WO2025030072A1 - Lipid nanoparticles and methods of use thereof - Google Patents

Lipid nanoparticles and methods of use thereof Download PDF

Info

Publication number
WO2025030072A1
WO2025030072A1 PCT/US2024/040661 US2024040661W WO2025030072A1 WO 2025030072 A1 WO2025030072 A1 WO 2025030072A1 US 2024040661 W US2024040661 W US 2024040661W WO 2025030072 A1 WO2025030072 A1 WO 2025030072A1
Authority
WO
WIPO (PCT)
Prior art keywords
lipid
lipid nanoparticle
rpv
ccr5
lnp
Prior art date
Application number
PCT/US2024/040661
Other languages
French (fr)
Inventor
Howard Gendelman
Sudipta PANJA
Lubaba ZAMAN
Milankumar PATEL
Original Assignee
Board Of Regents Of The University Of Nebraska
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Board Of Regents Of The University Of Nebraska filed Critical Board Of Regents Of The University Of Nebraska
Publication of WO2025030072A1 publication Critical patent/WO2025030072A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/14—Esters of carboxylic acids, e.g. fatty acid monoglycerides, medium-chain triglycerides, parabens or PEG fatty acid esters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/24—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/12—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by a special physical form, e.g. emulsion, microcapsules, liposomes, characterized by a special physical form, e.g. emulsions, dispersions, microcapsules
    • A61K51/1241—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by a special physical form, e.g. emulsion, microcapsules, liposomes, characterized by a special physical form, e.g. emulsions, dispersions, microcapsules particles, powders, lyophilizates, adsorbates, e.g. polymers or resins for adsorption or ion-exchange resins
    • A61K51/1244—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by a special physical form, e.g. emulsion, microcapsules, liposomes, characterized by a special physical form, e.g. emulsions, dispersions, microcapsules particles, powders, lyophilizates, adsorbates, e.g. polymers or resins for adsorption or ion-exchange resins microparticles or nanoparticles, e.g. polymeric nanoparticles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle

Definitions

  • the present invention relates generally to the delivery of therapeutics. More specifically, the present invention relates to compositions and methods for the delivery of therapeutic agents to a patient.
  • HIV human immunodeficiency virus type
  • Viral DNA integration into the host cell target genome defines microbial latency, demonstrating that HIV-1 can circumvent the host immunity and persist in the system with continuous antiretroviral immunity with continuous HIV comorbidities (Fotooh Abadi, et al. (2023) J. Nanobiotechnol., 21(1):19; Chun, et al. (2015) Nat. Immunol., 16(6):584-589; Surve, et al. (2020) Mol. Pharm., 17( 10): 3990-4003).
  • ART faces challenges due to its failure to eliminate infection, the need for strict regimen adherence, and drug-related toxicities (Vasukutty, et al. (2023) ACS Appl. Bio.
  • LNPs functional lipid nanoparticles
  • a means to improve these antiretroviral therapeutic challenges is long-acting (LA) ART. Improved drug delivery has an underexplored potential for improved therapeutic outcomes.
  • One way this can be further improved is through functional lipid nanoparticles (LNPs).
  • LNPs may not allow drug accumulation to viral reservoirs (Herskovitz, et al. (2021) Nanotheranostics 5(4):417-430).
  • ARV antiretroviral drug
  • LNPs may improve ARV pharmacodynamics by increasing drug circulation time and bioavailability (Fotooh Abadi, et al. (2023) J. Nanobiotechnol., 21(1): 19; Daraban, et al.
  • LNP composition and decoration enable ARV cell depots and enhance delivery to viral reservoirs (Wong, et al. (2019) Front. Immunol., 10:456992). Despite these advancements, improved LNP with superior properties are needed.
  • lipid nanoparticles are provided.
  • the lipid nanoparticles comprise more than one lipid, a C-C chemokine receptor type 5 (CCR5) targeting moiety, and a therapeutic agent and/or imaging agent.
  • the lipid nanoparticle comprises a polyethylene glycol (PEG)-lipid conjugate.
  • the CCR5 targeting moiety is selected from the group consisting of maraviroc, aplaviroc, vicriviroc, INCB009471, leronlimab, and the peptide Ala-Ser-Thr-Thr-Thr-Asn-Tyr- Thr (SEQ ID NO: 1) optionally comprising one or more D-amino acids.
  • the CCR5 targeting moiety is conjugated to a PEG-lipid conjugate via the PEG moiety.
  • the PEG-lipid conjugate is 1,2-distearoyl- sn-glycero-3 -phosphoethanolamine (DSPE)-PEG.
  • the lipid nanoparticle comprises phosphatidylcholine, DSPE-PEG, and DSPE-PEG-CCR5 conjugate.
  • the lipid nanoparticle encapsulates the therapeutic agent and/or imaging agent.
  • the therapeutic agent is an antiretroviral agent.
  • Antiretroviral agents include, without limitation, non-nucleoside reverse transcriptase inhibitors, nucleoside reverse transcriptase inhibitors, protease inhibitors, fusion inhibitors, integrase inhibitors, or CRISPR based therapeutics (e.g., a gRNA or crRNA).
  • the gRNA or crRNA is complementary to a sequence within an HIV-1 gene.
  • the gRNA or crRNA comprises a sequence with at least 90% identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18.
  • the antiretroviral agent is rilpivirine.
  • the lipid nanoparticle comprises a therapeutic agent and an imaging agent.
  • the imaging agent is CulnEuS?.
  • the lipid nanoparticle comprises phosphatidylcholine, DSPE-PEG, DSPE-PEG-CCR5 conjugate, and an antiretroviral agent (e.g., rilpivirine).
  • Compositions comprising at least one nanoparticle and a pharmaceutically acceptable carrier are also encompassed by the instant invention.
  • methods of treating, inhibiting, and/or preventing an HIV (e.g., HIV-1) infection in a subject in need thereof comprise administering at least one nanoparticle of the instant invention to the subject.
  • HIV e.g., HIV-1
  • methods of imaging HIV and/or HIV reservoirs and/or tracking or monitoring an HIV (e.g., HIV-1) infection comprise administering at least one nanoparticle of the instant invention to the subject and detecting the presence of the imaging agent.
  • HIV e.g., HIV-1
  • Figures 1 A-1D show the morphological characterization of the multimodal CuInEuS? nanoprobe.
  • Figures 1 A and IB provide transmission electronmicroscope images of the multimodal rode shape nanoprobes.
  • CuInEuS? and its crystal lattice (lines) are illustrated.
  • Figure 1C provides a scanning transmission electron microscopy map shows elemental localization within the nanoprobe from a corresponding high-angle annular dark-field electron microscopy image.
  • Figure 1C shows the presence of copper (top middle), indium (bottom left), europium (top right), and sulfur (bottom middle) in the nanoprobe.
  • Top left shows HAADF and bottom right shows overlap images.
  • Figure ID provides a XRD pattern of CuInEuS? nanoprobe which demonstrates a crystal structure.
  • Figure IE provides a structure of the DSPE-PEG conjugated CCR5 peptide.
  • Figure IF provides a schematic representation of rilpivirine (RPV) and inorganic nanoparticles (CulnEuS?) encapsulated lipid nanoparticles (LNP-RPV and LNP-RPV-CCR5) manufactured by using microfluidic mixing.
  • Figure 1G provides a schematic representation of rilpivirine (RPV) and encapsulated lipid nanoparticles (LNP-RPV and LNP-RPV- CCR5) manufactured by using microfluidic mixing.
  • Figures 2A-2F show physicochemical LNP characterization.
  • Figures 2A and 2B provide TEM images which show nearly spherical LNP-RPV and LNP-RPV- CCR5 morphology, respectively.
  • Figures 2C and 2D provide graphs of the DLS size profile demonstrating the unimodular distribution of the LNPs.
  • Figures 2E and 2F provide graphs of the changes in size and poly dispersity of the LNPs recorded for one month at 4 °C. LNPs were stable without changes in size and polydispersity.
  • Figures 3 A-3G show that CCR5-receptor targeted LNPs facilitate the particle’s cell uptake, depot formation, and HIV-1 suppression.
  • Figure 3A provides a graph of dose-associated macrophage viability measurements following LNP exposures by the CTB assay after a 24 hour incubation. The LNP- RPV and RPV- CCR5 treatments showed that cell viability was maintained at 100 pM of RPV doses.
  • Figure 3B provides a graph of LNP-RPV and LNP-RPV-CCR5 macrophage uptake analyzed by measuring RPV concentration for 24 hours at 20 pM RPV. Comparisons between LNP-RPV and RPV-CCR5 showed a 3 -fold increase in drug uptake.
  • Figure 3C provides a graph showing the CCR5 inhibitor (maraviroc, 1 nM) attenuated LNP uptake for the LNP-RPV-CCR5.
  • Figure 3D provides confocal microscopy performed with Cy 5.5 dye-labeled LNP-RPV-CCR5 treated macrophages in the presence (lower panel) and absence (upper panel) of maraviroc.
  • RPV retention ( Figure 3E) and viral suppression (Figure 3F) in LNP-RPV and LNP- RPV-CCR5 macrophage uptake were evaluated by measuring RPV and virus levels in the cell supernatant fluids. The data were collected over 25 days after a 100 pM RPV dose.
  • Figure 3G provides TEM images of LNP engulfed macrophage.
  • RPV retention ( Figure 3H) and viral suppression ( Figure 31) in LNP -RPV and LNP-RPV- CCR5 macrophage uptake were evaluated by measuring RPV and virus levels in the cell supernatant fluids. The data were collected over 25 days after a 30 pM administered dose.
  • Figures 4A-4I show LNP and RPV tissue biodistribution in mice by PET imaging and mass spectrometry.
  • Figure 4A provides a schematic presentation of LNP biodistribution by PET.
  • Figure 4B shows images of humanized mice injected with LNP -RPV or RPV-CCR5, and particle biodistribution monitored by PET at 6, 24, and 48 hours. Both coronal (left panel) and sagittal (right panel) views for LNP- RPV-CCR5 are illustrated.
  • Figures 4C and 4D provide graphs of the quantitative measurements of radiolabeled LNPs in tissue were recorded at 48 hours by gamma counter measurements. LNP-RPV-CCR5 was concentrated in the spleen.
  • Figure 4E provides a graph of spleen/liver RPV ratios for LNP-RPV-CCR5 and LNP -RPV.
  • Figure 4F provides a schematic presentation of LNP injection measurements in humanized mice.
  • Figure 4G provides a graph of plasma RPV levels following NP- RPV and RPV-CCR5 treated mice at 6 and 24 hours after injection.
  • Figure 4H provides a graph of the spleen/liver RPV ratio at 24 hours, the highest RPV levels are in the spleen after LNP injection.
  • Figure 41 provides whole body PET scanning images of humanized mice at 6 hours post-LNP administration.
  • Figures 5A-5B show brain delivery of LNP-RPV-CCR5 nanoparticles.
  • Humanized microglial (MG) mice were focus ultrasound (FUS) treated to the brain and then LNPs were injected intravenously through the tail.
  • Figure 5 A provides IVIS images showing bright Cy5.5 signals in the brain of FUS-treated mice that received the LNP-RPV-CCR5 compared to LNP -RPV. Both mice showed good BBB disruption, as shown by the gadolinium enhancements (bright signals, arrows) on the coronal sections of the Tl-weighted images (T1WI) on MRI.
  • Figures 6A-6D show viral suppression and toxicity profiles of LNP-carried RPV.
  • Figure 6A provides a schematic representation of experimental timelines for LNP treatments.
  • Figure 6B provides a graph showing viral suppression efficiency of LNP-RPV and LNP-RPV-CCR5 (individual humanized mice) on days 7 and 14. LNP-RPV-CCR5 showed complete viral suppression up to day 14.
  • Figure 6C provides a graph showing the change in mice body weight in the untreated, LNP- RPV, and LNP-RPV-CCR5 treated group.
  • Figure 6D provides histological images of hematoxylin and eosin-stained heart tissues, lung, kidney, spleen, and liver sections from the treatment groups. The images were captured at 20X magnification.
  • lipid nanoparticles are provided.
  • the lipid nanoparticles comprise one or more lipids.
  • the lipid nanoparticles comprise one or more lipid layers.
  • the lipid nanoparticles comprise a lipid monolayer.
  • the lipid nanoparticles comprise a lipid bilayer.
  • the lipid nanoparticles comprise a therapeutic agent and/or imaging agent.
  • the lipid nanoparticles coat, encapsulate, package, and/or encompass a therapeutic agent and/or imaging agent.
  • the lipid nanoparticles of the instant invention are typically round or spherically shaped.
  • the diameter or longest dimension of the lipid nanoparticle is about 10 to about 500 nm, about 20 nm to about 400 nm, about 20 nm to about 300 nm, about 50 nm to about 200 nm, about 50 nm to about 150 nm, about 75 nm to about 200 nm, about 75 nm to about 150 nm, about 75 nm to about 125 nm, or about 100 nm.
  • the lipid nanoparticles comprise cationic lipids, anionic lipids, zwitterionic lipids, and/or non-polar lipids.
  • the lipids may be linked or conjugated to other agents or compounds such as, without limitation, polymers (e.g., PEG).
  • the lipid nanoparticles comprise PEG-lipid conjugates. Any lipid or combination of lipids that are known in the art can be used to produce the lipid nanoparticles of the instant invention.
  • cationic lipids include, without limitation: 1,2-di-O-octadecenyl- 3 -trimethylammonium propane (DOTMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), didodecyldimethylammonium bromide (DDAB), N,N- dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1 ,2-dilinoleyloxy-N,N- dimethylaminopropane (DLinDMA), l,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), l,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1, 2-dilinoley oxy-3 -(dimethylamino)acetoxypropane (DLinDAC), 1, 2-dilinoley oxy-3
  • zwitterionic lipids include, without limitation: distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dioleoyl- phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane-l -carboxylate (DOPE-mal), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 16-0-monom ethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, l-stearoyl-2-oleoyl-phosphatidy ethanolamine (SOPE), distearoylphosphatidylcholine (DPSC), di
  • anionic lipids include, without limitation: phosphatidylglycerols (PG), phosphatidic acid, and phosphatidylinositol phosphates.
  • PG phosphatidylglycerols
  • phosphatidic acid phosphatidic acid
  • phosphatidylinositol phosphates examples include, without limitation: phosphatidylglycerols (PG), phosphatidic acid, and phosphatidylinositol phosphates.
  • non-polar lipids include, without limitation: glycerides (mono, di, and triglycerides) and other non-charged lipids.
  • the lipids are modified or conjugated to other molecules.
  • the lipid e.g., a zwitterionic lipid
  • the polymer is polyethylene glycol (PEG). While the present application generally refers to PEG-lipid conjugates, other polymers can be used in place of PEG.
  • the PEG has a molecular weight from about 200 g/mol to 10,000 g/mol. In certain embodiments, the PEG has a molecular weight from about 200 g/mol to 1,000 g/mol. In certain embodiments, the PEG has a molecular weight from about 200 g/mol to 800 g/mol.
  • the PEG has a molecular weight from about 1,000 g/mol to 3,000 g/mol. In certain embodiments, the PEG has a molecular weight from about 1,500 g/mol to 2,500 g/mol. In certain embodiments, the PEG has a molecular weight from about 1,800 g/mol to 2,200 g/mol. In certain embodiments, the PEG is selected from the group consisting of: PEG200, PEG300, PEG400, PEG600, PEG1000, PEG2000, PEG3000, PEG6000, and PEG8000. In certain embodiments, the PEG has from about 30 to 50 repeating units, about 35 to 50 repeating units, or about 35 to 45 repeating units.
  • PEG-lipid conjugates include, without limitation: PEG-CerC14, PEG-CerC20, DMG-PEG, DSPE-PEG, and DMP-PEG.
  • the lipid is conjugated to PEG 2000.
  • the lipid nanoparticles of the instant invention may comprise 1, 2, 3, 4, 5, or more of the lipids recited hereinabove.
  • the lipid nanoparticle of the present invention comprises at least one type of cationic lipid.
  • the lipid nanoparticle comprises at least one type of zwitterionic lipid.
  • the lipid nanoparticle comprises only zwitterionic lipids.
  • the lipid nanoparticle of the present invention comprises at least one PEG-lipid conjugate (e.g., a PEG-zwitterionic lipid conjugate).
  • the lipid nanoparticles comprise 1,2-distearoyl- sn-glycero-3 -phosphoethanolamine (DSPE).
  • the lipid nanoparticles comprise a phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the lipid nanoparticles comprise a phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the lipid nanoparticles comprise phosphatidylcholine.
  • the lipid nanoparticles comprise 1) DSPE and 2) phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the lipid nanoparticles comprise 1) DSPE and 2) phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the lipid nanoparticles comprise DSPE and phosphatidylcholine. In certain embodiments, the lipid nanoparticles further comprise cholesterol.
  • the lipid nanoparticles of the present invention further comprise a C-C chemokine receptor type 5 (CCR5 or CD 195) targeting moiety or ligand.
  • CCR5 targeting moi eties specifically bind CCR5.
  • Examples of CCR5 targeting moi eties include, without limitation: maraviroc, aplaviroc, vicriviroc, INCB009471 ((4,6- dimethylpyrimidin-5-yl)-[4-[(3S)-4-[(lR,2R)-2-ethoxy-5-(trifluoromethyl)-2,3- dihydro-lH-inden-l-yl]-3-methylpiperazin-l-yl]-4-methylpiperidin-l- yl]methanone), leronlimab, and the peptide Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr (SEQ ID NO: 1).
  • the peptide is D-Ala-peptide T-amide (DAPTA)
  • the CCR5 targeting moiety is linked to a lipid of the lipid nanoparticle. In certain embodiments, the CCR5 targeting moiety is on the exterior of the lipid nanoparticle. In certain embodiments, the CCR5 targeting moiety is linked (e.g., directly or via a linker) to any chemically available position on the surface of the lipid nanoparticle. In certain embodiments, the CCR5 targeting moiety is conjugated to a PEG-lipid conjugate (e.g., a PEG-zwitterionic lipid conjugate), particularly via the PEG moiety. In certain embodiments, the CCR5 targeting moiety is conjugated to DSPE-PEG. In certain embodiments, the CCR5 targeting moiety is the peptide D-ASTTTNYT-NH2 (SEQ ID NO: 1) conjugated to DSPE-PEG.
  • the lipid nanoparticle of the present invention comprises DSPE-PEG (e.g., DSPE-PEG2000). In certain embodiments, the lipid nanoparticle of the present invention further comprises phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the lipid nanoparticle of the present invention further comprises phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the lipid nanoparticle of the present invention further comprises phosphatidylcholine.
  • the lipid nanoparticle of the present invention further comprises DSPE-PEG (e.g., DSPE- PEG2000) conjugated to a CCR5 targeting moiety.
  • the lipid nanoparticle of the present invention further comprises DSPE-PEG-CCR5 peptide.
  • the lipid nanoparticle of the present invention further comprises a therapeutic agent.
  • the therapeutic agent is rilpivirine.
  • the lipid nanoparticle of the present invention further comprises an imaging agent.
  • the imaging agent is CuInEuS?.
  • the imaging agent is a cyanine (e.g., Cy5.5).
  • the lipid nanoparticle of the instant invention comprises about 25% to 65% of a zwitterionic lipid by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 35% to 55% of a zwitterionic lipid by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 40% to 50% of a zwitterionic lipid by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 45% of a zwitterionic lipid by weight (wt %).
  • the zwitterionic lipid is phosphatidyl serine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the zwitterionic lipid is phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the zwitterionic lipid is phosphatidylcholine.
  • the lipid nanoparticle of the instant invention comprises about 5% to 35% of a PEG-lipid conjugate by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 10% to 30% of PEG-lipid conjugate by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 15% to 25% of PEG-lipid conjugate by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 20% of PEG-lipid conjugate by weight (wt %). In certain embodiments, the PEG-lipid conjugate is DSPE-PEG. In certain embodiments, the PEG-lipid conjugate is DSPE-PEG2000.
  • the lipid nanoparticle of the instant invention comprises about 0.05% to 5% of a PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.1% to 2.5% of PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.25% to 1% of PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.5% of PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %).
  • the PEG-lipid conjugate linked to a CCR5 targeting moiety is DSPE-PEG-CCR5 peptide. In certain embodiments, the PEG-lipid conjugate is DSPE-PEG2000-CCR5 peptide.
  • the lipid nanoparticle of the instant invention comprises about 15% to 55% of a therapeutic agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 25% to 45% of a therapeutic agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 30% to 40% of a therapeutic agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 35% of a therapeutic agent by weight (wt %). In certain embodiments, the therapeutic agent is rilpivirine.
  • the lipid nanoparticle of the instant invention comprises about 0.1% to 10% of an imaging agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.5% to 5% of an imaging agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 1% to 3% of an imaging agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 1.5% of an imaging agent by weight (wt %). In certain embodiments, the imaging agent is CuInEuS?.
  • the lipid nanoparticle comprises a zwitterionic lipid (e.g., PC), a PEG-lipid conjugate (e.g., DSPE-PEG), a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide), and a therapeutic agent (e.g., rilpivirine).
  • a zwitterionic lipid e.g., PC
  • a PEG-lipid conjugate e.g., DSPE-PEG
  • a PEG-lipid conjugate linked to a CCR5 targeting moiety e.g., DSPE-PEG-CCR5 peptide
  • a therapeutic agent e.g., rilpivirine
  • the lipid nanoparticle comprises a zwitterionic lipid (e.g., PC), a PEG-lipid conjugate (e.g., DSPE-PEG), a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide), and an imaging agent (e.g., CuInEuS?).
  • a zwitterionic lipid e.g., PC
  • a PEG-lipid conjugate e.g., DSPE-PEG
  • a PEG-lipid conjugate linked to a CCR5 targeting moiety e.g., DSPE-PEG-CCR5 peptide
  • an imaging agent e.g., CuInEuS?
  • the lipid nanoparticle comprises a zwitterionic lipid (e.g., PC), a PEG-lipid conjugate (e.g., DSPE-PEG), a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide), a therapeutic agent (e.g., rilpivirine), and an imaging agent (e.g., CuInEuS?).
  • a zwitterionic lipid e.g., PC
  • a PEG-lipid conjugate e.g., DSPE-PEG
  • a PEG-lipid conjugate linked to a CCR5 targeting moiety e.g., DSPE-PEG-CCR5 peptide
  • a therapeutic agent e.g., rilpivirine
  • an imaging agent e.g., CuInEuS?
  • the lipid nanoparticle comprises: a) a zwitterionic lipid (e.g., PC) in an amount of about 35% to 55% by weight; b) a PEG- lipid conjugate (e.g., DSPE-PEG) in an amount of about 10% to 30% by weight; c) a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide) in an amount of about 1% to about 2.5% by weight; and d) a therapeutic agent (e.g., rilpivirine) in an amount of about 25% to 45% by weight and/or an imaging agent (e.g., CuInEuS?) in an amount of about 0.5% to 5% by weight, wherein the total weight percentage does not exceed 100%.
  • a zwitterionic lipid e.g., PC
  • a PEG- lipid conjugate e.g., DSPE-PEG
  • the lipid nanoparticles further comprise a therapeutic agent and/or imaging agent.
  • the lipid nanoparticles coat, package, encapsulate, and/or encompass a therapeutic agent and/or imaging agent.
  • the therapeutic agent and/or imaging agent is contained within the interior of the lipid nanoparticle and/or within a lipid layer of the lipid nanoparticle.
  • the therapeutic agent and/or imaging agent is linked or conjugated to a lipid of the lipid nanoparticle (e.g., conjugated to a PEG-lipid conjugate).
  • the imaging agents of the instant invention may be molecular imaging agents and/or diagnostic agents.
  • the imaging agent is detectable by flow cytometry, single-photon emission computed tomography (SPECT), computed tomography (CT), positron emission tomography (PET), in vivo imaging system (IVIS), confocal microscopy imaging, or magnetic resonance imaging (MRI).
  • the imaging agents are PET, SPECT, CT, and/or MRI imaging agents.
  • the imaging agent is a nuclear medicine agent (e.g., PET or SPECT radioisotopes).
  • the imaging agent is an MRI contrast agent.
  • the imaging agent is a fluorescent dye.
  • imaging agents include, without limitation: optical imaging agents (e.g., near IR dyes (e.g., IRDye 800CW), phorphyrins, anthraquinones, anthrapyrazoles, perylenequinones, xanthenes, cyanines, acridines, phenoxazines, phenothiazines and derivatives thereof), fluorescent compounds (e.g., Alexa Fluor® dyes (e.g., Alexa Fluor® 488), fluorescein, rhodamine, Cy3, Cy5, Cy5.5, Dil, DiO, DID and derivatives thereof), chromophores, paramagnetic or superparamagnetic ions (e g., Gd(III), Eu(III), Dy(III), Pr(III), Pa(IV), Mn(II), Cr(III), Co(III), Fe(III), Cu(II), Ni(II), Ti(III), and V(IV)), magnetic resonance imaging (MRI) contrast agents (e.
  • the fluorescent imaging agent is DiD (DiIC18 (5); l,l'-dioctadecyl-3, 3, 3', 3'- tetramethylindodicarbocyanine, 4- chlorobenzenesulfonate salt).
  • the imaging agent is a radiolabeled europium doped cobalt ferrite (CFEu) nanoparticle (e.g., 177 Lu/ 89 ZrCFEu nanoparticle).
  • the imaging agent is CulnEuS?.
  • the imaging agent is a cyanine (e.g., Cy5.5).
  • the therapeutic agents of the instant invention may be antiviral agents.
  • the therapeutic agent is an antiretroviral agent.
  • the therapeutic agent is a non-nucleoside reverse transcriptase inhibitor, nucleoside reverse transcriptase inhibitor, protease inhibitor, fusion inhibitor, or integrase inhibitor.
  • the therapeutic agent is rilpivirine (RPV).
  • Therapeutic agents of the instant invention include, but are not limited to: small molecules, peptides, proteins, nucleoside and nucleotide analogs, prodrugs, nanoformulated drugs (such as nanoformulated antiretroviral compounds), and DNA and/or RNA based molecules such as siRNAs, miRNAs, antisense, and CRISPR/Cas9 constructs including, for example, gRNA.
  • therapeutic agents include, but are not limited to, compounds disclosed in WO 2017/223280, WO 2020/086555, WO 2016/057866, WO 2019/140365, WO 2019/199756, and WO 2020/112931, each incorporated by reference herein.
  • the therapeutic agents may be antiviral agents.
  • Antiretroviral agents may be effective against or specific to lentiviruses.
  • Lentiviruses include, without limitation, human immunodeficiency virus (HIV) (e.g., HIV-1, HIV-2), bovine immunodeficiency virus (BIV), feline immunodeficiency virus (FIV), simian immunodeficiency virus (SIV), and equine infectious anemia virus (EIA).
  • HIV human immunodeficiency virus
  • BIV bovine immunodeficiency virus
  • FIV feline immunodeficiency virus
  • SIV simian immunodeficiency virus
  • EIA equine infectious anemia virus
  • the therapeutic agent is an anti-HIV agent.
  • An anti-HIV agent may be a compound which inhibits HIV, such as, for example, by inhibiting HIV replication and/or infection. Examples of anti-HIV agents include, without limitation:
