WO2024239018A1 - Methods and pharmaceutical compositions for treating chemotherapy-induced peripheral neuropathy with eg5 inhibitors - Google Patents

Methods and pharmaceutical compositions for treating chemotherapy-induced peripheral neuropathy with eg5 inhibitors Download PDF

Info

Publication number
WO2024239018A1
WO2024239018A1 PCT/US2024/030257 US2024030257W WO2024239018A1 WO 2024239018 A1 WO2024239018 A1 WO 2024239018A1 US 2024030257 W US2024030257 W US 2024030257W WO 2024239018 A1 WO2024239018 A1 WO 2024239018A1
Authority
WO
WIPO (PCT)
Prior art keywords
paclitaxel
treatment
keratinocytes
emd534085
therapeutic agent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2024/030257
Other languages
French (fr)
Inventor
Sandra RIEGER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Miami
Original Assignee
University of Miami
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Miami filed Critical University of Miami
Publication of WO2024239018A1 publication Critical patent/WO2024239018A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4738Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4741Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having oxygen as a ring hetero atom, e.g. tubocuraran derivatives, noscapine, bicuculline
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]

Definitions

  • chemotherapeutic agents including paclitaxel (Brand name Taxol), cause sensory-dominant peripheral neuropathy (Argyriou etal., 2010, J BU ON 15: 435-446; Beijers et al., 2012, Neth J Med 70: 18-25; Argyriou et al., 2012, Crit Rev Oncol Hematol 82: 51-77; Gomstein et al., 2014, Neuropharmacology 76 Pt A: 175-183; Boyette-Davis etal., 2015, Pain Manag 5: 285-296; Flatters et al., 2017 , Br J Anaesth 119: 737-749; Argyriou et al., 2017, Nat Rev Neurol 13: 492-504; Argyriou et al., 2019, Journal of neurology, neurosurgery, and psychiatry 90: 1361-1369).
  • paclitaxel treatment stimulated the formation of reactive oxygen species (ROS) in epidermal keratinocytes, which induced Matrix-Metalloproteinase 13 (MMP-13, collagenase-3) expression, resulting in extracellular matrix (ECM) degradation and axon degeneration (Lisse et al., 2016, Id using Cirrincione et al., 2020, Sci Rep 10: 3970).
  • ROS reactive oxygen species
  • MMP-13 Matrix-Metalloproteinase 13
  • ECM extracellular matrix
  • pharmacological inhibition of MMP-13 in zebrafish, rats, and mice rescued paclitaxel neurotoxicity and restored epidermal integrity.
  • compositions associated with inhibition of paclitaxel induced ROS formation in epidermal keratinocytes upstream of MMP-13 are also disclosed.
  • CIPN chemotherapy- induced peripheral neuropathy
  • the therapeutic agent is an Eg5 inhibitor.
  • the Eg5 inhibitor is monastrol, ispinesib, (+)-S-trityle-L-cysteine (TriC), BRD9876, filanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB-743921, MK0731, 4SC-205, ARQ 621, or EMD534085.
  • the Eg5 inhibitor is EMD534085.
  • the therapeutic agent is administered before, during, and after administration of the chemotherapeutic treatment.
  • the therapeutic agent inhibits expression of kifl 1 gene encoding EG5. More particularly, the therapeutic agent is a CRISPR-Cas9 complex comprising a single guide RNA specific for kifll gene.
  • the chemotherapeutic treatment is paclitaxel, docetaxel, cabazitaxel, TPL287, and albumin paclitaxel, or a combination thereof.
  • the therapeutic agent can be delivered via intravenous administration or topical administration.
  • the therapeutic agent is capable of preventing or reducing degeneration of neurons innervating epidermal keratinocytes.
  • the chemotherapeutic treatment includes a chemotherapeutic agent capable of stabilizing microtubules in keratinocytes.
  • a pharmaceutical composition comprising a therapeutic agent capable of inhibiting Eg5 function or expression, a chemotherapeutic agent capable of stabilizing microtubule in keratinocytes, and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition can contain the therapeutic agent which is an Eg5 inhibitor.
  • the pharmaceutical composition contains an Eg5 inhibitor that is monastrol, ispinesib, (+)-S-trityle-L-cysteine (TriC), BRD9876, fdanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB-743921, MK0731, 4SC-205, ARQ 621, or EMD534085.
  • the therapeutic agent inhibits expression of kifl 1 gene encoding Eg5.
  • the therapeutic agent in certain embodiments is a CRISPR-Cas9 complex comprising a single guide RNA specific for kifll gene.
  • the chemotherapeutic agent is paclitaxel, docetaxel, cabazitaxel, TPI-287, or albumin paclitaxel, or a combination thereof, wherein the pharmaceutical composition is delivered via intravenous administration or topical administration to a patient to prevent CIPN.
  • the pharmaceutical composition is capable of preventing or reducing degeneration of neurons innervating epidermal keratinocytes.
  • the pharmaceutical composition is used to prevent chemotherapy-induced peripheral neuropathy (CIPN) by administering a therapeutically effecting amount thereof to a patient undergoing chemotherapeutic treatment with an agent that promotes degeneration of neurons innervating the skin.
  • CIPN chemotherapy-induced peripheral neuropathy
  • FIG. 1A through FIG. IL are images and analysis of detyrosination and fasciculation of microtubules following paclitaxel treatment.
  • FIG. 1A is a transmission electron microscopy image of a larval zebrafish caudal fin at 6 days post fertilization (dpf) showing an infolded epidermis and a single keratinocyte wrapping around the distal caudal fin edge (green). Mesenchymal cells are located medially between the infolded epidermis.
  • dpf days post fertilization
  • IB is a schematic of the caudal fin shown in FIG. 1A depicting the cell types that are present. Two contralateral sensory neurons (red and blue) are shown that innervate the epidermis and arborize between the periderm and basal keratinocyte layer.
  • FIG. 1C is a schematic of the experimental design for anti-detyrosinated tubulin antibody (GluTub) staining of detyrosinated (stabilized) microtubules (dMTs) shown in FIG. 1D-1F.
  • GluTub anti-detyrosinated tubulin antibody
  • dMTs detyrosinated microtubules
  • FIG. IE is enhanced GluTub labelling in linear mesenchymal cells at 2dpf following 3hr vehicle treatment (left column), which was absent in mesenchymal cells in the presence of paclitaxel (right column) but instead cutaneous sensory axons (dotted linear structures) were labelled.
  • FIG. IF is GluTub staining in a 2dpf zebrafish embryo. Mesenchymal cells (thin arrows) were strongly labeled in both 3hr vehicle (0.05% DMSO; top row left image) and paclitaxel treated fish (top row right image). Axonal dMTs were evident following paclitaxel treatment (thick arrows) but rarely present in vehicle controls at 3 hours.
  • FIG. 1G demonstrates that at 6dpf, dMTs were present in mesenchymal cells and axons of vehicle-treated fish. Following 96hr paclitaxel treatment (right panel), dMTs were fasciculated in individual keratinocytes in the caudal fin (thin arrow - top arrow of the right image) and most prominently at the fin edge (oval dotted line).
  • FIG. II demonstrates increased percent animals with dfMTs after 48 and 96hr paclitaxel but not vehicle treatment (n>15 animals/group).
  • FIG. IK demonstrates increased caudal fin keratinocytes per 100pm 2 with dfMTs following 22pM paclitaxel treatment, while few keratinocytes harbor dfMTs when animals were treated with lOOnM paclitaxel (n>17 animals/group).
  • FIG. IL demonstrates a single injection of 20mg/kg paclitaxel into mice at 5 weeks caused dfMT and rosette formation 48hr after the injection, assessed with alpha-tubulin staining. dfMT formation is evident in the suprabasal epidermis.
  • FIG. 2A through FIG. 21 demonstrate mechanotransduction activation of Noxl upstream of MMP-13 and cutaneous axon degeneration.
  • FIG. 2A shows that keratinocyte mitochondria showed subtle changes in the reactive oxygen species (H2O2) following paclitaxel treatment. Mitochondria in basal keratinocytes were labelled with tp63 :HyPer-mito to detect H2O2 dependent oxidation of HyPer with ratiometric imaging. Unoxidized hydrogen peroxide sensor (HyPer) was detected when HyPer is excited at 420nm. Oxidized HyPer was detected when excited at 505nm.
  • H2O2 reactive oxygen species
  • FIG. 2B is a summary of HyPer-mito ratio at 3hr and 48 hour of vehicle versus paclitaxel treatment.
  • qPCR quantitative PCR
  • FIG. 2D demonstrates that Noxl was distributed in the cytoplasm and nucleus of caudal fin keratinocytes when fish were treated with vehicle (0.05% DMSO) and translocated to the plasma membrane and clusters in the nucleus following prolonged paclitaxel treatment.
  • FIG. 2E shows Tg(//?63:GFP-CAAX) transgenic animals with fluorescently labelled basal keratinocyte plasma membranes used to measure keratinocyte length and width by comparing medial and edge (dash line) keratinocytes. Quantifications were performed before and after zebrafish stretch on the stretcher, which revealed that fin edge keratinocytes increased in length but not in width whereas no effect was seen for medial keratinocytes.
  • FIG. 2F demonstrates immunofluorescence staining for alpha tubulin, showing microtubule stretching along the fin edge in wildtype (left 2 panels) and homozygous cyba-/- fish (right 2 panels) treated for 48 hours with vehicle.
  • FIG. 2G shows ratiometric HyPer imaging and summary oxidation data from 5min pre-stretch to 90min post-stretch in wildtype and cyba-/- mutants treated with vehicle or paclitaxel illustrated by the top-most panel.
  • FIG. 3A through FIG. 3M show that paclitaxel treatment induces cell cycle genes in the skin of mice and patients with CIPN.
  • FIG. 3B is a heatmap showing up (red) and down (blue) regulated genes.
  • FIG. 3C is gProfiler analysis at peak neuropathy day 7 (D7) revealing Gene Ontology (GO) terms for extracellular matrix and collagen-related processes, and cell cycle regulation.
  • FIG. 3D is STRING interactome analysis of genes in FIG. 3C identifying a major cluster for cell cycle genes (magenta, blue), and proteins involved in disulfide bond formation (yellow).
  • FIG. 3A through FIG. 3M show that paclitaxel treatment induces cell cycle genes in the skin of mice and patients with CIPN.
  • FIG. 3B
  • FIG. 3E is validation of mouse RNAseq data confirming the upregulation of spindle checkpoint regulators (Plklm Cdc20, Ndc80, Bubl, Dlgap5) following paclitaxel treatment relative to vehicle controls, with the highest expression increase at D7 during peak neuropathy.
  • FIG. 3F shows that STRING interactome analysis predicted the interactions of these genes with Kifll and other mitotic genes.
  • FIG. 3G are normalized gene counts for upregulated Kif genes following paclitaxel treatment (shown are days 4, 7, 11, and 23 of treatment).
  • FIG. 3H are normalized gene counts for Nox genes and their regulators detected in the skin (shown are days 4, 7, 11, and 23 of treatment).
  • FIG. 3K show RNAseq using human lower leg skin from 3 CIPN patients (CIPN5, 31, 35 weeks) and 3 control subjects (CTRL 1-3).
  • FIG. 31 is a heatmap and PCA plot revealing the separation of CIPN patients from the controls.
  • FIG. 3J shows relative gene expression of upregulated KIF genes (left to right: KIF11, KIF 12, KIF13B, KIF 17, KIF1C, K1F26A).
  • FIG. 3L shows that NOXI was most strongly induced and showed great variability together with NOX4 and CYBB.
  • FIG. 3K shows STRING network analysis which revealed KIF11 as a central hub for co-upregulated KIF genes.
  • FIG. 3M is iDEP.96 analysis of the 1200 most variable differentially expressed genes showing three distinct clusters.
  • the first cluster (A, blue) harbours genes that are downregulated in the CIPN patients.
  • Cluster B (yellow) harbours genes that are upregulated in the patient diagnosed with CIPN 5 weeks prior.
  • Cluster C (purple) harbours genes that are upregulated in the patients diagnosed with CIPN 35 and 31 weeks prior).
  • FIG. 4A through FIG. 4J demonstrate that paclitaxel induces Eg5 expression and Eg5-dependent dfMT and nuclear X-ROS formation.
  • FIG. 4A is Eg5 immunofluorescence staining showing punctate staining in proximal caudal fin keratinocytes of vehicle treated animals. Staining along the fin edge (white dashed line) is absent. Paclitaxel treatment promoted Eg5 activation in the proximal fin (white arrows) and in fin edge keratinocytes leading to asterlike formations (white dashed line, thick white arrow - bottom arrow of bottom right panel).
  • FIG. 4A is Eg5 immunofluorescence staining showing punctate staining in proximal caudal fin keratinocytes of vehicle treated animals. Staining along the fin edge (white dashed line) is absent. Paclitaxel treatment promoted Eg5 activation in the proximal fin (white arrows) and in fin
  • FIG. 4B shows that EMD534085 co-admini strati on with lOOnM and 22pM paclitaxel rescued microtubule fasciculation but not detyrosination.
  • NM lateral line neuromast.
  • /7 /CRISPR knockout prevented detyrosination and fasciculation of MTs.
  • FIG. 4C shows percentage of animals with dfMTs/keratinocyte was reduced when paclitaxel is administered in combination with EMD534085 or in kifll CRISPR knockout fish (n>23 animals/group).
  • FIG. 4D shows that EMD534085 treatment or kifll CRISPR knockout in presence of paclitaxel reduced the number of keratinocytes with dfMTs per animal compared with paclitaxel alone (n>21 animals per group).
  • FIG. 4E shows zebrafish kifll CRISPR knockout without Eg5 induction in caudal fin following paclitaxel treatment. Vehicle (top) and paclitaxel (bottom) treatment for 96 hours did not induce Eg5 expression detected with an Eg5 specific antibody using immunofluorescence staining.
  • FIG. 4F shows normalized intensity ratios of GluTub suggest that kifl 1 CRISPR knockout rescued microtubule detyrosination induced by paclitaxel.
  • FIG. 4G shows that paclitaxel induced total and phospho-Eg5 in mouse suprabasal keratinocytes.
  • Mice were i.p. injected once with either 0.9% NaCl (vehicle) or 30mg/kg paclitaxel, followed by fixation 48 hours post injection. Alpha-tubulin antibody staining was used as counterstain. DAPI was used to depict nuclei.
  • Top panel Weak Eg5 expression in the vehicle control epidermis (left) but strong induction of Eg5 following paclitaxel treatment (right). Lower panel: Eg5 phosphorylation was absent in the skin following vehicle injection (left). Paclitaxel injection induced Eg5 phosphorylation in basal and suprabasal keratinocytes.
  • FIG. 4H and FIG. 41 show that Noxl nuclear but not plasma membrane translocation induced by 96hr paclitaxel treatment was rescued with EMD534085 co-administration.
  • FIG. 4J shows that nuclear HyPer oxidation induced by paclitaxel treatment was rescued with EMD534085 coadministration.
  • FIG. 5A through FIG. 5D show detyrosinated fasciculated microtubules associate with nuclei.
  • FIG. 5A shows that dfMTs detected with anti-GluTub staining associate with a keratinocyte nucleus labelled with Hoechst33342 (left image). 3D reconstruction of the same image using Imaris (right image).
  • FIG. 5B shows that 3D-rendered dfMTs pinch off nuclear content (left and right, thin arrow) and perforated the nucleus (right, thick arrows).
  • FIG. 5C shows nuclear volume of keratinocytes following 96 hours of 22pM paclitaxel treatment.
  • FIG. 5D shows decreased nuclear sphericity of keratinocytes with dfMTs appearance (n>5 animals/group).
  • DFL- MT detyrosinated fasciculated looped microtubule.
  • FIG. 6A through FIG. 6F demonstrate that dfMTs modulate mitosis but not apoptosis.
  • FIG. 6B is percent animals without and >1 mitotic divisions/12hr (n>9 animals/group).
  • FIG. 6C shows that EMD534085 combination with 22pM paclitaxel increased cell divisions/animal compared with paclitaxel treatment (n>8 animals/group).
  • FIG. 6D shows that 96hr treatment with EMD534085 and 22pM paclitaxel increased cell death (n>8 animals/group).
  • FIG. 6E is time-lapse imaging of keratinocyte cell death in caudal fin.
  • Caudal fin keratinocyte nuclei were visualized in a Tg(h2a:h2a-GFP) zebrafish caudal fin at 6dpf.
  • the fish was treated with paclitaxel+EMD534085 for 96hr.
  • the intact keratinocyte nucleus (top, arrow) condenses within 15 minutes (middle, arrow) and subsequently fragments (bottom, arrow), indicative of cell death.
  • Right panels show higher magnification images.
  • 6F is a model for Eg5-dependent dfMT formation and downstream events: paclitaxel activated Eg5 as part of the cell cycle checkpoint, however, independent of mitosis in interphase keratinocytes leading to crosslinking and fasciculation of long-term stabilized, detyrosinated microtubules.
  • dfMTs constrained the nucleus and promoted Noxl nuclear accumulation and X-ROS formation upstream of mmpl3 induction.
  • FIG. 7A through FIG. 7H demonstrate that paclitaxel modulated microtubule growth dynamics in keratinocytes independent of Eg5. Microtubule growth dynamics were captured and quantified in caudal fin keratinocytes expressing tp63:EB3-GFP.
  • FIG. 7D are kymographs of growing microtubules generated with MTrackJ shows more rapid depolymerization in the presence of paclitaxel, consistent with quantifications in FIG.7F.
  • FIG. 7E shows that decreased comet velocity following 3hr paclitaxel treatment was not rescued by co-admini strati on of EMD534085 (n>8 animals/group).
  • FIG. 7F shows that decreased track length upon 3hr paclitaxel treatment was not rescued by co-administration of EMD534085 (n>8 animals/group).
  • FIG. 7G shows that comet duration was not changed for any of the treatments (n>8 animals/group).
  • 7H shows microtubule average growth distance in pm over 50 seconds in epidermal keratinocytes in the caudal fin of 6dpf larval zebrafish treated for 96hr either with vehicle, EMD534085, 22pm paclitaxel, or 22pM paclitaxel in combination with EMD534085.
  • FIG. 8A through FIG. 8H show microtubule behavior in genetically stabilized microtubules.
  • FIG. 8A shows microtubule network in CMV-Tau-Bfp2 expressing keratinocytes following 96hr vehicle treatment.
  • FIG. 8B shows that 96hr paclitaxel treatment induced linearization of Tau- Bfp2-stabilized microtubules. The polar plot validates increased linearity (n>4 animals/ plot).
  • FIG. 8A shows microtubule network in CMV-Tau-Bfp2 expressing keratinocytes following 96hr vehicle treatment.
  • FIG. 8B shows that 96hr paclitaxel treatment induced linearization of Tau- Bfp2-stabilized microtubules. The polar plot validates increased linearity
  • FIG. 8D is 3D reconstruction of EB3-GFP plus-ends in a keratinocyte following 96hr paclitaxel treatment.
  • FIG. 8E shows more than 80% of EB3-GFP plus-ends colocalized with Tau-Bfp2 regardless of low or high Tau expression. Paclitaxel treatment for 96hr further increased co-localization (n>5 animals/group).
  • FIG. 8F shows that paclitaxel treatment for 96hr increased EB3-GFP velocity in the presence of Tau-Bfp2.
  • FIG. 8G and FIG. 8H demonstrates that colocalized EB3-GFP and Tau-Bfp2 microtubules (arrow) showed overlapping growth tracks when traced along curvatures.
  • FIG. 9A through FIG. 91 show that Eg5 inhibition rescued and keratinocyte- specific overexpression induced paclitaxel neurotoxicity.
  • FIG. 9A shows degeneration of cutaneous axons detected with anti-acetylated tubulin antibody staining following 96hr treatment with 22pM paclitaxel, but not when treated with lOOnM paclitaxel or 22pM paclitaxel+EMD534085 (n>l 1 animals/group).
  • FIG. 9A shows degeneration of cutaneous axons detected with anti-acetylated tubulin antibody staining following 96hr treatment with 22pM paclitaxel, but not when treated with lOOnM paclitaxel or 22p
  • FIG. 9C shows that paclitaxel induced axonal detyrosination and keratinocytes acetylation. Increased axonal dMT formation (thin white arrows) and keratinocyte-specific microtubule acetylation at lysine position 40 (K40) (thick arrows) were produced following 22pM paclitaxel treatment for 96 hours with and without EMD534085.
  • FIG. 9D is quantification of normalized acetylation intensity showing an increase in keratinocyte microtubule acetylation after 96hr paclitaxel treatment with and without EMD534085.
  • FIG. 9D is quantification of normalized acetylation intensity showing an increase in keratinocyte microtubule acetylation after 96hr paclitaxel treatment with and without EMD534085.
  • FIG. 9F top panel: Co-expression of isll :Gal4VP16_14xUAS-tdTomato (magenta) in axons and tp63:A7/ 7-AcGFP (blue) in few keratinocytes that were not in contact with cutaneous branches did not promote axon degeneration.
  • Bottom panel Axon degeneration was prominent when tp63:/q/7/-AcGFP expressing basal keratinocytes were abundant and established contact with cutaneous branches.
  • FIG. 9F top panel: Co-expression of isll :Gal4VP16_14xUAS-tdTomato (magenta) in axons and tp63:A7/ 7-AcGFP (blue) in few
  • FIG. 9G is magnification of FIG. 9F showing nuclear Eg5 and weaker cytoplasmic localization in 6dpf zebrafish expressing tp63:£z/77-AcGFP.
  • FIG. 9H is quantification of axon degeneration showing that low presence of keratinocytes expressing kifl 7-AcGFP was insufficient to induce axon degeneration.
  • FIG. 91 is a model showing paclitaxel-dependent Eg5 induction leading to dfMT formation and Noxl -dependent mmpl3 expression in keratinocytes, which promoted ECM degradation and axon degeneration.
  • FIG. 10 is a depiction of the forward primer used for sequencing a single zebrafish and yielded deletions in transiently injected embryos in experiments involving CRISPR.
  • FIG. 11A through FIG. 11C show that EMD534085 reduced detyrosinated microtubules (dMT) caused by paclitaxel treatment.
  • FIG. 11A shows the treatment plan for 12 week-old mice receiving intraperitoneal injections of vehicle (0.5% DMSO//lxPBS), paclitaxel (24mg/kg; one injection), or paclitaxel plus EG5 inhibitor, EMD534085 (20mg/kg; 3 injections: 1 before, during, and after paclitaxel). The mice were then sacrificed 24 hours after the last injection and the skin of the hind paw pad was collected.
  • FIG. 11A shows the treatment plan for 12 week-old mice receiving intraperitoneal injections of vehicle (0.5% DMSO//lxPBS), paclitaxel (24mg/kg; one injection), or paclitaxel plus EG5 inhibitor, EMD534085 (20mg/kg; 3 injections: 1 before, during, and after paclitaxel). The mice
  • FIG. 11B show images of collected skin tissues stained with anti-GluTub (to detect detyrosinated microtubules) and DAPI to detect nuclei.
  • the arrows in the circle point to brittle skin in the stratum spinosum.
  • the other arrows point to cells that have increased detyrosination.
  • FIG. 11C is the quantification of number of cells with dMT per 250 pm 2 area with each treatment.
  • compositions and methods for the treatment of chemotherapy- induced peripheral neuropathy are provided herein.
  • ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. For example, “about 5%” means “about 5%” and also “5%.” The term “about” can also refer to ⁇ 10% of a given value or range of values. Therefore, about 5% also means 4.5% - 5.5%, for example.
  • the terms “or” and “and/or” are utilized to describe multiple components in combination or exclusive of one another.
  • x, y, and/or z can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.”
  • Subject or “patient” as used herein are used interchangeably and refer to a warmblooded animal such as a mammal, preferably a human, which is afflicted with, or has the potential to be afflicted with cancer as described herein.
  • the subject can be a human patient that was at risk for, or suffering from, peripheral neuropathy induced by chemotherapy treatment.
  • Contacting includes the physical contact of at least one substance to another substance.
  • Express or “expression” as used herein refers to transcription and translation of a nucleic acid coding sequence resulting in production of the encoded polypeptide.
  • “Pharmaceutical composition” refers to a composition that includes one or more therapeutic agents, such as an Eg5 inhibitor, a pharmaceutically acceptable carrier, a solvent, an adjuvant, and/or a diluent, or any combination thereof.
  • therapeutic agents such as an Eg5 inhibitor, a pharmaceutically acceptable carrier, a solvent, an adjuvant, and/or a diluent, or any combination thereof.
  • the exact nature of the carrier, solvent, adjuvant, or diluent will depend upon the desired use of the composition (e.g., route of administration), and can range from being suitable or acceptable for veterinary uses to being suitable or acceptable for human use.
  • chemotherapeutic agents refer to chemicals/drugs that are used to treat cancer.
  • the therapeutic agent is used to treat CIPN.
  • the "therapeutic agents,” described herein or compositions thereof, will generally be used in an amount effective to achieve the intended result, for example, to treat cancer or to treat CIPN.
  • Some chemotherapeutic agents described herein are capable of stabilizing the cellular microtubule.
  • chemotherapy agents can be in multiple forms including, but not limited to, capsules, tablets, injectables, or patches.
  • CIPN chemotherapy-induced peripheral neuropathy
  • Stabilized microtubule refers to a shift in the equilibrium of tubulin polymer that made up the microtubule from the soluble to the polymerized form.
  • a preferred mechanism of microtubule stabilization occurs post-translationally, by detyrosination (dMT) - a process to remove the terminal tyrosine on a- tubulin by tubulin carboxypeptidase (Hallak et al., 1977, FEBS letters 73: 147-150), thereby exposing a glutamate residue (Nieuwenhuis et al., 2019, Trends Cell Biol 29: 80-92).
  • Chemotherapeutic agents that are microtubule stabilizers include paclitaxel, docetaxel, cabazitaxel, TPI-287, and albumin paclitaxel.
  • paclitaxel docetaxel
  • cabazitaxel cabazitaxel
  • albumin paclitaxel The structures and commercial sources/publications of these compounds are provided below.
  • TPI-287 (MedChemExpress, catalogue number: 849213-15-
  • inhibitors refer to biologically active compounds that reduce a protein’s function or expression.
  • Eg5 refers to kinesin-5 protein, which can be expressed in mammals, zebrafish, or other animals.
  • Eg5 and EG5 mean kinesin-5 protein.
  • Eg5 inhibitors are capable of reducing detyrosination of microtubules in keratinocytes and degeneration of axons innervating the keratinocytes caused by chemotherapeutic drugs such as paclitaxel treatment.
  • Eg5 inhibitors include, but are not limited to, monastrol, ispinesib, (+)-S-trityle-L-cysteine (TriC), BRD9876, filanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB-743921, MK0731, 4SC-205, ARQ 621, and EMD534085.
  • therapeutic effects produced by Eg5 inhibitors can be achieved by reducing Eg5 gene expression, inter alia, by genome-editing tools such as CR1SPR-Cas9, TALE nucleases, zinc-finger nucleases, and the like that target Eg5 specifically.
  • genome-editing tools such as CR1SPR-Cas9, TALE nucleases, zinc-finger nucleases, and the like that target Eg5 specifically.
  • compositions appropriate for such therapeutic applications include preparations for parenteral, subcutaneous, transdermal, intradermal, intramuscular, intravenous
  • compositions appropriate for therapeutic applications can be in admixture with one or more pharmaceutically acceptable excipients, diluents, or carriers such as sterile water, physiological saline, glucose, or the like.
  • pharmaceutical compositions are lyophilized.
  • compositions as provided herein contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
  • the pharmaceutical compositions can be formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy, 20th edition, 2000, ed. A. R. Gennaro, Lippincott Williams & Wilkins, Philadelphia, and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York).
  • a variety of dosage schedules are contemplated by this disclosure.
  • a subject can be dosed monthly, every other week, weekly, daily, or multiple times per day.
  • Dosage amounts and dosing frequency can vary based on the dosage form and/or route of administration, and the age, weight, sex, and/or severity of the subject’s disease.
  • Therapeutic benefit refers to the rebuilding and/or remodeling of damaged tissue thereby eradicating or ameliorating one or more of the symptoms associated with the injury or surgical recovery such that a subject being treated with the therapeutic agent reports an improvement in feeling or condition, notwithstanding that the subject can still have incomplete healing or injury resolution.
  • an Eg5 inhibitor is provided to a subject as part of a pharmaceutical composition
  • a pharmaceutical composition comprising an inhibitor, a chemotherapeutic agent, and a pharmaceutically acceptable carrier, wherein the chemotherapeutic agent is a microtubule stabilizer.
  • the pharmaceutical composition can be delivered to the subject locally or systemically via topical administration, intravascular administration, such as intravenous, intramuscular, or intra-arterial administration, intraperitoneal administration, and the like.
  • the Eg5 inhibitor is administered before, during, and/or after the administration of the chemotherapeutic agent.
  • the Eg5 inhibitor can be included with the chemotherapeutic agent in one injection to be given to the patients; or two injections - one including Eg5 inhibitor and one including the chemotherapeutic agent can be given.
  • treatment refers to the clinical intervention made in response to a disease, disorder, or physiological condition of the subject or to which a subject can be susceptible.
  • the aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder, or condition.
  • the terms “prevent” and “preventing” refer to prophylactic or preventive measures intended to inhibit undesirable physiological changes or detrimental progression of a condition.
  • the terms “effective amount” or “therapeutically effective amount” refer to an amount sufficient to effect beneficial or desirable biological and/or clinical results. In other words, a “therapeutically effective” amount is an amount that will provide some alleviation, mitigation, or decrease in at least one clinical symptom in the subject.
  • Wildtype strains of Zebrafish (Nacre/mitfa), Tuebingen and AB strains were purchased from the Zebrafish International Resource Center (ZIRC) and embryos raised and bred according to NIH guidelines. Tuebingen wildtype fish were used for CRISPR studies. Nacre fish were used for membrane labelling of keratinocytes in tp63:GFP-CAAX. All remaining analyses were performed in AB fish. Animals were handled in strict accordance with good animal practices as approved by the appropriate IACUC committees (MDI Biological Laboratory IACUC number A13-20; University of Miami’s A-3224-01 and AALAC accreditation site: 001069).
  • Zebrafish eggs were collected in a strainer and rinsed with deionized water, and then transferred into Petri dishes with Embryo medium (Instant Ocean salt water + methylene blue, Zebrafish book protocol (Westerfield, 2007, University of Oregon Press, Eugene 5 th edition, incorporated by reference herein in its entirety , incorporated by reference herein in its entirety) or Ringers solution. Following overnight incubation at 28.5°C, embryos were cleaned and fresh Ringer’s solution with phenol -thio-urea was added for further incubation. Embryos were kept in a 14: 10 hr light/dark cycle.
  • Embryo medium Instant Ocean salt water + methylene blue, Zebrafish book protocol (Westerfield, 2007, University of Oregon Press, Eugene 5 th edition, incorporated by reference herein in its entirety , incorporated by reference herein in its entirety
  • Ringers solution Following overnight incubation at 28.5°C, embryos were cleaned and fresh Ringer’s solution with phenol -thio
  • Transgenic lines Tg(h2a:h2a-GFP, Cat. No. ZL1087) transgenic fish were obtained from the Zebrafish International Resource Center (ZIRC). tp63:GFP-CAAX fish were previously published (Lisse etal., 2016, Proc. Natl. Acad. Sci. USA 113: E2189-2198).
  • CREST3:EB3-GFP was a gift from the Koester Lab (University of Braunschweig, Germany) (pCS2_CMV:EB3-GFP sequence is from PMID: 12684451, for CREST3-EB3-GFP see SEQ ID NO: 25).
  • the CMV promoter was removed from pCS2 by digestion with Hindlll, followed by Klenow fragment incubation to create blunt-ends, purification and subsequent digestion done with Sall.
  • Tol2 CREST3:Gal4VP16 14xUAS-GFP (gift from Alvaro Sagasti, UCLA; and see Rieger et al., 2011, PLoS Biol. 9: el000621) was digested with EcoRV (created blunt-end site) and Sall. The gel-purified fragment was ligated into the pCS2_EB3-GFP plasmid overnight at 16°C and transformed into Top 10 cells for purification and injection
  • a construct identified as tp63 :EB3-GFP was generated by removing the CMV promoter as above.
  • the tp63 promoter was removed by digestion of pBSK- JC_T2_tp63_Gal4VP16_GFP-5xUAS-MCS (SEQ ID NO: 30) with Apal and Avril, followed by Klenow treatment to generate blunt ends.
  • Klenow treatment to generate blunt ends.
  • the tp63 promoter fragment was ligated into pCS2-EB3-GFP, as above. Both constructs were sequenced and further verified by in vivo imaging.
  • a construct identified as tp63 :Ai/77-AcGFP was generated by PCR amplification of zebrafish kifll from cDNA (Horizon Discovery, Clone ID: 3815942) for ligation into the pAcGFP-Nl (Takara, Cat. No. 632501) fusion vector.
  • the following primers were used: Fwd 5’-AAGGCCTCTGTCGACCATGGCATCATCACAAGTAC-3’ (SEQ ID NO: 1) and rev 5’- AGAATTCGCAAGCTTATTCTGACATCTGAGTGGAAGT-3’ (SEQ ID NO: 2) and Q5 P Polymerase (NEBNext® High-Fidelity 2X PCR Master Mix). This was followed by PCR purification (QIAGEN PCR Purification kit) and ligation of the amplicon into pAcGFP-Nl. The plasmid was transformed into One-Shot Top 10 cells (ThermoSci entific, Cat. No.
  • KXIG:tp63:AcGFP (Lisse et al., 2016, Proc Natl Acad Sci USA 113(15): E2189-98) was digested with BamHI/Notl to remove AcGFP with gel extraction (QIAGEN) and BamHI_A7/77- AcGFP_NotI was inserted via ligation using T4 DNA ligase (Promega, Cat. No M180A) at room temperature for 2 hours. The ligation reaction was transformed into One-Shot ToplO cells and colonies were screened via PCR for positive inserts. Plasmid DNA from positive colonies were isolated and purified using the QIAGEN MiniPrep kit and verified via sequencing. Positive plasmids were injected into zebrafish and verified for fluorescence, which was only visible if kifll was cloned in-frame with AcGFP.
  • a construct identified as isll :Gal4VP16_14xUAS-tdTomato (SEQ ID NO: 31) was provided to the laboratory.
  • mTagBFP2-MAPTau-C-10 was provided by Michael Davidson (Addgene plasmid #55311; PMID: 22174863, RRID:Addgene_55311).
  • Hyper was amplified from pHyPer-dMito (Evrogen) without the stop codon using the following primers: Fwd: 5’-3’ catttacctctgaagccacgggtttagtgaaccgtcag (SEQ ID NO: 5) and Rev: 5’-ttcctcctccAACCGCCTGTTTTAAAAC-3’ (SEQ ID NO: 6).
  • the CAAX motif was amplified using the primers 5’-acaggcggttGGAGGAGGAAGATCTAAG-3’ (SEQ ID NO: 7) and 5’-tcgagctccaccgcggtggcAACACCCCTTGTATTACTG-3’ (SEQ ID NO: 8) from the pME- EGFP-CAAX vector (gift from Chi-Bin Chien). Both amplicons were purified using the PCR Purification kit (QIAGEN) and ligated via HiFi Assembly using the 2x HiFi Master mix (NEB, Cat. No. M0541) at 50°C for 20 minutes. The assembly reaction was transformed into NEB 5- alpha competent cells provided with the HiFi Assembly kit (NEB, Cat. No. E5520) and colonies grown and purified via the Plasmid Miniprep kit (Qiagen) and subsequently sequenced.
  • tp63:HyPer-mito KXIG:tp63:HyPer-mito was cloned by digesting tp63:AcGFP with BamHI/Notl (NEB) to excise AcGFP (tp63:Hyper-mito sequence is SEQ ID NO: 29).
  • a hydrogen peroxide sensor specific to the mitochondria was amplified from pHyPer-dMito (Evrogen) using the following primers Fwd: 5’- catttacctctgaagccacgggtttagtgaaccgtcag-3’ (SEQ ID NO: 9) and Rev: 5’- tcgagctccaccgcggtggctaagatacattgatgagtttgg-3’ (SEQ ID NO: 10).
  • the amplicon was ligated into the vector containing the tp63 promoter using the Hi-Fi Assembly Master mix (NEB) at 50°C for 20 minutes.
  • the assembly reaction was transformed into NEB 5-alpha competent cells and purified using the plasmid miniprep kit by Qiagen, and subsequently sequenced.
  • Paclitaxel was purchased from Sigma- Aldrich (Cat No. T7402) and upon arrival stored as powder at 4°C. A stock solution was prepared in 100% fresh DMSO to make 5.9 mM paclitaxel. The stock solution was divided into 20-30pl aliquots and stored at -20°C until use (maximal 6 months). Immediately prior to use, paclitaxel was diluted in Ringer’s solution and added to dechorionated larval zebrafish. The larval fish were placed individually or in small groups into wells of a 12-well plate containing the treatment solutions. The control group was 0.05% DMSO. Plates were incubated at 28.5°C and protected from light.
  • Paclitaxel and DMSO solutions were exchanged every 48hr if longer incubations were used.
  • EMD534085, Eg5 inhibitor (MedChemExpress, Cat. No. HY-15000) was diluted in 100% DMSO to make a lOmM stock solution and stored at -20°C. Immediately prior to use, the inhibitor was diluted to 25 pM and added at 4dpf, following two days of either vehicle or paclitaxel incubation. For Noxl staining experiments, the inhibitor was added together with paclitaxel at 2dpf. The solutions were exchanged every 48hr.
  • Larval fish were further incubated overnight in antibody solution (Millipore Sigma, Cat. No. AB3201, 1 :300 rabbit anti-GluTub; Sigma, Cat No. T6793, 1 :500 mouse anti-acetylated tubulin) in blocking buffer at 4°C, on a rotator.
  • antibody solution Millipore Sigma, Cat. No. AB3201, 1 :300 rabbit anti-GluTub; Sigma, Cat No. T6793, 1 :500 mouse anti-acetylated tubulin
  • larval fish were transferred into 6-well plates and washed 4xl5min in IxPBST at room temperature, with rocking. This was followed by incubation in secondary antibody (goat antirabbit Cy5, Abeam, Cat. No. ab97077; goat anti-mouse Cy3, Abeam, Cat. No. ab97035) and 1 : 10,000 Hoechst 33342 (ThermoFisher Scientific, Cat. No.
  • BR biological replicate
  • Larvae were collected into 1.5ml reaction tubes post-treatment and RNA extraction was performed using the rNeasy Plus Micro kit (Qiagen, Cat. No. 74034).
  • cDNA was synthesized from ⁇ 300ng total RNA using the Superscript IV VILO kit (Thermo Fisher, Cat. No. 11756050).
  • Primers in target genes were designed wherein primers annealed in two exons separated by one or several large introns that could not be amplified with the selected PCR settings, to avoid genomic DNA contamination.
  • Quantitative PCR was performed with the Applied Biosystems QuantStudio 3 using PowerUp SYBR Green (ThermoFisher, Cat No. A25741). Amplification signals for expressed target genes were normalized to zebrafish 18S rRNA signals. qPCR conditions were used as follows: 95°C for 10 minutes, 40 cycles of 95°C for 15 seconds, 50°C for 30 seconds, 72°C for 30 seconds. Each biological replicate was run in quadruplicate. Data were presented as relative expression compared to control using the delta-vdelta Ct (2 MCt ) method.
  • CRISPR oligos targeting kifll were designed using the IDT CRISPR design tool (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM).
  • the oligo (5’- AGGTGACCGATCACCCAATG (SEQ ID NO: 21) was designed to anneal within exon 5 of 23 exons total in zebrafish kifll with expected mutations ⁇ position 270bp in the sequenced region using the following primers for PCR amplification: Fwd 5’- TTAGGTTTTTGGCCCTTCTG-3’ (SEQ ID NO: 22) and Rev 5’- GAGGGTCCTGATAGAGAAAAAGTGAA-3’ (SEQ ID NO: 23).
  • the forward primer was used for sequencing and yielded deletions in transiently injected embryos, as shown in example below in which single zebrafish were sequenced (FIG. 10).
  • the CRISPR oligo was injected using the Alt-R system (IDT, https://www.idtdna.com/pages/technology/crispr/crispr-genome-editing/Alt-R-systems/cas9), which has provided highly reliable and efficient zebrafish knockout results as used herein.
  • the IDT-recommended protocol (below) was used for CRISPR oligo preparations. Fertilized eggs were injected ⁇ 15 minutes post fertilization with CRISPR oligos to ensure maximal efficiency.
  • RNA complexes were assembled by combining 3pL of gRNA with 3pL of diluted Cas9 protein, followed by incubation at 37°C for 10 min, and then allowed to cool to room temperature. Embryos were collected at the 1-cell stage and 3nL of RNP complex injected. Un-injected control embryos were also used in experiments. Injected fish were monitored for toxicity at 8 hours, 1 day, 2 days, and 4 days post injection. Four days post-injection genomic DNA was collected using the NaOH method. Target specific PCR was performed and PCR products analyzed using 2% agarose gels.
  • Microtubule analyses was performed in Imaris 9.5.1 (Bitplane) by measuring the straightness of filaments (microtubules) using the “Filaments — Dendrite Straightness” tool, which was defined as the ratio between filament length and radial distance between two branch points (h). The value was always smaller than 1 since the Dendrite Straightness of 1 defines straight objects.
  • Fluorescence intensities were measured using the Imaris MATLAB plugin or Fiji. A line was typically placed over the region of interest and the fluorescence automatically quantified. The values were normalized to nuclear (Hoechst33342) fluorescence intensities within the same fish and region to obtain an intensity ratio.
  • Nuclear sphericity and volume were calculated in Imaris following 3D rendering of round keratinocyte nuclei using the Surface tool. First, background subtractions were performed, followed by automatic threshold detection. The threshold was adjusted if necessary to fit the nucleus. Thresholds were kept constant for comparisons.
  • dfMT thicknesses (defined as the mean width of a given dfMT) was manually measured at high magnification using the Slice mode in Imaris and the Line tool for measuring the distance between two points.
  • the innermost and outermost microtubule cable was defined as perimeter for the width measurements. Measurements were taken in 3 dfMT positions that covered the minimum, medium, and maximum width within a given dfMT to obtain an overall range distribution.
  • EB3-GFP tracking was done in Fiji using the MTrackJ plugin to trace microtubules over time and create Kymographs, measure the velocity, track length, and comet duration. Tracking was also performed using the Spots and Surface tools in Imaris. Settings were initially automatically detected to fit the fluorescence and subsequently modified manually for improved fit. Settings were maintained between treatment groups. [00083] Axon branch number quantifications were performed by drawing a 50pm line across the dorsal, medial, and ventral caudal fin edge region at a distance of 100pm parallel to the fin edge (which was determined to be the most reliable region to quantify distal branch numbers). Axons traversing this line were counted and averaged per treatment group.
  • HyPer fluorescence measurements were taken using the Imaris Spots function by manually placing spots along the axon and using the fluorescence intensity profile measurements MatLab tool.
  • HyPer fluorescence was measured in the oxidized (505nm) and unoxidized (420nm) channels by using the region of interest (ROI) function in ZEN Black (Zeiss) whereby ROIs were selected inside highly magnified mitochondria (HyPer-mito), cytoplasm (HyPer-cyto) or the plasma membrane (HyPer-CAAX). The data was exported, and ratios determined in Excel.
  • H2O2 measurements in zebrafish transiently injected with tp63:Hyper were manually performed by placing spot objects in Imaris 9.5.1 onto individual cells such that the spots extended to the lateral edges. Fluorescence intensities were measured inside the spots and 505nm/420nm ratios were subsequently calculated.
  • Measurements were determined by measuring fluorescence intensity in Fiji using single slice and single channel modes.
  • a line using the line tool was placed along the plasma membrane that was clearly distinguishable from the cytoplasm due to increased fluorescence compared with the cytoplasm in all treatment groups.
  • the measurement tool was subsequently selected to measure the mean fluorescence intensity.
  • Three lines per caudal fin keratinocyte were averaged for 5 cells per animal and at least 3 animals per treatment group.
  • nuclei were first overlaid with Noxl fluorescence to ensure the exclusion of nuclear measurements. These images were then used to draw lines within the cytoplasm as above.
  • the line was placed inside a nucleus such that it spanned the longest extent of the nucleus. The fluorescence data was exported to Excel and the ratios calculated.
  • Student’s /-test was used to compare groups.
  • a one-way ANOVA was used to compare more than two groups and a single variable.
  • a two-way ANOVA was used for comparisons of multiple groups and multiple variables. Significance was set at p ⁇ 0.05, p ⁇ 0.01, p ⁇ 0.001, p ⁇ 0.0001.
  • mice in each cage were randomly allocated to different treatment groups. Food and water were available ad libitum and experiments were performed during the light cycle (7:00 am to 7:00 pm). Animals were euthanized via CO2 asphyxiation, followed by cervical dislocation. Animals that showed behavioral disturbances unrelated to chemotherapy-induced pain were excluded from further behavioral testing. The animal’s husbandry conformed with established NIH and Institutional Animal Care and Use Committee (IACUC) approved protocols.
  • IACUC Institutional Animal Care and Use Committee
  • mice at 12 weeks old were IP injected with vehicle (0.5% DMSO//lxPBS), paclitaxel (24mg/kg; one injection), and the EG5 inhibitor, EMD534085 (20mg/kg; 3 injections: 1 before, during, and after paclitaxel).
  • vehicle 0.5% DMSO//lxPBS
  • paclitaxel 24mg/kg; one injection
  • EMD534085 the EG5 inhibitor
  • Paws and back skin were collected at predetermined time points, placed in 10% formalin, and stored overnight at 4°C. Samples were embedded in paraffin and sectioned at 7pm, deparaffinized, washed with PBS, and incubated at room temperature for 5 min in 0.1% Triton X-100 in PBS and then blocked for 30 min (5% BSA). Sections were incubated with primary antibody diluted in blocking solution, overnight at 4°C in a humidity chamber. Following PBS washes, sections were incubated for 1 h at room temperature with a secondary antibody. Tissues were mounted and assessed for staining.
  • Antibodies used were against detyrosinated tubulin Millipore AB3201, p- 7/- // Invitrogen PA5-38647, alpha-tubulin Proteintech 66031-1-Ig, mouse Alexa Fluor 488 Invitrogen A21202, and rabbit Alexa flour 546 Invitrogen A10040. DAPI was used for nuclei counterstaining. Imaging:
  • Immunofluorescence staining was performed with a widefield microscopy using a Plan-Apochromatix 100* objective lens (oil immersion, numerical aperture [NA] 1.4), 20x and lOx objective lens on inverted Zeiss Axio Observer Z1 using AxioVision 4.8 software. Images were acquired using a monochrome Zeiss Axio Cam MRm CCD camera. Images were processed with the NIH Image J software.
  • Consent was given to obtain two skin punch biopsies of approximately 4 mm diameter. These were collected 10 cm proximal to the lateral malleolus on the distal leg as described previously (Engelstad et al., 2012, Neurology 79: 2187-2193). The biopsies were carried out under anesthesia following local injection of 2% lidocaine with epinephrine, using a sterile technique. In addition, three healthy volunteers of similar age and same gender (female) were recruited as controls. Volunteers serving as controls had no history of neuropathy, diabetes, or familial neuropathies. One skin biopsy was used for RNA sequencing (Azenta/Genewiz) whereas the other biopsy was used in other experiments as set forth herein.
  • RNA isolation and quality control were performed, and paired-end Illumina sequencing (HiSeq 2xl50bp) was conducted. Sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36. The trimmed reads were mapped to the Homo sapiens GRCh38 reference genome available on ENSEMBL using the STAR aligner v.2.5.2b.
  • the STAR aligner was a splice aligner that detects splice junctions and incorporates them to help align the entire read sequences. BAM fdes were generated through this step. Unique gene hit counts were calculated by using featureCounts from the Subread package v.1.5.2.
  • the hit counts were summarized and reported using the gene id feature in the annotation fde. Only unique reads that fell within exon regions were counted. If a strand- specific library preparation was performed, the reads were strand- specifically counted. After extraction of gene hit counts, the gene hit counts table was used for downstream differential expression analysis. Using DESeq2, a comparison of gene expression between the customer-defined groups of samples was performed. The Wald test was used to generate p-values and log2 fold changes. Genes with an adjusted p-value ⁇ 0.05 and absolute log2 fold change > 1 were called as differentially expressed genes for each comparison. Below are the results of the number of differentially expressed genes for all comparisons provided.
  • a gene ontology analysis was performed on the statistically set of genes by implementing the software GeneSCF v.1. l-p2.
  • the goa human GO list was used to cluster the set of genes based on their biological processes and determine their statistical significance.
  • a list of genes clustered based on their gene ontologies was generated.
  • Example 1 Paclitaxel treatment promoted microtubule detyrosination and fasciculation in epidermal keratinocytes [00094] It was first determined whether paclitaxel treatment of larval zebrafish stimulated microtubule stabilization. Stabilized microtubules undergo a modification whereby the terminal tyrosine residue was removed, leading to detyrosination (dMT) (Roll-Mecak et al., 2020, Developmental cell 54: 7-20), which was associated with particularly long-term stabilized microtubule populations (Khawaj a et al., 1988, The Journal of cell biology 106: 141-149). Exposure of the penultimate glutamate residue can be detected using a GluTub antibody.
  • dMT detyrosination
  • dMTs were visible in mesenchymal cells at 2 days post fertilization and could be distinguished by their elongate shape spanning multiple keratinocytes (as shown in FIG. 1A, FIG. IB, FIG. IE, and FIG. IF).
  • Paclitaxel (22pM) treatment promoted microtubule detyrosination in keratinocytes following long-term (96hr) but not short-term (3hr) treatment (normalized fluorescence intensity ratio: 3hr (2dpf), vehicle: 1.039 ⁇ 0.093 vs.
  • paclitaxel 1.197 ⁇ 0.053; 96hr (6dpf), vehicle: 1.203 ⁇ 0.115 vs.
  • paclitaxel 2.621 ⁇ 0.14
  • FIG. ID Intriguingly, dMTs became fasciculated in a subset of keratinocytes and looped around the cell periphery, most prominently in the distal caudal fin in which axon degeneration commences (Lisse et al., 2016, Proceedings of the National Academy of Sciences of the United States of America 113: E2189-2198) (as shown in FIG. IE and FIG. 1G).
  • dfMT Microtubule detyrosination, fasciculation, and looping
  • paclitaxel A low dose of paclitaxel (lOOnM) also promoted dfMT formation, but the overall number of affected keratinocytes per animal was lower compared with high dose experiments (lOOnM paclitaxel: 0.4 ⁇ 0.21 dfMT-positive keratinocytes/lOOpm 2 ) (as shown in FIG. 1 J), suggesting that the extent of dfMT formation was dose-dependent.
  • the fascicle width of dMTs was enhanced (lOOnM paclitaxel: 6.0 ⁇ 0.49
  • Example 2 Paclitaxel promoted X-ROS formation via altered microtubule mechanotransduction
  • ROS can be derived from two major sources within cells, mitochondria and membrane-bound NADPH oxidases.
  • Previously detected morphological changes in keratinocyte mitochondria following paclitaxel treatment (Cirrincione et aL, 2020, Set Rep 10, 3970) suggested that keratinocyte-specific mitochondrial reactive oxygen species (mitoROS) might be a source, supported by mitochondrial diseases having been linked to peripheral neuropathy (Cassereau et al., 2014, Revue neurography 170: 366-374; Flatters et al.. 2015, Biol Transl Sci.
  • H2O2 hydrogen peroxide
  • NADPH oxidases were therefore an alternative source for ROS.
  • the NADPH oxidase family consists of Noxl-5 and Duoxl/2, with Duox2 being species-dependent (Donko et a , 2005, Land B Biol Sci 360: 2301-2308) and Noxl-4 being activated by the subunit p22phox (Bedard et aL, 2007, Physiological reviews 87, 245-313; Ushio-Fukai et al., 1996, The Journal of biological chemistry 271 : 23317-23321).
  • Quantitative PCR was used initially in zebrafish to analyze expression of the two known epithelium-specific NADPH oxidases, noxl and duox, in addition to nox2, which was shown to be activated by mechanotransduction mechanisms in cardiomyocytes (Prosser et aL, 2011, Science 333: 1440-1445).
  • QPCR on whole larval zebrafish showed only noxl being upregulated following 48hr paclitaxel treatment (foldchange from vehicle control: duox: 1.63 ⁇ 0.23, noxl : 2.5 ⁇ 0.61, nox2: 1.35 ⁇ 0.12) (as shown in FIG. 2C).
  • HyPer imaging was performed. Dual channel imaging of oxidized and unoxidized HyPer in 5min intervals for 90 minutes pre- and post-stretch showed that HyPer oxidation in vehicle control fish was relatively sluggish, with a maximum increase at ⁇ 80min post-stretch (HyPer ratio (505/420) pre- vs. post-stretch (max): 1.62 vs. 1.97) (as shown in FIG. 2G). Paclitaxel-treated animals (3hr treatment), in contrast, showed rapid HyPer oxidation that peaked between 10-20min (HyPer ratio pre- vs.
  • Peripheral neuropathy was correlated with these times points using von Frey behavioral testing, which determined that peak neuropathy was present at day 7 (D7). Peripheral neuropathy was further determined by gene coexpression profiles (log2 fold-change: >0.65) (shown in FIG. 3C). This identified several biological categories during peak neuropathy with the largest clusters being implicated in extracellular matrix organization (e.g. "ECM”, “collagen-containing ECM”, “collagen trimer”) and cell cycle regulation (e.g. "outer kinetochore”, “kinesin complex”, condensed chromosome, centromeric region”, “mitotic spindle”, “microtubules”), consistent with our findings in zebrafish.
  • paclitaxel is a known cell cycle checkpoint regulator (Jia et al., 2016, Nature communications 7: 10818; Leonard etal., 2011, Current opinion in chemical biology 15: 88- 102)
  • expression of the known checkpoint regulators, Plkl, Cdc20, Ndc80, Bublc, Dlgap5 was further analyzed and showed a co-upregulation from D7 onward (shown in FIG. 3E).
  • Additional genes in the data set that were upregulated during peak neuropathy and formed a network included the mitosis regulating genes, including Cdkl, Aurka, Aurkb, and Kifll (shown in FIG. 3F).
  • Kifll which encodes Eg5 (also known as Kinesin-5), was especially informative because 1) members of the Kinesin family are implicated in microtubule regulation and cell cycle progression (Hirokawa et al., 2009, Nat Rev Mol Cell Biol 10: 682-696), 2) the implication of Eg5 in the regulation of cytokinesis via its microtubule crosslinking activity (Leary etal., 2019, Curr Biol 29: 3825-3837.
  • Nox family genes were further analyzed and showed that Cyba and Cybb, the latter being specific to immune cells, were upregulated at D23, whereas other genes, such as Noxl and Nox4 were slightly but not increased at varying days (shown in FIG. 3H).
  • RNAseq was conducted on three paclitaxel-treated breast cancer patients with CIPN and three age/sex-matched healthy controls. Upon enrolment, each participant completed a questionnaire and physical examination, followed by a full-thickness skin punch biopsy. The patients were diagnosed with CIPN 35 weeks (CIPN35), 31 weeks (CIPN31), and 5 weeks (CIPN05) prior to the biopsy. After RNA extraction and processing, Illumina RNAseq analysis was performed, followed by heatmap and PCA plot generation using iDEP (Ge et al., 2018, BMC Bioinformatics 19: 534).
  • NADPH oxidases identified N0X1 and CYBB as the most highly upregulated genes in the paclitaxel -treated patient skin compared with healthy controls (shown in FIG. 3L). Using the top 1,200 most variable differentially expressed genes, three major clusters were further identified with iDEP (shown in FIG. 3M). The first cluster showed pathways downregulated in the CIPN patients, which included processes, such as "epithelium/epidermis development 1 ', "keratinocyte differentiation”, “gluconeogenesis”, and "lipid catabolic processes”.
  • the second cluster (B) harbored genes upregulated in the 5-week CIPN patient skin, and these were involved in processes like "hydrogen peroxide catabolic process", “cell death”, and “response to hydrogen peroxide”.
  • Cluster C contained genes upregulated in the 31/35-week CIPN patients, with functions in "chromatin remodeling/assembly/disassembly”, “chromosome condensation”, “chromosome organization”, and "DNA conformation change".
  • Example 4 Kiflll S promoted dfMT and nuclear X-ROS formation in zebrafish [000102] Because Eg5 has been linked to bortezomib-induced peripheral neuropathy, subsequent analyses were focused on this cell cycle regulator, using primarily zebrafish due to their in vivo imaging capabilities. First, whether paclitaxel induced Eg5 expression in caudal fin keratinocytes was determined. Following 96hr vehicle treatment, Eg5 immunofluorescence staining with an antibody targeting the conserved phosphorylation site, Thr927 (PTGTTPQRK - SEQ ID NO: 24), revealed a uniform punctate Eg5 localization in the caudal fin except around the fin edge (shown in FIG. 4A).
  • EMD534085 0 ⁇ 0 vs. lOOnM paclitaxel: 0.4 ⁇ 0.21 vs. lOOnM paclitaxel+EMD534085: 0.8 ⁇ 0.38 vs. 22pM paclitaxel: 6.957+1.49 vs. 22pM paclitaxel+EMD534085: 0.52 ⁇ 0.36 cells/animal) (shown in FIG. 4D).
  • kifll was transiently deleted by injecting CRISPR oligos into 1-cell stage embryos. These were directed to exon 5 ( ⁇ 90aa of 1072aa), which eliminated Eg5 protein expression (shown in FIG. 4E) (percent animals with dfMTs: CRISPR+vehicle: 0%; CRISPR+22pM paclitaxel: 25%; number of keratinocytes per animal with dfMTs: CRISPR+vehicle: 0+0; CRISPR+22pM paclitaxel: 0.29+0.16) (shown in FIG. 4B- D).
  • transient kifll CRISPR knockout also reduced microtubule detyrosination when comparing 96hr vehicle and paclitaxel treated animals, suggesting a role for Eg5 in detyrosination, which was not modified when animals were treated with EMD534085 (normalized detyrosination fluorescence intensity: vehicle: 1.2+0.11 vs. CRISPR+vehicle: 1.12+0.2; 22pM paclitaxel: 2.62+0.14 vs. CRISPR+paclitaxel: 0.85+0.11) (shown in FIG. 4F).
  • EMD534085 did not affect paclitaxel-induced Noxl plasma membrane translocation (Membrane:cytoplasmic ratio: vehicle: 1.78+0.09 vs. EMD534085: 1.7+0.1 vs. paclitaxel: 2.35 ⁇ 0.17 vs.
  • dfMTs should be in close proximity to the nucleus in order to activate Noxl by mechanotransduction.
  • high resolution imaging and 3D rendering of keratinocyte dfMTs and nuclei were used.
  • 96hr paclitaxel treatment led to a partial association between dfMTs and nuclei (shown in FIG. 5A) whereby the nuclear content was sometimes pinched off or nuclei were perforated by dfMTs (shown in FIG. 5B).
  • dfMTs were typically associated with enlarged nuclei (vehicle nuclear volume: 291.3 ⁇ 30.62pm3 vs.
  • dfMTs formed a physical barrier that impairs nuclear function.
  • Example 6 EMD534085 promoted keratinocyte mitosis and cell death in the presence of paclitaxel
  • Combination treatment with 22pM paclitaxel and EMD534085 increased the percentage of animals with at least 1 cell division to 88% (shown in FIG. 6B). Mitotic divisions per animal were also increased with EMD534085 and 22pM paclitaxel in combination, possibly due to reduced fasciculation leading to less impaired nuclei to divide (96hr, vehicle: 1.07 ⁇ 0.3 vs. lOOnM paclitaxel: 0.72 ⁇ 0.423 vs. 22 pM paclitaxel: 1.4 ⁇ 0.67 vs. EMD534085: 1.27 ⁇ 0.46/12hr vs. lOOnM paclitaxel+EM534085: 1.55 ⁇ 0.62/12hr vs. 22pM paclitaxel+EMD534085: 3.125 ⁇ 1.18) (shown in FIG. 6C).
  • Example 7 Eg5 did not influence microtubule growth behavior
  • microtubule stabilization indicative of microtubule stabilization.
  • microtubules with uniform EB3-GFP binding appeared linear and continuous treatment for 48hr and 96hr with paclitaxel further enhanced the linearity (shown in FIG. 7C). This behavior therefore contrasts the curved conformation of stable dfMTs.
  • Further analysis of microtubule growth dynamics showed that 3hr paclitaxel treatment decreased the growth velocity and track length of microtubules, whereas comet duration per se was not affected (shown in FIG. 7D-7H).
  • Combination treatment of EMD534085 and 22pM paclitaxel did not alter the effects induced by paclitaxel alone, suggesting that Eg5 does not influence paclitaxel-dependent microtubule growth dynamics.
  • microtubule stabilization per se leads to curved microtubules, or whether this was a specific property pertaining to paclitaxel
  • microtubules in keratinocytes of zebrafish injected with CMV:Tau-Bfp2 were analyzed.
  • This microtubule- associated protein has been shown to induce microtubule stabilization by binding to the interface between a and p-tubulin heterodimers (Kadavath et al., 2015, Proceedings of the National Academy of Sciences of the United States of America 112: 7501-7506; Ross el al., 2004, Proceedings of the National Academy of Sciences of the United States of America 101 : 12910- 12915).
  • Treatment with 22pM paclitaxel for 96hr further increased Tau-Bfp2 and EB3-GFP co-localization regardless of weak or strong Tau-Bfp2 expression (EB3- GFP puncta co-localized with Tau-Bfp2, weak Tau-Bfp2 expression: 85.42 ⁇ 1.64% of, strong Tau-Bfp2 expression: 86.13 ⁇ 1.22%, Tau-Bfp2+96hr paclitaxel: 91.26 ⁇ 1.64%).
  • Example 8 Keratinocyte-specific Eg5 overexpression promoted cutaneous sensory axon degeneration
  • axon degeneration in zebrafish that were treated for 96hr with low (lOOnM) and high (22pM) paclitaxel concentrations in the presence and absence of EMD534085 was assessed.
  • Treatment with vehicle, EMD534085 and lOOnM paclitaxel did not alter axon branch number assessed with acetylated tubulin staining.
  • Eg5-dependent axon degeneration was caused by keratinocyte or neuron-specific effects (because inter alia Eg5 was also expressed neuronally (Falnikar et al., 2011, Mol Biol Cell 22: 1561-1574; Wei et al., 2022, Neurotherapeutics 19: 1401-1413) was determined as set forth herein. Possible neuron-intrinsic axon growth effects with EMD534085 were observed. Initially the extent to which axonal microtubules were stabilized was determined and whether this process was altered using EMD534085 in the presence and absence of paclitaxel.
  • paclitaxel does not appear to regulate dMT formation via Eg5 in axons.
  • Transient plasmid DNA injections into zebrafish typically mosaically label cells, which allowed for the observation of axons in the absence and presence of Eg5-overexpressing keratinocytes.
  • wildtype axons in animals with few Eg5-GFP positive ( ⁇ 10) keratinocytes remained intact (shown in FIG. 9F, top panel)
  • axons in contact with large areas of Eg5 overexpressing keratinocytes (>20) degenerated shown in FIG. 9F, bottom panel
  • FIG. 9G, and FIG. 9H keratinocyte-specific Eg5 overexpression mimicked paclitaxel-induced sensory axon degeneration.
  • Example 9 Paclitaxel induced dfMT and brittle skin in keratinocytes of mice, which was rescued by Eg5 inhibitor
  • mice 12- week old C57BL6/J mice were intraperitoneally injected with vehicle (0.5% DMSO//lxPBS), paclitaxel (24mg/kg; one injection), and the EG5 inhibitor, EMD534085 (20mg/kg; 3 injections: 1 before, during, and after paclitaxel), as indicated in the schematic of FIG. 11 A.
  • mice were then sacrificed and the skin of the hind paw pad was fixed in 4% paraformaldehyde, followed by sectioning and staining with 1) anti-GluTub (to detect detyrosinated microtubules) and 2) DAPI to detect nuclei.
  • paclitaxel treatment increased GluTub fluorescence, indicating increased dfMT.
  • the thick white arrows in the paclitaxel image showed brittle skin in the stratum spinosum. While these cells lost their nucleus, these dark spots (empty regions) were not present in animals injected with vehicle or paclitaxel +EMD, suggesting a rescue effect.
  • the white arrows point to cells that have increased detyrosination which was seen around the nucleus (high mag Paclitaxel image - FIG. 11B).
  • the white arrows in the Pcxt+EMD image showed dMT; however, the high magnification image and DAPI image demonstrated that these cells were not associated with nuclei and seemed to be either dead cells or another cell type (not keratinocytes).
  • the number of epidermal keratinocytes with dMT was quantified in FIG. 11C, which showed an increase with paclitaxel treatment. The increase was dampened when paclitaxel was injected with EMD534085.
  • TTAGGGAAC SEQ ID NO: 26

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

This disclosure provides methods and pharmaceutical compositions for preventing or treating chemotherapy-induced peripheral neuropathy (CIPN) in a subject undergoing a chemotherapeutic treatment.

Description

METHODS AND PHARMACEUTICAL COMPOSITIONS FOR TREATING CHEMOTHERAPY-INDUCED PERIPHERAL NEUROPATHY WITH EG5 INHIBITORS
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0001] This invention was made with government support under 1R01CA215973-05 awarded by the National Institutes of Health. The government has certain rights in the invention.
CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to U.S. provisional application number 63/503,154, filed May 18, 2023, the disclosure of which is expressly incorporated by reference herein.
REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing that has been submitted electronically and is hereby incorporated by reference in its entirety. The Sequence Listing was created on May 17, 2024, is named “23-0726-WO_SequenceListing.xml”, and is 104,608 bytes in size.
BACKGROUND OF THE DISCLOSURE
[0004] A wide variety of chemotherapeutic agents, including paclitaxel (Brand name Taxol), cause sensory-dominant peripheral neuropathy (Argyriou etal., 2010, J BU ON 15: 435-446; Beijers et al., 2012, Neth J Med 70: 18-25; Argyriou et al., 2012, Crit Rev Oncol Hematol 82: 51-77; Gomstein et al., 2014, Neuropharmacology 76 Pt A: 175-183; Boyette-Davis etal., 2015, Pain Manag 5: 285-296; Flatters et al., 2017 , Br J Anaesth 119: 737-749; Argyriou et al., 2017, Nat Rev Neurol 13: 492-504; Argyriou et al., 2019, Journal of neurology, neurosurgery, and psychiatry 90: 1361-1369). Studies have shown that the earliest signs of degeneration are detected in an unmyelinated sensory neuron population that innervates the epidermis (Bennett et al., 2011, Eur J Neurosci 33 : 1667-1676). Symptoms range from pain and tingling to temperature sensitivity and numbness originating in the hands and feet and progressing proximally (Staff et al., 2020, Experimental neurology 324: 11312). One in every two chemotherapy patients suffers from chemotherapy-induced peripheral neuropathy (CIPN), and one in every three patients requires a dose reduction or discontinuation of this life-saving treatment (Seretny et al., 2014, Pain 155: 2461-2470), therefore decreasing the chance of survival. There are currently no treatments to prevent or reverse CIPN, mostly due to the lack of understanding about the molecular mechanisms of CIPN.
[0005] Recent research on the effects of chemotherapeutic drug-induced peripheral neuropathy has focused particularly on paclitaxel-induced damage of healthy cells. Putative mechanisms for paclitaxel neurotoxicity have been suggested based on rodent in vitro and in vivo studies (Staff et al., 2020, Id), including reduced local mRNA translation due to decreased axonal microtubule transport and changes in mitochondrial functions (Pease-Raissi etal., 2017, Neuron 96: 373-386 e376; Bobylev et al., 2015, Neurobiol Dis 82: 321-33), leading to the deregulation of intracellular calcium dynamics and neuropeptide release in sensory neurons (Li et al., 2015, J Neurosci 35: 13487-1350). Also the induction of inflammatory cascades in rat dorsal root ganglion neurons following paclitaxel treatment involving chemokines, such as CXCL1/8/ MCP- l/CCL-2 and their cognate receptors has been described (Brandolini et al., 2017, Oncotarget 8: 23188-23201). Studies in zebrafish further demonstrate that paclitaxel damages epidermal keratinocytes prior to promoting cutaneous sensory axon degeneration (Lisse et al., 2016, Proc. Natl. Acad. Sci. USA 113: E2189-2198). It was also demonstrated that paclitaxel treatment stimulated the formation of reactive oxygen species (ROS) in epidermal keratinocytes, which induced Matrix-Metalloproteinase 13 (MMP-13, collagenase-3) expression, resulting in extracellular matrix (ECM) degradation and axon degeneration (Lisse et al., 2016, Id„ Cirrincione et al., 2020, Sci Rep 10: 3970). In addition, pharmacological inhibition of MMP-13 in zebrafish, rats, and mice rescued paclitaxel neurotoxicity and restored epidermal integrity. Studies in Drosophila and mice subsequently demonstrated that overexpression of the collagen- binding P-integrin 1 (ITGB1) in sensory neurons rescued paclitaxel neurotoxicity (Shin et al., 2021, Proc. Natl. Acad. Sci. USA 118: e2006050118). This is consistent with epidermal collagen degradation and neuronal downregulation of integrin receptors in a ROS-dependent manner resulting from paclitaxel induced MMP13 expression. This in turn promoted axonal detachment from the ECM and axon degeneration. However, the mechanisms upstream of MMP13 that are responsible for triggering CIPN remain unknown. There is thus a need in the art for a greater understanding of CIPN and methods and pharmaceutical compositions for treating this disorder.
SUMMARY [0006] The disclosure provides compositions associated with inhibition of paclitaxel induced ROS formation in epidermal keratinocytes upstream of MMP-13. Methods for using these compounds are also disclosed.
[0007] Disclosed herein in a first aspect is a method of preventing or treating chemotherapy- induced peripheral neuropathy (CIPN) in a subject undergoing a chemotherapeutic treatment, the method comprising: administering to the subject a therapeutic agent capable of inhibiting kinesin-5 (Eg5) function or expression.
[0008] In one embodiment of the method the therapeutic agent is an Eg5 inhibitor. In some embodiments, the Eg5 inhibitor is monastrol, ispinesib, (+)-S-trityle-L-cysteine (TriC), BRD9876, filanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB-743921, MK0731, 4SC-205, ARQ 621, or EMD534085. In one embodiment, the Eg5 inhibitor is EMD534085. In some embodiments, the therapeutic agent is administered before, during, and after administration of the chemotherapeutic treatment.
[0009] In a further embodiment of the method the therapeutic agent inhibits expression of kifl 1 gene encoding EG5. More particularly, the therapeutic agent is a CRISPR-Cas9 complex comprising a single guide RNA specific for kifll gene.
[00010] In another embodiment the chemotherapeutic treatment is paclitaxel, docetaxel, cabazitaxel, TPL287, and albumin paclitaxel, or a combination thereof. The therapeutic agent can be delivered via intravenous administration or topical administration.
[00011] In a further embodiment, the therapeutic agent is capable of preventing or reducing degeneration of neurons innervating epidermal keratinocytes.
[00012] In another embodiment the chemotherapeutic treatment includes a chemotherapeutic agent capable of stabilizing microtubules in keratinocytes.
[00013] In a second aspect is a pharmaceutical composition comprising a therapeutic agent capable of inhibiting Eg5 function or expression, a chemotherapeutic agent capable of stabilizing microtubule in keratinocytes, and a pharmaceutically acceptable carrier. The pharmaceutical composition can contain the therapeutic agent which is an Eg5 inhibitor.
[00014] In another embodiment the pharmaceutical composition contains an Eg5 inhibitor that is monastrol, ispinesib, (+)-S-trityle-L-cysteine (TriC), BRD9876, fdanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB-743921, MK0731, 4SC-205, ARQ 621, or EMD534085.. In another embodiment of the pharmaceutical composition the therapeutic agent inhibits expression of kifl 1 gene encoding Eg5. The therapeutic agent in certain embodiments is a CRISPR-Cas9 complex comprising a single guide RNA specific for kifll gene.
[00015] In other embodiments of the pharmaceutical compositions disclosed herein the chemotherapeutic agent is paclitaxel, docetaxel, cabazitaxel, TPI-287, or albumin paclitaxel, or a combination thereof, wherein the pharmaceutical composition is delivered via intravenous administration or topical administration to a patient to prevent CIPN.
[00016] In a further embodiment the pharmaceutical composition is capable of preventing or reducing degeneration of neurons innervating epidermal keratinocytes.
[00017] In a further embodiment the pharmaceutical composition is used to prevent chemotherapy-induced peripheral neuropathy (CIPN) by administering a therapeutically effecting amount thereof to a patient undergoing chemotherapeutic treatment with an agent that promotes degeneration of neurons innervating the skin.
[00018] These and other features, objects, and advantages of this invention will become better understood from the description that follows. In the description, reference was made to the accompanying drawings, which form a part hereof and in which there was shown by way of illustration, not limitation, embodiments of the invention. The description of preferred embodiments was not intended to limit the invention to cover all modifications, equivalents, and alternatives. Reference should therefore be made to the claims recited herein for interpreting the scope of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[00019] The disclosure will be better understood and features, aspects, and advantages other than those set forth above will become apparent when consideration was given to the following detailed description thereof. Such detailed description refers to the following drawings. [00020] FIG. 1A through FIG. IL are images and analysis of detyrosination and fasciculation of microtubules following paclitaxel treatment. FIG. 1A is a transmission electron microscopy image of a larval zebrafish caudal fin at 6 days post fertilization (dpf) showing an infolded epidermis and a single keratinocyte wrapping around the distal caudal fin edge (green). Mesenchymal cells are located medially between the infolded epidermis. FIG. IB is a schematic of the caudal fin shown in FIG. 1A depicting the cell types that are present. Two contralateral sensory neurons (red and blue) are shown that innervate the epidermis and arborize between the periderm and basal keratinocyte layer. FIG. 1C is a schematic of the experimental design for anti-detyrosinated tubulin antibody (GluTub) staining of detyrosinated (stabilized) microtubules (dMTs) shown in FIG. 1D-1F. FIG. ID is the normalized intensity ratio of GluTub stained microtubules in the caudal fin (see region of interest, ROI, arrowhead; left panel) which demonstrated increased detyrosination following 96hr, but not 3hr, of paclitaxel treatment compared with vehicle (0.05% DMSO) controls (right panel). GluTub staining was normalized to Hoechst33342 nuclear stain within each fin. FIG. IE is enhanced GluTub labelling in linear mesenchymal cells at 2dpf following 3hr vehicle treatment (left column), which was absent in mesenchymal cells in the presence of paclitaxel (right column) but instead cutaneous sensory axons (dotted linear structures) were labelled. Diffuse dMT staining was present in the caudal fin following 96hr vehicle treatment, whereas 96hr paclitaxel treatment showed fasciculated dMTs (dfMTs) in keratinocytes (thin arrows). FIG. IF is GluTub staining in a 2dpf zebrafish embryo. Mesenchymal cells (thin arrows) were strongly labeled in both 3hr vehicle (0.05% DMSO; top row left image) and paclitaxel treated fish (top row right image). Axonal dMTs were evident following paclitaxel treatment (thick arrows) but rarely present in vehicle controls at 3 hours. Keratinocyte plasma membranes were visualized with tp63:GFP-CAAX (green) demonstrating mesenchymal cell microtubules span multiple keratinocyte cell diameters. FIG. 1G demonstrates that at 6dpf, dMTs were present in mesenchymal cells and axons of vehicle-treated fish. Following 96hr paclitaxel treatment (right panel), dMTs were fasciculated in individual keratinocytes in the caudal fin (thin arrow - top arrow of the right image) and most prominently at the fin edge (oval dotted line). Cutaneous axons (thick arrows in left panel - control, and bottom left of the right panel - paclitaxel) displayed a weak punctate detyrosination pattern in the control animal, which was more prominent following paclitaxel treatment. FIG. 1H are polar plots depicting orientation and shape of dMTs in the caudal fin (180°=proximal; 0°= distal fin) (n=4 animals/plot). FIG. II demonstrates increased percent animals with dfMTs after 48 and 96hr paclitaxel but not vehicle treatment (n>15 animals/group). FIG. 1J demonstrates increased caudal fin keratinocytes per 100pm2 with dfMTs following 22pM paclitaxel treatment, while few keratinocytes harbor dfMTs when animals were treated with lOOnM paclitaxel (n>17 animals/group). Quantification of the fasciculation width of dfMTs in FIG. IK demonstrates an increase in animals treated with lOOnM paclitaxel for 96hr compared with 22pM paclitaxel treatment (n=5 animals/group). FIG. IL demonstrates a single injection of 20mg/kg paclitaxel into mice at 5 weeks caused dfMT and rosette formation 48hr after the injection, assessed with alpha-tubulin staining. dfMT formation is evident in the suprabasal epidermis.
[00021] FIG. 2A through FIG. 21 demonstrate mechanotransduction activation of Noxl upstream of MMP-13 and cutaneous axon degeneration. FIG. 2A shows that keratinocyte mitochondria showed subtle changes in the reactive oxygen species (H2O2) following paclitaxel treatment. Mitochondria in basal keratinocytes were labelled with tp63 :HyPer-mito to detect H2O2 dependent oxidation of HyPer with ratiometric imaging. Unoxidized hydrogen peroxide sensor (HyPer) was detected when HyPer is excited at 420nm. Oxidized HyPer was detected when excited at 505nm. Quantification of oxidized:unoxidized HyPer ratios showed that oxidation was not different when comparing 3hr and 48hr vehicle versus 22pM paclitaxel treatment. FIG. 2B is a summary of HyPer-mito ratio at 3hr and 48 hour of vehicle versus paclitaxel treatment. FIG. 2C are quantitative PCR (qPCR) results showing increased Noxl expression in 4dpf zebrafish following 48hr paclitaxel treatment (i.e. axon degeneration onset) (n=3 biological replicates with 10 animals per replicate). FIG. 2D demonstrates that Noxl was distributed in the cytoplasm and nucleus of caudal fin keratinocytes when fish were treated with vehicle (0.05% DMSO) and translocated to the plasma membrane and clusters in the nucleus following prolonged paclitaxel treatment. Membrane:cytoplasmic ratio of Noxl staining (left, lower panel) increased upon continued paclitaxel treatment (n>6 animal s/group), similar to the nuclear: cytoplasmic ratio (n>9 animals/group) (right, lower panel). FIG. 2E showing Tg(//?63:GFP-CAAX) transgenic animals with fluorescently labelled basal keratinocyte plasma membranes used to measure keratinocyte length and width by comparing medial and edge (dash line) keratinocytes. Quantifications were performed before and after zebrafish stretch on the stretcher, which revealed that fin edge keratinocytes increased in length but not in width whereas no effect was seen for medial keratinocytes. FIG. 2F demonstrates immunofluorescence staining for alpha tubulin, showing microtubule stretching along the fin edge in wildtype (left 2 panels) and homozygous cyba-/- fish (right 2 panels) treated for 48 hours with vehicle. Microtubule stretching at the fin edge was less evident following paclitaxel treatment (white arrows - top panels vehicle treatment, versus yellow arrows - bottom panels paclitaxel treatment). FIG. 2G shows ratiometric HyPer imaging and summary oxidation data from 5min pre-stretch to 90min post-stretch in wildtype and cyba-/- mutants treated with vehicle or paclitaxel illustrated by the top-most panel. Paclitaxel treatment resulted in faster activation of H2O2 production in wildtype animals (right upper graph) compared with vehicle-treated controls (left upper graph), whereas HyPer oxidation was largely reduced or absent in vehicle (left lower graph) and paclitaxel- treated cyba-/- mutants (right lower graph), respectively (n=5 animals/group). FIG. 2H shows that prolonged paclitaxel, but not vehicle, treatment reduced the number of axon branches in the caudal fin of wildtype but not cyba-/- fish (n=6-9 animals/group). Stretch was associated with axon degeneration in wildtype fish treated with paclitaxel, but not cyba-/- fish. FIG. 21 is qPCR data showing enhanced mmpl3a (MMP13 homolog) expression in wildtype fish treated with paclitaxel, but not in cyba-/- mutants (n=10-20 animals/group in 3 biological replicates).
[00022] FIG. 3A through FIG. 3M show that paclitaxel treatment induces cell cycle genes in the skin of mice and patients with CIPN. FIG. 3A shows a treatment scheme for mouse RNAseq analysis (n=4 animals per group). FIG. 3B is a heatmap showing up (red) and down (blue) regulated genes. FIG. 3C is gProfiler analysis at peak neuropathy day 7 (D7) revealing Gene Ontology (GO) terms for extracellular matrix and collagen-related processes, and cell cycle regulation. FIG. 3D is STRING interactome analysis of genes in FIG. 3C identifying a major cluster for cell cycle genes (magenta, blue), and proteins involved in disulfide bond formation (yellow). FIG. 3E is validation of mouse RNAseq data confirming the upregulation of spindle checkpoint regulators (Plklm Cdc20, Ndc80, Bubl, Dlgap5) following paclitaxel treatment relative to vehicle controls, with the highest expression increase at D7 during peak neuropathy. FIG. 3F shows that STRING interactome analysis predicted the interactions of these genes with Kifll and other mitotic genes. FIG. 3G are normalized gene counts for upregulated Kif genes following paclitaxel treatment (shown are days 4, 7, 11, and 23 of treatment). FIG. 3H are normalized gene counts for Nox genes and their regulators detected in the skin (shown are days 4, 7, 11, and 23 of treatment). FIG. 31 through FIG. 3K show RNAseq using human lower leg skin from 3 CIPN patients (CIPN5, 31, 35 weeks) and 3 control subjects (CTRL 1-3). FIG. 31 is a heatmap and PCA plot revealing the separation of CIPN patients from the controls. FIG. 3J shows relative gene expression of upregulated KIF genes (left to right: KIF11, KIF 12, KIF13B, KIF 17, KIF1C, K1F26A). FIG. 3L shows that NOXI was most strongly induced and showed great variability together with NOX4 and CYBB. FIG. 3K shows STRING network analysis which revealed KIF11 as a central hub for co-upregulated KIF genes. FIG. 3M is iDEP.96 analysis of the 1200 most variable differentially expressed genes showing three distinct clusters. The first cluster (A, blue) harbours genes that are downregulated in the CIPN patients. Cluster B (yellow) harbours genes that are upregulated in the patient diagnosed with CIPN 5 weeks prior. Cluster C (purple) harbours genes that are upregulated in the patients diagnosed with CIPN 35 and 31 weeks prior).
[00023] FIG. 4A through FIG. 4J demonstrate that paclitaxel induces Eg5 expression and Eg5-dependent dfMT and nuclear X-ROS formation. FIG. 4A is Eg5 immunofluorescence staining showing punctate staining in proximal caudal fin keratinocytes of vehicle treated animals. Staining along the fin edge (white dashed line) is absent. Paclitaxel treatment promoted Eg5 activation in the proximal fin (white arrows) and in fin edge keratinocytes leading to asterlike formations (white dashed line, thick white arrow - bottom arrow of bottom right panel). FIG. 4B shows that EMD534085 co-admini strati on with lOOnM and 22pM paclitaxel rescued microtubule fasciculation but not detyrosination. NM=lateral line neuromast. /7 /CRISPR knockout prevented detyrosination and fasciculation of MTs. FIG. 4C shows percentage of animals with dfMTs/keratinocyte was reduced when paclitaxel is administered in combination with EMD534085 or in kifll CRISPR knockout fish (n>23 animals/group). FIG. 4D shows that EMD534085 treatment or kifll CRISPR knockout in presence of paclitaxel reduced the number of keratinocytes with dfMTs per animal compared with paclitaxel alone (n>21 animals per group). FIG. 4E shows zebrafish kifll CRISPR knockout without Eg5 induction in caudal fin following paclitaxel treatment. Vehicle (top) and paclitaxel (bottom) treatment for 96 hours did not induce Eg5 expression detected with an Eg5 specific antibody using immunofluorescence staining. FIG. 4F shows normalized intensity ratios of GluTub suggest that kifl 1 CRISPR knockout rescued microtubule detyrosination induced by paclitaxel. FIG. 4G shows that paclitaxel induced total and phospho-Eg5 in mouse suprabasal keratinocytes. Mice were i.p. injected once with either 0.9% NaCl (vehicle) or 30mg/kg paclitaxel, followed by fixation 48 hours post injection. Alpha-tubulin antibody staining was used as counterstain. DAPI was used to depict nuclei. Top panel: Weak Eg5 expression in the vehicle control epidermis (left) but strong induction of Eg5 following paclitaxel treatment (right). Lower panel: Eg5 phosphorylation was absent in the skin following vehicle injection (left). Paclitaxel injection induced Eg5 phosphorylation in basal and suprabasal keratinocytes. Ep: Epidermis; hpi: hours post injection. FIG. 4H and FIG. 41 show that Noxl nuclear but not plasma membrane translocation induced by 96hr paclitaxel treatment was rescued with EMD534085 co-administration. FIG. 4J shows that nuclear HyPer oxidation induced by paclitaxel treatment was rescued with EMD534085 coadministration.
[00024] FIG. 5A through FIG. 5D show detyrosinated fasciculated microtubules associate with nuclei. FIG. 5A shows that dfMTs detected with anti-GluTub staining associate with a keratinocyte nucleus labelled with Hoechst33342 (left image). 3D reconstruction of the same image using Imaris (right image). FIG. 5B shows that 3D-rendered dfMTs pinch off nuclear content (left and right, thin arrow) and perforated the nucleus (right, thick arrows). FIG. 5C shows nuclear volume of keratinocytes following 96 hours of 22pM paclitaxel treatment. The nuclear volume of keratinocytes with dfMTs appearance was significantly larger than the nuclear volume of keratinocytes with wildtype appearance (n>5 animals/group). FIG. 5D shows decreased nuclear sphericity of keratinocytes with dfMTs appearance (n>5 animals/group). DFL- MT: detyrosinated fasciculated looped microtubule.
[00025] FIG. 6A through FIG. 6F demonstrate that dfMTs modulate mitosis but not apoptosis. FIG. 6A shows keratinocyte divisions at 3 and 6dpf (96hr treatment) assessed by time-lapse imaging in caudal fins of Tg(h2a:h2a-GFP) fish (n=28 at 3dpf; n=12 at 6dpf). FIG. 6B is percent animals without and >1 mitotic divisions/12hr (n>9 animals/group). FIG. 6C shows that EMD534085 combination with 22pM paclitaxel increased cell divisions/animal compared with paclitaxel treatment (n>8 animals/group). FIG. 6D shows that 96hr treatment with EMD534085 and 22pM paclitaxel increased cell death (n>8 animals/group). FIG. 6E is time-lapse imaging of keratinocyte cell death in caudal fin. Caudal fin keratinocyte nuclei were visualized in a Tg(h2a:h2a-GFP) zebrafish caudal fin at 6dpf. The fish was treated with paclitaxel+EMD534085 for 96hr. The intact keratinocyte nucleus (top, arrow) condenses within 15 minutes (middle, arrow) and subsequently fragments (bottom, arrow), indicative of cell death. Right panels show higher magnification images. FIG. 6F is a model for Eg5-dependent dfMT formation and downstream events: paclitaxel activated Eg5 as part of the cell cycle checkpoint, however, independent of mitosis in interphase keratinocytes leading to crosslinking and fasciculation of long-term stabilized, detyrosinated microtubules. dfMTs constrained the nucleus and promoted Noxl nuclear accumulation and X-ROS formation upstream of mmpl3 induction.
[00026] FIG. 7A through FIG. 7H demonstrate that paclitaxel modulated microtubule growth dynamics in keratinocytes independent of Eg5. Microtubule growth dynamics were captured and quantified in caudal fin keratinocytes expressing tp63:EB3-GFP. FIG. 7A and FIG. 7B show keratinocytes with uniform EB3-GFP localization along the microtubule lattice. Paclitaxel treatment increased the number of keratinocytes with uniform EB3-GFP labelling (n=5 animals). FIG. 7C shows increased straightness of microtubule growth tracks following 48 and 96hr paclitaxel treatment (l=straight, 0=curved). FIG. 7D are kymographs of growing microtubules generated with MTrackJ shows more rapid depolymerization in the presence of paclitaxel, consistent with quantifications in FIG.7F. FIG. 7E shows that decreased comet velocity following 3hr paclitaxel treatment was not rescued by co-admini strati on of EMD534085 (n>8 animals/group). FIG. 7F shows that decreased track length upon 3hr paclitaxel treatment was not rescued by co-administration of EMD534085 (n>8 animals/group). FIG. 7G shows that comet duration was not changed for any of the treatments (n>8 animals/group). FIG. 7H shows microtubule average growth distance in pm over 50 seconds in epidermal keratinocytes in the caudal fin of 6dpf larval zebrafish treated for 96hr either with vehicle, EMD534085, 22pm paclitaxel, or 22pM paclitaxel in combination with EMD534085.
[00027] FIG. 8A through FIG. 8H show microtubule behavior in genetically stabilized microtubules. FIG. 8A shows microtubule network in CMV-Tau-Bfp2 expressing keratinocytes following 96hr vehicle treatment. Polar plot shows tracings to outline microtubule conformations (n=5 animals/ plot). FIG. 8B shows that 96hr paclitaxel treatment induced linearization of Tau- Bfp2-stabilized microtubules. The polar plot validates increased linearity (n>4 animals/ plot). FIG. 8C demonstrates that microtubule track straightness in keratinocytes expressing Tau-Bfp2 with and without 96hr paclitaxel treatment showed enhanced linearization in the presence of paclitaxel: Straightness (1= straight, Ocurved) (n>5 animals/group). FIG. 8D is 3D reconstruction of EB3-GFP plus-ends in a keratinocyte following 96hr paclitaxel treatment. FIG. 8E shows more than 80% of EB3-GFP plus-ends colocalized with Tau-Bfp2 regardless of low or high Tau expression. Paclitaxel treatment for 96hr further increased co-localization (n>5 animals/group). FIG. 8F shows that paclitaxel treatment for 96hr increased EB3-GFP velocity in the presence of Tau-Bfp2. FIG. 8G and FIG. 8H demonstrates that colocalized EB3-GFP and Tau-Bfp2 microtubules (arrow) showed overlapping growth tracks when traced along curvatures.
[00028] FIG. 9A through FIG. 91 show that Eg5 inhibition rescued and keratinocyte- specific overexpression induced paclitaxel neurotoxicity. FIG. 9A shows degeneration of cutaneous axons detected with anti-acetylated tubulin antibody staining following 96hr treatment with 22pM paclitaxel, but not when treated with lOOnM paclitaxel or 22pM paclitaxel+EMD534085 (n>l 1 animals/group). FIG. 9B is quantification showing an increased axon branch number for paclitaxel+EMD534085, whereas kifll CRISPR knockout rescues axon branch number to wildtype levels (n=6 animals/group). FIG. 9C shows that paclitaxel induced axonal detyrosination and keratinocytes acetylation. Increased axonal dMT formation (thin white arrows) and keratinocyte-specific microtubule acetylation at lysine position 40 (K40) (thick arrows) were produced following 22pM paclitaxel treatment for 96 hours with and without EMD534085. FIG. 9D is quantification of normalized acetylation intensity showing an increase in keratinocyte microtubule acetylation after 96hr paclitaxel treatment with and without EMD534085. FIG. 9E shows increased axonal dMTs along axon segments in distal caudal fin seen with 22pM paclitaxel compared to EMD534085 (n=5-7 animals/group). FIG. 9F top panel: Co-expression of isll :Gal4VP16_14xUAS-tdTomato (magenta) in axons and tp63:A7/ 7-AcGFP (blue) in few keratinocytes that were not in contact with cutaneous branches did not promote axon degeneration. Bottom panel: Axon degeneration was prominent when tp63:/q/7/-AcGFP expressing basal keratinocytes were abundant and established contact with cutaneous branches. FIG. 9G is magnification of FIG. 9F showing nuclear Eg5 and weaker cytoplasmic localization in 6dpf zebrafish expressing tp63:£z/77-AcGFP. FIG. 9H is quantification of axon degeneration showing that low presence of keratinocytes expressing kifl 7-AcGFP was insufficient to induce axon degeneration. FIG. 91 is a model showing paclitaxel-dependent Eg5 induction leading to dfMT formation and Noxl -dependent mmpl3 expression in keratinocytes, which promoted ECM degradation and axon degeneration.
[00029] FIG. 10 is a depiction of the forward primer used for sequencing a single zebrafish and yielded deletions in transiently injected embryos in experiments involving CRISPR.
[00030] FIG. 11A through FIG. 11C show that EMD534085 reduced detyrosinated microtubules (dMT) caused by paclitaxel treatment. FIG. 11A shows the treatment plan for 12 week-old mice receiving intraperitoneal injections of vehicle (0.5% DMSO//lxPBS), paclitaxel (24mg/kg; one injection), or paclitaxel plus EG5 inhibitor, EMD534085 (20mg/kg; 3 injections: 1 before, during, and after paclitaxel). The mice were then sacrificed 24 hours after the last injection and the skin of the hind paw pad was collected. FIG. 11B show images of collected skin tissues stained with anti-GluTub (to detect detyrosinated microtubules) and DAPI to detect nuclei. The arrows in the circle point to brittle skin in the stratum spinosum. The other arrows point to cells that have increased detyrosination. FIG. 11C is the quantification of number of cells with dMT per 250 pm2 area with each treatment.
DETAILED DESCRIPTION OF THE DISCLOSURE
[00031] Provided herein are compositions and methods for the treatment of chemotherapy- induced peripheral neuropathy (CIPN).
[00032] It is to be understood that the particular aspects of the specification are described herein are not limited to specific embodiments presented and can vary. It also will be understood that the terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting. Moreover, particular embodiments disclosed herein can be combined with other embodiments disclosed herein, as would be recognized by a skilled person, without limitation
Definitions
[00033] Throughout this specification, unless the context specifically indicates otherwise, the terms “comprise” and “include” and variations thereof (e.g., “comprises,” “comprising,” “includes,” and “including”) are understood to indicate the inclusion of a stated component, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other component, feature, element, or step or group of components, features, elements, or steps. Any of the terms "comprising", "consisting essentially of', and "consisting of' can be replaced with either of the other two terms, while retaining their ordinary meanings [00034] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise.
[00035] Unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values herein that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[00036] As used herein and in the drawings, ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. For example, “about 5%” means “about 5%” and also “5%.” The term “about” can also refer to ± 10% of a given value or range of values. Therefore, about 5% also means 4.5% - 5.5%, for example. [00037] As used herein, the terms “or” and “and/or” are utilized to describe multiple components in combination or exclusive of one another. For example, “x, y, and/or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.”
[00038] “Subject” or “patient” as used herein are used interchangeably and refer to a warmblooded animal such as a mammal, preferably a human, which is afflicted with, or has the potential to be afflicted with cancer as described herein. The subject can be a human patient that was at risk for, or suffering from, peripheral neuropathy induced by chemotherapy treatment. [00039] "Contacting” as used herein includes the physical contact of at least one substance to another substance.
[00040] "Express” or “expression” as used herein refers to transcription and translation of a nucleic acid coding sequence resulting in production of the encoded polypeptide.
Compositions
[00041] "Pharmaceutical composition” as used herein refers to a composition that includes one or more therapeutic agents, such as an Eg5 inhibitor, a pharmaceutically acceptable carrier, a solvent, an adjuvant, and/or a diluent, or any combination thereof. The exact nature of the carrier, solvent, adjuvant, or diluent will depend upon the desired use of the composition (e.g., route of administration), and can range from being suitable or acceptable for veterinary uses to being suitable or acceptable for human use.
[00042] The terms "chemotherapy" and "chemotherapeutic agents,” as used herein refer to chemicals/drugs that are used to treat cancer. In a preferred embodiment the therapeutic agent is used to treat CIPN. The "therapeutic agents," described herein or compositions thereof, will generally be used in an amount effective to achieve the intended result, for example, to treat cancer or to treat CIPN. Some chemotherapeutic agents described herein are capable of stabilizing the cellular microtubule. One skill in the art will readily recognize that chemotherapy agents can be in multiple forms including, but not limited to, capsules, tablets, injectables, or patches.
[00043] “Chemotherapy-induced peripheral neuropathy” (CIPN) is a common side effect wherein the chemotherapy causes damages or degeneration of peripheral neurons, especially sensory neurons. CIPN symptoms include tingling, pain, decreased sensation, increased sensitivity (to touch, temperature, pressure and pain), and muscle weakness.
[00044] “Stabilized microtubule” as used herein refers to a shift in the equilibrium of tubulin polymer that made up the microtubule from the soluble to the polymerized form. A preferred mechanism of microtubule stabilization occurs post-translationally, by detyrosination (dMT) - a process to remove the terminal tyrosine on a- tubulin by tubulin carboxypeptidase (Hallak et al., 1977, FEBS letters 73: 147-150), thereby exposing a glutamate residue (Nieuwenhuis et al., 2019, Trends Cell Biol 29: 80-92). Chemotherapeutic agents that are microtubule stabilizers include paclitaxel, docetaxel, cabazitaxel, TPI-287, and albumin paclitaxel. The structures and commercial sources/publications of these compounds are provided below.
Figure imgf000015_0001
Figure imgf000016_0001
TPI-287 (MedChemExpress, catalogue number: 849213-15-
6)
[00045] As used herein "inhibitors” refer to biologically active compounds that reduce a protein’s function or expression.
[00046] As used herein “Eg5” refers to kinesin-5 protein, which can be expressed in mammals, zebrafish, or other animals. For the purpose of this application, both Eg5 and EG5 mean kinesin-5 protein.
[00047] As described herein, Eg5 inhibitors are capable of reducing detyrosination of microtubules in keratinocytes and degeneration of axons innervating the keratinocytes caused by chemotherapeutic drugs such as paclitaxel treatment. In some embodiments, such Eg5 inhibitors include, but are not limited to, monastrol, ispinesib, (+)-S-trityle-L-cysteine (TriC), BRD9876, filanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB-743921, MK0731, 4SC-205, ARQ 621, and EMD534085. The structures and commercial sources/publications of these compounds are provided below. In some embodiments, therapeutic effects produced by Eg5 inhibitors can be achieved by reducing Eg5 gene expression, inter alia, by genome-editing tools such as CR1SPR-Cas9, TALE nucleases, zinc-finger nucleases, and the like that target Eg5 specifically.
Figure imgf000016_0002
Figure imgf000017_0001
Figure imgf000018_0001
Figure imgf000019_0001
, -2)
[00048] Examples of compositions appropriate for such therapeutic applications include preparations for parenteral, subcutaneous, transdermal, intradermal, intramuscular, intravenous
(e.g., injectable), intrajoint, intratendon, intraligament, intrasynovial, extrasy novi al, or intratracheal administration, such as sterile suspensions, emulsions, and aerosols. In some cases, pharmaceutical compositions appropriate for therapeutic applications can be in admixture with one or more pharmaceutically acceptable excipients, diluents, or carriers such as sterile water, physiological saline, glucose, or the like. For example, the compounds described herein can be administered to a subject as a pharmaceutical composition comprising a carrier solution. In some cases, pharmaceutical compositions are lyophilized. In other cases, pharmaceutical compositions as provided herein contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. The pharmaceutical compositions can be formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy, 20th edition, 2000, ed. A. R. Gennaro, Lippincott Williams & Wilkins, Philadelphia, and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York).
[00049] A variety of dosage schedules are contemplated by this disclosure. For example, a subject can be dosed monthly, every other week, weekly, daily, or multiple times per day. Dosage amounts and dosing frequency can vary based on the dosage form and/or route of administration, and the age, weight, sex, and/or severity of the subject’s disease.
[00050] "Therapeutic benefit" refers to the rebuilding and/or remodeling of damaged tissue thereby eradicating or ameliorating one or more of the symptoms associated with the injury or surgical recovery such that a subject being treated with the therapeutic agent reports an improvement in feeling or condition, notwithstanding that the subject can still have incomplete healing or injury resolution.
Pharmaceutical Formulations and Methods of Treatment
[00051] In exemplary embodiments, an Eg5 inhibitor is provided to a subject as part of a pharmaceutical composition comprising an inhibitor, a chemotherapeutic agent, and a pharmaceutically acceptable carrier, wherein the chemotherapeutic agent is a microtubule stabilizer. The pharmaceutical composition can be delivered to the subject locally or systemically via topical administration, intravascular administration, such as intravenous, intramuscular, or intra-arterial administration, intraperitoneal administration, and the like.
[00052] In some embodiments, the Eg5 inhibitor is administered before, during, and/or after the administration of the chemotherapeutic agent. The Eg5 inhibitor can be included with the chemotherapeutic agent in one injection to be given to the patients; or two injections - one including Eg5 inhibitor and one including the chemotherapeutic agent can be given.
[00053] As used herein, “treatment” refers to the clinical intervention made in response to a disease, disorder, or physiological condition of the subject or to which a subject can be susceptible. The aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder, or condition.
[00054] The terms “prevent” and “preventing” refer to prophylactic or preventive measures intended to inhibit undesirable physiological changes or detrimental progression of a condition. [00055] The terms “effective amount” or “therapeutically effective amount” refer to an amount sufficient to effect beneficial or desirable biological and/or clinical results. In other words, a “therapeutically effective” amount is an amount that will provide some alleviation, mitigation, or decrease in at least one clinical symptom in the subject.
[00056] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which this disclosure belongs. [00057] For the purposes of promoting an understanding of the principles of the disclosure, reference will now be made to embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure was thereby intended, such alteration and further modifications of the disclosure as illustrated herein, being contemplated as would normally occur to one skilled in the art to which the disclosure relates.
[00058] Various exemplary embodiments of compositions and methods according to this invention are now described in the following non-limiting Examples. The Examples are offered for illustrative purposes only and are not intended to limit the scope of this invention in any way. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims.
EXAMPLES
Materials and Methods
Zebrafish husbandry and transgenic lines
[00059] Wildtype strains of Zebrafish (Nacre/mitfa), Tuebingen and AB strains were purchased from the Zebrafish International Resource Center (ZIRC) and embryos raised and bred according to NIH guidelines. Tuebingen wildtype fish were used for CRISPR studies. Nacre fish were used for membrane labelling of keratinocytes in tp63:GFP-CAAX. All remaining analyses were performed in AB fish. Animals were handled in strict accordance with good animal practices as approved by the appropriate IACUC committees (MDI Biological Laboratory IACUC number A13-20; University of Miami’s A-3224-01 and AALAC accreditation site: 001069). Zebrafish eggs were collected in a strainer and rinsed with deionized water, and then transferred into Petri dishes with Embryo medium (Instant Ocean salt water + methylene blue, Zebrafish book protocol (Westerfield, 2007, University of Oregon Press, Eugene 5th edition, incorporated by reference herein in its entirety , incorporated by reference herein in its entirety) or Ringers solution. Following overnight incubation at 28.5°C, embryos were cleaned and fresh Ringer’s solution with phenol -thio-urea was added for further incubation. Embryos were kept in a 14: 10 hr light/dark cycle.
[00060] Transgenic lines: Tg(h2a:h2a-GFP, Cat. No. ZL1087) transgenic fish were obtained from the Zebrafish International Resource Center (ZIRC). tp63:GFP-CAAX fish were previously published (Lisse etal., 2016, Proc. Natl. Acad. Sci. USA 113: E2189-2198).
Plasmids
[00061J CREST3:EB3-GFP: pCS2_CMV:EB3-GFP was a gift from the Koester Lab (University of Braunschweig, Germany) (pCS2_CMV:EB3-GFP sequence is from PMID: 12684451, for CREST3-EB3-GFP see SEQ ID NO: 25). The CMV promoter was removed from pCS2 by digestion with Hindlll, followed by Klenow fragment incubation to create blunt-ends, purification and subsequent digestion done with Sall. The CREST3 promoter in
Tol2 CREST3:Gal4VP16 14xUAS-GFP (gift from Alvaro Sagasti, UCLA; and see Rieger et al., 2011, PLoS Biol. 9: el000621) was digested with EcoRV (created blunt-end site) and Sall. The gel-purified fragment was ligated into the pCS2_EB3-GFP plasmid overnight at 16°C and transformed into Top 10 cells for purification and injection
[00062] A construct identified as tp63 :EB3-GFP (SEQ ID NO: 26) was generated by removing the CMV promoter as above. The tp63 promoter was removed by digestion of pBSK- JC_T2_tp63_Gal4VP16_GFP-5xUAS-MCS (SEQ ID NO: 30) with Apal and Avril, followed by Klenow treatment to generate blunt ends. Following gel purification, the tp63 promoter fragment was ligated into pCS2-EB3-GFP, as above. Both constructs were sequenced and further verified by in vivo imaging. [00063] A construct identified as tp63 :Ai/77-AcGFP (SEQ ID NO: 27) was generated by PCR amplification of zebrafish kifll from cDNA (Horizon Discovery, Clone ID: 3815942) for ligation into the pAcGFP-Nl (Takara, Cat. No. 632501) fusion vector. The following primers were used: Fwd 5’-AAGGCCTCTGTCGACCATGGCATCATCACAAGTAC-3’ (SEQ ID NO: 1) and rev 5’- AGAATTCGCAAGCTTATTCTGACATCTGAGTGGAAGT-3’ (SEQ ID NO: 2) and Q5 P Polymerase (NEBNext® High-Fidelity 2X PCR Master Mix). This was followed by PCR purification (QIAGEN PCR Purification kit) and ligation of the amplicon into pAcGFP-Nl. The plasmid was transformed into One-Shot Top 10 cells (ThermoSci entific, Cat. No. C404010) and plasmids were purified from colony minipreps using a MiniPrep kit (QIAGEN). The insert (kifl 7-AcGFP) was subsequently amplified from using the following primers: Fwd 5’- GGATCCTTATGGCATCATCACAAGT-3’ (SEQ ID NO: 3) and Rev 5’- GCGGCCGCTTCTTGTACAGCTC-3’ (SEQ ID NO: 4) that added BamHI/Notl restriction sites. KXIG:tp63:AcGFP (Lisse et al., 2016, Proc Natl Acad Sci USA 113(15): E2189-98) was digested with BamHI/Notl to remove AcGFP with gel extraction (QIAGEN) and BamHI_A7/77- AcGFP_NotI was inserted via ligation using T4 DNA ligase (Promega, Cat. No M180A) at room temperature for 2 hours. The ligation reaction was transformed into One-Shot ToplO cells and colonies were screened via PCR for positive inserts. Plasmid DNA from positive colonies were isolated and purified using the QIAGEN MiniPrep kit and verified via sequencing. Positive plasmids were injected into zebrafish and verified for fluorescence, which was only visible if kifll was cloned in-frame with AcGFP.
[00064] A construct identified as isll :Gal4VP16_14xUAS-tdTomato (SEQ ID NO: 31) was provided to the laboratory. mTagBFP2-MAPTau-C-10 was provided by Michael Davidson (Addgene plasmid #55311; PMID: 22174863, RRID:Addgene_55311).
[00065] A construct identified as tp63 :HyPer-CAAX: KXIG:tp63 AcGFP (Lisse et al. , 2016, Proc Natl Acad Sci USA 113(15): E2189-98) was digested with BamHI/Notl (NEB) to excise AcGFP. Hyper was amplified from pHyPer-dMito (Evrogen) without the stop codon using the following primers: Fwd: 5’-3’ catttacctctgaagccacgggtttagtgaaccgtcag (SEQ ID NO: 5) and Rev: 5’-ttcctcctccAACCGCCTGTTTTAAAAC-3’ (SEQ ID NO: 6). The CAAX motif was amplified using the primers 5’-acaggcggttGGAGGAGGAAGATCTAAG-3’ (SEQ ID NO: 7) and 5’-tcgagctccaccgcggtggcAACACCCCTTGTATTACTG-3’ (SEQ ID NO: 8) from the pME- EGFP-CAAX vector (gift from Chi-Bin Chien). Both amplicons were purified using the PCR Purification kit (QIAGEN) and ligated via HiFi Assembly using the 2x HiFi Master mix (NEB, Cat. No. M0541) at 50°C for 20 minutes. The assembly reaction was transformed into NEB 5- alpha competent cells provided with the HiFi Assembly kit (NEB, Cat. No. E5520) and colonies grown and purified via the Plasmid Miniprep kit (Qiagen) and subsequently sequenced.
[00066] A construct identified as tp63:HyPer-mito: KXIG:tp63:HyPer-mito was cloned by digesting tp63:AcGFP with BamHI/Notl (NEB) to excise AcGFP (tp63:Hyper-mito sequence is SEQ ID NO: 29). Hyper-mito, a hydrogen peroxide sensor specific to the mitochondria was amplified from pHyPer-dMito (Evrogen) using the following primers Fwd: 5’- catttacctctgaagccacgggtttagtgaaccgtcag-3’ (SEQ ID NO: 9) and Rev: 5’- tcgagctccaccgcggtggctaagatacattgatgagtttgg-3’ (SEQ ID NO: 10). The amplicon was ligated into the vector containing the tp63 promoter using the Hi-Fi Assembly Master mix (NEB) at 50°C for 20 minutes. The assembly reaction was transformed into NEB 5-alpha competent cells and purified using the plasmid miniprep kit by Qiagen, and subsequently sequenced.
Pharmacological agents
[00067] Paclitaxel was purchased from Sigma- Aldrich (Cat No. T7402) and upon arrival stored as powder at 4°C. A stock solution was prepared in 100% fresh DMSO to make 5.9 mM paclitaxel. The stock solution was divided into 20-30pl aliquots and stored at -20°C until use (maximal 6 months). Immediately prior to use, paclitaxel was diluted in Ringer’s solution and added to dechorionated larval zebrafish. The larval fish were placed individually or in small groups into wells of a 12-well plate containing the treatment solutions. The control group was 0.05% DMSO. Plates were incubated at 28.5°C and protected from light. Treatment lengths are indicated in the Drawings, Description of the Drawings, and Examples where appropriate. Paclitaxel and DMSO solutions were exchanged every 48hr if longer incubations were used. EMD534085, Eg5 inhibitor (MedChemExpress, Cat. No. HY-15000) was diluted in 100% DMSO to make a lOmM stock solution and stored at -20°C. Immediately prior to use, the inhibitor was diluted to 25 pM and added at 4dpf, following two days of either vehicle or paclitaxel incubation. For Noxl staining experiments, the inhibitor was added together with paclitaxel at 2dpf. The solutions were exchanged every 48hr.
Immunofluorescence/ Zebrafish immunofluorescence staining [00068] Larval fish were transferred into 20ml glass vials and fixed in 4% paraformaldehyde (PFA)/lx Phosphate-buffered saline (PBS) for 1.5hr at room temperature, with gentle rocking. Following a 5-minute incubation in lxPBS+0.1% Tween-20 (PBST), zebrafish were permeabilized in lxPBS+0.1% Triton X-100 for 10-30min. Larval fish were transferred into 2ml reaction tubes and incubated in blocking buffer (lxPBST+5%BSA) for 30min at room temperature, with rocking. Larval fish were further incubated overnight in antibody solution (Millipore Sigma, Cat. No. AB3201, 1 :300 rabbit anti-GluTub; Sigma, Cat No. T6793, 1 :500 mouse anti-acetylated tubulin) in blocking buffer at 4°C, on a rotator. The next morning, larval fish were transferred into 6-well plates and washed 4xl5min in IxPBST at room temperature, with rocking. This was followed by incubation in secondary antibody (goat antirabbit Cy5, Abeam, Cat. No. ab97077; goat anti-mouse Cy3, Abeam, Cat. No. ab97035) and 1 : 10,000 Hoechst 33342 (ThermoFisher Scientific, Cat. No. 62249, 20mM solution) in blocking buffer for Ihr at room temperature, with rocking. Fish were covered to avoid bleaching. Fish were washed for 4xl5min in IxPBST at room temperature, with rocking, and immediately mounted for imaging on glass bottom petri dishes (Spectrum Laboratory Products, Cat. No. 750- 10403-UE) using 1% agarose (Thermo Fisher Scientific, Cat. No. 16520050). A 1 :200 dilution was used for mouse alpha-tubulin antibody (Proteintech, Cat. No. 66031-1) and a 1 :1,000 dilution of donkey anti-mouse IgG Alexa488 (ThermoFisher Scientific, Cat. No. A-21202) for secondary detection. For Noxl immunostaining, a 1 :300 dilution of primary antibody (Anti- NOX1 Rabbit Polyclonal Antibody, Avantar, Cat. No. 102164-796) and a 1 : 1,000 dilution of secondary goat anti-rabbit Cy2 (Abeam, Cat. No. ab6940) antibody was used. Eg5 antibody (Abeam, Cat. No. 61199) was used at a 1 : 100 and secondary goat anti -rabbit Cy2 (Abeam, Cat. No. ab6940) at 1 : 1,000 dilution.
Quantitative PCR
[00069] Zebrafish larvae (AB/Nacre) were treated in pools of -20-30 larvae per treatment per biological replicate (BR); each BR consisted of embryos from distinct parents. Larvae were collected into 1.5ml reaction tubes post-treatment and RNA extraction was performed using the rNeasy Plus Micro kit (Qiagen, Cat. No. 74034). cDNA was synthesized from ~300ng total RNA using the Superscript IV VILO kit (Thermo Fisher, Cat. No. 11756050). Primers in target genes were designed wherein primers annealed in two exons separated by one or several large introns that could not be amplified with the selected PCR settings, to avoid genomic DNA contamination. Quantitative PCR was performed with the Applied Biosystems QuantStudio 3 using PowerUp SYBR Green (ThermoFisher, Cat No. A25741). Amplification signals for expressed target genes were normalized to zebrafish 18S rRNA signals. qPCR conditions were used as follows: 95°C for 10 minutes, 40 cycles of 95°C for 15 seconds, 50°C for 30 seconds, 72°C for 30 seconds. Each biological replicate was run in quadruplicate. Data were presented as relative expression compared to control using the delta-vdelta Ct (2 MCt) method.
Table 1. Primer sequence for qPCR:
Figure imgf000026_0001
kifll CRISPR knockout
[00070] CRISPR oligos targeting kifll were designed using the IDT CRISPR design tool (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM). The oligo (5’- AGGTGACCGATCACCCAATG (SEQ ID NO: 21) was designed to anneal within exon 5 of 23 exons total in zebrafish kifll with expected mutations ~ position 270bp in the sequenced region using the following primers for PCR amplification: Fwd 5’- TTAGGTTTTTGGCCCTTCTG-3’ (SEQ ID NO: 22) and Rev 5’- GAGGGTCCTGATAGAGAAAAAGTGAA-3’ (SEQ ID NO: 23). The forward primer was used for sequencing and yielded deletions in transiently injected embryos, as shown in example below in which single zebrafish were sequenced (FIG. 10).
[00071] The CRISPR oligo was injected using the Alt-R system (IDT, https://www.idtdna.com/pages/technology/crispr/crispr-genome-editing/Alt-R-systems/cas9), which has provided highly reliable and efficient zebrafish knockout results as used herein. The IDT-recommended protocol (below) was used for CRISPR oligo preparations. Fertilized eggs were injected ~15 minutes post fertilization with CRISPR oligos to ensure maximal efficiency.
Zebrafish embryo microinjection protocol (IDT)
[00072] Ribonucleoprotein delivery using the Alt-R™ CRISPR-Cas9 System. Alt-R crRNA and tracrRNA were suspended in Nuclease-Free IDTE Buffer to final concentrations of lOOpM each. A gRNA (3pM gRNA) solution was prepared using the components in Table 2.
Table 2. gRNA Solution Components
Figure imgf000027_0001
Samples were heated at 95°C for 5 min, allowed to cool to room temperature (15-25°C). Final concentrations of crRNA and tracrRNA were 36ng/pL and 67ng/pL, respectively. Cas9 protein was diluted to a to a 0.5pg/pL working concentration in the buffer as shown in Table 3.
Table 3. Cas9 working concentration buffer components
Figure imgf000027_0002
RNA complexes were assembled by combining 3pL of gRNA with 3pL of diluted Cas9 protein, followed by incubation at 37°C for 10 min, and then allowed to cool to room temperature. Embryos were collected at the 1-cell stage and 3nL of RNP complex injected. Un-injected control embryos were also used in experiments. Injected fish were monitored for toxicity at 8 hours, 1 day, 2 days, and 4 days post injection. Four days post-injection genomic DNA was collected using the NaOH method. Target specific PCR was performed and PCR products analyzed using 2% agarose gels.
Imaging
[00073] Confocal immunofluorescence imaging of zebrafish was performed with a 20x air objective and zooms between lx-3.8x. For microtubule detection, 1pm sections in varying stack sizes were recorded to capture the full diameter of the caudal fin at either 512x512; 860x860; or 1024x1024 pixel resolution. Scanning was performed at variable scan speed to ensure high quality images.
Live imaging of zebrafish:
[00074] Fish were anesthetized in 2-phenoxyethanol (1 : 1000) in Ringer’s solution prior to imaging and mounted in 1.2% agarose. EB3-GFP and Tau-Bfp2 were imaged with a scan speed kept at the maximum level in single slice mode with Is intervals for a total of 60s to capture microtubule dynamics. h2a:H2A-GFP time-lapse recordings were produced ( Zeiss LSM880 AiryScan confocal microscope) with 1 m sections recorded every lOmin for 12hr using 800x800 pixels. All other live fish were imaged using 1024x1024 pixels.
Image processing:
[00075] Images were processed and analyzed in Imaris 9.5.1 (Bitplane, Switzerland) or Fiji. Projected stacks were saved as .tif files using the Snap tool, followed by processing in Photoshop to assemble the figures. 3D reconstructions were performed in Imaris using the semiautomated Surface details were set either automatically or manually adjusted depending on the final render quality. Threshold detection and voxel number settings were automatically set. The rendered images were adjusted through repeated re-adjustments of each setting, until a suitable fit was observed. The settings were kept the same for groups that were compared. Graphs were generated and statistics performed in Prism 9 (GraphPad) software. Schematics were prepared in Adobe Illustrator. HyPer mitochondria were ratiometrically displayed using the Image calculator function in ZEN Black whereby the 420nm unoxidized and 505nm oxidized channels were added into the division calculator and the signal was amplified by a factor of 150. Quantifications
[00076] Microtubule analyses was performed in Imaris 9.5.1 (Bitplane) by measuring the straightness of filaments (microtubules) using the “Filaments — Dendrite Straightness” tool, which was defined as the ratio between filament length and radial distance between two branch points (h). The value was always smaller than 1 since the Dendrite Straightness of 1 defines straight objects.
[00077] Fluorescence intensities were measured using the Imaris MATLAB plugin or Fiji. A line was typically placed over the region of interest and the fluorescence automatically quantified. The values were normalized to nuclear (Hoechst33342) fluorescence intensities within the same fish and region to obtain an intensity ratio.
[00078] Cell counting in the caudal fin was performed in three 100pm2 boxes in the dorsal, medial and ventral caudal fin (~100pm from the edge).
[00079] Nuclear sphericity and volume were calculated in Imaris following 3D rendering of round keratinocyte nuclei using the Surface tool. First, background subtractions were performed, followed by automatic threshold detection. The threshold was adjusted if necessary to fit the nucleus. Thresholds were kept constant for comparisons.
[00080] Cell divisions and cell death were manually counted in 12hr movie recordings. The caudal fin was divided into 6 quadrants and individual cells in each quadrant were manually followed over 12hr at least 3 times sequentially to capture cell divisions and dying cell behaviors.
[00081] dfMT thicknesses (defined as the mean width of a given dfMT) was manually measured at high magnification using the Slice mode in Imaris and the Line tool for measuring the distance between two points. The innermost and outermost microtubule cable was defined as perimeter for the width measurements. Measurements were taken in 3 dfMT positions that covered the minimum, medium, and maximum width within a given dfMT to obtain an overall range distribution.
[00082] EB3-GFP tracking was done in Fiji using the MTrackJ plugin to trace microtubules over time and create Kymographs, measure the velocity, track length, and comet duration. Tracking was also performed using the Spots and Surface tools in Imaris. Settings were initially automatically detected to fit the fluorescence and subsequently modified manually for improved fit. Settings were maintained between treatment groups. [00083] Axon branch number quantifications were performed by drawing a 50pm line across the dorsal, medial, and ventral caudal fin edge region at a distance of 100pm parallel to the fin edge (which was determined to be the most reliable region to quantify distal branch numbers). Axons traversing this line were counted and averaged per treatment group. Axonal fluorescence measurements were taken using the Imaris Spots function by manually placing spots along the axon and using the fluorescence intensity profile measurements MatLab tool. [00084] HyPer fluorescence was measured in the oxidized (505nm) and unoxidized (420nm) channels by using the region of interest (ROI) function in ZEN Black (Zeiss) whereby ROIs were selected inside highly magnified mitochondria (HyPer-mito), cytoplasm (HyPer-cyto) or the plasma membrane (HyPer-CAAX). The data was exported, and ratios determined in Excel. H2O2 measurements in zebrafish transiently injected with tp63:Hyper were manually performed by placing spot objects in Imaris 9.5.1 onto individual cells such that the spots extended to the lateral edges. Fluorescence intensities were measured inside the spots and 505nm/420nm ratios were subsequently calculated.
Membrane/cytoplasmic/niiclear ratio measurements for Noxl staining
[00085] Measurements were determined by measuring fluorescence intensity in Fiji using single slice and single channel modes. First, a line using the line tool was placed along the plasma membrane that was clearly distinguishable from the cytoplasm due to increased fluorescence compared with the cytoplasm in all treatment groups. The measurement tool was subsequently selected to measure the mean fluorescence intensity. Three lines per caudal fin keratinocyte were averaged for 5 cells per animal and at least 3 animals per treatment group. To determine the mean cytoplasmic fluorescence intensity, nuclei were first overlaid with Noxl fluorescence to ensure the exclusion of nuclear measurements. These images were then used to draw lines within the cytoplasm as above. For nuclear measurements, the line was placed inside a nucleus such that it spanned the longest extent of the nucleus. The fluorescence data was exported to Excel and the ratios calculated.
Statistical analyses
[00086] Student’s /-test was used to compare groups. A one-way ANOVA was used to compare more than two groups and a single variable. A two-way ANOVA was used for comparisons of multiple groups and multiple variables. Significance was set at p<0.05, p<0.01, p<0.001, p<0.0001.
In vivo experiments
Animal care and treatment:
[00087] C57BL/6 mouse, 6 weeks old (15-22g), were IP injected with 20 mg/kg paclitaxel
(Athenex). The mice in each cage were randomly allocated to different treatment groups. Food and water were available ad libitum and experiments were performed during the light cycle (7:00 am to 7:00 pm). Animals were euthanized via CO2 asphyxiation, followed by cervical dislocation. Animals that showed behavioral disturbances unrelated to chemotherapy-induced pain were excluded from further behavioral testing. The animal’s husbandry conformed with established NIH and Institutional Animal Care and Use Committee (IACUC) approved protocols.
[00088] For producing the experimental results illustrated in FIG. 11A-11C, C57BL6/J mice at 12 weeks old were IP injected with vehicle (0.5% DMSO//lxPBS), paclitaxel (24mg/kg; one injection), and the EG5 inhibitor, EMD534085 (20mg/kg; 3 injections: 1 before, during, and after paclitaxel). The mice were then sacrificed 24 hours after the last injection (EMD534085 or vehicle) or 48 hours after paclitaxel injection, and the skin of the hind paw pad was collected for histology studies.
Tissue staining:
[00089] Paws and back skin were collected at predetermined time points, placed in 10% formalin, and stored overnight at 4°C. Samples were embedded in paraffin and sectioned at 7pm, deparaffinized, washed with PBS, and incubated at room temperature for 5 min in 0.1% Triton X-100 in PBS and then blocked for 30 min (5% BSA). Sections were incubated with primary antibody diluted in blocking solution, overnight at 4°C in a humidity chamber. Following PBS washes, sections were incubated for 1 h at room temperature with a secondary antibody. Tissues were mounted and assessed for staining. Antibodies used were against detyrosinated tubulin Millipore AB3201, p- 7/- // Invitrogen PA5-38647, alpha-tubulin Proteintech 66031-1-Ig, mouse Alexa Fluor 488 Invitrogen A21202, and rabbit Alexa flour 546 Invitrogen A10040. DAPI was used for nuclei counterstaining. Imaging:
[00090] Immunofluorescence staining was performed with a widefield microscopy using a Plan-Apochromatix 100* objective lens (oil immersion, numerical aperture [NA] 1.4), 20x and lOx objective lens on inverted Zeiss Axio Observer Z1 using AxioVision 4.8 software. Images were acquired using a monochrome Zeiss Axio Cam MRm CCD camera. Images were processed with the NIH Image J software.
Mouse RNAseq analysis:
[00091] The RNAseq data set was published in Cirrincione et al. (2022, Data 7: 72). Following differential gene expression analysis (FDR<0.01) comparing paclitaxel-treated to vehicle control animals (n=4), identified genes were queried in gProfiler and grouped by their molecular function. Using normalized gene counts, Kif genes were analyzed for their expression and plotted over time. Significance values comparing paclitaxel and vehicle controls were established using Prism 9 (GraphPad). Kif 11 was queried in STRING to identify associated networks and interacting proteins compared to the RNAseq data set and differentially expressed genes were graphed in Prism 9.
Human RNAseq
[00092] Three female breast cancer survivors were recruited who received standard adjuvant paclitaxel treatment. Paclitaxel was administered in these patients over the course of 12 weeks by infusions of 80 mg/m2 each. A retrospective review of the patient’s medical records was conducted to confirm the date of CIPN diagnosis (5 weeks for XMMP003, 31 weeks for XMMP002, and 35 weeks for XMMP001 prior to the performed skin biopsies) and record paclitaxel administration to the patient. Neurological history, examination, and QLQ-CIPN20 quality of life questionnaire, which has been validated to detect the presence of CIPN (Postma et al., 2005, Eur J Cancer 41 : 1135-1139), was completed in all subjects. Consent was given to obtain two skin punch biopsies of approximately 4 mm diameter. These were collected 10 cm proximal to the lateral malleolus on the distal leg as described previously (Engelstad et al., 2012, Neurology 79: 2187-2193). The biopsies were carried out under anesthesia following local injection of 2% lidocaine with epinephrine, using a sterile technique. In addition, three healthy volunteers of similar age and same gender (female) were recruited as controls. Volunteers serving as controls had no history of neuropathy, diabetes, or familial neuropathies. One skin biopsy was used for RNA sequencing (Azenta/Genewiz) whereas the other biopsy was used in other experiments as set forth herein. RNA isolation and quality control were performed, and paired-end Illumina sequencing (HiSeq 2xl50bp) was conducted. Sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36. The trimmed reads were mapped to the Homo sapiens GRCh38 reference genome available on ENSEMBL using the STAR aligner v.2.5.2b. The STAR aligner was a splice aligner that detects splice junctions and incorporates them to help align the entire read sequences. BAM fdes were generated through this step. Unique gene hit counts were calculated by using featureCounts from the Subread package v.1.5.2. The hit counts were summarized and reported using the gene id feature in the annotation fde. Only unique reads that fell within exon regions were counted. If a strand- specific library preparation was performed, the reads were strand- specifically counted. After extraction of gene hit counts, the gene hit counts table was used for downstream differential expression analysis. Using DESeq2, a comparison of gene expression between the customer-defined groups of samples was performed. The Wald test was used to generate p-values and log2 fold changes. Genes with an adjusted p-value < 0.05 and absolute log2 fold change > 1 were called as differentially expressed genes for each comparison. Below are the results of the number of differentially expressed genes for all comparisons provided. A gene ontology analysis was performed on the statistically set of genes by implementing the software GeneSCF v.1. l-p2. The goa human GO list was used to cluster the set of genes based on their biological processes and determine their statistical significance. A list of genes clustered based on their gene ontologies was generated.
[00093] Differentially expressed candidate genes for control subjects and CIPN patients were subsequently graphed either as normalized gene counts or relative expression using GraphPad Prism 9. Upregulated KIF genes were queried in STRING to identify networks. The data was uploaded to the Gene Omnibus Database with the GEO Accession number GSE228633.
Example 1: Paclitaxel treatment promoted microtubule detyrosination and fasciculation in epidermal keratinocytes [00094] It was first determined whether paclitaxel treatment of larval zebrafish stimulated microtubule stabilization. Stabilized microtubules undergo a modification whereby the terminal tyrosine residue was removed, leading to detyrosination (dMT) (Roll-Mecak et al., 2020, Developmental cell 54: 7-20), which was associated with particularly long-term stabilized microtubule populations (Khawaj a et al., 1988, The Journal of cell biology 106: 141-149). Exposure of the penultimate glutamate residue can be detected using a GluTub antibody. Previous findings showed that cutaneous axon degeneration was most prevalent in the distal caudal fin of zebrafish, which consists of two layers of epidermal keratinocytes that are infolded. Each of the two layers are innervated by unmyelinated axons of somatosensory neurons and mesenchymal cells are medially located between the infolded epidermis (as shown in FIG. 1A and FIG. IB) This distal fin axon degeneration model was used in all subsequent studies. Caudal fin keratinocytes in vehicle (0.05% DMSO)-treated animals did not show stable microtubule populations following treatment for 3 and 96 hours (as shown in FIG. 1C-E). However, dMTs were visible in mesenchymal cells at 2 days post fertilization and could be distinguished by their elongate shape spanning multiple keratinocytes (as shown in FIG. 1A, FIG. IB, FIG. IE, and FIG. IF). Paclitaxel (22pM) treatment promoted microtubule detyrosination in keratinocytes following long-term (96hr) but not short-term (3hr) treatment (normalized fluorescence intensity ratio: 3hr (2dpf), vehicle: 1.039±0.093 vs. paclitaxel: 1.197±0.053; 96hr (6dpf), vehicle: 1.203±0.115 vs. paclitaxel: 2.621±0.14) (as shown in FIG. ID). Intriguingly, dMTs became fasciculated in a subset of keratinocytes and looped around the cell periphery, most prominently in the distal caudal fin in which axon degeneration commences (Lisse et al., 2016, Proceedings of the National Academy of Sciences of the United States of America 113: E2189-2198) (as shown in FIG. IE and FIG. 1G). Microtubule detyrosination, fasciculation, and looping (abbreviated as dfMT) was evident after 48hr paclitaxel treatment in -45% of analyzed animals, and in -90% after 96 hours, but never in vehicle controls, or after 3hr paclitaxel treatment (as shown in FIG. IH and FIG. II). dfMT presence ranged from 0 to -20 keratinocytes/100pm2/animal but on average, these were detected in 3.64±1.28 keratinocytes/lOOpm2 following 48hr paclitaxel treatment, and in 7.7±1.6 keratinocytes/ 100 pm2 following 96hr paclitaxel treatment (as shown in FIG. 1J). A low dose of paclitaxel (lOOnM) also promoted dfMT formation, but the overall number of affected keratinocytes per animal was lower compared with high dose experiments (lOOnM paclitaxel: 0.4±0.21 dfMT-positive keratinocytes/lOOpm2) (as shown in FIG. 1 J), suggesting that the extent of dfMT formation was dose-dependent. Interestingly, despite the low number of keratinocytes harboring dfMTs with lOOnM paclitaxel treatment, the fascicle width of dMTs was enhanced (lOOnM paclitaxel: 6.0±0.49|im vs. 22pM paclitaxel: 3.4±0.17pm) (as shown in FIG. IK). To determine if this phenotype was inherent to zebrafish or conserved in mammals, dfMT formation in the mouse epidermis was analyzed. A single injection of vehicle or 20mg/kg paclitaxel into mice (5-6 weeks) resulted in dfMT formation in a subset of suprabasal keratinocytes. These occasionally formed large cell clusters with rosette-like dfMTs connecting them (as shown in FIG. IL). In contrast, vehicle-injected control animals never showed dfMT formation although some degree of detyrosination was present. Together, these findings demonstrated that paclitaxel treatment promoted a dose-dependent dfMT formation in subpopulations of epidermal keratinocytes,
Example 2: Paclitaxel promoted X-ROS formation via altered microtubule mechanotransduction
[00095] It was then determined whether keratinocyte dfMT formation contributed to ROS production. ROS can be derived from two major sources within cells, mitochondria and membrane-bound NADPH oxidases. Previously detected morphological changes in keratinocyte mitochondria following paclitaxel treatment (Cirrincione et aL, 2020, Set Rep 10, 3970) suggested that keratinocyte-specific mitochondrial reactive oxygen species (mitoROS) might be a source, supported by mitochondrial diseases having been linked to peripheral neuropathy (Cassereau et al., 2014, Revue neurologique 170: 366-374; Flatters et al.. 2015, Biol Transl Sci. 131 : 119-146; Pareyson et al., 2013, Lancet Neurol. 12: 1011-1024). To assess mitoROS levels in keratinocytes, tp63 :HyPer-mito, a mitochondria-targeted genetic sensor for the ROS, hydrogen peroxide (H2O2) (Bilan et al., 2018, Antioxid Redox Signal 29: 569-584; Bilan et al., 2013, ACS Chem Biol 8: 535-542) was expressed in zebrafish. Treatment with paclitaxel for 3hr and 48hr, which was when cytoplasmic ROS were abundant (Lisse et aL, 2016, Proceedings of the National Academy of Sciences of the United States of America 113: E2189-2198, Cirrincione et al., 2022, Data 7: 72) did not increase mitochondrial HyPer oxidation (3hr vehicle: 1.054±0.031 vs. paclitaxel: 1.252±0.066; 48hr vehicle: 1.029±0.086 vs. paclitaxel: 0.972±0.2) (as shown in FIG. 2A and FIG. 2B). These results suggested that paclitaxel was not contributing to ROS formation in mitochondria and that NADPH oxidases were the likely source of ROS in keratinocytes, consistent with previous findings that 3hr and 48hr paclitaxel treatment induces cytoplasmic H2O2 production (Lisse et aL, 2016, Proceedings of the National Academy of Sciences of the United States of America 113: E2189-2198; Cirrincione et al., 2020, Sci Rep 10, 3970).
[00096] NADPH oxidases were therefore an alternative source for ROS. The NADPH oxidase family consists of Noxl-5 and Duoxl/2, with Duox2 being species-dependent (Donko et a , 2005, Land B Biol Sci 360: 2301-2308) and Noxl-4 being activated by the subunit p22phox (Bedard et aL, 2007, Physiological reviews 87, 245-313; Ushio-Fukai et al., 1996, The Journal of biological chemistry 271 : 23317-23321). Quantitative PCR (qPCR) was used initially in zebrafish to analyze expression of the two known epithelium-specific NADPH oxidases, noxl and duox, in addition to nox2, which was shown to be activated by mechanotransduction mechanisms in cardiomyocytes (Prosser et aL, 2011, Science 333: 1440-1445). QPCR on whole larval zebrafish showed only noxl being upregulated following 48hr paclitaxel treatment (foldchange from vehicle control: duox: 1.63±0.23, noxl : 2.5±0.61, nox2: 1.35±0.12) (as shown in FIG. 2C). Immunofluorescence staining and 3D reconstruction of Noxl, and nuclear staining using Hoechst33342, further showed a time-dependent recruitment of Noxl to the plasma membrane and nucleus in epidermal keratinocytes following paclitaxel, but not vehicle, treatment (membrane:cytoplasmic ratio, 48hr vehicle: 1.23±0. 04 vs. paclitaxel: 1.5±0.09; 120hr vehicle: 1.74±0.09 vs. paclitaxel: 2.63±0.29) (as shown in FIG. 2D). These findings indicate that paclitaxel modulates Noxl activity by promoting its subcellular translocation, which could be mediated by the altered mechanotransduction of dfMTs, consistent with findings in muscle cells. [00097] Paclitaxel induced Nox-dependent ROS formation was studied by altering microtubule tension, exerted on a zebrafish caudal fin while simultaneously permitting ROS formation to be monitored using time-lapse imaging. The experiments were conducted on the basis that stretch in the presence and absence of paclitaxel would modify microtubule dynamics and this should impact ROS production in wildtype fish, whereas Nox-deficient cyba-/- mutants do not produce ROS in response to stretch. The extent of stretch that was induced in wildtype transgenic Tg(tp63:GFP-CAAX) (Lisse etaL, 2016, Proceedings of the National Academy of Sciences of the United States of America 113 : E2189-2198) fish in which keratinocyte plasma membranes are fluorescently labelled was characterized. Comparison of vehicle-treated pre-and 15min post-stretch keratinocytes showed an increase in keratinocyte length, but not width, at the fin edge (keratinocyte length, medial fin: pre-stretch: 27.99±0.97pm vs. post-stretch: 30.37±1.05pm; fin edge: pre-stretch: 30.35±1.36pm vs. post-stretch: 36.46±2.04pm; keratinocyte width, medial fin: pre-stretch: 19.19±0.86pm vs. post-stretch: 19.01±0.69 pm, fin edge: pre-stretch: 11.62±0.59 pm vs. post-stretch: 13.52±1.16pm) as shown in (FIG. 2E). Subsequent fixation of stretched wildtype and cyba-/- mutant fish followed by immunofluorescence staining for alpha-tubulin confirmed stretching of microtubules in fin edge keratinocytes of vehicle-treated, but not in paclitaxel-treated, animals (FIG. 2F), confirming altered mechanical characteristics of stabilized microtubules.
[00098] To further investigate whether paclitaxel in combination with stretch alters ROS formation, HyPer imaging was performed. Dual channel imaging of oxidized and unoxidized HyPer in 5min intervals for 90 minutes pre- and post-stretch showed that HyPer oxidation in vehicle control fish was relatively sluggish, with a maximum increase at ~80min post-stretch (HyPer ratio (505/420) pre- vs. post-stretch (max): 1.62 vs. 1.97) (as shown in FIG. 2G). Paclitaxel-treated animals (3hr treatment), in contrast, showed rapid HyPer oxidation that peaked between 10-20min (HyPer ratio pre- vs. post-stretch (max): 1.49 vs. 1.75) and thereafter declined. This result indicates that altered mechanical characteristics of dflMTs contribute to ROS formation in keratinocytes following paclitaxel treatment. As predicted, HyPer oxidation was Nox-dependent since stretching of cyba-/- mutants with and without paclitaxel treatment resulted in a 10-fold decrease in HyPer oxidation in the vehicle controls, and the absence of a response to stretch in the paclitaxel group (cyba-/-, vehicle: HyPer ratio pre- vs. post-stretch (max): 1.50 vs. 1.69 vs. paclitaxel: 1.25 vs. 1.36). These results further indicated that dfMTs promoted NOXl-dependent ROS (X-ROS) formation in keratinocytes following paclitaxel treatment. The remaining HyPer oxidation in vehicle-treated cyba-/- mutants suggested that changes in MT tension can also stimulate other P22phox-independent NADPH oxidases, such as Duox, or stimulate mitochondrial ROS production.
[00099] To further determine whether microtubule stretch enhanced paclitaxel-induced axon degeneration in a Nox-dependent manner, the axon branch number in wildtype and cyba-/- fish treated with vehicle and paclitaxel either stretched or unstretched was compared. Stretching was performed after 96hr treatment, followed by 2hr post-stretch fixation, and staining for detection of acetylated tubulin in axons. Axon branch quantifications showed a decrease in axon branches in the caudal fin of wildtype paclitaxel-treated but not vehicle control fish, and no change was found within the cyba- - group. While stretching slightly enhanced degeneration within wildtype animals, it was rescued in paclitaxel-treated and stretched cyba-/- mutants (as shown in FIG. 2H). To determine whether Nox activation occurred upstream of MMP-13, mmpl3 expression was analyzed by qPCR in whole larval wildtype and cyba-'- mutant fish in the absence and presence of paclitaxel. Wildtype but not cyba-/- fish treated for 48hr with paclitaxel to stimulate axon degeneration displayed increased mmpl3 expression (as shown in FIG. 21). Together these data supported a model by which paclitaxel -induced microtubule stabilization induced X-ROS formation and MMP-13 expression upstream of cutaneous sensory axon degeneration.
Example 3: Paclitaxel treatment stimulated cell cycle gene expression in skin
[000100] Molecular mechanisms underlying paclitaxel-induced microtubule fasciculation were then investigated. Because previously identified CIPN dependence on MMP-13 was conserved (Lisse et al., 2016, Proc. Natl. Acad. Sci. U. S. 113: E2189-2198; Cirrincione et al., 2020, Sci Rep 10, 3970), a mouse RNAseq dataset in which mice received four intraperitoneal injections of either vehicle or 2mg/kg paclitaxel every other day four times (Cirrincione et al., 2022, Data 7: 72) was analyzed. In this experiment, skin was harvested on days 4, 7, 11, and 23 for comparisons of gene expression profiles (shown in FIG. 3A). Peripheral neuropathy was correlated with these times points using von Frey behavioral testing, which determined that peak neuropathy was present at day 7 (D7). Peripheral neuropathy was further determined by gene coexpression profiles (log2 fold-change: >0.65) (shown in FIG. 3C). This identified several biological categories during peak neuropathy with the largest clusters being implicated in extracellular matrix organization (e.g. "ECM", "collagen-containing ECM", "collagen trimer") and cell cycle regulation (e.g. "outer kinetochore", "kinesin complex", condensed chromosome, centromeric region", "mitotic spindle", "microtubules"), consistent with our findings in zebrafish. Interactome analysis using STRING (Szklarczyk et al., 2021, Nucl. Acids Res 49: D605-D612) to predict protein association networks further identified major clusters involved in cell cycle regulation, which contained various kinesins, microtubule and nucleus regulators, as well as one cluster annotated as "disulfide bond", consistent with a role for oxidative signal activation (Leonard et al., 2011, Current opinion in chemical biology 15: 88-102) (shown in FIG. 3D). Given that paclitaxel is a known cell cycle checkpoint regulator (Jia et al., 2016, Nature communications 7: 10818; Leonard etal., 2011, Current opinion in chemical biology 15: 88- 102), expression of the known checkpoint regulators, Plkl, Cdc20, Ndc80, Bublc, Dlgap5 was further analyzed and showed a co-upregulation from D7 onward (shown in FIG. 3E). Additional genes in the data set that were upregulated during peak neuropathy and formed a network included the mitosis regulating genes, including Cdkl, Aurka, Aurkb, and Kifll (shown in FIG. 3F). Kifll, which encodes Eg5 (also known as Kinesin-5), was especially informative because 1) members of the Kinesin family are implicated in microtubule regulation and cell cycle progression (Hirokawa et al., 2009, Nat Rev Mol Cell Biol 10: 682-696), 2) the implication of Eg5 in the regulation of cytokinesis via its microtubule crosslinking activity (Leary etal., 2019, Curr Biol 29: 3825-3837. e3823), consistent with the microtubule fasciculation phenotype, and 3) Eg5 inhibition in mice with the small molecule inhibitor, monastrol, has been shown to alleviate CIPN caused by bortezomib (Bobylev et al., 2017, Neurotox Res 32: 555-562). Besides Kifll, other upregulated Kif genes were found during peak neuropathy: Kif2c, Kif 14, Kifl5, Kif20a, Kif20b and Kif23 (shown in FIG. 3G). Expression profiles of several Nox family genes were further analyzed and showed that Cyba and Cybb, the latter being specific to immune cells, were upregulated at D23, whereas other genes, such as Noxl and Nox4 were slightly but not increased at varying days (shown in FIG. 3H).
[000101] To determine the extent to which these findings are conserved in humans, RNAseq was conducted on three paclitaxel-treated breast cancer patients with CIPN and three age/sex-matched healthy controls. Upon enrolment, each participant completed a questionnaire and physical examination, followed by a full-thickness skin punch biopsy. The patients were diagnosed with CIPN 35 weeks (CIPN35), 31 weeks (CIPN31), and 5 weeks (CIPN05) prior to the biopsy. After RNA extraction and processing, Illumina RNAseq analysis was performed, followed by heatmap and PCA plot generation using iDEP (Ge et al., 2018, BMC Bioinformatics 19: 534). Differences in gene expression between the three CIPN patients and healthy controls were evident from these two analyses (shown in FIG. 31). Further enrichment analysis showed that the patients with their first CIPN diagnosis 31 and 35 weeks prior to the skin biopsy shared distinct gene clusters that separated from the patient with the most recent CIPN diagnosis (5 weeks prior). Although KIF 11 was upregulated in all three patients compared with controls, the expression differences were not due to a strong expression increase in one of the CIPN patients (CIPN31). Differential gene expression analysis further identified several other upregulated KIF genes (shown in FIG. 3 J). STRING interactome analysis of upregulated KIF genes revealed that KIF11 serves as a central hub for these co-upregulated KIF genes (shown in FIG. 3K). Expression analysis of NADPH oxidases identified N0X1 and CYBB as the most highly upregulated genes in the paclitaxel -treated patient skin compared with healthy controls (shown in FIG. 3L). Using the top 1,200 most variable differentially expressed genes, three major clusters were further identified with iDEP (shown in FIG. 3M). The first cluster showed pathways downregulated in the CIPN patients, which included processes, such as "epithelium/epidermis development1', "keratinocyte differentiation", "gluconeogenesis", and "lipid catabolic processes". The second cluster (B) harbored genes upregulated in the 5-week CIPN patient skin, and these were involved in processes like "hydrogen peroxide catabolic process", "cell death", and "response to hydrogen peroxide". Cluster C contained genes upregulated in the 31/35-week CIPN patients, with functions in "chromatin remodeling/assembly/disassembly", "chromosome condensation", "chromosome organization", and "DNA conformation change". These results establish conserved skin-specific gene expression profiles for mice and humans whereby paclitaxel promoted expression of genes involved in cell cycle and oxidative stress regulation.
Example 4: Kiflll S promoted dfMT and nuclear X-ROS formation in zebrafish [000102] Because Eg5 has been linked to bortezomib-induced peripheral neuropathy, subsequent analyses were focused on this cell cycle regulator, using primarily zebrafish due to their in vivo imaging capabilities. First, whether paclitaxel induced Eg5 expression in caudal fin keratinocytes was determined. Following 96hr vehicle treatment, Eg5 immunofluorescence staining with an antibody targeting the conserved phosphorylation site, Thr927 (PTGTTPQRK - SEQ ID NO: 24), revealed a uniform punctate Eg5 localization in the caudal fin except around the fin edge (shown in FIG. 4A). Treatment with 22pM paclitaxel for 96 hours promoted Eg5 puncta formation and Eg5 location to structures reminiscent of microtubule asters, such as formed during early mitosis (Meaders etal., 2020, Cell Rep 33: 108213), which was most prominent at the fin edge. Because of the microtubule crosslinking activity of Eg5 during spindle formation and elongation (Goulet et a/., 2013, Int Rev Cell Mol Biol 304: 419-466; Mann et al., 2019, Trends Cell Biol 29: 66-79), which resembles the observed Eg5 expression pattern in keratinocytes, whether Eg5 played a role in paclitaxel-dependent dfMT formation was determined. Indeed, combination of the Eg5 inhibitor, EMD534085, with 22pM paclitaxel largely prevented dfMTs formation in the majority of animals (vehicle: 0%, EMD534085: 0%, lOOnM paclitaxel: 20%, lOOnM paclitaxel+ EMD534085: 16%, 22pM paclitaxel: 65.22%, 22pM paclitaxel+EMD534085: 9.5%) (shown in FIG. 4B and FIG. 4C). Similarly, the number of dfMT -harboring keratinocytes per animal was reduced with EMD534085/paclitaxel coadministration (96hr vehicle: 0±0 vs. EMD534085: 0±0 vs. lOOnM paclitaxel: 0.4±0.21 vs. lOOnM paclitaxel+EMD534085: 0.8±0.38 vs. 22pM paclitaxel: 6.957+1.49 vs. 22pM paclitaxel+EMD534085: 0.52±0.36 cells/animal) (shown in FIG. 4D). Since 25pM EMD534085 was administered after 2d of vehicle and paclitaxel treatment, the few keratinocytes harboring dfMTs in the presence of 22pM paclitaxel and EMD534085 likely formed prior to inhibitor administration, consistent with the finding that dfMTs were already present in some animals after 48hr paclitaxel treatment (shown in FIG. II and FIG. 1 J).
[000103] To validate the specificity of Eg5, kifll was transiently deleted by injecting CRISPR oligos into 1-cell stage embryos. These were directed to exon 5 (~90aa of 1072aa), which eliminated Eg5 protein expression (shown in FIG. 4E) (percent animals with dfMTs: CRISPR+vehicle: 0%; CRISPR+22pM paclitaxel: 25%; number of keratinocytes per animal with dfMTs: CRISPR+vehicle: 0+0; CRISPR+22pM paclitaxel: 0.29+0.16) (shown in FIG. 4B- D). Interestingly, transient kifll CRISPR knockout also reduced microtubule detyrosination when comparing 96hr vehicle and paclitaxel treated animals, suggesting a role for Eg5 in detyrosination, which was not modified when animals were treated with EMD534085 (normalized detyrosination fluorescence intensity: vehicle: 1.2+0.11 vs. CRISPR+vehicle: 1.12+0.2; 22pM paclitaxel: 2.62+0.14 vs. CRISPR+paclitaxel: 0.85+0.11) (shown in FIG. 4F). Importantly, increased total and phospho-Eg5 levels were also detected in basal and suprabasal epidermal keratinocytes of mice following a single injection of either vehicle or 20mg/kg paclitaxel (shown in FIG. 4G). These findings established a conserved role for paclitaxel in epidermal Eg5 induction.
[000104] To determine whether Eg5 acted upstream of X-ROS and sensory axon degeneration, the subcellular localization of Noxl in the presence and absence of EMD534085 was first analyzed. Immunofluorescence staining showed that EMD534085 co-administration with paclitaxel led to more condensed cytoplasmic vesicles compared with paclitaxel alone. Although EMD534085 did not affect paclitaxel-induced Noxl plasma membrane translocation (Membrane:cytoplasmic ratio: vehicle: 1.78+0.09 vs. EMD534085: 1.7+0.1 vs. paclitaxel: 2.35±0.17 vs. paclitaxel+ EMD534085: 2.072±0.12), Noxl was however largely absent from the nucleus in EMD534085-treated animals (Nucleus:cytoplasmic ratio: vehicle: 1.04±0.09 vs. EMD534085: 1.36±0.08 vs. paclitaxel: 1.73±0.1.6 vs. paclitaxel+ EMD534085: 1.35±0.08) (shown in FIG. 4H and FIG. 41). This indicated that Eg5 induced Noxl nuclear, but not plasma membrane, translocation in a paclitaxel-dependent manner.
[000105] Further quantification of compartmentalized ElyPer oxidation near the plasma membrane and the nucleus (co-labelled with Hoechst33342) showed increased oxidation within the nucleus upon paclitaxel treatment, but surprisingly not at the plasma membrane. Nuclear HyPer oxidation was reduced upon co-administration of EMD534085 without effects on plasma membrane oxidation (shown in FIG. 4J). These findings supported a role for Eg5 in nuclear X- ROS production as a result of microtubule fasciculation and increased mechanical tension.
Example 5: Detyrosinated fasciculated microtubules associated with nuclei
[000106] It was expected that dfMTs should be in close proximity to the nucleus in order to activate Noxl by mechanotransduction. To further confirm this expectation, high resolution imaging and 3D rendering of keratinocyte dfMTs and nuclei were used. These experiments demonstrated that 96hr paclitaxel treatment led to a partial association between dfMTs and nuclei (shown in FIG. 5A) whereby the nuclear content was sometimes pinched off or nuclei were perforated by dfMTs (shown in FIG. 5B). Moreover, dfMTs were typically associated with enlarged nuclei (vehicle nuclear volume: 291.3±30.62pm3 vs. paclitaxel: 582±83.18pm3) (shown in FIG. 5C) that were less spherical (1 = spherical vs. 0 = nonspherical: vehicle: 0.27±0.01 vs. paclitaxel: 0.23±0.01) (shown in FIG. 5D). These results further suggested that dfMTs formed a physical barrier that impairs nuclear function.
Example 6: EMD534085 promoted keratinocyte mitosis and cell death in the presence of paclitaxel
[000107] Because paclitaxel induced Eg5 expression in keratinocytes, and in cancer cells has a major role in preventing mitosis while promoting apoptosis (Jordan et al., 1993, Proceedings of the National Academy of Sciences of the United States of America 90: 9552- 9556; Zasadil et al, 2019, Sci Transl Med 6: 229ra243; Zhao et al., 2022, Apoptosis 27: 647- 667), whether Eg5 inhibition in combination with paclitaxel influenced keratinocyte mitosis and apoptosis was investigated. If dfMTs form a physical barrier, increased mitosis should be seen when EMD534085 was co-administered with paclitaxel. Consistent with this hypothesis, in vitro studies using paclitaxel sensitive and resistant ovarian cancer cells showed that Eg5 inhibition with HR22C16-A1 antagonized the effects of paclitaxel on mitotic inhibition (Marcus et al., 2018, Mol Med 'Rep 17: 8289-8299). To examine the effects of EMD534085 on mitosis, cell divisions in keratinocytes expressing nuclear h2a-h2a:GFP were quantified using 12hr time-lapse imaging. Surprisingly, cell divisions in caudal fin keratinocytes at 3dpf (embryonic to larval transition) and 6dpf (late larval stage) were rare. The few divisions present were mostly restricted to the distal notochord region, with an average of 0.96±0.20/12hr divisions at 3dpf and 1.16±0.44/12hr at 6dpf in this region (shown in FIG. 6A). At least 1 cell division/12hr was present in 40-60% of animals either treated with vehicle, lOOnM and 22pM paclitaxel, as well as upon treatment with EMD534085 and lOOnM paclitaxel/EMD534085. Combination treatment with 22pM paclitaxel and EMD534085 increased the percentage of animals with at least 1 cell division to 88% (shown in FIG. 6B). Mitotic divisions per animal were also increased with EMD534085 and 22pM paclitaxel in combination, possibly due to reduced fasciculation leading to less impaired nuclei to divide (96hr, vehicle: 1.07±0.3 vs. lOOnM paclitaxel: 0.72±0.423 vs. 22 pM paclitaxel: 1.4±0.67 vs. EMD534085: 1.27±0.46/12hr vs. lOOnM paclitaxel+EM534085: 1.55±0.62/12hr vs. 22pM paclitaxel+EMD534085: 3.125±1.18) (shown in FIG. 6C).
[000108] Since apoptosis has been found to be the primary mechanism of cell death upon paclitaxel treatment (Zasadil et al., 2019, Sci TranslMed 6: 229ra243; Zhao et al., 2022, Apoptosis 27: 647-667; Marcus et al., 2018, Moi 'Med Rep 17: 8289-8299; Ren et al., 2018, Mol Med Rep 17: 8289-8299; Jordan et al., 1996, Cancer research 56: 816-825), the effects of 96hr paclitaxel/EMD534085 combination treatment on cell death by imaging h2a:h2a-GFP fish were further explored with in vivo time-lapse imaging for 12 hours. Overall, there was either none or very little cell death in vehicle and lOOnM paclitaxel-treated animals, whereas 22pM paclitaxel increased the number of dying cells, however, this was not significant due to great variability (vehicle: 0±0 vs. lOOnM paclitaxel: 0.18±0.18 vs. 22pM paclitaxel: 0.6±0.3 dying cells/ caudal fin). EMD534085 alone increased cell death slightly above 22pM paclitaxel treatment, and surprisingly reduced cell death when co-administered with lOOnM paclitaxel (EMD534085: 0.81±0.26 vs. lOOnM paclitaxel+EMD534085: 0.07±0.07). Nevertheless, EMD534085 combination with 22pM paclitaxel significantly increased cell death compared with vehicle (22pM paclitaxel+EMD534085: 1.37±0.53) but not with paclitaxel (shown in FIG. 6D and FIG. 6E). Thus, while EMD534085 in combination with a paclitaxel slightly enhanced mitosis, its effects on cell death were negligible. These findings indicate that keratinocyte dfMTs were formed independently of mitosis but impact mitotic behavior, while effects on apoptosis in the presence of paclitaxel are not enhanced (shown in FIG. 6F).
Example 7: Eg5 did not influence microtubule growth behavior
[000109] These findings set forth above suggested that Eg5 acts on stable microtubules. To validate this, microtubule growth dynamics were characterized in basal keratinocytes expressing the microtubule plus-end binding protein, EB3-GFP (courtesy of R. Koester) (Distel et a , 2010, The Journal of cell biology 191: 875-890). Time-lapse recordings (Ifr/sec for 60sec) showed that, as expected, EB3-GFP mostly localized to microtubule plus-ends during growth. However, a small proportion of keratinocytes also harbored uniformly labelled EB3-positive microtubules, consistent with previous observations in murine axons (Kleele et al., 2015, Proceedings of the National Academy of Sciences of the United States of America 112: 7501-7506). Paclitaxel treatment for 3hr resulted in an increased number of keratinocytes with uniform EB3 labelling (3hr vehicle: 5.12% vs. paclitaxel: 19.29%; 48hr vehicle: 0% vs. paclitaxel: 10.09%; 96hr vehicle: 3.44% vs. 22pM paclitaxel: 20.13%) (shown in FIG. 7A and FIG. 7B), indicative of microtubule stabilization. Intriguingly, however, microtubules with uniform EB3-GFP binding appeared linear and continuous treatment for 48hr and 96hr with paclitaxel further enhanced the linearity (shown in FIG. 7C). This behavior therefore contrasts the curved conformation of stable dfMTs. Further analysis of microtubule growth dynamics showed that 3hr paclitaxel treatment decreased the growth velocity and track length of microtubules, whereas comet duration per se was not affected (shown in FIG. 7D-7H). Combination treatment of EMD534085 and 22pM paclitaxel did not alter the effects induced by paclitaxel alone, suggesting that Eg5 does not influence paclitaxel-dependent microtubule growth dynamics.
[000110] To further determine whether microtubule stabilization per se leads to curved microtubules, or whether this was a specific property pertaining to paclitaxel, microtubules in keratinocytes of zebrafish injected with CMV:Tau-Bfp2 were analyzed. This microtubule- associated protein has been shown to induce microtubule stabilization by binding to the interface between a and p-tubulin heterodimers (Kadavath et al., 2015, Proceedings of the National Academy of Sciences of the United States of America 112: 7501-7506; Ross el al., 2004, Proceedings of the National Academy of Sciences of the United States of America 101 : 12910- 12915). In experiments disclosed herein it was found that Tau-Bfp2 induced fasciculation and mild curving of microtubules (shown in FIG. 8A), which differed from the curved dfMT conformation induced by paclitaxel. Intriguingly, treatment of zebrafish expressing Tau-Bfp2 in keratinocytes for 96hr with paclitaxel promoted linearization of microtubules rather than circularization (l=straight, 0=curved: 96hr weak Tau-Bfp2 expression: 0.94±0.01, strong Tau- Bfp2 labelling: 0.93±0.01, strong Tau-Bfp2+paclitaxel: 0.98±0.002) (shown in FIG. 8B and FIG. 8C), consistent with previous findings (Kadavath et al., 2015, Proceedings of the National Academy of Sciences of the United States of America 112: 7501-7506). Tau therefore seems to prevent paclitaxel-induced dfMT formation. Together these data suggested that dfMTs formed as a consequence of paclitaxel dependent Eg5 activation rather than microtubule stabilization per se.
[000111] Interestingly, co-expression of EB3-GFP with Tau-Bfp2 in keratinocytes revealed a subpopulation of growing EB3-GFP plus-ends that grew along stable Tau-Bfp2 microtubules (shown in FIG. 8D and FIG. 8E). Treatment with 22pM paclitaxel for 96hr further increased Tau-Bfp2 and EB3-GFP co-localization regardless of weak or strong Tau-Bfp2 expression (EB3- GFP puncta co-localized with Tau-Bfp2, weak Tau-Bfp2 expression: 85.42±1.64% of, strong Tau-Bfp2 expression: 86.13±1.22%, Tau-Bfp2+96hr paclitaxel: 91.26±1.64%). Also the velocity of EB3-GFP plus-ends moving along these linear Tau-Bfp2 microtubules was increased with paclitaxel treatment compared to Tau-Bfp2 alone (weak Tau-Bfp2: 0.155±0.003pm/s, high Tau- Bfp2: 0.156±0.003pm/s vs. Tau-Bfp2+96hr paclitaxel: 0.184±0.003pm/s) (shown in FIG. 8F). Plotting of the X/Y positions of some microtubules revealed that EB3-GFP growth trajectories closely followed Tau-Bfp2 associated microtubule filaments (shown in FIG. 8G and FIG. 8H). Thus EB3-GFP plus-ends appeared in part to grow along pre-existing stable microtubules, which could be a means to maintain cellular organization.
Example 8: Keratinocyte-specific Eg5 overexpression promoted cutaneous sensory axon degeneration
[000112] That the earliest signs of paclitaxel-induced axon degeneration are evident at the distal fin edge had been shown to be due to MMP-13 dependent ECM degradation (Lisse et al., 2016, Proceedings of the National Academy of Sciences of the United States of America 113: E2189-2198; Cirrincione et al., 2020, Sci Rep 10, 3970), consistent with the vast majority of dfMTs being present in this region (shown in FIG. 1G). To determine whether EG5-dependent dfMTs induced axon degeneration, axon degeneration in zebrafish that were treated for 96hr with low (lOOnM) and high (22pM) paclitaxel concentrations in the presence and absence of EMD534085 was assessed. Treatment with vehicle, EMD534085 and lOOnM paclitaxel did not alter axon branch number assessed with acetylated tubulin staining. Treatment with 22pM paclitaxel, however, reduced the axon branch number as previously shown (96hr: vehicle: 10.83±0.58, EMD534085: 10.25±0.47, lOOnM paclitaxel: 9.86±0.43, lOOnM paclitaxel +48hr EMD534085: 10.73±0.63, 22pM paclitaxel: 7.54±0.56 branches/50pm) (shown in FIG. 9A and FIG. 9B). Intriguingly, combination treatment of 22pM paclitaxel and EMD534085 rescued axon degeneration even above control levels (19.89±1.09 branches/50pm). These findings were consistent with observations that monastrol promotes neurite outgrowth in cultured mouse DRG neurons (Haque etal., 2004, Cell Motil Cytoskeleton 58: 10-16), suggesting a neuron-intrinsic growth effect. To further validate Eg5 as the pharmacological target of EMD534085 in axon regeneration, zebrafish injected with kifll CRISPR oligo were also analyzed. Paclitaxel-treated kifll CRISPR zebrafish did not show altered axon branch numbers in the caudal fin compared with vehicle-treated CRISPR and wildtype controls, although axon growth was not increased, as seen with EMD534085 ( /77-CRISPR+vehicle: 12.08±0.68, /77-CRISPR+22pM paclitaxel: 12.83±0.96) (shown in FIG. 9B). These findings implicated Eg5 as downstream target of paclitaxel in axon degeneration, although it was not determined why kifll knockout modulated axon behavior differently from pharmacological Eg5 inhibition, possibly due to developmental effects of the CRISPR oligo.
[000113] Whether Eg5-dependent axon degeneration was caused by keratinocyte or neuron-specific effects (because inter alia Eg5 was also expressed neuronally (Falnikar et al., 2011, Mol Biol Cell 22: 1561-1574; Wei et al., 2022, Neurotherapeutics 19: 1401-1413) was determined as set forth herein. Possible neuron-intrinsic axon growth effects with EMD534085 were observed. Initially the extent to which axonal microtubules were stabilized was determined and whether this process was altered using EMD534085 in the presence and absence of paclitaxel. Quantification of axonal detyrosination in wildtype distal fins following 96hr treatment with either vehicle or EMD534085 showed a punctate pattern in axons, whereas 22pM paclitaxel but not paclitaxel/EMD534085 promoted a uniform distribution of dMTs along axon segments (shown in FIG. 9C). Quantification of the average detyrosination fluorescence intensity along individual axon segments however showed that only paclitaxel differed from EMD534085 (normalized GluTub intensity ratios, wildtype 96hr vehicle: 2.44±0.24, EMD534085: 2.13±0.13, 22pM paclitaxel: 3.19±0.42, 22pM paclitaxel+EMD534085: 2.86±0.21) (shown in FIG. 9B, FIG. 9C, and FIG. 9E). Thus, paclitaxel does not appear to regulate dMT formation via Eg5 in axons.
[000114] Next a transgene encoding tp63 A//'//-AcGFP for transient Eg5 overexpression in keratinocytes was injected. Plasmids isll :tdTomato were further co-expressed in sensory neurons to label wildtype axons. Eg5 preferentially located to keratinocyte nuclei with some cytoplasmic labelling (shown in FIG. 9F and FIG. 9G), consistent with its nuclear localization in cultured interphase HeLa cells (Muretta et al. , 2018, Proceedings of the National Academy of Sciences of the United States of America 115: E1779-E1788). Transient plasmid DNA injections into zebrafish typically mosaically label cells, which allowed for the observation of axons in the absence and presence of Eg5-overexpressing keratinocytes. Whereas wildtype axons in animals with few Eg5-GFP positive (<10) keratinocytes) remained intact (shown in FIG. 9F, top panel), axons in contact with large areas of Eg5 overexpressing keratinocytes (>20) degenerated (shown in FIG. 9F, bottom panel), FIG. 9G, and FIG. 9H). Therefore, keratinocyte-specific Eg5 overexpression mimicked paclitaxel-induced sensory axon degeneration. These findings supported a model in which Eg5 activation by paclitaxel stimulated X-ROS formation and MMP-13 dependent ECM degradation in keratinocytes, ultimately leading to axon degeneration (shown in FIG. 91).
Example 9: Paclitaxel induced dfMT and brittle skin in keratinocytes of mice, which was rescued by Eg5 inhibitor
[000115] The data set forth herein showed that paclitaxel increased dfMT in an Eg5- dependent manner in zebra fish. To test whether this phenotype was also present in mice, 12- week old C57BL6/J mice were intraperitoneally injected with vehicle (0.5% DMSO//lxPBS), paclitaxel (24mg/kg; one injection), and the EG5 inhibitor, EMD534085 (20mg/kg; 3 injections: 1 before, during, and after paclitaxel), as indicated in the schematic of FIG. 11 A. These mice were then sacrificed and the skin of the hind paw pad was fixed in 4% paraformaldehyde, followed by sectioning and staining with 1) anti-GluTub (to detect detyrosinated microtubules) and 2) DAPI to detect nuclei. As shown in FIG. 11B, paclitaxel treatment increased GluTub fluorescence, indicating increased dfMT. The thick white arrows in the paclitaxel image showed brittle skin in the stratum spinosum. While these cells lost their nucleus, these dark spots (empty regions) were not present in animals injected with vehicle or paclitaxel +EMD, suggesting a rescue effect. The white arrows point to cells that have increased detyrosination which was seen around the nucleus (high mag Paclitaxel image - FIG. 11B). The white arrows in the Pcxt+EMD image showed dMT; however, the high magnification image and DAPI image demonstrated that these cells were not associated with nuclei and seemed to be either dead cells or another cell type (not keratinocytes). The number of epidermal keratinocytes with dMT was quantified in FIG. 11C, which showed an increase with paclitaxel treatment. The increase was dampened when paclitaxel was injected with EMD534085.
[000116] In summary, the data showed that the phenotype observed in zebrafish was conserved in mammals, namely that paclitaxel induced dMT in epidermal keratinocytes, which can be rescued by EG5 inhibition with EMD534085.
[000117] All publications, patents, and patent applications mentioned in this specification areherein incorporated by reference to the same extent as if each individual publication, patent, and patent application was specifically and individually indicated to be incorporated by reference.
[000118] While some embodiments have been illustrated and described in detail in the appended drawings and the foregoing description, such illustration and description are to be considered illustrative and not restrictive. Other variations to the disclosed embodiments can be understood and effected in practicing the claims, from a study of the drawings the disclosure, and the appended claims. The mere fact that certain measures or features are recited in mutually different dependent claims does not indicate that the combination of these measures or features cannot be used. Any reference signs in the claims should not be construed as limiting the scope.
Attorney Docket No: 23-0726-WO
References
1. E. Gomstein, T. L. Schwarz, The paradox of paclitaxel neurotoxicity: Mechanisms and unanswered questions. Neuropharmacology 76 Pt A, 175-183 (2014).
2. A. A. Argyriou, J. Bruna, A. A. Genazzani, G. Cavaletti, Chemotherapy-induced peripheral neurotoxicity: management informed by pharmacogenetics. Nat Rev Neurol 13, 492- 504 (2017).
3. A. A. Argyriou, J. Bruna, P. Marmiroli, G. Cavaletti, Chemotherapy -induced peripheral neurotoxicity (CIPN): an update. Crit Rev Oncol Hematol 82, 51-77 (2012).
4. A. A. Argyriou et al., Neurophysiological, nerve imaging and other techniques to assess chemotherapy-induced peripheral neurotoxicity in the clinical and research settings. Journal of neurology, neurosurgery, and psychiatry, (2019).
5. A. A. Argyriou, V. Zolota, O. Kyriakopoulou, H. P. Kalofonos, Toxic peripheral neuropathy associated with commonly used chemotherapeutic agents. J BUON 15, 435-446 (2010).
6. A. J. Beijers, J. L. Jongen, G. Vreugdenhil, Chemotherapy-induced neurotoxicity: the value of neuroprotective strategies. Neth J Med 70, 18-25 (2012).
7. J. A. Boyette-Davis, E. T. Walters, P. M. Dougherty, Mechanisms involved in the development of chemotherapy-induced neuropathy. Pain Manag 5, 285-296 (2015).
8. S. J. L. Flatters, P. M. Dougherty, L. A. Colvin, Clinical and preclinical perspectives on Chemotherapy-Induced Peripheral Neuropathy (CIPN): a narrative review. Br J Anaesth 119, 737-749 (2017).
9. G. J. Bennett, G. K. Liu, W. H. Xiao, H. W. Jin, C. Siau, Terminal arbor degeneration— a novel lesion produced by the antineoplastic agent paclitaxel. Eur J Neurosci 33, 1667-1676 (2011).
10. N. P. Staff et al., Pathogenesis of paclitaxel-induced peripheral neuropathy: A current review of in vitro and in vivo findings using rodent and human model systems. Experimental neurology 324, 113121 (2020).
11. M. Seretny et al., Incidence, prevalence, and predictors of chemotherapy-induced peripheral neuropathy: A systematic review and meta-analysis. Pain 155, 2461-2470 (2014). Attorney Docket No: 23-0726-WO
12. S. E. Pease-Raissi et al., Paclitaxel Reduces Axonal Bclw to Initiate IP3R1 -Dependent Axon Degeneration. Neuron 96, 373-386 e376 (2017).
13. I. Bobylev et al., Paclitaxel inhibits mRNA transport in axons. Neurobiol Dis 82, 321-331 (2015).
14. Y. Li et al., The Cancer Chemotherapeutic Paclitaxel Increases Human and Rodent Sensory Neuron Responses to TRPV1 by Activation of TLR4. J Neurosci 35, 13487-13500 (2015).
15. L. Brandolini et al., CXCR1/2 pathways in paclitaxel-induced neuropathic pain. Oncotarget 8, 23188-23201 (2017).
16. T. S. Lisse et al., Paclitaxel-induced epithelial damage and ectopic MMP-13 expression promotes neurotoxicity in zebrafish. Proceedings of the National Academy of Sciences of the United States of America 113, E2189-2198 (2016).
17. A. M. Cirrincione et al., Paclitaxel-induced peripheral neuropathy is caused by epidermal ROS and mitochondrial damage through conserved MMP-13 activation. Sci Rep 10, 3970 (2020).
18. G. J. Shin et al., Integrins protect sensory neurons in models of paclitaxel-induced peripheral sensory neuropathy. Proceedings of the National Academy of Sciences of the United States of America 118, (2021).
19. A. A. Hyman, S. Salser, D. N. Drechsel, N. Unwin, T. J. Mitchison, Role of GTP hydrolysis in microtubule dynamics: information from a slowly hydrolyzable analogue, GMPCPP. Mol Biol Cell 3, 1155-1167 (1992).
20. I. Amal, R. H. Wade, How does taxol stabilize microtubules? Curr Biol 5, 900-908 (1995).
21. M. E. Hallak, J. A. Rodriguez, H. S. Barra, R. Caputto, Release of tyrosine from tyrosinated tubulin. Some common factors that affect this process and the assembly of tubulin. FEBS letters 73, 147-150 (1977).
22. J. Nieuwenhuis, T. R. Brummelkamp, The Tubulin Detyrosination Cycle: Function and Enzymes. Trends Cell Biol 29, 80-92 (2019).
23. C. Y. Chen et al., Suppression of detyrosinated microtubules improves cardiomyocyte function in human heart failure. Nature medicine 24, 1225-1233 (2018). Attorney Docket No: 23-0726-WO
24. J. P. Kerr et al., Detyrosinated microtubules modulate mechanotransduction in heart and skeletal muscle. Nature communications 6, 8526 (2015).
25. A. Mialhe et al., Tubulin detyrosination is a frequent occurrence in breast cancers of poor prognosis. Cancer research 61, 5024-5027 (2001).
26. L. Peris et al., Tubulin tyrosination regulates synaptic function and is disrupted in Alzheimer's disease. Brain : a journal of neurology, (2022).
27. J. Dalous et al., Reversal of cell polarity and actin-myosin cytoskeleton reorganization under mechanical and chemical stimulation. Biophys J 94, 1063-1074 (2008).
28. M. Thery, A. Jimenez-Dalmaroni, V. Racine, M. Bomens, F. Julicher, Experimental and theoretical study of mitotic spindle orientation. Nature 447, 493-496 (2007).
29. A. J. Engler, S. Sen, H. L. Sweeney, D. E. Discher, Matrix elasticity directs stem cell lineage specification. Cell 126, 677-689 (2006).
30. K. Grote et al., Mechanical stretch enhances mRNA expression and proenzyme release of matrix metalloproteinase-2 (MMP-2) via NAD(P)H oxidase-derived reactive oxygen species. Circulation research 92, e80-86 (2003).
31. R. J. Khairallah et al., Microtubules underlie dysfunction in duchenne muscular dystrophy. Sci Signal 5, ra56 (2012).
32. B. L. Prosser, C. W. Ward, W. J. Lederer, X-ROS signaling: rapid mechano-chemo transduction in heart. Science 333, 1440-1445 (2011).
33. P. Robison et al., Detyrosinated microtubules buckle and bear load in contracting cardiomyocytes. Science 352, aaf0659 (2016).
34. C. W. Ward, B. L. Prosser, W. J. Lederer, Mechanical stretch-induced activation of ROS/RNS signaling in striated muscle. Antioxid Redox Signal 20, 929-936 (2014).
35. A. Roll-Mecak, The Tubulin Code in Microtubule Dynamics and Information Encoding. Developmental cell 54, 7-20 (2020).
36. S. Khawaja, G. G. Gundersen, J. C. Bulinski, Enhanced stability of microtubules enriched in detyrosinated tubulin is not a direct function of detyrosination level. The Journal of cell biology 106, 141-149 (1988).
37. J. Cassereau, P. Codron, B. Funalot, Inherited peripheral neuropathies due to mitochondrial disorders. Revue neurologique 170, 366-374 (2014). Attorney Docket No: 23-0726-WO
38. S. J. Flatters, The contribution of mitochondria to sensory processing and pain. Prog Mol Biol Transl Sci 131, 119-146 (2015).
39. D. Pareyson, G. Piscosquito, I. Moroni, E. Salsano, M. Zeviani, Peripheral neuropathy in mitochondrial disorders. Lancet Neurol 12, 1011-1024 (2013).
40. D. S. Bilan, V. V. Belousov, In Vivo Imaging of Hydrogen Peroxide with HyPer Probes. Anti oxi d Redox Signal 29, 569-584 (2018).
41. D. S. Bilan et al., HyPer-3: a genetically encoded H(2)O(2) probe with improved performance for ratiometric and fluorescence lifetime imaging. ACS Chem Biol 8, 535-542 (2013).
42. A. Cirrincione, C. Reimonn, B. Harrison, S. Rieger, Longitudinal RNA sequencing of skin and DRG neurons in mice with paclitaxel-induced peripheral neuropathy. Data 7, 72 (2022).
43. A. Donko, Z. Peterfi, A. Sum, T. Leto, M. Geiszt, Dual oxidases. Philos Trans R Soc Lond B Biol Sci 360, 2301-2308 (2005).
44. K. Bedard, K. H. Krause, The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiological reviews 87, 245-313 (2007).
45. M. Ushio-Fukai, A. M. Zafari, T. Fukui, N. Ishizaka, K. K. Griendling, p22phox is a critical component of the superoxide-generating NADH/NADPH oxidase system and regulates angiotensin Il-induced hypertrophy in vascular smooth muscle cells. The Journal of biological chemistry 271, 23317-23321 (1996).
46. D. Szklarczyk et al., The STRING database in 2021 : customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res 49, D605-D612 (2021).
47. S. E. Leonard, K. S. Carroll, Chemical 'omics' approaches for understanding protein cysteine oxidation in biology. Current opinion in chemical biology 15, 88-102 (2011).
48. J. C. Waters, R. H. Chen, A. W. Murray, E. D. Salmon, Localization of Mad2 to kinetochores depends on microtubule attachment, not tension. The Journal of cell biology 141, 1181-1191 (1998).
49. L. Jia, B. Li, H. Yu, The Bubl-Plkl kinase complex promotes spindle checkpoint signalling through Cdc20 phosphorylation. Nature communications 7, 10818 (2016).
50. N. Hirokawa, Y. Noda, Y. Tanaka, S. Niwa, Kinesin superfamily motor proteins and intracellular transport. Nat Rev Mol Cell Biol 10, 682-696 (2009). Attorney Docket No: 23-0726-WO
51. A. Leary et al., Successive Kinesin-5 Microtubule Crosslinking and Sliding Promote Fast, Irreversible Formation of a Stereotyped Bipolar Spindle. Curr Biol 29, 3825-3837. e3823 (2019).
52. I. Bobylev et al., Kinesin-5 Blocker Monastrol Protects Against Bortezomib-Induced Peripheral Neurotoxicity. Neurotox Res 32, 555-562 (2017).
53. R. P. Brandes, N. Weissmann, K. Schroder, Nox family NADPH oxidases in mechanotransduction: mechanisms and consequences. Anti oxi d Redox Signal 20, 887-898 (2014).
54. S. X. Ge, E. W. Son, R. Yao, iDEP: an integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinformatics 19, 534 (2018).
55. J. L. Meaders, S. N. de Matos, D. R. Burgess, A Pushing Mechanism for Microtubule Aster Positioning in a Large Cell Type. Cell Rep 33, 108213 (2020).
56. A. Goulet, C. Moores, New insights into the mechanism of force generation by kinesin-5 molecular motors. Int Rev Cell Mol Biol 304, 419-466 (2013).
57. B. J. Mann, P. Wadsworth, Kinesin-5 Regulation and Function in Mitosis. Trends Cell Biol 29, 66-79 (2019).
58. M. A. Jordan, R. J. Toso, D. Thrower, L. Wilson, Mechanism of mitotic block and inhibition of cell proliferation by taxol at low concentrations. Proceedings of the National Academy of Sciences of the United States of America 90, 9552-9556 (1993).
59. L. M. Zasadil et al., Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Sci Transl Med 6, 229ra243 (2014).
60. S. Zhao, Y. Tang, R. Wang, M. Najafi, Mechanisms of cancer cell death induction by paclitaxel: an updated review. Apoptosis : an international journal on programmed cell death 27, 647-667 (2022).
61. A. I. Marcus et al., Mitotic kinesin inhibitors induce mitotic arrest and cell death in Taxol -resistant and -sensitive cancer cells. The Journal of biological chemistry 280, 11569- 11577 (2005).
62. X. Ren et al., Paclitaxel suppresses proliferation and induces apoptosis through regulation of ROS and the AKT/MAPK signaling pathway in canine mammary gland tumor cells. Mol Med Rep 17, 8289-8299 (2018). Attorney Docket No: 23-0726-WO
63. M. A. Jordan et al., Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research 56, 816-825 (1996).
64. M. Distel, J. C. Hocking, K. Volkmann, R. W. Koster, The centrosome neither persistently leads migration nor determines the site of axonogenesis in migrating neurons in vivo. The Journal of cell biology 191, 875-890 (2010).
65. T. Kleele et al., An assay to image neuronal microtubule dynamics in mice. Nature communications 5, 4827 (2014).
66. H. Kadavath et al., Tau stabilizes microtubules by binding at the interface between tubulin heterodimers. Proceedings of the National Academy of Sciences of the United States of America 112, 7501-7506 (2015).
67. J. L. Ross, C. D. Santangelo, V. Makrides, D. K. Fygenson, Tau induces cooperative Taxol binding to microtubules. Proceedings of the National Academy of Sciences of the United States of America 101, 12910-12915 (2004).
68. S. A. Haque, T. P. Hasaka, A. D. Brooks, P. V. Lobanov, P. W. Baas, Monastrol, a prototype anti-cancer drug that inhibits a mitotic kinesin, induces rapid bursts of axonal outgrowth from cultured postmitotic neurons. Cell Motil Cytoskeleton 58, 10-16 (2004).
69. A. Falnikar, S. Tole, P. W. Baas, Kinesin-5, a mitotic microtubule-associated motor protein, modulates neuronal migration. Mol Biol Cell 22, 1561-1574 (2011).
70. N. Wei et al., Inhibitions and Down-Regulation of Motor Protein Eg5 Expression in Primary Sensory Neurons Reveal a Novel Therapeutic Target for Pathological Pain. Neurotherapeutics 19, 1401-1413 (2022).
71. J. M. Muretta et al., A posttranslational modification of the mitotic kinesin Eg5 that enhances its mechanochemical coupling and alters its mitotic function. Proceedings of the National Academy of Sciences of the United States of America 115, E1779-E1788 (2018).
72. T. Akera, Y. Goto, M. Sato, M. Yamamoto, Y. Watanabe, Madl promotes chromosome congression by anchoring a kinesin motor to the kinetochore. Nat Cell Biol 17, 1124-1133 (2015).
73. R. A. Clark, T. K. Epperson, A. J. Valente, Mechanisms of activation of NADPH oxidases. Jpn J Infect Dis 57, S22-23 (2004). Attorney Docket No: 23-0726-WO
74. J. M. Cook-Mills, Hydrogen peroxide activation of endothelial cell-associated MMPs during VCAM-1 -dependent leukocyte migration. Cell Mol Biol (Noisy-le-grand) 52, 8-16 (2006).
75. Y. Son et al., Mitogen- Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways? J Signal Transduct 2011, 792639 (2011).
76. A. Dhar, M. R. Young, N. H. Colburn, The role of AP-1, NF-kappaB and ROS/NOS in skin carcinogenesis: the JB6 model is predictive. Molecular and cellular biochemistry 234-235, 185-193 (2002).
77. N. D'Ambrosi, S. Rossi, V. Gerbino, M. Cozzolino, Rael at the crossroad of actin dynamics and neuroinflammation in Amyotrophic Lateral Sclerosis. Front Cell Neurosci 8, 279 (2014).
78. M. A. Johnson, B. R. Henderson, The scaffolding protein IQGAP1 co-localizes with actin at the cytoplasmic face of the nuclear envelope: implications for cytoskeletal regulation. Bioarchitecture 2, 138-142 (2012).
79. D. Owen et al., The IQGAPl-Racl and IQGAP1-Cdc42 interactions: interfaces differ between the complexes. The Journal of biological chemistry 283, 1692-1704 (2008).
80. A. Hervera et al., Reactive oxygen species regulate axonal regeneration through the release of exosomal NADPH oxidase 2 complexes into injured axons. Nat Cell Biol 20, 307-319 (2018).
81. B. J. Benedikter et al., Redox-dependent thiol modifications: implications for the release of extracellular vesicles. Cell Mol Life Sci 75, 2321-2337 (2018).
82. A. Straube, A. Merdes, EB3 regulates microtubule dynamics at the cell cortex and is required for myoblast elongation and fusion. Curr Biol 17, 1318-1325 (2007).
83. G. T. Eisenhoffer et al., Crowding induces live cell extrusion to maintain homeostatic cell numbers in epithelia. Nature 484, 546-549 (2012).
References (Methods)
1. Lisse, T. S. et al. Paclitaxel-induced epithelial damage and ectopic MMP-13 expression promotes neurotoxicity in zebrafish. Proceedings of the National Academy of Sciences of the United States of America 113, E2189-2198, doi: 10.1073/pnas,1525096113 (2016).
2. O'Brien, G. S. et al. Coordinate development of skin cells and cutaneous sensory axons in zebrafish. Journal of Comparative Neurology 520, 816-831, doi:10.1002/cne.22791 (2012). Attorney Docket No: 23-0726-WO
3. Meijering, E., Dzyubachyk, O. & Smal, I. Methods for cell and particle tracking. Methods Enzymol 504, 183-200, doi: 10.1016/B978-0-12-391857-4.00009-4 (2012).
4. Nieuwenhuis, J. & Brummelkamp, T. R. The Tubulin Detyrosination Cycle: Function and Enzymes. Trends Cell Biol 29, 80-92, doi:10.1016/j.tcb.2018.08.003 (2019).
5. Cirrincione, A., Reimonn, C., Harrison, B. & Rieger, S. Longitudinal RNA sequencing of skin and DRG neurons in mice with paclitaxel-induced peripheral neuropathy. Data 7, 72, doi:https://doi.org/10.3390/data7060072 (2022).
6. Postma, T. J. et al. The development of an EORTC quality of life questionnaire to assess chemotherapy-induced peripheral neuropathy: the QLQ-CIPN20. Eur J Cancer 41, 1135-1139, doi:10.1016/j.ejca.2005.02.012 (2005).
7. Engelstad, J. K. et al. Epidermal nerve fibers: confidence intervals and continuous measures with nerve conduction. Neurology 79, 2187-2193, doi: 10.1212/WNL.0b013e3182759608 (2012).
Attorney Docket No: 23-0726-WO
De novo plasmids in this disclosure:
CREST3:EB3-GFP
Sequence:
CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTT
TAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGT
GTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAAC
CGTCTATCAGGGCGATGGCCCACGCTGGCTAAGAACTCATCAGCCTCCCCGGTCCATCTACCCACGTA
CCAATGCACCAATTGGCCACAATGACGGCTACTACATGGTGCCATTCCTTCCTCTTTATAGGAATGGAG
ACTACCTCCTGTCCAACAAGGCTCTTGGATACGAGTACGCCTACCTGTTGGACCCAGGTCATTGCACA
ACACCAGAAATGCCCTCTGATCTGCAAAAGACGTGAATATCTGTTCAGACACCCATATCCACTCTGTTC
CACACAGGTCAGAGGTTTGTCCAGGAGTTCTTGACAGAGGTGTAAAAAGTACTCAAAAATTTTACTCA
AGTGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAAAAGTAAAAGTATCTGGCTAGAATCTTA
CTTGAGTAAAAGTAAAAAAGTACTCCATTAAAATTGTACTTGAGTATTAAGGAAGTAAAAGTAAAAGC
AAGAAAGAAAACTAGAGATTCTTGTTTAAGCTTTTAATCTCAAAAAACATTAAATGAAATGCATACAA
GGTTTTATCCTGCTTTAGAACTGTTTGTATTTAATTATCAAACTATAAGACAGACAATCTAATGCCAGT
ACACGCTACTCAAAGTTGTAAAACCTCAGATTTAACTTCAGTAGAAGCTGATTCTCAAAATTGTTAGTG
TCAAGCCTAGCTCTTTTGGGGCTGAAAAGCAATCCTGCAGTGCTGAAAAGCCTCTCACAGGCAGCCGA
TGCGGGAAGAGGTGTATTAGTCTTGATAGAGAGGCTGCAAATAGCAGGAAACGTGAGCAGAGACTCC
CTGGTGTCTGAAACACAGGCCAGATGGGCCCTCGAGCAGGAAACAGCTATGACCATGATTACGCCAA
GCTATCAACTTTGTATAGAAAAGTTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATT
AGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGGTCGACC
GTATAGAAAAGTTGGTAACAGGATGTGACACGTCGTCTGCTTTAATCAGTGTTTGAGAGGGCACCTCT
ACACACTGAATGCCAAGCAAAGAAAGTCAGAAAATCTAAATAATAGCAAACATACACACACACACAT
ACACAAATATATATATCAACTCTTCATTCAGTTATTTACAAAAAAAACTGAGAATATCTGAACTAGCC
AGATGAAAAAAGAGAGCGAGAAAGGAGAAAAGAAAGAGAGAGAGAGATAAAATGAAAGAGACAGA
CAGAAACAGACAGAGGGAGAGGGAGTCAGTCTCTTGTGACCTACATGAAAGCAACGTGCCTCGCTAC
TCCTGGCTAAATGCACTCTCATATTAATATTTTAAAACGCCGTAATGTGACGGTGAAACCCTCGGAGG
ACAGATACATCAATTTGCAGGGGCCTCGGCTTCAGGAAAGAGAAACAGGGATAATTTGCCATTAGGA
GAAATTGTTCATTATGGGCAGCTTCTTAGGAACACATAAACCAAGTCGCCTCTCTCACGTGAGCTGCA
AATCCACACTTTTGAGTGAATGGAGACGTTGCCCGAGAGCTTTAATGCTCCTGGGTCATTAGTACAAA
AAGGTTTGTTGTGCTGTTAAATCTGCTGCATGTTGCGGTGATCAATCAACATGAAAGGGGCTTCCCACT
AAGACCGGATCACTGTAAATAAATCAATTAGGCCGCGAGAGTCAAGCTTTTATCAGAATTGTTGCTAC
ACACACACACACACACACACACACACAATCGGCTTATAGATTCAGTGCTGAACAGTCCGGTTCAGATT
CAGCTCAAAATAAATAAGACATCTGAGTTTGCTGATCATCGTTCAGCCAGTAAATGACACCAGCAGCA
GGCCAAGTTTCCATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTC
AAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTC
CCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACT
GGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATTTTGAAAATGGATTCTTTACA
GGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGTCACAGATA
GATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGACAGCATAGAATAAGTGCGACATCATCA
TCGGAAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCGTCGAGGTCGACCCCGGGAATTC
AGATCTCTCGAGCCGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGAC
GTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCC
GGGTCCGGGATTTACCCCCCACGACTCCGCCCCCTACGGCGCTCTGGATATGTAGCGGATCTACTAGT
GCGGCCCCTCTCGAGCCTCTAGAACTATAGTGAGTCGTATTACGTAGATCCAGACATGATAAGATACA
TTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGAT
GCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTT
ATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAATTCGCGGCCATCAAGCTTAGGCCTCCAAG
GCGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAA
ATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT
AACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAA Atorney Docket No: 23-0726-WO
GTAAAACCTCTACAAATGTGGTATGGCTGATTATCCGGAGTACTGTCCTCCGGGCTGGCGGAGTACTG
TCCTCCGGCAAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCAAGGC
GGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCC
TCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGA
GGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACT
GTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGTCCA
CTTAAGCTAGGTGGCCAGCGGTGGGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGA
AAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTCTAGAGGGTATATAATGGATCCCA
TCGCGTCTCAGCCTCACTTTGAGCTCCTCCACACGAATTCTTTGGCCACAAGCTGACCCTGAAGTTCAT
CTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACTACGGCGTGCAGTG
CTTCAGCATGGCCGTCAATGTGTACTCCACATCTGTGACCAGTGAAAATCTGAGTCGCCATGATATGCT
TGCATGGGTCAACGACTCCCTGCACCTCAACTATACCAAGATAGAACAGCTTTGTTCAGGGGCAGCCT
ACTGCCAGTTCATGGACATGCTCTTCCCCGGCTGTGTGCACTTGAGGAAAGTGAAGTTCCAGGCCAAA
CTAGAGCATGAATACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTTGACAA
AATCATTCCTGTAGAGAAATTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATTCAGTGGTTTA
AGAAATTCTTTGACGCAAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGAC
GTAGCGCCACCTCCTAACCCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGT
TCCACAGAGGACGTCCCCCACAGGCCCAAAAAACATGCAGACCTCTGGCCGGCTGAGCAATGTGGCC
CCCCCCTGCATTCTCCGGAAGAATCCTCCATCAGCCCGAAATGGCGGCCATGAGACTGATGCCCAAAT
TCTTGAACTCAACCAACAGCTGGTGGACTTGAAGCTGACAGTGGATGGGCTGGAGAAGGAACGTGAC
TTCTACTTCAGCAAACTTCGTGACATCGAGCTCATCTGCCAGGAGCATGAAAGTGAAAACAGCCCTGT
TATCTCAGGCATCATTGGCATCCTCTATGCCACAGAGGAAGGATTCGCACCCCCCATGAAGCAGCACG
ACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC
AACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGG
GCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAA
CGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATC
GAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGC
TGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGA
TCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGG
GCGGTGGAAGATCTGGGAATTCAAGGCCTCTCGAGCCTCTAGATTCTGCAGCCCTATAGcGCCATAGT
GACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGA
TATTTATATCATTTTACGTTTCTCGTTCAACTTTATTATACATAGTTGATAATTCACTGGCCGTCGTTTT
ACGGTACCATCGATGATGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGA
ATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGC
TGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGA
GGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGATCAGATCTG
CGAAGATACGGCCACGGGTGCTCTTGATCCTGTGGCTGATTTTGGACTGTGCTGCTCGCAGCTGCTGAT
GAATCACATACTTCCTCCATTTTCTTCCACTGATTGACTGTTATAATTTCCCTAATTTCCAGGTCAAGGT
GCTGTGCATTGTGGTAATAGATGTGACATGACGTCACTTCCAAAGGACCAATGAACATGTCTGACCAA
TTTCATATAATGTGAAAACGATTTTCATAGGCAGAATAAATAACATTTAAATTAAACTGGGCATCAGC
GCAATTCAATTGGTTTGGTAATAGCAAGGGAAAATAGAATGAAGTGATCTCCAAAAAATAAGTACTTT
TTGACTGTAAATAAAATTGTAAGGAGTAAAAAGTACTTTTTTTTCTAAAAAAATGTAATTAAGTAAAA
GTAAAAGTATTGATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCCAAAAATAATACTTAAGTACAG
TAATCAAGTAAAATTACTCAAGTACTTTACACCTCTGGTTCTTGACCCCCTACCTTCAGCAAGCCCAGC
AGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTT
AATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCC
ACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACA
TTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATC
GGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCT
GCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAG
AATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAA
AGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCA
AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
GCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGT
GCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGT Atorney Docket No: 23-0726-WO
AAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGC
GGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTG
CGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCG
CTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGAT
CCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATG
AGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGT
ATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGT
CTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCA
TCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAA
CCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTA
ATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTA
CAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGC
GAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAA
GTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCAT
CCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGA
CCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCT
CATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGA
TGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAA
AAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACT
CTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGT
ATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG (SEQ ID NO: 25) tp63:EB3-GFP
Sequence:
CGCCATTCTGCCTGGGGACGTCGGAGCACTCGAGAGAAACCAGGCTCAGTCGGGCACGACCATTACTC CACTTGACCAAACGTCTGCATATTTATAAATAATAATTTGCGTATTAATATGCAGATAAAGACAATTA AAAGAAGCAACAGTAGCATTAATCATTCAAATAACAGTATACAATCAAACAACATTTTGTATATATAT TTAAAAAAACAATACAAGGAGTAAAGACAAAGGCAATATCATTTAGTTTTTTTAATATTAACAAACCA CAGGCTGTGTGAACCATCAGCAATTTCAAACCAGAGGGATCTGCTTTTTTGGGAACGATGTTGCAAAT TTAATCTCTAGATTTTTTAAATCATGGATAGCCTCCCTAAAGCAAAAGCTTTTTAGGGGCTTTACTTCTC CTGATTGCAGCCTGTGGTATAATTTGTGATTGTTAGGTGGGTCAGGTTTTGGGGTCCAGCCCTTTGTGC ACTTTGACTATTGTCACCTTAGGCTGTCCCTTAATGCTGCCACCTCTGACCCCGGTGGGACACATAAAT AACTTCTCCACCCGAGTTAGCATTTCAAGCCAGTGCAATAAAGAAATTAAAAATAATTGATTTATTAA CAACTCTGTTTTATCTTTAAAAAATAAAATGTTTTATATCTAATGTTCACTCAGGTACCTGATATTGTTT GCTGTGCAATAATGTAGGTTAGTCATTATATTGACAAAGAAAATTAAATATGATGTTGTTTATTTTTAA TTTTACATTATAGACTAGATTAGATTTTCATTTGGAATTTAATTAGGAGTGCCTGGAGTGCATTGAGAA CGTTAAAAAAAAAAAATCTGCTTACTCTTATAGCTTTGGAAACTATTTTCAGATTATTACTCCACTATA GAAGCGATTCCTTTTTTTGAATAATTAAATATATATATACAGTGCTCAGCATAAATGATCATCACAGAT CTCTATTTTAAAGTATTATTTTTCCATAGGATGCTTTACAATAATATATGTGTGTGTATACATTAGAATT GTCAGTTACAAAATCAAAACTGCAACAAAATAACTAAACTTAAGATCTAATGAGTACACCCAAATTAA
ACCAAACATTAGTCTATGCAAAAATTAATATGTTAAGGAAAAATATTAAATACAATTTTAATATTCAG TCATTCATTTTCTTTTTTGCTTAGTCCCTTTATTAATCTGGGGTCGCCACAGTGGAATTAACTGCCAATT TATCCAGCATATATTTTATGCAGCGGATGCTCTTCCAGCTGCTACCCATCACTGGGAATCACCCATACA CTCTCATTCACACACATACACTACGGACAATTTAGCCTACCCAATTCACCTATAGCGTATGTCTTTGGA CTTGTGGGGGAAACCGGAACACACGGAGGAAACCCACGCGAACACAGGGAGATCATGCAAACTCAGA AACGCCAACTGATCCAGCCAAGGCTCGAACCAGTGACCTTCTTGCTGTGAGGCAATAGGGCTACCCAT TGTGTCACTGCACCGTCCACAATTTTAATAAACATGAAAAATCCCGAGAAACATAAACAATATTAAAT GTAGTTGAAATTTTGTTGTTTGAAATTGTATTTATTAAATAAAAAAAATGTATGTATTATTATTATTTAT TTATTTATAAAAGATGTTAGGTGGCCAAACTCTTTTTTTTAATGGATATAGTTGTTTAATAAAACAATT TTGTTTAAATAAAACAAAATATATTGAATGAGCCATGTTGCTGTTGTTGTTTTTTACAGGCTTGATGTA CAATATGATCTTTGTGTAGTTTTATAGTAATAAATCATTCATGTCTTGTGTATTGTACGTCATATTATCT TAAAAGTACGCTATTAATTAAACTTGTTTATATGGTCATCTTAGACAGGACTCTCATTATAAAAGGATT TTTGTTAATTTTATTAGTACCTTCCTGGAAAAATAAAAGATAAATAAATAAAAATGAATAAAAGTCTT Atorney Docket No: 23-0726-WO
GGGCTTGTTTTCTGTACGAGTAATAAAAAAGAGTAAGCAAATATTCTGCATGACAATATTGTTCAAAG
TTTAAGGGCTGTATTTTTTATAATTGTTGGTTATTAACATGTTTTATACAAATTACTTTCAACATGGCTG
AAATAATAATTGTTATCACTATTTGAAACAGTCCTAGAATAGATTTTACTATATTTACATTTATTCCTCT
GATGACAAAGTTGAAATTCCTCTGATGACAAAGCAAAACTCTCAACTCTAGTTTTATTTTATTGTAATA
ACCATGTCAAGGGATAATGACAATGTTTTCCATTATATTTTCAATATAGAATAAAATTATAATTTATTA
ATCATTTAGTAGGGCAGCATGGTGGCACAATGGGTAGCACAATCACCTCACACCAAGAAGGTTGCTAG
TTCGAGCCCCGGCTGGGTCAGTTTGCATATCTGTGTGGAGAATGTTCTCTCTGTGTTGCCATGGGTTTC
CTCTGGGTGCTCTAGTTTCCACCACAAGTCTAAAAACAAGTGGCATCGGTGAATTGTGTAGGCTAAAT
TGTCTGTAGTGTTTGTGTGTGATTGAGTGTTTATGGATGTTTCCCAGTGATGGGTTGCAGTTGGAAGGG
CATTCTCTGCGTAAAACTATAAGTTGGCGGTTCATTCCACTGTGGTGACCCCAGATTAATAAAGGGATT
AAGCCGAAAAGAAAATGAATCATTAAATGATCATTTAGTTGATTGGAGAGCATTGCATAATGAGAATC
AAATAATGTATAGTTTTTTGTAAAATGATTGTGTATTAGAGGCACATTGTACGTAGTGTGGAATGTTTA
GGTTGTCTTTCTGATTGTTTTCATTTTGCAGAAGTTCATTTGCAGTCAGTGTAGTCAAAGCACCTCAGCT
CAATTTATAGCAGCAGCCTGCTGTGATTTAAGTGCCACAGGAGTGAAGGCTTTAACCCCTGTTGTAGA
TTGCAACCAATGTTTTTCTAAGGTAATTAGAAGCTTGTTTAGCTAACGCTACCCACCCCACCCCCCACA
AAAAAGTTGCTCTGAATAGCAGCATCTACCCCCAGGAGGGTGCAAGCTTCTGTTTTGAAGAAATTTGC
TCATGGTGTTACATAGGTGTTTAAAAATGTATGTTTTTTAATAGCATATATTTTAAAAGTGACTCATTA
A ATTTGTATCTAATTCCATTACTTCGTCACAATTCCATCGACACGTTTGTCGTGCTAGGAATAATCTTAGGAACAGAGAGAGTGGAACTCTCCTATTCTCATAAAGGAAAACCTCGCATAATTrATTCCACCGCCAAC
TTTTAATTTGGGGTTCCAAACCAGTTTGAATTCTTTTGTTCTGTTGAACACAAAATAAGATGTTTTAAG
AATGTTGGAAATGTTGGAGACTTTTATAGTAGGAAAAACATATACTAATATTTGCATTCATGTTTGAAA
TGTTTAAAACATTTTTCAAAATATCTTATTTTTCAACTGTTTTGGAACAAGTCAAAAGTGAGTAAATGA
TGACTGATAAACAATTTCTTTAAATACAGATGAAAATAGCGTCTAACACATTTTGAACTAGTTCACTTT
CAACCACAGCAAGAGGTAGTCGAAAACACATTTGATCACATTTTGTTGTGGGACCGCTTGTTGTTCAG
TGTGTTTTCATTGTTGAGTTACAAACCGGTAAGTGGCATTAAAACATGTTTTGGCATCACTGATGATCA
TAAATAAATTGGTTAAAAAATTAAAAATTAGATGCTTACAGTACAGTTTGTTTAAAAACTTGCACTTTT
TGTAGTGTGAAATGACATTAGTACCTGCAGTGGGCTTTCTTTGTTCTGTATCTTCTGATGAATCTAACA
TAAAGACATTTAAATATTCACAATGGAGTGGGTTGGTTCTCATCTATCTGAAACAACATTAGTGTGTTC
AAAACAAATCTACACCAGTGATCTCTGATAGATACAAGCTGTCAACCGTAGTCCTATTGTTTCTCATGC
GACTGTCACAGGGCCATGCTAGAGGCTCTTTGGGTGGTGAGTAGAGACTCATTCTTATGCAAACAGGC
TATGGATGCTACAACTGAAGAGAATTTAGTGCTCTAAGGTCATCGCAGTTCTATAAAGCAGATTCCCT
T CTCTATATATATATGGTCCTCAAGTAGGCAAAAATATTTTTATTTGATAGTTCCGTCGAGTATGTTGGCAAACGCATATTCTTTAATACAAGCCTAGTCTAAGATGCAATGTTCGTTTCTATAAATTTTAACTTCTAT
TGTTATTATTTCAACTCATAATATCTCCTTTTAAAGATGATTCATTTGATTGTAGTTATAATAATTGTTT
TATTAATGCAAAAATTGCTTAAATGTTTGGCCTCTGAGATTTTCAGTTGACTCAATATTTTTGGAGCCT
GTTTCATGACTTTATTTAAAATATAATCTGCACTCGCAAATATTACAATTATATCATATTTTGAAAATCT
TAGATGTACATTTGTTTTGAAAATGGTTTAAAGGAAATTTAGGTCAAAATGTGTGTTTTTTTTAAATAA
TAATTCAGTCTTTTTTTTGATATAATAGGGAAAATGACAGCAATTAAAAGGCTGTTTTGGAAAGACATC
TAGGTCTGGTGCAGACTTCGTAACTTCTTAGAGTTAAATCTTGAAAACGGAGCCAGAAGACGGGCAAC
ACCTTCCTAAAAGCAGGGTGGGGTGTTGGACAGGTAGCTTCTTGGAACCTCCCCTCTTTGTCGCTGTGG
TATATATAGAAATCCCATTGAATTCCTATAGAGACCTTAAGCCCGTACCATTTACCTCTGAAGAGCTTG
ATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGGATCCCATCGATTCGAATTCAAGG
CCTATGGCCGTCAATGTGTACTCCACATCTGTGACCAGTGAAAATCTGAGTCGCCATGATATGCTTGCA
TGGGTCAACGACTCCCTGCACCTCAACTATACCAAGATAGAACAGCTTTGTTCAGGGGCAGCCTACTG
CCAGTTCATGGACATGCTCTTCCCCGGCTGTGTGCACTTGAGGAAAGTGAAGTTCCAGGCCAAACTAG
AGCATGAATACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTTGACAAAATC
ATTCCTGTAGAGAAATTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATTCAGTGGTTTAAGAA
ATTCTTTGACGCAAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGACGTAG
CGCCACCTCCTAACCCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGTTCCA
CAGAGGACGTCCCCCACAGGCCCAAAAAACATGCAGACCTCTGGCCGGCTGAGCAATGTGGCCCCCC
CCTGCATTCTCCGGAAGAATCCTCCATCAGCCCGAAATGGCGGCCATGAGACTGATGCCCAAATTCTT
GAACTCAACCAACAGCTGGTGGACTTGAAGCTGACAGTGGATGGGCTGGAGAAGGAACGTGACTTCT
ACTTCAGCAAACTTCGTGACATCGAGCTCATCTGCCAGGAGCATGAAAGTGAAAACAGCCCTGTTATC
TCAGGCATCATTGGCATCCTCTATGCCACAGAGGAAGGATTCGCACCCCCCTGAGCCTCTAGAACTAT
AGTGAGTCGTATTACGTAGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAG
AATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAG Atorney Docket No: 23-0726-WO
CTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGG
AGGTTTTTTAATTCGCGGCCGCGGCGCCAATGCATTGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTG
AGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCAC
AATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAA
CTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAA
TGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGA
CTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTAT
CCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACC
GTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGA
CGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTC
CCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGC
GTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGC
TGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAAC
CCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATG
TAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGT
ATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAAC
CACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAG
AAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGG
TCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCT
AAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCG
ATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGC
TTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGC
AATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGT
CTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCA
TTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGAT
CAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTG
TCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCA
TGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGC
GGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAA
GTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAG
TTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTG
AGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACT
CATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTT
GAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTAAATT
GTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGG
CCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTT
TGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGG
GCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTA
AATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAA
AGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCG
TAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGC
AACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGTCGACCATAGCCAATTCAAT
ATGGCGTATATGGACTCATGCCAATTCAATATGGTGGATCTGGACCTGTGCCAATTCAATATGGCGTAT
ATGGACTCGTGCCAATTCAATATGGTGGATCTGGACCCCAGCCAATTCAATATGGCGGACTTGGCACC
ATGCCAATTCAATATGGCGGACTTGGCACTGTGCCAACTGGGGAGGGGTCTACTTGGCACGGTGCCAA
GTTTGAGGAGGGGTCTTGGCCCTGTGCCAAGTCCGCCATATTGAATTGGCATGGTGCCAATAATGGCG
GCCATATTGGCTATATGCCAGGATCAATATATAGGCAATATCCAATATGGCCCTATGCCAATATGGCT
ATTGGCCAGGTTCAATACTATGTATTGGCCCTATGCCATATAGTATTCCATATATGGGTTTTCCTATTG
ACGTAGATAGCCCCTCCCAATGGGCGGTCCCATATACCATATATGGGGCTTCCTAATACCGCCCATAG
CCACTCCCCCATTGACGTCAATGGTCTCTATATATGGTCTTTCCTATTGACGTCATATGGGCGGTCCTAT
TGACGTATATGGCGCCTCCCCCATTGACGTCAATTACGGTAAATGGCCCGCCTGGCTCAATGCCCATTG
ACGTCAATAGGACCACCCACCATTGACGTCAATGGGATGGCTCATTGCCCATTCATATCCGTTCTCACG
CCCCCTATTGACGTCAATGACGGTAAATGGCCCACTTGGCAGTACATCAATATCTATTAATAGTAACTT
GGCAAGTACATTACTATTGGAAGGACGCCAGGGTACATTGGCAGTACTCCCATTGACGTCAATGGCGG
TAAATGGCCCGCGATGGCTGCCAAGTACATCCCCATTGACGTCAATGGGGAGGGGCAATGACGCAAA Atorney Docket No: 23-0726-WO
TGGGCGTTCCATTGACGTAAATGGGCGGTAGGCGTGCCTAATGGGAGGTCTATATAAGCAATGCTCGT
TTAGGGAAC (SEQ ID NO: 26) tp63:Ai/Z/-AcGFP
Sequence:
CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTT
TAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGT
GTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAAC
CGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCC
GTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCAGAGGT
GTAAAAAGTACTCAAAAATTTTACTCAAGTGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAA
AAGTAAAAGTATCTGGCTAGAATCTTACTTGAGTAAAAGTAAAAAAGTACTCCATTAAAATTGTACTT
GAGTATTAAGGAAGTAAAAGTAAAAGCAAGAAAGAAAACTAGAGATTCTTGTTTAAGCTTTTAATCTC
AAAAAACATTAAATGAAATGCATACAAGGTTTTATCCTGCTTTAGAACTGTTTGTATTTAATTATCAAA
CTATAAGACAGACAATCTAATGCCAGTACACGCTACTCAAAGTTGTAAAACCTCAGATTTAACTTCAG
TAGAAGCTGATTCTCAAAATTGTTAGTGTCAAGCCTAGCTCTTTTGGGGCTGAAAAGCAATCCTGCAGT
GCTGAAAAGCCTCTCACAGGCAGCCGATGCGGGAAGAGGTGTATTAGTCTTGATAGAGAGGCTGCAA
ATAGCAGGAAACGTGAGCAGAGACTCCCTGGTGTCTGAAACACAGGCCAGATCGCGTTGTAAAACGA
CGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACGATCCACCGGTCGCTCGAG
AGAAACCAGGCTCAGTCGGGCACGACCATTACTCCACTTGACCAAACGTCTGCATATTTATAAATAAT
AATTTGCGTATTAATATGCAGATAAAGACAATTAAAAGAAGCAACAGTAGCATTAATCATTCAAATAA
CAGTATACAATCAAACAACATTTTGTATATATATTTAAAAAAACAATACAAGGAGTAAAGACAAAGG
CAATATCATTTAGTTTTTTTAATATTAACAAACCACAGGCTGTGTGAACCATCAGCAATTTCAAACCAG
AGGGATCTGCTTTTTTGGGAACGATGTTGCAAATTTAATCTCTAGATTTTTTAAATCATGGATAGCCTC
CCTAAAGCAAAAGCTTTTTAGGGGCTTTACTTCTCCTGATTGCAGCCTGTGGTATAATTTGTGATTGTT
AGGTGGGTCAGGTTTTGGGGTCCAGCCCTTTGTGCACTTTGACTATTGTCACCTTAGGCTGTCCCTTAA
TGCTGCCACCTCTGACCCCGGTGGGACACATAAATAACTTCTCCACCCGAGTTAGCATTTCAAGCCAGT
GCAATAAAGAAATTAAAAATAATTGATTTATTAACAACTCTGTTTTATCTTTAAAAAATAAAATGTTTT
ATATCTAATGTTCACTCAGGTACCTGATATTGTTTGCTGTGCAATAATGTAGGTTAGTCATTATATTGA
CAAAGAAAATTAAATATGATGTTGTTTATTTTTAATTTTACATTATAGACTAGATTAGATTTTCATTTGG
AATTTAATTAGGAGTGCCTGGAGTGCATTGAGAACGTTAAAAAAAAAAAATCTGCTTACTCTTATAGC
TTTGGAAACTATTTTCAGATTATTACTCCACTATAGAAGCGATTCCTTTTTTTGAATAATTAAATATATA
TATACAGTGCTCAGCATAAATGATCATCACAGATCTCTATTTTAAAGTATTATTTTTCCATAGGATGCT
TTACAATAATATATGTGTGTGTATACATTAGAATTGTCAGTTACAAAATCAAAACTGCAACAAAATAA
CTAAACTTAAGATCTAATGAGTACACCCAAATTAAACCAAACATTAGTCTATGCAAAAATTAATATGT
TAAGGAAAAATATTAAATACAATTTTAATATTCAGTCATTCATTTTCTTTTTTGCTTAGTCCCTTTATTA
ATCTGGGGTCGCCACAGTGGAATTAACTGCCAATTTATCCAGCATATATTTTATGCAGCGGATGCTCTT
CCAGCTGCTACCCATCACTGGGAATCACCCATACACTCTCATTCACACACATACACTACGGACAATTTA
GCCTACCCAATTCACCTATAGCGTATGTCTTTGGACTTGTGGGGGAAACCGGAACACACGGAGGAAAC
CCACGCGAACACAGGGAGATCATGCAAACTCAGAAACGCCAACTGATCCAGCCAAGGCTCGAACCAG
TGACCTTCTTGCTGTGAGGCAATAGGGCTACCCATTGTGTCACTGCACCGTCCACAATTTTAATAAACA
TGAAAAATCCCGAGAAACATAAACAATATTAAATGTAGTTGAAATTTTGTTGTTTGAAATTGTATTTAT
T
TTA TA TA TT TA AA AA TA GA GA AA TA AT TG AT GA TT TG GT TA TTT ATA AT TT AA AT AT AA CT AT AT TA TT TT TT GA TT TT TT AA AT AA TA AA AA AG AA CT AG ATT AA AG TG AT TAG TG TC GC AA AA TA GC AT GCT CT C
ATGTTGCTGTTGTTGTTTTTTACAGGCTTGATGTACAATATGATCTTTGTGTAGTTTTATAGTAATAAAT
CATTCATGTCTTGTGTATTGTACGTCATATTATCTTAAAAGTACGCTATTAATTAAACTTGTTTATATGG
TCATCTTAGACAGGACTCTCATTATAAAAGGATTTTTGTTAATTTTATTAGTACCTTCCTGGAAAAATA
AAAGATAAATAAATAAAAATGAATAAAAGTCTTGGGCTTGTTTTCTGTACGAGTAATAAAAAAGAGTA
AGCAAATATTCTGCATGACAATATTGTTCAAAGTTTAAGGGCTGTATTTTTTATAATTGTTGGTTATTA
ACATGTTTTATACAAATTACTTTCAACATGGCTGAAATAATAATTGTTATCACTATTTGAAACAGTCCT
AGAATAGATTTTACTATATTTACATTTATTCCTCTGATGACAAAGTTGAAATTCCTCTGATGACAAAGC
AAAACTCTCAACTCTAGTTTTATTTTATTGTAATAACCATGTCAAGGGATAATGACAATGTTTTCCATT
ATATTTTCAATATAGAATAAAATTATAATTTATTAATCATTTAGTAGGGCAGCATGGTGGCACAATGG Atorney Docket No: 23-0726-WO
GTAGCACAATCACCTCACACCAAGAAGGTTGCTAGTTCGAGCCCCGGCTGGGTCAGTTTGCATATCTG
TGTGGAGAATGTTCTCTCTGTGTTGCCATGGGTTTCCTCTGGGTGCTCTAGTTTCCACCACAAGTCTAA
AAACAAGTGGCATCGGTGAATTGTGTAGGCTAAATTGTCTGTAGTGTTTGTGTGTGATTGAGTGTTTAT
GGATGTTTCCCAGTGATGGGTTGCAGTTGGAAGGGCATTCTCTGCGTAAAACTATAAGTTGGCGGTTC
ATTCCACTGTGGTGACCCCAGATTAATAAAGGGATTAAGCCGAAAAGAAAATGAATCATTAAATGATC
ATTTAGTTGATTGGAGAGCATTGCATAATGAGAATCAAATAATGTATAGTTTTTTGTAAAATGATTGTG
TATTAGAGGCACATTGTACGTAGTGTGGAATGTTTAGGTTGTCTTTCTGATTGTTTTCATTTTGCAGAA
GTTCATTTGCAGTCAGTGTAGTCAAAGCACCTCAGCTCAATTTATAGCAGCAGCCTGCTGTGATTTAAG
TGCCACAGGAGTGAAGGCTTTAACCCCTGTTGTAGATTGCAACCAATGTTTTTCTAAGGTAATTAGAA
GCTTGTTTAGCTAACGCTACCCACCCCACCCCCCACAAAAAAGTTGCTCTGAATAGCAGCATCTACCCC
T CTATGTGTATGAGAGTATGGCCAAATAGTCATTTCTTTTGATATTATAGGATAGGAACATACTATTTTGACATTCGAATCGAGTTCGATTTCATCGACTCAAGTGCTTGGTCTCTTATATCATACAATGGATAACTTG
GACAAAGGACCCTTTTAAGGACCCCTATACACCACATTTTTATCTATCTAATCACAAGTGGGTGATATT
AGAGGGATGATTCACCTAAAAATGAATTTTCCGCATTTTAATTTGGGGTTCCAAACCAGTTTGAATTCT
TTTGTTCTGTTGAACACAAAATAAGATGTTTTAAGAATGTTGGAAATGTTGGAGACTTTTATAGTAGGA
AAAACATATACTAATATTTGCATTCATGTTTGAAATGTTTAAAACATTTTTCAAAATATCTTATTTTTCA
ACTGTTTTGGAACAAGTCAAAAGTGAGTAAATGATGACTGATAAACAATTTCTTTAAATACAGATGAA
AATAGCGTCTAACACATTTTGAACTAGTTCACTTTCAACCACAGCAAGAGGTAGTCGAAAACACATTT
GATCACATTTTGTTGTGGGACCGCTTGTTGTTCAGTGTGTTTTCATTGTTGAGTTACAAACCGGTAAGT
GGCATTAAAACATGTTTTGGCATCACTGATGATCATAAATAAATTGGTTAAAAAATTAAAAATTAGAT
GCTTACAGTACAGTTTGTTTAAAAACTTGCACTTTTTGTAGTGTGAAATGACATTAGTACCTGCAGTGG
GCTTTCTTTGTTCTGTATCTTCTGATGAATCTAACATAAAGACATTTAAATATTCACAATGGAGTGGGT
TGGTTCTCATCTATCTGAAACAACATTAGTGTGTTCAAAACAAATCTACACCAGTGATCTCTGATAGAT
ACAAGCTGTCAACCGTAGTCCTATTGTTTCTCATGCGACTGTCACAGGGCCATGCTAGAGGCTCTTTGG
GTGGTGAGTAGAGACTCATTCTTATGCAAACAGGCTATGGATGCTACAACTGAAGAGAATTTAGTGCT
CTAAGGTCATCGCAGTTCTATAAAGCAGATTCCCTCCAAAAAGCTAGAGAAAATTATGTGTCTGGAGG
CACCATCTATCAGTGCAGTCATTCTTTTATTACTTTTTTTTTTTGTCCATGCAATTTTTTAATCGCATTTT
GAAGTATTTAAACCATTAAGAGTGTCAAATTATCATGTTATTATTTCAACTCATAATATCTCCTTTTAA
AGATGATTCATTTGATTGTAGTTATAATAATTGTTTTATTAATGCAAAAATTGCTTAAATGTTTGGCCTC
TGAGATTTTCAGTTGACTCAATATTTTTGGAGCCTGTTTCATGACTTTATTTAAAATATAATCTGCACTC
GCAAATATTACAATTATATCATATTTTGAAAATCTTAGATGTACATTTGTTTTGAAAATGGTTTAAAGG
AAATTTAGGTCAAAATGTGTGTTTTTTTTAAATAATAATTCAGTCTTTTTTTTGATATAATAGGGAAAA
TGACAGCAATTAAAAGGCTGTTTTGGAAAGACATCTAGGTCTGGTGCAGACTTCGTAACTTCTTAGAG
TTAAATCTTGAAAACGGAGCCAGAAGACGGGCAACACCTTCCTAAAAGCAGGGTGGGGTGTTGGACA
GGTAGCTTCTTGGAACCTCCCCTCTTTGTCGCTGTGGTATATATAGAAATCCCATTGAATTCCTATAGA
GACCTTAAGCCCGTACCATTTACCTCTGAAGCCACGGATCCCATGGTGATGGCATCATCACAAGTACC
AGCAGCCAAAAAAGATGAGAAGGGCAGAAACATACAAGTGGTTGTACGATGCAGACCCTTTAACACA
GTGGAGCGTAAATCTGGCTCTCACACTGTTGTTGAATGTGACCAGAACCGGAAAGAGGTGATTATGCG
TACTGGAGGTGCCACAGACAAAGCAGCAAGAAAAACATACACTTTTGATATGGTTTTTGGCCCTTCTG
CCAAACAAATTGAAGTTTATAGGAGTGTGGTTTGCCCCATATTAGATGAAGTTATCATGGGCTATAAC
TGCACAATCTTTGCATATGGGCAAACCGGAACAGGCAAAACCTTCACAATGGAAGGTGACCGATCACC
CAATGAGGAGTTTACTTGGGAAGAGGACCCTCTGGCTGGAATAATTCCCAGGACTCTTCATCAGATCT
TTGAAAAACTGTCTAATAATGGCACAGAGTTCTCAGTGAAGGTGTCTCTGCTGGAAATTTATAACGAG
GAACTGTTTGACCTGCTCAGCCCTGCTCCTGATGTCACAGAGAGATTACAGCTCTTTGATGATCCCAGA
AATAAAAGGGGTGTGACCATTAAAGGTCTGGAGGAAATCACCGTACACAATAAGAATGAGGTGTATC
AGATCCTGGAGAGAGGAGCAGCCAAGAGGAAGACTGCCTCCACACTCATGAATGCCTATTCCAGTCG
ATCCCACTCTGTGTTCTCTGTCACTATTCACATGAAGGAAATCACACTGGATGGGGAAGAGCTAGTTA
AGATTGGTAAACTCAACTTGGTGGATCTTGCAGGTAGTGAGAACATCGGACGATCTGGTGCTGTGGAT
AAGCGTGCACGTGAAGCTGGCAACATCAACCAGTCTCTGCTAACTCTGGGTCGTGTAATCAAGGCTTT
GGTGGAGAGAGGGCCTCACGTGCCCTACAGAGAGTCTAAACTAACCCGCATACTGCAGGACTCGCTA
GGAGGACGCACCAAAACCTCTATCATCGCCACTGTGTCTCCTGCCTCCATCAATCTGGAGGAAACTCT
GAGCACTTTAGACTATGCTAACAGAGCTAAGAGCATCATGAATAAGCCTGAGGTCAATCAAAAGCTTA
CCAAGAGAACCCTCATCAAGGAATACACAGAGGAAATTGAGAGACTGAAGAGAGATTTGGCTGCCAC
CCGTGACAAACATGGAGTGTACCTTTCCGTTGATAACTATGAGACTTTGAATGGTAAAATTGTGTCTCA
GGAAGAGCAGATTACAGAGTACACTGAGCGGATAGCTGCTATGGAGGAGGAGCTCAAAAAGATTATA
GACCTGTTCACAGATAGTAAGCAGAAATTGGAACAGTGCACCGAGGACCTGCAAGACAAAAACCAGA Atorney Docket No: 23-0726-WO
GACTGGAGGAGGCTCACAAAGACCTATCGGAGACCAGGCACCGCCTCAATCAGGAGGAATTCATCAG
TACACAGCTTCAAACCAATGAGAGTCACCTCTATAACACTGCTGACCAGTTGTTAAGCACTGCTGAGG
CCAGCACACAGGATGTCGGTGGTCTCCATGCTAAGCTACAAAGGAAGAAGGATGTGGAGCTTCATAA
CAGTAAGGTTCAGGAGAGCTTCTCCCAGTGCATGGAGAACTGCTACAACAGCATGCAGACCTCACTGA
AGGAGCAGAGCCAAAAACATGCTGCTATGATTGATTATTACCGCTCCTCTGTGGGTGAGCTGCTGAAC
ACCAATGGCAAGGTGTTTAAGGAGACTTTGGGTGCTGTGTGCGAGTCTTACAGCAGTATTAAAGGAGC
TGTGGGAGAAGGTGTAGAGCGGTGTAAGGAGCAAGTGTTAAATCAGGAGAAACTCTCTCAGGATGCT
CAAAACAGCATCCTGGAAATTCTGGATGAACACAAACAGCATCTTGAGGAGGTTCTGGTTGCCCAGGC
GGTGCCAGGTATCAGGTCTGTCATGTCCATGAATGACAATTTGAAGCAAACCCTTCACAAATACCACA
ATCTGGCTGAGCAGATGCAGGGTGTGAAAGCAGATATGATGACGTTTTTTGATGCGTACACTGAATCA
CTGGCCAGTATGCGAGAGTGCGCTTTGCAGGGTTTTAACACACTGCGTGCCGAACATGACAAACTCAA
ACAACAAATCAGCCAAGCTGGAAACAGCCATCAAGTGCGTGTGGCCGAGCTGGTTCAGTGTTTGCAGA
ACCAAATGAATCTGCTGGCGGTGGACACTCAGAATGACTTTGAGGGTCTTTCACAAGCAGCATCTGCC
CAGATTCCTCCACTGGAAACATTACAGAGCTCCATAGAGAGTAAATGCACAGTGGCTGAGGAGCAGG
CTGTGTCTGTTCGTGCTCGACTGGGTTCCTCTGTTCATGGAGTGATTTCAGAGATGAATAGTGTGACTA
AGGAGGGAGAGAGGGCGCTGGAGGAGTGTGCTGGTTATTGTGGACACCTGCAGACATCGCTGGACTC
GCTGGCTGAGTCAGGACTCAAGTGGTGCGATGAAGCTAAAGGCTTGACTGAGAGTAAAGCCCAGGAG
CAACTCAAACTCATCAGACAGACAGACACGGCTGTGCAAGACCTGCTGAAGTCTGTGGAGGAAAAGG
GTGAGAAAGCTGTTCAGGACTGTGAAGCCAGATTGGGTCAAATGCAGCAGGAAATGGAAGCAACCCT
GGGTCGTGTGGAAATGCAGACCAGCAAAGATGAAGCGACATTGCAGGAGCACAGAGAGACCCTGTCC
TCCATCAACACTCAGGCACTGGACACCGTACACAACTTCATCAGCTCAGTGCTACGGCAGGATTTACC
AACAGGAACGACCCCTCAGCGCAAAGAGTACATGTACCCACGTGTGCTGAGCAGGCCGAGGAGTAGA
GAGGAGCTGGAAGAGGAGTTCAGAGCTCAGCAAGAGCAGCTTCAGTCTGAACTGAAGCCGTGTGAGA
TCGTAATGGAGGTGGAGGAGGAGAAACCTGTCGACCAGGACTCTCTGGAGGATGACGTCAGTGTTTCT
AGTGATGGAAACAACACTGAACAGTCGTGCTCTGATGAGAACCTGATATGTTATGAGAATGGAAGGA
TTCCTTTTTTCAAGAAGAAAAGCAAGAAGGAAAATGGCAGTAAATCACTGAACCGTTCAAAGGTGGA
GAATGACAGCATGTCAACACCACCCCGCTCTAAACTTCCACTCAGATGTCAGAGCAAGGGCGCCGAGC
TGTTCACCGGCATCGTGCCCATCCTGATCGAGCTGAATGGCGATGTGAATGGCCACAAGTTCAGCGTG
AGCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCA
AGCTGCCTGTGCCCTGGCCCACCCTGGTGACCACCCTGAGCTACGGCGTGCAGTGCTTCTCACGCTACC
CCGATCACATGAAGCAGCACGACTTCTTCAAGAGCGCCATGCCTGAGGGCTACATCCAGGAGCGCACC
ATCTTCTTCGAGGATGACGGCAACTACAAGTCGCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGT
GAATCGCATCGAGCTGACCGGCACCGATTTCAAGGAGGATGGCAACATCCTGGGCAATAAGATGGAG
TACAACTACAACGCCCACAATGTGTACATCATGACCGACAAGGCCAAGAATGGCATCAAGGTGAACTT
CAAGATCCGCCACAACATCGAGGATGGCAGCGTGCAGCTGGCCGACCACTACCAGCAGAATACCCCC
ATCGGCGATGGCCCTGTGCTGCTGCCCGATAACCACTACCTGTCCACCCAGAGCGCCCTGTCCAAGGA
CCCCAACGAGAAGCGCGATCACATGATCTACTTCGGCTTCGTGACCGCCGCCGCCATCACCCACGGCA
TGGATGAGCTGTACAAGTGAGCGGCCGCCACCGCGGTGGAGCTCGAATTAATTCATCGATGATGATCC
AGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTT
ATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAAC
AACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAA
CCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGATCAGGCCGCCACCGCGGTGGAGCTCCAGC
TTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGGC
GAAGATACGGCCACGGGTGCTCTTGATCCTGTGGCTGATTTTGGACTGTGCTGCTCGCAGCTGCTGATG
AATCACATACTTCCTCCATTTTCTTCCACTGATTGACTGTTATAATTTCCCTAATTTCCAGGTCAAGGTG
CTGTGCATTGTGGTAATAGATGTGACATGACGTCACTTCCAAAGGACCAATGAACATGTCTGACCAAT
TTCATATAATGTGAAAACGATTTTCATAGGCAGAATAAATAACATTTAAATTAAACTGGGCATCAGCG
CAATTCAATTGGTTTGGTAATAGCAAGGGAAAATAGAATGAAGTGATCTCCAAAAAATAAGTACTTTT
TGACTGTAAATAAAATTGTAAGGAGTAAAAAGTACTTTTTTTTCTAAAAAAATGTAATTAAGTAAAAG
TAAAAGTATTGATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCCAAAAATAATACTTAAGTACAGT
AATCAAGTAAAATTACTCAAGTACTTTACACCTCTGGGGGAGGTTCCCTTTAGTGAGGGTTAATTGCGC
GCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACA
TACGAGCCGGAAGCATAAAGTGTAAAGCCTGGTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGC
TCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGC
AGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAA
CTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAA Atorney Docket No: 23-0726-WO
ATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAG
TGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGAT
AACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCAC
CGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAAC
TTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAG
TTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATT
CAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCT
CCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCAC
TGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGT
CATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCG
CCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGAT
CTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTAC
TTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCG
ACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTC
TCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCC
CGAAAAGTG (SEQ ID NO: 27) tp63 '.HyPer-cyto
Sequence:
CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTT
TAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGT
GTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAAC
CGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCC
GTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAA
CGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGT
CACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCAT
TCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAA
GGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAAC
GACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCTCGAGTCGAGCAGGG
GGATCATCTAATCAAGCACAAATAAGGGGCGTGTAACACAAAAGCCAGCGACCCTTTCCAATGCAAA
TCAAACTTGCAATTCTTTGCCGTTTTTATCATTTAAGTGTCGGCTTAAGGTCCACTATCAGATGTAAAC
AGCCTTATCTAACAAAGGTATCATTACATTCTGAAATTCTCAGGCATGCAAGCTAGCTTATGACGCACT
AGGGAGTGCCACCCTTCCTTTCGCCCTAACTTCGTGATAACTCGCGCGTTTCACTCAACAGCTGCATCC
GCCCTAGTGCTACTGGGAGTTGTAGTATACAAGACGCTTACAGGCTGAATGTTCTGTCAAGACCCCGC
CTCTAGCACTTTGGGAATTCTGGACTTGATGATGTCATGGTTAATCCCCGCCCAGTAGAGGCGGCTATA
TAAAGGGTGGTTAAGGCCCGGTTCGCTCTCTTCCTCACCGGGTCTGCGGCGAGTTCTAGCTGAAGCTTC
CTGCAGGTCGACCGATCCTGAGAACTTCAGGGTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGC
TATTGTAAAATTCATGTTATATGGAGGGGGCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGTC
CCTTGTATCACCATGGACCCTCATGATAATTTTGTTTCTTTCACTTTCTACTCTGTTGACAACCATTGTC
TCCTCTTATTTTCTTTTCATTTTCTGTAACTTTTTCGTTAAACTTTAGCTTGCATTTGTAACGAATTTTTA
AATTCACTTTTGTTTATTTGTCAGATTGTAAGTACTTTCTCTAATCACTTTTTTTTCAAGGCAATCAGGG
TATATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAAATGATAAGGTAGAATATT
TCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTACACCCTGGTCATCAT
CCTGCCTTTCTCTTTATGGTTACAATGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAA
ACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCTTCTCTTTCCTACAGCTCCTGGGCAACGTGCTGGTT
GTTGTGCTGTCTCATCATTTTGGCAAAGAATTCCTCGACGGATCCACCGGTCGCCACCATGGTGAGCAA
GGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCAC
AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTG
CACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCT
TCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTC
CAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGG
GCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGG
GCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGC Atorney Docket No: 23-0726-WO
ATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACC
AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC
GCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCG
GGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCCACCGCGGTGGAGCTCGAATTAAT
TCATCGATGATGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAG
TGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAAT
AAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTT
TTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGATCAGATCTGTCCCG
ATCTTTCTCTTCTGTGCTGTCAATTTAGAGTAGTTTTTGAGGTAATTTGGGTGCATTCTCTGTAAAAACA
ACAAATAAATATTTATATTGTATGCAATAAATGTAACAATTACACATACACTCTCTGATTACAGCATTA
AAGGGTTAGTTCACCCAAAAATGAAAAGATGTCATTAATGACTCACCCTCATGTCGTTCCAAGCCCGT
AACACCTCCGTTCATCTTCGGAACACAGTTTAAGATATTTTAGATTTAGTCCGAGAGCTTTCTGTCCCT
CCACTGAAAATGTATGTACGGTATACTGTCCATGTCCAGAAAGGTAATAAAAACATCAAAGTAGTCCA
TGTGACATCAGTGGGTTAGGTAGAATTATTTGAAGCATCGAAAATACATTTTGGTCCAAAAATAACAA
AACCTACGACTTTATTCAGCATTGTAGCGTCACTGCGAAGTCGTGAACGCGGATTGACAACAGACCCG
GAAGAGAATACAATGCCGAATAAAGTCGTAGGTTTTGTTATTTTTGGACCAAAATGTATTCGATGCTTC
AAAAAATTCTAACTAACCCACTGATGTCACATGGACTACTTTGATGTTTTTATTACCTTTCTGGACATG
GACAGTATACCGTACATACATTCTCAATGGAGGCACAGAAAGCTCTCGGACTAAATCTAAAATATCTT
AAACTGTGTTCTGAAGATGAACGGAGGTCTTACGGGCTTGGAACGACATGAGGGCGAGTCATTAATGA
CATTATTTTCATTTTTGGGTGAACTAACCCTTTAATAAAACTGACATTTGCAGCCAATTGCACACTTTAT
AATGTTAAATACTTGTTGATTTTAGAAATACAGTAGCATTTAGTGACAATCAAACATTAATTTTATTTC
TGATTATATTGACAAAAACACAGGACTGTAAGGCTGACATGACAGGGTGAATTGATTTCATTACATTA
GTTTTGATGGTAACACTTTTACAATAAGGTTCGTTAGTTAACTACATTAGTTAACATGAACTAATAATG
AACTGCACGTATACATGTTAATTTCAACATTTACTAATACTTTATATCTTGTTAACATTAGTTAATGCAC
TGTGAACTAACATGAACAAACAATGAACATCTGTATTTCTATTAACTAACGTTAACAAAGATTAACAG
ATACAGTAACAAATGTATTGCTCATGGTTATTTAATGTTAGTTAATACATGAACTAATCAACCTCATTG
TAAAGTGTTACCGTTTTGACAATACAACATGTTTGGAAAAAAATTTCTCGCTTGGTTTTCTTGTGTTTTG
CATGAATTCAAACACAATGAGAGCACGGAATGATAATGATTATTCAAAGCTGCAATAGGCGCCAAATT
TCCCGTGGACCTAACGTTACCAATTACAAATGCATTTTAGCATTTTATTACGTGAGCCTTATATTGTCA
ATCGCATGCATTAGTGAAAATAGGCCTACTACACATATAAAAGGCGCGCCATCAACGTCAAAACATGC
ACACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTATCAGTAAAACAAAAGATCCACCGGTCGC
CACCATGGTGATGGAGATGGCAAGCCAGCAGGGCGAGACGATGTCCGGACCGCTGCACATTGGTTTG
ATTCCCACAGTTGGACCGTACCTGCTACCGCATATTATCCCTATGCTGCACCAGACCTTTCCAAAGCTG
GAAATGTATCTGCATGAAGCACAGACCCACCAGTTACTGGCGCAACTGGACAGCGGCAAACTCGATTG
CGTGATCCTCGCGCTGGTGAAAGAGAGCGAAGCATTCATTGAAGTGCCGTTGTTTGATGAGCCAATGT
TGCTGGCTATCTATGAAGATCACCCGTGGGCGAACCGCGAATGCGTACCGATGGCCGATCTGGCAGGG
GAAAAACTGCTGATGCTGGAAGATGGTCACTGTTTGCGCGATCAGGCAATGTCCGCCGGCTACAACAG
CGACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCAC
AACGTCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCC
CCGTGCTGCTGCCCGACAACCACTACCTGAGCTTCCAGTCCGTCCTGAGCAAAGACCCCAACGAGAAG
CGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
CAACGTGGATGGCGGTAGCGGTGGCACCGGCAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCC
ATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCG
ATGCCACCTACGGCAAGCTGACCCTGAAGCTGATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCC
ACCCTCGTGACCACCCTCGGCTACGGCCTGAAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCA
CGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACG
GCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAA
GGGCATCGGCTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACGGCACCGGTTTC
TGTTTTGAAGCCGGGGCGGATGAAGATACACACTTCCGCGCGACCAGCCTGGAAACTCTGCGCAACAT
GGTGGCGGCAGGTAGCGGGATCACTTTACTGCCAGCGCTGGCTGTGCCGCCGGAGCGCAAACGCGAT
GGGGTTGTTTATCTGCCGTGCATTAAGCCGGAACCACGCCGCACTATTGGCCTGGTTTATCGTCCTGGC
TCACCGCTGCGCAGCCGCTATGAGCAGCTGGCAGAGGCCATCCGCGCAAGAATGGATGGCCATTTCGA
TAAAGTTTTAAAACAGGCGGTTTAAtgagcGGCCGCCACCGCGGTGGAGCTCGAATTAATTCATCGATGA
TGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAA
TGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTA
ACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAG Atorney Docket No: 23-0726-WO
TAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGATCAGATCTGTCCCGATCTTTCTCTT
CTGTGCTGTCAATTTAGAGTAGTTTTTGAGGTAATTTGGGTGCATTCTCTGTAAAAACAACAAATAAAT
ATTTATATTGTATGCAATAAATGTAACAATTACACATACACTCTCTGATTACAGCATTAAAGGGTTAGT
TCACCCAAAAATGAAAAGATGTCATTAATGACTCACCCTCATGTCGTTCCAAGCCCGTAACACCTCCG
TTCATCTTCGGAACACAGTTTAAGATATTTTAGATTTAGTCCGAGAGCTTTCTGTCCCTCCACTGAAAA
TGTATGTACGGTATACTGTCCATGTCCAGAAAGGTAATAAAAACATCAAAGTAGTCCATGTGACATCA
GTGGGTTAGGTAGAATTATTTGAAGCATCGAAAATACATTTTGGTCCAAAAATAACAAAACCTACGAC
TTTATTCAGCATTGTAGCGTCACTGCGAAGTCGTGAACGCGGATTGACAACAGACCCGGAAGAGAATA
CAATGCCGAATAAAGTCGTAGGTTTTGTTATTTTTGGACCAAAATGTATTCGATGCTTCAAAAAATTCT
AACTAACCCACTGATGTCACATGGACTACTTTGATGTTTTTATTACCTTTCTGGACATGGACAGTATAC
CGTACATACATTCTCAATGGAGGCACAGAAAGCTCTCGGACTAAATCTAAAATATCTTAAACTGTGTT
A CTTGTTATATGGAGTGGTAGAACAGCGTAAGAGCTCCCTTTTATCAGAGTGACATATAGCGTAGAACCGAATCTATGTGCAAGGCGCGACAGTATGGTCCAACTATCATATTTGAATCAAATTTGATTTTATATAC
TACTTGTTGATTTTAGAAATACAGTAGCATTTAGTGACAATCAAACATTAATTTTATTTCTGATTATATT
GACAAAAACACAGGACTGTAAGGCTGACATGACAGGGTGAATTGATTTCATTACATTAGTTTTGATGG
TAACACTTTTACAATAAGGTTCGTTAGTTAACTACATTAGTTAACATGAACTAATAATGAACTGCACGT
ATACATGTTAATTTCAACATTTACTAATACTTTATATCTTGTTAACATTAGTTAATGCACTGTGAACTAA
CATGAACAAACAATGAACATCTGTATTTCTATTAACTAACGTTAACAAAGATTAACAGATACAGTAAC
AAATGTATTGCTCATGGTTATTTAATGTTAGTTAATACATGAACTAATCAACCTCATTGTAAAGTGTTA
CCGTTTTGACAATACAACATGTTTGGAAAAAAATTTCTCGCTTGGTTTTCTTGTGTTTTGCATGAATTCA
AACACAATGAGAGCACGGAATGATAATGATTATTCAAAGCTGCAATAGGCGCCAAATTTCCCGTGGAC
CTAACGTTACCAATTACAAATGCATTTTAGCATTTTATTACGTGAGCCTTATATTGTCAATCGCATGCA
TTAGTGAAAATAGGCCTACTACACATATAAAAGGCGCGCCATCAACGTCAAAACATGCACACCCAAA
AAAAAAAAAAAAAAAAAAAAAAAAAACTATCAGTAAAACAAAATACTTAATGTACTTACCTCAATAT
GCTTCCTTAGGTTTGATGGCGAACTTTTGAAGGCCGATATTTCTTTATTAAGCGGGAGACAGAGGACA
CATTTCATCTTGAATGAATCTTTATTTACACCACTTAAAGAAAAGAATTCGCGAAGATACGGCCACGG
GTGCTCTTGATCCTGTGGCTGATTTTGGACTGTGCTGCTCGCAGCTGCTGATGAATCACATACTTCCTC
CATTTTCTTCCACTGATTGACTGTTATAATTTCCCTAATTTCCAGGTCAAGGTGCTGTGCATTGTGGTAA
TAGATGTGACATGACGTCACTTCCAAAGGACCAATGAACATGTCTGACCAATTTCATATAATGTGAAA
ACGATTTTCATAGGCAGAATAAATAACATTTAAATTAAACTGGGCATCAGCGCAATTCAATTGGTTTG
GTAATAGCAAGGGAAAATAGAATGAAGTGATCTCCAAAAAATAAGTACTTTTTGACTGTAAATAAAAT
TGTAAGGAGTAAAAAGTACTTTTTTTTCTAAAAAAATGTAATTAAGTAAAAGTAAAAGTATTGATTTTT
AATTGTACTCAAGTAAAGTAAAAATCCCCAAAAATAATACTTAAGTACAGTAATCAAGTAAAATTACT
CAAGTACTTTACACCTCTGGTTCTTGACCCCCTACCTTCAGCAAGCCCAGCAGATCCACTAGTTCTAGA
GCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTA
ATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGG
AAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCAC
TGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGA
GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAG
GAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT
TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACC
CGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCC
TGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCT
GTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGC
CCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCAC
TGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAA
GTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTA
CCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTT
GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGG
GTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCT
TCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGT
CTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAG
TTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCA
ATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGG
CCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTA Atorney Docket No: 23-0726-WO
GAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCAC
GCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCA
TGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGT
TATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGT
GACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGG
CGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCT
TCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACC
CAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATG
CCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTAT
TGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACA
AATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG (SEQ ID NO: 28) tp63:HyPer-mito
Sequence:
GCCACCGCGGTGGAGCTCGAATTAATTCATCGATGATGATCCAGACATGATAAGATACATTGATGAGT
TTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTT
TATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGG
TTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTAT
GATCCTCTAGATCAGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGC
GCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGGCGAAGATACGGCCACGGGTGCTCTTGATC
CTGTGGCTGATTTTGGACTGTGCTGCTCGCAGCTGCTGATGAATCACATACTTCCTCCATTTTCTTCCAC
TGATTGACTGTTATAATTTCCCTAATTTCCAGGTCAAGGTGCTGTGCATTGTGGTAATAGATGTGACAT
GACGTCACTTCCAAAGGACCAATGAACATGTCTGACCAATTTCATATAATGTGAAAACGATTTTCATA
GGCAGAATAAATAACATTTAAATTAAACTGGGCATCAGCGCAATTCAATTGGTTTGGTAATAGCAAGG
GAAAATAGAATGAAGTGATCTCCAAAAAATAAGTACTTTTTGACTGTAAATAAAATTGTAAGGAGTAA
AAAGTACTTTTTTTTCTAAAAAAATGTAATTAAGTAAAAGTAAAAGTATTGATTTTTAATTGTACTCAA
GTAAAGTAAAAATCCCCAAAAATAATACTTAAGTACAGTAATCAAGTAAAATTACTCAAGTACTTTAC
ACCTCTGGGGGAGGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTT
CCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGC
CTGGTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGG
TAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTT
TGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA
TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATA
TATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTA
TTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCT
GGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCA
GCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATT
GTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACA
GGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGA
GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGT
AAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCC
GTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACC
GAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCA
TCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGT
AACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAA
CAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTT
CCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATT
TAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTAAATTGTAAGCGTT
AATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATC
GGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAA
GAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGC
CCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAA Atorney Docket No: 23-0726-WO
CCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCAGAGGTGTAAAAAGTACTCAAAAAT
TTTACTCAAGTGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAAAAGTAAAAGTATCTGGCTA
GAATCTTACTTGAGTAAAAGTAAAAAAGTACTCCATTAAAATTGTACTTGAGTATTAAGGAAGTAAAA
GTAAAAGCAAGAAAGAAAACTAGAGATTCTTGTTTAAGCTTTTAATCTCAAAAAACATTAAATGAAAT
GCATACAAGGTTTTATCCTGCTTTAGAACTGTTTGTATTTAATTATCAAACTATAAGACAGACAATCTA
ATGCCAGTACACGCTACTCAAAGTTGTAAAACCTCAGATTTAACTTCAGTAGAAGCTGATTCTCAAAA
TTGTTAGTGTCAAGCCTAGCTCTTTTGGGGCTGAAAAGCAATCCTGCAGTGCTGAAAAGCCTCTCACA
GGCAGCCGATGCGGGAAGAGGTGTATTAGTCTTGATAGAGAGGCTGCAAATAGCAGGAAACGTGAGC
AGAGACTCCCTGGTGTCTGAAACACAGGCCAGATCGCGTTGTAAAACGACGGCCAGTGAGCGCGCGT
AATACGACTCACTATAGGGCGAATTGGGTACGATCCACCGGTCGGCCGGCCGATTAATTAACGAGCTC
GAGAGAAACCAGGCTCAGTCGGGCACGACCATTACTCCACTTGACCAAACGTCTGCATATTTATAAAT
AATAATTTGCGTATTAATATGCAGATAAAGACAATTAAAAGAAGCAACAGTAGCATTAATCATTCAAA
TAACAGTATACAATCAAACAACATTTTGTATATATATTTAAAAAAACAATACAAGGAGTAAAGACAAA
GGCAATATCATTTAGTTTTTTTAATATTAACAAACCACAGGCTGTGTGAACCATCAGCAATTTCAAACC
AGAGGGATCTGCTTTTTTGGGAACGATGTTGCAAATTTAATCTCTAGATTTTTTAAATCATGGATAGCC
TCCCTAAAGCAAAAGCTTTTTAGGGGCTTTACTTCTCCTGATTGCAGCCTGTGGTATAATTTGTGATTG
TTAGGTGGGTCAGGTTTTGGGGTCCAGCCCTTTGTGCACTTTGACTATTGTCACCTTAGGCTGTCCCTTA
ATGCTGCCACCTCTGACCCCGGTGGGACACATAAATAACTTCTCCACCCGAGTTAGCATTTCAAGCCA
GTGCAATAAAGAAATTAAAAATAATTGATTTATTAACAACTCTGTTTTATCTTTAAAAAATAAAATGTT
TTATATCTAATGTTCACTCAGGTACCTGATATTGTTTGCTGTGCAATAATGTAGGTTAGTCATTATATTG
ACAAAGAAAATTAAATATGATGTTGTTTATTTTTAATTTTACATTATAGACTAGATTAGATTTTCATTTG
GAATTTAATTAGGAGTGCCTGGAGTGCATTGAGAACGTTAAAAAAAAAAAATCTGCTTACTCTTATAG
CTTTGGAAACTATTTTCAGATTATTACTCCACTATAGAAGCGATTCCTTTTTTTGAATAATTAAATATAT
ATATACAGTGCTCAGCATAAATGATCATCACAGATCTCTATTTTAAAGTATTATTTTTCCATAGGATGC
TTTACAATAATATATGTGTGTGTATACATTAGAATTGTCAGTTACAAAATCAAAACTGCAACAAAATA
ACTAAACTTAAGATCTAATGAGTACACCCAAATTAAACCAAACATTAGTCTATGCAAAAATTAATATG
TTAAGGAAAAATATTAAATACAATTTTAATATTCAGTCATTCATTTTCTTTTTTGCTTAGTCCCTTTATT
AATCTGGGGTCGCCACAGTGGAATTAACTGCCAATTTATCCAGCATATATTTTATGCAGCGGATGCTCT
TCCAGCTGCTACCCATCACTGGGAATCACCCATACACTCTCATTCACACACATACACTACGGACAATTT
AGCCTACCCAATTCACCTATAGCGTATGTCTTTGGACTTGTGGGGGAAACCGGAACACACGGAGGAAA
CCCACGCGAACACAGGGAGATCATGCAAACTCAGAAACGCCAACTGATCCAGCCAAGGCTCGAACCA
GTGACCTTCTTGCTGTGAGGCAATAGGGCTACCCATTGTGTCACTGCACCGTCCACAATTTTAATAAAC
ATGAAAAATCCCGAGAAACATAAACAATATTAAATGTAGTTGAAATTTTGTTGTTTGAAATTGTATTTA
T TTTTATATATTTAAAAATAGAGAAATAATTGATGATTTGGTTATTTATAATTTAAATATAACTATATTATTTTTTGATTTTTTAAATAATAAAAAAGAACTAGATTAAAGTAGTTAGTGTCGCAAAATAGCATGCTC
CATGTTGCTGTTGTTGTTTTTTACAGGCTTGATGTACAATATGATCTTTGTGTAGTTTTATAGTAATAAA
TCATTCATGTCTTGTGTATTGTACGTCATATTATCTTAAAAGTACGCTATTAATTAAACTTGTTTATATG
GTCATCTTAGACAGGACTCTCATTATAAAAGGATTTTTGTTAATTTTATTAGTACCTTCCTGGAAAAAT
AAAAGATAAATAAATAAAAATGAATAAAAGTCTTGGGCTTGTTTTCTGTACGAGTAATAAAAAAGAGT
AAGCAAATATTCTGCATGACAATATTGTTCAAAGTTTAAGGGCTGTATTTTTTATAATTGTTGGTTATT
AACATGTTTTATACAAATTACTTTCAACATGGCTGAAATAATAATTGTTATCACTATTTGAAACAGTCC
TAGAATAGATTTTACTATATTTACATTTATTCCTCTGATGACAAAGTTGAAATTCCTCTGATGACAAAG
CAAAACTCTCAACTCTAGTTTTATTTTATTGTAATAACCATGTCAAGGGATAATGACAATGTTTTCCAT
TATATTTTCAATATAGAATAAAATTATAATTTATTAATCATTTAGTAGGGCAGCATGGTGGCACAATGG
GTAGCACAATCACCTCACACCAAGAAGGTTGCTAGTTCGAGCCCCGGCTGGGTCAGTTTGCATATCTG
TGTGGAGAATGTTCTCTCTGTGTTGCCATGGGTTTCCTCTGGGTGCTCTAGTTTCCACCACAAGTCTAA
AAACAAGTGGCATCGGTGAATTGTGTAGGCTAAATTGTCTGTAGTGTTTGTGTGTGATTGAGTGTTTAT
GGATGTTTCCCAGTGATGGGTTGCAGTTGGAAGGGCATTCTCTGCGTAAAACTATAAGTTGGCGGTTC
ATTCCACTGTGGTGACCCCAGATTAATAAAGGGATTAAGCCGAAAAGAAAATGAATCATTAAATGATC
ATTTAGTTGATTGGAGAGCATTGCATAATGAGAATCAAATAATGTATAGTTTTTTGTAAAATGATTGTG
TATTAGAGGCACATTGTACGTAGTGTGGAATGTTTAGGTTGTCTTTCTGATTGTTTTCATTTTGCAGAA
GTTCATTTGCAGTCAGTGTAGTCAAAGCACCTCAGCTCAATTTATAGCAGCAGCCTGCTGTGATTTAAG
TGCCACAGGAGTGAAGGCTTTAACCCCTGTTGTAGATTGCAACCAATGTTTTTCTAAGGTAATTAGAA
GCTTGTTTAGCTAACGCTACCCACCCCACCCCCCACAAAAAAGTTGCTCTGAATAGCAGCATCTACCCC
T CTATGTGTATGAGAGTTAGGCCAAATAGTCATTTCTTTTGATTATATAGGATAGGAACATACTATTTTGACATTCGAATCGAGTTCGATTTCATCGACTCAAGTGCTTGGTCTCTTATATCATACAATGGATAACTTG Atorney Docket No: 23-0726-WO
GACAAAGGACCCTTTTAAGGACCCCTATACACCACATTTTTATCTATCTAATCACAAGTGGGTGATATT
AGAGGGATGATTCACCTAAAAATGAATTTTCCGCATTTTAATTTGGGGTTCCAAACCAGTTTGAATTCT
TTTGTTCTGTTGAACACAAAATAAGATGTTTTAAGAATGTTGGAAATGTTGGAGACTTTTATAGTAGGA
AAAACATATACTAATATTTGCATTCATGTTTGAAATGTTTAAAACATTTTTCAAAATATCTTATTTTTCA
ACTGTTTTGGAACAAGTCAAAAGTGAGTAAATGATGACTGATAAACAATTTCTTTAAATACAGATGAA
AATAGCGTCTAACACATTTTGAACTAGTTCACTTTCAACCACAGCAAGAGGTAGTCGAAAACACATTT
GATCACATTTTGTTGTGGGACCGCTTGTTGTTCAGTGTGTTTTCATTGTTGAGTTACAAACCGGTAAGT
GGCATTAAAACATGTTTTGGCATCACTGATGATCATAAATAAATTGGTTAAAAAATTAAAAATTAGAT
GCTTACAGTACAGTTTGTTTAAAAACTTGCACTTTTTGTAGTGTGAAATGACATTAGTACCTGCAGTGG
GCTTTCTTTGTTCTGTATCTTCTGATGAATCTAACATAAAGACATTTAAATATTCACAATGGAGTGGGT
TGGTTCTCATCTATCTGAAACAACATTAGTGTGTTCAAAACAAATCTACACCAGTGATCTCTGATAGAT
ACAAGCTGTCAACCGTAGTCCTATTGTTTCTCATGCGACTGTCACAGGGCCATGCTAGAGGCTCTTTGG
GTGGTGAGTAGAGACTCATTCTTATGCAAACAGGCTATGGATGCTACAACTGAAGAGAATTTAGTGCT
CTAAGGTCATCGCAGTTCTATAAAGCAGATTCCCTCCAAAAAGCTAGAGAAAATTATGTGTCTGGAGG
CACCATCTATCAGTGCAGTCATTCTTTTATTACTTTTTTTTTTTGTCCATGCAATTTTTTAATCGCATTTT
GAAGTATTTAAACCATTAAGAGTGTCAAATTATCATGTTATTATTTCAACTCATAATATCTCCTTTTAA
AGATGATTCATTTGATTGTAGTTATAATAATTGTTTTATTAATGCAAAAATTGCTTAAATGTTTGGCCTC
TGAGATTTTCAGTTGACTCAATATTTTTGGAGCCTGTTTCATGACTTTATTTAAAATATAATCTGCACTC
GCAAATATTACAATTATATCATATTTTGAAAATCTTAGATGTACATTTGTTTTGAAAATGGTTTAAAGG
AAATTTAGGTCAAAATGTGTGTTTTTTTTAAATAATAATTCAGTCTTTTTTTTGATATAATAGGGAAAA
TGACAGCAATTAAAAGGCTGTTTTGGAAAGACATCTAGGTCTGGTGCAGACTTCGTAACTTCTTAGAG
TTAAATCTTGAAAACGGAGCCAGAAGACGGGCAACACCTTCCTAAAAGCAGGGTGGGGTGTTGGACA
GGTAGCTTCTTGGAACCTCCCCTCTTTGTCGCTGTGGTATATATAGAAATCCCATTGAATTCCTATAGA
GACCTTAAGCCCGTACCATTTACCTCTGAAGCCACGGGTTTAGTGAACCGTCAGATCCGCTAGCATGTC
CGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCA
AGATCCATTCGTTGGGGGATCTGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCC
CGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTGGGGGATCCACCGGTCGCCACCGAGATGGC
AAGCCAGCAGGGCGAGACGATGTCCGGACCGCTGCACATTGGTTTGATTCCCACAGTTGGACCGTACC
TGCTACCGCATATTATCCCTATGCTGCACCAGACCTTTCCAAAGCTGGAAATGTATCTGCATGAAGCAC
AGACCCACCAGTTACTGGCGCAACTGGACAGCGGCAAACTCGATTGCGTGATCCTCGCGCTGGTGAAA
GAGAGCGAAGCATTCATTGAAGTGCCGTTGTTTGATGAGCCAATGTTGCTGGCTATCTATGAAGATCA
CCCGTGGGCGAACCGCGAATGCGTACCGATGGCCGATCTGGCAGGGGAAAAACTGCTGATGCTGGAA
GATGGTCACTGTTTGCGCGATCAGGCAATGTCCGCCGGCTACAACAGCGACAACGTCTATATCATGGC
CGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCACAACGTCGAGGACGGCAGCGTG
CAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA
CTACCTGAGCTTCCAGTCCGTCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGG
AGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAACGTGGATGGCGGTAGCGGT
GGCACCGGCAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCG
ACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGAC
CCTGAAGCTGATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTCGGCT
ACGGCCTGAAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATG
CCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCG
AGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGGCTTCAAGGAGGA
CGGCAACATCCTGGGGCACAAGCTGGAGTACAACGGCACCGGTTTCTGTTTTGAAGCCGGGGCGGATG
AAGATACACACTTCCGCGCGACCAGCCTGGAAACTCTGCGCAACATGGTGGCGGCAGGTAGCGGGAT
CACTTTACTGCCAGCGCTGGCTGTGCCGCCGGAGCGCAAACGCGATGGGGTTGTTTATCTGCCGTGCA
TTAAGCCGGAACCACGCCGCACTATTGGCCTGGTTTATCGTCCTGGCTCACCGCTGCGCAGCCGCTATG
AGCAGCTGGCAGAGGCCATCCGCGCAAGAATGGATGGCCATTTCGATAAAGTTTTAAAACAGGCGGTT
TAAAGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAA
ACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTG
CAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGC
ATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA (SEQ ID NO: 29) pBSK- JC T2 tp63 Gal4 VP 16 GFP-5xUAS-MC S Atorney Docket No: 23-0726-WO
Sequence:
CTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACA
CTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTC
CCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCA
AAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGA
CGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGG
TCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAAC
AAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTGCCATTCGCCATTCAGGCTGCGCA
ACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCT
GCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGA
ATTGTAATACGACTCACTATAGGGCGACCCTGCAGAGGTGTAAAAAGTACTCAAAAATTTTACTCAAG
TGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAAAAGTAAAAGTATCTGGCTAGAATCTTACT
TGAGTAAAAGTAAAAAAGTACTCCATTAAAATTGTACTTGAGTATTAAGGAAGTAAAAGTAAAAGCA
AGAAAGAAAACTAGAGATTCTTGTTTAAGCTTTTAATCTCAAAAAACATTAAATGAAATGCATACAAG
GTTTTATCCTGCTTTAGAACTGTTTGTATTTAATTATCAAACTATAAGACAGACAATCTAATGCCAGTA
CACGCTACTCAAAGTTGTAAAACCTCAGATTTAACTTCAGTAGAAGCTGATTCTCAAAATTGTTAGTGT
CAAGCCTAGCTCTTTTGGGGCTGAAAAGCAATCCTGCAGTGCTGAAAAGCCTCTCACAGGCAGCCGAT
GCGGGAAGAGGTGTATTAGTCTTGATAGAGAGGCTGCAAATAGCAGGAAACGTGAGCAGAGACTCCC
TGGTGTCTGAAACACAGGCCAGATGGCCCCGCGGCCGGGCCCTCGGCCGGCCGATTAATTAACGAGCT
CGAGAGAAACCAGGCTCAGTCGGGCACGACCATTACTCCACTTGACCAAACGTCTGCATATTTATAAA
TAATAATTTGCGTATTAATATGCAGATAAAGACAATTAAAAGAAGCAACAGTAGCATTAATCATTCAA
ATAACAGTATACAATCAAACAACATTTTGTATATATATTTAAAAAAACAATACAAGGAGTAAAGACAA
AGGCAATATCATTTAGTTTTTTTAATATTAACAAACCACAGGCTGTGTGAACCATCAGCAATTTCAAAC
CAGAGGGATCTGCTTTTTTGGGAACGATGTTGCAAATTTAATCTCTAGATTTTTTAAATCATGGATAGC
CTCCCTAAAGCAAAAGCTTTTTAGGGGCTTTACTTCTCCTGATTGCAGCCTGTGGTATAATTTGTGATT
GTTAGGTGGGTCAGGTTTTGGGGTCCAGCCCTTTGTGCACTTTGACTATTGTCACCTTAGGCTGTCCCTT
AATGCTGCCACCTCTGACCCCGGTGGGACACATAAATAACTTCTCCACCCGAGTTAGCATTTCAAGCC
AGTGCAATAAAGAAATTAAAAATAATTGATTTATTAACAACTCTGTTTTATCTTTAAAAAATAAAATGT
TTTATATCTAATGTTCACTCAGGTACCTGATATTGTTTGCTGTGCAATAATGTAGGTTAGTCATTATATT
GACAAAGAAAATTAAATATGATGTTGTTTATTTTTAATTTTACATTATAGACTAGATTAGATTTTCATTT
GGAATTTAATTAGGAGTGCCTGGAGTGCATTGAGAACGTTAAAAAAAAAAAATCTGCTTACTCTTATA
GCTTTGGAAACTATTTTCAGATTATTACTCCACTATAGAAGCGATTCCTTTTTTTGAATAATTAAATATA
TATATACAGTGCTCAGCATAAATGATCATCACAGATCTCTATTTTAAAGTATTATTTTTCCATAGGATG
CTTTACAATAATATATGTGTGTGTATACATTAGAATTGTCAGTTACAAAATCAAAACTGCAACAAAAT
AACTAAACTTAAGATCTAATGAGTACACCCAAATTAAACCAAACATTAGTCTATGCAAAAATTAATAT
GTTAAGGAAAAATATTAAATACAATTTTAATATTCAGTCATTCATTTTCTTTTTTGCTTAGTCCCTTTAT
TAATCTGGGGTCGCCACAGTGGAATTAACTGCCAATTTATCCAGCATATATTTTATGCAGCGGATGCTC
TTCCAGCTGCTACCCATCACTGGGAATCACCCATACACTCTCATTCACACACATACACTACGGACAATT
TAGCCTACCCAATTCACCTATAGCGTATGTCTTTGGACTTGTGGGGGAAACCGGAACACACGGAGGAA
ACCCACGCGAACACAGGGAGATCATGCAAACTCAGAAACGCCAACTGATCCAGCCAAGGCTCGAACC
AGTGACCTTCTTGCTGTGAGGCAATAGGGCTACCCATTGTGTCACTGCACCGTCCACAATTTTAATAAA
CATGAAAAATCCCGAGAAACATAAACAATATTAAATGTAGTTGAAATTTTGTTGTTTGAAATTGTATTT
A
TTT TT TA TA TA TT TA AA AA TA GA GA AA TAA TT AG GTA TTT GG TT TA TT AT AA TT ATA AT AT AA CT AT AT TA TT TT TT GA TT TT TT AA AT AA TA AA AA AG AA CT AG AT ATA ATG AG TT AG TG TC GC AA AA TA GC AT GC
CCATGTTGCTGTTGTTGTTTTTTACAGGCTTGATGTACAATATGATCTTTGTGTAGTTTTATAGTAATAA
ATCATTCATGTCTTGTGTATTGTACGTCATATTATCTTAAAAGTACGCTATTAATTAAACTTGTTTATAT
GGTCATCTTAGACAGGACTCTCATTATAAAAGGATTTTTGTTAATTTTATTAGTACCTTCCTGGAAAAA
TAAAAGATAAATAAATAAAAATGAATAAAAGTCTTGGGCTTGTTTTCTGTACGAGTAATAAAAAAGAG
TAAGCAAATATTCTGCATGACAATATTGTTCAAAGTTTAAGGGCTGTATTTTTTATAATTGTTGGTTATT
AACATGTTTTATACAAATTACTTTCAACATGGCTGAAATAATAATTGTTATCACTATTTGAAACAGTCC
TAGAATAGATTTTACTATATTTACATTTATTCCTCTGATGACAAAGTTGAAATTCCTCTGATGACAAAG
CAAAACTCTCAACTCTAGTTTTATTTTATTGTAATAACCATGTCAAGGGATAATGACAATGTTTTCCAT
TATATTTTCAATATAGAATAAAATTATAATTTATTAATCATTTAGTAGGGCAGCATGGTGGCACAATGG
GTAGCACAATCACCTCACACCAAGAAGGTTGCTAGTTCGAGCCCCGGCTGGGTCAGTTTGCATATCTG
TGTGGAGAATGTTCTCTCTGTGTTGCCATGGGTTTCCTCTGGGTGCTCTAGTTTCCACCACAAGTCTAA
AAACAAGTGGCATCGGTGAATTGTGTAGGCTAAATTGTCTGTAGTGTTTGTGTGTGATTGAGTGTTTAT Atorney Docket No: 23-0726-WO
GGATGTTTCCCAGTGATGGGTTGCAGTTGGAAGGGCATTCTCTGCGTAAAACTATAAGTTGGCGGTTC
ATTCCACTGTGGTGACCCCAGATTAATAAAGGGATTAAGCCGAAAAGAAAATGAATCATTAAATGATC
ATTTAGTTGATTGGAGAGCATTGCATAATGAGAATCAAATAATGTATAGTTTTTTGTAAAATGATTGTG
TATTAGAGGCACATTGTACGTAGTGTGGAATGTTTAGGTTGTCTTTCTGATTGTTTTCATTTTGCAGAA
GTTCATTTGCAGTCAGTGTAGTCAAAGCACCTCAGCTCAATTTATAGCAGCAGCCTGCTGTGATTTAAG
TGCCACAGGAGTGAAGGCTTTAACCCCTGTTGTAGATTGCAACCAATGTTTTTCTAAGGTAATTAGAA
GCTTGTTTAGCTAACGCTACCCACCCCACCCCCCACAAAAAAGTTGCTCTGAATAGCAGCATCTACCCC
T CTATGTGTATGAGAGTATGGCCAAATAGTCATTTCTTTTGATATTATAGGATAGGAACATACTATTTTGACATTCGAATCGAGTTCGATTTCATCGACTCAAGTGCTTGGTCTCTTATATCATACAATGGATAACTTG
GACAAAGGACCCTTTTAAGGACCCCTATACACCACATTTTTATCTATCTAATCACAAGTGGGTGATATT
AGAGGGATGATTCACCTAAAAATGAATTTTCCGCATTTTAATTTGGGGTTCCAAACCAGTTTGAATTCT
TTTGTTCTGTTGAACACAAAATAAGATGTTTTAAGAATGTTGGAAATGTTGGAGACTTTTATAGTAGGA
AAAACATATACTAATATTTGCATTCATGTTTGAAATGTTTAAAACATTTTTCAAAATATCTTATTTTTCA
ACTGTTTTGGAACAAGTCAAAAGTGAGTAAATGATGACTGATAAACAATTTCTTTAAATACAGATGAA
AATAGCGTCTAACACATTTTGAACTAGTTCACTTTCAACCACAGCAAGAGGTAGTCGAAAACACATTT
GATCACATTTTGTTGTGGGACCGCTTGTTGTTCAGTGTGTTTTCATTGTTGAGTTACAAACCGGTAAGT
GGCATTAAAACATGTTTTGGCATCACTGATGATCATAAATAAATTGGTTAAAAAATTAAAAATTAGAT
GCTTACAGTACAGTTTGTTTAAAAACTTGCACTTTTTGTAGTGTGAAATGACATTAGTACCTGCAGTGG
GCTTTCTTTGTTCTGTATCTTCTGATGAATCTAACATAAAGACATTTAAATATTCACAATGGAGTGGGT
TGGTTCTCATCTATCTGAAACAACATTAGTGTGTTCAAAACAAATCTACACCAGTGATCTCTGATAGAT
ACAAGCTGTCAACCGTAGTCCTATTGTTTCTCATGCGACTGTCACAGGGCCATGCTAGAGGCTCTTTGG
GTGGTGAGTAGAGACTCATTCTTATGCAAACAGGCTATGGATGCTACAACTGAAGAGAATTTAGTGCT
CTAAGGTCATCGCAGTTCTATAAAGCAGATTCCCTCCAAAAAGCTAGAGAAAATTATGTGTCTGGAGG
CACCATCTATCAGTGCAGTCATTCTTTTATTACTTTTTTTTTTTGTCCATGCAATTTTTTAATCGCATTTT
GAAGTATTTAAACCATTAAGAGTGTCAAATTATCATGTTATTATTTCAACTCATAATATCTCCTTTTAA
AGATGATTCATTTGATTGTAGTTATAATAATTGTTTTATTAATGCAAAAATTGCTTAAATGTTTGGCCTC
TGAGATTTTCAGTTGACTCAATATTTTTGGAGCCTGTTTCATGACTTTATTTAAAATATAATCTGCACTC
GCAAATATTACAATTATATCATATTTTGAAAATCTTAGATGTACATTTGTTTTGAAAATGGTTTAAAGG
AAATTTAGGTCAAAATGTGTGTTTTTTTTAAATAATAATTCAGTCTTTTTTTTGATATAATAGGGAAAA
TGACAGCAATTAAAAGGCTGTTTTGGAAAGACATCTAGGTCTGGTGCAGACTTCGTAACTTCTTAGAG
TTAAATCTTGAAAACGGAGCCAGAAGACGGGCAACACCTTCCTAAAAGCAGGGTGGGGTGTTGGACA
GGTAGCTTCTTGGAACCTCCCCTCTTTGTCGCTGTGGTATATATAGAAATCCCATTGAATTCCTATAGA
GACCTTAAGCCCGTACCATTTACCTCTGAAGCCTAGGATGAAGCTACTGTCTTCTATCGAACAAGCATG
CGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAG
AACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGA
AGTGGAATCAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACA
TGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGATAATG
TGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGACAG
CATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTAT
CGTCGAGGTCGACCCCGGGAATTCAGATCTCTCGAGCCGCCCCCCCGACCGATGTCAGCCTGGGGGAC
GAGCTCCACTTAGACGGCGAGGACGTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGA
CATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTACCCCCCACGACTCCGCCCCCTACGGCGCTC
TGGATATGGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGACGTGGC
GATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTC
CGGGATTTACCCCCCACGACTCCGCCCCCTACGGCGCTCTGGATATGGCCGACTTCGAGTTTGAGCAG
ATGTTTACCGATGCCCTTGGAATTGACGAGTACGGTGGGGGCGGCCGGCCGCGACTCTAGATCATAAT
CAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAA
ACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAA
TAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCAT
CAATGTATGGCGGCCGCAGCTCGGCGCCCTTGCTCACCATGGTGGCGACCGGTCTTGTACAGCTCATC
CATGCCGTGGGTGATGGCGGCGGCGGTCACGAAGCCGAAGTAGATCATGTGATCGCGCTTCTCGTTGG
GGTCCTTGGACAGGGCGCTCTGGGTGGACAGGTAGTGGTTATCGGGCAGCAGCACAGGGCCATCGCC
GATGGGGGTATTCTGCTGGTAGTGGTCGGCCAGCTGCACGCTGCCATCCTCGATGTTGTGGCGGATCTT
GAAGTTCACCTTGATGCCATTCTTGGCCTTGTCGGTCATGATGTACACATTGTGGGCGTTGTAGTTGTA
CTCCATCTTATTGCCCAGGATGTTGCCATCCTCCTTGAAATCGGTGCCGGTCAGCTCGATGCGATTCAC
CAGGGTATCGCCCTCGAACTTCACCTCGGCGCGCGACTTGTAGTTGCCGTCATCCTCGAAGAAGATGG Atorney Docket No: 23-0726-WO
TGCGCTCCTGGATGTAGCCCTCAGGCATGGCGCTCTTGAAGAAGTCGTGCTGCTTCATGTGATCGGGGT
AGCGTGAGAAGCACTGCACGCCGTAGCTCAGGGTGGTCACCAGGGTGGGCCAGGGCACAGGCAGCTT
GCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGCTCA
CGCTGAACTTGTGGCCATTCACATCGCCATTCAGCTCGATCAGGATGGGCACGATGCCGGTGAACAGC
TCGGCGCCCTTGCTCACCATGGATCCCGTCTAGAGGGTATATAATGGATCCCATCGCGTCTCAGCCTCA
CTTTGAGCTCCTCCACACGAATTCTTTGGCCCGGAGTACTGTCCTCCGGGCTGGCGGAGTACTGTCCTC
CGGCAAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCAAGGCGGAGT
ACTGTCCTCCGTCTAGAGGGTATATAATGGATCCCATCGCGTCTCAGCCTCACTTTGAGCTCCTCCACA
CGAATTCCCTCGACCTCGAAGACCTTAAGTTCGAATTAGGCGCGCCAGGTGATCATCATGAATCCGCT
CATTGATATCTTTTTTTTTCCTTTCTTGTACAAAGTGGGGGATCCAGACATGATAAGATACATTGATGA
GTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTG
CTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTC
AGGTTCAGGGGGAGGTGTGGGAGGTTTTTTCCAACTTTATTATACAGGTACCAAGGCCTTCGATTTTTC
GCGATTTTTTGCGAAGATACGGCCACGGGTGCTCTTGATCCTGTGGCTGATTTTGGACTGTGCTGCTCG
CAGCTGCTGATGAATCACATACTTCCTCCATTTTCTTCCACTGATTGACTGTTATAATTTCCCTAATTTC
CAGGTCAAGGTGCTGTGCATTGTGGTAATAGATGTGACATGACGTCACTTCCAAAGGACCAATGAACA
TGTCTGACCAATTTCATATAATGTGAAAACGATTTTCATAGGCAGAATAAATAACATTTAAATTAAACT
GGGCATCAGCGCAATTCAATTGGTTTGGTAATAGCAAGGGAAAATAGAATGAAGTGATCTCCAAAAA
ATAAGTACTTTTTGACTGTAAATAAAATTGTAAGGAGTAAAAAGTACTTTTTTTTCTAAAAAAATGTAA
TTAAGTAAAAGTAAAAGTATTGATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCCAAAAATAATAC
TTAAGTACAGTAATCAAGTAAAATTACTCAAGTACTTTACACCTCTGGGGGAGGTTCCCTTTAGTGAG
GGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAA
TTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTC
ACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGA
ATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTC
GCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCA
CAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTA
AAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT
CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT
GGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTG
TGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCC
GGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTA
GGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTAT
CTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCA
CCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAA
GATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTC
ATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAA
AGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGAT
CTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTT
ACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAA
TAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCT
ATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATT
GCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCA
AGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTC
AGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATG
CCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGG
CGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGT
GCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTC
GATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGC
AAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT
ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAA
TGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCAC (SEQ ID
NO: 30) Atorney Docket No: 23-0726-WO isll:Gal4VP16 14xUAS-tdTomato
Sequence:
CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTT
TAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGT
GTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAAC
CGTCTATCAGGGCGATGGCCCACGCTGGCTAAGAACTCATCAGCCTCCCCGGTCCATCTACCCACGTA
CCAATGCACCAATTGGCCACAATGACGGCTACTACATGGTGCCATTCCTTCCTCTTTATAGGAATGGAG
ACTACCTCCTGTCCAACAAGGCTCTTGGATACGAGTACGCCTACCTGTTGGACCCAGGTCATTGCACA
ACACCAGAAATGCCCTCTGATCTGCAAAAGACGTGAATATCTGTTCAGACACCCATATCCACTCTGTTC
CACACAGGTCAGAGGTTTGTCCAGGAGTTCTTGACAGAGGTGTAAAAAGTACTCAAAAATTTTACTCA
AGTGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAAAAGTAAAAGTATCTGGCTAGAATCTTA
CTTGAGTAAAAGTAAAAAAGTACTCCATTAAAATTGTACTTGAGTATTAAGGAAGTAAAAGTAAAAGC
AAGAAAGAAAACTAGAGATTCTTGTTTAAGCTTTTAATCTCAAAAAACATTAAATGAAATGCATACAA
GGTTTTATCCTGCTTTAGAACTGTTTGTATTTAATTATCAAACTATAAGACAGACAATCTAATGCCAGT
ACACGCTACTCAAAGTTGTAAAACCTCAGATTTAACTTCAGTAGAAGCTGATTCTCAAAATTGTTAGTG
TCAAGCCTAGCTCTTTTGGGGCTGAAAAGCAATCCTGCAGTGCTGAAAAGCCTCTCACAGGCAGCCGA
TGCGGGAAGAGGTGTATTAGTCTTGATAGAGAGGCTGCAAATAGCAGGAAACGTGAGCAGAGACTCC
CTGGTGTCTGAAACACAGGCCAGATGGGCCCTCGAGCAGGAAACAGCTATGACCATGATTACGCCAA
GCTATCAACTTTGTATAGAAAAGTTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATT
AGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGGTCGACC
AGAGAGGGAGAGAGGGATAGGGACAAGAGTGGCCCATCAATACAGTGACCAAACACCGGAGCTCAA
CACACACCCCTAACTCTAATCGCAAGCATCTCGATTTCGGGAAGTCCTGCAACACCTCGAACCCTCGG
CCACTTTCCCACCTTCACAGATAAAAACACGGGCACTAAGGGCCTTCTGTCCGGTTTTAAAAGTGGAC
CTAACACCGCCTTACTTTCTTGACATGGGAGACATGGGGGATCCACCGAAAAAAAAGCGTCTAATCTC
GTTGTGTGTCGGCTGTGGGAATCAAATCCATGACCAGTATATTCTGCGCGTGTCGCCGGATCTGGAGT
GGCACGCGGCGTGTTTGAAATGTGCAGAATGTAACCAGTATCTGGACGAGTCCTGTACATGTTTTGTG
CGAGACGGGAAAACTTACTGTAAACGGGACTACATCAGGTTATACGGGATCAAATGTGCAAAATGCA
ACATCGGTTTCAGCAAGAATGACTTTGTGATGAGAGCACGTTCGAAGGTTTATCATATTGAGTGTTTTA
GATGTGTGGCGTGTAGTCGGCAGCTCATCCCAGGAGATGAGTTCGCTCTGCGGGAAGACGGGCTCTTC
TGCAGGGCCGACCATGACGTGGTGGAGCGGGCAACAATGGGTGCTGGTGACCCATTAAGCCCATTAC
ATCCGGCGAGACCTTTACAAATGGCAGCAGAGCCCATTTCGGCACGTCAGCCTGCGCTTCGACCTCAT
GTGCACAAGCAACCTGAGAAAACAACCCGCGTCCGGACAGTCCTCAACGAAAAACAGCTCCATACCT
TGAGGACTTGTTACAATGCCAACCCTCGACCCGACGCCCTCATGAAAGAGCAGCTCGTTGAGATGACG
GGTCTTAGTCCGAGAGTCATCAGGGTTTGGTTTCAAAACAAGCGCTGCAAGGATAAAAAGAGGAGCA
TACTGATGAAGCAACTCCAGCAGCAGCAACCCAACGACAAAACGAACATCCAGGGGATGACAGGTAC
TCCAATGGTGGCGACCAGTCCAGAGAGACACGACGGTGGTTTGCAGGCAAACCAAGTGGAGGTGCAG
AGTTACCAACCGCCTTGGAAAGTCCTAAGTGACTTCGCACTGCAGAGTGACATCGACCAGCCTGCTTT
CCAACAACTGGTTAATTTTTCTGAAGGTGGTCCAGGCTCAAACTCCACAGGGAGCGAGGTCGCGTCAA
TGTCCTCGCAACTGCCAGATACACCAAACAGCATGGTAGCGAGTCCTATAGAGGCCTAGGCGAGTGGA
TTATCTCCTGCATCTGAAGTTTGCGAAAGGACGTGTCCGGGAACCAATCTCAGAGAGAGGCTCGTGAA
GTTTCTTCCATCCCTATTTCATTTAGGGCCGCTTCTGAATAAAAGCCCATCCTCCGACTGCACGAGGCC
TCTATATCGAAACAACCTTTGGTTGTATTTATACACTGTGATGACAATCGTGGGATTTAAACACACTCT
GACCGGGCAAGTCCAACGAGTGTTGCGAAAAGACCATTTAAAGTTGCAGACTCCAGCGAAAGTGGAC
CCTGCCGGCGCACATATTCACATACCGAACCTGACATGATCATTGCAGTGCTCCGCGGCCGAGTGGAC
CTGGTCGGCTACACTTTTGCCAAATACCCCTCCACACTTTTCCCACTTTTATGACAAATCAATGGACCT
CTACGGATATAAGACGCAAGAGAACTTAGTCTAATATATTCATTCATATATAGTCTACTTCTGTGCGCA
ACGTAAGTAGCCTATAATGAAACCATGACTGTTTATTCTGTTTCTATAAAAGATCGAGACGGACTATA
CTTGCTCACAAATAAGGGTATGGCAGCCGAGGTCTACTGCGATTACAGTTTTGTTATATGGTCTCTTTT
GAAGCCCAAGTACTAAGGCATTGCAACAAGGTATACCTCTATTTTGCCACAAGCTGTGTGGGAATTTC
ATGTGTTCGTGTCCGTCCAAGAAGTTTTTTTTCTTTCCCAAAGATGTGTATAGGTTTAATTTAAGTTAAT
ATGACTGACTAGTTCTGGAGGTTTTGTTTCGTTCCTGTATTACAAAATATTTTATTATTTATTGTCAAAA
GACATGCCACTTTTGTGTACTTTTACTTGCTGAAGAAGTAAAAAAGGAGGAAAAGAATATTGTCGACT
CCGAATGATCTATCATAAATTGACGTGTCCTGTCGTTTGATCAAAGACTGATGTAAGAACAACGCCAT Atorney Docket No: 23-0726-WO
ATGTAGAGTTATCTTCAGGAAAATCTTGATCAATAAAAATCTGACGTGTACTGTAAGTCCATGAAGCT
ACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAAC
CGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCG
CTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGAT
TTTTCCTCGAGAAGACCTTGACATGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTAAC
AGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTG
ATATGCCTCTAACATTGAGACAGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAA
AGGTCAAAGACAGTTGACTGTATCGTCGAGGTCGACCCCGGGAATTCAGATCTCTCGAGCCGCCCCCC
CGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGACGTGGCGATGGCGCATGCCGA
CGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTACCCCCC
ACGACTCCGCCCCCTACGGCGCTCTGGATATGTAGCGGATCTACTAGTGCGGCCCCTCTCGAGCCTCTA
GAACTATAGTGAGTCGTATTACGTAGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCA
CAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCA
TTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAG
GTGTGGGAGGTTTTTTAATTCGCGGCCATCAAGCTTAGGCCTCCAAGGCGATCCAGACATGATAAGAT
ACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGT
GATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCAT
TTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGG
TATGGCTGATTATCCGGAGTACTGTCCTCCGGGCTGGCGGAGTACTGTCCTCCGGCAAGGTCGGAGTA
CTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCAAGGCGGAGTACTGTCCTCCGACACT
AGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGT
ACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGA
CACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCG
GAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGTCCACTTAAGCTAGGTGGCCAGCGG
TGGGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAA
ATTTGTGATGCTATTGCTTTATTTCTAGAGGGTATATAATGGATCCCATCGCGTCTCAGCCTCACTTTGA
GCTCCTCCACACGAATTCTTTGGCCACAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCC
GTGCCCTGGCCCACCCTCGTGACCACCCTGACTACGGCGTGCAGTGCTTCAGCAATATACTCGAGTTAT
GGTGAGCAAGGGCGAGGAGGTCATCAAAGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCATG
AACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCA
AGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCATGTAC
GGCTCCAAGGCGTACGTGAAGCACCCCGCCGACATCCCCGATTACAAGAAGCTGTCCTTCCCCGAGGG
CTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGTCTGGTGACCGTGACCCAGGACTCCTCCC
TGCAGGACGGCACGCTGATCTACAAGGTGAAGATGCGCGGCACCAACTTCCCCCCCGACGGCCCCGTA
ATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGA
AGGGCGAGATCCACCAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGACCAT
CTACATGGCCAAGAAGCCCGTGCAACTGCCCGGCTACTACTACGTGGACACCAAGCTGGACATCACCT
CCCACAACGAGGACTACACCATCGTGGAACAGTACGAGCGCTCCGAGGGCCGCCACCACCTGTTCCTG
GGGCATGGCACCGGCAGCACCGGCAGCGGCAGCTCCGGCACCGCCTCCTCCGAGGACAACAACATGG
CCGTCATCAAAGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCATGAACGGCCACGAGTTCGAG
ATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGG
GCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCATGTACGGCTCCAAGGCGTACGTGA
AGCACCCCGCCGACATCCCCGATTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTG
ATGAACTTCGAGGACGGCGGTCTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCACGCTGAT
CTACAAGGTGAAGATGCGCGGCACCAACTTCCCCCCCGACGGCCCCGTAATGCAGAAGAAGACCATG
GGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACCAGG
CCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGACCATCTACATGGCCAAGAAGCC
CGTGCAACTGCCCGGCTACTACTACGTGGACACCAAGCTGGACATCACCTCCCACAACGAGGACTACA
CCATCGTGGAACAGTACGAGCGCTCCGAGGGCCGCCACCACCTGTTCCTGTACGGCATGGACGAGCTG
TACAAGTTTATGCATATTACGCGCCATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGT
TTTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTATTATA
CATAGTTGATAATTCACTGGCCGTCGTTTTACGGTACCATCGATGATGATCCAGACATGATAAGATAC
ATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGA
TGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTT
TATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTA
TGGCTGATTATGATCCTCTAGATCAGATCTGCGAAGATACGGCCACGGGTGCTCTTGATCCTGTGGCTG Atorney Docket No: 23-0726-WO
ATTTTGGACTGTGCTGCTCGCAGCTGCTGATGAATCACATACTTCCTCCATTTTCTTCCACTGATTGACT
GTTATAATTTCCCTAATTTCCAGGTCAAGGTGCTGTGCATTGTGGTAATAGATGTGACATGACGTCACT
TCCAAAGGACCAATGAACATGTCTGACCAATTTCATATAATGTGAAAACGATTTTCATAGGCAGAATA
AATAACATTTAAATTAAACTGGGCATCAGCGCAATTCAATTGGTTTGGTAATAGCAAGGGAAAATAGA
A TTTTGTATATGCTTGAAATACATACACAATAGATAAAAATTTAAAAGGTTAACATATATGTTTAGAAACTAGGTTAAATATGTAATATATATTTTAGATTATAGGTGAACGTTCAAAAAGATAAAGATAGCTTATA
AAATCCCCAAAAATAATACTTAAGTACAGTAATCAAGTAAAATTACTCAAGTACTTTACACCTCTGGT
TCTTGACCCCCTACCTTCAGCAAGCCCAGCAGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGA
GCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCC
TGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCT
GGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGA
AACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCG
CTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCA
CTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAA
GGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCC
TGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATAC
CAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTG
TCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCC
GGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAA
CAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCT
ACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGT
AGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTAC
GCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACG
AAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATT
AAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTA
ATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTG
TAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACG
CTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCT
GCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTT
AATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCT
TCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGT
TAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGC
AGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAAC
CAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATA
CCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCA
AGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCT
TTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAA
GGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTT
ATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACA
TTTCCCCGAAAAGTG (SEQ ID NO: 31)

Claims

CLAIMS:
1. A method of preventing or treating chemotherapy-induced peripheral neuropathy (CIPN) in a subject undergoing a chemotherapeutic treatment, the method comprising: administering to the subject a therapeutic agent capable of inhibiting kinesin-5 (Eg5) function or expression.
2. The method of claim 1, wherein the therapeutic agent is an Eg5 inhibitor.
3. The method of claim 2, wherein the Eg5 inhibitor is monastrol, ispinesib, (+)-S-trityle-L- cysteine (TriC), BRD9876, filanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB- 743921, MK0731, 4SC-205, ARQ 621, or EMD534085.
4. The method of claim 1, wherein the therapeutic agent inhibits expression of kifll gene encoding EG5.
5. The method of claim 4, wherein the therapeutic agent is a CRISPR-Cas9 complex comprising a single guide RNA specific for the kifll gene.
6. The method of claim 1, wherein the chemotherapeutic treatment includes a chemotherapeutic agent capable of stabilizing microtubules in keratinocytes.
7. The method of claim 1, wherein the therapeutic agent is capable of preventing or reducing degeneration of neurons innervating epidermal keratinocytes.
8. The method of claim 6, wherein the chemotherapeutic treatment is administration of paclitaxel, docetaxel, cabazitaxel, TPI-287, albumin paclitaxel or a combination thereof.
9. The method of claim 7, wherein the therapeutic agent is delivered via intravenous administration or topical administration.
10. A pharmaceutical composition comprising a therapeutic agent capable of inhibiting Eg5 function or expression, a chemotherapeutic agent capable of stabilizing microtubules in keratinocytes, and a pharmaceutically acceptable carrier.
11. The pharmaceutical composition of claim 10, wherein the therapeutic agent is an Eg5 inhibitor.
12. The pharmaceutical composition of claim 11, wherein the Eg5 inhibitor is monastrol, ispinesib, (+)-S-trityle-L-cysteine (TriC), BRD9876, filanesib (ARRY-520), litronesib (LY2523355), AZD4877, SB-743921, MK0731, 4SC-205, ARQ 621, or EMD534085.
13. The pharmaceutical composition of claim 12, wherein the therapeutic agent inhibits expression of kifl 1 gene encoding Eg5.
14. The pharmaceutical composition of claim 13, wherein the therapeutic agent is a CRISPR- Cas9 complex comprising a single guide RNA specific for the kifl 1 gene.
15. The pharmaceutical composition of claim 10, wherein the therapeutic agent is capable of preventing or reducing degeneration of neurons innervating epidermal keratinocyte.
16. The pharmaceutical composition of claim 10, wherein the chemotherapeutic agent is paclitaxel, docetaxel, cabazitaxel, TPI-287, albumin paclitaxel, or a combination thereof.
17. The pharmaceutical composition of claim 10 for preventing chemotherapy-induced peripheral neuropathy (CIPN) by administering a therapeutically effecting amount thereof to a patient undergoing chemotherapeutic treatment with an agent that promotes degeneration of neurons innervating the skin.
PCT/US2024/030257 2023-05-18 2024-05-20 Methods and pharmaceutical compositions for treating chemotherapy-induced peripheral neuropathy with eg5 inhibitors Ceased WO2024239018A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363503154P 2023-05-18 2023-05-18
US63/503,154 2023-05-18

Publications (1)

Publication Number Publication Date
WO2024239018A1 true WO2024239018A1 (en) 2024-11-21

Family

ID=91585807

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2024/030257 Ceased WO2024239018A1 (en) 2023-05-18 2024-05-20 Methods and pharmaceutical compositions for treating chemotherapy-induced peripheral neuropathy with eg5 inhibitors

Country Status (1)

Country Link
WO (1) WO2024239018A1 (en)

Non-Patent Citations (108)

* Cited by examiner, † Cited by third party
Title
"Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT WILLIAMS & WILKINS
1. BOBYLEV ET AL.: "Kinesin-5 Blocker Monastrol Protects Against Bortezomib-Induced Peripheral Neurotoxicity", NEUROTOX RES, vol. 32, 2017, pages 555 - 562, XP036322004, DOI: 10.1007/s12640-017-9760-7
A. 1. MARCUS ET AL.: "Mitotic kinesin inhibitors induce mitotic arrest and cell death in Taxol-resistant and -sensitive cancer cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 280, 2005, pages 11569 - 11577, XP008052654, DOI: 10.1074/jbc.M413471200
A. A. ARGYRIOU ET AL.: "Neurophysiological, nerve imaging and other techniques to assess chemotherapy-induced peripheral neurotoxicity in the clinical and research settings", JOURNAL OF NEUROLOGY, NEUROSURGERY, AND PSYCHIATRY, vol. 90, 2019, pages 1361 - 1369
A. A. ARGYRIOUJ. BRUNAA. A. GENAZZANIG. CAVALETTI: "Chemotherapy-induced peripheral neurotoxicity: management informed by pharmacogenetics", NAT REV NEUROL, vol. 13, 2017, pages 492 - 504
A. A. ARGYRIOUJ. BRUNAP. MARMIROLIG. CAVALETTI: "Chemotherapy-induced peripheral neurotoxicity (CIPN): an update", CRIT REV ONCOL HEMATOL, vol. 82, 2012, pages 51 - 77, XP028909920, DOI: 10.1016/j.critrevonc.2011.04.012
A. A. ARGYRIOUV. ZOLOTAO. KYRIAKOPOULOUH. P. KALOFONOS: "Toxic peripheral neuropathy associated with commonly used chemotherapeutic agents", J BUON, vol. 15, 2010, pages 435 - 446
A. A. HYMANS. SALSERD. N. DRECHSELN. UNWINT. J. MITCHISON: "Role of GTP hydrolysis in microtubule dynamics: information from a slowly hydrolyzable analogue, GMPCPP", MOL BIOL CELL, vol. 3, 1992, pages 1155 - 1167
A. DHARM. R. YOUNGN. H. COLBURN: "The role of AP-1, NF-kappaB and ROS/NOS in skin carcinogenesis: the JB6 model is predictive", MOLECULAR AND CELLULAR BIOCHEMISTRY, vol. 234-235, 2002, pages 185 - 193, XP019288541
A. DONKÓZ. PÉTERFIA. SUMT. LETOM. GEISZT: "Dual oxidases", PHILOS TRANS R SOC LOND B BIOL SCI, vol. 360, 2005, pages 2301 - 2308
A. FALNIKARS. TOLEP. W. BAAS: "Kinesin-5, a mitotic microtubule-associated motor protein, modulates neuronal migration", MOL BIOL CELL, vol. 22, 2011, pages 1561 - 1574
A. GOULETC. MOORES: "New insights into the mechanism of force generation by kinesin-5 molecular motors", INT REV CELL MOL BIOL, vol. 304, 2013, pages 419 - 466
A. HERVERA ET AL.: "Reactive oxygen species regulate axonal regeneration through the release of exosomal NADPH oxidase 2 complexes into injured axons", NAT CELL BIOL, vol. 20, 2018, pages 307 - 319, XP036439067, DOI: 10.1038/s41556-018-0039-x
A. J. BEIJERSJ. L. JONGENG. VREUGDENHIL: "Chemotherapy-induced neurotoxicity: the value of neuroprotective strategies", NETH J MED, vol. 70, 2012, pages 18 - 25
A. J. ENGLERS. SENH. L. SWEENEYD. E. DISCHER: "Matrix elasticity directs stem cell lineage specification", CELL, vol. 126, 2006, pages 677 - 689
A. LEARY ET AL.: "Successive Kinesin-5 Microtubule Crosslinking and Sliding Promote Fast, Irreversible Formation of a Stereotyped Bipolar Spindle", CURR BIOL, vol. 29, 2019, pages 3825 - 3837
A. M. CIRRINCIONE ET AL.: "Paclitaxel-induced peripheral neuropathy is caused by epidermal ROS and mitochondrial damage through conserved MMP-13 activation", SCI REP, vol. 10, 2020, pages 3970
A. MIALHE ET AL.: "Tubulin detyrosination is a frequent occurrence in breast cancers of poor prognosis", CANCER RESEARCH, vol. 61, 2001, pages 5024 - 5027, XP002542411
A. STRAUBEA. MERDES: "EB3 regulates microtubule dynamics at the cell cortex and is required for myoblast elongation and fusion", CURR BIOL, vol. 17, 2007, pages 1318 - 1325, XP022184978, DOI: 10.1016/j.cub.2007.06.058
ARGYRIOU ET AL., J BU ON, vol. 15, 2010, pages 435 - 446
B. J. BENEDIKTER ET AL.: "Redox-dependent thiol modifications: implications for the release of extracellular vesicles", CELL MOL LIFE SCI, vol. 75, 2018, pages 2321 - 2337, XP036518057, DOI: 10.1007/s00018-018-2806-z
B. J. MANNP. WADSWORTH: "Kinesin-5 Regulation and Function in Mitosis", TRENDS CELL BIOL, vol. 29, 2019, pages 66 - 79
B. L. PROSSERC. W. WARDW. J. LEDERER: "X-ROS signaling: rapid mechano-chemo transduction in heart", SCIENCE, vol. 333, 2011, pages 1440 - 1445
BILAN ET AL., ANTIOXIDREDOX SIGNAL, vol. 29, 2018, pages 569 - 584
BOBYLEV ILJA ET AL: "Kinesin-5 Blocker Monastrol Protects Against Bortezomib-Induced Peripheral Neurotoxicity", NEUROTOXICITY RESEARCH, HARWOOD ACADEMIC PUBLISHERS, LAUSANNE, CH, vol. 32, no. 4, 13 June 2017 (2017-06-13), pages 555 - 562, XP036322004, ISSN: 1029-8428, [retrieved on 20170613], DOI: 10.1007/S12640-017-9760-7 *
C. W. WARDB. L. PROSSERW. J. LEDERER: "Mechanical stretch-induced activation of ROS/RNS signaling in striated muscle", ANTIOXID REDOX SIGNAL, vol. 20, 2014, pages 929 - 936
C. Y. CHEN ET AL.: "Suppression of detyrosinated microtubules improves cardiomyocyte function in human heart failure", NATURE MEDICINE, vol. 24, 2018, pages 1225 - 1233, XP036928719, DOI: 10.1038/s41591-018-0046-2
CIRRINCIONE, A.REIMONN, C.HARRISON, B.RIEGER, S.: "Longitudinal RNA sequencing of skin and DRG neurons in mice with paclitaxel-induced peripheral neuropathy", DATA, vol. 7, 2022, pages 72
D. OWEN ET AL.: "The IQGAP1-Rac1 and IQGAP1-Cdc42 interactions: interfaces differ between the complexes", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 283, 2008, pages 1692 - 1704
D. PAREYSONG. PISCOSQUITO1. MORONIE. SALSANOM. ZEVIANI: "Peripheral neuropathy in mitochondrial disorders", LANCET NEUROL, vol. 12, 2013, pages 1011 - 1024
D. S. BILAN ET AL.: "HyPer-3: a genetically encoded H(2)O(2) probe with improved performance for ratiometric and fluorescence lifetime imaging", ACS CHEM BIOL, vol. 8, 2013, pages 535 - 542
D. S. BILANV. V. BELOUSOV: "In Vivo Imaging of Hydrogen Peroxide with HyPer Probes", ANTIOXID REDOX SIGNAL, vol. 29, 2018, pages 569 - 584
D. SZKLARCZYK ET AL.: "The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets", NUCLEIC ACIDS RES, vol. 49, 2021, pages D605 - D612
DIAZ ANTONIO CADIZ ET AL: "Epidermal Eg5 promotes X-ROS dependent paclitaxel neurotoxicity", BIORXIV, 24 May 2023 (2023-05-24), XP093192103, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2023.05.22.541784v2> DOI: 10.1101/2023.05.22.541784 *
DONKÓ ET AL., LOND B BIOL SCI, vol. 360, 2005, pages 2301 - 2308
E. GORNSTEINT. L. SCHWARZ: "The paradox of paclitaxel neurotoxicity: Mechanisms and unanswered questions", NEUROPHARMACOLOGY, vol. 76, 2014, pages 175 - 183
ENGELSTAD, J. K. ET AL.: "Epidermal nerve fibers: confidence intervals and continuous measures with nerve conduction", NEUROLOGY, vol. 79, 2012, pages 2187 - 2193
FLATTERS ET AL., BIOL TRANSL SCI., vol. 131, 2015, pages 119 - 146
FLATTERS ET AL., BR JANAESTH, vol. 119, 2017, pages 737 - 749
G. J. BENNETTG. K. LIUW. H. XIAOH. W. JINC. SIAU: "Terminal arbor degeneration--a novel lesion produced by the antineoplastic agent paclitaxel", EUR J NEUROSCI, vol. 33, 2011, pages 1667 - 1676, XP071867776, DOI: 10.1111/j.1460-9568.2011.07652.x
G. J. SHIN ET AL.: "Integrins protect sensory neurons in models of paclitaxel-induced peripheral sensory neuropathy", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 118, 2021
G. T. EISENHOFFER ET AL.: "Crowding induces live cell extrusion to maintain homeostatic cell numbers in epithelia", NATURE, vol. 484, 2012, pages 546 - 549, XP037198908, DOI: 10.1038/nature10999
GARCIA-SAEZ ISABEL ET AL: "Eg5 targeting agents: From new anti-mitotic based inhibitor discovery to cancer therapy and resistance", BIOCHEMICAL PHARMACOLOGY, ELSEVIER, US, vol. 184, 11 December 2020 (2020-12-11), XP086487203, ISSN: 0006-2952, [retrieved on 20201211], DOI: 10.1016/J.BCP.2020.114364 *
H. KADAVATH ET AL.: "Tau stabilizes microtubules by binding at the interface between tubulin heterodimers", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 112, 2015, pages 7501 - 7506
I. ARNALR. H. WADE: "How does taxol stabilize microtubules?", CURR BIOL, vol. 5, 1995, pages 900 - 908
I. BOBYLEV ET AL.: "Paclitaxel inhibits mRNA transport in axons", NEUROBIOL DIS, vol. 82, 2015, pages 321 - 331
J. A. BOYETTE-DAVISE. T. WALTERSP. M. DOUGHERTY: "Mechanisms involved in the development of chemotherapy-induced neuropathy", PAIN MANAG, vol. 5, 2015, pages 285 - 296
J. C. WATERSR. H. CHENA. W. MURRAYE. D. SALMON: "Localization of Mad2 to kinetochores depends on microtubule attachment, not tension", THE JOURNAL OF CELL BIOLOGY, vol. 141, 1998, pages 1181 - 1191, XP055009795, DOI: 10.1083/jcb.141.5.1181
J. CASSEREAUP. CODRONB. FUNALOT: "Inherited peripheral neuropathies due to mitochondrial disorders", REVUE NEUROLOGIQUE, vol. 170, 2014, pages 366 - 374
J. DALOUS ET AL.: "Reversal of cell polarity and actin-myosin cytoskeleton reorganization under mechanical and chemical stimulation", BIOPHYS J, vol. 94, 2008, pages 1063 - 1074, XP029293727, DOI: 10.1529/biophysj.107.114702
J. L. MEADERSS. N. DE MATOSD. R. BURGESS: "A Pushing Mechanism for Microtubule Aster Positioning in a Large Cell Type", CELL REP, vol. 33, 2020, pages 108213
J. L. ROSSC. D. SANTANGELOV. MAKRIDESD. K. FYGENSON: "Tau induces cooperative Taxol binding to microtubules", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 101, 2004, pages 12910 - 12915
J. M. COOK-MILLS: "Hydrogen peroxide activation of endothelial cell-associated MMPs during VCAM-1-dependent leukocyte migration", CELL MOL BIOL (NOISY-LE-GRAND, vol. 52, 2006, pages 8 - 16
J. M. MURETTA ET AL.: "A posttranslational modification of the mitotic kinesin Eg5 that enhances its mechanochemical coupling and alters its mitotic function", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 115, 2018, pages E1779 - E1788
J. P. KERR ET AL.: "Detyrosinated microtubules modulate mechanotransduction in heart and skeletal muscle", NATURE COMMUNICATIONS, vol. 6, 2015, pages 8526
K. BEDARD, K. H. KRAUSE: "The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology.", PHYSIOLOGICAL REVIEWS, vol. 87, 2007, pages 245 - 313
K. GROTE ET AL.: "Mechanical stretch enhances mRNA expression and proenzyme release of matrix metalloproteinase-2 (MMP-2) via NAD(P)H oxidase-derived reactive oxygen species", CIRCULATION RESEARCH, vol. 92, 2003, pages e80 - 86, XP002315165, DOI: 10.1161/01.RES.0000077044.60138.7C
L. BRANDOLINI ET AL.: "CXCR1/2 pathways in paclitaxel-induced neuropathic pain", ONCOTARGET, vol. 8, 2017, pages 23188 - 23201
L. JIAB. LIH. YU: "The Bub1-Plk1 kinase complex promotes spindle checkpoint signalling through Cdc20 phosphorylation", NATURE COMMUNICATIONS, vol. 7, 2016, pages 10818
L. M. ZASADIL ET AL.: "Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles", SCI TRANSL MED, vol. 6, 2014, pages 229ra243
L. PERIS ET AL.: "Tubulin tyrosination regulates synaptic function and is disrupted in Alzheimer's disease", BRAIN : A JOURNAL OF NEUROLOGY, 2022
LISSE ET AL., PROC NATL ACAD SCI USA, vol. 113, no. 15, 2016, pages E2189 - 98
LISSE ET AL., PROC. NATL. ACAD. SCI. U. S., vol. 113, 2016, pages E2189 - 2198
LISSE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 113, 2016, pages E2189 - 2198
LISSE, T. S. ET AL.: "Paclitaxel-induced epithelial damage and ectopic MMP-13 expression promotes neurotoxicity in zebrafish", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 1 13, 2016, pages E2189 - 2198
M. A. JOHNSONB. R. HENDERSON: "The scaffolding protein IQGAP1 co-localizes with actin at the cytoplasmic face of the nuclear envelope: implications for cytoskeletal regulation", BIOARCHITECTURE, vol. 2, 2012, pages 138 - 142
M. A. JORDAN ET AL.: "Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death", CANCER RESEARCH, vol. 56, 1996, pages 816 - 825, XP055703937
M. A. JORDANR. J. TOSOD. THROWERL. WILSON: "Mechanism of mitotic block and inhibition of cell proliferation by taxol at low concentrations", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 90, 1993, pages 9552 - 9556, XP000986130, DOI: 10.1073/pnas.90.20.9552
M. DISTELJ. C. HOCKINGK. VOLKMANNR. W. KOSTER: "The centrosome neither persistently leads migration nor determines the site of axonogenesis in migrating neurons in vivo", THE JOURNAL OF CELL BIOLOGY, vol. 191, 2010, pages 875 - 890
M. E. HALLAKJ. A. RODRIGUEZH. S. BARRAR. CAPUTTO: "Release of tyrosine from tyrosinated tubulin. Some common factors that affect this process and the assembly of tubulin", FEBS LETTERS, vol. 73, 1977, pages 147 - 150, XP025600316, DOI: 10.1016/0014-5793(77)80968-X
M. SERETNY ET AL.: "Incidence, prevalence, and predictors of chemotherapy-induced peripheral neuropathy: A systematic review and meta-analysis", PAIN, vol. 155, 2014, pages 2461 - 2470
M. THERYA. JIMENEZ-DALMARONIV. RACINEM. BORNENSF. JULICHER: "Experimental and theoretical study of mitotic spindle orientation", NATURE, vol. 447, 2007, pages 493 - 496
M. USHIO-FUKAIA. M. ZAFARIT. FUKUIN. ISHIZAKAK. K. GRIENDLING: "p22phox is a critical component of the superoxide-generating NADH/NADPH oxidase system and regulates angiotensin II-induced hypertrophy in vascular smooth muscle cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, 1996, pages 23317 - 23321, XP055017854, DOI: 10.1074/jbc.271.38.23317
MASANAS ET AL., CLIN TRANSL MED., vol. 11, no. 10, 2021, pages e533
MATSUNO KENJI ET AL: "Therapeutic potential of mitotic kinesin inhibitors in cancer", EXPERT OPINION ON THERAPEUTIC PATENTS, TAYLOR & FRANCIS, GB, vol. 18, no. 3, 1 March 2008 (2008-03-01), pages 253 - 274, XP002592150, ISSN: 1354-3776, DOI: 10.1517/13543776.18.3.253 *
MEIJERING, E.DZYUBACHYK, O.SMAL, 1.: "Methods for cell and particle tracking", METHODS ENZYMOL, vol. 504, 2012, pages 183 - 200, XP093038878, DOI: 10.1016/B978-0-12-391857-4.00009-4
N. D'AMBROSIS. ROSSIV. GERBINOM. COZZOLINO: "Rac1 at the crossroad of actin dynamics and neuroinflammation in Amyotrophic Lateral Sclerosis", FRONT CELL NEUROSCI, vol. 8, 2014, pages 279
N. HIROKAWAY. NODAY. TANAKAS. NIWA: "Kinesin superfamily motor proteins and intracellular transport", NAT REV MOL CELL BIOL, vol. 10, 2009, pages 682 - 696
N. P. STAFF ET AL.: "Pathogenesis of paclitaxel-induced peripheral neuropathy: A current review of in vitro and in vivo findings using rodent and human model systems", EXPERIMENTAL NEUROLOGY, vol. 324, 2020, pages 113121
N. WEI ET AL.: "Inhibitions and Down-Regulation of Motor Protein Eg5 Expression in Primary Sensory Neurons Reveal a Novel Therapeutic Target for Pathological Pain", NEUROTHERAPEUTICS, vol. 19, 2022, pages 1401 - 1413
NAKAI RYUICHIRO ET AL: "K858, a Novel Inhibitor of Mitotic Kinesin Eg5 and Antitumor Agent, Induces Cell Death in Cancer Cells", CANCER RESEARCH, vol. 69, no. 9, 30 April 2009 (2009-04-30), San Diego, CA . Philadelphia (PA, pages 3901 - 3909, XP093192156, ISSN: 0008-5472, Retrieved from the Internet <URL:https://aacrjournals.org/cancerres/article/69/9/3901/553112/K858-a-Novel-Inhibitor-of-Mitotic-Kinesin-Eg5-and> DOI: 10.1158/0008-5472.CAN-08-4373 *
NIEUWENHUIS, J.BRUMMELKAMP, T. R.: "The Tubulin Detyrosination Cycle: Function and Enzymes", TRENDS CELL BIOL, vol. 29, 2019, pages 80 - 92
O'BRIEN, G. S. ET AL.: "Coordinate development of skin cells and cutaneous sensory axons in zebrafish", JOURNAL OF COMPARATIVE NEUROLOGY, vol. 520, 2012, pages 816 - 831
P. ROBISON ET AL.: "Detyrosinated microtubules buckle and bear load in contracting cardiomyocytes", SCIENCE, vol. 352, 2016, pages aaf0659
PAREYSON ET AL., LANCET NEUROL., vol. 12, 2013, pages 1011 - 1024
POSTMA, T. J. ET AL.: "The development of an EORTC quality of life questionnaire to assess chemotherapy-induced peripheral neuropathy: the QLQ-CIPN20", EUR J CANCER, vol. 41, 2005, pages 1135 - 1139, XP025298305, DOI: 10.1016/j.ejca.2005.02.012
R. A. CLARKT. K. EPPERSONA. J. VALENTE: "Mechanisms of activation of NADPH oxidases", JPN J INFECT DIS, vol. 57, 2004, pages 22 - 23
R. J. KHAIRALLAH ET AL.: "Microtubules underlie dysfunction in duchenne muscular dystrophy", SCI SIGNAL, vol. 5, 2012, pages ra56
R. P. BRANDESN. WEISSMANNK. SCHRODER: "Nox family NADPH oxidases in mechanotransduction: mechanisms and consequences", ANTIOXID REDOX SIGNAL, vol. 20, 2014, pages 887 - 898
RIEGER ET AL., PLOS BIOL., vol. 9, 2011, pages e1000621
ROLL-MECAK ET AL.: "The Tubulin Code in Microtubule Dynamics and Information Encoding", DEVELOPMENTAL CELL, vol. 54, 2020, pages 7 - 20, XP086208115, DOI: 10.1016/j.devcel.2020.06.008
S. A. HAQUET. P. HASAKAA. D. BROOKSP. V. LOBANOVP. W. BAAS: "Monastrol, a prototype anti-cancer drug that inhibits a mitotic kinesin, induces rapid bursts of axonal outgrowth from cultured postmitotic neurons", CELL MOTIL CYTOSKELETON, vol. 58, 2004, pages 10 - 16
S. E. LEONARDK. S. CARROLL: "Chemical 'omics' approaches for understanding protein cysteine oxidation in biology", CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 15, 2011, pages 88 - 102, XP028364299, DOI: 10.1016/j.cbpa.2010.11.012
S. E. PEASE-RAISSI ET AL.: "Paclitaxel Reduces Axonal Bclw to Initiate IP3R1-Dependent Axon Degeneration", NEURON, vol. 96, 2017, pages 373 - 386
S. J. FLATTERS: "The contribution of mitochondria to sensory processing and pain", PROG MOL BIOL TRANSL SCI, vol. 131, 2015, pages 119 - 146
S. J. L. FLATTERSP. M. DOUGHERTYL. A. COLVIN: "Clinical and preclinical perspectives on Chemotherapy-Induced Peripheral Neuropathy (CIPN): a narrative review", BR J ANAESTH, vol. 119, 2017, pages 737 - 749
S. KHAWAJAG. G. GUNDERSENJ. C. BULINSKI: "Enhanced stability of microtubules enriched in detyrosinated tubulin is not a direct function of detyrosination level", THE JOURNAL OF CELL BIOLOGY, vol. 106, 1988, pages 141 - 149
S. X. GEE. W. SONR. YAO: "iDEP: an integrated web application for differential expression and pathway analysis of RNA-Seq data", BMC BIOINFORMATICS, vol. 19, 2018, pages 534
S. ZHAOY. TANGR. WANGM. NAJAFI: "Mechanisms of cancer cell death induction by paclitaxel: an updated review", APOPTOSIS : AN INTERNATIONAL JOURNAL ON PROGRAMMED CELL DEATH, vol. 27, 2022, pages 647 - 667
SHIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 118, 2021, pages e2006050118
SZKLARCZYK ET AL., NUCL. ACIDS RES, vol. 49, 2021, pages D605 - D612
T. AKERAY. GOTOM. SATOM. YAMAMOTOY. WATANABE: "Mad1 promotes chromosome congression by anchoring a kinesin motor to the kinetochore", NAT CELL BIOL, vol. 17, 2015, pages 1124 - 1133
T. KLEELE ET AL.: "An assay to image neuronal microtubule dynamics in mice", NATURE COMMUNICATIONS, vol. 5, 2014, pages 4827
X. REN ET AL.: "Paclitaxel suppresses proliferation and induces apoptosis through regulation of ROS and the AKT/MAPK signaling pathway in canine mammary gland tumor cells", MOL MED REP, vol. 17, 2018, pages 8289 - 8299
Y. LI ET AL.: "The Cancer Chemotherapeutic Paclitaxel Increases Human and Rodent Sensory Neuron Responses to TRPV1 by Activation of TLR4", J NEUROSCI, vol. 35, 2015, pages 13487 - 13500
Y. SON ET AL.: "Mitogen-Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways?", J SIGNAL TRANSDUCT, vol. 2011, 2011, pages 792639
ZASADIL ET AL., SCI TRANSLMED, vol. 6, 2019, pages 229ra243
ZHAO ET AL., APOPTOSIS, vol. 27, 2022, pages 647 - 667

Similar Documents

Publication Publication Date Title
Cho et al. Nasal placode development, GnRH neuronal migration and Kallmann syndrome
Xu et al. Enriched environment enhances β‐adrenergic signaling to prevent microglia inflammation by amyloid‐β
Zhang et al. Lamotrigine attenuates deficits in synaptic plasticity and accumulation of amyloid plaques in APP/PS1 transgenic mice
Di Maio et al. In vivo imaging of dorsal root regeneration: rapid immobilization and presynaptic differentiation at the CNS/PNS border
Alpár et al. Hypothalamic CNTF volume transmission shapes cortical noradrenergic excitability upon acute stress
Zhang et al. Association of mitochondrial letm1 with epileptic seizures
Yang et al. VEGF ameliorates cognitive impairment in in vivo and in vitro ischemia via improving neuronal viability and function
US20150119327A1 (en) Drug screening platform for rett syndrome
Lee et al. Involvement of BDNF/ERK signaling in spontaneous recovery from trimethyltin-induced hippocampal neurotoxicity in mice
Wu et al. Recombinant adiponectin peptide promotes neuronal survival after intracerebral haemorrhage by suppressing mitochondrial and ATF4‐CHOP apoptosis pathways in diabetic mice via Smad3 signalling inhibition
EP3355924A1 (en) Methods of treating and preventing amyotrophic lateral sclerosis
Chen et al. CRISPR/Cas9-mediated CysLT1R deletion reverses synaptic failure, amyloidosis and cognitive impairment in APP/PS1 mice
Dong et al. miR-214-3p promotes the pathogenesis of Parkinson's disease by inhibiting autophagy
Gómez-Palacio-Schjetnan et al. In vivo BDNF modulation of adult functional and morphological synaptic plasticity at hippocampal mossy fibers
Carver et al. Blockade of TRPC channels limits cholinergic-driven hyperexcitability and seizure susceptibility after traumatic brain injury
Strecker et al. Aging of different avian cultured cells: lack of ROS-induced damage and quality control mechanisms
Wang et al. Effects of JIP3 on epileptic seizures: evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures
Wang et al. The alleviative effect of Calendula officinali s L. extract against Parkinson’s disease-like pathology in zebrafish via the involvement of autophagy activation
Ji et al. Modulation of comorbid depression of neuropathic pain by dopamine input from VTA to the ventral hippocampus
Choi et al. Dopaminergic manipulations and its effects on neurogenesis and motor function in a transgenic mouse model of Huntington's disease
Gao et al. The Administration of Circulating Extracellular Vesicles Modified by Anesthesia and Surgery Induces Delirium‐Like Behaviors in Aged Mice
Lee et al. Blimp-1 is an essential component of the genetic program controlling development of the pectoral limb bud
WO2024239018A1 (en) Methods and pharmaceutical compositions for treating chemotherapy-induced peripheral neuropathy with eg5 inhibitors
Zhu et al. A novel anti-epileptogenesis strategy of temporal lobe epilepsy based on nitric oxide donor
Singh et al. Pathogenic variants in autophagy-tethering factor EPG5 drive neurodegeneration through mitochondrial dysfunction and innate immune activation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24734493

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE