WO2024257028A2

WO2024257028A2 - Fermentation material

Info

Publication number: WO2024257028A2
Application number: PCT/IB2024/055825
Authority: WO
Inventors: Fabio Pereira; Javier VARELA; Ricardo Figueiredo; Bogdan KURPIL
Original assignee: Cataya Bio Shanghai Co Ltd
Current assignee: Cataya Bio Shanghai Co Ltd
Priority date: 2023-06-14
Filing date: 2024-06-14
Publication date: 2024-12-19
Anticipated expiration: 2025-12-14
Also published as: CN121443747A; WO2024257028A3

Abstract

The present invention relates to a spray dried fermentation material comprising at least 8 wt.% acetylated derivative of a sphingoid base of formula (1), wherein R¹ is C₁₁-C₂₄ alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, and wherein said acetylated derivative of the sphingoid base comprises a mixture of tri- and di- acetylated derivatives of said sphingoid base in a ratio from about 1:0.2 to about 0.2:1, correspondingly. The invention discloses a method of producing the spray dried fermentation material and cells that are capable of fermenting the acetylated derivatives of the sphingoid base.

Description

P-CC-0040/PT DESCRIPTION FERMENTATION MATERIAL Field of Invention The present invention relates to a fermentation material comprising acetylated derivatives of spingoid bases produced by yeast strains and to a method for the preparation thereof. Background Sphingolipids are essential components of cell membrane and are crucial for normal functioning of cells of both neural tissue, skin, and immune system. Oleaginous microorganisms have been found to produce sphingolipids such as sphingosine, phytosphingosine and/or derivatives thereof. These microorganisms (e.g., yeasts Pichia ciferrii, also known as

ciferrii, or Yarrowia lipolytica) provides sources for sphingolipids themselves and have described as potential “cell factories” for the production of starting materials for the manufacturing of other commercially valuable compounds which could offer a viable alternative to the use of animal sources of these compounds (see review Athenaki M., et al., 2017, Journal of Applied Microbiology 124, 336-367). For example, acetylated derivatives of sphingosine, dihydrosphingosine and phytosphingosine produced by yeast cells may be deacetylated and the thus- obtained sphingosine, dihydrosphingosine or phytosphingosine may be chemically converted into related compounds such as ceramides, pseudoceramides and/or glycoceramides which in turn may be applied in cosmetic and dermatological products. However, the complex and relatively resistant cell wall of yeasts limits the full recovery of intracellular lipids and usually solvent extraction is not sufficient to effectively extract the lipid bodies. A pre-treatment or cell disruption method is hence a prerequisite prior to solvent extraction. In general, there are no recovery methods that are equally efficient for different species of oleaginous yeasts. Each method adopts different mechanisms to disrupt cells and extract the lipids, thus a systematic evaluation is essential before choosing a particular method to efficiently extract these compounds. So far, a major strategy of industrial research was to improve the production of the compounds by improving the synthetic capacity of yeast cells. Typically, these yeast strains are subjected to various genetic modifications to enhance the production. Although, it would be highly desirable to obtain strains with substantially higher productivity, it would hardly solve the problem of insufficient extraction of the synthesized lipids from the cells. One of the problems associated with the insufficient extraction of sphingoid bases from the P-CC-0040/PT fermentation material is that the compounds are poorly soluble in water and, therefore, either dewatering is needed before applying organic solvents or use of complexing agents that increase the aqueous solubility of the substances. Both later approaches have been described in connection with fermentation and extraction of the fermented sphingoid bases. For example, WO2017033463 describes the use of complexing agents for the fermented TAPS, tetracetylated derivative of phytosphingosine. US20030143659 describes two down-stream processing procedures for the fermentation material containing TAP produced by P. ciferri, both including dewatering: (i) a sequential dewatering of the biomass by a three-step procedure including harvesting the cells by centrifugation, extruding of the cell pellet to create a granular-like material and drying the extrudate, and (ii) a one-step dewatering of fermentation broth by spray-drying. However, according to US20030143659, using the procedure (i) for the fermentation material containing TAPs has significant disadvantage – there is a high loss of the compounds in spray-drying, and therefore it is practically unapplicable for the industrial production of the compounds. Recently, WO2022158993 has described the use of spray-granulation for dewatering of a similar fermentation material containing TAPS. In contrary to US20030143659, WO2022158993 did not report major (over 70%) losses of the fermented TAPS in spray-granulation, yet a noticeable loss of at least 20% of fermented TAPS was observed. Accordingly, there is a need for efficient robust, economically efficient, and environmentally friendly industrial methods for the production of spingoid bases. Summary of Invention The present invention provides recombinant Pichia ciferrii (Wickerhamomyces ciferrii) cells that are capable of fermenting significant amounts of acetylated derivatives of sphingoid bases, an efficient and robust fermentation method, and an effective and an ecologically friendly approach for the extraction of the fermented acetylated analogues of sphingoid bases from the de-watered fermentation material prepared by spray-drying. In particular, a first aspect of the present invention relates to a spray dried fermentation material comprising at least around 8 wt.% acetylated derivatives of a sphingoid base of formula (1): P-CC-0040/PT wherein R¹ is C11-C24 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, and wherein said acetylated derivatives of the sphingoid base comprise a mixture of tri- and di- acetylated derivatives of said sphingoid base a ratio from about 1:0.2 to about 0.2:1, correspondingly. A second aspect of the invention relates to a method of producing a spray dried fermentation material comprising at least about 8 wt.% acetylated derivatives of a sphingoid base of formula (1):

(1), wherein R¹ is C₁₁-C₂₄ alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, comprising - fermenting acetylated derivatives of the sphingoid base of formula (1) in a yeast cell; - collecting the fermentation material at the end of fermentation, wherein the fermentation material comprising the biomass and fermentation broth; - spray drying the collected fermentation material, and thereby obtaining said spray dried fermentation material, wherein P-CC-0040/PT the fermentation material comprises at least around 1 wt.% acetylated derivatives of said sphingoid base, and wherein said acetylated derivative comprises a mixture of tri- and di- acetylated derivatives of said sphingoid base in a ratio from about 1:0.2 to about 0.2:1, correspondingly. A third aspect of the invention relates to a recombinant Wickerhamomyces ciferrii cell, wherein said cell is Hygromycin B resistant and wherein said cells is producing a mixture of acetylated derivatives of a sphingoid base of formula (1), wherein said mixture comprises tri- and diacetylated derivatives of said sphingoid base in a ratio from about 1:0.2 to about 0.2:1, correspondingly. Detailed description of Invention Introducing the Hygromycin B resistant gene of Escherichia coli, hph, a common selectable marker, in the genome of wild type yeast Wickerhamomyces ciferrii (W. ciferrii) surprisingly resulted in an improved fermentation of acetylated derivatives of D-ribo-phytosphingosine (interchangeably called herein as “phytosphingosine” or “phSph”) by the recombinant cells. Even more surprising, these recombinant cells not only produced higher amounts of acetylated phytosphingosine derivatives, but also provided a robust and stable fermentation characterized in that the cells fermented a mixture of acetylated devivatives of phSph that typically comprised at least tri- and di-acetylated derivatives (TriAPS and DiAPS) in a ratio from about 1:0.2 to about 0.2:1, correspondingly. A further genetic modification of these cells, in order to create a D-erythro-dihydrosphingosine producing strain, in particular, inactivation of the SYR2/SUR2 gene encoding sphinganine C4-hydroxylase, which catalyses the conversion of dihydrosphingosine (interchangably called herein as “D-erythro- dihydrosphingosine” or “sphinganine” or “dhSph”), to phytosphingosine, did not affect high productivity, robustness and viability of the cells, and the cells did also retain the profile of fermented acetylated derivatives of this sphingoid base, i.e. the cells typically fermented a mixture of acetylated derivatives of dhSph that comprised at least tri -and di- -acetylated derivatives (and TriADS and DiADS, correspondingly) in the ratio from about 1:0.2 to about 0.2:1, correspondingly. The fermentation material obtained from these two different Hygromycin B resistant W. ciferrii strains, when spray-dried, provided an excellent starting material for an efficient extraction of the fermented acetylated derivatives of both above mentioned sphingoid bases. Accordingly, in different aspects the present invention relates to - a Hygromycin B resistant W. ciferrii strain that produces a mixture of acetylated derivatives of a sphingoid base of formula (1): P-CC-0040/PT

