WO2024255872A1 - Compositions and methods for med26-mediated regulation of erythropoiesis - Google Patents
Compositions and methods for med26-mediated regulation of erythropoiesis Download PDFInfo
- Publication number
- WO2024255872A1 WO2024255872A1 PCT/CN2024/099339 CN2024099339W WO2024255872A1 WO 2024255872 A1 WO2024255872 A1 WO 2024255872A1 CN 2024099339 W CN2024099339 W CN 2024099339W WO 2024255872 A1 WO2024255872 A1 WO 2024255872A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- med26
- polypeptide
- active fragment
- cell
- erythroid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0641—Erythrocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/125—Stem cell factor [SCF], c-kit ligand [KL]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/14—Erythropoietin [EPO]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2303—Interleukin-3 (IL-3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/998—Proteins not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/11—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from blood or immune system cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- the present application is in the field of transcriptional gene regulation.
- erythropoiesis In steady-state erythropoiesis, approximately 2-3 million red blood cells are produced per second in the bone marrow (4) .
- CFU-Es progressively differentiate into mature red blood cells through a series of 3–5 cell divisions, termed terminal erythropoiesis (6) .
- terminal erythropoiesis erythroblasts undergo dramatic changes including nuclear condensation, wide-range transcription repression, extensive hemoglobin biogenesis, enucleation, and organelle clearance (7, 8) .
- the positive transcription elongation factor (P-TEFb) which contains the catalytic subunit cyclin-dependent kinase 9 (CDK9) , cooperates with the master erythroid transcription factor GATA1 to enhance transcription elongation (13) .
- Hexim1 a regulator that promotes Pol II pausing, is highly expressed during terminal erythropoiesis, and is associated with accelerated differentiation of hexamethylene bisacetamide (HMBA) -treated HUDEP-2 erythroid cells (14) .
- Phase separation which mediates membraneless compartment organization termed biomolecular condensates, has become an emerging model to explain diverse cellular events, including transcription regulation (15-17) .
- Phase separation participates in transcription initiation and elongation via phosphorylation of the Pol II CTD (18) .
- the presence of promoter condensates and gene-body condensates have been proposed at different transcription steps (3, 19) .
- proteins with phase separation capacity including BRD4, MED1, and Pol II CTD (20-22) , have been identified in transcription condensates, it remains unclear whether the dynamic composition of these condensates could contribute to driving the progression of developmental processes.
- the Mediator complex also known as the TRAP/SMCC, CRSP, PC2, or ARC complex, is a large multi-subunit complex composed of head, middle, tail, and CDK8 kinase modules, and is conserved from yeasts to metazoans (23) , (24) .
- the Mediator complex forms a functional bridge between gene promoters and enhancers, linking tissue-specific transcription factors (TFs) with general transcription factors (GTFs) and Pol II, thereby serving as an integrative hub for pre-initiation complex assembly, transcription elongation, and termination (23, 25) .
- TFs tissue-specific transcription factors
- GTFs general transcription factors
- Pol II general transcription factors
- Several Mediator subunits have been shown to be important for various developmental processes through their associations with tissue-specific TFs (26) .
- MED1 is a cofactor of GATA1; MED1 knockout mice died at E11.5 of severe anemia (27, 28) .
- MED26 is a unique subunit in that, based on previous biochemical studies, its presence is usually exclusive to the CDK8 kinase module, and therefore is often regarded as a transcription activator (30) .
- MED26 directly interacts with the super elongation complex (SEC) and the little elongation complex (LEC) containing P-TEFb via its N-terminal domain (NTD) (31-33) .
- SEC super elongation complex
- LEC little elongation complex
- NTD N-terminal domain
- MED26 also functions as a molecular switch from its initiation state to its elongation state via interaction with the GTF TFIID (32) .
- GTF TFIID GTF TFIID
- a method of promoting erythroid differentiation comprising administering to an erythroid precursor cell an agent that increases RNA polymerase II pausing mediated by a mediator complex subunit (MED26) polypeptide in the cell.
- MED26 mediator complex subunit
- the agent increases the interaction of the MED26 with a transcription pausing factor, such as a factor in a negative elongation factor (NELF) , DRB Sensitivity Inducing Factor (DSIF) or polymerase associated factor (PAF) complex, particularly a PAF1, in the cell.
- a transcription pausing factor such as a factor in a negative elongation factor (NELF) , DRB Sensitivity Inducing Factor (DSIF) or polymerase associated factor (PAF) complex, particularly a PAF1, in the cell.
- the agent increases occupancy of a super-enhancer site by the MED26, such as a super-enhancer selected from CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27.
- a super-enhancer selected from CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27.
- the agent comprises the MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment.
- the active fragment comprises an intrinsically disordered region (IDR) of the MED26 polypeptide, more particularly, the active fragment comprises a polypeptide that is at least 90%, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%identical to the amino acid sequence of SEQ ID NO: 17.
- IDR intrinsically disordered region
- the active fragment comprises a TFIIS domain and an intrinsically disordered region (IDR) of the MED26 polypeptide, more particularly, the active fragment comprises a polypeptide that is at least 90%, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%identical to the amino acid sequence of SEQ ID NO: 2.
- IDR intrinsically disordered region
- the agent comprises the MED26 polypeptide or the nucleic acid encoding the MED26 polypeptide, more particularly, the MED26 polypeptide comprises a polypeptide that is at least 90%, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%identical to the amino acid sequence of SEQ ID NO: 1.
- Also provided is a method of promoting erythroid differentiation comprising administering to an erythroid precursor a polypeptide comprising the amino acid sequence of SEQ ID NO: 17 or a polynucleotide encoding the polypeptide.
- polypeptide comprises the amino acid sequence of SEQ ID NO: 2.
- the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.
- the erythroid precursor is a hematopoietic stem and progenitor cell (HSPC) , such as a CD34+ HSPC.
- HSPC hematopoietic stem and progenitor cell
- the erythroid precursor is an erythroblast, such as an erythroblast derived from a CD34+ HSPC.
- the agent is administered to the erythroid precursor in vitro.
- the agent is administered to the erythroid precursor in vivo in a subject in need thereof.
- the subject is in need of treating a disease associated with defective erythroid differentiation.
- the disease associated with defective erythroid differentiation is a myelodysplastic syndrome, such as refractory anemia or refractory cytopenia, erythroid dysplasia, bone marrow failure or megaloblastic anemia.
- Also provided is a method of identifying an agent for promoting erythroid differentiation comprising:
- composition comprising a MED26 polypeptide or an active fragment thereof
- composition b. contacting the composition with a test agent
- test agent increases the capacity of the MED26 to mediate RNA polymerase II pausing.
- the assessing step comprises assessing whether the test agent promotes the capacity of the MED26 to form an aggregate, to interact with a transcription pausing factor, and/or to occupy a super-enhancer site.
- composition comprising an agent that increases RNA polymerase II pausing mediated by a MED26 polypeptide.
- RNA polymerase II pausing mediated by a MED26 polypeptide for use in a method of promoting erythroid differentiation in an erythroid precursor cell.
- Also provided is a method of delivering a reagent to a cell comprising: (a) preparing a condensate comprising a MED26 polypeptide or active fragment thereof and the reagent; and (b) contacting the cell with the condensate, whereby the MED26 polypeptide or active fragment thereof delivers the reagent to the cell.
- the reagent is a nucleic acid, such as one or more RNA or DNA molecules.
- the MED26 polypeptide or active fragment thereof comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, , sequence identity to SEQ ID NO: 16.
- the MED26 polypeptide or active fragment thereof comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, sequence identity to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.
- the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.
- the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NO: 12.
- the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NO: 2.
- the nucleic acid encodes one or more components for gene editing.
- the gene editing comprises a CRISPR gene editing, and the nucleic acid encodes one or more of a CRISPR RNA (crRNA) , a tracrRNA that hybridizes with the crRNA, and a Cas endonuclease (such as Cas9, Cas12, Cas13) , preferably, the nucleic acid encodes a single guide RNA comprising the crRNA and the tracrRNA and/or the Cas endonuclease, more preferably, the nucleic acid encodes the single guide RNA and a Cas9 endonuclease.
- crRNA CRISPR RNA
- tracrRNA that hybridizes with the crRNA
- Cas endonuclease such as Cas9, Cas12, Cas13
- the nucleic acid is a DNA molecule, such as a plasmid DNA.
- the nucleic acid is an RNA, such as an mRNA.
- the reagent is a DNA molecule, such as a circular DNA (e.g., a plasmid DNA) or a linear DNA.
- the reagent is an RNA, such as an mRNA, an siRNA, an antisense RNA, a linear RNA, a circular RNA or a tRNA.
- the step of preparing the condensate comprises mixing the reagent with the MED26 polypeptide or active fragment thereof in a buffer comprising water.
- the buffer further comprises polyethylene glycol (PEG) .
- PEG polyethylene glycol
- the buffer comprises 1-30% (w/v) PEG, such as 2-20% (w/v) PEG, e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%or 15% (w/v) PEG, preferably 10% (w/v) PEG.
- the step of preparing the condensate comprises mixing the reagent with 1-200 ⁇ M, preferably 5-150 ⁇ M, such as 5, 10, 25, 50, 75, 100, 125, or 150 ⁇ M, more preferably 10 ⁇ M, of the MED26 polypeptide or active fragment thereof.
- FIGs. 1A-F show transcription condensates switched to MED26 enriched form in erythroid differentiation.
- FIG. 1A shows Western blot analysis of relative abundance of several Mediator subunits over time (Days 0-20) in the human CD34+ erythroid culture with ⁇ -actin as a loading control.
