays, from safety and escalation and dose range trials, individual clinician-patient relationships, as well as in vitro and in vivo assays. In some aspects, an AAV is administered to the recipient and/or to the donor liver (such as in an ex vivo perfusion system for these aspects) at a dose of about 1 x 1011 to about 1 x 1014 viral particles (vp)/kg. In some examples, the AAV is administered to the recipient at a dose of about 1 x 1012 to about 8 x 1013 vp/kg. In other examples, the AAV is administered to the recipient or to the donor liver at a dose of about 1 x 1013 to about 6 x 1013 vp/kg. In specific non-limiting examples, the AAV is administered to the recipient or to the donor liver at a dose of at least about 1 x 1011, at least about 5 x 1011, at least about 1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vp/kg. In other non- limiting examples, the AAV is administered to the recipient or to the donor liver at a dose of no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vp/kg. In one non-limiting example, the AAV is administered to the recipient or to the donor liver at a dose of about 1 x 1012 vp/kg. The AAV can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more doses) as needed for the desired therapeutic results. In some aspects, a lentivirus is administered to the recipient and/or to the donor liver (such as in an ex vivo perfusion system in these aspects) at a dose of about 1 x 1011 to about 1 x 1014 viral particles (vp)/kg. In some examples, the lentivirus is administered to the recipient or to the donor liver at a dose of about 1 x 1012 to about 8 x 1013 vp/kg. In other examples, the lentivirus is administered to the recipient or to the donor liver at a dose of about 1 x 1013 to about 6 x 1013 vp/kg. In specific non-limiting examples, the lentivirus is administered to the recipient or to the donor liver at a dose of at least about 1 x 1011, at least about 5 x 1011, at least about 1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vp/kg. In other non-limiting examples, the lentivirus is administered to the recipient or to the donor
liver at a dose of no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vp/kg. In one non- limiting example, the lentivirus is administered to the recipient or to the donor liver at a dose of about 1 x 1012 vp/kg. The lentivirus can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more doses) as needed for the desired therapeutic results. In some aspects, GSH and/or a supplement that increases GSH in the subject, such as Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S-Adenosylhomocysteine, S-Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, Guanadinoacetate, a pharmaceutically acceptable salt thereof, or any combination thereof, can be used. GSH and supplements that increases GSH in the subject, such as Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S-Adenosylhomocysteine, S-Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, Guanadinoacetate, a pharmaceutically acceptable salt thereof, and combinations thereof, and their administration, are disclosed in PCT Publication No. WO 2023/092134, incorporated herein by reference. In some aspects, one or more of these compounds is used to increase survival of a donor liver in a liver transplant recipient, wherein the donor liver is homozygous for rs738409:G mutation. In one non-limiting example, GSH is administered to the subject. In some aspects, administering GSH to the subject inhibits lipid peroxidation and/or mitochondrial shrinkage. Pharmaceutical compositions that include GSH and/or a supplement that increases glutathione in the subject, wherein the supplement is Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S-Adenosylhomocysteine, S- Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, Guanadinoacetate, a pharmaceutically acceptable salt thereof, or any combination thereof, can be formulated with an appropriate pharmaceutically acceptable carrier and used in the methods disclosed herein. The dosage form of the pharmaceutical composition will be determined by the mode of administration chosen. Exemplary administration methods include, but are not limited to, topical, oral, subcutaneous, transdermal, intrathecal, intramuscular, intravenous, intraperitoneal, and similar administration routes, or combinations thereof. For instance, in addition to injectable fluids, topical, inhalation, oral, infusion, and suppository formulations can be employed. Oral formulations can be liquid (such as syrups, solutions, or suspensions) or solid (such as powders, pills, tablets, or capsules). Suppository preparations can also be solid, gel, or in a suspension form. Infusion preparations, administered by catheter, are generally administered as liquids. Inhalation preparations can be liquid (such as solutions or suspensions) and include mists, sprays, and the like. For solid compositions, conventional non-toxic solid carriers can include pharmaceutical grades of mannitol, lactose, cellulose, starch, or magnesium stearate. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art. In some aspects, the pharmaceutical composition can be formulated for oral, intramuscular, or intravenous administration.
The amount of GSH or a supplement that increases glutathione in the subject, such as Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S-Adenosylhomocysteine, S-Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, Guanadinoacetate, a pharmaceutically acceptable salt thereof, or any combination, that is administered, will be dependent on the subject being treated, the severity of the affliction, and the manner of administration and is best left to the judgment of the prescribing clinician. Within these bounds, the formulation to be administered will contain a quantity of the active ingredient(s)in amounts effective to achieve the desired effect in the subject being treated. An effective amount can be the amount that is necessary to treat or lower the risk of a subject for decreased liver function of a transplant, or increase the size of the transplant. In some aspects, the administration results in improved survival of the transplanted liver. The pharmaceutical compositions that include GSH and/or a supplement that increases glutathione in the subject, wherein the supplement is at least one of Glutamine, Glutamate, GSSG, Cysteine, Glycine, Cys-Gly, Choline, Phosphatidylcholine, Sorbitol, Palmitoylcarnitine, Methylthioadenosine, S- Adenosylhomocysteine, S-Adenosylmethionine, Cystine, Methionine Creatine, Gamma-aminobutyrate, or Guanadinoacetate, a pharmaceutically acceptable salt thereof, or any combination, can be formulated in unit dosage form, suitable for individual administration of precise dosages. A variety of dosages and dosing regimens are possible (for example, Kilpatrick et al., International Immunopharmacology, 3:541–548, 2003; Gandhi et al., Blood, 106(13):4253-4260, 2005, both of which are incorporated herein by reference in their entireties). In one specific, non-limiting example, a unit dosage (such as intravenous dosage or an oral dosage) can be used. In some aspects, the subject is administered (for example, orally) about 50 to about 1500 mg of GSH, such as about 50 mg to about 150 mg, about 150 mg to about 300 mg, about 300 mg to about 450 mg, about 450 mg to about 600 mg, about 600 mg to about 750 mg, about 750 mg to about 900 mg, about 900 mg to about 1150 mg, about 1150 mg to about 1300 mg, or about 1300 mg to about 1500 mg. In one specific non-limiting example, the subject is administered (for example, orally) about 300 mg of GSH per day. In another specific, non-limiting example, the subject is administered (for example, intravenously) about 1400 mg in a single dose or in more than dose. The dose administered to a subject should be sufficient to induce a beneficial therapeutic response in a subject over time, or to promote survival of a donor liver in a recipient subject. The beneficial therapeutic response may require one or more doses, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, or 500, or more doses, administered at the same or different times. The dose may vary from subject to subject or may be the same. An appropriate dose can be determined by one of ordinary skill in the art using routine experimentation. Pharmaceutically acceptable salts and hydrates are also of use in the disclosed methods. In one aspect, and pharmaceutically acceptable salt is a chloride salt. However, other salts can be utilized, such as
alkali metal salts; esters such as acetate, butyrate, octinoate, palmitate, chlorobenzoates, benzoates, C1-C6 benzoates, succinates, and mesylate; salts of such esters; and nitrile oxides. A variety of administration regimens are possible (for example, Kilpatrick et al., International Immunopharmacology, 3:541–548, 2003; Gandhi et al., Blood, 106(13):4253-4260, 2005, both of which are incorporated herein by reference in their entireties). Administration with an effective amount can be a single administration or multiple administrations. Administration can involve daily or multi-daily or less than daily (such as weekly, monthly, etc.) doses over a period of a few days to weeks or months, or even years. In a particular non-limiting example, administration involves once daily dose or twice daily dose. The particular mode/manner of administration and the dosage regimen will be selected by the attending clinician, taking into account the particulars of the case (such as the subject, the disease, the disease state/severity involved, the particular administration, and whether the treatment is prophylactic). In specific, non-limiting examples, administration can be oral, intramuscular, or by intravenous delivery. In some aspects, for the use of GSH, and/or a supplement that increases glutathione in the subject, the composition is administered daily. In other aspects the composition is administered more than once a day, such as twice a day, three time a day or four times a day. In yet other aspects, the composition is administered once a day, every other day, every three days or once a week. In some aspects, the GSH or a supplement that increases glutathione in the subject is administered by an intravenous (IV) infusion, such as within one day after transplantation or resection, and continued for at least 7 days, such as 8, 9, 10, 11, 12, 13 or 14 days, such as for about 7 to about 14 days. However, the IV infusion can be continued for longer periods, such as for up to three weeks. In a liver transplant donor, and IV infusion can be administered before and/or after a resection procedure. In some aspects, GSH or a supplement that increases glutathione in the subject is administered intravenously, such as using an infusion. The following examples are provided to illustrate particular features of certain aspects of the disclosure, but the scope of the claims should not be limited to those features exemplified. EXAMPLES Genome-wide association studies (GWAS) (Romeo et al., 2008, Nat Genet 40, 1461-1465; Kozlitina et al., 2014, Nat Genet 47, 1443-1448; Speliotes et al., 2011, PLoS Genet 7, e1001324; Buch et al., 2015, Nat Genet 47, 1443-1448; Abul-Husn et al., 2018, N Engl J Med 378, 1096-1106; Valenti et al., 2010, Hepatology 51, 1209-1217; Tan et al., 2014, J Gastroenterol 49, 1056-1064; Dongiovanni et al., 2015, Hepatology 61, 506-514; Mancina et al., 2016, Gastroenterol 150, 1219-1230; Ma et al., 2019, Hepatology 69, 1504-1519; Musso et al., 2009, Hepatology 49, 426-435) have identified several variants or combinations of variants (Gellert-Kristensen et al., 2020, Hepatology 72, 845-856) including PNPLA3 (rs738409 C>G p.Ie148Met; patatin-like phospholipase domain-containing protein 3) (Romeo et al., 2008, Nat Genet 40, 1461-1465; Speliotes et al., 2011, PLoS Genet 7, e1001324; Valenti et al., 2010, Hepatology