wherein R¹ is C5-50 alkyl, preferably a C11-21 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen or is a single bond when R² is -OH; - a method of producing a mixture of acetylated derivatives of said sphingoid base, comprising incubating the cell in a fermentation medium under conditions allowing to obtain a fermentation material comprising at least about 1 wt.% acetylated derivatives of the sphingoid base; and - a spray-dried fermentation material comprising at least about 8 wt.% acetylated derivatives of the fermented sphingoid base obtained following the fermentation. The above aspects and different embodiments of the invention are described throughout the specification and illustrated by non-limiting working examples presented herein. Terms and definitions specified below relate to all aspects and embodiments of the invention, unless mentioned otherwise. The term “a” grammatically is a singular, but it may as well mean the plural of e.g., the intended compound. For example, a skilled person would understand that in the expression “a sphingoid base of formula (1)”, the provision of not only one single sphingoid base of formula (1), but of a variety of compounds of the same type is meant. As used herein, the various functional groups or substituents represented will be understood to have a point of attachment at the functional group or atom having the dash (-). For example, in the case of -OH it will be understood that the point of attachment is the oxygen atom. If a group is listed without a dash, then the attachment point is indicated by the plain and ordinary meaning of the recited group. The skilled person would understand that when speaking of position C-1, C-2, C-3, C-4, C-5 etc., reference is herein always made to the respective carbon atoms of sphingoid base of formula (1). P-CC-0040/PT As used herein, the term “alkyl” refers to an acyclic straight or branched hydrocarbyl group having 1- 50 carbon atoms which may be saturated or contain one or more double and/or triple bonds, so forming, for example, an alkenyl or an alkynyl, and/or which may be substituted or unsubstituted, as herein further described. Typically, the term alkyl refers to a straight acyclic hydrocarbyl group having 5-50 carbons, which may be substituted or unsubstituted. As used herein, the term “substituted” means that the group or molecule in question is substituted with a group which typically modifies the general chemical characteristics of the group or molecule in question. The substituents can be used to modify characteristics of the group or molecule, such as stability, solubility and the ability of the to form crystals. The person skilled in the art will be aware of other suitable substituents of a similar size and charge characteristics, which could be used as alternatives in a given situation. As used herein, the term “fermentation material” refers to a material obtained from a fermentation process, preferably a microbial fermentation process, which typically comprises an aqueous phase (also termed “fermentation broth” or “fermentation medium”), and a biomass. The aqueous phase typically comprises water soluble components such hydrophilic molecules, soluble proteins, and electrolytes. The biomass typically comprises the microbial cells, and any molecule or component with lower affinity to the aqueous phase such as hydrophobic molecules, denaturated proteins, and cell debris. By “microbial cell” is preferably meant a yeast cell, in particular,

ciferrii/Pichia ciferrii cell. In the context of the present invention, the terms “about”, “around”, or “approximate” are applied interchangeably to a particular value (e.g. “a purity of about 85%”, “a purity of around 85%”, or “a purity of approximate 85%”), or to a range (e.g. “between about 11 wt.% to about 15 wt.%”, “between around 11 wt.% to around 15 wt.%”, or “between approximately 11 wt.% to approximately 15 wt.%” ), to indicate a deviation from 0.1% to 10% of that particular value or range. However, some values maybe indicated without connection to the latter terms, and such case it is understood that a deviation of the value within 0.1%-10% is contemplated, unless otherwise specified. Throughout the specification “wt.%” is meant the weight of the named substance contained in the 100 g of the named composition, e.g. the solid matter typically have a water content of at least about 50 wt.%, means that 100 g of the solid matter typically contains about 50 g of water. Sphingoid bases according to the present invention are preferably represented by a sphingoid base of formula (1): P-CC-0040/PT

(1), wherein, R¹ is C5-50 alkyl, preferably a C11-21 alkyl, such as a a C11-17 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen or is a single bond when R² is - OH. In some preferred embodiments, the sphingoid base of formula (1) is of D-ribo-phytosphingosine. In some other preferred embodiments, the sphingoid base of formula (1) is D-erythro- dihydrosphingosine. As used herein, the term “acetylated derivative(s) of the sphingoid base of formula (1)” refers to derivative(s) of the sphingoid base of formula (1), wherein the C-1 hydroxyl group, and/or the C-3 hydroxyl group, and/or the C-4 hydroxyl group, and/or the C-2 amino group are acetylated. Accordingly, the acetylated derivative(s) of the sphingoid base of formula (1) may be mono-, di-, tri-, tetra-acetylated derivative(s) of the sphingoid base of formula (1). In different embodiments, the acetylated derivative(s) are a mixture of two, three or four of said derivatives, preferably, the mixture comprises at least di- and tri- acetylated derivative(s) of the sphingoid base of formula (1). In some embodiments, an acetylated derivative(s) of a sphingoid base of formula (1) is a mixture of acetylated derivative(s) of the sphingoid base, wherein the mixture comprises mono-, di-, tri-, and/or tetra-acetylated derivatives of ^D-ribo-phytosphingosine. In some embodiments, one or more acetylated derivative(s) of the sphingoid base of formula (1) comprised in the mixture is a tetra- acetylated derivative of D-ribo-phytosphingosine that is commonly abbreviated as TAPS. In some embodiments, one or more acetylated derivative(s) of the sphingoid base of formula (1) comprised in the mixture is a tri-acetylated derivative of D-ribo-phytosphingosine that is commonly abbreviated as TriAPS. In some embodiments, one or more acetylated derivative(s) of the sphingoid base of formula (1) comprised in the mixture is a di-acetylated derivative of ^D-ribo-phytosphingosine that is commonly abbreviated as DiAPS. In some embodiments, one or more acetylated derivative(s) of the sphingoid base of formula (1) comprised in the mixture is a mono-acetylated derivative of D-ribo- P-CC-0040/PT phytosphingosine that is commonly abbreviated as MAPS. In some embodiments, the mixture may comprise TAPS, TriAPS, DiAPS, and MAPS. In some other embodiments, the mixture may comprise TAPS, TriAPS and DiAPS. In some other embodiments, the mixture may comprise TriAPS, DiAPS and MAPS. Preferably, the mixture of acetylated derivative(s) of D-ribo-phytosphingosine comprises at least TriAPS and DiAPS, and the ratio between TriAPS and DiAPS in the mixture is from about 0.2:1 to about 1:0.2. In some embodiments, an acetylated derivative(s) of a sphingoid base of formula (1) is a mixture of acetylated derivative(s) of the sphingoid base, wherein the mixture comprises mono-, di- and tri- acetylated derivatives of ^D-erythro-dihydrosphingosine. In some embodiments, one or more acetylated derivative(s) of the sphingoid base of formula (1) comprised in the mixture may be a tri- acetylated derivative of D-erythro-dihydrosphingosine that is commonly abbreviated as TriADS. In some embodiments, one or more acetylated derivative(s) of sphingoid base of formula (1) comprised in the mixture may be a di-acetylated derivative of D-erythro-dihydrosphingosine that is commonly abbreviated as DiADS. In some embodiments, one or more acetylated derivative(s) sphingoid base of formula (1) comprised in the mixture may be a mono-acetylated derivative of D-erythro- dihydrosphingosine that is commonly abbreviated as MADS. In some other embodiments, the mixture may comprise TriADS, DiADS and MADS. Preferably, the mixture of acetylated derivative(s) of D-ribo- phytosphingosine comprises at least TriADS and DiADS, and the ratio between TriADS and DiADS in the mixture is from about 0.2:1 to about 1:0.2. In the context of the present invention, the terms “derivative” and “analogue” may be used interchangeably to describe a compound which was produced by a chemical modification of the original compound and differs from the original compound in that one or more structural components of the original compound, such as one or more atoms, functional groups, or substructures, are replaced with other atoms, groups, or substructures, i.e. the compound derived from the original compound by modification of that original compound. Term ”derivative” or “derived” may also be used herein to describe a microorganism, e.g. a cell, such as a yeast cell, wherein said microorganism is created by a genetic or other type manipulation/modification of the original microorganism, e.g. by treatment of the original microorganism with one or another chemical or physical factor, like an antibiotic, UV light etc. Microorganism derivatives derived from the original microorganism by a genetic manipulation/modification (or by the type of modification/treatment) performed by man are called herein “recombinant” microorganisms or cells. P-CC-0040/PT The term ”fermentation” or “fermenting” in the present context means a metabolic process that produces chemical changes in organic substances through the action of enzymes of a microorganism. The term “fermented” in connection with a substance means that the substance is produced via fermentation. The term “fermentation material” means biomass, i.e. a plurality of microorganisms that fermented a substance of interest, e.g. a sphingoid base, and a medium in with the microorganisms were cultivated/maintained while fermenting the substance, i.e. fermentation broth. The term “duration of fermentation” means a period of time during which the microorganism is fermenting a substance of interest. According to the invention, the substance of interest, i.e. a spingoid base of formula (1)