- FIG. 1B shows Western blot analysis of relative abundance of BRD4 and Rpb1 over time (Days 0-20) in the human CD34+ erythroid culture with ⁇ -actin as a loading control.
- FIG. 1C shows on top a schematic diagram of the OptoDroplet assay and on bottom time-lapse images of various Mediator subunits analyzed by the OptoDroplet assay.
- FIG. 1D shows representative images of FRAP assay for EGFP-MED26 condensates in K562 cells.
- FIG. 1E shows droplet formation assays of gradient diluted MED26 and MED1 IDR proteins under the low-salt buffer without PEG condition.
- FIG. 1F shows droplet formation assays in which 1, 6-hexanediol (1, 6-Hex) was added to test disruption of the liquid-like condensates.
- FIG. 1G shows droplet formation assays conducted in 25 mM Tris-HCl (pH 7.4) with various NaCl concentrations.
- FIGs. 2A-2I show MED26 is essential to erythropoiesis under normal and PHZ-induced stress conditions.
- FIG. 2A shows a Western blot demonstrating MED26 knock-out efficiency in the mouse spleen cells with GAPDH as a loading control.
- FIG 2B shows images of the mice overview, femur and spleen of control and cko mice after MED26 knock-out induced by pIpC injection.
- FIG. 2C shows Prussian blue staining for iron in control and cko mice spleen.
- FIG. 2D shows graphs of mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) in control and MED26 knock-out mice after 3 days pIpC injection induced knock-out.
- FIG. 2E shows Giemsa staining of peripheral blood smears from control and cko mice. Arrow indicates reticulocytes.
- FIG. 2F shows FACS analysis to detect differentiation states of mice femur bone marrow cells by two erythroid markers (CD71, Ter119) .
- FIG. 2G shows levels of Hemoglobin (HGB) , red blood cells (RBC) , and hematocrit (HCT) in control and conditional MED26 knock-out (cKO) mice pretreated with 5 ug/g pIpC one day before PHZ (60 mg/kg) injection on day 0.
- FIG. 2I shows percentages of Lin-, LSK, LT-HSC, ST-HSC, MPP, CMP, GMP, MEP cells in the bone marrow of control and cko mice.
- the p-values were calculated using an unpaired two-tailed Student’s t-test (C, F, H) , significant differences by Student’s t-test are marked by asterisks: *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, ****P ⁇ 0.0001, n.s., not significant.
- FIGs. 3A-3D show MED26 is essential for the progression of normal erythropoiesis.
- FIG. 3A shows representative colony images for colony-forming assay of human CD34+ cells transduced with control shRNA or shRNA targeting MED26.
- FIG. 3B shows relative MED26 gene expression human CD34+ cells transduced with control shRNA or shRNA targeting MED26.
- FIGs. 3C and 3D show quantification of CFU-GM and CFU-GEMM colony size after knocking down MED26 in human CD34+ cells.
- CFU-GEMM colony-forming unit-granulocyte, erythrocyte, monocyte, megakaryocyte
- CFU-GM colony-forming unit-granulocyte, macrophage.
- FIGs. 4A-F show phase-separation capacity of MED26 is associated with erythroid development.
- FIG. 4A shows a Western blot demonstrating MED26 over-expression efficiency in the ex vivo human CD34+ erythroid differentiation system on Day 8 with GAPDH as a loading control.
- FIG. 4B shows FACS analysis to detect two erythroid markers (CD71, CD235a) upon MED26 overexpression.
- FIG. 4C shows pictures of CD34+ cell pellets upon MED26 overexpression on Day 10 and Day 12. The dotted circles indicate the cell pellets position.
- FIG. 4D shows a schematic diagram of MED26 truncations of TFIIS domain, intrinsically disordered region (IDR) , and Mediator complex interaction domain.
- IDR intrinsically disordered region
- FIG. 4E shows representative time-lapse images of the indicated MED26 truncations in the OptoDroplet assay.
- FIG. 4F shows fluorescent imaging of an in vitro phase separation assay of the indicated MED26 truncations fused with EGFP.
- FIG. 4G shows FACS analysis to detect erythroid markers (CD71, CD235a) upon full-length or truncated MED26 overexpression in the ex vivo human CD34+ erythroid culture.
- FIGs. 5A-F show RNA polymerase II exhibits transcription pausing at MED26-enriched loci.
- FIG. 5A shows heatmaps from CUT&Tag assays showing the number and distribution of MED1, MED26, GATA1 and GATA2 common peaks, MED1 unique peaks, and MED26 unique peaks on Day 4 in the primary human CD34+ derived erythroid culture.
- FIG. 5B shows the ratio of MED26 to MED1 signals on all the transcription start sites (TSS) with MED1 and/or MED26 occupancy in CUT&Tag assays of primary human erythroblasts on Day 4. Each dot represents one gene.
- FIG. 5C shows a schematic defining the MED26-enriched or MED26-poor Mediator loci.
- FIG. 5D shows heatmaps showing RNA Pol II and PRO-seq signal of MED26-enriched or -poor genes from -3kb of TSS to +3kb of transcription end site (TES) .
- FIG. 5E shows IGV visualization showing examples of MED26-enriched (top) and MED26-poor (bottom) loci. The grey shaded areas indicate MED26 occupancy around the TSS. NC indicates signals of negative control samples.
- RPB1 is the largest component of RNA Pol II.
- FIG. 5F shows boxplots comparing the Pausing Index of MED26-enriched or -poor loci. The pausing indices were calculated from Rpb1 CUT&Tag or PRO-seq. The p-values were calculated using the two-sided Wilcoxon rank-sum test.
- FIG. 6A-I show MED26 enrichment promotes transcription pausing necessary for erythropoiesis.
- FIG. 6A shows a heatmap showing the relative interaction strength of indicated proteins baited by MED1 or MED26 in HEK293 cells. Relative interaction strength is calculated by NSAF from mass spectrometry data.
- FIG. 6B shows co-immunoprecipitation of HEK293 cells transfected with 3XFlag-MED1, 3XFlag-MED26, or 3XFlag-EV (control plasmid) .
- FIG. 6C shows recombinant proteins of mCherry and mCherry-PAF1-400-531 (a. a. 400-531, the putative IDR of PAF1) were purified from the prokaryotic expression system and detected by Coomassie blue staining.
- FIG. 6D shows in vitro phase separation assay of EGFP-fused MED26 1-480 and mCherry-PAF1-400-531, with a buffer containing 5%PEG-8000.
- FIG. 6E shows representative images of MED26 KO K562 cells transfected with MED26-truncations-EGFP and PAF1-mcherry. The white dotted circle indicates the nuclear area.
- FIG. 6F shows boxplots comparing the MED26 to MED1 signal ratio on Day 4 and Day 16 of the human CD34+ derived erythroid culture. (The p-values are calculated by paired Wilcox test) .
- FIG. 6G shows boxplots comparing the Pausing Index on Day 4 and Day 16 of the human CD34+ derived erythroid culture. (The p-values are calculated by paired Wilcox test) .
- FIG. 6H shows IGV visualization of the CUT&Tag signals of PRO-seq, MED1, and MED26 at RPS9 (non-erythroid gene) and HBB (erythroid gene) loci.
- FIG. 6I shows FACS analysis of erythroid markers CD71 and CD235a in primary human erythroblasts treated with DRB (5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole) .
- FIG. 7 shows electron microscope images of RAW264.7 cell uptake of MED26-mRNA coacervates.
- FIG. 8 shows FACS analysis of Jurkat cells transfected with EGFP mRNA (Cy5-labeled) loaded MED26 coacervates formulations featuring varying PEG concentrations.
- FIG. 9A shows fluorescence micrographs of 293T and Jurkat cells transfected with MED26-EGFP mRNA coacervates. Scale bar, 50 ⁇ m.
- FIG. 9B shows quantification of mRNA expression in 293T and Jurkat cells 24 hours post-transfection with MED26 coacervates or Lipofectamine MessegerMAX.
- FIG. 10A shows schematic illustration of MED26 truncations.
- FIG. 10B shows quantification of mRNA expression in Jurkat cells 24 hours after transfection with coacervates formed by MED26 truncated proteins.
- FIG. 10C shows quantification of mRNA expression in Jurkat cells 24 hours after transfection with coacervates formulations featuring varying MED26 (135-480) concentrations.
- FIG. 10D shows quantification of mRNA expression in Jurkat cells 24 hours after transfection with coacervates formulations featuring varying higher MED26 (135-480) concentrations.
- FIG. 11 shows FACS analysis of Jurkat cells at 24 hours after treating with two mRNAs (EGFP mRNA and tdTomato mRNA) loaded coacervates.
- FIG. 12A shows Representative confocal laser scanning microscopy images of early endosome, coacervates (Cy5-labled mRNA) , and nucleus (Hoechst 33342) in 293T cells 1 hour post-transfection with MED26 coacervates. Scale bar, 5 ⁇ m.
- FIG. 12B shows representative confocal laser scanning microscopy images of LysoTracker, coacervates (Cy5-labled mRNA) , and nucleus (Hoechst 33342) in Jurkat cells 3 hours post-incubation with MED26 coacervates. Scale bar, 5 ⁇ m.
- FIG. 12C shows Temporal expression profile in 293T cells transfected with MED26-mRNA coacervates.
- FIG. 12D shows MED26 protein level over time in Jurkat cells transfected with MED26-mRNA coacervates.
- FIG. 13A shows the relative quantity of mRNA levels in 293T-GFP cells 72 hours after treating with single-targeted siRNA-loaded MED26 coacervates.
