WO2024259262A2 - Antisense nucleic acids to induce abcd2 expression - Google Patents
Antisense nucleic acids to induce abcd2 expression Download PDFInfo
- Publication number
- WO2024259262A2 WO2024259262A2 PCT/US2024/034048 US2024034048W WO2024259262A2 WO 2024259262 A2 WO2024259262 A2 WO 2024259262A2 US 2024034048 W US2024034048 W US 2024034048W WO 2024259262 A2 WO2024259262 A2 WO 2024259262A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- antisense nucleic
- seq
- abcd2
- therapeutic agent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3233—Morpholino-type ring
Definitions
- the present disclosure relates to a compositions and methods that employ antisense oligonucleotides (ASOs) to induce ABCD2 expression as a potential therapeutic agent for X- linked adrenoleukodystrophy (ALD).
- ASOs antisense oligonucleotides
- Adrenoleukodystrophy is an X-linked neurometabolic disorder primarily affecting white matter of the brain and spinal cord, and the adrenal glands.
- the three main phenotypes of ALD include a severe, pediatric cerebral form (cALD), an adult peripheral adrenomyeloneuropathy (AMN), and a form affecting the adrenals only, commonly referred to as Addison's disease.
- ALD is caused by mutations in the ABCD1 gene encoding the peroxisomal ABC transporter protein (ALDP) which is a family of peroxisomal transporters. This can lead to deficient -oxidation of saturated very-long-chain fatty acids (VLCFAs).
- Other members of peroxisomal transporters are encoded by ABCD2, ABCD3, and ABCD4, and evidence has been shown that their increased expression can compensate for the reduced levels ofABCDl.
- Antisense oligonucleotides are short complementary nucleic acid molecules that alter gene expression using different mechanisms depending on the location of hybridization.
- Antisense oligonucleotides can include single-stranded synthetic ribonucleotide or deoxyribonucleotide analogs to attach complementary protein-coding or non- coding RNAs to affect translation.
- ASOs can include single-stranded synthetic ribonucleotide or deoxyribonucleotide analogs to attach complementary protein-coding or non- coding RNAs to affect translation.
- antisense nucleic acids that targets a 5’ upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino backbone.
- the antisense nucleic acid comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- the antisense nucleic acid comprises 20 to 23 nucleotides.
- a nucleotide of the antisense nucleic acid comprises a chemical modification.
- the antisense nucleic acid comprises a phosphorodiamidate morpholino oligomer (PMO).
- the antisense nucleic acid targets an AUG sequence of the 5’ upstream open reading frame of the ABCD2 mRNA.
- the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
- the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
- compositions that include a therapeutic agent, wherein the therapeutic agent increases ABCD2 gene expression; and an excipient.
- the therapeutic agent comprises an antisense nucleic acid.
- the therapeutic agent comprises an antisense oligonucleotide (ASO).
- ASO comprises 20 to 23 nucleotides.
- a nucleotide of the ASO comprises a chemical modification.
- the ASO comprises a phosphorodiamidate morpholino oligomer (PMO).
- the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid targets a 5’ untranslated region of the ABCD2 gene. In some embodiments, administering the therapeutic agent increases expression of ABCD2 mRNA. In some embodiments, administering the therapeutic agent increases expression of ABCD2 protein.
- ALD adrenoleukodystrophy
- the method including administering a therapeutic agent to the subject, wherein the therapeutic agent increases ABCD2 gene expression, thereby treating ALD.
- the therapeutic agent comprises an antisense nucleic acid.
- the therapeutic agent comprises an antisense oligonucleotide (ASO).
- the antisense nucleic acid comprises 20 to 23 nucleotides. In some embodiments, a nucleotide of the antisense nucleic acid comprises a chemical modification. In some embodiments, the antisense nucleic acid comprises a phosphorodiamidate morpholino oligomer (PMO).
- PMO phosphorodiamidate morpholino oligomer
- the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid targets a 5’ untranslated region of the ABCD2 gene. In some embodiments, administering the therapeutic agent increases expression of ABCD2 mRNA. In some embodiments, administering the therapeutic agent increases expression of ABCD2 protein.
- FIG. 1 shows an exemplary schematic of oligonucleotide-based therapeutics in a cell.
- FIG. 2 shows an exemplary schematic of antisense nucleic acids that include a phosphorodiamidate morpholino oligomer targeting upstream open reading frames in 5’ UTR of an mRNA.
- FIG. 3 shows fluorescence images of patient-derived fibroblasts after three doses of ASOs (IpM, 5pM, and lOpM) were delivered into the cells.
- FIG. 4 shows the expression of ABCD2 mRNA in human fibroblasts within 48h of ASO transfection with three doses of ASOs (IpM, 5pM, and lOpM).
- FIGs. 5A-5C show VLCFA levels in human fibroblasts within 7 days of ASO transfection with three doses of ASOs (IpM, 5pM, and lOpM).
- FIG. 6 shows an exemplary schematic of three antisense oligonucleotides (ASOs) with phosphorodiamidate morpholino (PMO) modifications on all nucleotides designed to directly target upstream open reading frame (uORF) regions of ABCD2 to increase its expression (ASO1 - SEQ ID NO: 1, ASO2 - SEQ ID NO: 2, ASO3 - SEQ ID NO: 3).
- ASOs antisense oligonucleotides
- PMO phosphorodiamidate morpholino
- FIG. 7 shows fluorescence images of fibroblasts after 48 hours of ASO transfection and media change.
- ASO localization in fibroblasts was imaged at 20x using a Leica DMi8 Thunder Imager.
- the 3’-carboxyfluorescein signal attached to ASOs was found within fibroblasts, indicating successful delivery of ASOs within cells.
- FIG. 8 shows RT-qPCR analysis revealed dose-dependent increase of ABCD2 expression levels in four patient ALD fibroblasts after 48 hours of ASO transfection. Relative to baseline expression levels, all ASOs led to significant increase in ABCD2 expression. The largest enhancement was observed after treatment with ASO2, resulting in an up to 4.7-fold increase in ABCD2 expression over baseline levels.