  • NRTIs Nucleoside reverse transcriptase inhibitors
  • NRTIs refer to nucleosides and nucleotides and analogues thereof that inhibit the activity of reverse transcriptase, particularly HIV-1 reverse transcriptase.
  • NRTIs typically comprise a sugar and base.
  • nucleoside-analog reverse transcriptase inhibitors include, without limitation, adefovir dipivoxil, adefovir, lamivudine, telbivudine, entecavir, tenofovir, stavudine, abacavir, didanosine, emtricitabine, zalcitabine, and zidovudine.
  • NNRTIs Non-nucleoside reverse transcriptase inhibitors (NNRTIs).
  • NNRTIs bind to and block reverse transcriptase, particularly the HIV reverse transcriptase.
  • NNRTI may be allosteric inhibitors which bind (e.g., reversibly) at a nonsubstratebinding site on reverse transcriptase (e.g., thereby altering the shape of the active site or blocking polymerase activity).
  • NNRTIs include, without limitation, delavirdine (DLV, BHAP, U-90152; Rescriptor®), efavirenz (EFV, DMP-266, SUSTIVA®), nevirapine (NVP, Viramune®), PNU- 142721, capravirine (S-l 153, AG-1549), emivirine (+)-calanolide A (NSC-675451) and B, etravirine (ETR, TMC-125, Intelence®), rilpivirne (RPV, TMC278, EdurantTM), DAPY (TMC120), doravirine (PifeltroTM), BILR-355 BS, PHI-236, and PHI-443 (TMC- 278).
  • DLV delavirdine
  • BHAP U-90152
  • Rescriptor® efavirenz
  • EFP nevirapine
  • NNP Viramune®
  • PNU- 142721 capravirine (
  • Protease inhibitors are inhibitors of a viral protease, particularly the HIV-1 protease.
  • protease inhibitors include, without limitation, darunavir, amprenavir (141W94, AGENERASE®), tipranivir (PNU-140690, APTIVUS®), indinavir (MK-639; CRIXIVAN®), saquinavir (INVIRASE®, FORTOVASE®), fosamprenavir (LEXIVA®), lopinavir (ABT- 378), ritonavir (ABT-538, NORVIR®), atazanavir (REYATAZ®), nelfinavir (AG- 1343, VIRACEPT®), lasinavir (BMS-234475/CGP-61755), BMS-2322623, GW- 640385X (VX-385), AG-001859, and SM-309515.
  • Fusion or entry inhibitors are compounds, such as peptides, which block HIV entry into a cell (e.g., by binding to HIV envelope protein and blocking the structural changes necessary for the virus to fuse with the host cell).
  • fusion inhibitors include, without limitation, CCR5 receptor antagonists (e.g., maraviroc (Selzentry®, Celsentri)), enfuvirtide (INN, FUZEON®), T-20 (DP-178, FUZEON®) and T-1249.
  • Integrase inhibitors are a class of antiretroviral drug designed to block the action of integrase (e.g., HIV integrase), a viral enzyme that inserts the viral genome into the DNA of the host cell.
  • integrase inhibitors include, without limitation, cabotegravir (CAB), raltegravir (RAL), elvitegravir (EVG), dolutegravir (DTG), bictegravir (BIC), BI 224436, and MK-2048.
  • Anti-HIV compounds also include maturation inhibitors (e.g., bevirimat). Maturation inhibitors are typically compounds which bind HIV Gag and disrupt its processing during the maturation of the virus. Anti-HIV compounds also include HIV vaccines such as, without limitation, ALVAC® HIV (vCP1521), AIDSVAX®B/E (gpl20), and combinations thereof. Anti-HIV compounds also include HIV antibodies (e.g., antibodies against gpl20 or gp41), particularly broadly neutralizing antibodies.
  • maturation inhibitors e.g., bevirimat
  • Maturation inhibitors are typically compounds which bind HIV Gag and disrupt its processing during the maturation of the virus.
  • Anti-HIV compounds also include HIV vaccines such as, without limitation, ALVAC® HIV (vCP1521), AIDSVAX®B/E (gpl20), and combinations thereof.
  • Anti-HIV compounds also include HIV antibodies (e.g., antibodies against gpl20 or gp41), particularly broadly neutralizing antibodies.
  • anti-HIV agents More than one anti-HIV agent may be used, particularly where the agents have different mechanisms of action (as outlined above).
  • anti-HIV agents which are not NNRTIs may be combined with NNRTI drugs.
  • the anti-HIV agents include agents used in highly active antiretroviral therapy (HA ART).
  • the therapeutic can be a prodrug or nanoformulated drug.
  • prodrugs and nanoformulated drugs include long acting formulations of antiretrovirals and include those described in PCT/US2019/063498, PCT/US2019/057406, WO 2019/199756, WO 2019/140365, U.S. Patent Application No. 16/304,759, each of the foregoing incorporated by reference herein.
  • the therapeutic agent is a gene editing tool.
  • the lipid nanoparticles of the instant invention comprise at least one gene editing tool.
  • the therapeutic agent may be a gene editing tool to excise or delete all or part of the viral genome within a cell, particularly the HIV-1 genome, particularly the integrated HIV-1 genome.
  • the viral genome can be edited, excised, or deleted using any method known in the art such as, without limitation: zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), clustered regularly interspaced short palindromic repeats (CRISPRs), and meganucleases.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator like effector nucleases
  • CRISPRs clustered regularly interspaced short palindromic repeats
  • meganucleases is utilized.
  • CRISPR Clustered, regularly interspaced, short palindromic repeat
  • Cas9 e.g., from Streptococcus pyogenes
  • CRISPR Clustered, regularly interspaced, short palindromic repeat
  • Cas9 e.g., from Streptococcus pyogenes
  • gene editing are well known in the art (see, e.g., Shi et al. (2015) Nat. Biotechnol., 33(6):661-7; Sander et al. (2014) Nature Biotech., 32:347-355; Jinek et al. (2012) Science, 337:816-821; Cong et al. (2013) Science 339:819-823; Ran et al. (2013) Nature Protocols 8:2281-2308; Mali et al. (2013) Science 339:823-826; Sapranauskas et al.
  • CRISPR Clustered, regularly interspaced, short palindromic repeat
  • Cas9
  • RNA-guided CRISPR/Cas9 system involves using Cas9 along with a guide RNA molecule (gRNA). Guidelines and computer-assisted methods for generating gRNAs are available and well known in the art (see, e.g, CRISPR Design Tool (crispr.mit.edu); Hsu et al. (2013) Nat. Biotechnol.
  • gRNAs bind and recruit Cas9 to a specific target sequence (e.g., viral genome) where it mediates a double strand DNA (dsDNA) break. More than one gRNA (e.g., two) may be administered to make multiple breaks within the target nucleic acid. The double strand break can be repaired by non-homologous end joining (NHEJ) pathway yielding a deletion of the target nucleic acid.
  • NHEJ non-homologous end joining
  • the Cas protein is a Cas9, CasPhi (Cas ⁇ I>), Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl Csy2, Csy3, CaslO, Csm2, Cmr5, CaslO, Csxl 1, CsxlO, Csfl, Csn2, Cas4, C2cl, C2c3, Cas 12a (Cpfl), Cas 12b, Casl2e, Cas 13 a, Cas 13, Cas 13c, or Cas 13d.
  • Streptococcus pyogenes Cas9 Cas9 D10A
  • high fidelity Cas9 KI einstiver et al. (2016) Nature, 529:490-495; Slaymaker et al. (2016) Science, 351 :84-88
  • Cas9 nickase Cas9 with altered PAM specificities (e.g., SpCas9_VQR, SpCas9_EQR, and SpCas9_VRER; Kleinstiver et al.
  • the Cas9 is S. pyogenes Cas9.
  • the binding specificity of the CRISPR/Cas9 complex depends on two different elements. First, the binding complementarity between the targeted sequence (e.g., viral genome) and the complementary recognition sequence of the gRNA (e.g., -18-22 nucleotides, particularly about 20 nucleotides). Second, the presence of a protospacer-adjacent motif (PAM) juxtaposed to the target DNA/gRNA complementary region (Jinek et al. (2012) Science 337:816-821; Hsu et al. (2013) Nat. Biotech., 31 :827-832; Sternberg et al. (2014) Nature 507:62-67). The PAM motif for S.
  • PAM protospacer-adjacent motif
  • Pyogenes Cas9 has been fully characterized, and is NGG or NAG (Jinek et al. (2012) Science 337:816-821; Hsu et al. (2013) Nat. Biotech., 31 : 827-832).
  • Other PAMs of other Cas9 proteins are also known (see, e.g., addgene.org/crispr/guide/ #pam-table). Examples of PAM sequences include, without limitation: S. pyogenes (spCas9) - NGG; S.
  • aureus Cas9 (saCas9) - NNGRRT or NGRRN; Neisseria meningitidis (NmeCas9) -NNNNGATT; Campylobacter jejuni (CjCas9) - NNNNRYAC; Streptococcus thermophilus (StCas9) - NNAGAAW; Lachnospiraceae bacterium (LbCpfl) - TTTV; and Acidaminococcus sp. (AsCpfl) - TTTV.
  • the PAM sequence is 3’ of the target sequence in the genomic sequence.
  • the guide RNA may comprise separate nucleic acid molecules wherein one RNA may specifically hybridize to a target sequence (crRNA) and another RNA (trans-activating crRNA (tracrRNA)) specifically hybridizes with the crRNA.
  • the crRNA and a tracrRNA may be bound together.
  • the gRNA binds to a Cas enzyme (e.g., Cas9) and guides the Cas enzyme to the target sequence.
  • Cas enzyme e.g., Cas9
  • the term “crRNA” means a non-coding short RNA sequence which binds to a complementary target DNA sequence.
  • the crRNA sequence may bind to a Cas enzyme (e.g., Cas9) and the crRNA sequence guides the complex via pairing to a specific target DNA sequence.
  • tracrRNA or transactivating CRISPR RNA means an RNA sequence that base pairs with the crRNA (e.g., a scaffold sequence to form a functional guide RNA (gRNA)).
  • the tracrRNA sequence binds to a Cas enzyme (e.g., Cas9), while the crRNA sequence of the gRNA directs the complex to a target sequence.
  • Cas enzyme e.g., Cas9
  • Any suitable tracrRNA sequence is contemplated for use with a gRNA disclosed herein (e.g., 5’-GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGUC CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGCUUUU; SEQ ID NO: 18).
  • the guide RNA is a single molecule (sgRNA) which comprises a sequence (crRNA; complementary sequence) which specifically hybridizes (e.g., complete complementary) with a target sequence and a sequence (e.g., a tracrRNA sequence; scaffold sequence) recognized by Cas9, which are well known in the art.
  • sgRNA is a single RNA construct comprising a crRNA sequence and a tracrRNA sequence.
  • gRNA is generally used herein to encompass sgRNA unless the context clearly dictates otherwise. The greater the complementarity reduces the likelihood of undesired cleavage events at other sites of the genome.
  • the region of complementarity (e.g., between a guide RNA (or crRNA) and a target sequence) is at least about 10, at least about 12, at least about 15, at least about 17, at least about 20, at least about 25, at least about 30, at least about 35, or more nucleotides.
  • the region of complementarity (e.g., between a guide RNA and a target sequence) is about 15 to about 25 nucleotides, about 15 to about 23 nucleotides, about 16 to about 23 nucleotides, about 17 to about 21 nucleotides, about 18 to about 22 nucleotides, or about 20 nucleotides.
  • the guide RNA targets a sequence or comprises a sequence (e.g., RNA version) which has at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity to the target sequence.
  • the gRNA targets (and inactivates or deletes) all or part of integrated HIV-1 DNA.
  • the gRNA targets (and inactivates or deletes) all or part of the transactivator of transcription (tat) gene.
  • at least two different gRNA (or crRNA) are used.
  • one gRNA may target the transactivator of transcription (tat) gene and the other gRNA (or crRNA) may target another region of the integrated HIV-1 genome (e.g., a region other than LTR).
  • the CRISPR and gRNA are selected from those described in Dash et al. (Nat. Comm. (2019) 10( 1 ):2753 or WO 2021/178924), each incorporated by reference herein.
  • the gRNA or crRNA may be constructed from a multiple sequence alignment of separate viral strains and/or bind to a plurality of nucleic acids of an overlapping exon.
  • the overlapping exon is part of a nucleic acid sequence of at least two HIV genes (e.g., HIV-1 genes).
  • the HIV (e.g., HIV-1) genes are selected from the group consisting of: tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef.
  • the overlapping exon is part of a nucleic acid sequence of at least three HIV (e.g., HIV-1) genes selected from the group consisting of: tat, rev, env- gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef.
  • HIV e.g., HIV-1
  • the overlapping exon is part of a nucleic acid sequence of HIV (e.g., HIV-1) genes tat, rev, and env.
  • the crRNA or gRNA comprises one of the following nucleic acid sequences and/or targets the indicated sequence:
  • UAGAUCCUAACCUAGAGCCC (SEQ ID NO: 2; TatA 2 ), wherein the target DNA complementary sequence is TAGATCCTAACCTAGAGCCC (SEQ ID NO: 3);
  • UCUCCGCUUCUUCCUGCCAU (SEQ ID NO: 12; TatG), wherein the target DNA complementary sequence is TCTCCGCTTCTTCCTGCCAT (SEQ ID NO: 13);
  • GGCUCUAGGUUAGGAUCUAC (SEQ ID NO: 16; Tati), wherein the target DNA complementary sequence is GGCTCTAGGTTAGGATCTAC (SEQ ID NO: 17).
  • the crRNA or gRNA comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 97% identical to one of the sequences set forth above (e.g., SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, or 16).
  • the lipid nanoparticle comprises at least one Cas (e.g., the protein and/or a nucleic acid molecule encoding Cas) and at least one gRNA, crRNA, and/or tracrRNA or a nucleic acid molecule encoding the gRNA, crRNA, and/or tracrRNA.
  • the lipid nanoparticle comprises at least one gRNA, crRNA, and/or tracrRNA or a nucleic acid molecule encoding the gRNA, crRNA, and/or tracrRNA (e.g., the Cas or a nucleic acid molecule encoding Cas can be delivered separately).
  • the crRNA, gRNA, tracrRNA, and/or nucleic acid sequence encoding the Cas protein is part of any suitable delivery vehicle.
  • the delivery vehicle is a plasmid.
  • the delivery vehicle is a viral vector.
  • the nucleic acid sequence encoding the Cas protein is contained in a viral vector.
  • the viral vector is an adenovirus, an adeno-associated virus (AAV), a retrovirus, or a herpesvirus.
  • the viral vector is an adeno-associated virus (AAV), such as AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV- 8, AAV-9, AAV- 10, AAV-11, AAV-12, AAV-13 or AAV rh.74.
  • AAV adeno-associated virus
  • compositions comprising at least one lipid nanoparticle of the instant invention and at least one carrier (e.g., pharmaceutically acceptable carrier).
  • the lipid nanoparticles may comprise more than one therapeutic and/or imaging agent.
  • the pharmaceutical composition comprises a first lipid nanoparticle comprising a first therapeutic and a second lipid nanoparticles comprising a second therapeutic, wherein the first and second therapeutics are different.
  • the pharmaceutical composition comprises a first lipid nanoparticle comprising a first imaging agent and a second lipid nanoparticle comprising a second imaging agent, wherein the first and second imaging agents are different.
  • the pharmaceutical composition comprises a first lipid nanoparticle comprising a therapeutic agent and a second lipid nanoparticle comprising an imaging agent.
  • the compositions (e.g., pharmaceutical compositions) of the instant invention may further comprise (e.g., not contained within the lipid nanoparticles) other therapeutic agents (e.g., other anti-HIV compounds).
  • the lipid nanoparticles of the instant invention may be used to deliver at least one therapeutic and/or imaging agent to a cell or a subject (including non-human animals).
  • the present invention also encompasses methods for preventing (e.g., prophylactically protecting), inhibiting, and/or treating and/or tracking or monitoring (e.g., in real time) a viral infection, particularly an HIV infection.
  • the methods comprise administering lipid nanoparticles of the instant invention (optionally in a composition) to a subject in need thereof.
  • the methods may further comprise (in the context of tracking and/or monitoring the viral infection) detecting the molecular imaging agent (e.g., in said subject).
  • Monitoring and tracking the viral infection can also be used for tracking the effectiveness of a therapy. Monitoring and tracking the viral infection can also be used for detecting, monitoring, and/or observing HIV viral reservoirs.
  • the lipid nanoparticles of the present invention contain both a therapeutic and a molecular imaging agent and allows for both treating and imaging the viral infection.
  • the methods further comprise disrupting the blood brain barrier.
  • the methods further comprise administering an agent or therapy to disrupt the blood brain barrier of the subject (e.g., prior to, after, and/or at same time as the administration of lipid nanoparticles).
  • the method further comprises administering ultrasound (e.g., focused ultrasound) to the subject (e.g., to the brain or blood brain barrier), optionally with the administration of microbubbles (e.g., intravenously).
  • Viral infections to be treated and/or monitored by the instant invention include, but are not limited to infections by: HIV, flavivirus, togaviruses, non-HIV retroviruses, lentiviruses, coronaviruses, orthomyxoviruses, paramyxovirus, rhabdoviruses, filoviruses, arenaviruses, bunyaviruses, and delta viruses.
  • the viral infection is a retroviral infection or a lentiviral infection.
  • the viral infection is a HIV infection.
  • the lipid nanoparticles of the instant invention can be administered to an animal, in particular a mammal, more particularly a human, in order to treat/inhibit/prevent the viral infection (e.g., a retroviral infection such as an HIV infection).
  • the pharmaceutical compositions of the instant invention may also comprise at least one other therapeutic agent such as an antiviral agent, particularly at least one other anti-HIV compound/agent.
  • the additional anti-HIV compound may also be administered in a separate pharmaceutical composition from the lipid nanoparticles or compositions of the instant invention.
  • the pharmaceutical compositions may be administered at the same time or at different times (e.g., sequentially).
  • the dosage ranges for the administration of the lipid nanoparticles and/or compositions of the invention are those large enough to produce the desired effect (e.g., curing, relieving, treating, and/or preventing the viral infection (e.g., HIV infection), the symptoms of it (e.g., AIDS, ARC), or the predisposition towards it).
  • the dosage should not be so large as to cause significant adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like.
  • the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art.
  • the dosage can be adjusted by the individual physician in the event of any counter indications.
  • lipid nanoparticles described herein will generally be administered to a patient as a pharmaceutical composition.
  • patient refers to human or animal subjects. These lipid nanoparticles may be employed therapeutically, under the guidance of a physician.
  • compositions comprising the lipid nanoparticles of the instant invention may be conveniently formulated for administration with any pharmaceutically acceptable carrier(s).
  • the complexes may be formulated with an acceptable medium such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents, or suitable mixtures thereof, particularly an aqueous solution.
  • concentration of the lipid nanoparticles in the chosen medium may be varied and the medium may be chosen based on the desired route of administration of the pharmaceutical composition. Except insofar as any conventional media or agent is incompatible with the lipid nanoparticles to be administered, its use in the pharmaceutical composition is contemplated.
  • the dose and dosage regimen of lipid nanoparticles according to the invention that are suitable for administration to a particular patient may be determined by a physician considering the patient’s age, sex, weight, general medical condition, and the specific condition for which the lipid nanoparticles are being administered and the severity thereof.
  • the physician may also take into account the route of administration, the pharmaceutical carrier, and the lipid nanoparticle’s biological activity.
  • lipid nanoparticles of the invention may be administered by direct injection or intravenously.
  • a pharmaceutical composition comprises the lipid nanoparticles dispersed in a medium that is compatible with the site of injection.
  • Lipid nanoparticles of the instant invention may be administered by any method.
  • the lipid nanoparticles of the instant invention can be administered, without limitation parenterally, subcutaneously, orally, topically, pulmonarily, rectally, vaginally, intravenously, intraperitoneally, intrathecally, intracerbrally, epidurally, intramuscularly, intradermally, or intracarotidly.
  • Lipid nanoparticles of the present invention may be administered to a subject in need by any appropriate route including but not limited to enteral, gastroenteral, oral, transdermal, subcutaneous, nasal, intravenous, intravenous bolus, intravenous drip, intraarterial, intramuscular, transmucosal, insufflation, sublingual, buccal, conjunctival, cutaneous, and intrathecal.
  • the lipid nanoparticles are administered parenterally.
  • the lipid nanoparticles are administered orally, intramuscularly, subcutaneously, or to the bloodstream (e.g., intravenously).
  • the lipid nanoparticles are administered intramuscularly or subcutaneously.
  • compositions for injection are known in the art. If injection is selected as a method for administering the lipid nanoparticles, steps must be taken to ensure that sufficient amounts of the molecules or cells reach their target cells to exert a biological effect. Dosage forms for parenteral administration include, without limitation, solutions, emulsions, suspensions, dispersions and powders/granules for reconstitution.
  • compositions containing lipid nanoparticles of the present invention as the active ingredient in intimate admixture with a pharmaceutically acceptable carrier can be prepared according to conventional pharmaceutical compounding techniques.
  • the carrier may take a wide variety of forms depending on the form of pharmaceutical composition desired for administration, e.g., intravenous, oral, direct injection, intracranial, and intravitreal.
  • a pharmaceutical composition of the invention may be formulated in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form refers to a physically discrete unit of the pharmaceutical composition appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art.
  • Dosage units may be proportionately increased or decreased based on the weight of the patient. Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art.
  • the appropriate dosage unit for the administration of lipid nanoparticles may be determined by evaluating the toxicity of the molecules or cells in animal models. Various concentrations of lipid nanoparticles in pharmaceutical composition may be administered to mice, and the minimal and maximal dosages may be determined based on the beneficial results and side effects observed as a result of the treatment. Appropriate dosage unit may also be determined by assessing the efficacy of the lipid nanoparticle treatment in combination with other standard drugs. The dosage units of lipid nanoparticles may be determined individually or in combination with each treatment according to the effect detected.
  • the pharmaceutical composition comprising the lipid nanoparticles may be administered at appropriate intervals until the pathological symptoms are reduced or alleviated, after which the dosage may be reduced to a maintenance level. The appropriate interval in a particular case would normally depend on the condition of the patient.
  • “Pharmaceutically acceptable” indicates approval by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • a “carrier” refers to, for example, a diluent, adjuvant, preservative (e.g., Thimersol, benzyl alcohol), anti-oxidant (e.g., ascorbic acid, sodium metabisulfite), solubilizer (e.g., polysorbate 80), emulsifier, buffer (e.g., Tris HC1, acetate, phosphate), antimicrobial, bulking substance (e.g., lactose, mannitol), excipient, auxiliary agent or vehicle with which an active agent of the present invention is administered.
  • Pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin.
  • Water or aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions.
  • Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin (Mack Publishing Co., Easton, PA); Gennaro, A. R., Remington: The Science and Practice of Pharmacy, (Lippincott, Williams and Wilkins); Liberman, et al., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y.; and Kibbe, et al., Eds., Handbook of Pharmaceutical Excipients, American Pharmaceutical Association, Washington.
  • prodrug refers to a compound that is metabolized or otherwise converted to a biologically active or more active compound or drug, typically after administration.
  • a prodrug, relative to the drug is modified chemically in a manner that renders it, relative to the drug, less active, essentially inactive, or inactive.
  • the chemical modification is such that the corresponding drug is generated by metabolic or other biological processes, typically after the prodrug is administered.
  • treat refers to any type of treatment that imparts a benefit to a patient afflicted with a disease, including improvement in the condition of the patient (e.g., in one or more symptoms), delay in the progression of the condition, etc.