- FIG. 13B shows relative quantity of mRNA levels in 293T-GFP cells 72 hours after treating with multiple-targeted siRNAs-loaded MED26 coacervates.
- FIG. 14A shows quantification of plasmid (size: 8 kb and 15 kb) expression in Jurkat cells 48 hours post-transfection with MED26 coacervates or Lipofectamine 3000.
- FIG. 14B shows quantification of plasmid (size: 8 kb and 15 kb) expression in 293T cells 48 hours post-transfection with MED26 coacervates or Lipofectamine 3000.
- FIG. 14C shows quantification of plasmid expression in Jurkat cells 48 hours after transfection with coacervates packaging CRISPR/Cas9 pDNA with different MED26 (135-480) concentrations.
- FIG. 14D shows FACS analysis of Jurkat cells at 48 hours after treating with two plasmids (GFP plasmid and tdTomato plasmid) -packed coacervates.
- FIG. 14E shows a schematic illustration of the structure of the all-in-one pDNA-CRISPR/Cas9.
- FIG. 14F shows Transfection efficiency at the DNMT1, HBB and HPRT1 locus in Jurkat cells treated with single targeted pDNA-loaded MED26 coacervates.
- FIG. 14G shows indel frequencies at the DNMT1, HBB and HPRT1 locus in Jurkat cells treated with single targeted pDNA-loaded MED26 coacervates.
- FIG. 14H shows transfection efficiency at the DNMT1, HBB, HPRT1 locus in 293T cells treated with single or triple targeted pDNA-loaded MED26 coacervates.
- FIG. 14I shows indel frequencies at the DNMT1, HBB, HPRT1 locus in 293T cells treated with single or triple targeted pDNA-loaded MED26 coacervates.
- any numerical values such as a concentration or a concentration range described herein, are to be understood as being modified in all instances by the term “about. ”
- a numerical value typically includes ⁇ 10%of the recited value.
- a concentration of 1 mg/mL includes 0.9 mg/mL to 1.1 mg/mL.
- a concentration range of 1%to 10% (w/v) includes 0.9% (w/v) to 11% (w/v) .
- the use of a numerical range expressly includes all possible subranges, all individual numerical values within that range, including integers within such ranges and fractions of the values unless the context clearly indicates otherwise.
- the terms “comprises, ” “comprising, ” “includes, ” “including, ” “has, ” “having, ” “contains” or “containing, ” or any other variation thereof, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers and are intended to be non-exclusive or open-ended.
- a composition, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but can include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus.
- a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present) , A is false (or not present) and B is true (or present) , and both A and B are true (or present) .
- a first option refers to the applicability of the first element without the second.
- a second option refers to the applicability of the second element without the first.
- a third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or” as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or. ”
- subject means any animal, preferably a mammal, most preferably a human.
- mammal encompasses any mammal. Examples of mammals include, but are not limited to, cows, horses, sheep, pigs, cats, dogs, mice, rats, rabbits, guinea pigs, monkeys, humans, etc., more preferably a human.
- nucleic acids or polypeptide sequences e.g., MED26 protein and fragments thereof or polynucleotides that encode them
- sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence comparison algorithm then calculates the percent sequence identity for the test sequence (s) relative to the reference sequence, based on the designated program parameters.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith &Waterman, Adv. Appl. Math. 1981; 2: 482, by the homology alignment algorithm of Needleman &Wunsch, J. Mol. Biol. 1970; 48: 443, by the search for similarity method of Pearson &Lipman, Proc. Nat’l. Acad. Sci. USA 1988; 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI) , or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley &Sons, Inc., 1995 Supplement (Ausubel) ) .
- Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0) .
- M forward score for a pair of matching residues; always > 0
- N penalty score for mismatching residues; always ⁇ 0
- W, T, and X determine the sensitivity and speed of the alignment.
- the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff &Henikoff, Proc. Natl. Acad. Sci. USA 1989; 89: 10915) .
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin &Altschul, Proc. Nat’l. Acad. Sci. USA 1993; 90: 5873-5787) .
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N) ) , which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
- a further indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid, as described below.
- a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
- Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions.
- isolated means a biological component (such as a nucleic acid, peptide or protein) has been substantially separated, produced apart from, or purified away from other biological components of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins.
- Nucleic acids, peptides and proteins that have been “isolated” thus include nucleic acids and proteins purified by standard purification methods.
- isolated nucleic acids, peptides and proteins can be part of a composition and still be isolated if the composition is not part of the native environment of the nucleic acid, peptide, or protein.
- the term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
- nucleic acid molecule synonymously referred to as “nucleic acid molecule, ” “nucleotides” or “nucleic acids, ” refers to any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA.
- Polynucleotides include, without limitation single-and double-stranded DNA, DNA that is a mixture of single-and double-stranded regions, single-and double-stranded RNA, and RNA that is mixture of single-and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single-and double-stranded regions.
- polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
- the term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
- Modified bases include, for example, tritylated bases and unusual bases such as inosine.
- polynucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
- Polynucleotide also embraces relatively short nucleic acid chains, often referred to as oligonucleotides.
- vector is a replicon in which another nucleic acid segment can be operably inserted so as to bring about the replication or expression of the segment.
- the term “host cell” refers to a cell comprising a nucleic acid molecule of the invention.
- the “host cell” can be any type of cell, e.g., a primary cell, a cell in culture, or a cell from a cell line.
- a “host cell” is a cell transfected with a nucleic acid molecule of the invention.
- a “host cell” is a progeny or potential progeny of such a transfected cell.
- a progeny of a cell may or may not be identical to the parent cell, e.g., due to mutations or environmental influences that can occur in succeeding generations or integration of the nucleic acid molecule into the host cell genome.
- expression refers to the biosynthesis of a gene product.
- the term encompasses the transcription of a gene into RNA.
- the term also encompasses translation of RNA into one or more polypeptides, and further encompasses all naturally occurring post-transcriptional and post-translational modifications.
- peptide, ” “polypeptide, ” or “protein” can refer to a molecule comprised of amino acids and can be recognized as a protein by those of skill in the art.
- the conventional one-letter or three-letter code for amino acid residues is used herein.
- the terms “peptide, ” “polypeptide, ” and “protein” can be used interchangeably herein to refer to polymers of amino acids of any length.
- the polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids.
- the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc. ) , as well as other modifications known in the art.
- the peptide sequences described herein are written according to the usual convention whereby the N-terminal region of the peptide is on the left and the C-terminal region is on the right. Although isomeric forms of the amino acids are known, it is the L-form of the amino acid that is represented unless otherwise expressly indicated.
- Erythropoiesis is the process of making red blood cells. At each stage of maturation, erythroblasts are both phenotypically distinct and have a unique transcriptomic profile and chromatin landscape. The morphologic changes include a progressively acidophilic appearance due to accumulation of hemoglobin, a steady decrease in cell size, and dramatic nuclear condensation, which culminates in enucleation. This process requires the coordinated effort of epigenetic regulators and transcription factors, as well as precise regulation of RNA polymerase II activity. The average human makes two to three million red cells per second to maintain steady state, and avoid anemia.
- Defects in terminal erythroid maturation such as nuclear condensation defects, or asynchronous maturation of the nucleus and cytoplasm, are commonly found in myelodysplastic syndromes, and inherited anemias. Understanding the molecular mechanisms that govern terminal erythroid maturation is essential to understanding how mutations or other genetic perturbations result in dyserythropoiesis, and to designing rational therapies (Wells and Steiner, Front Genet. 2022; 13: 805265) .
- the application provides methods of promoting erythroid differentiation.
- a method of promoting erythroid differentiation comprises administering to an erythroid precursor cell an agent that increases RNA polymerase II pausing mediated by a mediator complex subunit 26 (MED26) polypeptide in the cell.
- MED26 mediator complex subunit 26
- stem cell refers to undifferentiated cells of a multicellular organism having the ability to self-renew that can generate daughter cells that can undergo terminal differentiation into more than one distinct cell types with specific functions.
- a stem cell has the potential to differentiate into multiple types of cells and is capable of unlimited self-replication via asymmetric cell division, a process known as self-renewal.
- the stem cell is an adult stem cell, also called a somatic stem cell, which is multipotent and can generate cell types within a specific lineage, such as blood cells or endothelial cells.
- the stem cell is a hematopoietic stem cell.
- hematopoietic stem cells refers to immature cells having the capacity to self-renew and to differentiate into one or more mature blood cells.
- mature blood cells include, but are not limited to, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils) , erythrocytes (e.g., reticulocytes, erythrocytes) , thrombocytes (e.g., megakaryoblasts, platelet producing megakaryocytes, platelets) , monocytes, dendritic cells, microglia, osteoclasts, and lymphocytes.
- granulocytes e.g., promyelocytes, neutrophils, eosinophils, basophils
- erythrocytes e.g., reticulocytes, erythrocytes
- thrombocytes e.g., megakaryoblasts, platelet producing megakaryocytes, platelets
- monocytes e.g., dendritic cells, microglia, osteoclasts, and lymphocytes
- progenitor cell refers to cells that are descendants of stem cells, which can further differentiate to create specialized cell types. The term is not limitative and does not limit these cells to a particular lineage. Unlike stem cells, progenitor cells have a lesser ability to self-renew. In addition, the cell potency of progenitor cells is usually more restricted than stem cells. A progenitor cell is normally only capable of differentiating into cells that belong to the same tissue or organ. Some progenitor cells have one final target cell that they differentiate to (unipotent) , while others have the potential to terminate in more than one cell type (oligopotent or multipotent) .
- an erythroid precursor cell is any cell involved in the erythroid formation process.
- the erythroid precursor is a hematopoietic stem and progenitor cell (HSPC) , such as a CD34+ HSPC.