(1), wherein, R¹ is C_5-50 alkyl, preferably a C_11-21 alkyl, such as a a C_11-21 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen or is a single bond when R² is -OH, is produced via fermentation in a microorganism that is preferably a yeast cell, such as W. ciferrii cell. According to the invention, the W. ciferrii cell may be a wild type cell or it may be a recombinant cell. The term “wild type cell" means that the cell does not contain any artificial/synthetic genetic material that was introduced in the cell by genetic manipulation of the cell by man (in contrary to recombinant cell that is created by genetic manipulation by man). In some preferred embodiments, the invention uses recombinant cells. In one preferred embodiment, a recombinant cell is derived from a wild type W. ciferrii cell that was genetically manipulated to comprise the Hygromycin B-resistance gene of Escherichia coli, hph gene (hph-recombinant cell or hph-cell). P-CC-0040/PT In another preferred embodiment, a recombinant cell is the hph-containing recombinant W. ciferrii cell that is further genetically manipulated to inactivate the SUR2/SYR2 gene comprised in the genome of the wild type W ciferrii. The wild type W. ciferrii of the invention is preferably a W. ciferrii cell of strain F-60-10 (such as the strain having ATCC ID No.14091). According to the invention, both wild type W. ciferrii cells and the hph-W. ciferrii cells are capable of fermenting derivatives of D-ribo-phytosphingosine at least 1 wt.% of total fermentation material. Surprisingly, the hph-W. ciferrii cells are capable of fermenting around 5-10% higher amounts of the phytosphingosine derivatives than the wild-type cells, and also have an increased viability, i.e. the final fermentation material contains less dead cells and cell debris, which is advantageous for down-stream processing of the fermentation material to extract and purify the fermented substances of interest. To ferment acetylated derivatives of D-erythro-dihydrosphingosine (sphinganine), according to the invention, the above mentioned wild type W. ciferrii cells or hph-W. ciferrii cells are to be genetically modified to reduce the activity of SUR2/SYR2 gene comprised in the genome of the wild type W Ciferri. The term “reduce activity of a gene”, e.g. SUR2/SYR2, means to make the gene non-functional , e.g. to express either no or less of the corresponding gene transcript (mRNA), or to express an unstable or difunctional transcript which is either not translated to the protein encoded by the gene, or is translated to a protein that has a low or no functional activity which is normally associated with this protein. In other words, a protein encoded by the gene is not expressed in the cell, or it is expressed in a such low amount that its functional activity is practically undetectable. e.g., the product of the gene is a mutated protein with no or a decreased functional activity. In one embodiment of the invention, the activity of SUR2/SYR2 may be inactivated by a deletion of the entire gene sequence from W. ciferrii cell genome. By the term “entire sequence of the gene” means a fragment of the genomic DNA sequence comprising both coding sequence and regulatory elements of the gene that are essential for the coding sequence transcription and translation. In another embodiment, the gene may be inactivated by mutation of the coding sequence that would result on expression of a functionally inactive C4-sphinganine hydroxylase encoded by the gene. By the term “functionally inactive” in respect to an enzyme means that the enzyme is unable of catalyzing the reaction that it normally catalyzes in the cell, e.g. in respect to a functionally inactive C4-sphinganine hydroxylase it means that enzyme cannot catalyze the reaction of conversion of sphinganine to phytosphingosine in vivo. In it understood that a functionally inactive C4-sphinganine hydroxylase includes both the enzyme with amino acid sequence that comprises mutated/modified/deleted amino acid residues that are essential for the catalytic activity of the enzyme, and the functionally active enzyme, which is expressed in such low amounts that are insufficient to fully convert the P-CC-0040/PT synthesized by the cell sphinganine to phytosphingosine. i.e. the expression “low amount of functionally active enzyme ” in the present context means the amount of the enzyme is equalized to its functional activity which is evaluated by measuring the amounts of the initial compound (substrate) and final compound (reaction product) of the reaction that the enzymes catalyzes. In one preferred embodiment, the SUR2/SYR2 gene is fully or partially deleted from the genome of a sphingosine production cell. In some embodiments, the SUR2/SYR2 gene activity in a W. ciferrii may be affected by other means, like genetic disruption of the gene expression controlling elements, like the promotor region, or mutation of parts of the gene that relate to the stability or functionality of the gene transcript, mRNA. Methods for gene manipulation and cloning, as well as method for making recombinant cells are well known in the art and can be readily used for the purposes of the invention. Non-limiting example of the genetic manipulation the SUR2/SYR2 gene sequence to reduce the activity of the gene is described in working Examples illustrating the invention. Sphinganine accumulating recombinant yeasts have been described before, e.g. by disturbing the function of the SUR2/SYR2 gene in haploid Saccharomyces cerevisiae cells (Grilley et al., 1998, J Biol Chem 273:11062-11068) via screening for Syringomycin E resistant mutants. However, as it has been reported, these yeasts produce very low levels of sphinganine which are not enough for an efficient industrial production. Bae et al. (2004, Yeast, 21: 437-443) describe the sphinganine production level of a Saccharomyces cerevisiae sur2 null mutant lacking C4-sphinganine hydroxylase. It was shown to be only 346 pmol/mg protein, which corresponds to approximately 10 microgram/g biomass. This is far too low for a commercial process. Surprisingly, recombinant yeast cells with a reduced/no activity of the SUR2/SYR2 gene of this invention are capable of high- yield production of sphinganine, which amounts correspond to at least 1 wt.% of the total fermentation material. W. ciferrii fermentation according to the invention may be performed using standard approaches of the technical field, or as described in WO2022158993. The fermentation is preferably a batch fermentation. According to the invention, fermentation of acetylated derivatives of phytosphingosine and sphinganine in the corresponding W. ciferrii cells (as described above) typically comprises the following steps: - cultivating the selected W. ciferrii under conditions that allow to produce the corresponding acetylated derivative of sphingoid base for a period of time; and - collecting the entire fermentation material at the end of the cultivation period of time. P-CC-0040/PT By “cultivating” means maintaining of the cell in a medium comprising ingredients essential for the cell metabolism, like minerals, vitamins, carbon source, etc.. Cultivation conditions allowing production of sphingoid bases and acetylated analogs thereof are described in the art and can be used for the purposes of the present invention. However, surprisingly, the inventors found that cultivating the cells in a medium that contains around 8-10 wt.% glycerol, used as the carbon source, and around 0.1 wt.% magnesium is more efficient for the production of the compounds of interest, i.e. the same/similar yields of the acetylated derivatives of sphingoid bases can be produced in shorter fermentation periods of time. Surprisingly, a fermentation that lasts around 40-60 hours (called herein “short” fermentation) produces under these conditions a similar/same amounts of acetylated derivatives of the sphingoid base per a unit of biomass (i.e. weight, cell number, etc.) as the fermentation that lasts around 90-120 hours (called herein “long” fermentation). The yields of an acetylated derivative spingoid base of the invention fermented (either in long or short fermentation) in cells described herein are typically at least around 1 wt.% of the total fermentation material collected at the end of fermentation. Further, typically, the fermented acetylated derivative is represented by a mixture thereof that contains at least tri – and di-acetylated derivatives, and wherein the ratio between tri – and di-acetylated derivatives in the mixture is similar/same, independently whether said fermented derivative is produced using the short or long fermentation , i.e. a fermented mixture of acetylated derivatives contains in a ratio tri– and di-acetylated derivatives from about 1:0.2 to about 0.2:1, correspondingly. Accordingly, one aspect of the invention relates to a method of fermenting an acetylated derivative of a sphingoid base of formula (1), - comprising fermenting the acetylated derivative of the sphingoid base of formula (I) in a yeast cell; - collecting the fermentation material at the end of fermentation, wherein the fermentation material comprising the biomass and fermentation broth; wherein the fermenting comprising cultivating a W. ciferrii cell in a fermentation medium that comprises around 8-10 wt.% glycerol and around 0.1 wt.% magnesium. Preferably, the W. ceferrrii cell is recombinant cell. Preferably, recombinant W. ceferrrii cell is Hygromycin B resistant. In one preferred embodiment, the Hygromycin B resistant W. ceferrrii cell comprises no or reduced activity of the SUR2/SYR2 gene or said gene product, such as mRNA or protein. Preferably, the W. ceferrrii cell is cultivated in a fermentation medium comprising around 8-10 wt.% glycerol and around 0.1 wt.% magnesium for at least 40 hours, preferably from around 40 hours to P-CC-0040/PT around 60 hours. The fermentation time may be longer, as discussed above, in these embodiments, the fermentation medium preferably comprises a higher amount of magnesium, such as 40-60 % higher, and around 1.5 to 3.5 times lower amount of glycerol compared to the amounts used for a short fermentation. Preferably, the short (40-60 hours) fermentation of acetylated derivatives of the invention in the described above W. ceferrrii cells is performed in fermentation medium which comprise around 40-60% less all essential compounds, like phosphate, magnesium, trace minerals, vitamins, etc., but glycerol, compared to the medium used for the long fermentation (90-120 hours). The content of glycerol is, in contrary, is preferably at least 1.5 times higher in the short fermentation. Non-limiting examples of the cultivation medium are described in the working Examples illustrating the invention. Under the above described conditions, surprisingly, the yeast cells of the invention are capable to ferment an acetylated sphingoid base of the invention an amount of at least around 1 wt.% of the total fermentation material collected at the end of fermentation. By the term “end of fermentation” means the time point at the end of period of cultivation of a cell of the invention which is at least 40 hours and at most 120 hours. The collected fermentation material following the fermentation of the cell under the conditions according to the invention comprise a mixture of acetylated derivatives of a sphingoid base of the invention, wherein said mixture comprises at least tri- and di-acetylated derivatives of said base, and wherein the ratio of tri -to di-acetilated derivatives is from about 0.2:1 to about 1:0.2. As disclosed above, the species of the fermented derivatives of a sphingoid base depends on the type of recombinant cell used for the fermentation, however, the yields and the mentioned ratio of tri- and di- acetylated derivatives in the mixture are surprisingly similar for all species of the sphingoid base of the invention. Surprisingly, the inventors found that this robust fermentation provides a perfect material for down- stream processing of the fermented acetylated derivatives of the corresponding sphingoid which processing includes a step of spray-drying the fermentation material. The inventors, surprisingly found that the fermentation material obtained following fermentation according to the invention can be spray-dried without losing significant, if any, amounts of the fermented acetylated derivatives of the corresponding sphingoid base. In particular, the loss of compound of interest following spray- drying of the fermentation material is in the range of around 0.5%-10%, e.g. around 2% -5%, which makes the use of the method described herein is perfectly applicable for the industrial production of sphingoid bases. Accordingly, one aspect of the invention relates to a method of producing a spray dried fermentation material comprising an acetylated derivative of a sphingoid base of formula (1): P-CC-0040/PT