51, 1209-1217) that are associated with predisposing susceptibility to MAFLD and progression to fibrosis and ESLD, especially when synergized on individuals with a BMI >35 kg/m (Estes et al., 2018, Hepatology 67, 123-133; Stender et al., 2017, Nat Genet 49, 842-847). The PNPLA3 rs738409 variant is of especial interest due to its wide and significant ubiquitous association with every step on the MAFLD spectrum (including hepatocellular carcinoma) and alcohol-related liver disease and the lack of tractable mechanistic targets (Mann et al., 2017, Nat Rev Gastroenterol Hepatol 14, 506-507). Most of the gene variant associations examined including PNPLA3 highlight the role of lipid droplet biology, intracellular lipid synthesis and degradation, and secretion of very-low-density lipoproteins (Trepo et al., 2020, J Hepatol 72, 1196-1209) as potential mechanisms behind the development of MAFLD. Functional analyses of these variants in human livers are underexplored (Eshraghian et al., 2021, BMC Gastroenterol 21, 458; Watt et al., 2013, Am J Transplant 13, 2450-2457), and the mechanisms by which the variants lead to ESLD and cellular death are poorly understood. To elucidate the impact of genetic variants in healthy donors that might affect the metabolic capacity and adaptation to stressors of the transplanted grafts, PNPLA3 rs738409 variant was analyzed in healthy donors, patients with ESLD, and donor and recipients undergoing LDLT. It was found that PNPLA3 rs738409 variant is present in 28% of ESLD patients in a US cohort and nearly 50% of ESLD patients in Asian cohort. The PNPLA3 rs738409 variant in the donor graft was associated with reduced recipient survival. The molecular and metabolic consequences of PNPLA3 rs738409 variants was studied using an integrated multiomics approach encompassing semi-targeted metabolomics and transcriptomics. The effect of these variants on mitochondrial morphology, peroxisomal fatty acid oxidation, lipid peroxidation, and cell death via ferroptosis using primary human hepatocytes and cell lines was also studied. To confirm the findings of the multiomics analysis, peroxisomal fatty acid oxidation, ferroptosis, and bile salt export were targeted to increase the survival of primary hepatocytes. Collectively, the results have elucidated an undiscovered mechanism of metabolic regulation by the PNPLA3 rs738409 variant and revealed that personalized therapies that inhibit ferroptosis can reverse programmed cell death by reducing lipid peroxidation. Importantly, the study leads to the use of precision medicine-based strategies for liver transplantation by promoting genotype profiling of donors in LDLT programs. EXAMPLE 1: Materials and Methods Study population As part of a retrospective cohort study, 85 recipients and 85 donors who underwent living donor liver transplantation. The mean (± SD) follow-up time was 48 ± 39 months. DNA was available for 83 recipients and 79 donors. Only recipients undergoing liver transplantation due to NASH, Alcoholic cirrhosis, and cryptogenic cirrhosis were included in this study. The study was conducted with the approval of the institutional ethics review boards. The selection criteria for performing LDLT were published previously (Yoshizumi et al., 2021, J Hepatol 74, 372-379). In brief, LDLT was indicated when no other potentially curative modality was available, and no other organ dysfunction present. The selection criteria for performing LDLT on patients
with hepatocellular carcinoma were no other potentially curative modality available, no extrahepatic metastasis, and no major vascular infiltration. The recipient’s age was not a factor. Donors were selected from candidates who volunteered to be living donors. They were required to be within 3 degrees of kinship or the recipient’s spouse and between 20 and 65 years of age. Individual approval was obtained from the Ethics Committee of Kyushu University Hospital for donors who were not within three degrees of kinship with the recipient. Good Samaritan donation was not used. Three-dimensional computed tomography was performed for volumetric analysis and delineation of vascular anatomy. Decisions about graft types were based on the preoperatively predicted GW-to- SLW (GW/SLW) ratio. When the preoperatively projected GW/SLW ratio was greater than 35 percent, left lobe + caudate lobe grafts were chosen, but when the donor was younger than 30 years old, a smaller graft, one with a GW/SLW ratio between 30 and 35 percent, was used. Human hepatocytes De-identified healthy controls were acquired, and adult human hepatocytes were also obtained. Primary human hepatocytes were isolated using a three-step collagenase digestion technique as previously described (Faccioli et al., 2021, Organogenesis 17, 117-125). Briefly, the cell isolation was initiated by perfusion with 37oC calcium-free HBSS supplemented with 0.5 mM EGTA and collagenase solution (VitaCyte, Indianapolis, IN) until the tissue was fully digested. The digested liver was cooled with ice-cold Leibovitz’s L-15 medium and strained through serial progressively smaller stainless-steel sieves with a final filtration through a 100 µm mesh. The final crude cell suspension was centrifuged twice, and the post-digest medium was aspirated. Cell viability was assessed after isolation using trypan blue exclusion, and only cell preparations with viability greater than 80% were cryopreserved. Single vials of cryopreserved hepatocytes were obtained from In Vitro ADMET Laboratories (Malden, MA) and Novabiosis (Durham, NC). Genotyping DNA was extracted with the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany), and samples were genotyped using TaqMan SNP genotyping assays for PNPLA3 (rs738409), (Thermo Fisher Scientific, San Jose, CA) (Yang et al., 2019, Hepatology 70, 231-240). Amplification and genotype clustering was performed using a StepOnePlus system (Applied Biosystems, Foster City, CA). Sanger sequencing DNA extraction was performed with the KAPA Express Extract DNA Extraction Kit (Kapa Biosystems, London, UK). Polymerase chain reaction (PCR) amplification was conducted with the KOD ONE PCR Master Mix (Toyobo, Osaka, Japan) using the forward primer: 5′-CCA ACA ACC CTT GGT CCT GT-3′ (SEQ ID NO: 1) and reverse primer: 5′-GGG TAG CCT GGA AAT AGG GC-3′ (SEQ ID NO: 2) for PNPLA3. PCR products were then purified using ExoSAP-IT Express PCR cleanup kit (Applied Biosystems, Foster City, CA) and sequenced. Sequencing buffer and a 1:4 dilution of BigDye 3.1
(ThermoFisher Scientific, Waltham, MA) were added, and thermocycling was performed according to ABI recommendations. According to manufacturer instructions, removing unincorporated sequencing reagents is performed using CleanSeq magnetic beads (Agencourt, Beckman Coulter, Brea, CA). Two control samples were included with every sequencing to ensure the proper performance of reagents and equipment. Production of High Titer Lentivirus Vector cloning, vector sequencing, and production of high-titer lentivirus were performed by Vectorbuilder (Chicago, IL). Briefly, lentiviruses were produced by co-transfecting 293T cells with the expression vectors pLV[Exp]-CMV>EGFP or pLV[Exp]-CMV>hGPX4 (transcript variant NM_001039848.4 containing a selenocysteine insertion sequence (SECIS) element to ensure proper incorporation of selenocysteine), envelope plasmid (pMD2. G) and packaging plasmids (pMDLg/pRRE and pRSV-Rev) using FuGENE 6 transfection reagent (Promega Corporation, Madison, WI, USA). After cell debris and macromolecular contaminants were filtered by 0.45um filter, the filtrate was collected and concentrated with PEG6000 (Sigma-Aldrich, Saint-Louis, MO) to increase the virus titer to yield 1x10^9 viral particles/ml before being stored at −80°C. Cell culture and transfection Primary human hepatocytes were cultured in Hepatocyte Culture Medium (Lonza, Walkersville, MD) on type I rat tail collagen-coated plates (Corning, Corning, NY) and kept at 37°C in 5% CO2. Cell preparations with post-thaw viability greater than 80% were used for cell culture. Suspension culture of primary human hepatocytes was performed on ultra-low attachment plates (ThermoFisher Scientific, Waltham, MA) on an orbital shaker. To create an environment of ferroptosis in primary human hepatocytes, 50µM (5α,8α)-8-(1,1- dimethylethyl)-3-methyl-1,2-dioxaspiro[4.5]decane-3-ethanol (FINO2, Cayman Chemical, Ann Arbor, MI) dissolved in DMSO was added to the medium. To evaluate the effect of deferoxamine, primary human hepatocytes were treated with 100µM Deferoxamine (DFO, Sigma-Aldrich, Saint-Louis, MO) for 24 hours in suspension. To evaluate the effect of GSH, primary human hepatocytes on collagen-coated plates were treated with 10µM reduced L-Glutathione (GSH, Sigma-Aldrich, Saint-Louis, MO) for 48 hours. To evaluate the contribution of bile acids GCA at 250μM (glycocholate, Sigma-Aldrich, Saint-Louis, MO) and GCDCA 100μM (glycochenodeoxycholate, Sigma-Aldrich, Saint-Louis, MO) were conjugated with 5% BSA-free fatty acid prior to be dissolved in an FBS-free medium for the time of the study (24 hours). To lower the bile acid levels in primary hepatocytes, 10µM of Obeticholic acid (OCA, SML3096, Sigma- Aldrich, Saint-Louis, MO) was added to the cells for 72 hours. A dose-response cell viability experiment was performed in primary human hepatocytes treated with different ferroptosis inducers and inhibitors. After plating the cells in collagen coated 96 well plate and kept overnight at 37 °C in 5% CO2 the hepatocytes were treated with the following compounds: 2-[1-[4-[2-(4- chlorophenoxy)acetyl]-1-piperazinyl]ethyl]-3-(2-ethoxyphenyl)-4(3H)-quinazolinone (Erastin, #7754) at 2,
5, 10 and 20 µM; (1S,3R)-2-(2-chloroacetyl)-2,3,4,9-tetrahydro-1-[4-(methoxycarbonyl)phenyl]-1H- pyrido[3,4-b]indole-3-carboxylic acid, methyl ester (RLS3, #19288) at 0.5, 1, 2.5 and 5 µM; FINO2 (#25096) at 10, 20, 50 and 100 µM and N2,N7-dicyclohexyl-9-(hydroxyimino)-9H-fluorene-2,7- disulfonamide (FIN56, #25180) at 1, 2.5, 5 and 10 µM. The cell viability was normalized to non-treated samples and measured at 3, 6, 12, 24 and 48 hours after adding the ferroptosis inducers.10 µM of 3-amino- 4-(cyclohexylamino)-benzoic acid, ethyl ester (Ferrostatin-1, #17729) and 5 µM N-[(3- chlorophenyl)methyl]-spiro[piperidine-4,2'(1'H)-quinoxalin]-3'-amine (Liproxstatin-1, #17730) were used as ferroptosis inhibitors. Briefly, primary human hepatocytes were plated in a collagen-coated plate and kept overnight at 37 °C in 5% CO2. In the following day, the ferroptosis inhibitors were added and 48 hours later cell viability and ROS were measured accordingly. A hepatocellular cell line was obtained from ATCC (HepG2, ATCC, Manassas, VA), maintained in EMEM medium (ATCC, Manassas, VA) supplemented with 10% HyClone fetal bovine serum (ThermoFisher Scientific, Waltham, MA), 1% Penicillin/Streptomycin (ThermoFisher Scientific, Waltham, MA) and kept at 37°C in 5% CO2. For ferroptosis induction, 20μM of (5α,8α)-8-(1,1-dimethylethyl)-3- methyl-1,2-dioxaspiro[4.5]decane-3-ethanol (FINO2, Cayman Chemical, Ann Arbor, MI) dissolved in DMSO was added to the medium. Transfection was performed by Lipofectamine 3000 (Invitrogen, Carlsbad, CA). Transduction was performed with pLV[Exp]-CMV>EGFP or pLV[Exp]-CMV>hGPX4 particles at an MOI of 20 and under the presence of polybrene (8 μg/ml). GFP and GPX4 expression were evaluated 48 hours after transduction. Enoximone (Tocris, Bristol, UK) dissolved in DMSO was added to the medium at a final concentration of 250μM 24h before collecting the cells. To evaluate the contribution of bile acids FBS-containing medium was replaced with serum-free medium that remained in contact with the cells for an additional 48 h. GCA at 250μM (glycocholate, Sigma-Aldrich, Saint-Louis, MO) and GCDCA 100μM (glycochenodeoxycholate, Sigma-Aldrich, Saint-Louis, MO) dissolved in medium were added for the last 24 h of the study. Quality control tests included viability and mycoplasma testing (Lonza, Walkersville, MD). PNPLA3 gene edition The single-guide RNA (sgRNA) sequence was designed to cut the human PNPLA3 gene at the position chr22:43,928,854 to replace the minor allele (G) to the major allele (C). The sgRNA sequence can be found in the FIG.4C. The sgRNA was cloned into plasmid vector and nucleofected into a hepatocellular cell line together with the donor DNA (ACTTCTCTCTCCTTTGCTTTCACAGGCCTTGGTATGTTCCTGCTTCATCCCCTTTTACAGTGGCC TTATCCCTCCTTCCTTCAGAGGCGTGGTAAGT (SEQ ID NO: 3)). Antibiotic selection was performed and DNA from selected clonal cells was extracted, amplified, and purified before sequencing as previous described (Synthego, Redwood City, CA). Major homozygous clones were identified, expanded and cryopreserved and one was used to perform the experiments.