- the erythroid precursor is an erythroblast, such as an erythroblast derived from a CD34+ HSPC.
- agents capable of increasing RNA polymerase II pausing mediated by MED26 polypeptide.
- agents include small molecules, peptides, polypeptides, nucleic acids, oligonucleotides, antibodies, etc.
- the increased interaction or occupancy can be by increased affinity and/or increased amount or concentration.
- the term “MED26” or “MED26 polypeptide” refers to mediator of RNA polymerase II transcription subunit 26, or mediator complex subunit 26 protein, a component or subunit of the CRSP (cofactor required for SP1 activation) complex.
- the MED26 is a mammalian MED26, such as a human MED26.
- the MED26 polypeptide is a human MED26 polypeptide.
- the human MED26 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or an active fragment thereof.
- the agent comprises the MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment.
- active fragment refers to a fragment of MED26 or derivative thereof that is capable of interacting with a transcription pausing factor to mediate RNA polymerase II pausing or that is capable of forming a condensate with a reagent and delivering the reagent to a cell.
- the active fragment comprises an intrinsically disordered region (IDR) of the MED26 polypeptide, more particularly, the active fragment comprises a polypeptide that is at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%identical to the amino acid sequence of SEQ ID NO: 17.
- IDR intrinsically disordered region
- the active fragment comprises a TFIIS domain and an intrinsically disordered region (IDR) of the MED26 polypeptide, more particularly, the active fragment comprises a polypeptide that is at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%identical to the amino acid sequence of SEQ ID NO: 2.
- IDR intrinsically disordered region
- the agent comprises the MED26 polypeptide or the nucleic acid encoding the MED26 polypeptide, more particularly, the MED26 polypeptide comprises a polypeptide that is at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%identical to the amino acid sequence of SEQ ID NO: 1.
- a MED26 polypeptide or an active fragment thereof can be produced by any suitable methods in view of the present disclosure.
- a MED26 polypeptide or an active fragment thereof is produced by recombinant production, e.g., encoded by a nucleic acid comprising the polynucleotide sequence of GenBank Accession No. NM_004831.5, or a fragment thereof.
- the nucleic acid can be optimized for protein expression.
- enhancer refers to a short region of DNA to which proteins (e.g., transcription factors) bind to enhance transcription of a gene.
- transcriptional coactivator refers to a protein or complex of proteins that interacts with transcription factors to stimulate transcription of a gene.
- a “super-enhancer” or “super-enhancer site” is a region of DNA comprising two or more enhancers that is collectively bound by an array of transcription factor proteins to drive transcription of genes involved in cell identity. Examples of super-enhancers include, but are not limited to, those described, e.g., in U.S. Patent Publication US2014/0287932 , the content of which is incorporated herein by reference in its entirety .
- the agent increases the interaction of the MED26 with a transcription pausing factor, such as a factor in a negative elongation factor (NELF) , DRB Sensitivity Inducing Factor (DSIF) or polymerase associated factor (PAF) complex, particularly a PAF1, in the cell.
- a transcription pausing factor such as a factor in a negative elongation factor (NELF) , DRB Sensitivity Inducing Factor (DSIF) or polymerase associated factor (PAF) complex, particularly a PAF1, in the cell.
- the agent increases occupancy of a super-enhancer site by the MED26, such as a super-enhancer for a gene selected from cyclin-dependent kinase 6 (CDK6) , Apoptosis regulator Bcl-2 (BCL2) , High mobility group protein HMG-I/HMG-Y (HMGA1) , Transcriptional activator Myb (MYB) , 40S ribosomal protein S14 (RPS14) , 60S ribosomal protein L36a-like R (PL36AL) , and 60S ribosomal protein L27 (RPL27) .
- CDK6 cyclin-dependent kinase 6
- BCL2 Apoptosis regulator Bcl-2
- HMGA1 High mobility group protein HMG-I/HMG-Y
- MYB Transcriptional activator Myb
- RPS14 40S ribosomal protein S14
- PL36AL 60S ribosomal protein L36a-like R
- Also provided is a method of promoting erythroid differentiation comprising administering to an erythroid precursor a polypeptide comprising the amino acid sequence of SEQ ID NO: 17 or a polynucleotide encoding the polypeptide.
- polypeptide comprises the amino acid sequence of SEQ ID NO: 2. In certain, embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.
- the agent is administered to the erythroid precursor in vitro. In certain embodiments, the agent is administered to the erythroid precursor in vivo in a subject in need thereof.
- the subject is in need of treating a disease associated with defective erythroid differentiation.
- the disease associated with defective erythroid differentiation is a myelodysplastic syndrome, such as refractory anemia or refractory cytopenia, erythroid dysplasia, bone marrow failure or megaloblastic anemia.
- MED26 polypeptide or active fragment thereof delivers the reagent to the cell.
- the reagent is a small molecule such as protein, peptide, RNAs, DNAs or CRISPR components for gene editing.
- the condensate provides a protective environment that enhances the reagents stability, solubility, and/or controlled release.
- the reagent is a nucleic acid, such as one or more RNA or DNA molecules.
- the nucleic acid encodes one or more components for gene editing.
- the gene editing comprises a CRISPR gene editing, and the nucleic acid encodes one or more of a CRISPR RNA (crRNA) , a tracrRNA that hybridizes with the crRNA, and a Cas endonuclease (such as Cas9, Cas12, Cas13) , preferably, the nucleic acid encodes a single guide RNA comprising the crRNA and the tracrRNA and/or the Cas endonuclease, more preferably, the nucleic acid encodes the single guide RNA and a Cas9 endonuclease.
- crRNA CRISPR RNA
- tracrRNA that hybridizes with the crRNA
- Cas endonuclease such as Cas9, Cas12, Cas13
- the nucleic acid is a DNA molecule, such as a plasmid DNA.
- the reagent is a DNA molecule, such as a circular DNA (e.g., a plasmid DNA) or a linear DNA (e.g., an antisense DNA) .
- the nucleic acid is an RNA, such as an mRNA.
- the reagent is an RNA, such as an mRNA, an siRNA, an antisense RNA, a linear RNA, a circular RNA or a tRNA.
- the RNA can be modified with one or more chemical modifications.
- the MED26 polypeptide or active fragment thereof comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, sequence identity to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.
- the MED26 polypeptide or active fragment thereof comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, sequence identity to SEQ ID NO: 16.
- the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.
- the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NO: 12.
- the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NO: 2.
- the step of preparing the condensate comprises mixing the reagent with the MED26 polypeptide or active fragment thereof in a buffer comprising water.
- the buffer further comprises polyethylene glycol (PEG) .
- the buffer comprises 1-30% (w/v) PEG, such as 2-20% (w/v) PEG, e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%or 15% (w/v) PEG, preferably 10% (w/v) PEG.
- the step of preparing the condensate comprises mixing the reagent with 1-200 ⁇ M, preferably 5-150 ⁇ M, such as 5, 10, 25, 50, 75, 100, 125, or 150 ⁇ M, more preferably 10 ⁇ M, of the MED26 polypeptide or active fragment thereof.
- compositions comprising an agent that increases RNA polymerase II pausing mediated by a MED26 polypeptide.
- agent or composition comprising an agent that increases RNA polymerase II pausing mediated by a MED26 polypeptide for use in a method of promoting erythroid differentiation in an erythroid precursor cell.
- a “carrier” includes pharmaceutically acceptable carriers, excipients, or stabilizers that are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed.
- the physiologically acceptable carrier is an aqueous pH buffered solution.
- physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN TM , polyethylene glycol (PEG) , and PLURONICS TM .
- buffers such as phosphate, citrate, and other organic acids
- antioxidants including ascorbic acid
- proteins
- an effective amount or “therapeutically effective amount” of a substance is at least the minimum concentration required to effect a measurable improvement or prevention of a particular disorder.
- An effective amount herein may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of the substance to elicit a desired response in the individual. An effective amount is also one in which any toxic or detrimental effects of the treatment are outweighed by the therapeutically beneficial effects.
- an effective amount comprises an amount sufficient to cause a tumor to shrink and/or to decrease the growth rate of the tumor (such as to suppress tumor growth) or to prevent or delay other unwanted cell proliferation in cancer.
- an effective amount is an amount sufficient to delay development of cancer.
- an effective amount is an amount sufficient to prevent or delay recurrence. In some embodiments, an effective amount is an amount sufficient to reduce recurrence rate in the individual.
- An effective amount can be administered in one or more administrations.
- An effective amount can be administered in one or more administrations.
- an effective amount of drug, compound, or pharmaceutical composition is an amount sufficient to accomplish prophylactic or therapeutic treatment either directly or indirectly. As is understood in the clinical context, an effective amount of a drug, compound, or pharmaceutical composition may or may not be achieved in conjunction with another drug, compound, or pharmaceutical composition. Thus, an “effective amount” may be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be given in an effective amount if, in conjunction with one or more other agents, a desirable result may be or is achieved.
- CD34+ cells were purified from human cord blood (Cord Blood Bank of Beijing) using the MACS MicroBead kit (Miltenyi Biotec, Bergisch Gladbach, Germany) .
- the two-phase erythroid differentiation protocol was modified from the previous study (38) .
- the base medium contained IMDM (Gibco, Waltham, MA, USA) , 5%human AB serum (Wokavi Biotech, Beijing, China) , 10%FBS (Gibco) , 10 ng/mL heparin (Sigma, St.
- Phase-I medium was supplemented with 50 ng/mL Human Recombinant SCF (Stem Cell Technologies, Vancouver, BC, Canada) and 10 ng/mL Human Recombinant IL-3 (Stem Cell Technologies) .