(1), wherein R¹ is C₁₁-C₂₄ alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, comprising - fermenting the acetylated derivative of the sphingoid base of formula (1) in a yeast cell; - collecting the fermentation material at the end of fermentation, wherein the fermentation material comprising the biomass and fermentation broth; - spray drying the collected fermentation material, and thereby obtaining said spray dried fermentation material, wherein the fermentation material before spray drying comprises at least around 1 wt.% acetylated derivative of said sphingoid base, and following the spray drying it comprises at least around 8 wt.% of said acetylated derivative, and wherein said acetylated derivative comprises a mixture of tri- and di-acetylated derivatives of said sphingoid base in a ratio from about 1:0.2 to about 0.2:1, correspondingly. Without being bound to a theory, the inventors assume that the presence of particular species of the acetylated derivatives of a sphingoid base of the invention (i.e. tri- and di-acetylated derivatives of the sphingoid bases) together with high amounts of the fermented compounds of interest in the fermentation material produced according to the invention contribute to efficiency of down-stream processing of said material that includes a step of spray-drying of the material. Spray-drying of the fermentation material according to the invention does not require particular precautions and can be performed using standard industrial or lab spray-drying equipment following guidance of the art, or performed as described in an illustrative working example presented in this _{patent application.} P-CC-0040/PT Preferably, spray drying according to the invention is performed at temperatures that are not exceeding 180⁰C. Preferably, the maximum inlet air temperature of around 150-180 °C, the minimum inlet air temperature of 100-130 °C and the minimum outlet air temperature of 60-80°C should be applied. A spray-dried fermentation material produced at such temperatures is typically characterized by a good flowability and is not-caking, which allows to store the material for long periods of time before further processing, i.e. extraction the fermented acetylated derivative from the material, and efficient extraction of the fermented compounds of interest. A small size of the particles of the spray- dried material, typically from around 20 μm to around 60 μm, contributes to efficiency of the following extraction with appropriate solvents. Preferably, fermentation material processed using spray drying is obtained using the short fermentation described above. Preferably, spray dried fermentation material comprises at most 5 wt.% water, more preferably at most 0.5-2.5 wt.% water. Extraction of the fermented acetylated derivatives if the spingoid base of the invention from the spray dried fermentation material is preferably conducted using a hydrophobic solvent. The solvent employed will depend upon the compound to be extracted, but in particular one can mention C_1-10 alkyl esters (e.g. ethyl or butyl acetate), toluene, C1-6 alcohols (e.g. methanol, propanol) and C3-8 alkanes (e.g. hexane), and/or a supercritical fluid (e.g. liquid CO2 or supercritical propane). Performing extraction on the small granules, one can significantly reduce the amount of solvent required, such as up 50-70 times less solvent may be needed in order to perform the extraction. Not only does this result in a significant economic saving, because less solvent is used, it also minimizes emission problems. By using small particles obtained following spray drying of the fermentation material according to the invention the surface area available to the solvent can be particularly high and therefore one can obtain good yields. Following the above disclosure, some preferred, however, not-limiting embodiments of the invention are listed below. 1. A spray dried fermentation material comprising at least 8 wt.% acetylated derivative of a sphingoid base of formula (1)

(1), P-CC-0040/PT wherein R¹ is C11-C24 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, and wherein said acetylated derivative of the sphingoid base comprise a mixture of tri- and diacetylated derivatives of said sphingoid base a ratio from about 1:0.2 to about 0.2:1, correspondingly. 2. A spray dried fermentation material of embodiment 1, wherein the acetylated derivative comprises a mixture of tetra-, tri-, di- and/or monoacetylated derivatives of the sphingoid base. 3. A spray dried fermentation material as of embodiment 1 or 2, wherein the sphingoid base is D- ribo-phytosphingosine. 4. A spray dried fermentation material as of embodiment 1 or 2, wherein the sphingoid base is DL- erythro-dihydrosphingosine. 5. A spray dried fermentation material as of any embodiments from 1 to 4, wherein the material comprises at most 5 wt.% water, preferably at most 0.5-2.5 wt.% water. 6. A spray dried fermentation material as of any embodiments from 1 to 5, comprising a dry matter derived from the biomass and fermentation broth. 7. A spray dried fermentation material as of any embodiments from 1 to 6, wherein the material comprises particles with the diameter in the range from about 20 micrometers to about 60 micrometers. 8. A method of producing a spray dried fermentation material comprising at least 8 wt.% acetylated derivative of a sphingoid base of formula (1)

(1), P-CC-0040/PT wherein R¹ is C11-C24 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, comprising - fermenting the acetylated derivative of the sphingoid base of formula (1) in a yeast cell; - collecting the fermentation material at the end of fermentation, wherein the fermentation material comprising the biomass and fermentation broth; - spray drying the collected fermentation material, and thereby obtaining said spray dried fermentation material, wherein the fermentation material comprises at least 1 wt.% acetylated derivative of said sphingoid base, and wherein said acetylated derivative comprises a mixture of tri- and diacetylated derivatives of said sphingoid base in a ratio from about 1:0.2 to about 0.2:1, correspondingly. 9. A method as of embodiment 8, wherein the acetylated derivative of a sphingoid base of formula (1) comprises a mixture of tetra-, tri-, di- and/or monoacetylated derivatives said sphingoid base. 10. A method as of any embodiments 8 or 9, wherein the sphingoid base is D-ribo- phytosphingosine. 11. A method as of any embodiments 8 or 9, wherein the sphingoid base is DL-erythro- dihydrosphingosine. 12. A method of as of any embodiments 8 to 11, wherein the yeast cell is a Wickerhamomyces ciferrii cell. 13. A method as of embodiment 12, wherein the Wickerhamomyces ciferrii cell is a Hygromycin B resistant recombinant cell. 14. A method as of embodiments 12 or 13, wherein the cell is lacking the SYR2/SUR2 gene comprises an inactivated SYR2/SUR2 gene, or wherein the cell is lacking the sphinganine P-CC-0040/PT hydroxylase enzymatic activity or comprises a reduced sphinganine hydroxylase enzymatic activity. 15. A method as of any embodiments 8 to 14, wherein fermenting of the acetylated derivative of the sphingoid base comprises incubation of the microorganism in a fermentation medium comprising around 8-10 wt.% glycerol and around 0.1 wt.% magnesium. 16. A method as of any embodiments 8 to 15, wherein the duration of fermenting is from around 40 to around 60 hours. 17. A method as of any embodiments 8 to 16, wherein spray drying is performed at the maximum inlet air temperature of around 150-180 °C, the minimum inlet air temperature of 100-130 °C and the minimum outlet air temperature of 60-80°C. 18. A recombinant Wickerhamomyces ciferrii cell, wherein said cell is Hygromycin B resistant and wherein said cell is producing an acetylated derivative of a sphingoid base of formula (1), wherein said acetylated derivative comprising a mixture of tri- and di-acetylated derivatives in a ratio from about 1:0.2 to about 0.2:1, correspondingly. 19. A recombinant Wickerhamomyces ciferrii cell as of embodiment 18, wherein the spingoid base is D-ribo-phytosphingosine. 20. A recombinant Wickerhamomyces ciferrii cell as of embodiment 18, wherein said cell is lacking or comprises an inactivated SYR2/SUR2 gene, or the cell is lacking or comprises a reduced sphinganine hydroxylase enzymatic activity. 21. A recombinant Wickerhamomyces ciferrii cell as of any embodiments 18, 19 or 21, wherein the sphingoid base is DL-erythro-dihydrosphingosine.

P-CC-0040/PT EXAMPLES Working examples below are given only for the purpose to illustrate the invention and describe non- limiting embodiments of the invention. Example 1. Fermentation of acetylated analogs of phytosphingosine Acetylated forms of D-ribo-phytosphingosine (phytosphingosine), TAPS - Tetraacetylphytosphingosine, TriAPS - Triacetylphytosphingosine, DiAPS - Diacetylphytosphingosine and MAPS – Monoacetylphytosphingosine, were produced by growing an antibiotic resistant W. ciferrii strain obtained from the wild type strain F-60-10 (ATCC 14091) according the procedures described below. 1.1. Strain Wild type W. ciferrii, was routinely grown at 30° C in YPD medium (10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose) with agitation at 200 rpm in an orbital shaker. For solid media, 20 g/L agar was added to YPD medium. For yeast transformations the YPD medium was supplemented with 530 µg/mL Hygromycin B or 60 µg/mL Nourseothricin (clonNAT). Transformants were also selected on synthetic complete medium plates lacking adenine. To test for sphingoid base production, the strains were grown in glycerol basal medium (GBM) (7,5 g/L KH2PO4, 7,5 g/L NH4H2PO4, 1.32 g/L MgSO4· 7H2O, 1.32 g/L NaCl, 2.5 % glycerol) supplemented with 0.46 mL/L of trace element solution (60 mg/L FeSO4·7H2O, 0.95 mg/L CuSO4·5H2O, 20 mg/L ZnSO4·7H2O, 2 µg/L KI, 2.3 mg/L MnSO4·H2O, 2.45 mg/L H3BO3) and 2.26 mL/L of vitamin solution (2.5 mg/L nicotinic acid, 2.5 mg/L calcium-D-pantothenate, 2.5 mg/L thiamine hydrochloride, 1.7 mg/L 4-Aminobenzoic acid, 0.4 mg/L pyridoxine, 25 µg/L biotin). Single colonies were picked and grown for 48 h in 100 mL baffled-Erlenmeyer flasks at 30° with agitation at 200 rpm in an orbital shaker. After such time, optical density (OD600) was measured using a spectrophotometer and the strains were inoculated in fresh GBM to an OD600 of 0.1. The strains were grown for 48 hours in 250 mL baffled-Erlenmeyer flasks at 30° with agitation at 200 rpm in an orbital shaker. Chemically competent E. coli DH5α (New England Biolabs) was used for cloning experiments. After transformation, the cells were grown in LB agar (10 g/L tryptone, 10 g/L NaCl, 5 g/L yeast extract, 20 g/L agar) supplemented with 100 µg/mL ampicillin. To propagate positive plasmids, the desired colonies were grown in LB broth containing ampicillin. An integrative plasmid (pOM30) was constructed to enable the CRISPR-Cas9 technology in W. ciferrii. The plasmid contained: the CAS9 sequence carrying the SV40 nuclear targeting sequence under the control of the WcPGK1 promoter and WcCYC1 terminator, the hph marker encoding resistance to P-CC-0040/PT Hygromycin B under the control of the WcTDH3 promoter and WcENO1 terminator, an E. coli module containing the ampicillin resistance gene and the ColE1 replication origin, and a gRNA expression element composed of a mScarlet-1 dropout cassette flanked by BsmBI sites. This component also contained the gRNA scaffold sequence followed by the HDV ribozyme. Expression was controlled by the WcPDA1 promoter and WcTEF1 terminator. The CAS9 gene and hph marker were codon-optimized for W. ciferrii. To construct the plasmid, the elements were ordered as overlapping synthetic blocks and assembled using a commercial kit. Assembly products were transformed into E. coli and colonies were screened via colony PCR. A second plasmid (pOM30-B) used for transient expression of a gRNA target was also constructed. This plasmid contained a gRNA expression element like the one in pOM30 but also included the panARS replication origin and the codon-optimized nat marker conferring resistance to Nourseothricin under the control of the WcTDH3 promoter and WcENO1 terminator. 1.2 Long-term fermentation A seed culture of the antibiotic resistant W. ciferrii for the fed-batch culture was grown by adding 1% of the strain (Example 1.1.) to a 250 ml baffled shake flask containing 100 ml of complex medium. The flasks were incubated at 30°C and 250 rpm. For the actual TAPS production, a Jupiter 2 fermenter (Solaris) with a working volume of 1.5-1.7 L was used. Stirring was done by three 6-blade Rushton-type impellers. The pH and dissolved oxygen were measured by InPro electrodes. Airflow was regulated at a set flow rate. The vessel with electrodes was sterilized (autoclaved) at 120 °C for 20 min prior to inoculation with the seed culture. The pH wascontrolled by addition of a 12.5% ammonium hydroxide solution. A typical culture medium composition was as the following (conc. In g/L): 7.50 NH4H2PO4 7.50 KH2PO4 25.00 Glycerol 1.32 NaCl 0.46 Trace mineral solution (Fe (0.9%), Cu (0.1%), Zn (0.35%), I (0.04%), Mn (0.07%), B (0.04%), Mo (0.1%)) 1.32 MgSO₄.7H₂O 2.26 Vitamin solution (C (0.1%), B1 (0.2%), B3 (0.2%), B5 (0.2%), B6 (0.03%), B7(0.002%), B12 (0.13%)) A typical culture conditions were as the following: Dissolved O₂ 0-40% P-CC-0040/PT Temperature 28-34 ^oC pH 5.5-8.5 Stirring rate 400-1900 rpm Air flow 1.0 vvm Inoculation of the fermenter was done with 10 % (v/v) of the seed culture. When glycerol in the batch phase was depleted (as indicated by the sudden and marked increase in DO) a feed solution (glycerol 75% w/v / MgSO₄.7H₂O 2g/L) was gradually fed into the fermenter. The total amount of feed (500-850 g glycerol) was added over a period of approximately 90 hours. Total biomass and sphingoid base concentration were regularly monitored in samples taken from the fermenter. To analyze the acetylated forms of phytosphingosine, samples of the fermentation broth were treated with a methanol-acetonitrile solution to extract the compounds, and the contents of the extracts were analysed by HPLC. Typically, maximum biomass levels of 250-550 g/l was reached for a total of 1 l feed. The total fermented material (i.e. fermentation broth including biomass) typically contained at least around 2- 2.5 wt.% of acetylated derivatives of phytosphingosine after 110-140 hours of fermentation. A typical weight ratio of TriAPS: DiAPS was around 1:0.15. The total yield of the monoacetylated derivative of phytosphingosine (MAPS) per fermentation was approximately 1-1.5 wt.% (as evaluated by HPLC following an alkaline hydrolysis of the total fermented acetylated phytosphingosine material). 1.3. Short-term fermentation Typically, a seed culture of the antibiotic resistant W. ciferri for the fed-batch culture was grown by adding 1% of a strain to a 250 ml baffled shake flask containing 100 ml of complex medium. The flasks were incubated at 30°C and 250 rpm. For this seed stage, a Jupiter 2 fermenter (Solaris) with a working volume of 1.5 l was used. Stirring was done by three 6-blade Rushton-type impellers. The pH and dissolved oxygen were measured by InPro electrodes. Airflow was regulated at a set flow rate. The vessel with electrodes was sterilized (autoclaved) at 120 °C for 20 min prior to inoculation with the seed culture. The pH was controlled by addition of a 12.5% ammonium hydroxide solution. A typical culture medium composition was as the following (conc. in g/L) is: 5.0 NH4H2PO4 5.0 KH2PO4 40.00 Glycerol 0.88 NaCl P-CC-0040/PT 0.3 Trace mineral solution (Fe (0.9%), Cu (0.1%), Zn (0.35%), I (0.04%), Mn (0.07%), B (0.04%), Mo (0.1%)) 0.88 MgSO4.7H2O 1.50 Vitamin solution (C (0.1%), B1 (0.2%), B3 (0.2%), B5 (0.2%), B6 (0.03%), B7(0.002%), B12 (0.13%)) A typical culture conditions were as the following: Dissolved O₂ 0-40% Temperature 28-34 ^oC pH 5.5-8.5 Stirring rate 400-1900 rpm Air flow 1.0 vvm Inoculation of the fermenter was typically done with 1% (v/v) of the seed culture. When glycerol in the batch phase is depleted (as indicated by the sudden and marked increase in DO), a feed solution (glycerol 75% w/v / MgSO₄.7H₂O 2g/L) was gradually fed into the fermenter in steps until an OD of 150-250 was reached. For the actual TAPs production, a Jupiter 2 fermenter (Solaris) with a working volume of 1.5 L was used. Stirring was done by three 6-blade Rushton-type impellers. The pH and dissolved oxygen were measured by InPro electrodes. The airflow was regulated at a set flow rate. The vessel with electrodes was sterilized (autoclaved) at 120 °C for 20 min prior to inoculation with the seed culture. The pH was controlled by addition of a 12.5% ammonium hydroxide solution. A typical culture medium composition was as the following (conc. in g/L): 5.0 NH4H2PO4 5.0 KH2PO4 80.00 Glycerol 1.32 NaCl 0.46 Trace mineral solution (Fe (0.9%), Cu (0.1%), Zn (0.35%), I (0.04%), Mn (0.07%), B (0.04%), Mo (0.1%)) 1.32 MgSO4.7H2O 2.26 Vitamin solution (C (0.1%), B1 (0.2%), B3 (0.2%), B5 (0.2%), B6 (0.03%), B7(0.002%), B12 (0.13%)) The culture conditions were as the following: Dissolved O2 0-40% Temperature 28-34 ^oC pH 5.5-8.5 P-CC-0040/PT Stirring rate 400-1900 rpm Air flow 1.0 vvm Typically, the total amount of feed (300-400 g glycerol) was added over a period of approximately 30 hours. Total biomass and sphingoid base concentration were regularly monitored in samples taken from the fermenter and analyzed as described above. Typically, maximum biomass levels of 250-550 g/l were reached for a total of 0.5 l feed containing around 350 g glycerol. The total fermented material contained at least around 1-1.5 wt.% of acetylated derivatives of phytosphingosine after 48-56 hours of fermentation. A typical weight ratio of TriAPS:DiAPS in the fermented material was around 1:0.2. The total yield of the monoacetylated form of phytosphingosine (MAPS) per fermentation was approximately 1 wt.% (as evaluated by HPLC following an alkaline hydrolysis of the total fermented acetylated phytosphingosine material). 1.4. Conclusion A long-term (110-140 hours) and short-term (40-60 hours) fermentations of the same strain of W. ciferrii conducted under similar conditions with the except that concentration of all compounds of the culture media, but glycerol, was around 25-40% lower, and the concentration of glycerol was around 1.5-3.5 fold higher, resulted in similar yields of MAPS, showing that efficiency of the short term fermentation under the indicated conditions is significantly higher that the long term fermentation. Additionally, it was surprisingly found that the antibiotic resistant strain produced around 10-15% higher amounts of acetylated derivatives of phytosphingosine, than original wild type strain in both long-term and short term fermentations. Example 2: Fermentation of acetylated analogs of dihydrosphingosine Acetylated forms of ^DL-erythro-dihydrosphingosine (dihydrosphingosine ), TriADS - Triacetyldihydrosphingosine, DiADS - Diacetyldihydrosphingosine and MADS – Monoacetyldihydrosphingosine, were produced by an antibiotic resistant W. ciferrii strain (of Example 1.1.) according to the procedures described below. 2.1. Strain For the construction of the dihydrosphingosine producing strain containing inactivated SYR2 gene, a plasmid containing the optimized Cas9 gene driven by the PGK1 promoter from W. ciferrii was digested and transformed into the W. ciferrii strain obtained as described in Example 1.1. This plasmid contained a targeting sequence for the ADE2 gene, which, when mutated, produces red colonies P-CC-0040/PT indicating functional CRISPR-Cas9 technology. A red colony was selected and used for further engineering. To introduce the SYR2 gene mutation, a plasmid containing a targeting sequence for the gene, was constructed. The plasmid was transformed in combination with a 500 bp repair fragment. Transformants were selected on ClonNat and screened by colony PCR. A colony containing the desired mutation was obtained and confirmed via Sanger sequencing. The primers used for plasmid construction and strain engineering are shown in Table 1. Overhang sequences are shown in lowercase. SEQ. ID Primer ID Sequence Use 1 M13F GTAAAACGACGGCCAGT Screening/sequencing/amplifying ScADE construct 2 M13R CAGGAAACAGCTATGAC Screening/sequencing/amplifying ScADE construct 3 P218F ACAAACGTCTCAgaccCAATTAAT Construction SYR2 repair fragment TGTACTACTTAATTATGAGCCG plasmid.5’ region. 4 P218R GGCTACCGTCTCGtaagATATCAT Construction SYR2 repair fragment TTTACAAACAATTTTGTCATTATA plasmid.5’ region. CCC 5 P219F GGCTACCGTCTCGcttaATGATGG Construction SYR2 repair fragment ATTCTCAATGTTTATATAACAC plasmid.3’ region. 6 P219R GGCTACCGTCTCCgcctAAACAC Construction SYR2 repair fragment AAATCAAAACAAGACCATTAAG plasmid.3’ region. 7 P223F CAATTAATTGTACTACTTAATTAT Amplifying SYR2 repair fragment GAGCC 8 P223R AAACACAAATCAAAACAAGACC Amplifying SYR2 repair fragment 9 P140F AACATCCCAATGTGTAAAG Screening for mutations in the SYR2 locus 10 P140R CAAGTTTGATTAATGGCATAC Screening for mutations in the SYR2 locus 11 P179F atcaGATGGCCTGATGAGTCCGT ADE2 target sequence GAGGACGAAACGAGTAAGCTC GTCGCCATCATGTTAAACGTGTT P-CC-0040/PT 12 P179R aaacAACACGTTTAACATGATGG ADE2 target sequence CGACGAGCTTACTCGTTTCGTCC TCACGGACTCATCAGGCCATC 13 P221F atcaATAGCTCTGATGAGTCCGTG SYR2 target sequence AGGACGAAACGAGTAAGCTCGT CAGCTATAACAGGTGCAATCA 14 P221R aaacTGATTGCACCTGTTATAGCT SYR2 target sequence GACGAGCTTACTCGTTTCGTCCT CACGGACTCATCAGAGCTAT The original and mutated cell cultures were grown as described above and samples of the cultures were taken after 48 hours and analyzed for the presence of sphingoid bases. Approximately 0.1 mL were taken from each culture and combined with 0.8 mL of a 90:10 mixture of acetonitrile:methanol and 0.1 mL of 1M KOH. The samples were vortexed for 5 minutes and then centrifuged at 12000 rpm for 5 minutes. Supernatants were taken for the detection of monoacetylated phytosphingosine (MAPS) and monoacetylated dihydrosphingosine (MADS). The samples were analyzed using a Ascentis Express RP-Amide (15 cmx4.6 mm, 2.7 µm) column coupled with an UV detector. An acetonitrile/formic acid mixture as mobile phase. MAPS were detected only in the extracts from the wild type cells, while MADS were present only in the samples from the mutated cells. 2.2. Fermentation of acetylated forms of dihydrosphingosine The acetylated forms of dihydrosphingosine (TriADS - Triacetyldihydrosphingosine, DiADS - Diacetyldihydrosphingosine and MADS - Monoacetyldihydrosphingosine) were produced by the genetically modified W. ciferrii strain obtained as described in Example 2.1. according to the procedure below. A seed culture was grown by adding 1(v/v)%of a strain of Example 2.1. to a 250 ml baffled shake flask containing 100 ml of complex medium. The flasks were incubated at 30°C and 250rpm. After this stage a seed fermenter stage is necessary, to allow generation of a high cell density inoculum. This was done in a fed-batch fermentation using the following conditions: The culture medium composition was as the following (conc. in g/L): 5.00 NH4H2PO4 5.00 KH2PO4 40.00 Glycerol P-CC-0040/PT 0.88 NaCl 0.30 Trace mineral solution (Fe (0.9 %), Cu (0.1%), Zn (0.35%), I (0.04%), Mn (0.07%), B (0.04%), Mo (0.1%)) 0.88 MgSO4.7H2O 2.26 Vitamin solution (C (0.1 wt%), B1 (0.2%), B3 (0.2%), B5 (0.2%), B6 (0.03%), B7(0.002%), B12 (0.13%)) The culture conditions were: Dissolved O₂ 10-40% Temperature 28-34 ^oC pH 5.5-8.5 Stirring rate 400-1900 rpm Air flow 1.0 vvm The culture was grown until depletion of glycerol present on basal medium, point at which feeding started. This fed-batch phase took as long as necessary to obtain an OD₆₀₀ of 150-250. For the actual TriADS production, a Jupiter 2 fermenter (Solaris) with a working volume of 1.5 L was used. Stirring was done by three 6-blade Rushton-type impellers. pH and dissolved oxygen were measured by InPro electrodes. Airflow was regulated at a set flow rate. The vessel with electrodes was sterilized (autoclaved) at 120 °C for 20 min prior to inoculation with the seed culture. pH was controlled by addition of a 12.5%(g/L) ammonium hydroxide solution. The culture medium composition was as the following (conc. in g/L): 5.0 NH₄H₂PO₄ 5.0 KH2PO4 80.00 Glycerol 1.32 NaCl 0.46 Trace mineral solution (Fe (0.9%), Cu (0.1%), Zn (0.35%), I (0.04%), Mn (0.07%), B (0.04%), Mo (0.1%)) 1.32 MgSO₄.7H₂O 2.26 Vitamin solution (C (0.1%), B1 (0.2%), B3 (0.2%), B5 (0.2%), B6 (0.03%), B7(0.002%), B12 (0.13%)) The culture conditions were as the following: Dissolved O2 0-20% Temperature 28-34 ^oC pH 5.5-8.5 P-CC-0040/PT Stirring rate 400-1900 rpm Air flow 1.0 vvm Inoculation of the fermenter was done with 10 % (v/v) of the seed fermenter. When glycerol in the batch phase was depleted (as indicated by the sudden and marked increase in DO), a feed solution (glycerol 75% w/v / MgSO₄.7H₂O 2g/L) was gradually fed into the fermenter. The total amount of feed (300-450 g glycerol) was added over a period of approximately 30 hours. Total biomass and sphingoid base concentration were regularly monitored in samples taken from the fermenter which were analyzed as described above. Typically, maximum biomass levels of 250-550 g/l were reached for a total of 0.5 L feed containing around 350 g glycerol. Typically, the total fermented material contained at least around 1.5-2.5 wt.% of acetylated derivatives of dihydrosphingosine after around 60-90 h of fermentation. A typical weight ratio of TriADS:DiADS in the fermented material was around 0.4:1. The total yield of the monoacetylated derivative of dihydrosphingosine (MADS) per fermentation was approximately 1-1.5 wt.% (as evaluated by HPLC following an alkaline hydrolysis of the total fermented acetylated phytosphingosine material). Example 3. Down-stream processing of fermentation material 3.1. Spray drying of fermentation material The total fermentation material obtained following fermentations, as described above, was collected and spray dried in a Mobile Minor GEA spray dryer using the following conditions: Inlet temperature about 150° C to about 180° C, outlet temperature about 70° C to about 100° C, inlet flow rate about 30 g/min to 50 g/min, atomizer speed about 18000 RPM to 22000 RPM. The typical size of the particles of the solid matter obtained by the process was around 20 μm to 60 μm. The solid matter obtained after spray-drying contained from about 0.5 wt.% to about 2.5-5.0 wt.% of water, and from about 4 wt.% to about 25 wt.%, typically around 8-15 wt.% of the sphingoid bases (D-ribo-phytosphingosine and/or DL-erythro-dihydrosphingosine) in the acetylated forms. The spray-dried fermentation material demonstrated a good flowability, did not exhibit significant caking and retain this attribute after storage in closed packaging under ambient temperature fluctuations for at least one month. In general, the later characteristics of the spray dried material were better for the fermentation material derived from the short-term fermentation than from the long-term fermentation by at least 25%. Comparison of spray-dried material derived from a long-term fermentation with spray-granulated material (obtained as described in WO2022158993) showed that the spray-granulated material had better caking caracteristics than the spray-dried material. P-CC-0040/PT 3.2. Solvent extraction of solid matter obtained after spray drying The solid matter obtained in Example 3.1 was subjected to one-two extractions with acetone or isopropanol (1-3 vol. each) at a temperature between about 25^o C to about 45^o C, over 10-30 minutes. At the end of each extraction the solvent was collected via filtration or centrifugation of the extraction slurry. The combined acetone or isopropanol solutions were subjected to distillation to afford a solid or oily residue enriched in the sphingoid bases (D-ribo-phytosphingosine and/or DL-erythro- dihydrosphingosine) in the acetylated forms. The solid or oily contained up to 95% of acetylated sphingoid bases produced in fermentation. Conclusion The spray-drying of fermentation material prepared by the methods described above showed to be a very efficient way of its dewatering, and, surprisingly, not-destructive for the fermented sphingoid bases. Extraction of acetylated sphingoid bases from the spray-dried material resulted on a very good recovery of the compounds: up to 98% of total amount of the compounds produced in fermentation was recovered from the spray-dried fermentation material. The disclosure should not be seen in any way restricted to the embodiments described and a person with ordinary skill in the art will foresee many possibilities to modifications thereof. The above described embodiments are combinable. The following claims further set out particular embodiments of the disclosure.

Claims

P-CC-0040/PT CLAIMS 1. A spray dried fermentation material comprising at least 8 wt.% acetylated derivative of a sphingoid base of formula (1):

(1), wherein R¹ is C11-C24 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, and wherein said acetylated derivative of the sphingoid base comprise a mixture of tri- and di- acetylated derivatives of said sphingoid base a ratio from about 1:0.2 to about 0.2:1, correspondingly. 2. The spray dried fermentation material of claim 1, wherein the acetylated derivative comprises a mixture comprising tetra-, tri-, di- and/or monoacetylated derivatives of the sphingoid base. 3. The spray dried fermentation material of claims 1 or 2, wherein the sphingoid base is d-ribo- phytosphingosine. 4. The spray dried fermentation material of claims 1 or 2, wherein the sphingoid base is dl-erythro- dihydrosphingosine. 5. The spray dried fermentation material of any of the preceding claims, wherein the material comprises at most 5 wt.% water, preferably at most 0.5-2.5 wt.% water. 6. The spray dried fermentation material of any of the preceding claims, comprising dry matter derived from the biomass and fermentation broth. P-CC-0040/PT 7. The spray dried fermentation material of any of the preceding claims, wherein the material comprises particles with the diameter in the range from about 20 micrometers to about 60 micrometers. 8. A method of producing a spray dried fermentation material comprising at least 8 wt.% acetylated derivative of a sphingoid base of formula (1):

(1), wherein R¹ is C11-C24 alkyl, which may be saturated or contain one or more double and/or triple bonds, and/or which may contain one or more functional groups, the functional group being preferably selected from the group consisting of a hydroxyl group, R² is hydrogen or -OH, the bond may be a double or a single bond when R² is hydrogen, or is a single bond when R² is -OH, comprising - fermenting the acetylated derivative of the sphingoid base of formula (1) in a yeast cell; - collecting the fermentation material at the end of fermentation, wherein the fermentation material comprising the biomass and fermentation broth; - spray drying the collected fermentation material, and thereby obtaining said spray dried fermentation material, wherein the fermentation material comprises at least 1 wt.% acetylated derivative of said sphingoid base, and wherein said acetylated derivative comprises a mixture of tri- and diacetylated derivatives of said sphingoid base in a ratio from about 1:0.2 to about 0.2:1, correspondingly. 9. The method of claim 8, wherein the acetylated derivative of a sphingoid base of formula (1) comprises tetra-, tri-, di- and/or monoacetylated derivatives said sphingoid base. 10. The method of claim of any of claims 8-9, wherein the sphingoid base is D-ribo-phytosphingosine. P-CC-0040/PT 11. The method of claim of any of claims 8-9, wherein the sphingoid base is DL-erythro- dihydrosphingosine. 12. The method of any of claims 8-11, wherein the yeast cell is a Wickerhamomyces ciferrii cell. 13. The method of claim 12, wherein the Wickerhamomyces ciferrii cell is a Hygromycin B resistant recombinant cell. 14. The method of claim 12 or 13, wherein the cell is lacking the SYR2/SUR2 gene or comprises an inactivated SYR2/SUR2 gene, or wherein the cell is lacking the sphinganine hydroxylase enzymatic activity or comprises a reduced sphinganine hydroxylase enzymatic activity. 15. The method of any of claims 8-14, wherein fermenting of the acetylated derivative of the sphingoid base comprises incubation of the microorganism in a fermentation medium comprising around 8-10 wt.% glycerol and around 0.1 wt.% magnesium. 16. The method of claims 8-15, wherein the duration of fermenting is from around 40 to around 60 hours. 17. The method of any of claims 8-16, wherein spray drying is performed at the maximum inlet air temperature of around 150-180 °C, the minimum inlet air temperature of 100-130 °C and the minimum outlet air temperature of 60-80°C. 18. A recombinant Wickerhamomyces ciferrii cell, wherein said cell is Hygromycin B resistant and wherein said cell is producing an acetylated derivative of a sphingoid base of formula (1). 19. The recombinant cell of claim 18, wherein said acetylated derivative comprises a mixture of tri- and di-acetylated derivatives in a ratio from about 1:0.2 to about 0.2:1, correspondingly. 20. The recombinant cell of claim 18, wherein the spingoid base is d-ribo-phytosphingosine. 21. The recombinant cell of claim 19, wherein said cell is lacking the SYR2/SUR2 gene or comprises an inactivated SYR2/SUR2 gene, or the cells is lacking the sphinganine hydroxylase enzymatic activity or comprises a reduced sphinganine hydroxylase enzymatic activity. 22. The recombinant cell of claim 18, 19 or 21, wherein the sphingoid base is dl-erythro- dihydrosphingosine.