  • the treatment of a viral infection results in at least an inhibition/reduction in the number of infected cells and/or detectable viral levels.
  • the term “prevent” refers to the prophylactic treatment of a subject who is at risk of developing a condition (e.g., viral infection) resulting in a decrease in the probability that the subject will develop the condition.
  • a condition e.g., viral infection
  • a “therapeutically effective amount” of a compound or a pharmaceutical composition refers to an amount effective to prevent, inhibit, treat, or lessen the symptoms of a particular disorder or disease.
  • the treatment of a viral infection herein may refer to curing, relieving, and/or preventing the viral infection, the symptom(s) of it, or the predisposition towards it.
  • therapeutic agent refers to a chemical compound or biological molecule including, without limitation, nucleic acids, peptides, proteins, and antibodies that can be used to treat a condition, disease, or disorder or reduce the symptoms of the condition, disease, or disorder.
  • small molecule refers to a substance or compound that has a relatively low molecular weight (e.g., less than 4,000, less than 2,000, particularly less than 1 kDa or 800 Da).
  • small molecules are organic, but are not proteins, polypeptides, or nucleic acids, though they may be amino acids or dipeptides.
  • antimicrobials indicates a substance that kills or inhibits the growth of microorganisms such as bacteria, fungi, viruses, or protozoans.
  • antiviral refers to a substance that destroys a virus and/or suppresses replication (reproduction) of the virus.
  • an antiviral may inhibit and or prevent: production of viral particles, maturation of viral particles, viral attachment, viral uptake into cells, viral assembly, viral release/budding, viral integration, etc.
  • highly active antiretroviral therapy refers to HIV therapy with various combinations of therapeutics such as nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, HIV protease inhibitors, and fusion inhibitors.
  • amphiphilic means the ability to dissolve in both water and lipids/apolar environments.
  • an amphiphilic compound comprises a hydrophilic portion and a hydrophobic portion.
  • Hydrophilic designates a preference for apolar environments (e.g., a hydrophobic substance or moiety is more readily dissolved in or wetted by non-polar solvents, such as hydrocarbons, than by water).
  • Hydrophilic compounds are, for the most part, insoluble in water.
  • hydrophilic means the ability to dissolve in water.
  • polymer denotes molecules formed from the chemical union of two or more repeating units or monomers.
  • block copolymer most simply refers to conjugates of at least two different polymer segments, wherein each polymer segment comprises two or more adjacent units of the same kind.
  • antibody or “antibody molecule” is any immunoglobulin, including antibodies and fragments thereof (e.g., scFv), that binds to a specific antigen.
  • antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions of an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule.
  • immunologically specific refers to proteins/polypeptides, particularly antibodies, that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
  • Phorbol 12-myristate 13-acetate (PMA; P8138), 1-octanol, paraformaldehyde (PF A), were also obtained from Sigma Aldrich.
  • Dulbecco’s modified eagle’s medium (DMEM) containing glucose (4.5 g/L), phosphate-buffered saline (PBS), gentamicin, L-glutamine, sodium pyruvate, AcroMetrixTM EDTA Plasma Dilution Matrix (S2284) were purchased from Thermo Fisher Scientific/Gibco (Waltham, MA). Heat-inactivated pooled human serum was purchased from Alternative Biologies (Herndon, VA).
  • CTB Cell Titer BlueTM
  • CTB Promega (Madison, WI).
  • Rilpivirine RV; A904176 was purchased from Amadis Chemical (Zhejiang, China).
  • 1,20-distearoyl-phosphatidylethanolaminemethyl-polyethyleneglycol conjugate 2000 DSPE-PEG2000
  • DSPE-PEG2000 carboxy NHS DSPE- PEG2000
  • DSPE- PEG2000 1,20-distearoyl-phosphatidylethanolaminemethyl-polyethyleneglycol conjugate 2000
  • DSPE-PEG2000 1,20-distearoyl-phosphatidylethanolaminemethyl-polyethyleneglycol conjugate 2000
  • DSPE-PEG2000 1,20-distearoyl-phosphatidylethanolaminemethyl-polyethyleneglycol conjugate 2000
  • DSPE-PEG2000 carboxy NHS DSPE-PEG2000 carboxy NHS
  • the CCR5 targeting peptide, D-Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-NH2 (SEQ ID NO: 1) was purchased from P3 BioSystems (Louisville, KA).
  • the radioactive 64 copper chloride ( 64 CuCh) was requested and delivered from the Washington University School of Medicine MIR cyclotron facility (St. Louis, MO).
  • the multimodal nanoprobe particles were prepared by the solvothermal method. At first, the thioacetamide (15.026 mg, 2 mmol) and oleylamine (6 mL) were taken in a 20 mL glass vial, and the reaction mixture was sonicated for 2 minutes (operated at 20%, Cole-Parmer® 750 W model CPX750, IL). In a separate vial, indium (III) chloride dihydrate (22.118 mg, 1 mmol), europium (III) chloride hexahydrate (36.64 mg, 1 mmol), 1-octadecene (10 mL), and oleic acid (6 mL) were homogenized by vigorous stirring.
  • the homogeneous solution was transferred to the reaction mixture and further probe sonicated for 5 minutes. Subsequently, the copper (II) chloride dihydrate (34.09 mg, 2 mmol) was also added to the reaction mixture.
  • the reaction mixture was quickly transferred to the TeflonTM-lined hydrothermal autoclave and heated at 280°C for 8 hours. After the autoclave cooled down to room temperature, the crude reaction mixture was dispersed in ethanol (50 mL) by sonication. The solution was then spun down (950 x g for 30 minutes at 20°C) and the supernatant was decanted off. This ethanol -washing step was repeated thrice to remove unreacted starting materials. The particles were then stored in a desiccator for future use. To make the radioactive nanoprobe, the copper (II) chloride was substituted with radioactive copper (II)-64 chloride.
  • the bulk morphology and crystal lattice structure of the CuInEuS? nanoprobe were characterized by high-resolution transmission electron microscopy and selected area electron diffraction, respectively.
  • the elemental composition and chemical color mapping were analyzed by energy-dispersive X-ray spectroscopy and scanning transmission electron microscopy (STEM) with high-angle annular darkfield (HAADF) (FEI Tecnai OsirisTM S/TEM operated at 200 kV), respectively.
  • the nanoprobe’s surface composition and crystal structure were analyzed by XPS (Thermo Fisher Scientific, Waltham, MA) and powder XRD (Rigaku SmartLab Diffractometer, Rigaku Corporation, Tokyo, Japan).
  • the thermal property was analyzed by differential scanning calorimetry (NETZSCH DSC 204 Fl Phoenix®, Waldkraiburg, explanation, Germany) and thermogravimetric analysis (NETZSCH TGA 209 Fl Libra® system, Waldkraiburg, apparent, Germany).
  • a linear peptide with a sequence of D-Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr- NH2 was selected as a CCR5-receptor targeting ligand.
  • the free amine group of the peptide was conjugated with PEG lipid, DSPE-PEG2000 carboxy NHS via an activated acid-amine coupling reaction.
  • the reaction was conducted in a Schlenk tube by dissolving the peptide (3.57 mg, 4.15 pmol) in anhydrous DMSO (250 pL) followed by the addition of DIP A (10 pL).
  • LNPs formulation and their physicochemical properties LNPs were formulated by rapidly mixing the lipid and aqueous phases in the microfluidic device.
  • LNP-RPV-CCR5 L-a-phosphatidylcholine
  • PC 45 wt%
  • DSPE-PEG2000 17.5 wt%)
  • RPV 37 wt%
  • DSPE-PEG-CCR5 0.5 wt%)
  • the LNP without CCR5 ligand (LNP-RPV) was also formulated and used as a control in various experiments.
  • the existing lipid phase was combined with 1.5 wt% of 64 CuInEuS2 to formulate radiolabel LNP and 0.5 wt% of DSPE PEG(2000)-N-Cy5.5 lipid to formulate Cy5.5-dye-labeled LNPs.
  • the ratio of the aqueous phase to the lipid phase was maintained at 3 : 1 (v/v), and the total flow rate was held at 12 mL/minute.
  • the LNPs were purified by dialyzing (3.5-5 kDa cut off, cellulose acetate) against DI water over two days.
  • the purified LNP was further passed through a 40 pm cell strainer to remove the unencapsulated drug precipitate.
  • the size and zeta potential of LNP were measured by DLS (Zetasizer Nano ZS, Malvern).
  • the long-term stability of LNP at 4 °C was evaluated by intermittently measuring their size and zeta potential over a month.
  • the radioactivity of nanoprobe 6 4 CuInEuS2 was measured by gamma-ray scintillation spectrometry (Hidex AMG).
  • the LNPs 50 pL were sonicated with methanol (250 pL) for 30 minutes and subjected to ultra-high performing liquid chromatography (UPLC, Acquity UPLC H-class® system, Waters Milford, MA).
  • UPLC ultra-high performing liquid chromatography
  • the bulk morphology of the LNPs was captured under the transmission electron microscope (TEM, FEI TECNAI G2 Spirit TWIN microscope).
  • LC drug loading content
  • Table 1 A summary of the lipid compositions and physicochemical properties of LNPs.
  • 1.5 wt% CuEulnS? nanoprobe were included in the formulation to track them under positron emission tomography.
  • b Determined by using mass spectrometry.
  • Monocytes were obtained by leukapheresis from HIV and hepatitis B seronegative donors (Herskovitz, et al. (2021) EBioMedicine 73: 103678). Monocytes were cultured in 10% human serum (heat-inactivated) supplemented Dulbecco’s modified Eagle medium (DMEM) containing glucose (4.5 g/L), L- glutamine (200 mM), sodium pyruvate (1 mM), gentamicin (50 pg/mL), ciprofloxacin (10 pg/mL) and recombinant human macrophage colony-stimulating factor (1,000 U/mL) at 37°C in 5% CO2 incubator. On every other day, half of the culture media was replaced with fresh media and continued for one week to facilitate MDMs. The MDMs were then incubated with PMA (50 ng/mL) containing media for 24 hours and used for ex vivo assays.
  • PMA 50 ng/mL
  • CTB Cell Titer BlueTM
  • HIV-1 RT activity was employed to determine the antiretroviral efficacy.
  • MDMs were challenged with HIV-IADA (1.5 x 10 4 TCID50/mL) at 0.1 MOI for 8 hours. The cells were then washed with PBS and cultured overnight in fresh media. On the following day, HIV-1 infected cells were treated with LNPs at the dosage of 30 and 100 pM RPV equivalent for 24 hours. The treatment was then removed by PBS wash, and the cells were cultured in fresh media. At 1, 5, 9, 15, 21, and 25 days of post-treatment removal, culture media were collected to analyze the RT activity and the associated cells were harvested to quantitate RPV retention.
  • mice were obtained from the Jackson Laboratories (Bar Harbor, ME) and bred under specific pathogen-free conditions at the University of Kansas Medical Center by the ethical guidelines set forth by the National Institutes of Health for the care of laboratory animals.
  • the mice were humanized (hu-mice) by following protocol (Dash, et al. (2023) Proc. Natl. Acad. Sci., 120(19):e2217887120). Humanization was confirmed by flow cytometry analysis of blood immune cells (CD45 and CD3) staining.
  • PET imaging was performed on hu-mice to assess the real-time biodistribution of radio-labeled ( 64 CuInEuS2) LNPs.
  • the LNPs were injected to humice at the dosage equivalent to 1000 pCi/kg by the tail vein.
  • the biodistribution of radio-labeled LNPs was acquired at 6, 24, and 48 hours of post-injection using the PET bioimaging system (MOLECUBE P-CUBE, NV, Ghent, Belgium).
  • CT 3D computed tomography
  • PET VivoQuantTM 3.5 software
  • Radioactivity count (%/g) (organ radioactivity count x 100)/(total radioactivity count x organ weight).
  • mice were sacrificed, and liver, spleen, and blood plasma samples were collected for RPV quantification by electrospray ionization mass spectrometry (Waters ACQUITY H-class UPLC, Xevo® TQ-S micro-mass spectrometer, MA).
  • mice were anesthetized and prepared for the focused ultrasound (FUS) procedure. This involved removing the scalp hair and inserting a 26-gauge intravenous catheter into the tail vein. After stereotaxic localization of the bregma, lOOuL of Definity® microbubble solution (1 : 1000 dilution by volume) was immediately injected before the FUS. The FUS with optimized parameters (500kHz frequency, LOW power, 10% duty cycle, and 75 second duration) was then applied to each mouse hemisphere (+/- 2.5 mm of bregma). After the FUS, LNPs were immediately infused slowly through the tail vein catheter.
  • FUS focused ultrasound
  • the animal was then taken to the 9.4 Tesla MR scanner (Biospec® Avance III Bruker MR scanner) for verification of the blood-brain barrier disruption (BBBd) with T1 -weighted MRI before and after intravenous gadolinium infusion (25% dilution).
  • BBBd blood-brain barrier disruption
  • IVIS Xenogen Corporation, Alameda, CA
  • immunofluorescence evaluations were performed on the brain tissue. This included staining for all nuclei (DAP I), microglia (IBA-1), and human nuclei (HuNu).
  • Hu-mice with an average age between 18 to 20 weeks were infected with 1.5 x 10 4 tissue culture infective doseso (TCID50) of HIV-IADA via intraperitoneal injection.
  • TID50 tissue culture infective doseso
  • blood samples were collected via submandibular vein bleeding, blood plasma was 10-fold diluted in AcroMetrixTM EDTA plasma dilution matrix (Catalog # S2284, Thermo Scientific) and subjected to viral load determination using automated COBAS® Ampliprep V2.0/Taqman®- 48 system (Roche Molecular Diagnostics, Basel, Switzerland). After confirmation of plasma viral load, mice were separated into three groups: HIV-1 infected, untreated control, LNP-RPV, and LNP-RPV-CCR5.
  • LNPs were injected via tail vein at the dose of 25 mg/kg RPV equivalent.
  • the body weight and plasma viral load were determined on days 0 and 7 and 14 of post-LNP injection.
  • the mice were terminated, and blood and major organs collected.
  • Blood samples were used for whole blood cell count (by Abaxis VetScan® HM5) and serum chemistry (by Abaxis VetScan® VS2), and the tissues from the major organs were fixed, paraffin-emedded, and stained with hematoxylin and eosin (H&E).
  • the histological images of different tissues were captured on a NuanceTM EX multispectral imaging system affixed to a Nikon Eclipse E800 microscope.
  • Theranostic LNPs affirm the simultaneous delivery of a therapeutic drug and an imaging nanoprobe.
  • the theranostic lipid nanoparticles (LNPs) were developed to facilitate the simultaneous delivery of therapeutic agents and imaging probes.
  • the antiretroviral drug RPV was chosen as the therapeutic payload, while the radioactive nanoprobe 64 CuInEuS2 was selected for imaging purposes.
  • a CCR5 targeting peptide was conjugated to PEGylated lipid (DSPE-PEG) by an acid amine coupling reaction combined with phosphatidylcholine (PC) and a peptide unconjugated DSPE-PEG to formulate the targeted LNP.
  • RPV an FDA- approved, nonnucleoside reverse transcriptase inhibitor
  • LNP-RPV-CCR5 The nanoprobe’s properties and biodistribution were examined in humanized mice (hu-mice).
  • the beta emitter 64 CuInEuS2 offered an ideal radioactive half-life due to its compatibility with PET computed tomography (CT) or magnetic resonance imaging (MRI) tracking. This tri-modality was selected based on known safety and ease in biological monitoring (Daraban, et al. (2006) Annals West Univ. sekunder., 48: 118; Herskovitz, et al. (2021) Nanotheranostics 5(4):417-430).
  • the chelator-free 64 CuInEuS2 nanoprobe was synthesized by solvothermal methods using thioacetamide, europium (III) chloride hexahydrate, indium (III) chloride dihydrate, and copper (II) chloride dihydrate at optimal molar ratios.
  • the high boiling solvent, oleylamine was selected for solvothermal synthesis to avoid narrowly dispersed particles.
  • the nanoprobe morphology was examined under transmission electron microscopy (TEM) which revealed a narrowly dispersed rod-shaped nanostructure with an average diameter of 15 nm and an average length of 65 nm (Fig. 1A). High- resolution TEM images showed a crystal lattice (Fig. IB).
  • a linear CCR5-peptide D- Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-NH2 (SEQ ID NO: 1), was selected as the targeting ligand.
  • the free -NH2 group on the CCR5-peptide was conjugated to DSPE-PEG-NHS by an activated acid amine coupling reaction (Fig. IE).
  • Fig. IE A structure of the DSPE-PEG conjugated peptide is provided in Fig. IE.
  • the J H NMR spectra of the DSPE-PEG conjugated peptide showed chemical shifts at 0.8 and 1.27 ppm. These were assigned to the methyl and methylene protons of DSPE.
  • the chemical shift at 3.63 ppm was assigned to the methylene proton of PEG.
  • the chemical shifts at 6.79 and 7.09 ppm were assigned to the 4-hydroxyphenyl ring protons of the tyrosine (Tyr), and those between 1.5 to 3 ppm and 4 to 4.5 ppm were transferred to the overlapping proton signals from the peptide and DSPE-PEG segments.
  • J H NMR confirmed both the CCR5-peptide and DSPE-PEG segments, affirming the synthesis of the DSPE-PEG-CCR5. High-resolution mass spectrometry results further supported its synthesis.
  • LNPs were prepared by microfluidic techniques by rapid, chaotic mixing of lipid and aqueous phases ( Figures IF and 1G).
  • the LNP-RPV-CCR5 contained a mixture of PC (45 wt%), DSPE-PEG (19.5 wt%), RPV (35 wt%), and DSPE-PEG- CCR5 (0.5 wt%) in its lipid phase.
  • PBS was used in the aqueous phase.
  • LNP without DSPE-PEG-CCR5 LNP -RPV was prepared in parallel to serve as a control formulation. To track the LNPs by PET, both LNPs were reformulated with 1.5 wt% of the radioactive nanoprobe 64 CuInEuS2.
  • LNPs were neutral in charge with a surface zeta potential from 0.29 to 0.37 mV (Table 1).
  • LNPs with particle sizes of ⁇ 100 nm and a neutral surface charge were prepared for administration.
  • the RPV loading content in LNP -RPV and LNP-RPV-CCR5 were 49.78 and 30.80 wt%, respectively (Table 1).
  • the storage stability of the LNPs at 4°C showed no changes in particle size and dispersity for up to one month. These data demonstrated long-time storage stability (Fig. 2E-2F).
  • MDMs human monocyte -derived macrophages
  • Macrophages express CD4 and CCR5 receptors and are susceptible to HIV-1 infection (Kruize, et al. (2019) Front. Microbiol., 10:484054; Wong, et al. (2019) Front. Immunol., 10:456992; Meng, et al. (2021) Biology 10(7):661).
  • the cells are a known HIV reservoir (Veenhuis, et al. (2023) Nat. Microbiol., 8(5):833-844).
  • Infected macrophages can transmit the virus from person to person, serving as a depot for ARVs. Therefore, MDMs served as a primary cell model to examine the LNP antiretroviral efficacy. Before LNP treatment, the viability of MDMs was evaluated after 200 to 3 pM RPV LNPS exposures by the CellTiter-Blue Assay (Fig.
  • Infected MDMs without LNPs were maintained as controls (HIV-IADA and PMA). On days 1, 5, 9, 15, 21, and 25, culture supernatant fluids were removed and then analyzed for HIV-1 reverse transcriptase (RT) activity. Cells were harvested in parallel to quantify RPV. On day 9, LNP-RPV showed 26 and 5 nmol RPV at 100 and 30 pM treatment doses (Figs. 3E and 3H). In contrast, LNP-RPV-CCR5 showed 109 and 50 nmol RPV at 100 and 30 pM treatment doses. Both LNPs demonstrated a dose-dependent RPV retention. Each showed higher RPV retention at 100 than 30 pM (Figs. 3E and 3H).
  • the total radioactivity in the LNP was measured in relation to the total radioactivity of the LNP-plasma solution.
  • the radiolabeled LNPs were stable (98%) in mice plasma after 24 hours of incubation. This indicated their suitability for in vivo bioimaging.
  • Radiolabeled LNPs dose 1000 pCi/kg
  • PET images were captured at 6, 24, and 48 hours after injection and co-registered by CT (Fig. 4A-4E). Both the coronal and sagittal PET-CT images demonstrated spleen and liver LNP distribution (Fig. 4B).
  • the PET image displayed a progressive decrease of radioactive signals over time. This was attributed to the combined effect of radioactive decay and LNP excretion (Dilliard, et al. (2023) Nat. Rev. Mater., 8(4):282-300). Noticeably, LNP-RPV- CCR5 showed primary presence in the spleen, while LNP-RPV primarily accumulated in the liver. Comprehensively, the higher signal in LNP-RPV-CCR5 treated mice over LNP-RPV was linked to the tail vein injection site (Fig. 41). To validate these findings, mice were sacrificed at 48 hours after injection, and the remaining radioactivity was assayed by a gamma counter (Figs. 4C-4D).
  • LNP-RPV- CCR5 showed a propensity to spleen tissue accumulation. In contrast, LNP-RPV was distributed throughout all examined tissues. LNP-RPV-CCR5 showed a substantially higher spleen/liver radioactivity ratio than LNP-RPV. The spleen harbors a significant number of CCR5 -expressing immunocytes (Wang, et al. (2019) Faseb J., 33(8):8905-8912).
  • LNP-RPV- CCR5 demonstrated spleen-specific RPV accumulation with higher spleen/liver RPV ratios than for LNP-RPV (Fig. 4H). These data were well corroborated by PET imaging (Fig. 4B-E). Yet another limitation of ARV biodistribution rests in penetrance to the brain viral sanctuary. Indeed, LNP -based cargo delivery rests in its limited penetrance across the blood-brain barrier (BBB). To affect the penetration of LNPs into the brain, focused ultrasound (FUS) combined with microbubble-induced BBB disruption (BBBd) was used in the hu mice. The verification of BBBd was affirmed by the gadolinium enhancements (bright signals, arrows).
  • BBBd blood-brain barrier
  • mice were intravenously injected with Cy5.5 labeled LNPs.
  • the FUS-mediated temporary BBB disruption allows the LNP to cross into the brain.
  • the BBB naturally reseals; a similar strategy can be applied to humans (Burgess, et al. (2015) Expert Rev. Neurother., 15(5):477- 491).
  • whole-body scans were performed with an in vivo imaging system (IVIS). This revealed a higher brain accumulation and retention of LNP-RPV-CCR5 than LNP-RPV (Fig. 5A).
  • mice were stained with IBA-1 (microglia) and HuNu (human nuclei) and imaged by confocal microscopy (Fig. 5B). Approximately 20% of microglia (IBA-1, red) showed HuNu, green staining, and LNP engulfment. Mice treated with LNP-RPV-CCR5 displayed increased accumulation of LNPs in human microglia and higher cytoplasmic retention than those treated with LNP-RPV. These data support CCR5 targeted delivery.
  • IBA-1 microglia
  • HuNu human nuclei
  • the body weight of the hu-mice was measured. Blood samples were collected to determine hematologic profiles at the end of treatment. The heart, lung, spleen, liver, and kidneys were paraformaldehyde-fixed, sectioned, and stained with hematoxylin and eosin to assess tissue histology. The analysis of whole blood count and blood serum chemistry revealed no evidence of cytotoxicity in the LNP -treated group (Table 2 and 3). Moreover, the measured body weight remained unchanged throughout all the treatments (Fig. 6C). No histological abnormality was identified in the spleen despite the high levels of LNP accumulation and other examined organs (Fig. 6D). These examinations indicate that the LNPs were safe delivery vehicles. The results of these studies support the clinical translation of the LNP -based drug delivery.
  • Table 2 Assessment of hematological toxicity from complete blood count analysis.
  • WBC White Blood Cell Count
  • LYM Lymphocytes Count
  • MON Monocytes Count
  • NEU Neutrophils Count
  • RBC Red Blood Cell Count
  • HGB Hemoglobin Count
  • HCT Hematocrit Test
  • MCV Mean Corpuscular Volume Blood Test
  • MCH Mean Corpuscular Hemoglobin Blood Test
  • MCHC Mean Corpuscular Hemoglobin Concentration Test
  • RDWS Red Blood Cell Distribution Width Standard
  • PLT Platelet Count
  • MPV Mean Platelet Volume
  • PDWs Platelet distribution width Standard. Samples were analyzed by using VetScan® HM5. Values reported are the mean ⁇ SEM of 3 replicates for all the groups.
  • a multimodal radioactive nanoprobe with a CCR5-peptide conjugated DSPE-PEG-CCR5 lipid was successfully synthesized.
  • the CCR5-targeted LNP- RPV-CCR5 and nontargeted LNP-RPV were formulated by microfluidic mixing.
  • the spherically shaped LNPs had sizes near 100 nm with narrow size dispersity. These LNPs were devoid of associated toxi cities at 100 pM RPV equivalence doses.
  • LNP-RPV-CCR5 demonstrated substantially higher macrophage uptake and retention. In macrophages, the RPV was retained as a drug depot.
  • LNP-RPV-CCR5 A single dose of LNP-RPV-CCR5 treatment demonstrated a 25-day-long viral suppression in the HIV-1 infected macrophages not seen by LNP-RPV treatments.
  • the FUS combined with microbubble-induced BBBd facilitated the delivery of LNPs to the brain and higher drug retention in human microglia.
  • LNP-RPV-CCR5 LNP-RPV-CCR5
  • the therapeutic efficacy of the CCR5-targeted delivery system can be propelled by synergistic combination of multiple ARVs for longer-term effective HIV-1 treatments.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nanotechnology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Optics & Photonics (AREA)
  • Dispersion Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Preparation (AREA)

Abstract

The present invention provides lipid nanoparticles and methods of use thereof.

Description

LIPID NANOPARTICLES AND METHODS OF USE THEREOF
By Howard Gendelman Sudipta Panj a Lubaba Zaman Milankumar Patel
This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63/530,318, filed August 2, 2023. The foregoing application is incorporated by reference herein.
This invention was made with government support under Grants No. T32 NS105594, R01 MH121402, R01 AI158160, R01 DA054535, R01 NS126089, R01 AI145542, R01 NS036126, R01 MH115860, R33 DA041018, and R01 NS034239, all awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates generally to the delivery of therapeutics. More specifically, the present invention relates to compositions and methods for the delivery of therapeutic agents to a patient.
BACKGROUND OF THE INVENTION
The human immunodeficiency virus type (HIV) global epidemic began in 1981 and has led to 40 million deaths and equal numbers of infected people (Holmes, E.C. (2001) Biol. Rev. Camb. Philos. Soc., 76(2):239-254; Senapathi, et al. (2020) Colloids Surf. B Biointerfaces 191 : 1109791; Singh, et al. (2020) Nanomedicine 25: 102172). While human immunodeficiency virus type one (HIV- 1) replication suppressed by antiretroviral therapy (ART) has markedly improved disease outcomes, infection persists. Viral DNA integration into the host cell target genome defines microbial latency, demonstrating that HIV-1 can circumvent the host immunity and persist in the system with continuous antiretroviral immunity with continuous HIV comorbidities (Fotooh Abadi, et al. (2023) J. Nanobiotechnol., 21(1):19; Chun, et al. (2015) Nat. Immunol., 16(6):584-589; Surve, et al. (2020) Mol. Pharm., 17( 10): 3990-4003). ART faces challenges due to its failure to eliminate infection, the need for strict regimen adherence, and drug-related toxicities (Vasukutty, et al. (2023) ACS Appl. Bio. Mater., doi.ord/10.1021/acsabm.3c00456; Gunaseelan, et al. (2010) Adv. Drug Deliv. Rev., 62(4-5):518-531). ART bioavailability to the lymphoid, gut, central nervous system (CNS), heart, liver, and kidney tissues is added to this list of drug challenges (Fotooh Abadi, et al. (2023) J. Nanobiotechnol., 21(1): 19; Eshaghi, et al. (2022) ACS Appl. Mater. Interfaces 14(2):2488-2500; Menon, et al. (2022) Mater Today Adv., 16: 100299). Limitations in ART tissue penetrance are linked to drug pharmacologic properties or ART pauses, where both lead to the emergence of viral drug resistance (Johnson, et al. (2023) Viruses 15(1): 107). Therefore, strict adherence to lifelong ART is required to maintain viral suppression (Daraban, et al. (2006) Annals West Univ. Timisoara Phys. Ser., 48: 118).
A means to improve these antiretroviral therapeutic challenges is long-acting (LA) ART. Improved drug delivery has an underexplored potential for improved therapeutic outcomes. One way this can be further improved is through functional lipid nanoparticles (LNPs). However, this alone may not allow drug accumulation to viral reservoirs (Herskovitz, et al. (2021) Nanotheranostics 5(4):417-430). Success is made by optimizing antiretroviral drug (ARV) tissue and cell-specific targeting. LNPs may improve ARV pharmacodynamics by increasing drug circulation time and bioavailability (Fotooh Abadi, et al. (2023) J. Nanobiotechnol., 21(1): 19; Daraban, et al. (2006) Annals West Univ. Timisoara Phys. Ser., 48: 118; Kruize, et al. (2019) Front. Microbiol., 10:484054). LNP composition and decoration enable ARV cell depots and enhance delivery to viral reservoirs (Wong, et al. (2019) Front. Immunol., 10:456992). Despite these advancements, improved LNP with superior properties are needed.
SUMMARY OF THE INVENTION
In accordance with the instant invention, lipid nanoparticles are provided. In certain embodiments, the lipid nanoparticles comprise more than one lipid, a C-C chemokine receptor type 5 (CCR5) targeting moiety, and a therapeutic agent and/or imaging agent. In certain embodiments, the lipid nanoparticle comprises a polyethylene glycol (PEG)-lipid conjugate. In certain embodiments, the CCR5 targeting moiety is selected from the group consisting of maraviroc, aplaviroc, vicriviroc, INCB009471, leronlimab, and the peptide Ala-Ser-Thr-Thr-Thr-Asn-Tyr- Thr (SEQ ID NO: 1) optionally comprising one or more D-amino acids. In certain embodiments, the CCR5 targeting moiety is conjugated to a PEG-lipid conjugate via the PEG moiety. In certain embodiments, the PEG-lipid conjugate is 1,2-distearoyl- sn-glycero-3 -phosphoethanolamine (DSPE)-PEG. In certain embodiments, the lipid nanoparticle comprises phosphatidylcholine, DSPE-PEG, and DSPE-PEG-CCR5 conjugate. In certain embodiments, the lipid nanoparticle encapsulates the therapeutic agent and/or imaging agent. In certain embodiments, the therapeutic agent is an antiretroviral agent. Antiretroviral agents include, without limitation, non-nucleoside reverse transcriptase inhibitors, nucleoside reverse transcriptase inhibitors, protease inhibitors, fusion inhibitors, integrase inhibitors, or CRISPR based therapeutics (e.g., a gRNA or crRNA). In certain embodiments, the gRNA or crRNA is complementary to a sequence within an HIV-1 gene. In certain embodiments, the gRNA or crRNA comprises a sequence with at least 90% identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In certain embodiments, the antiretroviral agent is rilpivirine. In certain embodiments, the lipid nanoparticle comprises a therapeutic agent and an imaging agent. In certain embodiments, the imaging agent is CulnEuS?. In certain embodiments, the lipid nanoparticle comprises phosphatidylcholine, DSPE-PEG, DSPE-PEG-CCR5 conjugate, and an antiretroviral agent (e.g., rilpivirine). Compositions comprising at least one nanoparticle and a pharmaceutically acceptable carrier are also encompassed by the instant invention.
According to another aspect of the instant invention, methods of treating, inhibiting, and/or preventing an HIV (e.g., HIV-1) infection in a subject in need thereof are provided. The methods comprise administering at least one nanoparticle of the instant invention to the subject.
According to another aspect of the instant invention, methods of imaging HIV and/or HIV reservoirs and/or tracking or monitoring an HIV (e.g., HIV-1) infection are provided. The methods comprise administering at least one nanoparticle of the instant invention to the subject and detecting the presence of the imaging agent.
BRIEF DESCRIPTIONS OF THE DRAWING
Figures 1 A-1D show the morphological characterization of the multimodal CuInEuS? nanoprobe. Figures 1 A and IB provide transmission electronmicroscope images of the multimodal rode shape nanoprobes. CuInEuS? and its crystal lattice (lines) are illustrated. Figure 1C provides a scanning transmission electron microscopy map shows elemental localization within the nanoprobe from a corresponding high-angle annular dark-field electron microscopy image. Figure 1C shows the presence of copper (top middle), indium (bottom left), europium (top right), and sulfur (bottom middle) in the nanoprobe. Top left shows HAADF and bottom right shows overlap images. Figure ID provides a XRD pattern of CuInEuS? nanoprobe which demonstrates a crystal structure. Figure IE provides a structure of the DSPE-PEG conjugated CCR5 peptide. Figure IF provides a schematic representation of rilpivirine (RPV) and inorganic nanoparticles (CulnEuS?) encapsulated lipid nanoparticles (LNP-RPV and LNP-RPV-CCR5) manufactured by using microfluidic mixing. Figure 1G provides a schematic representation of rilpivirine (RPV) and encapsulated lipid nanoparticles (LNP-RPV and LNP-RPV- CCR5) manufactured by using microfluidic mixing.
Figures 2A-2F show physicochemical LNP characterization. Figures 2A and 2B provide TEM images which show nearly spherical LNP-RPV and LNP-RPV- CCR5 morphology, respectively. Figures 2C and 2D provide graphs of the DLS size profile demonstrating the unimodular distribution of the LNPs. Figures 2E and 2F provide graphs of the changes in size and poly dispersity of the LNPs recorded for one month at 4 °C. LNPs were stable without changes in size and polydispersity.
Figures 3 A-3G show that CCR5-receptor targeted LNPs facilitate the particle’s cell uptake, depot formation, and HIV-1 suppression. Figure 3A provides a graph of dose-associated macrophage viability measurements following LNP exposures by the CTB assay after a 24 hour incubation. The LNP- RPV and RPV- CCR5 treatments showed that cell viability was maintained at 100 pM of RPV doses. Figure 3B provides a graph of LNP-RPV and LNP-RPV-CCR5 macrophage uptake analyzed by measuring RPV concentration for 24 hours at 20 pM RPV. Comparisons between LNP-RPV and RPV-CCR5 showed a 3 -fold increase in drug uptake. Figure 3C provides a graph showing the CCR5 inhibitor (maraviroc, 1 nM) attenuated LNP uptake for the LNP-RPV-CCR5. Figure 3D provides confocal microscopy performed with Cy 5.5 dye-labeled LNP-RPV-CCR5 treated macrophages in the presence (lower panel) and absence (upper panel) of maraviroc. RPV retention (Figure 3E) and viral suppression (Figure 3F) in LNP-RPV and LNP- RPV-CCR5 macrophage uptake were evaluated by measuring RPV and virus levels in the cell supernatant fluids. The data were collected over 25 days after a 100 pM RPV dose. Figure 3G provides TEM images of LNP engulfed macrophage. Macrophages depots for LNP-RPV-CCR5 are shown. Statistical analysis was performed by an unpaired t-test. ****, p < 0.0001; and ns = not significant. RPV retention (Figure 3H) and viral suppression (Figure 31) in LNP -RPV and LNP-RPV- CCR5 macrophage uptake were evaluated by measuring RPV and virus levels in the cell supernatant fluids. The data were collected over 25 days after a 30 pM administered dose.
Figures 4A-4I show LNP and RPV tissue biodistribution in mice by PET imaging and mass spectrometry. Figure 4A provides a schematic presentation of LNP biodistribution by PET. Figure 4B shows images of humanized mice injected with LNP -RPV or RPV-CCR5, and particle biodistribution monitored by PET at 6, 24, and 48 hours. Both coronal (left panel) and sagittal (right panel) views for LNP- RPV-CCR5 are illustrated. Figures 4C and 4D provide graphs of the quantitative measurements of radiolabeled LNPs in tissue were recorded at 48 hours by gamma counter measurements. LNP-RPV-CCR5 was concentrated in the spleen. Figure 4E provides a graph of spleen/liver RPV ratios for LNP-RPV-CCR5 and LNP -RPV. Figure 4F provides a schematic presentation of LNP injection measurements in humanized mice. Figure 4G provides a graph of plasma RPV levels following NP- RPV and RPV-CCR5 treated mice at 6 and 24 hours after injection. Figure 4H provides a graph of the spleen/liver RPV ratio at 24 hours, the highest RPV levels are in the spleen after LNP injection. Figure 41 provides whole body PET scanning images of humanized mice at 6 hours post-LNP administration.
Figures 5A-5B show brain delivery of LNP-RPV-CCR5 nanoparticles. Humanized microglial (MG) mice were focus ultrasound (FUS) treated to the brain and then LNPs were injected intravenously through the tail. Figure 5 A provides IVIS images showing bright Cy5.5 signals in the brain of FUS-treated mice that received the LNP-RPV-CCR5 compared to LNP -RPV. Both mice showed good BBB disruption, as shown by the gadolinium enhancements (bright signals, arrows) on the coronal sections of the Tl-weighted images (T1WI) on MRI. Figure 5B shows that approximately 15% of microglia (IBA-1) showed human marker staining (HuNu), and only those showed the engulfment of LNPs. The Cy5.5 signals appear to be more intense in the animals that received the LNP-RPV-CCR5. Scale bar = 200 pm. Figures 6A-6D show viral suppression and toxicity profiles of LNP-carried RPV. Figure 6A provides a schematic representation of experimental timelines for LNP treatments. Figure 6B provides a graph showing viral suppression efficiency of LNP-RPV and LNP-RPV-CCR5 (individual humanized mice) on days 7 and 14. LNP-RPV-CCR5 showed complete viral suppression up to day 14. Figure 6C provides a graph showing the change in mice body weight in the untreated, LNP- RPV, and LNP-RPV-CCR5 treated group. Figure 6D provides histological images of hematoxylin and eosin-stained heart tissues, lung, kidney, spleen, and liver sections from the treatment groups. The images were captured at 20X magnification.
DETAILED DESCRIPTION OF THE INVENTION
Improvement of antiretroviral drug’s residence time by creating a cell depot that can sustain antiretroviral activities is possible through targeted delivery. Herein, a C-C chemokine receptor type 5 (CCR5) decorated rilpivirine (RPV) LNP nanoprobe was synthesized. The probe was designed to encase RPV with tissue delivery monitored by positron emission tomography (PET). The created LNP- RPV-CCR5 formulation led to viral suppression in viral reservoir tissues and cells in HIV-1 ADA-infected hu-mice. ARV myeloid-targeted formulations produced cell depots and improved ARV antiretroviral responses. The CCR5-mediated RPV-LNP cell uptake and retention reduced HIV-1 replication in human monocyte-derived macrophages and infection of humanized mice. Focused ultrasound allows the decorated LNP to penetrate the blood-brain barrier and reach brain myeloid cells. These findings offer a role for CCR5 -targeted therapeutics in antiretroviral delivery to optimize HIV suppression.
In accordance with the instant invention, lipid nanoparticles are provided. In certain embodiments, the lipid nanoparticles comprise one or more lipids. In certain embodiments, the lipid nanoparticles comprise one or more lipid layers. In certain embodiments, the lipid nanoparticles comprise a lipid monolayer. In certain embodiments, the lipid nanoparticles comprise a lipid bilayer. In certain embodiments, the lipid nanoparticles comprise a therapeutic agent and/or imaging agent. In certain embodiments, the lipid nanoparticles coat, encapsulate, package, and/or encompass a therapeutic agent and/or imaging agent. The lipid nanoparticles of the instant invention are typically round or spherically shaped. In certain embodiments, the diameter or longest dimension of the lipid nanoparticle is about 10 to about 500 nm, about 20 nm to about 400 nm, about 20 nm to about 300 nm, about 50 nm to about 200 nm, about 50 nm to about 150 nm, about 75 nm to about 200 nm, about 75 nm to about 150 nm, about 75 nm to about 125 nm, or about 100 nm.
In certain embodiments, the lipid nanoparticles comprise cationic lipids, anionic lipids, zwitterionic lipids, and/or non-polar lipids. The lipids may be linked or conjugated to other agents or compounds such as, without limitation, polymers (e.g., PEG). In certain embodiments, the lipid nanoparticles comprise PEG-lipid conjugates. Any lipid or combination of lipids that are known in the art can be used to produce the lipid nanoparticles of the instant invention.
Examples of cationic lipids include, without limitation: 1,2-di-O-octadecenyl- 3 -trimethylammonium propane (DOTMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), didodecyldimethylammonium bromide (DDAB), N,N- dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1 ,2-dilinoleyloxy-N,N- dimethylaminopropane (DLinDMA), l,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), l,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1, 2-dilinoley oxy-3 -(dimethylamino)acetoxypropane (DLinDAC), 1, 2-dilinoley oxy-3 - morpholinopropane (DLin-MA), l,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), l,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1- linoleoyl-2-linoleyloxy-3 -dimethylaminopropane (DLin-2-DMAP), 1,2- dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2- dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2- dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), 3-(N,N- dilinoleylamino)-l,2- propanediol (DLinAP), 3-(N,N-diolcylamino)-l,2-propanedio (DOAP), l,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG- DMA), 2, 2-dilinoleyl-4-dimethylaminomethyl-[l,3]-di oxolane (DLin-K-DMA), (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH- cyclopenta[d][l,3]dioxol-5-amine (ALNY-100), l,2-dioleoyl-3 -dimethylammonium propane (DODAP), cholest-5-en-3-ol (3P)-,3-[(3-aminopropyl)[4-[(3- aminopropyl)amino]butyl]carbamate (GL67), DOTAP-cholesterol (l,2-dioleoyl-3- trimethylammonium propane; (3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17- [(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,ll,12,14,15,16,17-dodecahydro-lH- cyclopenta[a]phenanthren-3-ol), GAP-DMORIE-DPyPE (Vaxfectin; (±)-N-(3- aminopropyl)-N,N-dimethyl-2,3-bis(cis-9-tetradeceneyloxy)-l-propanaminium;l,2- diphytanoyl-sn-glycero-3-phosphoethanolamine), GL67A (GL67-DOPE-DMPE- polyethylene glycol (PEG) (cholest-5-en-3-ol (3P)-,3-[(3-aminopropyl)[4-[(3- aminopropyl)amino]butyl]carbamate;l,2-dileoyl-sn-3-phosphoethanolamine; dimyristoylphosphoethanolamine; PEG), ethyl-phosphatidylcholine (EPC), N-(l- (2,3-dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N- dimethylammonium trifluoracetate (DOSPA), dioctadecylamidoglycyl carboxyspermine (DOGS), N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(((Z)-octadec- 9-en-l-yl)oxy)propan-l-aminium (DORIE), N-(l,2-dimyristyloxyprop-3-yl)-N,N- dimethyl-N-hydroxyethyl ammonium (DMRIE), (+/-)-N-(3-aminopropyl)-N,N- dimethyl-2,3-bis (dodecyloxy)-l-propanaminium (GAP-DLRIE), diC14-amidine, 3P-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol (DC-Chol), dimethyldioctadecylammonium (DDA), l,2-dioleoyl-3 -trimethylammonium propane (DOTAP), l,2-dimyristoyl-3-trimethylammonium-propane (DMTAP), 1,2-stearoyl- 3-trimethylammonium-propane (DSTAP) and N-(4-carboxybenzyl)-N,N-dimethyl- 2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), egg phosphatidylcholine, and cholesterol-polyethylene glycol, 98N12-5 (isomer of triethylenetetraminelaurylaminopropionate with a free internal amine, cholesterol, and mPEG2ooo-C14 glyceride), C12-200 (CAS#: 1220890-25-4; l,l-((2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl)(2 -hydroxydodecyl) amino)ethyl)piperazin-l- yl)ethyl)azanediyl)bis(dodecan-2-ol)), DLin-KC2-DMA (KC2) (CAS#: 1190197- 97-7; 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane), DLin-MC3-DMA (MC3) (CAS#: 1224606-06-7; dilinoleylmethyl-4-dimethylaminobutyrate), XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane), MD1 (CKK-E12; 3,6-bis({4- [bis(2-hydroxydodecyl)amino]butyl})piperazine-2, 5-dione), 7C1 (C15 epoxide- terminated lipid (e.g., Dahlman, et al. (2014) Nat. Nanotechnol., 9(8):648-655), and pharmaceutically acceptable salts thereof.
Examples of zwitterionic lipids include, without limitation: distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dioleoyl- phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane-l -carboxylate (DOPE-mal), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 16-0-monom ethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, l-stearoyl-2-oleoyl-phosphatidy ethanolamine (SOPE), distearoylphosphatidylcholine (DPSC), dipalmitoylphosphatidylcholine (DPPC), palmitoyloleoylphosphatidylcholine (POPC), 1,2- dileoyl-sn-3- phosphoethanolamine (DOPE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), dimyristoyl glycerol (DMG), phosphatidylserines, phosphatidylethanolamines, phosphatidylcholines, sphingomyelins, sphingophospholipids, betaine lipids (e.g., lauramidopropyl betaine), and SM (sphingomyelin), and combinations thereof.
Examples of anionic lipids include, without limitation: phosphatidylglycerols (PG), phosphatidic acid, and phosphatidylinositol phosphates.
Examples of non-polar lipids include, without limitation: glycerides (mono, di, and triglycerides) and other non-charged lipids.
In certain embodiments, the lipids are modified or conjugated to other molecules. In certain embodiments, the lipid (e.g., a zwitterionic lipid) is conjugated to a polymer. In certain embodiments, the polymer is polyethylene glycol (PEG). While the present application generally refers to PEG-lipid conjugates, other polymers can be used in place of PEG. In certain embodiments, the PEG has a molecular weight from about 200 g/mol to 10,000 g/mol. In certain embodiments, the PEG has a molecular weight from about 200 g/mol to 1,000 g/mol. In certain embodiments, the PEG has a molecular weight from about 200 g/mol to 800 g/mol. In certain embodiments, the PEG has a molecular weight from about 1,000 g/mol to 3,000 g/mol. In certain embodiments, the PEG has a molecular weight from about 1,500 g/mol to 2,500 g/mol. In certain embodiments, the PEG has a molecular weight from about 1,800 g/mol to 2,200 g/mol. In certain embodiments, the PEG is selected from the group consisting of: PEG200, PEG300, PEG400, PEG600, PEG1000, PEG2000, PEG3000, PEG6000, and PEG8000. In certain embodiments, the PEG has from about 30 to 50 repeating units, about 35 to 50 repeating units, or about 35 to 45 repeating units. Examples of PEG-lipid conjugates include, without limitation: PEG-CerC14, PEG-CerC20, DMG-PEG, DSPE-PEG, and DMP-PEG. In certain embodiments, the lipid is conjugated to PEG 2000.
The lipid nanoparticles of the instant invention may comprise 1, 2, 3, 4, 5, or more of the lipids recited hereinabove. In certain embodiments, the lipid nanoparticle of the present invention comprises at least one type of cationic lipid. In certain embodiments, the lipid nanoparticle comprises at least one type of zwitterionic lipid. In certain embodiments, the lipid nanoparticle comprises only zwitterionic lipids. In certain embodiments, the lipid nanoparticle of the present invention comprises at least one PEG-lipid conjugate (e.g., a PEG-zwitterionic lipid conjugate). In certain embodiments, the lipid nanoparticles comprise 1,2-distearoyl- sn-glycero-3 -phosphoethanolamine (DSPE). In certain embodiments, the lipid nanoparticles comprise a phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the lipid nanoparticles comprise a phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the lipid nanoparticles comprise phosphatidylcholine. In certain embodiments, the lipid nanoparticles comprise 1) DSPE and 2) phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the lipid nanoparticles comprise 1) DSPE and 2) phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the lipid nanoparticles comprise DSPE and phosphatidylcholine. In certain embodiments, the lipid nanoparticles further comprise cholesterol.
The lipid nanoparticles of the present invention further comprise a C-C chemokine receptor type 5 (CCR5 or CD 195) targeting moiety or ligand. CCR5 targeting moi eties specifically bind CCR5. Examples of CCR5 targeting moi eties include, without limitation: maraviroc, aplaviroc, vicriviroc, INCB009471 ((4,6- dimethylpyrimidin-5-yl)-[4-[(3S)-4-[(lR,2R)-2-ethoxy-5-(trifluoromethyl)-2,3- dihydro-lH-inden-l-yl]-3-methylpiperazin-l-yl]-4-methylpiperidin-l- yl]methanone), leronlimab, and the peptide Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr (SEQ ID NO: 1). In certain embodiments, the peptide is D-Ala-peptide T-amide (DAPTA) or Peptide T (D-ASTTTNYT-NH2 (SEQ ID NO: 1), referred to herein as CCR5 peptide).
In certain embodiments, the CCR5 targeting moiety is linked to a lipid of the lipid nanoparticle. In certain embodiments, the CCR5 targeting moiety is on the exterior of the lipid nanoparticle. In certain embodiments, the CCR5 targeting moiety is linked (e.g., directly or via a linker) to any chemically available position on the surface of the lipid nanoparticle. In certain embodiments, the CCR5 targeting moiety is conjugated to a PEG-lipid conjugate (e.g., a PEG-zwitterionic lipid conjugate), particularly via the PEG moiety. In certain embodiments, the CCR5 targeting moiety is conjugated to DSPE-PEG. In certain embodiments, the CCR5 targeting moiety is the peptide D-ASTTTNYT-NH2 (SEQ ID NO: 1) conjugated to DSPE-PEG.
In certain embodiments, the lipid nanoparticle of the present invention comprises DSPE-PEG (e.g., DSPE-PEG2000). In certain embodiments, the lipid nanoparticle of the present invention further comprises phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the lipid nanoparticle of the present invention further comprises phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the lipid nanoparticle of the present invention further comprises phosphatidylcholine. In certain embodiments, the lipid nanoparticle of the present invention further comprises DSPE-PEG (e.g., DSPE- PEG2000) conjugated to a CCR5 targeting moiety. In certain embodiments, the lipid nanoparticle of the present invention further comprises DSPE-PEG-CCR5 peptide. In certain embodiments, the lipid nanoparticle of the present invention further comprises a therapeutic agent. In certain embodiments, the therapeutic agent is rilpivirine. In certain embodiments, the lipid nanoparticle of the present invention further comprises an imaging agent. In certain embodiments, the imaging agent is CuInEuS?. In certain embodiments, the imaging agent is a cyanine (e.g., Cy5.5).
In certain embodiments, the lipid nanoparticle of the instant invention comprises about 25% to 65% of a zwitterionic lipid by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 35% to 55% of a zwitterionic lipid by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 40% to 50% of a zwitterionic lipid by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 45% of a zwitterionic lipid by weight (wt %). In certain embodiments, the zwitterionic lipid is phosphatidyl serine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and/or sphingophospholipid. In certain embodiments, the zwitterionic lipid is phosphatidylserine, phosphatidylethanolamine, and/or phosphatidylcholine. In certain embodiments, the zwitterionic lipid is phosphatidylcholine.
In certain embodiments, the lipid nanoparticle of the instant invention comprises about 5% to 35% of a PEG-lipid conjugate by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 10% to 30% of PEG-lipid conjugate by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 15% to 25% of PEG-lipid conjugate by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 20% of PEG-lipid conjugate by weight (wt %). In certain embodiments, the PEG-lipid conjugate is DSPE-PEG. In certain embodiments, the PEG-lipid conjugate is DSPE-PEG2000.
In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.05% to 5% of a PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.1% to 2.5% of PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.25% to 1% of PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.5% of PEG-lipid conjugate linked to a CCR5 targeting moiety by weight (wt %). In certain embodiments, the PEG-lipid conjugate linked to a CCR5 targeting moiety is DSPE-PEG-CCR5 peptide. In certain embodiments, the PEG-lipid conjugate is DSPE-PEG2000-CCR5 peptide.
In certain embodiments, the lipid nanoparticle of the instant invention comprises about 15% to 55% of a therapeutic agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 25% to 45% of a therapeutic agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 30% to 40% of a therapeutic agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 35% of a therapeutic agent by weight (wt %). In certain embodiments, the therapeutic agent is rilpivirine.
In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.1% to 10% of an imaging agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 0.5% to 5% of an imaging agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 1% to 3% of an imaging agent by weight (wt %). In certain embodiments, the lipid nanoparticle of the instant invention comprises about 1.5% of an imaging agent by weight (wt %). In certain embodiments, the imaging agent is CuInEuS?.
In certain embodiments, the lipid nanoparticle comprises a zwitterionic lipid (e.g., PC), a PEG-lipid conjugate (e.g., DSPE-PEG), a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide), and a therapeutic agent (e.g., rilpivirine). In certain embodiments, the lipid nanoparticle comprises a zwitterionic lipid (e.g., PC), a PEG-lipid conjugate (e.g., DSPE-PEG), a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide), and an imaging agent (e.g., CuInEuS?). In certain embodiments, the lipid nanoparticle comprises a zwitterionic lipid (e.g., PC), a PEG-lipid conjugate (e.g., DSPE-PEG), a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide), a therapeutic agent (e.g., rilpivirine), and an imaging agent (e.g., CuInEuS?). In certain embodiments, the lipid nanoparticle comprises: a) a zwitterionic lipid (e.g., PC) in an amount of about 35% to 55% by weight; b) a PEG- lipid conjugate (e.g., DSPE-PEG) in an amount of about 10% to 30% by weight; c) a PEG-lipid conjugate linked to a CCR5 targeting moiety (e.g., DSPE-PEG-CCR5 peptide) in an amount of about 1% to about 2.5% by weight; and d) a therapeutic agent (e.g., rilpivirine) in an amount of about 25% to 45% by weight and/or an imaging agent (e.g., CuInEuS?) in an amount of about 0.5% to 5% by weight, wherein the total weight percentage does not exceed 100%.
In certain embodiments, the lipid nanoparticles further comprise a therapeutic agent and/or imaging agent. In certain embodiments, the lipid nanoparticles coat, package, encapsulate, and/or encompass a therapeutic agent and/or imaging agent. In certain embodiments, the therapeutic agent and/or imaging agent is contained within the interior of the lipid nanoparticle and/or within a lipid layer of the lipid nanoparticle. In certain embodiments, the therapeutic agent and/or imaging agent is linked or conjugated to a lipid of the lipid nanoparticle (e.g., conjugated to a PEG-lipid conjugate).
The imaging agents of the instant invention may be molecular imaging agents and/or diagnostic agents. In certain embodiments, the imaging agent is detectable by flow cytometry, single-photon emission computed tomography (SPECT), computed tomography (CT), positron emission tomography (PET), in vivo imaging system (IVIS), confocal microscopy imaging, or magnetic resonance imaging (MRI). In certain embodiments, the imaging agents are PET, SPECT, CT, and/or MRI imaging agents. In certain embodiments, the imaging agent is a nuclear medicine agent (e.g., PET or SPECT radioisotopes). In certain embodiments, the imaging agent is an MRI contrast agent. In certain embodiments, the imaging agent is a fluorescent dye. Examples of imaging agents include, without limitation: optical imaging agents (e.g., near IR dyes (e.g., IRDye 800CW), phorphyrins, anthraquinones, anthrapyrazoles, perylenequinones, xanthenes, cyanines, acridines, phenoxazines, phenothiazines and derivatives thereof), fluorescent compounds (e.g., Alexa Fluor® dyes (e.g., Alexa Fluor® 488), fluorescein, rhodamine, Cy3, Cy5, Cy5.5, Dil, DiO, DID and derivatives thereof), chromophores, paramagnetic or superparamagnetic ions (e g., Gd(III), Eu(III), Dy(III), Pr(III), Pa(IV), Mn(II), Cr(III), Co(III), Fe(III), Cu(II), Ni(II), Ti(III), and V(IV)), magnetic resonance imaging (MRI) contrast agents (e.g., heavy metals, D0TA-Gd3+, DTPA-Gd3+ (gadolinium complex with diethylenetriamine pentaacetic acid)), positron emission tomography (PET) agents (labeled or complexed with nC, 13N, 150, 18F, 64Cu, 68Ga, 89Zr, or 82Rb (e.g., 18F-FDG (fluorodeoxyglucose))), computerized tomography (CT) agents (e.g., iodine or barium containing compounds, e.g., 2,3,5-triiodobenzoic acid), gamma or positron emitters (e.g., "mTc, i nIn, 113In, 153Sm, 123I, 131I, 18F, 64Cu, 177LU 2O1T1, etc., optionally complexed to other compounds (e.g., metal particles), radioisotopes, isotopes, biotin, gold (e.g., nanoparticles), radiolabeled compounds (e.g., radiolabeled nanoparticles), metal particles or nanoparticles (e.g., iron oxide, cobalt ferrite, CuS, quantum dots (QDs), Bismuth nanorods etc.), and/or reporter enzymes or proteins. In a particular embodiment, the fluorescent imaging agent is DiD (DiIC18 (5); l,l'-dioctadecyl-3, 3, 3', 3'- tetramethylindodicarbocyanine, 4- chlorobenzenesulfonate salt). In certain embdoiments, the imaging agent is a radiolabeled europium doped cobalt ferrite (CFEu) nanoparticle (e.g., 177Lu/89ZrCFEu nanoparticle). In certain embodiments, the imaging agent is CulnEuS?. In certain embodiments, the imaging agent is a cyanine (e.g., Cy5.5).
The therapeutic agents of the instant invention may be antiviral agents. In certain embodiments, the therapeutic agent is an antiretroviral agent. In certain embodiments, the therapeutic agent is a non-nucleoside reverse transcriptase inhibitor, nucleoside reverse transcriptase inhibitor, protease inhibitor, fusion inhibitor, or integrase inhibitor. In certain embodiments, the therapeutic agent is rilpivirine (RPV). Therapeutic agents of the instant invention include, but are not limited to: small molecules, peptides, proteins, nucleoside and nucleotide analogs, prodrugs, nanoformulated drugs (such as nanoformulated antiretroviral compounds), and DNA and/or RNA based molecules such as siRNAs, miRNAs, antisense, and CRISPR/Cas9 constructs including, for example, gRNA. Examples of therapeutic agents include, but are not limited to, compounds disclosed in WO 2017/223280, WO 2020/086555, WO 2016/057866, WO 2019/140365, WO 2019/199756, and WO 2020/112931, each incorporated by reference herein.
The therapeutic agents may be antiviral agents. Antiretroviral agents may be effective against or specific to lentiviruses. Lentiviruses include, without limitation, human immunodeficiency virus (HIV) (e.g., HIV-1, HIV-2), bovine immunodeficiency virus (BIV), feline immunodeficiency virus (FIV), simian immunodeficiency virus (SIV), and equine infectious anemia virus (EIA). In a particular embodiment, the therapeutic agent is an anti-HIV agent. An anti-HIV agent may be a compound which inhibits HIV, such as, for example, by inhibiting HIV replication and/or infection. Examples of anti-HIV agents include, without limitation:
(I) Nucleoside reverse transcriptase inhibitors (NRTIs). NRTIs refer to nucleosides and nucleotides and analogues thereof that inhibit the activity of reverse transcriptase, particularly HIV-1 reverse transcriptase. NRTIs typically comprise a sugar and base. Examples of nucleoside-analog reverse transcriptase inhibitors include, without limitation, adefovir dipivoxil, adefovir, lamivudine, telbivudine, entecavir, tenofovir, stavudine, abacavir, didanosine, emtricitabine, zalcitabine, and zidovudine.
(II) Non-nucleoside reverse transcriptase inhibitors (NNRTIs). NNRTIs bind to and block reverse transcriptase, particularly the HIV reverse transcriptase. NNRTI may be allosteric inhibitors which bind (e.g., reversibly) at a nonsubstratebinding site on reverse transcriptase (e.g., thereby altering the shape of the active site or blocking polymerase activity). Examples of NNRTIs include, without limitation, delavirdine (DLV, BHAP, U-90152; Rescriptor®), efavirenz (EFV, DMP-266, SUSTIVA®), nevirapine (NVP, Viramune®), PNU- 142721, capravirine (S-l 153, AG-1549), emivirine (+)-calanolide A (NSC-675451) and B, etravirine (ETR, TMC-125, Intelence®), rilpivirne (RPV, TMC278, Edurant™), DAPY (TMC120), doravirine (Pifeltro™), BILR-355 BS, PHI-236, and PHI-443 (TMC- 278).
(III) Protease inhibitors (PI). Protease inhibitors are inhibitors of a viral protease, particularly the HIV-1 protease. Examples of protease inhibitors include, without limitation, darunavir, amprenavir (141W94, AGENERASE®), tipranivir (PNU-140690, APTIVUS®), indinavir (MK-639; CRIXIVAN®), saquinavir (INVIRASE®, FORTOVASE®), fosamprenavir (LEXIVA®), lopinavir (ABT- 378), ritonavir (ABT-538, NORVIR®), atazanavir (REYATAZ®), nelfinavir (AG- 1343, VIRACEPT®), lasinavir (BMS-234475/CGP-61755), BMS-2322623, GW- 640385X (VX-385), AG-001859, and SM-309515.
(IV) Fusion or entry inhibitors. Fusion or entry inhibitors are compounds, such as peptides, which block HIV entry into a cell (e.g., by binding to HIV envelope protein and blocking the structural changes necessary for the virus to fuse with the host cell). Examples of fusion inhibitors include, without limitation, CCR5 receptor antagonists (e.g., maraviroc (Selzentry®, Celsentri)), enfuvirtide (INN, FUZEON®), T-20 (DP-178, FUZEON®) and T-1249.
(V) Integrase inhibitors (integrase-strand transfer inhibitors (INSTIs)). Integrase inhibitors are a class of antiretroviral drug designed to block the action of integrase (e.g., HIV integrase), a viral enzyme that inserts the viral genome into the DNA of the host cell. Examples of integrase inhibitors include, without limitation, cabotegravir (CAB), raltegravir (RAL), elvitegravir (EVG), dolutegravir (DTG), bictegravir (BIC), BI 224436, and MK-2048.
Anti-HIV compounds also include maturation inhibitors (e.g., bevirimat). Maturation inhibitors are typically compounds which bind HIV Gag and disrupt its processing during the maturation of the virus. Anti-HIV compounds also include HIV vaccines such as, without limitation, ALVAC® HIV (vCP1521), AIDSVAX®B/E (gpl20), and combinations thereof. Anti-HIV compounds also include HIV antibodies (e.g., antibodies against gpl20 or gp41), particularly broadly neutralizing antibodies.
More than one anti-HIV agent may be used, particularly where the agents have different mechanisms of action (as outlined above). For example, anti-HIV agents which are not NNRTIs may be combined with NNRTI drugs. In a particular embodiment, the anti-HIV agents include agents used in highly active antiretroviral therapy (HA ART). The therapeutic can be a prodrug or nanoformulated drug. Examples of prodrugs and nanoformulated drugs include long acting formulations of antiretrovirals and include those described in PCT/US2019/063498, PCT/US2019/057406, WO 2019/199756, WO 2019/140365, U.S. Patent Application No. 16/304,759, each of the foregoing incorporated by reference herein.
In certain embodiments, the therapeutic agent is a gene editing tool. In certain embodiments, the lipid nanoparticles of the instant invention comprise at least one gene editing tool. The therapeutic agent may be a gene editing tool to excise or delete all or part of the viral genome within a cell, particularly the HIV-1 genome, particularly the integrated HIV-1 genome. The viral genome can be edited, excised, or deleted using any method known in the art such as, without limitation: zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), clustered regularly interspaced short palindromic repeats (CRISPRs), and meganucleases. In certain embodiments, CRISPR is utilized.
Clustered, regularly interspaced, short palindromic repeat (CRISPR)/Cas9 (e.g., from Streptococcus pyogenes) technology and gene editing are well known in the art (see, e.g., Shi et al. (2015) Nat. Biotechnol., 33(6):661-7; Sander et al. (2014) Nature Biotech., 32:347-355; Jinek et al. (2012) Science, 337:816-821; Cong et al. (2013) Science 339:819-823; Ran et al. (2013) Nature Protocols 8:2281-2308; Mali et al. (2013) Science 339:823-826; Sapranauskas et al. (2011) Nucleic Acids Res. 39:9275-9282; Nishimasu et al. (2014) Cell 156(5):935-49; Swarts et al. (2012) PLoS One, 7:e35888; Sternberg et al. (2014) Nature 507(7490):62-7; addgene.org/crispr/guide). Typically, the RNA-guided CRISPR/Cas9 system involves using Cas9 along with a guide RNA molecule (gRNA). Guidelines and computer-assisted methods for generating gRNAs are available and well known in the art (see, e.g, CRISPR Design Tool (crispr.mit.edu); Hsu et al. (2013) Nat. Biotechnol. 31 :827-832; addgene.org/CRISPR; and CRISPR gRNA Design tool - DNA2.0 (dna20.com/eCommerce/startCas9)). gRNAs bind and recruit Cas9 to a specific target sequence (e.g., viral genome) where it mediates a double strand DNA (dsDNA) break. More than one gRNA (e.g., two) may be administered to make multiple breaks within the target nucleic acid. The double strand break can be repaired by non-homologous end joining (NHEJ) pathway yielding a deletion of the target nucleic acid. While CRISPR is described herein as utilizing Cas9, other nucleases such as other Cas proteins or Cas9 variants and homologs can be used. In certain embodiments, the Cas protein is a Cas9, CasPhi (Cas <I>), Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl Csy2, Csy3, CaslO, Csm2, Cmr5, CaslO, Csxl 1, CsxlO, Csfl, Csn2, Cas4, C2cl, C2c3, Cas 12a (Cpfl), Cas 12b, Casl2e, Cas 13 a, Cas 13, Cas 13c, or Cas 13d. Other examples include, without limitation, Streptococcus pyogenes Cas9, Cas9 D10A, high fidelity Cas9 (KI einstiver et al. (2016) Nature, 529:490-495; Slaymaker et al. (2016) Science, 351 :84-88), Cas9 nickase (Ran et al. (2013) Cell, 154: 1380-1389), Streptococcus pyogenes Cas9 with altered PAM specificities (e.g., SpCas9_VQR, SpCas9_EQR, and SpCas9_VRER; Kleinstiver et al. (2015) Nature, 523:481-485), Staphylococcus aureus Cas9, casl2a (Cpfl) (Rusk, N., Nat. Methods (2019) 16(3):215), the CRISPR/Cpfl system of Acidaminococcus. and the CRISPR/Cpfl system of Lachnospiraceae . In certain embodiments, the Cas9 is S. pyogenes Cas9.
The binding specificity of the CRISPR/Cas9 complex depends on two different elements. First, the binding complementarity between the targeted sequence (e.g., viral genome) and the complementary recognition sequence of the gRNA (e.g., -18-22 nucleotides, particularly about 20 nucleotides). Second, the presence of a protospacer-adjacent motif (PAM) juxtaposed to the target DNA/gRNA complementary region (Jinek et al. (2012) Science 337:816-821; Hsu et al. (2013) Nat. Biotech., 31 :827-832; Sternberg et al. (2014) Nature 507:62-67). The PAM motif for S. Pyogenes Cas9 has been fully characterized, and is NGG or NAG (Jinek et al. (2012) Science 337:816-821; Hsu et al. (2013) Nat. Biotech., 31 : 827-832). Other PAMs of other Cas9 proteins are also known (see, e.g., addgene.org/crispr/guide/ #pam-table). Examples of PAM sequences include, without limitation: S. pyogenes (spCas9) - NGG; S. aureus Cas9 (saCas9) - NNGRRT or NGRRN; Neisseria meningitidis (NmeCas9) -NNNNGATT; Campylobacter jejuni (CjCas9) - NNNNRYAC; Streptococcus thermophilus (StCas9) - NNAGAAW; Lachnospiraceae bacterium (LbCpfl) - TTTV; and Acidaminococcus sp. (AsCpfl) - TTTV. Typically, the PAM sequence is 3’ of the target sequence in the genomic sequence.
The guide RNA may comprise separate nucleic acid molecules wherein one RNA may specifically hybridize to a target sequence (crRNA) and another RNA (trans-activating crRNA (tracrRNA)) specifically hybridizes with the crRNA. The crRNA and a tracrRNA may be bound together. The gRNA binds to a Cas enzyme (e.g., Cas9) and guides the Cas enzyme to the target sequence. As used herein, the term “crRNA” means a non-coding short RNA sequence which binds to a complementary target DNA sequence. The crRNA sequence may bind to a Cas enzyme (e.g., Cas9) and the crRNA sequence guides the complex via pairing to a specific target DNA sequence. As used herein, the term “tracrRNA” or transactivating CRISPR RNA means an RNA sequence that base pairs with the crRNA (e.g., a scaffold sequence to form a functional guide RNA (gRNA)). The tracrRNA sequence binds to a Cas enzyme (e.g., Cas9), while the crRNA sequence of the gRNA directs the complex to a target sequence. Any suitable tracrRNA sequence is contemplated for use with a gRNA disclosed herein (e.g., 5’-GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGUC CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGCUUUU; SEQ ID NO: 18).
In certain embodiments, the guide RNA is a single molecule (sgRNA) which comprises a sequence (crRNA; complementary sequence) which specifically hybridizes (e.g., complete complementary) with a target sequence and a sequence (e.g., a tracrRNA sequence; scaffold sequence) recognized by Cas9, which are well known in the art. In other words, an sgRNA is a single RNA construct comprising a crRNA sequence and a tracrRNA sequence. Fore simplicity, the term gRNA is generally used herein to encompass sgRNA unless the context clearly dictates otherwise. The greater the complementarity reduces the likelihood of undesired cleavage events at other sites of the genome. In a particular embodiment, the region of complementarity (e.g., between a guide RNA (or crRNA) and a target sequence) is at least about 10, at least about 12, at least about 15, at least about 17, at least about 20, at least about 25, at least about 30, at least about 35, or more nucleotides. In a particular embodiment, the region of complementarity (e.g., between a guide RNA and a target sequence) is about 15 to about 25 nucleotides, about 15 to about 23 nucleotides, about 16 to about 23 nucleotides, about 17 to about 21 nucleotides, about 18 to about 22 nucleotides, or about 20 nucleotides. In a particular embodiment, the guide RNA (or crRNA) targets a sequence or comprises a sequence (e.g., RNA version) which has at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity to the target sequence. In certain embodiments, the gRNA (or crRNA) targets (and inactivates or deletes) all or part of integrated HIV-1 DNA. In certain embodiments, the gRNA (or crRNA) targets (and inactivates or deletes) all or part of the transactivator of transcription (tat) gene. In certain embodiments, at least two different gRNA (or crRNA) are used. For example, one gRNA (or crRNA) may target the transactivator of transcription (tat) gene and the other gRNA (or crRNA) may target another region of the integrated HIV-1 genome (e.g., a region other than LTR). In a particular embodiment, at least one of the CRISPR and gRNA (or crRNA) are selected from those described in Dash et al. (Nat. Comm. (2019) 10( 1 ):2753 or WO 2021/178924), each incorporated by reference herein.
In certain embodiments, the gRNA or crRNA may be constructed from a multiple sequence alignment of separate viral strains and/or bind to a plurality of nucleic acids of an overlapping exon. In certain embodiments, the overlapping exon is part of a nucleic acid sequence of at least two HIV genes (e.g., HIV-1 genes). In certain embodiments, the HIV (e.g., HIV-1) genes are selected from the group consisting of: tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef. In certain embodiments, the overlapping exon is part of a nucleic acid sequence of at least three HIV (e.g., HIV-1) genes selected from the group consisting of: tat, rev, env- gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef. In certaion embodiments, the overlapping exon is part of a nucleic acid sequence of HIV (e.g., HIV-1) genes tat, rev, and env.
In certain embodiments, the crRNA or gRNA comprises one of the following nucleic acid sequences and/or targets the indicated sequence:
1) UAGAUCCUAACCUAGAGCCC (SEQ ID NO: 2; TatA2), wherein the target DNA complementary sequence is TAGATCCTAACCTAGAGCCC (SEQ ID NO: 3);
2) UCUCCUAUGGCAGGAAGAAG (SEQ ID NO: 4; TatD), wherein the target DNA complementary sequence is TCTCCTATGGCAGGAAGAAG (SEQ ID NO: 5);
3) GAAGGAAUCGAAGAAGAAGG (SEQ ID NO: 6, TatE), wherein the target DNA complementary sequence is GAAGGAATCGAAGAAGAAGG (SEQ ID NO: 7);
4) GAAAGAAUCGAAGAAGGAGG (SEQ ID NO: 8; TatE2), wherein the target DNA complementary sequence is GAAAGAATCGAAGAAGGAGG (SEQ ID NO: 9); 5) CCGAUUCCUUCGGGCCUGUC (SEQ ID NO: 10; TatF), wherein the target DNA complementary sequence is CCGATTCCTTCGGGCCTGTC (SEQ ID NO: 11);
6) UCUCCGCUUCUUCCUGCCAU (SEQ ID NO: 12; TatG), wherein the target DNA complementary sequence is TCTCCGCTTCTTCCTGCCAT (SEQ ID NO: 13);
7) GCUUAGGCAUCUCCUAUGGC (SEQ ID NO: 14; TatH), wherein the target DNA complementary sequence is GCTTAGGCATCTCCTATGGC (SEQ ID NO: 15); and
8) GGCUCUAGGUUAGGAUCUAC (SEQ ID NO: 16; Tati), wherein the target DNA complementary sequence is GGCTCTAGGTTAGGATCTAC (SEQ ID NO: 17).
In certain embodiments, the crRNA or gRNA comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 97% identical to one of the sequences set forth above (e.g., SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, or 16).
CRISPR can be incorporated into lipid nanoparticles in various ways. In certain embodiments, the lipid nanoparticle comprises at least one Cas (e.g., the protein and/or a nucleic acid molecule encoding Cas) and at least one gRNA, crRNA, and/or tracrRNA or a nucleic acid molecule encoding the gRNA, crRNA, and/or tracrRNA. In certain embodiments, the lipid nanoparticle comprises at least one gRNA, crRNA, and/or tracrRNA or a nucleic acid molecule encoding the gRNA, crRNA, and/or tracrRNA (e.g., the Cas or a nucleic acid molecule encoding Cas can be delivered separately).
In certain embodiments, the crRNA, gRNA, tracrRNA, and/or nucleic acid sequence encoding the Cas protein is part of any suitable delivery vehicle. In certain embodiments, the delivery vehicle is a plasmid. In certain embodiments, the delivery vehicle is a viral vector. In certain embodiments, the nucleic acid sequence encoding the Cas protein is contained in a viral vector. In certain embodiments, the viral vector is an adenovirus, an adeno-associated virus (AAV), a retrovirus, or a herpesvirus. In certain embodiments, the viral vector is an adeno-associated virus (AAV), such as AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV- 8, AAV-9, AAV- 10, AAV-11, AAV-12, AAV-13 or AAV rh.74.
The instant invention also encompasses compositions (e.g., pharmaceutical compositions) comprising at least one lipid nanoparticle of the instant invention and at least one carrier (e.g., pharmaceutically acceptable carrier). As stated hereinabove, the lipid nanoparticles may comprise more than one therapeutic and/or imaging agent. In certain embodiments, the pharmaceutical composition comprises a first lipid nanoparticle comprising a first therapeutic and a second lipid nanoparticles comprising a second therapeutic, wherein the first and second therapeutics are different. In certain embodiments, the pharmaceutical composition comprises a first lipid nanoparticle comprising a first imaging agent and a second lipid nanoparticle comprising a second imaging agent, wherein the first and second imaging agents are different. In certain embodiments, the pharmaceutical composition comprises a first lipid nanoparticle comprising a therapeutic agent and a second lipid nanoparticle comprising an imaging agent. The compositions (e.g., pharmaceutical compositions) of the instant invention may further comprise (e.g., not contained within the lipid nanoparticles) other therapeutic agents (e.g., other anti-HIV compounds).
In accordance with another aspect of the instant invention, the lipid nanoparticles of the instant invention may be used to deliver at least one therapeutic and/or imaging agent to a cell or a subject (including non-human animals). The present invention also encompasses methods for preventing (e.g., prophylactically protecting), inhibiting, and/or treating and/or tracking or monitoring (e.g., in real time) a viral infection, particularly an HIV infection. In certain embodiments, the methods comprise administering lipid nanoparticles of the instant invention (optionally in a composition) to a subject in need thereof. The methods may further comprise (in the context of tracking and/or monitoring the viral infection) detecting the molecular imaging agent (e.g., in said subject). Monitoring and tracking the viral infection can also be used for tracking the effectiveness of a therapy. Monitoring and tracking the viral infection can also be used for detecting, monitoring, and/or observing HIV viral reservoirs. As explained herein, the lipid nanoparticles of the present invention contain both a therapeutic and a molecular imaging agent and allows for both treating and imaging the viral infection.
In certain embodiments, the methods further comprise disrupting the blood brain barrier. In certain embodiments, the methods further comprise administering an agent or therapy to disrupt the blood brain barrier of the subject (e.g., prior to, after, and/or at same time as the administration of lipid nanoparticles). In certain embodiments, the method further comprises administering ultrasound (e.g., focused ultrasound) to the subject (e.g., to the brain or blood brain barrier), optionally with the administration of microbubbles (e.g., intravenously).
Viral infections to be treated and/or monitored by the instant invention include, but are not limited to infections by: HIV, flavivirus, togaviruses, non-HIV retroviruses, lentiviruses, coronaviruses, orthomyxoviruses, paramyxovirus, rhabdoviruses, filoviruses, arenaviruses, bunyaviruses, and delta viruses. In a particular embodiment, the viral infection is a retroviral infection or a lentiviral infection. In a particular embodiment, the viral infection is a HIV infection.
The lipid nanoparticles of the instant invention (optionally in a composition) can be administered to an animal, in particular a mammal, more particularly a human, in order to treat/inhibit/prevent the viral infection (e.g., a retroviral infection such as an HIV infection). The pharmaceutical compositions of the instant invention may also comprise at least one other therapeutic agent such as an antiviral agent, particularly at least one other anti-HIV compound/agent. The additional anti-HIV compound may also be administered in a separate pharmaceutical composition from the lipid nanoparticles or compositions of the instant invention. The pharmaceutical compositions may be administered at the same time or at different times (e.g., sequentially).
The dosage ranges for the administration of the lipid nanoparticles and/or compositions of the invention are those large enough to produce the desired effect (e.g., curing, relieving, treating, and/or preventing the viral infection (e.g., HIV infection), the symptoms of it (e.g., AIDS, ARC), or the predisposition towards it). The dosage should not be so large as to cause significant adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any counter indications.
The lipid nanoparticles described herein will generally be administered to a patient as a pharmaceutical composition. The term “patient” as used herein refers to human or animal subjects. These lipid nanoparticles may be employed therapeutically, under the guidance of a physician.
The pharmaceutical compositions comprising the lipid nanoparticles of the instant invention may be conveniently formulated for administration with any pharmaceutically acceptable carrier(s). For example, the complexes may be formulated with an acceptable medium such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents, or suitable mixtures thereof, particularly an aqueous solution. The concentration of the lipid nanoparticles in the chosen medium may be varied and the medium may be chosen based on the desired route of administration of the pharmaceutical composition. Except insofar as any conventional media or agent is incompatible with the lipid nanoparticles to be administered, its use in the pharmaceutical composition is contemplated.
The dose and dosage regimen of lipid nanoparticles according to the invention that are suitable for administration to a particular patient may be determined by a physician considering the patient’s age, sex, weight, general medical condition, and the specific condition for which the lipid nanoparticles are being administered and the severity thereof. The physician may also take into account the route of administration, the pharmaceutical carrier, and the lipid nanoparticle’s biological activity.
Selection of a suitable pharmaceutical composition will also depend upon the mode of administration chosen. For example, the lipid nanoparticles of the invention may be administered by direct injection or intravenously. In this instance, a pharmaceutical composition comprises the lipid nanoparticles dispersed in a medium that is compatible with the site of injection.
Lipid nanoparticles of the instant invention may be administered by any method. For example, the lipid nanoparticles of the instant invention can be administered, without limitation parenterally, subcutaneously, orally, topically, pulmonarily, rectally, vaginally, intravenously, intraperitoneally, intrathecally, intracerbrally, epidurally, intramuscularly, intradermally, or intracarotidly. Lipid nanoparticles of the present invention may be administered to a subject in need by any appropriate route including but not limited to enteral, gastroenteral, oral, transdermal, subcutaneous, nasal, intravenous, intravenous bolus, intravenous drip, intraarterial, intramuscular, transmucosal, insufflation, sublingual, buccal, conjunctival, cutaneous, and intrathecal. In a particular embodiment, the lipid nanoparticles are administered parenterally. In a particular embodiment, the lipid nanoparticles are administered orally, intramuscularly, subcutaneously, or to the bloodstream (e.g., intravenously). In a particular embodiment, the lipid nanoparticles are administered intramuscularly or subcutaneously. Pharmaceutical compositions for injection are known in the art. If injection is selected as a method for administering the lipid nanoparticles, steps must be taken to ensure that sufficient amounts of the molecules or cells reach their target cells to exert a biological effect. Dosage forms for parenteral administration include, without limitation, solutions, emulsions, suspensions, dispersions and powders/granules for reconstitution.
Pharmaceutical compositions containing lipid nanoparticles of the present invention as the active ingredient in intimate admixture with a pharmaceutically acceptable carrier can be prepared according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of pharmaceutical composition desired for administration, e.g., intravenous, oral, direct injection, intracranial, and intravitreal.
A pharmaceutical composition of the invention may be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, refers to a physically discrete unit of the pharmaceutical composition appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art.
Dosage units may be proportionately increased or decreased based on the weight of the patient. Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art.
In accordance with the present invention, the appropriate dosage unit for the administration of lipid nanoparticles may be determined by evaluating the toxicity of the molecules or cells in animal models. Various concentrations of lipid nanoparticles in pharmaceutical composition may be administered to mice, and the minimal and maximal dosages may be determined based on the beneficial results and side effects observed as a result of the treatment. Appropriate dosage unit may also be determined by assessing the efficacy of the lipid nanoparticle treatment in combination with other standard drugs. The dosage units of lipid nanoparticles may be determined individually or in combination with each treatment according to the effect detected. The pharmaceutical composition comprising the lipid nanoparticles may be administered at appropriate intervals until the pathological symptoms are reduced or alleviated, after which the dosage may be reduced to a maintenance level. The appropriate interval in a particular case would normally depend on the condition of the patient.
Definitions
The following definitions are provided to facilitate an understanding of the present invention.
The singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.
“Pharmaceutically acceptable” indicates approval by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
A “carrier” refers to, for example, a diluent, adjuvant, preservative (e.g., Thimersol, benzyl alcohol), anti-oxidant (e.g., ascorbic acid, sodium metabisulfite), solubilizer (e.g., polysorbate 80), emulsifier, buffer (e.g., Tris HC1, acetate, phosphate), antimicrobial, bulking substance (e.g., lactose, mannitol), excipient, auxiliary agent or vehicle with which an active agent of the present invention is administered. Pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin. Water or aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin (Mack Publishing Co., Easton, PA); Gennaro, A. R., Remington: The Science and Practice of Pharmacy, (Lippincott, Williams and Wilkins); Liberman, et al., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y.; and Kibbe, et al., Eds., Handbook of Pharmaceutical Excipients, American Pharmaceutical Association, Washington.
The term “prodrug” refers to a compound that is metabolized or otherwise converted to a biologically active or more active compound or drug, typically after administration. A prodrug, relative to the drug, is modified chemically in a manner that renders it, relative to the drug, less active, essentially inactive, or inactive. However, the chemical modification is such that the corresponding drug is generated by metabolic or other biological processes, typically after the prodrug is administered.
The term “treat” as used herein refers to any type of treatment that imparts a benefit to a patient afflicted with a disease, including improvement in the condition of the patient (e.g., in one or more symptoms), delay in the progression of the condition, etc. In a particular embodiment, the treatment of a viral infection results in at least an inhibition/reduction in the number of infected cells and/or detectable viral levels.
As used herein, the term “prevent” refers to the prophylactic treatment of a subject who is at risk of developing a condition (e.g., viral infection) resulting in a decrease in the probability that the subject will develop the condition.
A “therapeutically effective amount” of a compound or a pharmaceutical composition refers to an amount effective to prevent, inhibit, treat, or lessen the symptoms of a particular disorder or disease. The treatment of a viral infection herein may refer to curing, relieving, and/or preventing the viral infection, the symptom(s) of it, or the predisposition towards it.
As used herein, the term “therapeutic agent” refers to a chemical compound or biological molecule including, without limitation, nucleic acids, peptides, proteins, and antibodies that can be used to treat a condition, disease, or disorder or reduce the symptoms of the condition, disease, or disorder.
As used herein, the term “small molecule” refers to a substance or compound that has a relatively low molecular weight (e.g., less than 4,000, less than 2,000, particularly less than 1 kDa or 800 Da). Typically, small molecules are organic, but are not proteins, polypeptides, or nucleic acids, though they may be amino acids or dipeptides.
The term “antimicrobials” as used herein indicates a substance that kills or inhibits the growth of microorganisms such as bacteria, fungi, viruses, or protozoans.
As used herein, the term “antiviral” refers to a substance that destroys a virus and/or suppresses replication (reproduction) of the virus. For example, an antiviral may inhibit and or prevent: production of viral particles, maturation of viral particles, viral attachment, viral uptake into cells, viral assembly, viral release/budding, viral integration, etc. As used herein, the term “highly active antiretroviral therapy” (HAART) refers to HIV therapy with various combinations of therapeutics such as nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, HIV protease inhibitors, and fusion inhibitors.
As used herein, the term “amphiphilic” means the ability to dissolve in both water and lipids/apolar environments. Typically, an amphiphilic compound comprises a hydrophilic portion and a hydrophobic portion. “Hydrophobic” designates a preference for apolar environments (e.g., a hydrophobic substance or moiety is more readily dissolved in or wetted by non-polar solvents, such as hydrocarbons, than by water). “Hydrophobic” compounds are, for the most part, insoluble in water. As used herein, the term “hydrophilic” means the ability to dissolve in water.
As used herein, the term “polymer” denotes molecules formed from the chemical union of two or more repeating units or monomers. The term “block copolymer” most simply refers to conjugates of at least two different polymer segments, wherein each polymer segment comprises two or more adjacent units of the same kind.
An “antibody” or “antibody molecule” is any immunoglobulin, including antibodies and fragments thereof (e.g., scFv), that binds to a specific antigen. As used herein, antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions of an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule.
As used herein, the term “immunologically specific” refers to proteins/polypeptides, particularly antibodies, that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
The following example provides illustrative methods of practicing the instant invention and is not intended to limit the scope of the invention in any way.
EXAMPLE
Materials and Methods
Materials Copper (II) chloride dihydrate (307483), indium (III) chloride (334065), europium (III) chloride hexahydrate (203254), thioacetamide (163678), oleic acid (364525), oleylamine (969831), 1-octadecene (O806-1L), L-a-phosphatidylcholine (PC) (from egg yolk), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), were obtained from Sigma Aldrich (St. Louis, MO). Phorbol 12-myristate 13-acetate (PMA; P8138), 1-octanol, paraformaldehyde (PF A), were also obtained from Sigma Aldrich. Dulbecco’s modified eagle’s medium (DMEM) containing glucose (4.5 g/L), phosphate-buffered saline (PBS), gentamicin, L-glutamine, sodium pyruvate, AcroMetrix™ EDTA Plasma Dilution Matrix (S2284) were purchased from Thermo Fisher Scientific/Gibco (Waltham, MA). Heat-inactivated pooled human serum was purchased from Innovative Biologies (Herndon, VA). Cell Titer Blue™ (CTB; G8080) was purchased from Promega (Madison, WI). Rilpivirine (RPV; A904176) was purchased from Amadis Chemical (Zhejiang, China). 1,20-distearoyl-phosphatidylethanolaminemethyl-polyethyleneglycol conjugate 2000 (DSPE-PEG2000), DSPE-PEG2000 carboxy NHS and DSPE- PEG(2000)-N-Cy5.5 were purchased from Avanti Polar Lipids (Birmingham, AL). The CCR5 targeting peptide, D-Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-NH2 (SEQ ID NO: 1) was purchased from P3 BioSystems (Louisville, KA). The radioactive 64 copper chloride (64CuCh) was requested and delivered from the Washington University School of Medicine MIR cyclotron facility (St. Louis, MO).
Synthesis of radioactive nanoprobes
The multimodal nanoprobe particles were prepared by the solvothermal method. At first, the thioacetamide (15.026 mg, 2 mmol) and oleylamine (6 mL) were taken in a 20 mL glass vial, and the reaction mixture was sonicated for 2 minutes (operated at 20%, Cole-Parmer® 750 W model CPX750, IL). In a separate vial, indium (III) chloride dihydrate (22.118 mg, 1 mmol), europium (III) chloride hexahydrate (36.64 mg, 1 mmol), 1-octadecene (10 mL), and oleic acid (6 mL) were homogenized by vigorous stirring. The homogeneous solution was transferred to the reaction mixture and further probe sonicated for 5 minutes. Subsequently, the copper (II) chloride dihydrate (34.09 mg, 2 mmol) was also added to the reaction mixture. The reaction mixture was quickly transferred to the Teflon™-lined hydrothermal autoclave and heated at 280°C for 8 hours. After the autoclave cooled down to room temperature, the crude reaction mixture was dispersed in ethanol (50 mL) by sonication. The solution was then spun down (950 x g for 30 minutes at 20°C) and the supernatant was decanted off. This ethanol -washing step was repeated thrice to remove unreacted starting materials. The particles were then stored in a desiccator for future use. To make the radioactive nanoprobe, the copper (II) chloride was substituted with radioactive copper (II)-64 chloride.
The bulk morphology and crystal lattice structure of the CuInEuS? nanoprobe were characterized by high-resolution transmission electron microscopy and selected area electron diffraction, respectively. The elemental composition and chemical color mapping were analyzed by energy-dispersive X-ray spectroscopy and scanning transmission electron microscopy (STEM) with high-angle annular darkfield (HAADF) (FEI Tecnai Osiris™ S/TEM operated at 200 kV), respectively. The nanoprobe’s surface composition and crystal structure were analyzed by XPS (Thermo Fisher Scientific, Waltham, MA) and powder XRD (Rigaku SmartLab Diffractometer, Rigaku Corporation, Tokyo, Japan). The thermal property was analyzed by differential scanning calorimetry (NETZSCH DSC 204 Fl Phoenix®, Waldkraiburg, Bayern, Germany) and thermogravimetric analysis (NETZSCH TGA 209 Fl Libra® system, Waldkraiburg, Bayern, Germany).
Synthesis of CCR5 peptide conjugated DSPE-PEG-CCR5 formulations
A linear peptide with a sequence of D-Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr- NH2 (SEQ ID NO: 1) was selected as a CCR5-receptor targeting ligand. The free amine group of the peptide was conjugated with PEG lipid, DSPE-PEG2000 carboxy NHS via an activated acid-amine coupling reaction. The reaction was conducted in a Schlenk tube by dissolving the peptide (3.57 mg, 4.15 pmol) in anhydrous DMSO (250 pL) followed by the addition of DIP A (10 pL). After 30 minutes of reaction at room temperature, DMSO dissolved DSPE-PEG2000 carboxy NHS (10 mg, 3.47 pmol) was added to the reaction mixture and allowed to stir for the next 24 hours. The completion of the reaction was examined by thin-layer chromatography using 1 :5 (v/v) MeOH/DCM as eluent. After the completion, the crude reaction mixture was dialyzed (cellulose acetate, MWCO 3.5kDa) against deionized (DI) water to remove the unconjugated peptide. The lyophilization of the dialyzed product ensued in a floppy white solid, further characterized by 'H NMR spectroscopy.
LNPs formulation and their physicochemical properties LNPs were formulated by rapidly mixing the lipid and aqueous phases in the microfluidic device. To formulate CCR5-targeted and RPV-encapsulated LNPs (LNP-RPV-CCR5), L-a-phosphatidylcholine (PC, 45 wt%), DSPE-PEG2000 (17.5 wt%), RPV (37 wt%), and DSPE-PEG-CCR5 (0.5 wt%) were combined in the lipid phase and the microfluidization (Precision Nanosystem) was performed with PBS as an aqueous phase (Table 1). The LNP without CCR5 ligand (LNP-RPV) was also formulated and used as a control in various experiments. The existing lipid phase was combined with 1.5 wt% of 64CuInEuS2 to formulate radiolabel LNP and 0.5 wt% of DSPE PEG(2000)-N-Cy5.5 lipid to formulate Cy5.5-dye-labeled LNPs. During LNP formulation, the ratio of the aqueous phase to the lipid phase was maintained at 3 : 1 (v/v), and the total flow rate was held at 12 mL/minute. After microfluidization, the LNPs were purified by dialyzing (3.5-5 kDa cut off, cellulose acetate) against DI water over two days. The purified LNP was further passed through a 40 pm cell strainer to remove the unencapsulated drug precipitate. The size and zeta potential of LNP were measured by DLS (Zetasizer Nano ZS, Malvern). The long-term stability of LNP at 4 °C was evaluated by intermittently measuring their size and zeta potential over a month. The radioactivity of nanoprobe 64CuInEuS2 was measured by gamma-ray scintillation spectrometry (Hidex AMG). To assess the RPV content, the LNPs (50 pL) were sonicated with methanol (250 pL) for 30 minutes and subjected to ultra-high performing liquid chromatography (UPLC, Acquity UPLC H-class® system, Waters Milford, MA). Correspondingly, the Cy 5.5-lipid content in the LNP was calculated by measuring the fluorescence (Ex/Em = 683/703 nm) using a benchtop plate reader (Molecular Devices, SpectraMax® M3, Sunnyvale, CA). The bulk morphology of the LNPs was captured under the transmission electron microscope (TEM, FEI TECNAI G2 Spirit TWIN microscope). To determine the drug loading content (LC), a known volume of LNP solution was lyophilized and the total mass content (drug + lipid) per mL of LNP was evaluated. The LC was determined by following the equation, (RPV per mL x 100)/ total mass of the LNP per mL.
Figure imgf000033_0001
Figure imgf000034_0001
Table 1: A summary of the lipid compositions and physicochemical properties of LNPs. For the biodistribution study, 1.5 wt% CuEulnS? nanoprobe were included in the formulation to track them under positron emission tomography. a Evaluated by using dynamic light scattering. b Determined by using mass spectrometry.
Plasma stability of the radiolabeled LNP
The stability of the radiolabeled LNPs was determined by incubating them in 10% mice plasma at 37°C for 24 hours. After the incubation, the LNP-plasma solution’s total radioactivity was determined by gamma counter. To measure the radioactivity outside the LNP, the LNP-plasma solution was filtered by using centrifugal filtration (Amicon®, 10K molecular-weight cut-off) at 2,000 * g for 15 minutes and measured the radioactivity in the filtrate. The percent of radiolabeling stability was determined as follows: radiolabeling stability (%) = [(total radioactivity) - (radioactivity in the filtrate)] x 100/total radioactivity.
Cell cultures
Monocytes were obtained by leukapheresis from HIV and hepatitis B seronegative donors (Herskovitz, et al. (2021) EBioMedicine 73: 103678). Monocytes were cultured in 10% human serum (heat-inactivated) supplemented Dulbecco’s modified Eagle medium (DMEM) containing glucose (4.5 g/L), L- glutamine (200 mM), sodium pyruvate (1 mM), gentamicin (50 pg/mL), ciprofloxacin (10 pg/mL) and recombinant human macrophage colony-stimulating factor (1,000 U/mL) at 37°C in 5% CO2 incubator. On every other day, half of the culture media was replaced with fresh media and continued for one week to facilitate MDMs. The MDMs were then incubated with PMA (50 ng/mL) containing media for 24 hours and used for ex vivo assays.
Cell viability assay
The effect of LNPs on MDMs cell viability was evaluated by Cell Titer Blue™ (CTB) assay. MDMs containing 96 well plates (1.5 x io5 cells/well) were incubated with LNPs at a dose ranging from 3 to 200 pM equivalent to RPV for 24 hours. After the allotted time, the cells were further incubated with CTB solution (20 pL/well) at 37°C for 2 hours, and fluorescence (Ex/Em = 560/590 nm) intensity was recorded on bench top plate reader (Molecular Devices SpectraMax® M3, SoftMax® Pro 6.2 software). The percentage of cell viability in the treatment group was evaluated by comparing their fluorescence intensity with that of the untreated group. Analogously, the MDM cell viability against MVC was evaluated at a dose ranging from 0.5 to 4 nM.
LNP MDM uptake
To evaluate the uptake, LNPs at doses equivalent to 30 and 100 pM RPV were incubated with MDMs in a 12-well plate (1.0 x io6 cells/well) with and without the pretreatment of MVC (1 nM). The uptake of LNP was determined by the means of RPV uptake. The concentration of RPV in MDMs was measured at 1, 2, 6, 12, and 24 hours of post incubation. At each time point, MDMs were washed and scraped into PBS. The scraped cells were pelleted down by centrifugation and sonicated with HPLC grade methanol (200 pL) to extract the RPV. To remove the cell debris, the methanol solution was further centrifugated (at 5000 x g for 10 minutes), and the supernatant was used to measure RPV concentration by UPLC.
Antiretroviral activity and LNP RPV macrophage retention
HIV-1 RT activity was employed to determine the antiretroviral efficacy. MDMs were challenged with HIV-IADA (1.5 x 104 TCID50/mL) at 0.1 MOI for 8 hours. The cells were then washed with PBS and cultured overnight in fresh media. On the following day, HIV-1 infected cells were treated with LNPs at the dosage of 30 and 100 pM RPV equivalent for 24 hours. The treatment was then removed by PBS wash, and the cells were cultured in fresh media. At 1, 5, 9, 15, 21, and 25 days of post-treatment removal, culture media were collected to analyze the RT activity and the associated cells were harvested to quantitate RPV retention.
Animals
NSG (NOD.Cg-Prkdcscld H2rgtmlwjl/SzJ) mice were obtained from the Jackson Laboratories (Bar Harbor, ME) and bred under specific pathogen-free conditions at the University of Nebraska Medical Center by the ethical guidelines set forth by the National Institutes of Health for the care of laboratory animals. The mice were humanized (hu-mice) by following protocol (Dash, et al. (2023) Proc. Natl. Acad. Sci., 120(19):e2217887120). Humanization was confirmed by flow cytometry analysis of blood immune cells (CD45 and CD3) staining.
LNP biodistribution
PET imaging was performed on hu-mice to assess the real-time biodistribution of radio-labeled (64CuInEuS2) LNPs. The LNPs were injected to humice at the dosage equivalent to 1000 pCi/kg by the tail vein. The biodistribution of radio-labeled LNPs was acquired at 6, 24, and 48 hours of post-injection using the PET bioimaging system (MOLECUBE P-CUBE, NV, Ghent, Belgium). The coregistration of 3D computed tomography (CT) and PET was performed by using VivoQuant™ 3.5 software (Invicro, Boston, MA). At 48 hours post-injection, mice were sacrificed, and major organs were collected, weighed, and measured the radioactivity using gamma scintillation spectrometry (Hidex Automatic Gamma Counter, Turku, Finland). The radioactivity count percent was determined by following the equation: Radioactivity count (%/g) = (organ radioactivity count x 100)/(total radioactivity count x organ weight).
To determine the biodistribution of RPV, the nonradioactive LNPs were injected at the dose of 25 mg/kg equivalent to RPV via the tail vein. At 24 hours of post-injection, mice were sacrificed, and liver, spleen, and blood plasma samples were collected for RPV quantification by electrospray ionization mass spectrometry (Waters ACQUITY H-class UPLC, Xevo® TQ-S micro-mass spectrometer, MA).
To conduct the brain distribution study, hu mice were anesthetized and prepared for the focused ultrasound (FUS) procedure. This involved removing the scalp hair and inserting a 26-gauge intravenous catheter into the tail vein. After stereotaxic localization of the bregma, lOOuL of Definity® microbubble solution (1 : 1000 dilution by volume) was immediately injected before the FUS. The FUS with optimized parameters (500kHz frequency, LOW power, 10% duty cycle, and 75 second duration) was then applied to each mouse hemisphere (+/- 2.5 mm of bregma). After the FUS, LNPs were immediately infused slowly through the tail vein catheter. The animal was then taken to the 9.4 Tesla MR scanner (Biospec® Avance III Bruker MR scanner) for verification of the blood-brain barrier disruption (BBBd) with T1 -weighted MRI before and after intravenous gadolinium infusion (25% dilution). On the following day, the IVIS (Xenogen Corporation, Alameda, CA) was performed to assess the brain distribution of LNPs and compare those with or without FUS. Following perfusion and euthanasia, immunofluorescence evaluations were performed on the brain tissue. This included staining for all nuclei (DAP I), microglia (IBA-1), and human nuclei (HuNu).
HIV-1 suppression in hu-mice
Hu-mice with an average age between 18 to 20 weeks were infected with 1.5 x 104 tissue culture infective doseso (TCID50) of HIV-IADA via intraperitoneal injection. At 2 weeks post-infection, blood samples were collected via submandibular vein bleeding, blood plasma was 10-fold diluted in AcroMetrix™ EDTA plasma dilution matrix (Catalog # S2284, Thermo Scientific) and subjected to viral load determination using automated COBAS® Ampliprep V2.0/Taqman®- 48 system (Roche Molecular Diagnostics, Basel, Switzerland). After confirmation of plasma viral load, mice were separated into three groups: HIV-1 infected, untreated control, LNP-RPV, and LNP-RPV-CCR5. LNPs were injected via tail vein at the dose of 25 mg/kg RPV equivalent. The body weight and plasma viral load were determined on days 0 and 7 and 14 of post-LNP injection. On day 14 of post-LNP injection, the mice were terminated, and blood and major organs collected. Blood samples were used for whole blood cell count (by Abaxis VetScan® HM5) and serum chemistry (by Abaxis VetScan® VS2), and the tissues from the major organs were fixed, paraffin-emedded, and stained with hematoxylin and eosin (H&E). The histological images of different tissues were captured on a Nuance™ EX multispectral imaging system affixed to a Nikon Eclipse E800 microscope.
Statistical analysis
Data are presented as mean ± standard deviation. The statistical difference between the two groups was analyzed using an unpaired t-test. The p < 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism 10.2.2.397 (GraphPad Software, Inc., San Diego, CA).
Results
Synthesis and characterization of64Cu!nEuS2 nanoprobes Theranostic LNPs affirm the simultaneous delivery of a therapeutic drug and an imaging nanoprobe. The theranostic lipid nanoparticles (LNPs) were developed to facilitate the simultaneous delivery of therapeutic agents and imaging probes. Specifically, the antiretroviral drug RPV was chosen as the therapeutic payload, while the radioactive nanoprobe 64CuInEuS2 was selected for imaging purposes. To this end, a CCR5 targeting peptide was conjugated to PEGylated lipid (DSPE-PEG) by an acid amine coupling reaction combined with phosphatidylcholine (PC) and a peptide unconjugated DSPE-PEG to formulate the targeted LNP. RPV, an FDA- approved, nonnucleoside reverse transcriptase inhibitor) was co-encapsulated within the LNP, creating the LNP-RPV-CCR5. The nanoprobe’s properties and biodistribution were examined in humanized mice (hu-mice). The beta emitter 64CuInEuS2 offered an ideal radioactive half-life due to its compatibility with PET computed tomography (CT) or magnetic resonance imaging (MRI) tracking. This tri-modality was selected based on known safety and ease in biological monitoring (Daraban, et al. (2006) Annals West Univ. Timisoara Phys. Ser., 48: 118; Herskovitz, et al. (2021) Nanotheranostics 5(4):417-430). The chelator-free 64CuInEuS2 nanoprobe was synthesized by solvothermal methods using thioacetamide, europium (III) chloride hexahydrate, indium (III) chloride dihydrate, and copper (II) chloride dihydrate at optimal molar ratios. The high boiling solvent, oleylamine, was selected for solvothermal synthesis to avoid narrowly dispersed particles. The nanoprobe morphology was examined under transmission electron microscopy (TEM) which revealed a narrowly dispersed rod-shaped nanostructure with an average diameter of 15 nm and an average length of 65 nm (Fig. 1A). High- resolution TEM images showed a crystal lattice (Fig. IB). The presence of crystallinity was confirmed by X-ray diffraction (XRD) peaks at 29 of 14.1°, 16.8°, 25.4°, 26.2°, 27.8°, 28.0°, 30.0°, 32.5°, 34.1°, 37.4°, 39.2°, 39.5°, 45.3°, 46.0° and 52.2°, and electron diffraction patterns (Fig. ID). High-angle annular dark-field scanning TEM showed copper, indium, europium, and sulfur coexistence within the 64CuInEuS2 nanoprobe (Fig. 1C). The results were supported by the appearance of the elements trace in energy-dispersive X-ray spectroscopy. 64CuInEuS2 was subjected to X-ray photoelectron spectroscopy (XPS) to evaluate its surface elemental composition. The appearance of binding energy peaks corresponding to Eu 3d (at 1134.26 and 1164.40 eV), Cu 2p (at 931.87 and 951.69 eV), In 3d (at 444.07 and 451.58 eV), and S 2p (at 161.09 and 168.47 eV) demonstrated their rodshape.
Synthesis of a CCR5-peptide conjugated DSPE-PEG formulation
To formulate the CCR5 -receptor-targeted LNP, a linear CCR5-peptide, D- Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-NH2 (SEQ ID NO: 1), was selected as the targeting ligand. The free -NH2 group on the CCR5-peptide was conjugated to DSPE-PEG-NHS by an activated acid amine coupling reaction (Fig. IE). A structure of the DSPE-PEG conjugated peptide is provided in Fig. IE. The JH NMR spectra of the DSPE-PEG conjugated peptide showed chemical shifts at 0.8 and 1.27 ppm. These were assigned to the methyl and methylene protons of DSPE. The chemical shift at 3.63 ppm was assigned to the methylene proton of PEG. The chemical shifts at 6.79 and 7.09 ppm were assigned to the 4-hydroxyphenyl ring protons of the tyrosine (Tyr), and those between 1.5 to 3 ppm and 4 to 4.5 ppm were transferred to the overlapping proton signals from the peptide and DSPE-PEG segments. JH NMR confirmed both the CCR5-peptide and DSPE-PEG segments, affirming the synthesis of the DSPE-PEG-CCR5. High-resolution mass spectrometry results further supported its synthesis.
LNP physicochemical properties
LNPs were prepared by microfluidic techniques by rapid, chaotic mixing of lipid and aqueous phases (Figures IF and 1G). The LNP-RPV-CCR5 contained a mixture of PC (45 wt%), DSPE-PEG (19.5 wt%), RPV (35 wt%), and DSPE-PEG- CCR5 (0.5 wt%) in its lipid phase. PBS was used in the aqueous phase. LNP without DSPE-PEG-CCR5, LNP -RPV was prepared in parallel to serve as a control formulation. To track the LNPs by PET, both LNPs were reformulated with 1.5 wt% of the radioactive nanoprobe 64CuInEuS2. TEM images showed a spherical morphology of both the LNPs (Fig. 2A-2B). The particle sizes of LNP -RPV and LNP-RPV-CCR5 were 98 and 91 nm, respectively (Table 1 and Fig. 2C-2D). LNPs were neutral in charge with a surface zeta potential from 0.29 to 0.37 mV (Table 1). LNPs with particle sizes of ~ 100 nm and a neutral surface charge were prepared for administration. The RPV loading content in LNP -RPV and LNP-RPV-CCR5 were 49.78 and 30.80 wt%, respectively (Table 1). The storage stability of the LNPs at 4°C showed no changes in particle size and dispersity for up to one month. These data demonstrated long-time storage stability (Fig. 2E-2F).
LNP treatment of human monocyte -derived macrophages (MDMs)
Macrophages express CD4 and CCR5 receptors and are susceptible to HIV-1 infection (Kruize, et al. (2019) Front. Microbiol., 10:484054; Wong, et al. (2019) Front. Immunol., 10:456992; Meng, et al. (2021) Biology 10(7):661). The cells are a known HIV reservoir (Veenhuis, et al. (2023) Nat. Microbiol., 8(5):833-844). Infected macrophages can transmit the virus from person to person, serving as a depot for ARVs. Therefore, MDMs served as a primary cell model to examine the LNP antiretroviral efficacy. Before LNP treatment, the viability of MDMs was evaluated after 200 to 3 pM RPV LNPS exposures by the CellTiter-Blue Assay (Fig.
3 A). The tests revealed a > 90% MDM viability with a dose equivalent of up to 100 pM RPV. To evaluate LNP uptake in MDMs 20 pM RPV was tested. The LNPs showed a time-dependent increase in RPV concentration for up to 12 hours and slowly reaching equilibrium at 12 to 24 hours (Fig. 3B). LNP-RPV-CCR5 showed a 3-fold higher RPV uptake at 12 hours compared to equivalent LNP -RPV levels. To test whether cell uptake was CCR5 mediated, comparisons were made with and without the CCR5 antagonist, maraviroc (MVC). With 1 nM/106 cell exposures MVC reduced LNP-RPV-CCR5 uptake. However, no MVC affect was seen for LNP -RPV (Fig. 3C). To affirm these results, Cy 5.5 dye-labeled LNPs with equivalent Cy 5.5 content were incubated with MDMs with or without MVC. After
4 hours, MDMs’ nuclei and cell membranes were stained with DAPI (stained DNA) and phalloidin (stained F-actin). The microscopic images revealed a bright fluorescence (Cy 5.5) of LNP-RPV-CCR5 throughout the MDMs (Fig. 3D). However, differential LNP localizations with reduced fluorescence intensity was observed for MVC treatments. These data affirmed that the entry of LNP-RPV- CCR5 was blocked by inhibition of the CCR5 -receptor. Moreover, MVC did not influence LNP -RPV. These data affirm that the LNP-RPV-CCR5 cell entry principally followed a CCR5-receptor-mediated pathway. In addition, MVC treatment did not affect cytotoxicities as it revealed > 90% cell viability at 1 and 2 nM treatment doses. The change in cell morphology in M VC-pretreated MDMs was due to the interaction between MVC and the CCR5 cell surface receptor. To evaluate the RPV retention and viral suppression of the LNPs, phorbol 12-myristate 13-acetate (PMA) cell stimulation was used to maximize cell differentiation. The fully differentiated PMA-treated cells were then infected with HIV- IADA at the multiplicity of infection (MOI) 0.1 and treated with LNP-RPV or LNP-RPV-CCR5 at 100 pM RPV doses. After 24 hours, treatment was removed, and cells were cultured in fresh media. Infected MDMs without LNPs were maintained as controls (HIV-IADA and PMA). On days 1, 5, 9, 15, 21, and 25, culture supernatant fluids were removed and then analyzed for HIV-1 reverse transcriptase (RT) activity. Cells were harvested in parallel to quantify RPV. On day 9, LNP-RPV showed 26 and 5 nmol RPV at 100 and 30 pM treatment doses (Figs. 3E and 3H). In contrast, LNP-RPV-CCR5 showed 109 and 50 nmol RPV at 100 and 30 pM treatment doses. Both LNPs demonstrated a dose-dependent RPV retention. Each showed higher RPV retention at 100 than 30 pM (Figs. 3E and 3H). In addition, the RPV retention followed descending trends over time throughout the treatment groups. At both doses, LNP-RPV-CCR5 demonstrated higher RPV retention than LNP-RPV. These results support the role of the CCR5 receptor in LNP-RPV-CCR5 cell uptake and its influence on the formation of the macrophage drug depot. To confirm these, LNP-containing macrophages were examined under TEM. Macrophages showed considerable RPV depots (arrowhead, Fig. 3G) in LNP-RPV-CCR5 treated cells than for LNP-RPV. In parallel tests, HIV-1 RT activity assessed virion production in HIV-IADA infected control groups (Fig. 3F). A single 100 pM dose of LNP-RPV-CCR5 inhibited virion production for up to 25 days. In contrast, the LNP-RPV showed viral breakthrough after day 9 (Fig. 3F). The reduced efficacy of LNP-RPV in inhibiting HIV-1 replication was coordinated to lower RPV retention (5.10 nmol at day 9). The 100 pM dose of LNP-RPV-CCR5 restricted viral growth up to 25 days. At 30 pM of LNP-RPV-CCR5, the decreased RPV retention (3 nmol at day 25) was less capable of inhibiting viral growth (Fig. 31).
Biodistribution of LNPs in hu mice
HIV uses CCR5 as a coreceptor for viral infection. The lack of this receptors in mice support their use in vivo studies of HIV infection in hu-mouse (Denton, et al. (2011) AIDS Rev., 13(3): 135-148). Thus, hu-mice were used to evaluate the biodistribution of 64CuInEuS2 encapsulated theranostic LNPs. The biodistribution was performed with PET-CT bioimaging. Before bioimaging, the stability of the radiolabeled LNPs was assessed in mice plasma. These controls precluded any false positive signals. LNPs were incubated in 10% mice plasma at 37 °C to determine the radiolabeling stability. The total radioactivity in the LNP was measured in relation to the total radioactivity of the LNP-plasma solution. The radiolabeled LNPs were stable (98%) in mice plasma after 24 hours of incubation. This indicated their suitability for in vivo bioimaging. Radiolabeled LNPs (dose 1000 pCi/kg) were injected by tail vein to hu mice to assess particle biodistribution (Kevadiya, et al. (2020) Theranostics 10(2):630-656). PET images were captured at 6, 24, and 48 hours after injection and co-registered by CT (Fig. 4A-4E). Both the coronal and sagittal PET-CT images demonstrated spleen and liver LNP distribution (Fig. 4B). The PET image displayed a progressive decrease of radioactive signals over time. This was attributed to the combined effect of radioactive decay and LNP excretion (Dilliard, et al. (2023) Nat. Rev. Mater., 8(4):282-300). Noticeably, LNP-RPV- CCR5 showed primary presence in the spleen, while LNP-RPV primarily accumulated in the liver. Comprehensively, the higher signal in LNP-RPV-CCR5 treated mice over LNP-RPV was linked to the tail vein injection site (Fig. 41). To validate these findings, mice were sacrificed at 48 hours after injection, and the remaining radioactivity was assayed by a gamma counter (Figs. 4C-4D). LNP-RPV- CCR5 showed a propensity to spleen tissue accumulation. In contrast, LNP-RPV was distributed throughout all examined tissues. LNP-RPV-CCR5 showed a substantially higher spleen/liver radioactivity ratio than LNP-RPV. The spleen harbors a significant number of CCR5 -expressing immunocytes (Wang, et al. (2019) Faseb J., 33(8):8905-8912).
To evaluate RPV distribution, LNP-RPV and LNP-RPV-CCR5 were injected at 25 mg/kg through the tail vein of the hu mice. The plasma RPV concentration was measured 6 and 24 hours after injection (Fig. 4F-4G). At 24 hours, mice were sacrificed, and the liver and spleen RPV levels were determined by electrospray ionization mass spectrometry. At 24 hours plasma, liver, and spleen RPV levels were 120, 4081, and 4600 ng/g in LNP-RPV-CCR5 treated mice. In contrast, RPV levels were 299, 2919, and 1898 ng/g in the LNP-RPV control mice. LNP-RPV- CCR5 demonstrated spleen-specific RPV accumulation with higher spleen/liver RPV ratios than for LNP-RPV (Fig. 4H). These data were well corroborated by PET imaging (Fig. 4B-E). Yet another limitation of ARV biodistribution rests in penetrance to the brain viral sanctuary. Indeed, LNP -based cargo delivery rests in its limited penetrance across the blood-brain barrier (BBB). To affect the penetration of LNPs into the brain, focused ultrasound (FUS) combined with microbubble-induced BBB disruption (BBBd) was used in the hu mice. The verification of BBBd was affirmed by the gadolinium enhancements (bright signals, arrows). These changes were illustrated in the coronal sections of the brain Tl-weighted MRI images (T1WI) (Fig. 5 A). Immediately following FUS, mice were intravenously injected with Cy5.5 labeled LNPs. The FUS-mediated temporary BBB disruption allows the LNP to cross into the brain. After FUS, the BBB naturally reseals; a similar strategy can be applied to humans (Burgess, et al. (2015) Expert Rev. Neurother., 15(5):477- 491). On the following day, whole-body scans were performed with an in vivo imaging system (IVIS). This revealed a higher brain accumulation and retention of LNP-RPV-CCR5 than LNP-RPV (Fig. 5A). This data was affirmed by quantifying the elevated levels of RPV in brain tissue by mass spectrometry. Specifically, the brain tissue of the LNP-RPV-CCR5 treated hu mice showed RPV levels of 400 ng/g, compared to 55 ng/g in those treated with LNP-RPV. Although FUS facilitates the delivery of both LNPs to the brain, LNP-RPV-CCR5 showed the highest retention based on its interactions with CCR5 receptor-expressing human myeloid-microglial cells (Necula, et al. (2021) Brain Behav. Immun., 92: 1-9). To examine cellspecificity, brain tissue sections were stained with IBA-1 (microglia) and HuNu (human nuclei) and imaged by confocal microscopy (Fig. 5B). Approximately 20% of microglia (IBA-1, red) showed HuNu, green staining, and LNP engulfment. Mice treated with LNP-RPV-CCR5 displayed increased accumulation of LNPs in human microglia and higher cytoplasmic retention than those treated with LNP-RPV. These data support CCR5 targeted delivery.
LNP-RPV-CCR5 viral suppression in hu-mice
After achieving higher levels of viral suppression in MDMs and lymphoid tissue-specific RPV biodistribution in human cell reconstituted hu-mice, an animal study was designed to validate levels of viral suppression for the LNP-RPV-CCR5. The timeline of the experiment is presented in Fig. 6A. Hu-mice were infected with 1.5 x io4 tissue culture infectious dose 50 (TCID50) of HIV-1 ADA. At two weeks, viral replication was confirmed by measuring plasma viral RNA copies. Subsequently, LNPs were administered by the tail vein injection at a dose of 25 mg/kg RPV equivalence. Viral suppression efficacy was analyzed by weekly plasma viral load measurements. Levels of viral suppression compared against LNP-RPV and LNP-RPV-CCR5 showed that the latter successfully held viral growth for 14 days in 2/3 treated mice (Fig. 6B). The higher levels of viral suppression of LNP-RPV-CCR5 were linked to CCR5-receptor-mediated lymphoidspecific RPV retention.
Tissue toxicity measurements
To assess the potential LNP toxicity, the body weight of the hu-mice was measured. Blood samples were collected to determine hematologic profiles at the end of treatment. The heart, lung, spleen, liver, and kidneys were paraformaldehyde-fixed, sectioned, and stained with hematoxylin and eosin to assess tissue histology. The analysis of whole blood count and blood serum chemistry revealed no evidence of cytotoxicity in the LNP -treated group (Table 2 and 3). Moreover, the measured body weight remained unchanged throughout all the treatments (Fig. 6C). No histological abnormality was identified in the spleen despite the high levels of LNP accumulation and other examined organs (Fig. 6D). These examinations indicate that the LNPs were safe delivery vehicles. The results of these studies support the clinical translation of the LNP -based drug delivery.
Figure imgf000044_0001
Figure imgf000045_0001
Table 2: Assessment of hematological toxicity from complete blood count analysis. WBC: White Blood Cell Count, LYM: Lymphocytes Count, MON: Monocytes Count, NEU: Neutrophils Count, RBC: Red Blood Cell Count, HGB: Hemoglobin Count, HCT: Hematocrit Test, MCV: Mean Corpuscular Volume Blood Test, MCH: Mean Corpuscular Hemoglobin Blood Test, MCHC: Mean Corpuscular Hemoglobin Concentration Test, RDWS: Red Blood Cell Distribution Width Standard, PLT: Platelet Count, MPV: Mean Platelet Volume, and PDWs: Platelet distribution width Standard. Samples were analyzed by using VetScan® HM5. Values reported are the mean ± SEM of 3 replicates for all the groups.
Figure imgf000045_0002
Table 3: Assessment of hematological toxicity from blood serum chemistry analysis. Albumin (ALB), alkaline phosphatase (ALP), alanine transaminase (ALT), amylase (AMY), total bilirubin (TBILL), blood ura nitrogen (BUN), calcium (CA), phosphorus (PHOS), creatinine (CRE), glucose (GLU), sodium ion (Na+), potassium ion (K+), total protein (TP), and Globulin (GLOB) were analyzed by using VetScan® VS2. Values reported are the mean ± SEM of 3 replicates for all the groups.
A multimodal radioactive nanoprobe with a CCR5-peptide conjugated DSPE-PEG-CCR5 lipid was successfully synthesized. The CCR5-targeted LNP- RPV-CCR5 and nontargeted LNP-RPV were formulated by microfluidic mixing. The spherically shaped LNPs had sizes near 100 nm with narrow size dispersity. These LNPs were devoid of associated toxi cities at 100 pM RPV equivalence doses. Unlike LNP-RPV, LNP-RPV-CCR5 demonstrated substantially higher macrophage uptake and retention. In macrophages, the RPV was retained as a drug depot. A single dose of LNP-RPV-CCR5 treatment demonstrated a 25-day-long viral suppression in the HIV-1 infected macrophages not seen by LNP-RPV treatments. The CCR5-receptor-mediated RPV uptake and depot formation were linked to an extended viral suppression. The PET-CT theranostic imaging revealed a spleenspecific biodistribution of LNP-RPV-CCR5, resulting in a higher RPV accumulation in the spleen of hu mice, a key HIV reservoir. The FUS combined with microbubble-induced BBBd facilitated the delivery of LNPs to the brain and higher drug retention in human microglia. Moreover, a single dose of LNP-RPV-CCR5 was sufficient to hold viral growth at bay in HIV-1 infected hu mice. The therapeutic efficacy of the CCR5-targeted delivery system can be propelled by synergistic combination of multiple ARVs for longer-term effective HIV-1 treatments.
A number of publications and patent documents are cited throughout the foregoing specification in order to describe the state of the art to which this invention pertains. The entire disclosure of each of these citations is incorporated by reference herein.
While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

Claims

What is claimed is:
1. A lipid nanoparticle comprising at least one lipid, a CCR5 targeting moiety, and a therapeutic agent and/or imaging agent.
2. The lipid nanoparticle of claim 1, wherein the lipids comprise a polyethylene glycol (PEG)-lipid conjugate.
3. The lipid nanoparticle of claim 1, wherein said CCR5 targeting moiety is selected from the group consisting of maraviroc, aplaviroc, vicriviroc, INCB009471, leronlimab, and the peptide Ala-Ser- Thr-Thr-Thr-Asn-Tyr-Thr (SEQ ID NO: 1) optionally comprising one or more D-amino acids.
4. The lipid nanoparticle of claim 3, wherein the CCR5 targeting moiety is the peptide D-Ala-Ser- Thr-Thr-Thr-Asn-Tyr-Thr (SEQ ID NO: 1).
5. The lipid nanoparticle of any one of claims 2-4, wherein the CCR5 targeting moiety is conjugated to the PEG-lipid conjugate.
6. The lipid nanoparticle of claim 2, wherein the PEG-lipid conjugate is 1,2- distearoyl-sn-glycero-3-phosphoethanolamine (DSPE)-PEG.
7. The lipid nanoparticle of any one of claims 1-6, wherein the lipid nanoparticle comprises phosphatidylcholine, DSPE-PEG, and DSPE-PEG-CCR5 peptide.
8. The lipid nanoparticle of any one of claims 1-7, wherein said lipid nanoparticle encapsulates said therapeutic agent and/or imaging agent.
9. The lipid nanoparticle of any one of claims 1-8, wherein the therapeutic agent is an antiretroviral agent.
10. The lipid nanoparticle of claim 9, wherein said antiretroviral agent is a nonnucleoside reverse transcriptase inhibitor, nucleoside reverse transcriptase inhibitor, protease inhibitor, fusion inhibitor, integrase inhibitor, or a gRNA or crRNA.
11. The lipid nanoparticle of claim 10, wherein said gRNA or crRNA is complementary to a sequence within an HIV-1 gene.
12. The lipid nanoparticle of claim 11, wherein said gRNA or crRNA comprises a sequence with at least 90% identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18.
13. The lipid nanoparticle of claim 9, wherein the antiretroviral agent is rilpivirine.
14. The lipid nanoparticle of anyone of claims 1-13, wherein the lipid nanoparticle comprises a therapeutic agent and an imaging agent.
15. The lipid nanoparticle of any one of claims 1-13, wherein said imaging agent is CulnEuS?.
16. The lipid nanoparticle of claim 1, wherein the lipid nanoparticle comprises phosphatidylcholine, DSPE-PEG, DSPE-PEG-CCR5 peptide, and an antiretroviral agent.
17. The lipid nanoparticle of claim 16, wherein said antiretroviral nanoparticle is rilpivirine.
18. A composition comprising a lipid nanoparticle of any one of claims 1-17 and a pharmaceutically acceptable carrier.
19. A method of treating an HIV-1 infection in an individual in need thereof, comprising administering to the individual the lipid nanoparticle according to any one of claims 1-17.
20. A method of imaging HIV reservoirs in an individual in need thereof, comprising administering to the individual the lipid nanoparticle of any one of claims 1-17.
PCT/US2024/040661 2023-08-02 2024-08-02 Lipid nanoparticles and methods of use thereof WO2025030072A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363530318P 2023-08-02 2023-08-02
US63/530,318 2023-08-02

Publications (1)

Publication Number Publication Date
WO2025030072A1 true WO2025030072A1 (en) 2025-02-06

Family

ID=94396027

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2024/040661 WO2025030072A1 (en) 2023-08-02 2024-08-02 Lipid nanoparticles and methods of use thereof

Country Status (1)

Country Link
WO (1) WO2025030072A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200368161A1 (en) * 2019-04-26 2020-11-26 National Yang-Ming University Tumor pH-shiftable coating and the nucleus-directed nanoparticles facilitate the targeted chemotherapy and gene therapy against multiple cancers and use thereof
WO2022198229A1 (en) * 2021-03-17 2022-09-22 Board Of Regents Of The University Of Nebraska Lipid nanoparticle formulations and methods of use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200368161A1 (en) * 2019-04-26 2020-11-26 National Yang-Ming University Tumor pH-shiftable coating and the nucleus-directed nanoparticles facilitate the targeted chemotherapy and gene therapy against multiple cancers and use thereof
WO2022198229A1 (en) * 2021-03-17 2022-09-22 Board Of Regents Of The University Of Nebraska Lipid nanoparticle formulations and methods of use thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LUEHMANN HANNAH P., PRESSLY ERIC D., DETERING LISA, WANG CYNTHIA, PIERCE RICHARD, WOODARD PAMELA K., GROPLER ROBERT J., HAWKER CRA: "PET/CT Imaging of Chemokine Receptor CCR5 in Vascular Injury Model Using Targeted Nanoparticle", THE JOURNAL OF NUCLEAR MEDICINE, SOCIETY OF NUCLEAR MEDICINE, US, vol. 55, no. 4, 1 April 2014 (2014-04-01), US , pages 629 - 634, XP093278277, ISSN: 0161-5505, DOI: 10.2967/jnumed.113.132001 *
MANDAL SUBHRA, SUNAGAWA SHAWNALYN W., PRATHIPATI PAVAN KUMAR, BELSHAN MICHAEL, SHIBATA ANNEMARIE, DESTACHE CHRISTOPHER J.: "Targeted Immuno-Antiretroviral to Promote Dual Protection against HIV: A Proof-of-Concept Study", NANOMATERIALS, MDPI, vol. 12, no. 11, pages 1942, XP093278279, ISSN: 2079-4991, DOI: 10.3390/nano12111942 *
RAY ET AL.: "Enhanced target cell specificity and uptake of lipid nanoparticles using RNA aptamers and peptides", BEILSTEIN J ORG CHEM, vol. 17, 26 April 2021 (2021-04-26), pages 891 - 907, XP093182992, DOI: 10.3762/bjoc.17.75 *

Similar Documents

Publication Publication Date Title
US20230364024A1 (en) Stabilized formulations of lipid nanoparticles
US12357575B2 (en) Methods of making lipid nanoparticles
US12090235B2 (en) Preparation of lipid nanoparticles and methods of administration thereof
US11969506B2 (en) Lipid nanoparticle formulation
US5705385A (en) Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US20200069599A1 (en) Stabilized formulations of lipid nanoparticles
US20240131181A1 (en) Therapeutic Targeting of Lipid Nanoparticles
JP2022544652A (en) Improved Lipid Nanoparticles for Delivery of Nucleic Acids
US20220047723A1 (en) OPTIMIZED mRNA ENCODING CAS9 FOR USE IN LNPs
WO2018126084A1 (en) Branched peg molecules and related compositions and methods
US20240189445A1 (en) Targeted Therapeutic Lipid Nanoparticles and Methods of Use
US20240165266A1 (en) Lipid nanoparticle formulations and methods of use thereof
US20220194990A1 (en) Virus-like particles and methods of use thereof
CN106714846A (en) Compositions and methods for therapeutics prescreening
CN116947785A (en) Ionizable lipids and complexes thereof for nucleic acid delivery
CN117177738A (en) Tissue-specific nucleic acid delivery by mixed cationic lipid particles
CN113710811A (en) Non-viral modification of T cell gene expression
WO2025030072A1 (en) Lipid nanoparticles and methods of use thereof
US20240269318A1 (en) Nano-delivery systems comprising modified lipids and use thereof
JP2001512831A (en) Methods for identifying biological drug compositions
JP2020525051A (en) Method of pre-screening therapeutic agent with body fluid
EP4590281A2 (en) Lipid nanoparticle formulations and methods of use thereof
WO2024200823A1 (en) Lipid-based nanoparticle targeted at activated immune cells for the expression of immune cell enhancing molecule and use thereof
WO2024192233A2 (en) Targeted delivery of therapeutic agents to the central nervous system and methods of use for treatment of neurological conditions
CN120390657A (en) Targeted delivery of gene editing constructs and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24850143

Country of ref document: EP

Kind code of ref document: A1