- Phase-II medium was supplemented with 50 ng/mL Human Recombinant SCF only.
- Cells were cultured in Phase-I medium for 8 days and then transferred to Phase-II medium for 6-8 days. All mouse and human cells were cultured in a 90% (v/v) humidified atmosphere with 5% (v/v) CO2 at 37 °C.
- MED26 The protein level of most Mediator subunits diminished substantially in the terminal stages of erythroid differentiation, whereas that of MED26 remained detectable throughout unexpectedly (Fig. 1A) . Consistently, immunofluorescence imaging of primary erythroblasts isolated from E14.5 mouse fetal livers revealed that the MED1 level declines while MED26 remains detectable from early to late erythropoiesis (Data not shown) . Given the relative abundance of MED26 in terminal erythropoiesis and the critical function of the Mediator complex in transcription regulation, MED26 may serve a unique function in late erythropoiesis.
- Example 2 exhibits biomolecular condensate formation
- MED26 has condensate forming capability, along with other Mediator subunits, by conducting the OptoDroplet assay.
- the OptoDroplet assay was conducted as previously described (35) . Plasmids containing the indicated Mediator subunits were transfected with Lipo2000 reagent into 293T cells. Transfected 293T cells were cultured at 37 °Cfor 48 h. For blue light activation and imaging, the cells were imaged using two laser wavelengths, 488 nm and 568 nm, every 2 seconds. The proteins with phase separation capacity will aggregate when triggered by blue light (Fig. 1C) . This assay revealed that MED1, MED4, MED26, and MED28 had droplet-forming capability (Fig. 1C) and structural evidence showing that large parts of these proteins are unstructured.
- MED26 exhibits droplet properties in vivo was examined using a fluorescence recovery after photobleaching (FRAP) assay. Briefly, the FRAP experiments were performed on a spinning disk microscope with a 63 ⁇ oil objective. MED26 droplets were bleached for 30 cycles using a laser intensity of 80%at 480 nm (for GFP) . The fluorescence recovery was recorded accordingly, and the fluorescence intensity of the photobleached area was normalized to the intensity of the unbleached area. The FRAP assay showed that enhanced green fluorescence protein fused with MED26 (EGFP-MED26) can form condensates in K562 erythroleukemia cells, and that the signal recovers promptly after photo-bleaching (Fig. 1D) .
- EGFP-MED26 enhanced green fluorescence protein fused with MED26
- Fig. 1D the signal recovers promptly after photo-bleaching
- the putative EGFP-MED26-IDR was expressed and purified.
- the DNA sequence of IDRs for the gene of interest was cloned into the pET28a prokaryotic expression vector, the backbone of which contains sequences encoding a 5’ 6xHis-tag followed by either mCherry or EGFP and an artificially synthesized amino acid linker GAPGSAGSAAGGSG (SEQ ID NO: 18) .
- the DNA sequence was inserted in frame into the backbone and ended with a STOP codon.
- the plasmids were first transformed into Rosetta competent cells (Tsingke, Beijing, China) ; a fresh bacterial colony was inoculated into 15 mL LB media containing kanamycin and chloramphenicol and grown at 37 °C overnight. The bacteria were subsequently transferred to a 500 mL culture and incubated until the optical density (O. D. ) reached approximately 0.3. The cells were pre-chilled to 16 °C before 1 mM IPTG induction and then grown overnight in a 16 °C centrifuge at 130 rpm. The bacterial pellets were collected and stored at -80 °C before further processing.
- the bacterial pellets were resuspended in Buffer A (50 mM Tris pH 7.5, 500 mM NaCl) containing 10 mM imidazole, lysozyme, and a protease inhibitor cocktail.
- Buffer A 50 mM Tris pH 7.5, 500 mM NaCl
- the cell resuspension was fully lysed on ice for approximately 30 min and sonicated (ten cycles of 15 seconds on, 60 seconds off) until lysates turned slightly clear.
- the lysates were centrifuged at 12,000g for 30 min to remove insoluble impurities.
- the supernatant was incubated with 1 mL pre-equilibrated Ni-NTA agarose at 4 °C for at least 1.5 h.
- the slurry was transferred into a column and washed with 15 volumes of Buffer A containing 10 mM imidazole.
- the purified protein was sequentially eluted with two volumes of Buffer A containing 50 mM imidazole, two volumes of Buffer A containing 100 mM imidazole, and three volumes of Buffer A containing 250 mM imidazole.
- the composition and purity of each fraction were analyzed using SDS-PAGE electrophoresis followed by Coomassie blue staining.
- the fraction containing the target protein was concentrated to a suitable volume and stored at -80 °C.
- buffers containing 10%PEG8000 in phosphate-buffered saline (PBS) , or low salt buffer containing 50 mM Tris-HCl (pH 7.5) and 25 mM NaCl without any crowding agents were used, respectively.
- Recombinant proteins were exchanged into the droplet formation buffer using Amicon Ultra centrifugal filters (30kDa MWCO, Millipore, Burlington, MA, USA) .
- the protein solution was immediately loaded onto a homemade chamber comprising a glass slide with a coverslip attached using two parallel strips of double-sided tape. Slides were then imaged using an Andor confocal microscope with a 63 ⁇ objective (Oxford Instruments, Abingdon, UK) .
- EGFP-MED26-IDR can form phase-separated droplets in vitro, with or without crowding reagents (10%PEG8000) (FIG. 1E and 1F) .
- crowding reagents 10%PEG8000
- fusion events of the MED26 droplets were captured, indicating their fluidic property (Data not shown) .
- the droplet formation assay with varying concentrations of EGFP-MED1-IDR, EGFP-MED26-IDR, and EGFP was next performed, which showed that MED26-IDR has a lower saturation concentration of phase separation than MED1-IDR (FIG. 1E) .
- MED26-IDR droplets are sensitive to 1, 6-HD and high salt treatment, indicating that hydrophobic and electrostatic interactions contribute to the droplet formation (FIG. 1F) .
- MED26 a subunit in the core Mediator complex, can undergo phase separation in vitro and in vivo, and suggested that the transcription condensates switch to a “MED26 enriched form” during terminal erythroid differentiation.
- Example 3 MED26 plays a crucial role in hematopoietic development in mice and human
- Med26 conditional knock-out mice were constructed to examine its function in the hematopoietic system.
- CRISPR/Cas9 technology was used to modify the Med26 gene.
- Flox sequences were inserted into both sides of the Med26 gene loci. The brief process is as follows: sgRNA, Cas9, and flox sequence donors were microinjected into the fertilized eggs of C57BL/6JGpt mice. Fertilized eggs were transplanted to obtain positive F0 mice which were confirmed by PCR and sequencing. A stable F1 generation mouse model was obtained by mating positive F0 generation mice with C57BL/6JGpt mice.
- Mx1-iCre mice were also generated by CRISPR/Cas9 technology, the Mx1-iCre-polyA gene fragment was inserted into the H11 site of mice.
- the brief process is similar to Med26 conditional knockout mice.
- Med26 flox/flox; wt/wt (control) or Med26 flox/flox; Mx1-iCre/wt (cko) mice were generated by natural propagation.
- 10 ⁇ g g-1 polyinosinic-polycytidylic acid pIpC-HMW, InvivoGen
- mice were sacrificed and the organs of interest were isolated for the following analysis.
- Med26 genomic loci was recombined and its protein expression was down-regulated after Cre induction by pIpC injection (Fig. 2A) .
- the cKO mice showed smaller body size, whiter hair and worse survival rate (FIG. 2B) .
- Prussian blue staining of the spleen section showed more iron deposition in the cKO mice, indicating increased abnormal erythroblasts were removed by the spleen (Fig. 2C) .
- Complete blood count (CBC) analysis of peripheral blood showed that cKO mice had lower mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) , but similar RBC, HGB, and hematocrit (Fig. 2D) , compared to the wildtype mice.
- MCV mean corpuscular volume
- MCH mean corpuscular hemoglobin
- the erythroid regeneration capacity of the cKO mice was next tested under phenylhydrazine (PHZ) -induced acute hemolytic anemia condition.
- PZ phenylhydrazine
- Med26 flox/flox ; wt/wt (control) or Med26 flox/flox ; Mx1-iCre/wt (cko) mice 6–8 weeks of age, randomized by weight, were pretreated with pIpC (5 ⁇ g g-1) for 1 day (day -1) .
- the mice were injected with phenylhydrazine (PHZ, Sigma) (60 mg kg-1) .
- Whole blood samples were collected on each day of days 1–7 for complete blood count (CBC) analyses.
- cKO mice were unable to recover after PHZ treatment (FIG. 2G) , consistent with much smaller spleen, scarce reticulocytes in the peripheral blood and fewer erythroblasts at the S3 stage in the bone marrow
- MED26 is essential for erythropoiesis in normal and stress conditions.
- the hematopoietic stem and progenitor cell (HSPC) and white blood cell (WBC) composition of cKO mice was also analyzed, which showed that LT-HSC, ST-HSC, MPP, CMP, GMP, MEP, B cell and neutrophils are impaired upon MED26 deficiency (Fig. 2H and 2I) .
- CD34+ cells were purified from human cord blood as described above.
- a miR-30-based shRNA vector was used; it was created by inserting the target gene into the EcoRI and XhoI sites as previously described (60) . It was observed that knocking down MED26 substantially abrogated colony-forming capacity of human CD34+ HSPCs (FIGs. 3A-D) .
- a gain-of-function assay in the primary human erythroid culture system was conducted.
- the coding sequence of the gene was amplified using PCR and cloned into the BamHI and NotI sites of the MSCV-3XFlag-T2A-copGFP vector. Results showed that MED26 over-expression promoted erythroid differentiation, but inhibited enucleation (Fig. 4A-C) .
- the OptoDroplet assay was first used to assess the function of MED26 truncations (Fig. 4D) .
- the results showed that the truncations containing amino acids (a.a. ) 88-480, the putative IDR region, have the aggregate forming capacity (Fig. 4D) .
- a. a. 1-480 formed more conspicuous aggregates than all other truncations, which suggests that a. a. 1-87 can promote the phase separation capacity of the MED26 IDR.
- 88-480 of MED26 but not a. a. 1-87 or 480-600, had phase separation capacity (Fig. 4E) .
- Previous reports showed that a. a. 1-87 is the TFIIS domain and that a.a. 480-600 contains the surface that interacts with the remaining Mediator complex (36, 39) .
- these three segments of MED26 were overexpressed in human CD34+ HSPCs, which showed that a. a. 88-480 alone can sufficiently promote erythroid differentiation relative to the full-length MED26 (Fig. 4F) .
- Example 5 MED26-enriched transcription condensates are preferentially associated with RNA polymerase II pausing
- the CUT&Tag signals of MED26 were analyzed, and compared to those of MED1, which is often regarded as a representative subunit of Mediator, in human CD34+ erythroid culture cells on Day 4.
- the CUT&Tag assay was performed as previously described (59) and followed the manufacturer’s instructions for the kit (Vazyme, Nanjing, China) . Briefly, 100,000 cells were freshly collected and captured using Concanavalin A (ConA) beads at room temperature. The cell/ConA beads complex was permeabilized and incubated with the primary antibody (at 1: 100 dilution) overnight at 4 °C. The secondary antibody was added to the solution and incubated at room temperature for 1 h.
- ConA Concanavalin A
- the secondary antibody was washed off prior to adding pA/G-Tn5 to the cell suspension and then incubated at room temperature for 1 h.
- the adapters were then inserted into the Tn5-tagged genome using the TruPrep Tagment Buffer L (TTBL) .
- the genomic DNA was extracted with DNA beads, and the tagged DNA fragments were amplified using the Next-Generation Sequencing (NGS) adapters with 16 cycles of PCR.
- NGS Next-Generation Sequencing
- the adaptor dimer was removed from the PCR products with DNA Clean Beads (Vazyme, Nanjing, China) .
- the library was quantified before sequencing.
- results showed that ⁇ 60%of chromatin sites with MED1 or MED26 occupancy do not colocalize (Fig. 5A) .
- MED26 colocalizes with GATA1 and GATA2 better than MED1, which suggests potential functional association between MED26 and GATA factors.
- the presence of MED1-or MED26-enriched condensates were observed in the primary human erythroblasts, as well as other cell types. Then the signal ratio of MED26 to MED1 was calculated at transcription start sites (TSS) of their occupancy loci.
- MED26-enriched chromatin sites While a large fraction of MED1 and/or MED26-occupied genes have a relatively constant MED26/MED1 signal ratio, a considerable number of genes have differential MED26/MED1 ratios, indicating the chromatin occupancy of MED26 and MED1 do not always intercorrelate.
- the maximum 10%ratio were defined as the “MED26-enriched chromatin sites” and the minimum 10%ratio as the “MED26-poor chromatin sites” (Fig. 5B-C) .
- the Pausing Index was calculated, which is defined by the ratio of “the read counts at the TSS region” to “the read counts at the gene body region” after normalizing both read counts by the length of the genomic region (40) .
- Example 6 MED26 recruits pausing factors to form biomolecular condensates
- IP-MS Immunoprecipitation coupled with Mass Spectrometry
- the protein complexes were eluted with 100 ⁇ g/mL 3XFlag peptide (Beyotime, China) , denatured with 2 ⁇ SDS sample buffer, and analyzed using SDS-PAGE electrophoresis followed by Coomassie blue staining.
- the PAGE gel band of the expected molecular weight for the target protein was cut into suitable size, digested with trypsin, and analyzed on a Q Exactive Plus Mass Spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) to identify the interacting proteins.
- the MS data were aligned with the Human Reviewed Swiss-Port database using the Proteome Discoverer 2.2 software.
- the NSAFs were calculated for each detected protein (32, 61-63) .
- the NSAF for a protein k is proportional to the amount of the protein present in the sample and is calculated using the following formula:
- MED26 and MED1 similarly co-immunoprecipitated with the majority of other Mediator subunits (the head, middle, and tail modules) and the elongation complex
- MED26 interacted much less with the CDK8 kinase module than MED1, consistent with a previous study (30) .
- MED26 interacted with many more transcription pausing factors (NELF, DSIF, and PAF complexes) than MED1, which supports the notion that MED26 associates with pausing (FIGs. 6A-B) .
- NELF, DSIF, and PAF complexes transcription pausing factors
- MED1 To determine whether the recruitment of pausing factors depends on the phase separation of MED26, mCherry fused with the disordered region of PAF1 was purified (FIG. 6C) .
- the in vitro droplet formation assay not only shows that a. a. 1-480 of MED26 can recruit pausing factor PAF1 (Fig. 6D) , but also suggests that the presence of pausing factors reciprocally promotes condensate formation of MED26.
- Previous studies show that a. a. 1-87 of MED26 contain a TFIIS domain, which can interact with TFIIS interacting motifs (TIM) that ubiquitously exist in disordered regions of transcription regulators (41) .
- TIM TFIIS interacting motifs
- the PAF1 complex subunits PAF1, LEO1, and CTR9 all contain TIM sequences. Therefore, the TFIIS domain and the IDR domain of MED26 may both be key segments to promote condensate formation.
- CUT&Tag assays were used to analyze the ratio of MED26 to MED1 chromatin occupancy on Day 4 and Day 16 of primary human CD34+ derived erythroblasts. Results revealed that the ratio of MED26 to MED1 increases at both erythroid and non-erythroid genes during differentiation, and the ratio at erythroid genes on Day 16 has a more marked increase relative to non-erythroid genes (FIG. 6F-G) .
- PRO-seq was performed on Day 4 or Day 16 ex vivo cultured erythroblasts.
- PRO-seq libraries were prepared as described previously (58) . Briefly, 2 ⁇ 10 7 Day4 or Day16 ex vivo cultured permeabilized CD34 cell nuclei were added to 2 ⁇ Nuclear Run-On (NRO) reaction mixture and incubated for 3 min at 37°C. Nascent RNA was extracted and fragmented by base hydrolysis in 0.2 N NaOH on ice for 10 min, and neutralized by adding 1 ⁇ volume of 1 M Tris-HCl pH 6.8.
- NRO Nuclear Run-On
- RNA adapter VRA3 5'p-GAUCGUCGGACUGUAGAACUCUGAAC (SEQ ID NO: 19) -/3’inverted dT/) , and the products were enriched by a second round of streptavidin enrichment. Then for 5’ end repair, the RNA products were treated with RppH (Thermo Fisher) and polynucleotide kinase (PNK, NEB) .
- RNA adaptor VRA5 5'-CUGAACAAGCAGAAGACGGCAUACGA (SEQ ID NO: 20) -3') before the third round of streptavidin bead enrichment.
- RNA was reverse transcribed using RT primer (5’AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA (SEQ ID NO: 21) -3’) .
- RT primer 5’AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA (SEQ ID NO: 21) -3’
- the cDNA product was amplified for 18 cycles and the library larger than 150 bp (insert > 70 bp) is purified from PAGE gel.
- the library was quantified before NGS.
- MED26 enrichment is associated with increased transcription pausing during terminal erythroid stages, which can promote erythroid development.
- mRNA therapy holds promising potential as a revolutionary approach in the field of medicine. Its ability to leverage the body’s natural cellular machinery for protein production offers targeted and precise treatment for various diseases. Therefore, the potential of MED26 condensates to function as intracellular transport for mRNA was evaluated.
- Condensates of MED26 (1-480 amino acids; SEQ ID NO: 2) and mRNA were prepared by adding them in ddH 2 O and gently mixing for 30-60 seconds.
- the phase separation diagram was determined through microscopic observation for a range of MED26 (1-480 amino acids; SEQ ID NO: 2) concentrations (0.1-100 ⁇ M) and mRNA concentrations (0.01-0.6 ⁇ M) .
- PEG was dissolved in ddH 2 O with a series of concentrations (0, 2, 5, 10, 15, 20%, wt/v) .
- MED26 (1-480 amino acids; SEQ ID NO: 2) (10 ⁇ M) and EGFP mRNA (0.1 ⁇ M) were introduced into the polyethylene glycol (PEG) solution and gently mixed for 30-60 seconds to form coacervates.
- 1 ⁇ 10 5 Jurkat cells were suspended in 20 ⁇ L Opti-MEM and combined with 40 ⁇ L coacervate solution. After a 2-hour incubation in a 96-well plate at 37°C with 5%CO 2 , 200 ⁇ L cell medium (RPMI-1640, 10%FBS, antibiotics) was added and the cells were cultured for 18 hours.
- cell medium RPMI-1640, 10%FBS, antibiotics
- PEG is widely employed to enhance LLPS as a crowding agent and dehydration inducer. It was observed that coacervates formed in the PEG solution demonstrated higher efficiency in cell entry in a concentration-dependent manner by detecting Cy5-labeled mRNA (FIG. 8) . The relationship between PEG concentration during the MED26-mRNA coacervate generation and expression efficiency was also investigated. FIG. 8 that higher expression level of the protein encoded by the mRNA was achieved when the coacervate was assembled in PEG solutions, and the high expression was achieved in 10%or higher PEG solution.
- MED26-EGFP mRNA coacervates efficiently transfected 293T, expressing EGFP mRNA with comparable efficiency to Lipofectamine MessengerMAX reagent (FIGs. 9A-B) .
- MED26 coacervates exhibited a notable capacity for delivering mRNA into Jurkat cells, surpassing the performance of Lipofectamine MessengerMAX reagent (FIGs. 9A-B) .
- the primary function of the MED26 protein is to participate in gene transcription within the cell nucleus.
- a series of truncated forms of the MED26 protein were designed and purified (FIG. 10A) . All truncations tested exhibited the ability to form coacervates with mRNA. Therefore, their delivery efficiency in Jurkat cells was compared and screened (FIG. 10B) .
- the fragment of amino acids 135-480 of MED26, i.e., MED26 (135-480; SEQ ID NO: 12) protein was chosen.
- MED26 (135-480; SEQ ID NO: 12) protein the delivery efficiency of various protein concentrations were assessed with 0.1 ⁇ M of mRNA, and 10 ⁇ M of protein was found to be sufficient to achieve high mRNA delivery efficiency in Jurkat cells (FIG. 10C) .
- Coacervates produced by higher MED26 concentration also successfully delivered mRNA into Jurkat cells (Fig. 10D) .
- MED26 coacervates were not confined to carrying a single mRNA; confocal observation revealed complete co-localization of two mRNAs within MED26 coacervates (data not shown) .
- FACS analysis and confocal observations confirmed a high correlation in expression between EGFP mRNA and tdTomato mRNA in Jurkat cells (FIG. 11) and in 293T cells.
- siRNA knockdown experiment 293T-GFP cells expressing stable GFP were seeded at a density of 2.5 ⁇ 10 5 cells per well in a 24-well cell culture plate one day prior.
- a coacervate mixture containing 10 ⁇ M MED26 (135-480; SEQ ID NO: 12) , 10%PEG, and 1 ⁇ M siRNA was prepared by thorough mixing for 30-60 seconds.
- the existing culture medium in each well was removed, and 200 ⁇ L of the coacervate mixture, combined with 100 ⁇ L of opti-MEM medium, was added to each well.
- the plate was then incubated stationary in a cell culture incubator for 2 hours. Post-transfection, 1 mL of complete DMEM growth medium was added to each well, and the plate was further incubated at 37°C in the incubator for 72 hours to assess the siRNA's knockdown effect on the target gene.
- siRNAs targeting different genes were thoroughly mixed, and a siRNA mixture with a final concentration of 1 ⁇ M was used for coacervate preparation. The remaining transfection conditions remained unchanged.
- pDNA CRISPR/Cas9-mediated gene knockout using plasmid DNA
- pDNA CRISPR/Cas9-mediated gene knockout using plasmid DNA
- pDNA delivery was assessed through MED26 coacervates.
- MED26-GFP pDNA coacervates successfully transfected Jurkat cells, surpassing the capabilities of Lipofectamine 3000 (FIG. 14A) .
- the transfection efficiency was comparable in 293T cells when delivering a small-sized plasmid, but notably, MED26 coacervates demonstrated enhanced performance in delivering large-sized plasmids (FIG. 14B) .
- MED26 coacervates outperformed Lipofectamine 3000 when co-transfecting cells with two pDNAs simultaneously (FIGS.
- MED26 coacervates The gene editing efficiency facilitated by MED26 coacervates was next assessed.
- Jurkat cells were exposed to CRISPR/Cas9 pDNA-loaded MED26 coacervates targeting DNA methyltransferase 1 (DNMT1) , hemoglobin subunit beta (HBB) , hypoxanthine phosphoribosyl transferase 1 (HPRT1) , and a pDNA mixture of these three targets.
- DNMT1 DNA methyltransferase 1
- HBB hemoglobin subunit beta
- HPRT1 hypoxanthine phosphoribosyl transferase 1
- pDNA mixture of these three targets To assess the efficiency of genomic editing, cells were treated with MED26 coacervate carrying the all-in-one plasmid (with gRNA for a specific target) . After 48 hours of transfection, cells were harvested, and the genomic DNA was extracted by QuickExtract TM DNA Extraction Solution (Lucigen) .
- the target genomic locus was amplified by nested PCR using Max DNA Polymerase (Takara) and primers listed in Table 1 and purification was performed using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit (Takara) . Subsequently, 200 ng of PCR products underwent the T7EN1 assay to evaluate the indel frequency following recommended protocols (Vazyme Biotech) . The digested products were analyzed using 2%agarose gels and captured with a gel imaging system (Tanon) . Indel percentages were measured by ImageJ software and calculated with the following formula:
- Indel (%) 100 ⁇ [1- (1-fraction cleaved) 1/2 ] , where the fraction cleaved is defined as the sum of each digested product intensity divided by the sum of each digested product intensity and undigested product intensity.
- MED26 coacervates demonstrated higher efficiency of plasmid expression ratios compared to Lipofectamine 3000 reagent in 293T cells (FIG. 14H) . Consequently, MED26 coacervates mediated higher genome editing efficiency at the DNMT1, HBB, HPRT1, and multiple-targeted loci (FIG. 14I) .
- the MED26 coacervate can allow multiple gene edits through a single-step transfection, particularly in hard-to-transfect Jurkat cells, without the need for Cas9 protein or gRNA.
- these coacervates can combine different gene categories, such as pDNA and siRNA, in a single coacervate (data not shown) , offering more options for multi-target drug discovery.
- TIF1gamma controls erythroid cell fate by regulating transcription elongation. Cell 142, 133-143 (2010) .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Developmental Biology & Embryology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims (36)
- A method of promoting erythroid differentiation, comprising administering to an erythroid precursor cell an agent that increases RNA polymerase II pausing mediated by a mediator complex subunit 26 (MED26) polypeptide in the cell.
- The method of claim 1, wherein the agent increases the interaction of the MED26 with a transcription pausing factor, such as a factor in a negative elongation factor (NELF) , DRB Sensitivity Inducing Factor (DSIF) or polymerase associated factor (PAF) complex, particularly a PAF1, in the cell.
- The method of claim 1, wherein the agent increases occupancy of a super-enhancer site by the MED26, such as a super-enhancer for a gene selected from CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27.
- The method of any one of the foregoing claims, wherein the agent comprises the MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment.
- The method of claim 4, wherein the active fragment comprises an intrinsically disordered region (IDR) of the MED26 polypeptide, more particularly, the active fragment comprises a polypeptide that is at least 90%, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, identical to the amino acid sequence of SEQ ID NO: 17.
- The method of claim 5, wherein the active fragment comprises a TFIIS domain and an intrinsically disordered region (IDR) of the MED26 polypeptide, more particularly, the active fragment comprises a polypeptide that is at least 90%, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, identical to the amino acid sequence of SEQ ID NO: 2.
- The method of any one of the foregoing claims, wherein the agent comprises the MED26 polypeptide or the nucleic acid encoding the MED26 polypeptide, more particularly, the MED26 polypeptide comprises a polypeptide that is at least 90%, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%identical to the amino acid sequence of SEQ ID NO: 1.
- A method of promoting erythroid differentiation, comprising administering to an erythroid precursor a polypeptide comprising the amino acid sequence of SEQ ID NO: 17 or a polynucleotide encoding the polypeptide.
- The method of claim 8, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 2.
- The method of claim 9, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.
- The method of any one of the foregoing claims, wherein the erythroid precursor is a hematopoietic stem and progenitor cell (HSPC) , such as a CD34+ HSPC.
- The method of any one of claims 1-10, wherein the erythroid precursor is an erythroblast, such as an erythroblast derived from a CD34+ HSPC.
- The method of any of the foregoing claims, wherein the agent is administered to the erythroid precursor in vitro.
- The method of any of the foregoing claims, wherein the agent is administered to the erythroid precursor in vivo in a subject in need thereof.
- The method of claim 14, wherein the subject is in need of treating a disease associated with defective erythroid differentiation.
- The method of claim 15, wherein the disease associated with defective erythroid differentiation is a myelodysplastic syndrome, such as refractory anemia or refractory cytopenia, erythroid dysplasia, bone marrow failure or megaloblastic anemia.
- A method of identifying an agent for promoting erythroid differentiation, comprisinga. providing a composition comprising a MED26 polypeptide or an active fragment thereof;b. contacting the composition with a test agent; andc. assessing whether the test agent increases the capacity of the MED26 to mediate RNA polymerase II pausing.
- The method of claim 17, wherein the assessing step comprises assessing whether the test agent promotes the capacity of the MED26 to form an aggregate, to interact with a transcription pausing factor, and/or to occupy a super-enhancer site.
- A composition comprising an agent that increases RNA polymerase II pausing mediated by a MED26 polypeptide.
- A method of delivering a reagent to a cell, comprising:a. preparing a condensate comprising a MED26 polypeptide or active fragment thereof and the reagent; andb. contacting the cell with the condensate,whereby the MED26 polypeptide or active fragment thereof delivers the reagent to the cell.
- The method of claim 20, wherein the reagent is a nucleic acid, such as one or more RNA or DNA molecules.
- The method of claim 20 or 21, wherein the MED26 polypeptide or active fragment thereof comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, sequence identity to SEQ ID NO: 16.
- The method of claim 22, wherein the MED26 polypeptide or active fragment thereof comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or 100%, sequence identity to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.
- The method of claim 22, wherein the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.
- The method of claim 22, wherein the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NO: 12.
- The method of claim 22, wherein the MED26 polypeptide or active fragment thereof comprises the amino acid sequence of SEQ ID NO: 2.
- The method of any one of claim 21-26, wherein the nucleic acid encodes one or more components for gene editing.
- The method of claim 27, wherein the gene editing comprises a CRISPR gene editing, and the nucleic acid encodes one or more of a CRISPR RNA (crRNA) , a tracrRNA that hybridizes with the crRNA, and a Cas endonuclease (such as Cas9, Cas12, Cas13) , preferably, the nucleic acid encodes a single guide RNA comprising the crRNA and the tracrRNA and/or the Cas endonuclease, more preferably, the nucleic acid encodes the single guide RNA and a Cas9 endonuclease.
- The method of claim 27 or 28, wherein the nucleic acid is a DNA molecule, such as a plasmid DNA.
- The method of claim 27 or 28, wherein the nucleic acid is an RNA, such as an mRNA.
- The method of any one of claim 21-26, wherein the reagent is a DNA molecule, such as a circular DNA (e.g., a plasmid DNA) or a linear DNA (e.g., an antisense DNA) .
- The method of any one of claim 21-26, wherein the reagent is an RNA, such as an mRNA, an siRNA, an antisense RNA, a linear RNA, a circular RNA or a tRNA.
- The method of any one of claims 20-32, wherein the step of preparing the condensate comprises mixing the reagent with the MED26 polypeptide or active fragment thereof in a buffer comprising water.
- The method of claim 33, wherein the buffer further comprises polyethylene glycol (PEG) .
- The method of claim 34, wherein the buffer comprises 1-30% (w/v) PEG, such as 2-20% (w/v) PEG, e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%or 15% (w/v) PEG, preferably 10% (w/v) PEG.
- The method of any one of claims 20-35, wherein the step of preparing the condensate comprises mixing the reagent with 1-200 μM, preferably 5-150 μM, such as 5, 10, 25, 50, 75, 100, 125, or 150 μM, more preferably 10 μM, of the MED26 polypeptide or active fragment thereof.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202480038946.9A CN121335976A (en) | 2023-06-15 | 2024-06-14 | Combinations and methods for MED26-mediated regulation of erythropoiesis |
| EP24822819.9A EP4724569A1 (en) | 2023-06-15 | 2024-06-14 | Compositions and methods for med26-mediated regulation of erythropoiesis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2023100427 | 2023-06-15 | ||
| CNPCT/CN2023/100427 | 2023-06-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2024255872A1 true WO2024255872A1 (en) | 2024-12-19 |
Family
ID=93851396
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CN2024/099339 Ceased WO2024255872A1 (en) | 2023-06-15 | 2024-06-14 | Compositions and methods for med26-mediated regulation of erythropoiesis |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4724569A1 (en) |
| CN (1) | CN121335976A (en) |
| WO (1) | WO2024255872A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN120555402A (en) * | 2025-07-30 | 2025-08-29 | 西湖凝聚体(杭州)生物科技有限公司 | A method for gene editing in primary cells |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190002886A1 (en) * | 2017-06-22 | 2019-01-03 | The Children's Medical Center Corporation | Signaling centers of erythroid differentiation |
| US20220112463A1 (en) * | 2019-02-28 | 2022-04-14 | Westlake Therapeutics (Hangzhou) Co. Limited | Method for preparing mature red blood cells in vitro using peripheral blood |
-
2024
- 2024-06-14 CN CN202480038946.9A patent/CN121335976A/en active Pending
- 2024-06-14 EP EP24822819.9A patent/EP4724569A1/en active Pending
- 2024-06-14 WO PCT/CN2024/099339 patent/WO2024255872A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190002886A1 (en) * | 2017-06-22 | 2019-01-03 | The Children's Medical Center Corporation | Signaling centers of erythroid differentiation |
| US20220112463A1 (en) * | 2019-02-28 | 2022-04-14 | Westlake Therapeutics (Hangzhou) Co. Limited | Method for preparing mature red blood cells in vitro using peripheral blood |
Non-Patent Citations (4)
| Title |
|---|
| LEE HSIANG-YING, ZHU SHICONG, ZHANG XIAOTING, LI MAN, ZHAO XINYING, LI NA, XIE SERA, YUE QIUYU, LI YUNFENG, LI DONG, WU FAN, ZHANG: "A Mediator Switch Tunes Transcription Pausing to Drive Erythropoiesis", BLOOD, W.B. SAUNDERS, vol. 142, no. Supplement 1, 2 November 2023 (2023-11-02), pages 10 - 10, XP093248127, ISSN: 0006-4971, DOI: 10.1182/blood-2023-189195 * |
| MURPHY ZACHARY C.; MURPHY KRISTIN; MYERS JACQUELYN; GETMAN MICHAEL; COUCH TYLER; SCHULZ VINCENT P.; LEZON-GEYDA KIMBERLY; PALUMBO : "Regulation of RNA polymerase II activity is essential for terminal erythroid maturation", BLOOD, W.B. SAUNDERS, vol. 138, no. 18, 3 June 2021 (2021-06-03), pages 1740 - 1756, XP086850531, ISSN: 0006-4971, DOI: 10.1182/blood.2020009903 * |
| TAKAHASHI HIDEHISA, RANJAN AMOL, CHEN SHIYUAN, SUZUKI HIDEFUMI, SHIBATA MIO, HIROSE TOMONORI, HIROSE HIROKO, SASAKI KAZUNORI, ABE : "The role of Mediator and Little Elongation Complex in transcription termination", NATURE COMMUNICATIONS, NATURE PUBLISHING GROUP, UK, vol. 11, no. 1, UK, XP093248128, ISSN: 2041-1723, DOI: 10.1038/s41467-020-14849-1 * |
| ZHU SHICONG, ZHANG XIAOTING, LI NA, ZHAO XINYING, LI MAN, XIE SI, YUE QIUYU, LI YUNFENG, LI DONG, WU FAN, ZHANG ZILE, FENG ZIQI, Z: "MED26-enriched condensates drive erythropoiesis through modulating transcription pausing", BIORXIV, 26 August 2024 (2024-08-26), XP093248132, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2024.08.26.609654v1.full.pdf> DOI: 10.1101/2024.08.26.609654 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN120555402A (en) * | 2025-07-30 | 2025-08-29 | 西湖凝聚体(杭州)生物科技有限公司 | A method for gene editing in primary cells |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4724569A1 (en) | 2026-04-15 |
| CN121335976A (en) | 2026-01-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240082420A1 (en) | Delivery of therapeutic rnas via arrdc1-mediated microvesicles | |
| US20250122499A1 (en) | Artificial nucleic acids for rna editing | |
| EP4239073A1 (en) | Recombinant nucleic acid molecule and application thereof in preparation of circular rna | |
| EP3538546B1 (en) | Compositions, methods, and therapeutic uses related to fusogenic protein minion | |
| Xiong et al. | Glutamylation of deubiquitinase BAP1 controls self-renewal of hematopoietic stem cells and hematopoiesis | |
| EP4724569A1 (en) | Compositions and methods for med26-mediated regulation of erythropoiesis | |
| EP4138879A1 (en) | Methods and compositions | |
| EP4689089A1 (en) | Crispr nuclease polypeptides and gene editing systems comprising such | |
| Yang et al. | WDR82-binding long noncoding RNA lncEry controls mouse erythroid differentiation and maturation | |
| CA3163572A1 (en) | Novel transduction enhancers and uses thereof | |
| Kikuchi et al. | E2F-6 suppresses growth-associated apoptosis of human hematopoietic progenitor cells by counteracting proapoptotic activity of E2F-1 | |
| EP4061834A1 (en) | Chemically inducible polypeptide polymerization | |
| WO2024073370A2 (en) | Methods to rejuvenate human cells through transcriptional reprogramming | |
| AU2022386233A1 (en) | Biomarkers of megakaryocyte-derived extracellular vesicles | |
| WO2015098963A1 (en) | Method for promoting expression of calreticulin, and synthetic peptide for use in method for promoting expression of calreticulin | |
| JP5832032B2 (en) | Method for screening substance having blood cell maturation promoting activity | |
| Mazur et al. | Efficient globin production during terminal erythropoiesis depends on the synergistic action of TENT5C poly (A) polymerase and LARP4/5 | |
| WO2026082018A1 (en) | Delivery system for gene editing and uses thereof | |
| Schneider | Investigation of the interaction of PRMT6 and LEF1/β-catenin in hematopoiesis | |
| WO2014046732A1 (en) | Cyclotide-based cxcr4 antagonists with anti-hiv activity | |
| CN118647365A (en) | Biomarkers of Megakaryocyte-derived Extracellular Vesicles | |
| Frigenti | Dynamic Ubiquitin Modification Regulated and Interpreted by Endosomal Sorting Complexes | |
| Kashuv | The Role of Tumor Microenvironment in the Modulation of Pre-metastatic Niches in Pancreatic Cancer | |
| Vijay | Identifying New Therapeutic Targets for Acute Myeloid Leukemia Protected in the Vascular Niche | |
| Li | Phase separation of AKAP95 regulates oncogenic MLL-fusion driven transcription and its modulation for cancer therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 24822819 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2025573704 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024822819 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2024822819 Country of ref document: EP Effective date: 20260107 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202508374R Country of ref document: SG |
|
| WWP | Wipo information: published in national office |
Ref document number: 11202508374R Country of ref document: SG |
|
| ENP | Entry into the national phase |
Ref document number: 2024822819 Country of ref document: EP Effective date: 20260107 |
|
| ENP | Entry into the national phase |
Ref document number: 2024822819 Country of ref document: EP Effective date: 20260107 |
|
| WWP | Wipo information: published in national office |
Ref document number: 2024822819 Country of ref document: EP |