- FIGs. 9A-9B show baseline C26:0 and C24:0 lysoPC were significantly higher in ALD fibroblasts compared to control.
- FIG. 9A shows a significant dose-dependent reduction in C26:0 levels after 7 days of ASO transfection. The most prominent reduction was noted with ASO2 in all ALD lines.
- FIG. 9B shows additionally, a significant dose-dependent reduction in C24:0 levels after 7 days of ASO transfection.
- this disclosure describes using antisense oligonucleotides (ASOs) to increase the levels of ABCD2 expression and peroxisomal transporters, wherein the higher levels of ABCD2 can compensate for the reduction in the expression of functional ABCD1 and clinically improve the symptoms of patients with adrenoleukodystrophy.
- ASOs antisense oligonucleotides
- an antisense nucleic acid that target a 5’ upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino backbone.
- an antisense nucleic acid comprises an antisense oligonucleotide (ASO).
- compositions including a therapeutic agent, wherein the therapeutic agent increases ABCD2 gene expression; and an excipient.
- methods of treating adrenoleukodystrophy (ALD) that include administering a therapeutic agent to the subject, wherein the therapeutic agent increases ABCD2 gene expression.
- compositions and methods are described herein, and can be used in any combination without limitation. Additional aspects of various components of the compositions and methods described herein are known in the art.
- administration typically refers to the administration of a composition to a subject or system to achieve delivery of an agent that is, or is included in, the composition.
- agents that are, or is included in, the composition.
- routes may, in appropriate circumstances, be utilized for administration to a subject, for example a human.
- administration may be ocular, oral, parenteral, etc.
- administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, transdermal, etc.), enteral, intra-arterial, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, intracisternal, within a specific organ (e.g., intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc.
- bronchial e.g., by bronchial instillation
- buccal which may be or comprise, for example, one or more of topical to the dermis, intradermal, transdermal, etc.
- enteral intra-arterial, intragastric, intramedullary, intramus
- administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and/or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.
- expression refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins.
- expression may include splicing of the mRNA in a eukaryotic cell.
- the expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.
- nucleic acid in its broadest sense, refers to a compound and/or substance that is, or can be incorporated into, a polynucleotide chain.
- a nucleic acid is a compound and/or substance that is, or can be incorporated into, a polynucleotide chain with a phosphodiester linkage.
- nucleic acid refers to an individual nucleic acid residue (e.g., a nucleotide and/or nucleoside); in some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues.
- a "nucleic acid” is or comprises ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a P-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2’-amino-LNA having a 2’-amino functionalization, and 2’-amino-a-LNA having a 2’-amino functionalization), or a combination thereof.
- RNAs ribonucleic acids
- DNAs deoxyribonucleic acids
- TAAs threose nucleic acids
- GNAs glycol nucleic acids
- PNAs peptide nucleic acids
- LNAs locked nucleic acids
- LNAs including LNA
- a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid residue analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that one or more residues, and in some embodiments, are linked together other than by a phosphodiester. For example, in some embodiments, a nucleic acid includes one or more phosphorothioate and/or phosphoroamidite (e.g., 5'-N-phosphoramidite) linkages rather than phosphodiester bonds.
- phosphorothioate and/or phosphoroamidite e.g., 5'-N-phosphoramidite
- a nucleic acid includes one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxy cytidine).
- natural nucleosides e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxy cytidine.
- a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2- thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5 -methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C 5 -bromouridine, C5- fluorouridine, C -iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5- methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated
- a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2 '-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids.
- a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein.
- a nucleic acid includes one or more introns.
- nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), enzymatic synthesis in the absence of a complementary template, reproduction in a recombinant cell or system, and chemical synthesis.
- a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long.
- a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded.
- a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide.
- Modifications can be introduced into a nucleotide sequence by standard techniques known in the art, such as site-directed mutagenesis and polymerase chain reaction (PCR)- mediated mutagenesis.
- Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
- Such families include amino acids with basic side chains (e.g., arginine, lysine and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., asparagine, cysteine, glutamine, glycine, serine, threonine, tyrosine, and tryptophan), nonpolar side chains (e.g., alanine, isoleucine, leucine, methionine, phenylalanine, proline, and valine), beta-branched side chains (e.g., isoleucine, threonine, and valine), and aromatic side chains (e.g., histidine, phenylalanine, tryptophan, and tyrosine), and aromatic side chains (e.g., histidine, phenylalanine, tryptophan, and tyrosine).
- basic side chains e.g., arginine,
- nucleotides and “nt” are used interchangeably herein to generally refer to biological molecules that comprise nucleic acids. Nucleotides can have moieties that contain the known purine and pyrimidine bases. Nucleotides may have other heterocyclic bases that have been modified. Such modifications include, e.g., methylated purines or pyrimidines, acylated purines or pyrimidines, alkylated riboses, or other heterocycles.
- nucleic acid modifications can also include a blocking modification comprising a 3’ end modification (e.g., a 3’ dideoxy C (3’ddC), 3’ddG, 3’ddA, 3’ddT, 3’ inverted dT, 3’ C3 spacer, 3’ amino, 3’ biotinylation, or 3’ phosphorylation).
- a 3’ end modification e.g., a 3’ dideoxy C (3’ddC), 3’ddG, 3’ddA, 3’ddT, 3’ inverted dT, 3’ C3 spacer, 3’ amino, 3’ biotinylation, or 3’ phosphorylation.
- polynucleotides can be used interchangeably, and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
- Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
- the following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
- a polynucleotide may comprise non-naturally occurring sequences.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by nonnucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
- a subject refers an organism, typically a mammal (e.g., a human).
- a subject is suffering from a relevant disease, disorder, or condition.
- a subject is susceptible to a disease, disorder, or condition.