Cell Viability Measurements Cell viability was typically assessed in a 96-well format by Alamar Blue (Invitrogen, Carlsbad, CA) absorbance (570nm/600nm) measured on a synergy HTX microplate reader (Biotek, Winooski, VT) 24h after ferroptosis induction. Post-isolation and post-thaw viability of primary human hepatocytes was evaluated by Trypan blue dye exclusion counting using a Countess 3 automated cell counter (Invitrogen, Carlsbad, CA). Analysis of Reactive oxygen species An oxidation-sensitive probe C11-BODIPY™ (581/591) (Invitrogen, Carlsbad, CA) was used to evaluate lipid peroxidation under a fluorescence microscope. Untreated hepatocytes were prepared with a cytocentrifuge and incubated for 30 min with 10μM C11-BODIPY™ and washed with PBS. Cultured cells were incubated with 10μM C11-BODIPY™ dissolved in culture media for 30 min at 37°C and washed with PBS. The fluorescent signal was evaluated 3h after the induction of ferroptosis. Malondialdehyde (MDA) is a natural byproduct of lipid peroxidation, and its quantification is generally used as a marker for lipid peroxidation. The MDA content in primary human hepatocytes was quantified using a commercially available kit from Sigma-Aldrich (Sigma-Aldrich, Saint-Louis, MO). Cryopreserved primary human hepatocytes were pelleted and analyzed directly, or they were cultured for 3h in suspension before the analysis. Cell lysates were deproteinized, and thiobarbituric acid (TBA) was added to generate an MDA-TBA adduct. The MDA-TBA adduct was quantified by fluorometric detection (ex/em=430nm/590nm). To detect hydrogen peroxide (H2O2) a HyPerRed vector (Addgene 48249, Watertown, MA) was transfected and live cells were imaged with a Nikon Inverted Research Fluorescence Microscope ECLIPSE Ti (Ermakova, Yulia G., et al. Nat. Comm.5.1 (2014): 5222). Total ROS in live cells was measured using the Cellular ROS Assay Kit (#ab186027, Abcam, Cambridge, UK). Following the manufacturer’s instructions, the fluorescence (Ex/Em = 520/605 nm) was quantitatively measured on a synergy HTX microplate reader (Biotek, Winooski, VT). Iron assay The iron concentration in cell lysates was assessed using an Iron Assay Kit (#ab83366, Abcam, Cambridge, UK) according to the manufacturer’s instructions. Transmission electron microscopy Human hepatocytes in suspension were briefly centrifugated and washed with PBS solution. Samples were then fixed with 2.5% glutaraldehyde overnight at 4°C. Fixed samples were processed by the Center for Biologic Imaging at the University of Pittsburgh, treated with 1% osmium tetroxide and 1% potassium ferricyanide for 1 hour at room temperature. Samples were washed with PBS and dehydrated in a graded series of ethanol solutions (30%, 50%, 70%, and 90% - 10 minutes each) and three 15-minute changes in fresh 100% ethanol. Infiltration was done with four 1-hour changes of EPON embedding plastic.
The last change of EPON was allowed to polymerize overnight at 37°C and then for 48 hours at 60°C. Resin blocks were removed from the Eppendorf tubes, and 70 nm sections were taken and placed onto copper TEM grids. Image acquisition was made using either the JEM-1011 or the JEM- 1400Plus transmission electron microscopes (Jeol, Peabody, MA) at 80kV fitted with a side mount AMT 2k digital camera (Advanced Microscopy Techniques, Danvers, MA). The mitochondrial shape was evaluated as published previously using ImageJ (De Vos et al., 2005, Curr Biol 15: 678-683). Briefly, individual mitochondria were analyzed for circularity (4^ area/perimeter2) and its reciprocal value used as the form factor. The form factor has a minimum value of 1 where mitochondria are a perfect circle, increasing in mitochondria with a rod shape. RNA sequencing RNA extraction, library preparation, and sequencing were performed at the University of Pittsburgh HSCRF Genomics Research Core. Briefly, total RNA was extracted from isolated primary human hepatocytes using RNeasy Plus Micro Kit (Qiagen). RNA integrity was assessed using the High Sensitivity RNA ScreenTape system on an Agilent 2200 TapeStation (Agilent). The SMART-Seq HT Kit (Takara Bio) was used to generate cDNA from 10 ng of total RNA, and the cDNA product was checked by an Agilent Fragment Analyzer system (Agilent) for quality control. The sequencing library was constructed by following the Illumina Nextera XT Sample Preparation Guide. One nanogram of input cDNA was fragmented and amplified using the Illumina Nextera XT kit. Equimolar amounts of each sample were finally pooled and sequenced on an Illumina Nextseq 500 system, using a paired-end 75-bp strategy. RNA-seq data analysis All memory-intensive computation were performed on clusters from the University of Michigan Greatlakes Advanced Research Computing resources. The quality of the raw fastq files were checked using FASTQC (version 0.11.9). In summary, the FastQC reports shows that the guanine-cytosine content of the samples ranges from 47% to 54%. As reference, a guanine-cytosine content between 30-40% is considered as too low as the DNA will be unstable, while a guanine-cytosine content between 70 -80% is considered too high because it makes PCR amplification more difficult. So, a guanine-cytosine content of about 50 to 60% is desirable (Amr et al., 2015, Clinical Genomics, 251-269). Another metric evaluated was the mean quality scores. All the samples had a score that falls within the acceptable threshold of 30. The QC-passed raw reads were then aligned to genome with STAR (version 2.7.5a) (Dobin et al., 2013, Bioinformatics 29, 15-21). The quality of the aligned reads was assessed using QoRTs (version 1.3.6) (Hartley et al., 2015, BMC bioinformatics 16, 1-7). The quality of the aligned reads was assessed based on the percentage of novel splice events. For all the samples, the percentage of novel splice events was about 1%. This value is within acceptable limits. Also, the sample passed the strandedness test. For all the samples, about 97% of the reads were mapped to the first strand. This attests to the quality of the sequenced RNA fragments. Downstream analysis was performed using DESeq2 in R (CRAN 4.04), BEAVR (a Browser-based tool for the
Exploration and Visualization of RNAseq data) (Perampalam et al., 2020, BMC bioinformatics 21, 1-14), GSEA (Mootha et al., 2003, Nature genetics 34, 267-273; Subramanian et al., 2005, PNAS 102, 15545- 15550) and GraphPad prism version 8. The p-value were computed based on Wald test statistics. Genes with fold change greater than 1.5 and p-value less than 0.05 are considered significant. Flux propensity analysis The flux propensity of hepatocytes was computed by integrating RNA Seq data with the reconstructed genome-scale model of human metabolism (also known as Recon 2.2) (Swainston et al., 2016, Metabolomics 12, 1-7) based on COMPASS algorithm (Wagner et al., 2021, Cell 184, 4168-4185). In summary, firstly, the vector of maximum flux, xr opt, through each and every metabolic reactions in Recon 2.2 was computed. This was achieved by solving the following optimization problem: Where, x is a vector
through each metabolic pathway in Recon 2.2. m is the number of metabolic reactions in Recon 2.2. A is the stoichiometry matrix of all metabolites with respect to their metabolic reactions, ω and λ are the lower and upper bound of the flux, x. The bounds are set to a default value of ±1000. And xrev denotes the reverse fluxes of reversible reactions which at this stage was set to zero to ensure only forward reactions were used in computing the maximum fluxes. Next, gene expression data from samples were utilized to design a penalty variable for each metabolic reaction such that the numerical value of the penalty variable is inversely proportional to the level of expression of genes that participate in such reaction. The implication of this is that genes with low expression will impose stricter penalty on its corresponding reaction. Subsequently, a linear optimization problem was designed to determine the set of penalty variables that minimize the penalty imposed on the metabolic pathways. This was achieved by solving the following optimization problem:
The resulting penalty values was aggregated to generate a reaction propensity score that is inversely proportional to the aggregated penalty value for each reaction in Recon 2.2. Downstream analyses were performed in python on Google colab platform, R (CRAN 4.04) and GraphPad prism version 8. To compare the relative activity of each metabolic reaction between PNPLA3
rs738409:G homozygous hepatocytes and the non-homozygous group, Cohen’s D statistics was used to compute the fold change difference between the means of two groups: Where M1 and M2 are the means of propensity score for group 1 (PNPLA3 rs738409:G homozygous hepatocytes) and group 2 (non-homozygous group), respectively. And s1 and s2 are the standard deviations of group 1 and group 2, respectively. A positive Cohen’s D value indicate a reaction that’s is relatively more active in PNPLA3 rs738409:G homozygous hepatocytes while a negative value indicates relative higher activity in non- homozygous group. The higher the magnitude of Cohen’s D, the higher the relative difference in activity between these two groups. The statistical significance of the Cohen’s D-values was calculated using Wilcoxon’s p-value adjusted based on Benjamini-Hochberg (BH) method. Because of the small sample size (n=3), an absolute Cohen’s D-value greater than 1.5 and Wilcoxon’s p-value less than 0.1 are considered significant. Below, some of the metabolic reactions are summarized. metadata_r_id reaction_name subsystem si si
Untargeted metabolomics Hepatocytes originally stored in -80°C were retrieved and transferred into a 15mL centrifuge tube. After adding 4mL of 80% (v/v) MEOH/Water to each sample, samples were briefly vortexed and deprotenated by incubating at -80°C for 20 minutes. Samples were then vortexed at 40C for 5 minutes. Followed by centrifugation at 4°C, 4696g (maximum speed) for 10 minutes. Supernatants were transferred to a fresh tube.500 μL of 80% (v/v) MEOH/Water was added to the remaining pellets, vortexed for 5 minutes at 4°C and then centrifuged at 4°C, 4696g (maximum speed) for 10 minutes. Supernatant was added to the previously collected supernatant. Next, supernatant was completely dried in vacuum concentrator. Dried pellets were stored in -80°C until they were processed the day of analysis. On the day of the analysis, the dried extracts were reconstituted in 200 µL of methanol/water (50/50 v/v), sonicated for 10 minutes, vortexed for few seconds and then filtered. 100 µL of reconstituted samples were transferred to the LC vials and 10 uL of each sample were pooled to the QC samples. The samples were analyzed in both HILIC and C18 column with both positive and negative ion modes. For C18 column in positive mode, 10 µL (8 µL for negative mode) of the samples were injected for analysis on an Agilent 6520 QTOF LC/MS machine using ACQUITY UPLC BEH C18 Column (130Å, 1.7 µm, 2.1 mm X 150 mm) coupled with 5 mm Van-Guard Pre-Columns. The column compartment was set at 40°C and the analysis was performed in both positive and negative modes. Mobile phase A was water with 0.1% formic acid while mobile phase B contains acetonitrile with 0.1% formic acid. The gradient method is as follows: 0 min: 1% B; 1 min: 1% B; 8 min: 99% B, 13 min: 85% B; 13.1 min: 1%B; 16 min: 1%B. For HILIC column in positive mode, 5 µL (2 µL for negative mode) of the samples were injected for analysis on an Agilent 6520 QTOF LC/MS machine using XBridgeBEH Amide XP Column (130Å, 2.5 μm, 4.6 mm X 150 mm) coupled with 5 mm VanGuard Cartridge. The column compartment was set at 40°C and the analysis was performed in both positive and negative modes. Mobile phase A was 10mM ammonium formate in water with 0.1% formic acid while mobile phase B contains 10mM ammonium formate in acetonitrile with 0.1% formic acid. The gradient method is as follows: 0 min: 1% B; 1 min: 1% B; 11.8 min: 80% B, 12.5 min: 1% B; 14.7 min: 1%B; 16 min: 1%B. The metabolite peaks were extracted using Agilent Masshunter Profinder based on an in-house library. Any metabolites whose RSD is greater than 30% in the QC measurements are removed from further analysis. The peak areas were normalized with cell numbers. Other downstream analysis was performed with Metaboanalyst® and GraphPad prism version 8. Figures were created with Biorender.com. Metabolites with more than 1.5-fold change and with p-value less than 0.05 are considered to be significantly different level of expression between two groups. Stable Isotopic Tracing Experiment Primary human hepatocytes were cultured in Hepatocyte Culture Medium (Lonza, Walkersville, MD) on type I rat tail collagen-coated plates (Corning, Corning, NY) and kept at 37 °C in 5% CO2 overnight for attachment. In the following day, cells were cultured with Docosanoic-1,2,3,4-13C4 acid (#57527, Sigma-
Aldrich, Saint-Louis, MO) and 13C1-labelled Palmitic Acid (#28749, Cayman Chemical, Ann Arbor, MI) conjugated in 5% BSA free-fatty acid. After 48 hours the cell pellets and stored in -80oC until we are ready for Acetyl-CoA measurement based on a protocol adopted from well-established methods from the literature (Basu et al., Nature protocols 7, 1-11 (2012); Izzo et al., Science Advances 9, eadf0115 (2023); Jones et al., Metabolites 11, 468 (2021)). Briefly, on the day of analysis, the cell pellets were transferred to the pre- chilled 2mL Precellys homogenizer tubes preloaded with 300-350mg of the small ceramic beads (1.4 mm OD). Next, 200 μL of pre-chilled extraction solvent: 10% (wt/vol) trichloroacetic acid (TCA) in optimal grade water was added to each sample. Subsequently, samples were homogenized to disintegrate the cellular organelles using the Precellys + Cyrolys Evolution Homogenizer with the following settings: Speed 6000 RPM; Cycle 4 x 20s, Pause 120 s; Cyolys On; Temp 4 °C; Mode Auto. After complete homogenization, 300 μL of the extraction solvent was added to make it up to 500 μL and the sample tubes were incubated on ice for 10 minutes; followed by centrifugation for 10 minutes at 1700g at 40C. The supernatant was collected for solid phase extraction (SPE). SPE was performed using the Oasis PRiME HLB 96-well µElution Plate with 3 mg Sorbent per Well. Briefly, the vacuum pressure was set at 5 in Hg, the columns were conditioned with 200μL of methanol, followed by equilibration with 200μL of water. Next, 500μL of the metabolite extract was loaded and the column was desalted with 200μL of water. Finally, the samples were eluted with 50μL of 25mM ammonium acetate thrice, resuspended in 5% salicylic acid and analyzed using Sciex 7500 LC-MS/MS system. Samples were run on the Kinetex 2.6um F5100 A, LC Column 150 x2.1mm C18 column (Phenomenex). The flow rate was set to 0.1 ml/min with 5mM ammonium acetate and 2.5mM DMBA (N,N-Dimethylbutylamine) as mobile phase A and 100% methanol as mobile phase B. The gradient for 22min method was set as follows- 0min: 2%B; 5min: 25% B; 5.5min: 100%B; 16min: 2%B. The MRMs for isotopologue measurements are in Supplementary Table 10. The data was corrected for natural abundance using IsoCorrectorR (v3.18)99. Pex2 and PNPLA3 knockdown The following siRNAs were ordered from GE Dharmacon: Accell Human Pex2 siRNA SMARTpool (E-006548-00-0050), Accell Human PNPLA3 siRNA SMARTpool (E-009564-00-0050) and Accell Non-targeting Pool (D-001910-10-50). siRNAs were reconstituted in siRNA Buffer (B-002000-UB- 100, Dharmacon, CO) at 100 μM. Hepatocytes were plated into collagen coated plates. In the following day, cells were washed once with PBS and siRNAs in media were added at a final concentration of 1 μM. After 24 hours, fresh media was added. Hepatocytes were cultured for an additional 24 hours and then samples were collected for analysis. ATP measurement The intracellular ATP content was measured on hepatocytes by using the ATP Determination Kit (A22066, Thermo Fisher Scientific, Waltham, MA) following the manufacturer’s instructions. The cells were incubated at 37°C during 1 hour in the absence or presence of 10 μg/ml oligomycin A (#11342,
Cayman Chemical, Ann Arbor, MI), and 10 mM 2- deoxyglucose (#14325,Cayman Chemical, Ann Arbor, MI). The ATP content was measured by luminescence with an integration time of 1s per well. Apoptosis and Necrosis detection REALTIME-GLO™ Annexin V Apoptosis and Necrosis Assay (JA1011, Promega Corporation, Madison, WI, USA) was used to detect apoptosis and necrosis in primary human hepatocytes. Briefly, the hepatocytes were treated with 10 μM staurosporine (STA, #1285, Tocris, Bristol, UK) and 10 μg/ml LPS (L2630, Sigma-Aldrich, Saint Louis, Missouri) for 6 hours and the luminescence signal was measured with an integration time of 1s per well (apoptosis) followed by a fluorescence measurement (Ex/Em: 485/525– 530nm) on a synergy HTX microplate reader (Biotek, Winooski, VT). Quantitative Real-Time PCR Total cellular RNA was isolated using the RNeasy Mini kit (QIAGEN, Hilden, Germany) and reverse transcribed using SuperScript III (Invitrogen, Carlsbad, CA) following the manufacturers’ instructions. The qPCR was performed with a StepOnePlus system (Applied Biosystems, Foster City, CA) using TaqMan Fast Advanced Master Mix (Life Technologies, Waltham, MA). Relative gene expression was normalized to β-actin (ACTB) mRNA. Relative expression was calculated using the ΔΔCT method. Western Blot Cells were trypsinized, pelleted, and washed with PBS. Lysis was performed with RIPA buffer (Sigma- Aldrich, Saint Louis, Missouri) and 1x Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, Waltham, MA) for 30 min at 4°C, followed by centrifuging at 13,000g for 10 min at 4°C. Protein concentrations of the supernatant were determined by comparison with a known concentration of bovine serum albumin using a Pierce BCA Protein Assay Kit (ThermoFisher Scientific, Waltham, MA).30 µg of lysate were loaded per well into 10% Mini-PROTEAN TGX™ gel (BioRad, Hercules, CA). Proteins were transferred onto a PVFD Transfer Membrane (Thermo Fisher Scientific, Waltham, MA). Membranes were incubated with a primary antibody solution overnight and then washed before incubation in secondary antibody solution for 1 hour. Target antigens were finally detected using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, Waltham, MA). Images were scanned and analyzed using ImageJ software. Immunostaining Human liver tissue was fixed in 4% paraformaldehyde for 12 h and 70% ethanol overnight at 4°C and then embedded in paraffin. Cut sections (5-7 microns) were mounted on glass slides for immunofluorescence and immunohistochemistry. Each sample was first stained with hematoxylin and eosin for histological examination. Slides were deparaffinized with xylenes and dehydrated with ethanol. Antigen unmasking was performed by boiling in 10mM citrate buffer, pH 6.0. For immunofluorescence, the slides were then blocked 1h with 10% goat serum, left incubating overnight at 4°C with primary antibodies, and
secondary antibody 1h at room temperature. Sections were covered with DAPI containing mounting media. For immunohistochemistry staining after the antigen unmasking, the slides were exposed to 3% hydrogen peroxide and incubated overnight at 4°C with primary antibodies. Tissue sections were then incubated with the secondary biotinylated antibody corresponding to the animal species of the primary antibody (BA-1000; Vector Laboratories, Burlingame, CA) and exposed to 3,3’-diaminobenzidine (SK-4105; Vector Laboratories) to visualize the peroxidase activity. Counterstaining was performed with Richard-Allan Scientific Signature Series Hematoxylin (Thermo Scientific, Waltham, MA). All procedures followed the kit instructions. Images were captured with a Nikon Eclipse Ti microscope. Following that, images were analyzed using ImageJ software. RGB stacks were generated, pre-processed to equalize the illumination within the stack, thresholded, and measured. ATF6 and E-Cadherin immunohistochemistry images were acquired using the PE Opera Phenix using the Harmony 5.1 software. Images were acquired with a 40X/1.1 NA Water Immersion objective. Fluorescence images were acquired with the following channels (Hoechst Ex.405/ Em.435-480, ATF6640 Ex./ Em.650-760, E-Cadherin Ex.488/ Em.500-550). To gather maximum intensity projections, a z-stack was acquired in confocal mode with 14 planes and a distance between each plane of 1.2 um. To determine the number of ATF6-positive nuclei we used Harmony 5.1 to create an analysis protocol that identifies nuclei based on Hoechst signal. Then, to determine ATF6 signal we sampled a ring region of 1.5X the outer border of the nuclear region. ATF6-positive cells were then quantified by thresholding signal above the ATF6 negative control well average signal. The overall percent of ATF6-positive cells was then determined by taking the total count of ATF6-positive cells and expressing it as a percent of the total number of nuclei (Hoechst-positive cells) in 49 fields per condition. Patients’ hepatic paraffin sections were analyzed by two different pathologists. Pathologic findings were assessed according to the Liver Cancer Study Group of Japan. Liver steatosis was graded based on the percentage of fat: grade 0 (healthy, <5%), grade 1 (mild, 5%-33%), grade 2 (moderate, 34%-66%), and grade 3 (severe, >66%). Inflammation and fibrosis were evaluated according to the New Inuyama Classification for histological assessment score for chronic hepatitis. XBP1 splicing quantification Total cellular RNA was isolated using the RNeasy Mini kit (QIAGEN, Hilden, Germany) and reverse transcribed using SUPERSCRIPT™ III (Invitrogen, Carlsbad, CA) following the manufacturers’ instructions. Complementary DNA was amplified using two sets of primers: a total XBP1 (tXBP1) and sequence that recognized between the unspliced (uXBP1) and spliced XBP1 (sXBP1) (Yoon et al., PLoS One 14, e0219978 (2019)). The amplification products were resolved in a 2% agarose gel and the quantification was performed using ImageJ software.
Quantification and Statistical Analysis Analysis of survival: the primary outcome of interest was the recipient’s overall survival, defined as the time from transplantation to the date of death or most recent follow-up. Mendelian randomization was performed and the effect of the genetic variant on the outcome was evaluated in a recessive genetic model. The results were evaluated using the OR value and the corresponding 95% confidence interval (CI). Overall survival was estimated using the Kaplan-Meier method, and groups were compared with a log-rank test. A univariable Cox proportional hazard regression model was constructed to assess the association between the genotype and mortality, all variables with a P-value < 0.1 were included in a multivariate model to adjust for confounding. The proportional hazard assumption was assessed, and no violations of the proportional- hazards assumption were found. All p-values less than 0.05 were considered statistically significant. Statistical analyses were performed using SPSS 25.0 (IBM, Chicago, IL) and Prism 9.0 Software (GraphPad Software, La Jolla, CA). Descriptive data were expressed as mean ± standard deviation (SD). Variables were tested for normal distribution prior to statistical testing. Comparisons of two groups were performed using a non- parametric Mann-Whitney U test or a parametric two-tailed t-test (indicated in the corresponding figure legends). For groups of three or more, the test for significance was performed using either a parametric one- way analysis of variance (ANOVA) if all samples were normally distributed, or a non-parametric Kruskal- Wallis test for non-normal distributions. Both tests were accompanied with a post-test analysis for multiple comparison correction (indicated in the corresponding figure legends). Simple linear regression was used for correlation analysis. Categorical variables were expressed using numbers and percentages (%). These were compared using Fisher exact tests. Overall survival was estimated using the Kaplan-Meier method, and groups were compared with a log-rank test. A univariable Cox proportional hazard regression model was constructed to assess the association between the genotype and mortality, all variables with a P-value < 0.1 were included in a multivariate model to adjust for confounding. The proportional hazard assumption was assessed, and no violations of the proportional-hazards assumption were found. All P values less than 0.05 were considered statistically significant. Statistical analyses were performed using SPSS 25.0 (IBM, Chicago, IL), DESeq2 in R (CRAN 4.04), Metaboanalyst®, and Prism 9.0 Software (GraphPad Software, La Jolla, CA). EXAMPLE 2: Patient Characteristics The impact of PNPLA3 rs738409 minor allele frequency in healthy subjects and ESLD patients in a US cohort was first assessed. PNPLA3 rs738409 variant in donors and recipients have been linked with GWAS to a spectrum of liver diseases ranging from steatosis to non-alcoholic steatohepatitis, hepatic fibrosis, ESLD and increased risk of mortality in the general population (FIG.1A). PNPLA3 rs738409:G minor allele was found at higher frequencies in ESLD (28%) individuals compared to healthy individuals (6%). This suggested that PNPLA3 rs738409 gene variant is associated with the development of NASH and its progression to ESLD as previously identified (FIG.1A). Furthermore, to assess the role PNPLA3 rs738409 minor allele might play in long-term outcome and recurrent disease in patients undergoing living
donor liver transplants, the high-risk liver disease progression PNPLA3 rs738409 variant was determined in 79 living liver graft donors and 83 living donor liver graft recipients who were transplanted for non-viral liver diseases in a LDLT program Japanese cohort (Laennec’s cirrhosis n=45, NASH n=27, Cryptogenic cirrhosis n=11). The PNPLA3 rs738409:G gene variant was present (minor homozygosity) in about 50% of recipients and 28% of donors (FIG.1B). In contrast, the frequency of the PNPLA3 rs738409:G gene variant in the general population in US is about 6-8% (Lazo et al., 2021, Clin Gastroenterol Hepatol 19: 2606-2614). The PNPLA3 variant minor allele >G was clearly more frequent among recipients compared to the general public and the donor population (FIG.1A) in this Japanese cohort since the PNPLA3 rs738409:G variant in transplant recipients is expected to be associated with the development of ESLD (Trepe et al., 2020, Hepatol 72: 1196-1209). Also, the increased frequency of this variant in the LDLT program donors may be a consequence related to the fact that most living donors are genetically related to their LDLT relative with liver disease. EXAMPLE 3: Relative association of PNPLA3 rs738409 variant in recipients to signs of ESLD Individuals with decreased hepatic lipolysis, conferred by the presence of the PNPLA3 variant, have been reported to reduced release of triglycerides and cholesterol into the circulation less compared to controls (Ruschenbaum, 2018, Hepatol Commun 2: 798-806). Indeed, the presence of PNPLA3 variant was associated with reduced serum cholesterol levels at the time of LDLT compared to patients who did not have this genetic variant. Moreover, explanted livers from recipients positive for PNPLA3 variant showed significant hepatic steatosis and moderate-to-severe necroinflammation in the liver (FIG.1B). To examine the genotyped combinations in donor liver grafts and recipients after LDLT, the genotyping and distribution (donors n=77, recipients n=77) was analyzed (FIG.1C). PNPLA3 variant donor livers were frequently transplanted in recipients that were also carrying the PNPLA3 variant (n=14) (FIG.1C). EXAMPLE 4: PNPLA3 rs738409 variant in donor grafts is associated with lower 5-year survival after LDLT The PNPLA3 rs738409 gene variant in donors affects on patient survival after LDLT was next studied. Overall, 5-year survival among patients (n=85) who underwent LDLT was 82% (Kaplan-Meier estimate).12 patients did not survive to five years, and none received a second transplant. LDLT patients who received a donor graft homozygous for the PNPLA3 variant had a poorer postoperative 5-year survival rate compared to LDLT recipients who received grafts that did not have this the variant (FIG.1D). A Cox multivariate regression analysis to adjust for confounding variables found that having the PNPLA3 rs738409:G variant was significantly associated with the recipient’s probability for survival while other variants predictive of liver disease (MBOAT7 rs641738, TM6SF2 rs58542926, and GCKR rs780094) did not. The LDLT recipient genotype did not significantly influence patient survival. To further investigate the consequences of PNPLA3 rs738409 gene variant in LDLT, the case of dual LDLT (Soejima et al., 2008, Am J Transplant 8: 887-892), where two liver grafts with different
PNPLA3 genotypes from two donors were transplanted into a single recipient, was analyzed. The dual LDLT was performed to avoid two potential LDLT-associated complications: development of small-for-size donor liver hemodynamic instability in the recipient and production of a small remnant liver that could produce liver failure in the donor. In this transplant recipient, the right liver lobe graft (donor 1) was heterozygous for the PNPLA3 variant, and the left liver lobe (donor 2) graft was homozygous for the PNPLA3 rs738409:G. At the time of transplantation, neither donor graft had significant hepatic steatosis (<0.5% hepatic steatosis). Four years post-transplant, only the donor 2 (PNPLA3 rs738409:G variant) transplanted liver graft developed histologically significant postoperative steatosis, a consequence of hepatocyte metabolic alterations in lipid uptake and export mechanisms, while the donor 1 liver graft did not develop postoperative steatosis. To functionally assess the extent of destabilize metabolism and de novo lipogenesis and lipid export that is associated with the PNPLA3 rs738409:G variant (BasuRay et al., 2017, Hepatology 66: 111-1124), the expression of PLIN2, a lipid droplet binding protein that is associated to steatosis and insulin resistance, was investigated. Four years after LDLT the left liver lobe (donor 2) expressed significantly more PLIN2 compared to the right liver lobe (donor 1). PLIN2 was predominantly expressed around lipid droplets in hepatocytes of the left liver lobe (donor 2), indicating the involvement of the PNPLA3 rs738409:G variant in alterations of lipid metabolism and development of ESLD (Ruschenbaum et al., 2018, Hepatol Commun 2: 798-806). EXMAPLE 5: PNPLA3 rs738409:G variant in human hepatocytes modulates metabolism, cellular stress and death through alterations in metabolic function To investigate the underlying mechanistic effect of the PNPLA3 rs738409 variant causing reduced capacity to adapt to stressors of hepatocytes from LDLT-patients, isolated hepatocytes of 175 donor normal livers were analyzed and identified that only 7% (n=12) carried the PNPLA3 rs738409:G variant (FIG.1E). Transcriptomic analysis and semi-targeted metabolomics profiling in donor human hepatocytes carrying PNPLA3 rs738409: G variant (Heps-PNPLA3-G; minor homozygous) was then compared them to donor human hepatocytes heterozygous-CG/major homozygous-CC for PNPLA3 rs738409 (Heps-PNPLA3-C/G). An integrated approach encompassing transcriptomics and metabolomics profiling was utilized to investigate metabolic pathway activity in hepatocytes isolated from LDLT patients (FIG.1E). This approach revealed that human Heps-PNPLA3-G have a significant increase in the arginine metabolic pathway, which, via the methionine salvage pathway, contributes to upregulation of methionine cycle that then leads to increased reduced glutathione production (FIG.1F). At the transcriptional level, human Heps- PNPLA3-G showed significant downregulation of glutathione peroxidase 4 (GPX4), an enzyme that reduces lipid peroxides at the expense of reduced glutathione, providing protection to cells against oxidative stress (FIG.1F). Additionally, we also observed a significant lower expression of acyl-CoA dehydrogenase, long chain (ACADL) in human Heps-PNPLA3-G compared to the control (FIG.1F). Considering the role of ACADL as one of the critical downstream enzymes of mitochondrial fatty acid β-oxidation, this result suggests an impaired mitochondrial fatty acid β-oxidation in human Heps-PNPLA3-G29,30. Interestingly, we
discovered that human Heps-PNPLA3-G contained a significant increase in the concentration of bile acids: glycocholate (GCA) and glycochenodeoxycholate (GCDCA) when compared to controls (Fig.1F). Moreover, transcriptomics revealed that human Heps-PNPLA3-G have a significant increase in expression of endoplasmic reticulum (ER) stress related genes: heat shock 70 KDa protein 5 (HSPA5) and DNA damage inducible transcript 3 (DDIT3), along with genes responsible for non-transferrin bound iron production, a phenomenon that could increase iron availability for the Fenton reaction in hepatocytes (Fig. 2A). These results were corroborated with the flux propensity analysis based on COMPASS computation pipeline (Wagner et al., Cell 184, 4168-4185 e4121 (2021). In this analysis, the metabolic flux reactions were based on Recon 2.2, a reconstructed model of human metabolism comprising of 7785 metabolic reactions, including 746 exchange reactions; and 5324 metabolites (Swainston et al., Metabolomics 12, 109 (2016))). The flux propensity analysis indicates a relative increase in metabolic activity involving pyruvate flux into the peroxisome in human Heps-PNPLA3-G (pyruvate peroxisomal transport via proton symport, PYRt2p_pos (Fig.2B). An increase in lactate dehydrogenase activity was observed in the human Heps- PNPLA3-G group (r0173_neg and LDH_L in Fig.2B). In addition, reduced activity was found in cholesterol and bile acid metabolism in human Heps-PNPLA3-G (Fig.2B). Taken together, this metabolomic and transcriptomic analysis suggests that human Heps-PNPLA3-G have altered cellular metabolism, which includes increased accumulation of bile acids, increased pyruvate flux into peroxisomes and reduced expression of GPX4 when compared to human Heps-PNPLA3-C/G controls. EXAMPLE 6: PNPLA3 rs738409:G variant regulates cellular stress via bile acids buildup and peroxisomal β-oxidation Given the findings that primary human Heps-PNPLA3-G show increased levels of bile acid metabolites (GCA and GCDCA) and have significantly reduced expression of bile acids efflux transporter SLC51A (FIG.2A), the potential consequences of ER stress were investigated (Malinen et al, 2018, Am J Physiol Gastrointest Liver Physiol 314: G597-G609). By comparing the transcriptome of human Heps- PNPLA3-C/G against that of those human Heps-PNPLA3-G, a high expression of ER stress-associated genes was observed: heat shock 70 KDa protein 5 (HSPA5) and DNA damage inducible transcript 3 (DDIT3) (FIG.1F & 2A &2C) (Beriault et al., 2013, Biochim Biophys Acta 1833: 2293-2301). Further, the flux propensity analysis revealed reduced activity in the bile acid synthesis pathway in the same cohort (FIGs.2B & 3A-3B ). To confirm that ER stress is a critical consequence of the presence of PNPLA3 rs738409:G variant in human primary hepatocytes, transcript and protein analysis was performed. Upon mRNA expression and immunohistochemistry analyses, a significantly higher expression of HSPA5 was found at both the mRNA and protein levels in human Heps-PNPLA3-G (Fig.3C). Moreover, ER stress can suppress bile acid synthesis by regulating CYP7A1, a rate-limiting enzyme in the synthesis of new bile acids (Henkel et al., Cell Mol Gastroenterol Hepatol 3, 261-271 (2017)). Notably, it was found that CYP7A1 is significantly downregulated in human Heps-PNPLA3-G compared to controls in the transcriptome analysis (Fig.2A,
heatmap panel). Additionally, after analyzing genes involved in cholesterol synthesis (HMGCR), bile acid synthesis (CYP7A1, CYP27A1 and CYP8B1), and bile acid homeostasis (FXR, BSEP and NTCP) only FXR was significantly downregulated in human Heps-PNPLA3-G when compared to controls (Fig.3C & Suppl. Fig.4A). To investigate whether GCA and GCDCA are involved in ER stress and to understand the underlying mechanism causing ER stress upon exposure to bile acids, human hepatocytes were treated with GCA and GCDCA and it was found that human Heps-PNPLA3-G were more susceptible to ER stress, indicated by the higher expression of HSPA5 (Fig.3D). Next, it was investigated whether the reduced efflux of bile acids contributed to ER stress, through the addition of exogenous bile acids. Only human Heps- PNPLA3-C/G showed significantly increased expression of BSEP in the presence of bile acids when compared to human Heps-PNPLA3-G (Fig.3D). To corroborate these findings in human livers and demonstrate that the stress state of human Heps-PNPLA3-G is not a deleterious effect of the perfusion/isolation process, the study was broadened to donor human liver tissue. First, the protein expression of Bile acid-coenzyme A:amino acid N-acyltransferase (BAAT), a liver enzyme responsible for glyco- and tauro- conjugation of bile acids which is an important last step in the intrahepatocyte transport of bile acids was analyzed (Pellicoro et al., Hepatology 45, 340-348 (2007)). A significant loss of BAAT in donor human livers carrying the PNPLA3-G rs738409 gene variant when compared to controls was observed, indicating low bile acids transport (Fig.3E). Then, the expression of the CCAAT-enhancer- binding protein homologous protein (CHOP) a transcription factor that is involved in the ER stress response by promoting protein synthesis and oxidation in the ER was observed (Marciniak et al., Genes Dev 18, 3066-3077 (2004)). A significant increase of CHOP in donor human livers carrying the PNPLA3-G rs738409 gene variant when compared to control donor livers was observed (Fig.3F). Additionally, activating transcription factor 6 (ATF6), an ER bound protein that translocate to the nucleus in response to stress (Hetz et al., Nat Rev Mol Cell Biol 21, 421-438 (2020)), demonstrated increased positive staining within the nucleus of hepatocytes from donor human livers carrying the PNPLA3-G rs738409 gene variant as compared to control donor human livers (Fig.3G). In addition, another indicator of elevated ER stress and the activation of the unfolded protein response (UPR) is mRNA splicing of the X-box-binding protein 1 (XBP1) resulting in the removal of a 26-nucleotide intron during ER stress (Yoon et al., PLoS One 14, e0219978 (2019)). Consistent with previous findings, human Heps-PNPLA3-G presents significant increased XBP1 mRNA splicing when compared to control human Heps-PNPLA3-C/G (Fig.3H). To confirm that accumulation of bile acids is partly liable for the ER stress documented in donor human livers and hepatocytes carrying the PNPLA3-G rs738409 gene variant, we treated human Heps- PNPLA3-G and Heps-PNPLA3-C/G with Obeticholic Acid (OCA), a well-established FXR agonist, to reduce intracellular bile acid levels. The activation of FXR pathway led to significantly decreased response expression of BSEP in the presence of OCA and a substantial reduction in HSPA5 in human Heps-PNPLA3- G (Fig.3I). These results indicate that human Heps-PNPLA3-G have increased ER stress partly due to their inability to export bile acids as indicated by the increased presence of intracellular bile acids and the reduced
expression and function of export related genes such as BSEP and SLC51A (Radun et al., Seminars in Liver Disease). It is well documented that fatty acids are imported to mitochondria by the carnitine shuttle for β- oxidation of fatty acids. In this study, Human Heps-PNPLA3-G have upregulated fatty acid import into mitochondria via the carnitine carrier system but a downregulation in mitochondrial β-oxidation (FIG.1F). In line with this observation, palmitoylcarnitine (an intermediate metabolite in the carnitine carrier system) was elevated consistently along with the upregulation of carnitine palmitoyltransferase 1 (CPT1) and CPT2 (FIG.1F). However, the expression of acyl-CoA dehydrogenase long chain (ACADL), a downstream enzyme of mitochondria β-oxidation, is lower in human Heps-PNPLA3-G, suggesting reduced β-oxidation in mitochondria. Moreover, in human Heps-PNPLA3-G, the flux propensity analysis reveals an upregulation of pyruvate flux into the peroxisome (PYRt2p_pos on FIG.2B). Given that peroxisomes are highly abundant cellular units in hepatocytes and involved in β-oxidation of fatty acids (Demarquoy et al., 2015, Hepatology 45: 340-348), the peroxisomes role in human Heps-PNPLA3-G was studied. The decreased mitochondrial β-oxidation concomitantly potentially leads to increased peroxisomal β-oxidation in human Heps-PNPLA3-G. Consequently, this increase in β-oxidation leads to increased ROS production resulting in ferroptosis (FIG.4A) (Demarquoy et al., 2015, Hepatology 45: 340-348; Wanders, 2014, Biochimie 98: 36- 44; Wanders et al., 2016, Front Cell Dev Biol 3: 83). To corroborate this hypothesis, the expression of peroxisomal acyl-coenzyme A oxidase 1 (ACOX1), an enzyme that catalyzes the rate-limiting step in peroxisomal β-oxidation was analyzed (Ding, 2021, Nat Metab 3: 1648-1661). ACOX1 is synthesized as a 70 kDa precursor protein, however, inside peroxisomes, it is processed into a 50 kDa protein (Klouwer et al., 2021, Front Cell Dev Biol 9: 661298). A significant increase in the ratio of the protein levels of the peroxisomal ACOX1 (50 kDa) to precursor ACOX1 (70 kDa) in human Heps-PNPLA3-G was found (FIG.4B), indicating increased peroxisomal β- oxidation in human Heps-PNPLA3-G when compared to human Heps-PNPLA3-C/G controls. Next, using CRISPR/Cas9 in human hepatoma cell line (HepG2) isogenic human Heps-PNPLA3-G variant (minor homozygous) and gene edited control human Heps-PNPLA3-CCas9 (major homozygous) were generated (FIG.4C). The role of peroxisomal β-oxidation in the production of reactive oxygen species (ROS) was studied using a red fluorescent genetically encoded indicator (HyPer-Red; Ermakova et al., 2014, Nat Commun 5: 5222) to detect hydrogen peroxide (H2O2) production in combination with enoximone, a specific inhibitor of peroxisomal β-oxidation (Abdel-Aleem, 1992, Life Sci 51: 53-57). There was a significant decrease in H2O2 in the presence of enoximone human Heps-PNPLA3-G when compared to human Heps-PNPLA3-CCas9 controls (FIG.4D). To determine if the increased peroxisomal β-oxidation can lead to ferroptosis, the lipid peroxidation in the presence of enoximone was quantified and there was a significant decrease especially in human Heps-PNPLA3-G with specific inhibition of peroxisomal β- oxidation (FIG.4E). Next, ferroptosis was induced in human Heps-PNPLA3-G and gene edited control by FINO2, a peroxide compound that indirectly inhibits GPX4 and oxidizes iron in the presence of enoximone (FIG.4F) (Gaschler et al., 2018, Nat Chem Bio 14: 507-515). As expected, enoximone significantly
increased cell viability in both human Heps-PNPLA3-G and gene edited control human Heps-PNPLA3-CCas9. However, viability was significantly higher in human Heps-PNPLA3-G. Moreover, similar treatment also decreased significantly lipid peroxidation especially in human Heps-PNPLA3-G (p=0.03, Welch’s t-test, CC: n=5, GG: n=5). These findings suggest that peroxisomal β-oxidation contributes to the ferroptosis observed in human hepatocytes carrying the PNPLA3 rs738409:G variant. To corroborate this finding in human livers, the protein expression of acetyl-Coenzyme A acyltransferase 1 (ACAA1) was analyzed (Fig. 4G). Second, the mitochondria and peroxisomal β-oxidation activities in human Heps-PNPLA3-G and Heps- PNPLA3-C/G controls were investigated. Stable isotope tracing experiment was done using C1-labelled palmitic acid, a long chain fatty acid that are predominantly oxidized via mitochondria β-oxidation and Docosanoic-1,2,3,4-13C4 acid, a very long chain fatty acid preferred by peroxisome β-oxidation. The corresponding labelled Acetyl-CoA, a major product of β-oxidation of fatty acids, was then measured (Bian et al., Journal of Biological Chemistry 280, 9265-9271 (2005); Kasumov et al., Biochemical Journal 389, 397-401 (2005); Reszko et al., Journal of Biological Chemistry 279, 19574-19579 (2004)). These result shows a similar enrichment of M+1 Acetyl-CoA originating from C1-labelled palmitic acid in human Heps- PNPLA3-G and control (Fig.4H). It has been reported that when mitochondrial β-oxidation is impaired for human Heps-PNPLA3-G, peroxisome can oxidize medium and long chain fatty acids, including palmitic acid (Violante et al., The FASEB Journal 33, 4355 (2019)). It was posited that, for C1-labelled palmitic acid, the peroxisome compensated for the impaired mitochondrial oxidation in human Heps-PNPLA3-G and that explained why there was no significant difference in the enrichment of M+1 Acetyl-CoA in the two groups. Alternatively, compared to human Heps-PNPLA3-C/G controls, the result showed a significant enrichment of M+2 Acetyl-CoA, from the Docosanoic-1,2,3,4-13C4 acid tracing experiment, in human Heps-PNPLA3-G thereby further corroborating that human Heps-PNPLA3-G have upregulated activities of peroxisomal β- oxidation (Fig.4I). To validate these observations, it was predicted that increased peroxisomal β-oxidation would result in an increase in ROS production and cellular stress in human Heps-PNPLA3-G. Human Heps-PNPLA3-G and human Heps-PNPLA3-C/G controls were treated with phytanic acid, an odd-chained fatty acid that undergo α-oxidation exclusively in peroxisome to yield pristanic acid that feed into peroxisomal β-oxidation (Verhoeven et al., Progress in lipid research 40, 453-466 (2001)), and ROS production was measured. As expected, ROS production was significantly increased in human Heps-PNPLA3-G when compared to human Heps-PNPLA3-C/G controls (Fig.4J). Additionally, gene knockdown experiments were performed specifically for peroxisomal biogenesis factor 2 (PEX2), a protein located in the peroxisomal membrane that mediates the detection of ROS within the peroxisome and the process of fatty acids break down (Ding et al., Nat Metab 3, 1648-1661 (2021)). Reducing PEX2 would potentially heighten lipolysis, releasing fatty acids that would be subsequently metabolized through β-oxidation and increase ROS production. Interestingly, reducing PEX2 expression in human Heps-PNPLA3-G and human Heps-PNPLA3-C/G controls resulted in a significant increase of ROS production in human Heps-PNPLA3-G compared to controls (Fig.4K). Taken
together, these results indicated that the PNPLA3-G rs738409 gene variant confers an elevated level of β- oxidation specifically in peroxisomes. EXAMPLE 7: Human donor livers and hepatocytes carrying PNPLA3 rs738409:G variant are susceptible to ferroptosis It was investigated whether the PNPLA3 rs738409:G variant is associated with metabolic capacity to adapt to ferroptosis which, is a unique cell death modality that is the result interaction between cellular metabolism, specifically, amino acids, lipids, iron and redox reactions (Jiang et al., 2021, Nat Rev Mol Cell Biol 22: 266-282). There was a significant increase of reduced glutathione in primary human Heps- PNPLA3-G (FIG.1F). This increase in reduced glutathione potentially stems from upregulation of metabolites in the methionine cycle that is also being supplemented by arginine metabolism in the methionine salvage pathway (Fig.1F). However, the transcriptomic analysis shows a substantial reduction in the expression of GPX4 in human Heps-PNPLA3-G (FIG.1F). It has been previously shown that lower expression of GPX4 leads to increased ferroptosis susceptibility (Yang et al., 2014, Cell 156: 317-331). Interestingly, there was no significant difference in the expression of the glutathione transporter SLC25A39/40 between the human hepatocyte experimental groups. To evaluate the other measures of ferroptosis susceptibility in human hepatocytes, the lipid droplet presence and lipid peroxidation were analyzed, and there was a significant increase in both lipid droplet content and lipid peroxidation (FIG.5A) in human Heps-PNPLA3-G compared to controls. Furthermore, there were abnormalities in mitochondrial morphology as shown by transmission electron microscopy consistent with ferroptosis (Dixon et al., 2012, Cell 149: 1060-1072). The analysis revealed an increased number of spherical mitochondria among hepatocytes homozygous for the PNPLA3 rs738409 variant rather than the rod shape commonly found in human hepatocytes (FIG.5A). Taken together, increased lipid peroxidation, reduced GPX4 levels and subsequent mitochondrial shrinkage demonstrated the onset of ferroptosis in PNPLA3 rs738409:G homozygous hepatocytes. To further the characterization of primary human Heps-PNPLA3-G and based on the alterations in mitochondrial morphology alterations in human Heps-PNPLA3-G, the levels of adenosine triphosphate (ATP) were assessed to determine if there was also a commensurate decrease in energy production (Fig. 5A). It was found that human Heps-PNPLA3-G had significantly reduced ATP levels when compared to control human Heps-PNPLA3-C/G. To determine how normal human Heps-PNPLA3-G and human Heps- PNPLA3-C/G maintain ATP production, the energy was examined whether it was derived from oxidative phosphorylation or from glycolysis. ATP levels in the presence of either an inhibitor of mitochondrial oxidative phosphorylation, oligomycin A, a F1F0-ATP synthase inhibitor or an inhibitor of glycolysis, 2- deoxyglucose (2DG) were measured. In human Heps-PNPLA3-C/G, blocking mitochondrial oxidative phosphorylation significantly reduced ATP, while blocking glycolysis had minimal effect (Fig.5A). These findings demonstrate that mitochondrial oxidative phosphorylation is the major source of energy production. In human Heps-PNPLA3-G, blocking mitochondrial oxidative phosphorylation resulted in a significant
utilization of the glycolytic system to maintain ATP levels, and blocking glycolysis significantly reduced ATP production (Fig.5A). These results show that there is a metabolic readjustment in energy production in human Heps-PNPLA3-G from oxidative phosphorylation to glycolysis. Glycolysis increases in human Heps- PNPLA3-G to compensate for decreased oxidative phosphorylation and maintain ATP production. Taken together, increased lipid content and peroxidation, mitochondrial shrinkage, utilization of glycolysis to produce ATP, and reduced GPX4 levels all suggest the onset of ferroptosis in PNPLA3 rs738409:G homozygous hepatocytes. It has been reported that hepatic triglycerides are significantly enriched in polyunsaturated fatty acids (PUFA) in carriers with the PNPLA3 rs738409:G variant (Luukkonen et al., 2016, J Hepatol 64: 1167- 1175). Moreover, long-chain PUFAs are highly susceptible to lipid peroxidation, a crucial driver of ferroptosis (Yang et al., 2016, PNAS 113, E4966-4975). To examine potential alterations in the lipid synthesis that could contribute to ferroptosis, the expression of metabolic enzymes that have been associated with susceptibility to ferroptosis were analyzed (Tesfay et al., 2019, Cancer Res 79: 5355-5366; Jiang et al., 2017, Theranostics 7: 3293-3305; Yuan et al., 2016, Biochem Biophys Res Commun 478: 1338-1343). Notably, there was a significantly decreased expression of stearoyl CoA desaturase (SCD) and fatty acid desaturase 2 (FADS2) along with a significant upregulation of acyl-CoA synthetase long-chain family member 4 (ACSL4) in human Heps-PNPLA3-G (FIGs.5B-5C). ACSL4 converts free long-chain fatty acids into fatty acyl-CoA esters preferentially using PUFAs such as arachidonate, and its overexpression has been linked to enhanced ferroptosis sensitivity (Yuan et al., 2016, Biochem Biophys Res Commun 478: 1338- 1343). Taken together, these data demonstrate that alterations in the lipid synthesis driven by PNPLA3 rs738409:G variant can increase the susceptibility of human hepatocytes to lipid peroxidation and ferroptosis. EXAMPLE 8: PNPLA3 rs738409:G variant mediates compensatory changes in iron metabolism and high baseline levels of lipid peroxidation in human hepatocytes To investigate the susceptibility of human Heps-PNPLA3-G to severe stress such as iron oxidation, FINO2 was used, a direct inducer of iron oxidation that ultimately causes widespread lipid peroxidation and ferroptosis (Gaschler et al., 2018, Nat Chem Bio 14: 507-515). As expected, human Heps-PNPLA3-C/G showed significant cell death and an increase in lipid peroxidation inducibility when exposed to FINO2 (FIG.5D). Although human Heps-PNPLA3-G showed significant cell death induction, their initial baseline levels of lipid peroxidation were already high, and induction of iron oxidation did not cause a significant increase in lipid peroxidation (FIG.5D). This observation was corroborated by correlating lipid peroxidation inducibility and hepatocyte viability (FIG.5D). In support of the previous observations, the mitochondrial morphology changed significantly from rod shape to spherical shape in the presence of FINO2 in human Heps-PNPLA3-C/G. Human Heps-PNPLA3-G already presented mitochondria shrinkage before induction of lipid peroxidation by FINO2 (FIG.5D). Subsequently, to confirm the susceptibility to ferroptosis of human Heps-PNPLA3-G, different ferroptosis inducers were tested such as erastin, which depletes GSH and inactivates GPX4 by inhibiting the solute carrier family 7 member 11 (SLC7A11) in the
cellular membrane, RSL3, which directly inhibits GPX4 (Forcina et al., Proteomics 19, e1800311 (2019)), and FIN56, a molecule that degrades GPX4 and reduce the antioxidant Coenzyme Q10 (Sun et al., Cell Death Dis 12, 1028 (2021)). Surprisingly, it was observed that erastin did not cause significant changes in cell viability on human Heps-PNPLA3-G or controls. Thus, the SLC7A11 pathway was investigated and it was found that primary human hepatocytes expressed minimal levels of SLC7A11, the erastin targeted receptor responsible for cellular cystine uptake to synthesize glutathione. However, RSL3, FiNO2 and FIN56 induced changes in cell viability. Human Heps-PNPLA3-G, especially, showed significant differences at various dosages and times when compared to human Heps-PNPLA3-C/G. These observations indicated that human Heps-PNPLA3-G have an increased baseline of cellular stress due to lipid peroxidation and susceptibility to ferroptosis. Inducing ferroptosis in human Heps-PNPLA3-G did not seem to exacerbate lipid peroxidation or cellular stress. To determine how blockage of ferroptosis affects cell viability in human Heps-PNPLA3-G, human Heps-PNPLA3-G and human Heps-PNPLA3-C/G were treated with the specific ferroptosis inhibitors liproxstatin-1 or Fer-1. Human Heps-PNPLA3-G treated with ferroptosis inhibitors exhibited both increased cellular viability and lower level of ROS when compared to human Heps-PNPLA3-C/G controls (Fig.5E). To further substantiate the causality between the PNPLA3 rs738409:G variant and increased lipid peroxidation and ferroptosis, gene-knockdown of PNPLA3 in both human Heps-PNPLA3-G and Heps- PNPLA3-C/G was done and it was found that human Heps-PNPLA3-C/G exhibited an increase in lipid peroxidation when compared to human Heps-PNPLA3-G which maintained ongoing lipid peroxidation (Fig. 5F). Consistent with these findings, no significant differences between human Heps-PNPLA3-G and human Heps-PNPLA3-C/G after exposure to apoptosis or necrosis inducers was found, indicating that primary human hepatocytes with and without the PNPLA3 rs738409:G variant are equally sensitive to apoptosis or necrosis. Taken together, these results indicate that PNPLA3 rs738409:G variant is specifically related to susceptibility to ferroptosis in primary human hepatocytes and normal human livers. EXAMPLE 9: Rescue of ferroptosis-driven programmed cell death in hepatocytes homozygous for the PNPLA3 rs738409:G variant Three approaches were evaluated: i) a pharmacological approach using an FDA-approved iron chelator Deferoxamine (DFO); ii) a nutritional supplementation using reduced L-Glutathione (GSH); and iii) a gene therapy approach directed to increasing GPX4-expression using a viral vector (FIGs.6A-6G). First, human Heps-PNPLA3-G cells were treated with DFO, resulting in significantly reduced lipid peroxidation, increased viability, and importantly a change in mitochondrial morphology from a spherical shape to the normal hepatocyte mitochondrion rod shape under the presence of FINO2 (FIGs.6A & 6C- 6D). Next, the nutritional supplementation of GSH to the culture medium was tested. It has been reported that GSH reduces ROS and lipid peroxidation by binding to free cytosolic iron (Fe2+) (Hider et al., 2021, Inten J of Mol Sci 22: 1278). There was a decrease in lipid peroxidation and an increase in viability in the presence of FINO2 (FIGs.6B & 6D). High oxidative stress regulates human Heps-PNPLA3-G to maintain higher levels of GSH compared to controls. However, low expression of GPX4 leads to suppressed
antioxidant activity, limiting the ability of the cells to regulate ferroptosis. Supplementation with GSH can overcome this limitation and reduce lipid peroxidation and ferroptosis, thereby rescuing cell viability (FIGs. 6B & 6D). The expression of GPX4 by qPCR was measured and found significantly reduced expression of GPX4 among human Heps-PNPLA3-G (FIGs.6C, 1F, 2A). Moreover, there was reduced protein expression of GPX4 in human livers. Notably, overexpressing GPX4 in human Heps-PNPLA3-G without exogenous supplementation, enables these cells to utilize endogenous GSH to reduce lipid peroxidation and ferroptosis, and enhance cell viability (FIG.6F). It was hypothesized that the overexpression of GPX4 in human Heps- PNPLA3-G without exogenous supplementation enables these cells to utilize endogenous GSH to reduce lipid peroxidation and ferroptosis, and enhance cell viability. Consequently, human Heps-PNPLA3-G and human Heps-PNPLA3-C/G controls were treated in the absence and presence of FINO2 with a lentiviral vector encoding GPX4 to evaluate its role in cell viability by reducing lipid peroxides. Significantly increased GPX4 expression in both human Heps-PNPLA3-G and human Heps-PNPLA3-C/G controls was observed (Fig.6G). A significant increase in cell viability when the ferroptosis inducer was absent or present in the culture medium in human Heps-PNPLA3-G when compared to human Heps-PNPLA3-C/G controls was documented (Fig.6G). Taken together, this data demonstrated that ferroptosis was a viable target in human Heps-PNPLA3-G. Personalized therapies inhibiting ferroptosis can reverse programmed cell death by reducing lipid peroxidation. As disclosed herein, PNPLA3 rs738409:G variant was profiled in a US cohort of 126 healthy donor livers, 54 ESLD livers and 79 liver graft donors and 83 LDLT recipients. The PNPLA3 rs738409:G variant was significantly frequent in ESLD livers and linked to poor recipient survival following LDLT and progressive liver disease in one donor graft in a patient who required two donor grafts for LDLT. The presence of the PNPLA3 rs738409:G variant increases lipid peroxidation, induces mitochondrial shrinkage and significant metabolic and transcriptomic alterations, upregulates peroxisomal β-oxidation and elevates bile acids levels. There is a survival advantage of genetic screening of LDLT donors. The PNPLA3 gene encodes for the patatin-like phospholipase domain-containing protein 3, located on hepatocyte lipid droplets and has lipase activity for long chain PUFAs (Li et al., 2012, J clin Invest 122: 4130-4144; He et al., 2010, J Biol Chem 285: 6706-6715). The PNPLA3 rs738409:G variant promotes triglyceride accumulation in the lipid droplet of the hepatocyte (He et al., 2010, J Biol Chem 285: 6706- 6715; Tilson et al., 2021, Hepatology 74: 2998-3017). Previous studies have shown that the PNPLA3 rs738409:G variant is also associated with hepatic fibrosis, inflammation (independent of diabetes or obesity) (Valenti et al., 2010, Hepatol 51: 1209-1217; Liu et al., 2014, Hepatol 61: 75-81; Sookoian et al., 2009, J Lipid Res 50: 2111-2116), and reduced serum levels of very low density lipoprotein and cholesterol in patients with metabolic syndrome (Pirazzi et al., 2012, J Hepatol 57: 1276-1282; Krarup et al., 2012, PLoS One 7: e40376; Mancina et al., 2015, J Clin Endocrinol Metab 100: E821-825). The PNPLA3 rs738409:G variant has also been associated with the development of post-transplant hepatic steatosis and
steatohepatitis in the chronic hepatitis C infected population (Miyaaki et al., 2018, Hepatol Res 48: E335- 339). The present results document that the presence of the PNPLA3 rs738409:G variant in the donor graft is associated with decreased recipient survival. Although donors homozygous for the PNPLA3 rs738409:G variant were significantly younger than non-homozygous donors, age was not a confounding variable in the Cox proportional hazards model. The prevalence of the PNPLA3 rs738409:G variant in the US cohort was 28% in patients with ESLD. However, in the Japanese cohort LDLT donor population (28% for donors) was considerably higher compared to other populations (The 1000 Genomes Project Consortium, 2015, Nature 526: 68-74). This high prevalence of PNPLA3 rs738409:G variant in donor liver grafts is due to the frequent genetic relationship between donor and recipient. Genome-wide association studies (GWAS) have identified genomic variants associated with the development of ESLD; however, the precise mechanisms by which these variants lead to ESLD and cellular death in humans have not been determined. Animal studies have revealed that endogenous PNPLA3 expression is exceedingly low in livers and highly expressed in adipose tissue (Baulande et al., 2001, J Biol Chem 276: 33336-33344). As a result, PNPLA3 must be overexpressed in mouse liver tissue in order to produce a human-like phenotype (Li et al., 2012, J clin Invest 122: 4130-4144). Moreover, the mouse and human PNPLA3 proteins are only approximately 60% identical, and when the human PNPLA3 protein is overexpressed in mouse livers, it is resistant to dietary regulation, indicating that the protein may have different functions in different species. Thus, it remains unclear to what extent the disease models in rodents can recapitulate the phenotype of the PNPLA3 rs738409 variant in humans. In this effort to understand the human biology of the PNPLA3 rs738409:G variant, induced pluripotent stem cell-derived hepatocytes have been studied (Tilson et al., 2021, Hepatology 74: 2998-3017). While human stem cell-based models can be used to examine some aspects of the human phenotype, it is unknown if stem cell-derived hepatocytes are mature enough to replicate the phenotype in its entirety. Therefore, isolated primary human hepatocytes were genetically profiled for MAFLD-related polymorphic sites and employed metabolomics, transcriptomic analysis and integrated both omics approaches using the flux propensity analysis, COMPASS, computation pipeline to uncover precise alterations in human hepatocyte function that carried the PNPLA3 rs738409:G variant. Using this integrative approach, increased intracellular levels of bile acids and increased β-oxidation in peroxisomes, which contributed to increased lipid peroxidation levels was found (FIGs.2 & 4). Experiments using the peroxisomal β-oxidation inhibitor enoximone in the presence of the lipid peroxidation inducer FINO2 reveal that, under physiological and stressful conditions, mitochondrial function in hepatocytes homozygous for the PNPLA3 rs738409:G variant may be compromised. These findings also demonstrated a role for the PNPLA3 rs738409:G variant in regulating levels of GPX4 expression (Yang et al., 2014, Cell 156: 317-331; Dixon et al., 2012, Cell 149: 1060-1072) and modulating iron metabolism and lipid peroxidation under conditions of cellular stress. These forms of stress have tissue-cumulative effects on metabolism and risk of recurrent liver disease in transplanted patients.
These studies also identified the importance of a mechanism of programmed cell death known as ferroptosis in patients with the PNPLA3 variant. This type of programmed cell death is caused by iron- dependent lipid peroxidation and is associated with mitochondrial shrinkage and reduced expression of GPX4. Human hepatocytes homozygous for the PNPLA3 rs738409:G variant expressed the ferroptosis signature of lower GPX4 expression, mitochondrial shrinkage, higher content of lipid droplets, and lipid peroxidation (FIG.5A). There was altered expression of genes related to iron metabolism that can increase intracellular iron; however, total iron load was no different in human hepatocytes homozygous for the PNPLA3 rs738409:G variant than in controls. These transcriptomic alterations in iron metabolism-related genes demonstrate the lower lipid peroxidation induction capacity of human hepatocytes homozygous for the PNPLA3 rs738409:G variant when exposed to FINO2. These findings show that expression of the PNPLA3 rs738409:G variant leads to ferroptosis in healthy human hepatocytes (FIGs.2-5). There was also evidence of ferroptosis in primary human hepatocytes, isolated from explanted cirrhotic livers with ESLD due to NASH, homozygous for the PNPLA3 rs738409:G variant. Significant reduced lipid peroxidation, thus limiting ferroptosis and rescue of human hepatocytes from cell death can be achieved by inhibiting iron chelation, increasing available GSH to bind free Fe2+ (Hider et al., 2021, Intern J of Mol Sci 22: 1278), or inducing GPX4 expression. Thus the use of molecular genotyping and phenotyping in combination with sensitive metabolomics and transcriptomics was effective at identifying molecular and metabolic processes associated with ESLD in humans. The results presented herein document that enoximone (1,3-Dihydro-4-methyl-5-[4- (methylthio)benzoyl]-2H-imidazol-2-one) and related compounds can be used to treat liver disease, such as ESLD and MAFLD. It will be apparent that the precise details of the methods or compositions described may be varied or modified without departing from the spirit of the described aspects of the disclosure. We claim all such modifications and variations that fall within the scope and spirit of the claims below.
Claims
Claims: 1. A method for inhibiting a liver disease in a subject, comprising: administering to the subject an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12- tricosadiynoic acid (TDYA), or a pharmaceutically acceptable salt thereof, thereby inhibiting the liver disease in the subject.
2. The method of claim 1, wherein the liver disease is end stage liver disease, metabolic associated fatty liver disease, fibrosis of the liver, cirrhosis, nonalcoholic fatty liver disease or inflammatory metabolic dysfunction-associated steatohepatitis.
3. The method of claim 2, wherein the liver disease is end stage liver disease or metabolic associated fatty liver disease.
4. The method of any one of claims 1-3, wherein the method comprises administering to the subject the effective amount of the PDEIII inhibitor, and wherein the PDEIII inhibitor is Enoximone, Amrinone, Cilostazol, Milrinone, Pimobendan, dipyridamole, or a pharmaceutically acceptable salt thereof.
5. The method of claim 4, wherein the PDEIII inhibitor is Enoximone.
6. The method of claim 1, comprising administering to the subject the effective amount of TDYA.
7. The method of any one of claims 1-6, wherein the method increases serum albumin, decreases serum ammonia, improve coagulation activity, decreases ascites production, improves neuropsychological status, decreases bilirubin, improves apolipoprotein and/or improves portal vein or systemic blood flow clearance of cholate in the subject.
8. The method of any one of claims 1-7, wherein the subject is human.
9. The method of claim 8, wherein the subject is homozygous for rs738409:G mutation in the patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene.
10. The method of any one of claims 1-9, comprising: selecting a subject that is homozygous for rs738409:G mutation in the PNPLA3 gene
11. The method of any one of claims 1-9, wherein the subject has a liver transplant.
12. The method of claim 11, wherein the liver transplant graft is homozygous for rs738409:G mutation in the PNPLA3 gene.
13. The method of claim 11 or claim 12, wherein the liver transplant was from a cadaveric liver transplant.
14. The method of claim 11 or claim 12, wherein the liver transplant was from a living donor.
15. The method of any one of claims 1-14, further comprising administering to the subject a effective amount of: (a) a nucleic acid molecule encoding glutathione peroxidase 4 (GPX4); or (b) glutathione (GSH).
16. The method of claim 15, wherein the nucleic acid molecule encoding GPX4 is an mRNA.
17. The method of any one of claims 1-16, further comprising administering to the subject a effective amount of deferoxamine, selenium, vitamin E (alpha-tocopherol), CoQ10, or a combination thereof.
18. The method of any one of claims 1-17, wherein the method inhibits lipid peroxidation in the subject.
19. The method of any one of claims 1-18, wherein the method inhibits ferroptosis in the subject.
20. The method of any one of claims 1-19, wherein the subject is at risk of developing the liver disease, and the method prevents the development of liver disease in the subject.
21. The method of any one of claims 1-19, wherein the subject has the liver disease, and the method treats the liver disease in the subject.
22. A composition comprising an effective amount of a phosphodiesterase (PDE) III inhibitor or 10,12-tricosadiynoic acid (TDYA), or a pharmaceutically acceptable salt thereof, for use in inhibiting liver disease in a subject.
23. The composition of claim 22, for use in the method of any one of claims 1-21.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363532314P | 2023-08-11 | 2023-08-11 | |
| US63/532,314 | 2023-08-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2025038398A1 true WO2025038398A1 (en) | 2025-02-20 |
Family
ID=94633050
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2024/041547 Pending WO2025038398A1 (en) | 2023-08-11 | 2024-08-08 | Methods of preventing or treating liver disease |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2025038398A1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050119272A1 (en) * | 2002-01-25 | 2005-06-02 | Diamedica Inc. | Use of phosphodiesterase antagonists to treat insulin resistance |
| US20110111066A1 (en) * | 2009-11-09 | 2011-05-12 | Bio-Engineered Supplements And Nutrition, Inc. | Method and composition for improved anabolism |
| US20200000811A1 (en) * | 2004-02-13 | 2020-01-02 | Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center | Methods of use of inhibitors of phosphodiesterases and modulators of nitric oxide, reactive oxygen species, and metalloproteinases in the treatment of peyronie's disease, arteriosclerosis and other fibrotic diseases |
| US20220364099A1 (en) * | 2021-05-11 | 2022-11-17 | Regeneron Pharmaceuticals, Inc. | Methods Of Treating Liver Diseases With Phosphodiesterase 3B (PDE3B) Inhibitors |
-
2024
- 2024-08-08 WO PCT/US2024/041547 patent/WO2025038398A1/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050119272A1 (en) * | 2002-01-25 | 2005-06-02 | Diamedica Inc. | Use of phosphodiesterase antagonists to treat insulin resistance |
| US20200000811A1 (en) * | 2004-02-13 | 2020-01-02 | Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center | Methods of use of inhibitors of phosphodiesterases and modulators of nitric oxide, reactive oxygen species, and metalloproteinases in the treatment of peyronie's disease, arteriosclerosis and other fibrotic diseases |
| US20110111066A1 (en) * | 2009-11-09 | 2011-05-12 | Bio-Engineered Supplements And Nutrition, Inc. | Method and composition for improved anabolism |
| US20220364099A1 (en) * | 2021-05-11 | 2022-11-17 | Regeneron Pharmaceuticals, Inc. | Methods Of Treating Liver Diseases With Phosphodiesterase 3B (PDE3B) Inhibitors |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hou et al. | Loss of TRIM21 alleviates cardiotoxicity by suppressing ferroptosis induced by the chemotherapeutic agent doxorubicin | |
| Qi et al. | Akap1 deficiency exacerbates diabetic cardiomyopathy in mice by NDUFS1-mediated mitochondrial dysfunction and apoptosis | |
| Petrović et al. | Oxidative stress-dependent contribution of HMGB1 to the interplay between apoptosis and autophagy in diabetic rat liver | |
| Graziani et al. | A new water soluble MAPK activator exerts antitumor activity in melanoma cells resistant to the BRAF inhibitor vemurafenib | |
| WO2021146258A1 (en) | Combination therapy for cancer | |
| Garreis et al. | Upregulation of transient receptor potential vanilloid type-1 channel activity and Ca2+ influx dysfunction in human pterygial cells | |
| SK285969B6 (en) | Preparations for treating mammalian or hyperproliferative cells | |
| Oda et al. | Impact of diclofenac sodium on tilmicosin-induced acute cardiotoxicity in rats (tilmicosin and diclofenac cardiotoxicity) | |
| Fu et al. | 20 (S)-Ginsenoside Rg2 attenuates myocardial ischemia/reperfusion injury by reducing oxidative stress and inflammation: role of SIRT1 | |
| JP2022551987A (en) | Compositions and methods for treating liver disease | |
| CN107405414A (en) | Treat the method and composition of cerebral disease | |
| Liu et al. | Genetic inhibition of FABP4 attenuated endoplasmic reticulum stress and mitochondrial dysfunction in rhabdomyolysis-induced acute kidney injury | |
| He et al. | Impaired RelA signaling and lipid metabolism dysregulation in hepatocytes: driving forces in the progression of metabolic dysfunction-associated steatotic liver disease | |
| Qi et al. | PGC-1α silencing compounds the perturbation of mitochondrial function caused by mutant SOD1 in skeletal muscle of ALS mouse model | |
| US9981048B2 (en) | Methods for the treatment and prevention of liver disease | |
| Choi et al. | Novel FoxO1 inhibitor, JY-2, ameliorates palmitic acid-induced lipotoxicity and gluconeogenesis in a murine model | |
| Zhang et al. | ECM1 protects against liver steatosis through PCBP1-mediated iron homeostasis | |
| Xu et al. | Chaihuang Yishen Granule ameliorates mitochondrial homeostasis by upregulating PRDX5/TFAM axis to inhibit renal fibrosis in CKD | |
| Bourebaba et al. | The PTP1B inhibitor MSI-1436 ameliorates liver insulin sensitivity by modulating autophagy, ER stress and systemic inflammation in Equine metabolic syndrome affected horses | |
| WO2025038398A1 (en) | Methods of preventing or treating liver disease | |
| Wang et al. | Selectively targeting the AdipoR2-CaM-CaMKII-NOS3 axis by SCM-198 as a rapid-acting therapy for advanced acute liver failure | |
| Varghese et al. | GRP78/BiP alleviates oxLDL-induced hepatotoxicity in familial hypercholesterolemia caused by missense variants of LDLR in a HepG2 cellular model | |
| Zhou et al. | Mammalian target of rapamycin complex 2 signaling is required for liver regeneration in a cholestatic liver injury murine model | |
| US20260041644A1 (en) | Lipid nanoparticles for drug delivery and methods of use thereof | |
| Zhao et al. | FXR acts as a therapeutic target for ulcerative colitis via suppressing ferroptosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 24854677 Country of ref document: EP Kind code of ref document: A1 |