- a subject displays one or more signs or symptoms or characteristics of a disease, disorder, or condition.
- a subject does not display any symptom or characteristic of a disease, disorder, or condition.
- a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition.
- a subject is a patient.
- a subject is an individual to whom diagnosis and/or therapy is and/or has been administered.
- treating means a reduction in the number, frequency, severity, or duration of one or more (e.g., two, three, four, five, or six) symptoms of a disease or disorder in a subject (e.g., any of the subjects described herein), and/or results in a decrease in the development and/or worsening of one or more symptoms of a disease or disorder in a subject.
- ASOs Antisense Oligonucleotides
- Antisense oligonucleotides are single-stranded nucleic acid molecules (e.g., deoxynucleotide or ribonucleotide analogues) targeting coding and non-coding ribonucleic acid (RNA) molecules.
- ASOs are able to increase the level of functional protein, reduce the level of toxic proteins, or modify the structure of impaired protein to improve function.
- ASOs have also been used to inhibit gene expression, modulate splicing of a precursor messenger RNA, or inactivate microRNAs.
- ASOs can hybridize to a target RNA (e.g., target mRNA) in a sequencespecific manner.
- ASOs in order to stabilize ASOs against nucleolytic degradation, can include chemically modified nucleotides such as phosphorothioates, 2’-O-methyl RNA, phosphorodiamidate morpholino oligomers (PMO), or locked nucleic acids.
- chemically modified nucleotides such as phosphorothioates, 2’-O-methyl RNA, phosphorodiamidate morpholino oligomers (PMO), or locked nucleic acids.
- an antisense nucleic acid that target a 5’ upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid includes a phosphorodiamidate morpholino backbone.
- an antisense nucleic acid comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- an antisense nucleic acid comprises about 20 to about 23 nucleotides. In some embodiments, an antisense nucleic acid comprises 20 to 23 nucleotides. In some embodiments, an antisense nucleic acid comprises 20 nucleotides. In some embodiments, an antisense nucleic acid comprises 21 nucleotides. In some embodiments, an antisense nucleic acid comprises 22 nucleotides. In some embodiments, an antisense nucleic acid comprises 23 nucleotides.
- a nucleotide of the antisense nucleic acid comprises a chemical modification.
- an antisense nucleic acid can include different modifications, e.g., in the sugar backbone to make it more cell permeable and nuclease resistant and physiologically non-toxic at low concentrations.
- an antisense nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, (e.g., a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro-modified nucleotide).
- RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA.
- modifications are routinely incorporated into oligonucleotides and such modified oligonucleotides have been shown to have a higher Tm (e.g., higher target binding affinity) than 2'-deoxyoligonucleotides against a given target.
- modified nucleic acids include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
- oligonucleotides can be modified with phosphorothioate backbones or with heteroatom backbones, particularly CH2 -NH-O- CH2, CH,-N(CH 3 )-O-CH2 (known as a methylene(methylimino) or MMI backbone], CH2 -0- -N (CH 3 )-CH 2 , CH2 -N (CH 3 )-N (CH 3 )-CH 2 and 0-N (CH 3 )- CH 2 -CH 2 backbones, wherein the native phosphodiester backbone is represented as 0- P- 0- CH,); amide backbones (see, e.g., De Mesmaeker et al. Ace. Chem. Res.
- morpholino backbone structures see, e.g., Summerton and Weller, U.S. Pat. No. 5,034,506
- PNA peptide nucleic acid
- Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos.
- Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- modified oligonucleotides include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see US patent nos.
- One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH 3 , F, OCN, OCH 3 , OCH3 O(CH 2 )n CH3, O(CH 2 )n NH 2 or O(CH 2 )n CH3 where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3 ; OCF3; O-, S , orN-alkyl; O-, S-, or N-alkenyl; SOCH3; SO 2 CH3; ONO 2 ; NO 2 ; N3; NH 2 ; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the
- one or more substituted sugar moieties includes 2'-methoxyethoxy [2'-O-CH 2 CH 2 OCH 3 , also known as 2'-O-(2- methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486).
- Other exemplary modifications include 2'-methoxy (2'-O-CH3), 2'-propoxy (2'-OCH 2 CH 2 CH3) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide.
- Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
- Antisense nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- nucleobase often referred to in the art simply as “base” modifications or substitutions.
- “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U).
- Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5 -methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2 -thio thymine, 5 -bromouracil, 5- hydroxymethyluracil, 8- azaguanine, 7-deazaguanine, N6 (6-amin
- antisense nucleic acid includes one or more chemical modifications. In some embodiments, one or more nucleotides of an antisense nucleic acid comprises a chemical modification. In some embodiments, all nucleotides of an antisense nucleic acid comprises a chemical modification.
- an antisense nucleic acid can include a phosphorodiamidate morpholino oligomer (PMO), wherein such an antisense nucleic acid comprises a phosphorodiamidate morpholino backbone.
- PMO phosphorodiamidate morpholino oligomer
- an antisense nucleic acid targets an AUG sequence of the 5’ upstream open reading frame of the ABCD2 mRNA.
- an antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
- an antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
- an antisense nucleic acid comprises or consists of a nucleotide sequence that differs in sequence at one or more positions as compared to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
- an antisense nucleic acid can comprise a nucleotide sequence that differs by one or two positions as compared to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, such that the antisense nucleic acid can still hybridize to the target mRNA and carry out its effects (e.g., induce ABCD2 gene expression).
- X-linked adrenoleukodystrophy is caused by defects of the ABCD1 gene on chromosome Xq28, resulting in an impairment of peroxisomal beta-oxidation and the accumulation of saturated very long chain fatty acids (VLCFAs).
- VLCFAs very long chain fatty acids
- the metabolic abnormality, elevated levels of very long-chain fatty acids in tissues and plasma, and the biochemical defect, reduced peroxisomal very long-chain acyl-CoA synthetase (VLCS) activity, are ubiquitous features of the disease. Additionally, the abnormal gene in X-ALD is not the gene for VLCS.
- APC ATP-binding cassette
- APC ATP-binding cassette
- the X-ALD protein (ALDP) is closely related to three other peroxisomal membrane ABC proteins: ABCD1 (ALDP), ABCD2 (ALDRP), and ABCD3 (PMP70), wherein evidence has been shown that their increased expression can compensate for the reduce levels of ABCD1.
- compositions comprising a therapeutic agent, wherein the therapeutic agent increases ABCD2 gene expression, and an excipient.
- a therapeutic agent comprises an antisense nucleic acid.
- a therapeutic agent comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- a therapeutic agent targets a 5’ untranslated region of the ABCD2 gene.
- a therapeutic agent comprises any one of the antisense nucleic acids described herein.
- administering a therapeutic agent increases expression of ABCD2 rnRNA. In some embodiments, administering a therapeutic agent increases expression of ABCD2 protein.
- a therapeutic agent comprises an antisense nucleic acid.
- a therapeutic agent comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- a therapeutic agent comprises any one of the antisense nucleic acids described herein.
- administering a therapeutic agent increases expression of ABCD2 mRNA and/or increases expression of ABCD2 protein, thereby treating ALD in the subject.
- Example 1 Antisense oligonucleotide induce ABCD2 gene expression
- ASOs antisense oligonucleotides
- PMO phosphorodiamidate morpholino
- Results showed ASO delivery into the cells using the transfection reagent (FIG. 3); ABCD2 mRNA expression within 48h of ASO transfection (FIG. 4); VLCFA levels within 7 days of ASO transfection (FIGs. 5A-5C). Furthermore, RT-qPCR analysis revealed dosedependent increase of ABCD2 expression levels in four patient ALD fibroblasts after 48 hours of ASO transfection. Relative to baseline expression levels, all ASOs led to significant increase in ABCD2 expression, wherein the largest enhancement was observed after treatment with ASO2, resulting in an up to 4.7-fold increase in ABCD2 expression over baseline levels (FIG. 8). Baseline C26:0 and C24:0 lysoPC were significantly higher in ALD fibroblasts compared to control.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Provided herein are antisense nucleic acids that targets a 5' upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino backbone. Also provided herein are methods of treating adrenoleukodystrophy (ALD) in a subject in need thereof, the method including administering a therapeutic agent to the subject, wherein the therapeutic agent increases ABCD2 gene expression, thereby treating ALD.
Description
ANTISENSE NUCLEIC ACIDS TO INDUCE ABCD2 EXPRESSION
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Provisional Patent Application No. 63/521,413, filed on June 16, 2023, which is incorporated herein by reference in its entirety.
SEQUENCE LISTING
This application contains a Sequence Listing that has been submitted electronically as an XML file named “44807-0461W01_SL_ST26.XML.” The XML file, created on June 12, 2024, is 3,692 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
TECHNICAL FIELD
The present disclosure relates to a compositions and methods that employ antisense oligonucleotides (ASOs) to induce ABCD2 expression as a potential therapeutic agent for X- linked adrenoleukodystrophy (ALD).
BACKGROUND
Adrenoleukodystrophy (ALD) is an X-linked neurometabolic disorder primarily affecting white matter of the brain and spinal cord, and the adrenal glands. The three main phenotypes of ALD include a severe, pediatric cerebral form (cALD), an adult peripheral adrenomyeloneuropathy (AMN), and a form affecting the adrenals only, commonly referred to as Addison's disease. ALD is caused by mutations in the ABCD1 gene encoding the peroxisomal ABC transporter protein (ALDP) which is a family of peroxisomal transporters. This can lead to deficient -oxidation of saturated very-long-chain fatty acids (VLCFAs). Other members of peroxisomal transporters are encoded by ABCD2, ABCD3, and ABCD4, and evidence has been shown that their increased expression can compensate for the reduced levels ofABCDl.
Antisense oligonucleotides (ASOs) are short complementary nucleic acid molecules that alter gene expression using different mechanisms depending on the location of hybridization. Antisense oligonucleotides (ASOs) can include single-stranded synthetic ribonucleotide or deoxyribonucleotide analogs to attach complementary protein-coding or non-
coding RNAs to affect translation. Thus, the ability of ASOs to induce ABCD2 gene expression has therapeutic potential for treatment of ALD.
SUMMARY
Provided herein are antisense nucleic acids that targets a 5’ upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino backbone. In some embodiments, the antisense nucleic acid comprises an antisense oligonucleotide (ASO). In some embodiments, the antisense nucleic acid comprises 20 to 23 nucleotides.
In some embodiments, a nucleotide of the antisense nucleic acid comprises a chemical modification. In some embodiments, the antisense nucleic acid comprises a phosphorodiamidate morpholino oligomer (PMO).
In some embodiments, the antisense nucleic acid targets an AUG sequence of the 5’ upstream open reading frame of the ABCD2 mRNA. In some embodiments, the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
Also provided herein are pharmaceutical compositions that include a therapeutic agent, wherein the therapeutic agent increases ABCD2 gene expression; and an excipient. In some embodiments, the therapeutic agent comprises an antisense nucleic acid. In some embodiments, the therapeutic agent comprises an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises 20 to 23 nucleotides.
In some embodiments, a nucleotide of the ASO comprises a chemical modification. In some embodiments, the ASO comprises a phosphorodiamidate morpholino oligomer (PMO).
In some embodiments, the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid targets a 5’ untranslated region of the ABCD2 gene. In some embodiments, administering the therapeutic agent increases expression of ABCD2 mRNA. In some embodiments, administering the therapeutic agent increases expression of ABCD2 protein.
Also provided herein are methods of treating adrenoleukodystrophy (ALD) in a subject in need thereof, the method including administering a therapeutic agent to the subject, wherein the therapeutic agent increases ABCD2 gene expression, thereby treating ALD. In some
embodiments, the therapeutic agent comprises an antisense nucleic acid. In some embodiments, the therapeutic agent comprises an antisense oligonucleotide (ASO).
In some embodiments, the antisense nucleic acid comprises 20 to 23 nucleotides. In some embodiments, a nucleotide of the antisense nucleic acid comprises a chemical modification. In some embodiments, the antisense nucleic acid comprises a phosphorodiamidate morpholino oligomer (PMO).
In some embodiments, the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the antisense nucleic acid targets a 5’ untranslated region of the ABCD2 gene. In some embodiments, administering the therapeutic agent increases expression of ABCD2 mRNA. In some embodiments, administering the therapeutic agent increases expression of ABCD2 protein.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinaiy skill in the art to which this disclosure pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 shows an exemplary schematic of oligonucleotide-based therapeutics in a cell.
FIG. 2 shows an exemplary schematic of antisense nucleic acids that include a phosphorodiamidate morpholino oligomer targeting upstream open reading frames in 5’ UTR of an mRNA.
FIG. 3 shows fluorescence images of patient-derived fibroblasts after three doses of ASOs (IpM, 5pM, and lOpM) were delivered into the cells.
FIG. 4 shows the expression of ABCD2 mRNA in human fibroblasts within 48h of ASO transfection with three doses of ASOs (IpM, 5pM, and lOpM).
FIGs. 5A-5C show VLCFA levels in human fibroblasts within 7 days of ASO transfection with three doses of ASOs (IpM, 5pM, and lOpM).
FIG. 6 shows an exemplary schematic of three antisense oligonucleotides (ASOs) with phosphorodiamidate morpholino (PMO) modifications on all nucleotides designed to directly target upstream open reading frame (uORF) regions of ABCD2 to increase its expression (ASO1 - SEQ ID NO: 1, ASO2 - SEQ ID NO: 2, ASO3 - SEQ ID NO: 3).
FIG. 7 shows fluorescence images of fibroblasts after 48 hours of ASO transfection and media change. ASO localization in fibroblasts was imaged at 20x using a Leica DMi8 Thunder Imager. The 3’-carboxyfluorescein signal attached to ASOs was found within fibroblasts, indicating successful delivery of ASOs within cells.
FIG. 8 shows RT-qPCR analysis revealed dose-dependent increase of ABCD2 expression levels in four patient ALD fibroblasts after 48 hours of ASO transfection. Relative to baseline expression levels, all ASOs led to significant increase in ABCD2 expression. The largest enhancement was observed after treatment with ASO2, resulting in an up to 4.7-fold increase in ABCD2 expression over baseline levels.
FIGs. 9A-9B show baseline C26:0 and C24:0 lysoPC were significantly higher in ALD fibroblasts compared to control. FIG. 9A shows a significant dose-dependent reduction in C26:0 levels after 7 days of ASO transfection. The most prominent reduction was noted with ASO2 in all ALD lines. FIG. 9B shows additionally, a significant dose-dependent reduction in C24:0 levels after 7 days of ASO transfection.
DETAILED DESCRIPTION
In various aspects, this disclosure describes using antisense oligonucleotides (ASOs) to increase the levels of ABCD2 expression and peroxisomal transporters, wherein the higher levels of ABCD2 can compensate for the reduction in the expression of functional ABCD1 and clinically improve the symptoms of patients with adrenoleukodystrophy.
In some embodiments, provided herein are antisense nucleic acids that target a 5’ upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino backbone. In some embodiments, an antisense nucleic acid comprises an antisense oligonucleotide (ASO).
Also provided herein are pharmaceutical compositions including a therapeutic agent, wherein the therapeutic agent increases ABCD2 gene expression; and an excipient. Also provided herein are methods of treating adrenoleukodystrophy (ALD) that include
administering a therapeutic agent to the subject, wherein the therapeutic agent increases ABCD2 gene expression.
Various non-limiting aspects of these compositions and methods are described herein, and can be used in any combination without limitation. Additional aspects of various components of the compositions and methods described herein are known in the art.
It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.
As used herein, the term “about”, when used herein in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” in that context. For example, in some embodiments, the term “about” may encompass a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.
As used herein, the term “administration” typically refers to the administration of a composition to a subject or system to achieve delivery of an agent that is, or is included in, the composition. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be ocular, oral, parenteral, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, transdermal, etc.), enteral, intra-arterial, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, intracisternal, within a specific organ (e.g., intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and/or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.
As used herein, the term “expression” refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. In some embodiments, if the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic
cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.
As used herein, “nucleic acid” in its broadest sense, refers to a compound and/or substance that is, or can be incorporated into, a polynucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is, or can be incorporated into, a polynucleotide chain with a phosphodiester linkage. As will be clear from context, in some embodiments, "nucleic acid" refers to an individual nucleic acid residue (e.g., a nucleotide and/or nucleoside); in some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, a "nucleic acid" is or comprises ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a P-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2’-amino-LNA having a 2’-amino functionalization, and 2’-amino-a-LNA having a 2’-amino functionalization), or a combination thereof. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid residue analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that one or more residues, and in some embodiments, are linked together other than by a phosphodiester. For example, in some embodiments, a nucleic acid includes one or more phosphorothioate and/or phosphoroamidite (e.g., 5'-N-phosphoramidite) linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid includes one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxy cytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2- thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5 -methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C 5 -bromouridine, C5- fluorouridine, C -iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5- methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2 '-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence
that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), enzymatic synthesis in the absence of a complementary template, reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide.
Modifications can be introduced into a nucleotide sequence by standard techniques known in the art, such as site-directed mutagenesis and polymerase chain reaction (PCR)- mediated mutagenesis. Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. Such families include amino acids with basic side chains (e.g., arginine, lysine and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., asparagine, cysteine, glutamine, glycine, serine, threonine, tyrosine, and tryptophan), nonpolar side chains (e.g., alanine, isoleucine, leucine, methionine, phenylalanine, proline, and valine), beta-branched side chains (e.g., isoleucine, threonine, and valine), and aromatic side chains (e.g., histidine, phenylalanine, tryptophan, and tyrosine), and aromatic side chains (e.g., histidine, phenylalanine, tryptophan, and tyrosine).
As used herein, the term “nucleotides” and “nt” are used interchangeably herein to generally refer to biological molecules that comprise nucleic acids. Nucleotides can have moieties that contain the known purine and pyrimidine bases. Nucleotides may have other heterocyclic bases that have been modified. Such modifications include, e.g., methylated purines or pyrimidines, acylated purines or pyrimidines, alkylated riboses, or other heterocycles. In some embodiments, nucleic acid modifications can also include a blocking modification comprising a 3’ end modification (e.g., a 3’ dideoxy C (3’ddC), 3’ddG, 3’ddA, 3’ddT, 3’ inverted dT, 3’ C3 spacer, 3’ amino, 3’ biotinylation, or 3’ phosphorylation). The terms “polynucleotides,” “nucleic acid,” and “oligonucleotides” can be used interchangeably,
and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise non-naturally occurring sequences. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by nonnucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
As used herein, the term “subject” refers an organism, typically a mammal (e.g., a human). In some embodiments, a subject is suffering from a relevant disease, disorder, or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more signs or symptoms or characteristics of a disease, disorder, or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and/or therapy is and/or has been administered.
As used herein, the term “treating” means a reduction in the number, frequency, severity, or duration of one or more (e.g., two, three, four, five, or six) symptoms of a disease or disorder in a subject (e.g., any of the subjects described herein), and/or results in a decrease in the development and/or worsening of one or more symptoms of a disease or disorder in a subject.
Antisense Oligonucleotides (ASOs)
Antisense oligonucleotides (ASOs) are single-stranded nucleic acid molecules (e.g., deoxynucleotide or ribonucleotide analogues) targeting coding and non-coding ribonucleic acid (RNA) molecules. Depending on the sequence and chemical modification, ASOs are able to increase the level of functional protein, reduce the level of toxic proteins, or modify the
structure of impaired protein to improve function. ASOs have also been used to inhibit gene expression, modulate splicing of a precursor messenger RNA, or inactivate microRNAs. In some embodiments, ASOs can hybridize to a target RNA (e.g., target mRNA) in a sequencespecific manner. In some embodiments, in order to stabilize ASOs against nucleolytic degradation, ASOs can include chemically modified nucleotides such as phosphorothioates, 2’-O-methyl RNA, phosphorodiamidate morpholino oligomers (PMO), or locked nucleic acids.
In some embodiments, provided herein are antisense nucleic acids that target a 5’ upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid includes a phosphorodiamidate morpholino backbone. In some embodiments, an antisense nucleic acid comprises an antisense oligonucleotide (ASO). In some embodiments, an antisense nucleic acid comprises about 20 to about 23 nucleotides. In some embodiments, an antisense nucleic acid comprises 20 to 23 nucleotides. In some embodiments, an antisense nucleic acid comprises 20 nucleotides. In some embodiments, an antisense nucleic acid comprises 21 nucleotides. In some embodiments, an antisense nucleic acid comprises 22 nucleotides. In some embodiments, an antisense nucleic acid comprises 23 nucleotides.
In some embodiments, a nucleotide of the antisense nucleic acid comprises a chemical modification. In some embodiments, as described in further detail below, an antisense nucleic acid can include different modifications, e.g., in the sugar backbone to make it more cell permeable and nuclease resistant and physiologically non-toxic at low concentrations. In some embodiments, an antisense nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, (e.g., a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro-modified nucleotide). In some embodiments, RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and such modified oligonucleotides have been shown to have a higher Tm (e.g., higher target binding affinity) than 2'-deoxyoligonucleotides against a given target.
A number of nucleotide and nucleoside modifications have been shown to make a nucleic acid into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; such modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified nucleic acids include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. In some embodiments, oligonucleotides can be modified
with phosphorothioate backbones or with heteroatom backbones, particularly CH2 -NH-O- CH2, CH,-N(CH3)-O-CH2 (known as a methylene(methylimino) or MMI backbone], CH2 -0- -N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and 0-N (CH3)- CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as 0- P- 0- CH,); amide backbones (see, e.g., De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374); morpholino backbone structures (see, e.g., Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (see, e.g., Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.
Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. Such modified oligonucleotides include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see US patent nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046;
5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3, OCH3 O(CH2)n CH3, O(CH2)n NH2 or O(CH2)n CH3 where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3 ; OCF3; O-, S , orN-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. In some embodiments, one or more substituted sugar moieties includes 2'-methoxyethoxy [2'-O-CH2CH2OCH3, also known as 2'-O-(2- methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other exemplary modifications include 2'-methoxy (2'-O-CH3), 2'-propoxy (2'-OCH2 CH2CH3) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
Antisense nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5 -methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2 -thio thymine, 5 -bromouracil, 5- hydroxymethyluracil, 8- azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine and 2,6- diaminopurine (see, e.g., Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). A “universal” base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C. (see, e.g., Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278, each of
which is incorporated herein by reference) and are presently preferred base substitutions. In some embodiments, antisense nucleic acid includes one or more chemical modifications. In some embodiments, one or more nucleotides of an antisense nucleic acid comprises a chemical modification. In some embodiments, all nucleotides of an antisense nucleic acid comprises a chemical modification.
In some embodiments, an antisense nucleic acid can include a phosphorodiamidate morpholino oligomer (PMO), wherein such an antisense nucleic acid comprises a phosphorodiamidate morpholino backbone.
In some embodiments, an antisense nucleic acid targets an AUG sequence of the 5’ upstream open reading frame of the ABCD2 mRNA. In some embodiments, an antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, an antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
SEQ ID NO: 1
CATGCTTCACAGAAATCCCCAGC
SEQ ID NO: 2
GATCATGCTTCACAGAAATCCCC
SEQ ID NO: 3
CATAGTCTGCAGCGTTTCTC
In some embodiments, an antisense nucleic acid comprises or consists of a nucleotide sequence that differs in sequence at one or more positions as compared to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. For example, an antisense nucleic acid can comprise a nucleotide sequence that differs by one or two positions as compared to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, such that the antisense nucleic acid can still hybridize to the target mRNA and carry out its effects (e.g., induce ABCD2 gene expression).
Methods of Treating X-linked adrenoleukodystrophy (ALD)
X-linked adrenoleukodystrophy (X-ALD) is caused by defects of the ABCD1 gene on chromosome Xq28, resulting in an impairment of peroxisomal beta-oxidation and the accumulation of saturated very long chain fatty acids (VLCFAs). The metabolic abnormality, elevated levels of very long-chain fatty acids in tissues and plasma, and the biochemical defect, reduced peroxisomal very long-chain acyl-CoA synthetase (VLCS) activity, are ubiquitous features of the disease. Additionally, the abnormal gene in X-ALD is not the gene for VLCS. Rather, it encodes a peroxisomal membrane protein with homology to the ATP-binding cassette (ABC) transmembrane transporter superfamily of proteins. The X-ALD protein (ALDP) is closely related to three other peroxisomal membrane ABC proteins: ABCD1 (ALDP), ABCD2 (ALDRP), and ABCD3 (PMP70), wherein evidence has been shown that their increased expression can compensate for the reduce levels of ABCD1.
Provided herein are pharmaceutical compositions comprising a therapeutic agent, wherein the therapeutic agent increases ABCD2 gene expression, and an excipient. In some embodiments, a therapeutic agent comprises an antisense nucleic acid. In some embodiments, a therapeutic agent comprises an antisense oligonucleotide (ASO). In some embodiments, a therapeutic agent targets a 5’ untranslated region of the ABCD2 gene. In some embodiments, a therapeutic agent comprises any one of the antisense nucleic acids described herein.
In some embodiments, administering a therapeutic agent increases expression of ABCD2 rnRNA. In some embodiments, administering a therapeutic agent increases expression of ABCD2 protein.
Also provided herein are methods of treating adrenoleukodystrophy (ALD) in a subject that include administering a therapeutic agent to the subject, wherein the therapeutic agent increases ABCD2 gene expression, thereby treating ALD. In some embodiments, a therapeutic agent comprises an antisense nucleic acid. In some embodiments, a therapeutic agent comprises an antisense oligonucleotide (ASO). In some embodiments, a therapeutic agent comprises any one of the antisense nucleic acids described herein.
In some embodiments, administering a therapeutic agent increases expression of ABCD2 mRNA and/or increases expression of ABCD2 protein, thereby treating ALD in the subject.
EXAMPLES
The disclosure is further described in the following examples, which do not limit the scope of the disclosure described in the claims.
Example 1 - Antisense oligonucleotide induce ABCD2 gene expression
The in vitro study aimed to assess the ability of three different ASOs to induce ABCD2 gene expression. It was hypothesized that pharmacological induction of ABCD2, wherein antisense oligonucleotides targeting upstream open reading frames on mature ABCD2 mRNA, may be able to enhance peroxisomal transporter protein and reduce the VLCFA levels caused by ABCD1 mutations (FIGs. 1-2).
Three antisense oligonucleotides (ASOs) with phosphorodiamidate morpholino (PMO) modifications on all nucleotides were designed to directly target upstream open reading frame (uORF) regions of ABCD2 to increase its expression (FIG. 6).
Fibroblasts derived from one patient with X-ALD (P: 5) and one healthy control (p: 7) were grown on 6-well-plates. After cells were 80% confluent, three doses of ASOs (luM, 5uM, and lOuM) were added to patient-derived fibroblasts. Endo-porter (6ul per ml) was used as a transfection reagent. After 48 hours of ASO transfection and media change, ASO localization in fibroblasts was imaged at 20x using a Leica DMi8 Thunder Imager. The 3’- carboxyfluorescein signal attached to ASOs was found within fibroblasts, indicating successful delivery of ASOs within cells (FIG. 7).
Results showed ASO delivery into the cells using the transfection reagent (FIG. 3); ABCD2 mRNA expression within 48h of ASO transfection (FIG. 4); VLCFA levels within 7 days of ASO transfection (FIGs. 5A-5C). Furthermore, RT-qPCR analysis revealed dosedependent increase of ABCD2 expression levels in four patient ALD fibroblasts after 48 hours of ASO transfection. Relative to baseline expression levels, all ASOs led to significant increase in ABCD2 expression, wherein the largest enhancement was observed after treatment with ASO2, resulting in an up to 4.7-fold increase in ABCD2 expression over baseline levels (FIG. 8). Baseline C26:0 and C24:0 lysoPC were significantly higher in ALD fibroblasts compared to control. A significant dose-dependent reduction in C26:0 levels after 7 days of ASO transfection was observed, wherein the most prominent reduction was noted with ASO2 in all ALD lines (FIG. 9A). Additionally, a significant dose-dependent reduction in C24:0 levels after 7 days of ASO transfection was observed (FIG. 9B).
Claims
1. An antisense nucleic acid that targets a 5’ upstream open reading frame of an ABCD2 mRNA, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino backbone.
2. The antisense nucleic acid of claim 1, wherein the antisense nucleic acid comprises an antisense oligonucleotide (ASO).
3. The antisense nucleic acid of claim 1 or 2, wherein the antisense nucleic acid comprises 20 to 23 nucleotides.
4. The antisense nucleic acid of any one of claims 1-3, wherein a nucleotide of the antisense nucleic acid comprises a chemical modification.
5. The antisense nucleic acid of claim 4, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino oligomer (PMO).
6. The antisense nucleic acid of any one of claims 1-5, wherein the antisense nucleic acid targets an AUG sequence of the 5’ upstream open reading frame of the ABCD2 mRNA.
7. The antisense nucleic acid of any one of claims 1-6, wherein the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
8. The antisense nucleic acid of claim 7, wherein the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
9. A pharmaceutical composition comprising a therapeutic agent, wherein the therapeutic agent increases ABCD2 gene expression; and an excipient.
10. The pharmaceutical composition of claim 9, wherein the therapeutic agent comprises an antisense nucleic acid.
11. The pharmaceutical composition of claim 10, wherein the therapeutic agent comprises an antisense oligonucleotide (ASO).
12. The pharmaceutical composition of claim 11, wherein the ASO comprises 20 to 23 nucleotides.
13. The pharmaceutical composition of claim 11 or 12, wherein a nucleotide of the ASO comprises a chemical modification.
14. The pharmaceutical composition of claim 13, wherein the ASO comprises a phosphorodiamidate morpholino oligomer (PMO).
15. The pharmaceutical composition of any one of claims 10-14, wherein the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
16. The pharmaceutical composition of claim 15, wherein the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
17. The pharmaceutical composition of any one of claims 10-16, wherein the antisense nucleic acid targets a 5’ untranslated region of the ABCD2 gene.
18. The pharmaceutical composition of any one of claims 9-17, wherein administering the therapeutic agent increases expression of ABCD2 mRNA.
19. The pharmaceutical composition of any one of claims 9-18, wherein administering the therapeutic agent increases expression of ABCD2 protein.
20. A method of treating adrenoleukodystrophy (ALD) in a subject in need thereof, the method comprising: administering a therapeutic agent to the subject, wherein the therapeutic agent increases ABCD2 gene expression, thereby treating ALD.
21. The method of claim 20, wherein the therapeutic agent comprises an antisense nucleic acid.
22. The method of claim 21, wherein the therapeutic agent comprises an antisense oligonucleotide (ASO).
23. The method of claim 21 or 22, wherein the antisense nucleic acid comprises 20 to 23 nucleotides.
24. The method of any one of claims 21-23, wherein a nucleotide of the antisense nucleic acid comprises a chemical modification.
25. The method of claim 23, wherein the antisense nucleic acid comprises a phosphorodiamidate morpholino oligomer (PMO).
26. The method of any one of claims 21-25, wherein the antisense nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
27. The method of claim 26, wherein the antisense nucleic acid consists of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
28. The method of any one of claims 21-27, wherein the antisense nucleic acid targets a 5’ untranslated region of the ABCD2 gene.
29. The method of claim any one of claims 21-28, wherein administering the therapeutic agent increases expression of ABCD2 mRNA.
30. The method of any one of claims 21-29, wherein administering the therapeutic agent increases expression of ABCD2 protein.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363521413P | 2023-06-16 | 2023-06-16 | |
| US63/521,413 | 2023-06-16 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2024259262A2 true WO2024259262A2 (en) | 2024-12-19 |
| WO2024259262A3 WO2024259262A3 (en) | 2025-04-24 |
Family
ID=93852743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2024/034048 Ceased WO2024259262A2 (en) | 2023-06-16 | 2024-06-14 | Antisense nucleic acids to induce abcd2 expression |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2024259262A2 (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003259285A1 (en) * | 2002-07-29 | 2004-02-16 | Hmgene, Inc. | Methods of identifying adipocyte specific genes, the genes identified, and their uses |
| EP2655621B1 (en) * | 2010-12-20 | 2018-05-23 | The General Hospital Corporation | Polycomb-associated non-coding rnas |
-
2024
- 2024-06-14 WO PCT/US2024/034048 patent/WO2024259262A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024259262A3 (en) | 2025-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7745609B2 (en) | Antisense modulation of CD40 expression | |
| US8067386B2 (en) | Modulation of eIF4E-BP2 expression | |
| ES2808561T3 (en) | RNA interference for the treatment of gain-of-function disorders | |
| JP7049247B2 (en) | Compositions and Methods for the Treatment of Kidney Disease | |
| US7598227B2 (en) | Modulation of apolipoprotein C-III expression | |
| KR101682735B1 (en) | Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf | |
| ES2658626T3 (en) | Treatment of diseases related to glial cell-derived neurotrophic factor (GDNF) by inhibition of natural antisense transcript to GDNF | |
| US20040101852A1 (en) | Modulation of CGG triplet repeat binding protein 1 expression | |
| CN107109411A (en) | Targeted increase in nuclear gene export | |
| US11946050B2 (en) | Polynucleotide compositions and methods for gene expression regulations | |
| US20040101857A1 (en) | Modulation of cytokine-inducible kinase expression | |
| US20040102391A1 (en) | Modulation of Gankyrin expression | |
| US20040224912A1 (en) | Modulation of PAI-1 mRNA-binding protein expression | |
| US7807652B2 (en) | Modulation of eIF4E-BP2 expression | |
| WO2024081163A1 (en) | Method of treating lbsl by modulating dars2 | |
| US20040115636A1 (en) | Modulation of interleukin 18 expression | |
| CA3207341A1 (en) | Compositions for treatment of conditions and diseases associated with polycystin expression | |
| US20040101853A1 (en) | Modulation of STAT2 expression | |
| US20040102401A1 (en) | Modulation of jagged 1 expression | |
| US7700574B2 (en) | Modulation of RANKL expression | |
| US20040101848A1 (en) | Modulation of glucose transporter-4 expression | |
| US20040137623A1 (en) | Delivery of oligonucleotide compounds into osteoclasts and modulation of osteoclast differentiation | |
| US20050181400A1 (en) | Modulation of eIF4E-BP1 expression | |
| US20040102403A1 (en) | Modulation of fibrillarin expression | |
| CN121109382A (en) | Oligonucleotides that regulate alternative splicing of the SLK gene, their preparation and applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |