WO2024201056A1 - Antibodies - Google Patents

Antibodies Download PDF

Info

Publication number
WO2024201056A1
WO2024201056A1 PCT/GB2024/050859 GB2024050859W WO2024201056A1 WO 2024201056 A1 WO2024201056 A1 WO 2024201056A1 GB 2024050859 W GB2024050859 W GB 2024050859W WO 2024201056 A1 WO2024201056 A1 WO 2024201056A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
chain variable
variable domain
heavy chain
antibodies
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2024/050859
Other languages
French (fr)
Inventor
Gavin Screaton
Juthathip Mongkolsapaya
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oxford University Innovation Ltd
Original Assignee
Oxford University Innovation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Ltd filed Critical Oxford University Innovation Ltd
Publication of WO2024201056A1 publication Critical patent/WO2024201056A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/102Coronaviridae (F)
    • C07K16/104Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2299/00Coordinates from 3D structures of peptides, e.g. proteins or enzymes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the invention relates to antibodies useful for the prevention, treatment and/or diagnosis of coronavirus infections, and diseases and/or complications associated with ⁇ coronavirus infections, including COVID-19.
  • Background of the invention Since emerging in late 2019 severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) is estimated to have led to 757 million infections and 6.9 million deaths. Effective vaccines and increasing herd immunity from natural infection have greatly ⁇ reduced the mortality from SARS-CoV-2 infection but are less effective at preventing infection. SARS-CoV-2 therefore still causes significant mortality in high-risk groups such as the immunosuppressed or elderly who show reduced or absent responses to vaccination.
  • NTD N-terminal domain
  • RBD receptor binding domain
  • RBD mutations can impart selective advantages to the virus, firstly some can increase the affinity to ACE2 ⁇ and are believed to drive increased transmissibility, the N501Y mutation found in the Alpha variant is an example of this. Secondly, mutations in the RBD and NTD may also ⁇ ⁇ lead to escape from neutralizing antibody responses. As herd immunity from vaccination and natural infection increases there is intense selective pressure to allow the virus to break through pre-existing immunity.
  • the inventors have identified 24 potent spike binding mAbs (IC50 ⁇ 50 ng/ml) from vaccinees who suffered vaccine break-through infections with Omicron sublineages ⁇ BA.4/5.
  • One mAb, BA.4/5-2 binds at the back of the left shoulder of the RBD in an area which is so far not in a mutational hot spot.
  • the invention provides an antibody capable of binding to the spike protein of coronavirus SARS-CoV-2, wherein the antibody comprises the six CDRs of antibody BA.4/5-2 described herein, or of any one of the antibodies in Tables 1 and 3 to 9 ⁇ as described herein.
  • the invention provides an antibody capable of binding to the spike protein of coronavirus SARS-CoV-2, wherein the antibody comprises CDRH1, CDRH2 and CDRH3, from a first antibody in Table 1 and CDRL1, CDRL2 and CDRL3 ⁇ ⁇ from a second antibody in Table 1, with the proviso that the first antibody and the second antibody are different.
  • the invention provides one or more polynucleotides encoding the antibody, one or more vectors comprising said polynucleotides, or a host cell ⁇ comprising said vectors.
  • the invention provides a method for producing an antibody that is capable of binding to the spike protein of coronavirus SARS-CoV-2, the method comprising culturing the host cell and isolating the antibody from said culture.
  • the invention provides a pharmaceutical composition ⁇ comprising: (a) the antibody, and (b) at least one pharmaceutically acceptable diluent or carrier.
  • the invention provides the antibody or the pharmaceutical composition for use in a method for treatment of a human or animal by therapy, or for use in a method of treating or preventing coronavirus infection, or a disease or complication ⁇ associated with coronavirus infection.
  • the invention provides a method of treating or preventing coronavirus infection, or a disease or complication associated with coronavirus infection in a subject, comprising administering a therapeutically effective amount of the antibody or the pharmaceutical composition to said subject.
  • the invention provides a method of identifying the presence of coronavirus, or a protein fragment thereof, in a sample, comprising: (i) contacting the sample with the antibody; and (ii) detecting the presence or absence of an antibody-antigen complex, wherein the presence of the antibody-antigen complex indicates the presence of coronavirus, or a fragment thereof, in the sample.
  • the invention provides a method of treating or preventing coronavirus infection, or a disease or complication associated therewith, in a subject, the method comprising identifying the presence of coronavirus according to the method above, and treating the subject with the antibody, an anti-viral drug or an anti-inflammatory agent.
  • the invention provides the use of the antibody or the ⁇ pharmaceutical composition for preventing, treating and/or diagnosing coronavirus infection, or a disease or complication associated therewith.
  • the invention provides the use of the antibody or the pharmaceutical composition for the manufacture of a medicament for treating or preventing coronavirus infection, or a disease or complication associated therewith.
  • BA.4/5 mAb Generation of BA.4/5 mAb.
  • A Live virus neutralization FRNT50 titres against Victoria, an ancestral SARS-CoV-2 isolate, BA.2, BA.4 and BA.5 viruses using serum from vaccine breakthrough BA.4/5.
  • B Sorting strategy for BA.4/5 specific B cells.
  • C Heavy chain and light chain gene usage of potent BA.4/5 mAbs.
  • D Number of somatic mutations found in BA.4/5 mAbs compared to sets previously isolated from early pandemic, Beta, BA.1 and BA.2 infection.
  • E Blocking of ACE2-S interaction by potent BA.4/5 mAbs.
  • Heatmaps of antibody IC50 neutralisation titres and live virus ⁇ neutralising activity of BA.4/5-2 and BA.4/5-5 (A) Heatmap of IC50s of potent BA.4/5 mAbs against pseudoviruses expressing variant S sequences. (B) Neutralisation curves and IC50s of BA.4/5-2 against 19 live virus variants. (C) Heatmap of IC50s of therapeutic monoclonal antibodies against pseudoviruses.
  • RBD is drawn as grey surface representation with BA.4 mutation sites shown in magenta and further mutation sites found in Omicron sublineages in cyan. Only VhVl domains of the Fabs are shown as ribbons for clarity with HC in red LC in blue.
  • C-G Binding position of the CDRs and detailed interactions for BA.4/5-1/RBD, H-L ⁇ for BA.4/5-2/RBD.
  • Protein main chains are drawn as ribbons and coils, and side chains as sticks with Fab HC in red and LC in blue, RBD in grey. Hydrogen bonds are shown as yellow broken sticks.
  • a-c Crystal structures of Delta-RBB/BA.4/5-1/EY6A, Delta-RBD/BA.4/5-2/Beta-49, and Delta- ⁇ RBD/Omi-42/Beta-49, respectively.
  • d Cryo-EM structure of Delta-RBD/BA.2-07/SAR1- 34/C1 complex.
  • e Binding of BA.4/5-5 stabilizes the nearby loops 620-640 from SD2 and 835-848 immediately after the fusion peptide from an adjacent chain. The start and end of each loop are marked by spheres.
  • f-h The binding mode of Omi-42 is compared with that of BA.4/5-2 by overlapping the RBD.
  • Protein main chains are drawn as ribbons and coils, ⁇ and side chains as sticks with Fab HC in red and LC in blue, SD1 in grey. Hydrogen bonds are shown as yellow broken sticks.
  • Omi-42 HC and LC are in brown and pale blue, respectively.
  • b RBD with the known mutation sites of Omicron variants in magenta.
  • Antibodies of the invention specifically binds to the spike protein of SAR-CoV-2. In particular, it specifically binds to the S1 subunit of the spike protein, such as the receptor binding domain (RBD) or the N-terminal domain (NTD).
  • An antibody of the invention may comprise all six CDRs of an antibody in Table 1.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having at least 80% sequence identity, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, to the heavy chain variable domain of an antibody in Table 1.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having at ⁇ least 80% sequence identity, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, to the light chain variable domain of an antibody in Table 1.
  • the antibody may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having at least 80% sequence identity, such as at least 90%, at least 95%, at least 96%, at least 97%, ⁇ at least 98%, at least 99% or 100% sequence identity, to the heavy chain variable domain and light chain domain, respectively, of an antibody in Table 1.
  • the antibody may comprise mutations in the framework regions of the variable domains compared to the antibody in Table 1.
  • the antibody may comprise a heavy chain variable domain comprising the CDRH1, CDRH2 and CDRH3 of an antibody in Table 1, and a ⁇ light chain variable domain comprising the CDRL1, CDRL2 and CDRL3 of the antibody in Table 1, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having at least 80% sequence identity, ⁇ ⁇ such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, to the heavy chain variable domain and light chain variable domain, respectively of the antibody in Table 1.
  • the antibody may be any one of the antibodies in Table 1.
  • ⁇ Table 1 lists 24 individual antibodies that were identified from recovered BA.4/5 SARS-CoV-2 infected patients.
  • Table 1 also lists the SEQ ID NOs for the heavy chain variable domain and light chain variable domain nucleotide and amino acid sequences, and the complementarity determining regions (CDRs) of the variable domains, of each of the antibodies.
  • the CDRH3 is the CDRH3 provided in the penultimate column of ⁇ Table 1
  • the CDRL3 is the CDRL3 provided in the penultimate column of Table 1.
  • the CDRH3 is the CDRH3 AA Junction provided in the ultimate column of Table 1 and/or the CDRL3 is the CDRL3 AA Junction provided in the ultimate column of Table 1.
  • the “AA Junction” CDR3 sequences are the CDR3 sequences defined by the IMGT numbering scheme plus an additional amino acid on the N-terminal and C-terminal ⁇ sides of the CDR taken from the framework region.
  • the antibody in Table 1 may be selected from the group consisting of BA.4/5-2 and BA.4/5-1.
  • the antibody in Table 1 may be selected from the group consisting of BA.4/5-2, BA.4/5-1, BA.4/5-8, BA.4/5-9, BA.4/5-22, BA.4/5-28, BA.4/5-31 and BA.4/5-34. These antibodies were surprisingly found to retain strong neutralisation of pseudoviral constructs of the SARS-CoV-2 variant strains Victoria, ⁇ Alpha, Beta, Gamma, Delta, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BQ.1, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1.
  • the antibody in Table 1 may be BA.4/5-2.
  • BA.4/5-2 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BS.1, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ⁇ 0.02 ⁇ g/ml.
  • an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 15, 16 and 17, respectively, and a ⁇ CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 21, 22 and 23, respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 14).
  • an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 20).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising ⁇ or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-2 (i.e. SEQ ID NOs: 14 and 20, respectively).
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid ⁇ sequences specified in SEQ ID NOs: 15, 16 and 17, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 21, 22 and 23, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and ⁇ light chain variable domain, respectively, of antibody BA.4/5-2 (i.e. SEQ ID NOs: 14 and 22, respectively).
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 14 and 22, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • a constant region such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • the heavy chain domain of BA.4/5-2 is derived from a IGHV3-30 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below).
  • an antibody of the invention may comprise the heavy chain of BA.4/5-2, and not the light chain of BA.4/5-2.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 15, 16 and 17, respectively.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence ⁇ identity to the heavy chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 14).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 14.
  • the antibody may comprise the light chain of BA.4/5-2, and not the heavy chain of BA.4/5-2.
  • the antibody ⁇ may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 21, 22 and 23, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 20).
  • the antibody may comprise a light ⁇ chain variable domain comprising or consisting of SEQ ID NO: 20.
  • the antibody in Table 1 may be BA.4/5-1.
  • BA.4/5-1 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BS.1, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, ⁇ XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ⁇ 0.15 ⁇ g/ml, and the SARS- CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.7
  • an antibody of the ⁇ invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 3, 4 and 5, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 9, 10 and 11, respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID NO: 2).
  • an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID ⁇ ⁇ NO: 8).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, ⁇ of antibody BA.4/5-1 (i.e.
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 3, 4 and 5, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 9, 10 and 11, respectively, wherein the heavy chain ⁇ variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-1 (i.e.
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy ⁇ chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 2 and 8, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • the heavy chain domain of BA.4/5-1 is derived from a IGHV4-39 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light ⁇ chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below).
  • an antibody of the invention may comprise the heavy chain of BA.4/5-1, and not the light chain of BA.4/5-1.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 3, 4 and 5, respectively.
  • the antibody ⁇ may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID NO: 2).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 2.
  • the antibody may comprise the light chain of BA.4/5-1, and not the heavy chain of BA.4/5-1.
  • the antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 9, 10 and 11, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ ⁇ ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID NO: 8).
  • the antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 8.
  • the antibody in Table 1 may be BA.4/5-8.
  • BA.4/5-8 was found ⁇ to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BS.1, BA.2.3.20, BQ.1, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF and XBB.1.5 with an IC50 of ⁇ 0.1 ⁇ g/ml and inter alia the SARS-CoV-2 variant strains BQ.1.1, CH.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ⁇ 0.05 ⁇ g/ml.
  • an antibody ⁇ of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 51, 52 and 53, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 57, 58 and 59, respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-8 (i.e. SEQ ID NO: 50).
  • an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-8 ⁇ (i.e. SEQ ID NO: 56).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-8 (i.e.
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 51, 52 and 53, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 57, 58 and 59, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of ⁇ an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-8 (i.e.
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in ⁇ ⁇ SEQ ID NOs: 50 and 56, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • a constant region such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • an antibody of the invention may comprise the heavy chain of BA.4/5-8, and not the light chain of BA.4/5-8.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences ⁇ specified in SEQ ID NOs: 51, 52 and 53, respectively.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-8 (i.e. SEQ ID NO: 50).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 50.
  • the antibody may comprise the light chain of BA.4/5-2, and not the heavy chain of BA.4/5-8.
  • the antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 57, 58 and 59, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-8 (i.e. SEQ ID NO: 56).
  • the antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 56.
  • the antibody in Table 1 may be BA.4/5-9.
  • BA.4/5-9 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, ⁇ BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, XBF, and DS.1 with an IC50 of ⁇ 0.05 ⁇ g/ml.
  • an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 63, 64 and 65, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences ⁇ specified in SEQ ID NOs: 69, 70 and 71, respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 62).
  • an antibody of the invention may comprise a light chain ⁇ ⁇ variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 68).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain variable ⁇ domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-9 (i.e. SEQ ID NOs: 62 and 68, respectively).
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the ⁇ amino acid sequences specified in SEQ ID NOs: 63, 64 and 65, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 69. 70 and 71, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable ⁇ domain and light chain variable domain, respectively, of antibody BA.4/5-9 (i.e.
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 62 and 68, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM ⁇ constant region.
  • the heavy chain domain of BA.4/5-9 is derived from a IGHV1-46 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below).
  • an antibody of the ⁇ invention may comprise the heavy chain of BA.4/5-9, and not the light chain of BA.4/5-9.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 63, 64 and 65, respectively.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence ⁇ identity to the heavy chain variable domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 62).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 62.
  • the antibody may comprise the light chain of BA.4/5-9, and not the heavy chain of BA.4/5-9.
  • the antibody ⁇ ⁇ may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 69, 70 and 71, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable ⁇ domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 68).
  • the antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 68.
  • the antibody in Table 1 may be BA.4/5-22.
  • BA.4/5-22 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BN.1, ⁇ BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ⁇ 0.025 ⁇ g/ml and inter alia the SARS-CoV-2 variant strains XBF, CH.1.1, BQ.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ⁇ 0.02 ⁇ g/ml.
  • an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 183, 184 and 185, ⁇ respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 189, 190 and 191, respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5- ⁇ 22 (i.e. SEQ ID NO: 182).
  • an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-22 (i.e. SEQ ID NO: 188).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain ⁇ variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-22 (i.e.
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 ⁇ having the amino acid sequences specified in SEQ ID NOs: 183, 184 and 185, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 189, 190 and 191, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence ⁇ ⁇ identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-2 (i.e.
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: ⁇ 182 and 188, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • the heavy chain domain of BA.4/5-22 is derived from a IGHV1-69 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is ⁇ particularly useful with the invention (explained further below).
  • an antibody of the invention may comprise the heavy chain of BA.4/5-22, and not the light chain of BA.4/5- 22.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 183, 184 and 185, respectively.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an ⁇ amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-22 (i.e. SEQ ID NO: 182).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 182.
  • the antibody may comprise the ⁇ light chain of BA.4/5-22, and not the heavy chain of BA.4/5-22.
  • the antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 189, 190 and 191, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light ⁇ chain variable domain of antibody BA.4/5-22 (i.e. SEQ ID NO: 188).
  • the antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 188.
  • the antibody in Table 1 may be BA.4/5-28.
  • BA.4/5-28 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, ⁇ BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ⁇ 0.1 ⁇ g/ml.
  • an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 231, 232 and 233, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 237, 238 and 239, ⁇ ⁇ respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 230).
  • an ⁇ antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 236).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of ⁇ an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-28 (i.e. SEQ ID NOs: 230 and 236, respectively).
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in ⁇ SEQ ID NOs: 231, 232 and 233, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 237, 238 and 239, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain ⁇ variable domain, respectively, of antibody BA.4/5-28 (i.e.
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 230 and 236, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • a constant region such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • an antibody of the invention may comprise ⁇ the heavy chain of BA.4/5-28, and not the light chain of BA.4/5-28.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 231, 232 and 233, respectively.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy ⁇ ⁇ chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 230).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 230.
  • the antibody may comprise the light chain of BA.4/5-28, and not the heavy chain of BA.4/5-28.
  • the ⁇ antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 237, 238 and 239, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 236).
  • the antibody may ⁇ comprise a light chain variable domain comprising or consisting of SEQ ID NO: 236.
  • the antibody in Table 1 may be BA.4/5-31.
  • BA.4/5-31 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, ⁇ CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ⁇ 0.2 ⁇ g/ml and the SARS-CoV-2 variant strains XBF, CH.1.1, BQ.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ⁇ 0.03 ⁇ g/ml.
  • an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 243, 244 and 245, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid ⁇ sequences specified in SEQ ID NOs: 249, 250 and 251, respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5- 31 (i.e. SEQ ID NO: 242).
  • an antibody of the invention may comprise ⁇ a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-31 (i.e. SEQ ID NO: 248).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-31 (i.e. SEQ ID NOs: 242 and 248, respectively).
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 243, 244 and 245, ⁇ ⁇ respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 249, 250 and 251, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence ⁇ identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-31 (i.e.
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 242 and 248, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, ⁇ IgG2, IgG3 or IgG4) or IgM constant region.
  • the heavy chain domain of BA.4/5-31 is derived from a IGHV4-39 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below).
  • an antibody of the ⁇ invention may comprise the heavy chain of BA.4/5-31, and not the light chain of BA.4/5- 31.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 243, 244 and 245, respectively.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% ⁇ sequence identity to the heavy chain variable domain of antibody BA.4/5-31 (i.e. SEQ ID NO: 242).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 242.
  • the antibody may comprise the light chain of BA.4/5-31, and not the heavy chain of BA.4/5-31.
  • the ⁇ antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 249, 250 and 251, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-31 (i.e. SEQ ID NO: 248).
  • the antibody may ⁇ comprise a light chain variable domain comprising or consisting of SEQ ID NO: 248.
  • the antibody in Table 1 may be BA.4/5-34.
  • BA.4/5-34 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 ⁇ ⁇ with an IC50 of ⁇ 0.1 ⁇ g/ml and the SARS-CoV-2 variant strains XBF, CH.1.1, BQ.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ⁇ 0.05 ⁇ g/ml.
  • an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 279, 280 and 281, respectively, and a CDRL1, ⁇ CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 285, 286 and 287, respectively.
  • an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 278).
  • an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 284).
  • an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of ⁇ an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-34 (i.e. SEQ ID NOs: 278 and 284, respectively).
  • an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in ⁇ SEQ ID NOs: 279, 280 and 281, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 285, 286 and 287, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain and light chain ⁇ variable domain, respectively, of antibody BA.4/5-34 (i.e.
  • the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 278 and 284, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • a constant region such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • the heavy chain domain of BA.4/5-34 is derived from a IGHV1-69 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below).
  • an antibody of the invention may comprise the heavy chain of BA.4/5-34, and not the light chain of BA.4/5- ⁇ ⁇ 34.
  • the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 279, 280 and 281, respectively.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% ⁇ sequence identity to the heavy chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 278).
  • the antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 278.
  • the antibody may comprise the light chain of BA.4/5-34, and not the heavy chain of BA.4/5-34.
  • the ⁇ antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 285, 286 and 287, respectively.
  • the antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 284).
  • the antibody may ⁇ comprise a light chain variable domain comprising or consisting of SEQ ID NO: 284.
  • Mixed chain antibodies of the invention An antibody of the invention may comprise a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a first antibody in Table 1 and a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a second antibody ⁇ in Table 1, with the proviso that the first and second antibodies are different.
  • Such antibodies are referred to as mixed chain antibodies herein.
  • Examples of the mixed chain antibodies useful with the invention are provided in Tables 3 to 9. Table 3 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV 4-39.
  • Table 4 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV3-30.
  • Table 5 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV3-53.
  • Table 6 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline ⁇ heavy chain IGHV3-66.
  • Table 7 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV3-53 and IGHV3-66.
  • Table 8 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV1-69.
  • an antibody of the invention comprises a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, with the proviso that the first and second antibodies are different.
  • the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid ⁇ sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the heavy chain variable domain of an antibody in Table 1, and a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of an antibody in Table 1, with the proviso that the first and second antibodies are ⁇ different.
  • an antibody of the invention comprises a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, and comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or ⁇ 100% sequence identity to the heavy chain variable domain of the first antibody in Table 1, and a light chain variable domain comprising or consisting of an amino acid sequence having ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity to the light chain variable domain of the second antibody in Table 1, with the proviso that the first and second antibodies are different.
  • the antibody in Table 1 may be selected from the group consisting of: BA.4/5-2, BA.4/5-1, BA.4/5-8, BA.4/5-22, BA.4/5-28, BA.4/5-31 and BA.4/5-34.
  • the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-1 and BA.4/5-31.
  • the heavy chain variable domain of these antibodies are derived from ⁇ IGHV 4-39.
  • the resulting mixed chain antibodies are ⁇ ⁇ set out in Table 3.
  • the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100%) sequence identity to the ⁇ corresponding variable domain of any one of the mixed chain antibodies as set out in Table 3.
  • the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-2 and BA.4/5-12.
  • the heavy chain variable domain of these antibodies are derived from ⁇ IGHV 3-30.
  • the resulting mixed chain antibodies are ⁇ set out in Table 4.
  • the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100%) sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table ⁇ 4.
  • the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-6, BA.4/5-7, BA.4/5-17 and BA.4/5-23.
  • the heavy chain variable domain of these antibodies are derived from ⁇ IGHV3-53.
  • the antibody of the invention may ⁇ comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 5.
  • the first antibody and the second antibody are both selected ⁇ from the group consisting of: BA.4/5-8, BA.4/5-10, BA.4/5-28 and BA.4/5-32.
  • the heavy chain variable domain of these antibodies are derived from ⁇ IGHV3-66.
  • the resulting mixed chain antibodies are set out in Table 6.
  • the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid ⁇ sequence having at least 80% sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 6.
  • Antibodies derived from IGHV3-53 may be used to produce mixed-chain antibodies with antibodies from IGHV3-66 (see, e.g. Dejnirattisai, Wanwisa, et al. "The antigenic anatomy of SARS-CoV-2 receptor binding domain.” Cell 184(8) (2021): 2183- ⁇ ⁇ 2200; Supasa, Piyada, et al.
  • the first antibody is selected from the group consisting of BA.4/5-6, BA.4/5-7, BA.4/5-17 and BA.4/5-23, and the second antibody is selected from the group consisting of BA.4/5-8, BA.4/5-10, BA.4/5- ⁇ 28 and BA.4/5-32.
  • the first antibody is selected from the group consisting of BA.4/5-8, BA.4/5-10, BA.4/5-28 and BA.4/5-32
  • the second antibody is selected from the group consisting of BA.4/5-6, BA.4/5-7, BA.4/5-17 and BA.4/5-23.
  • the heavy chain variable domain of these antibodies are derived from ⁇ IGHV3- 53 and IGVH3-66. Examples of the resulting mixed chain antibodies are set out in Table ⁇ 7.
  • the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 7.
  • the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-13, BA.4/5-18, BA.4/5-22, BA.4/5-25 and BA.4/5- 34.
  • the heavy chain variable domain of these antibodies are derived from ⁇ IGHV1-69.
  • the resulting mixed chain antibodies are set out in Table 8.
  • the antibody of the ⁇ invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100%)sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 8.
  • the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-15, BA.4/5-20, BA.4/5-21 and BA.4/5-24.
  • the heavy chain variable domain of these antibodies are derived from ⁇ IGHV3-9.
  • the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain ⁇ ⁇ and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100%) sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 9.
  • the constant region domains of an antibody molecule of the invention if present, may be selected having regard to the proposed function of the antibody molecule, and in particular the effector functions which may be required.
  • the constant region domains may be human IgA, IgD, IgE, IgG or IgM domains.
  • the constant regions are of human origin.
  • human IgG i.e. IgG1, IgG2, IgG3 or IgG4
  • ⁇ constant region domains may be used.
  • the constant region is a human IgG1 constant region.
  • the modification may comprise 1, 2, 3, 4, 5, up to 10, up to 20, up to 30 or more amino acid substitutions and/or deletions from the amino acid sequence of an antibody in Tables 1 and 3 to 9.
  • the modification may comprise an amino acid substituted with an alternative amino acid having similar properties.
  • Some properties ⁇ of the 20 main amino acids are as follows: Ala aliphatic, hydrophobic, neutral Met hydrophobic, neutral Cys polar, hydrophobic, neutral Asn polar, hydrophilic, neutral Asp polar, hydrophilic, charged (-) Pro hydrophobic, neutral Glu polar, hydrophilic, charged (-) Gln polar, hydrophilic, neutral Phe aromatic, hydrophobic, neutral Arg polar, hydrophilic, charged (+) Gly aliphatic, neutral Ser polar, hydrophilic, neutral His aromatic, polar, hydrophilic, Thr polar, hydrophilic, neutral charged (+) Ile aliphatic, hydrophobic, neutral Val aliphatic, hydrophobic, neutral Lys polar, hydrophilic, charged (+) Trp aromatic, hydrophobic, neutral Leu aliphatic, hydrophobic, neutral Tyr aromatic, polar, hydrophobic
  • the modification may comprise a derivatised amino acid, e.g.
  • ⁇ ⁇ Modification of antibodies of the invention as described above may be prepared during synthesis of the antibody or by post-production modification, or when the antibody is in recombinant form using the known techniques of site-directed mutagenesis, random mutagenesis, or enzymatic cleavage and/or ligation of nucleic acids.
  • ⁇ Antibodies of the invention may be modified (e.g. as described above) to improve the potency of said antibodies or to adapt said antibodies to new SARS-CoV-2 variants. The modifications may be amino acid substitutions to adapt the antibody to substitutions in a virus variant.
  • the known mode of binding of an antibody to the spike protein may be used to identify the ⁇ amino acids of the antibody that interact with the substitution in the virus variant. This information can then be used to identify possible substitutions of the antibody that will compensate for the change in the epitope characteristics. For example, a substitution of a hydrophobic amino acid in the spike protein to a negatively changes amino acid may be compensated by substituting the amino acid from the antibody that interacts with said ⁇ amino acid in the spike protein to a positively charged amino acid.
  • Methods for identifying residues of an antibody that may be substituted are encompassed by the present disclosure, for example, by determining the structure of antibody-antigen complexes as described herein.
  • the antibodies of the invention may contain one or more modifications to increase ⁇ their cross-lineage neutralisation property.
  • E484 of the spike protein which is a key residue that mediates the interaction with ACE2
  • SARS-CoV-2 strains see e.g. Figure 6, demonstrating that the Victoria, Delta and Gamma strains comprise E484 and that all remaining strains shown comprise an E484K, E484A or E484R mutation
  • antibodies that bind to E484 can be modified to compensate for the changes in E484 of the spike protein.
  • E484 is mutated from a negatively charged amino acid in the Victoria strain to a positively charged amino acid in the BA.2.3.20 SARs-CoV-2 strain.
  • the amino acid residues of antibodies that bind to or near E484 may be mutated to compensate for the change in charge.
  • ⁇ Antibodies of the invention may be isolated antibodies.
  • a composition consisting of an isolated antibody is substantially free of other antibodies having different antigenic specificities.
  • the term 'antibody' as used herein may relate to whole antibodies (i.e. comprising the elements of two heavy chains and two light chains inter-connected by disulphide ⁇ ⁇ bonds) as well as antigen-binding fragments thereof.
  • Antibodies typically comprise immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen.
  • immunoglobulin immunoglobulin
  • HCVR heavy chain variable region
  • VL light chain variable region
  • variable regions of the heavy and light chains contain a binding ⁇ domain that interacts with an antigen.
  • the VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • Antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, dAb (domain antibody), single chain, Fab, Fab’ and F(ab’)2 fragments, scFvs, and Fab ⁇ expression libraries
  • An antibody of the invention may be a monoclonal antibody.
  • Monoclonal antibodies (mAbs) of the invention may be produced by a variety of techniques, including conventional monoclonal antibody methodology, for example those disclosed in “Monoclonal Antibodies: a manual of techniques” (Zola H, 1987, CRC Press) and in ⁇ “Monoclonal Hybridoma Antibodies: techniques and applications” (Hurrell JGR, 1982 CRC Press).
  • An antibody of the invention may be multispecific, such as bispecific.
  • a bispecific antibody of the invention binds two different epitopes.
  • the epitopes may be in the same protein (e.g. two epitopes in spike protein of SARS-CoV-2) or different proteins (e.g.
  • a bispecific antibody of the invention may bind to two separate epitopes on the spike protein of SARS-CoV-2.
  • the bispecific antibody may bind to the NTD of the spike protein and to the RBD of the spike protein.
  • the bispecific antibody ⁇ may bind to two different epitopes in the RBD of the spike protein.
  • One or more (e.g. two) antibodies of the invention can be coupled to form a multispecific (e.g. bispecific) antibody. Methods to prepare multispecific, e.g. bispecific, antibodies are well known in the art.
  • An antibody may be selected from the group consisting of single chain antibodies, single chain variable fragments (scFvs), variable fragments (Fvs), fragment antigen- binding regions (Fabs), recombinant antibodies, monoclonal antibodies, fusion proteins comprising the antigen-binding domain of a native antibody or an aptamer, single-domain ⁇ antibodies (sdAbs), also known as VHH antibodies, nanobodies (Camelid-derived single- domain antibodies), shark IgNAR-derived single-domain antibody fragments called VNAR, diabodies, triabodies, Anticalins, aptamers (DNA or RNA) and active components or fragments thereof.
  • the constant region domains of an antibody molecule of the invention, if present, ⁇ may be selected having regard to the proposed function of the antibody molecule, and in particular the effector functions which may be required.
  • the constant region domains may be human IgA, IgD, IgE, IgG or IgM domains.
  • the constant regions are of human origin.
  • human IgG i.e. IgG1, IgG2, IgG3 or IgG4 constant region domains may be used.
  • the constant region is a human IgG1 ⁇ constant region.
  • the light chain constant region may be either lambda or kappa.
  • Antibodies of the invention may be mono-specific or multi-specific (e.g. bi- specific).
  • a multi-specific antibody comprises at least two different variable domains, wherein each variable domain is capable of binding to a separate antigen or to a different ⁇ epitope on the same antigen.
  • An antibody of the invention may be a chimeric antibody, a CDR-grafted antibody, a nanobody, a human or humanised antibody. Typically, the antibody is a human antibody. Fully human antibodies are those antibodies in which the variable regions and the constant regions (where present) of both the heavy and the light chains are all of human origin, or ⁇ substantially identical to sequences of human origin, but not necessarily from the same antibody.
  • the antibody of the invention may be a full-length antibody.
  • the antibody may comprise a heavy chain variable domain of an antibody in Table 1 or 3 to 9, a light chain variable domain of an antibody in Table 1 or 3 to 9, and a constant region, ⁇ such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region.
  • the antibody of the invention may be an antigen-binding fragment.
  • An antigen- binding fragment of the invention binds to the same epitope of the parent antibody, i.e. the antibody from which the antigen-binding fragment is derived.
  • An antigen-binding fragment of the invention typically retains the parts of the parent antibody that interact with ⁇ ⁇ the epitope.
  • the antigen-binding fragment typically comprise the complementarity- determining regions (CDRs) that interact with the antigen, such as one, two, three, four, five or six CDRs.
  • the antigen-binding fragment further comprises the structural scaffold surrounding the CDRs of the parent antibody, such as the variable ⁇ region domains of the heavy and/or light chains.
  • the antigen-binding fragment retains the same or similar binding affinity to the antigen as the parent antibody.
  • An antigen-binding fragment does not necessarily have an identical sequence to the parent antibody.
  • the antigen-binding fragment may have ⁇ 70%, ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity with the ⁇ respective CDRs of the parent antibody. In one embodiment, the antigen-binding fragment may have ⁇ 70%, ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 96%, ⁇ 97%, ⁇ 98%, ⁇ 99% or 100% sequence identity with the respective variable region domains of the parent antibody. Typically, the non-identical amino acids of a variable region are not in the CDRs.
  • the antigen-binding fragments of antibodies of the invention retain the ability to ⁇ selectively bind to an antigen.
  • Antigen-binding fragments of antibodies include single chain antibodies (i.e. a full-length heavy chain and light chain); Fab, modified Fab, Fab', modified Fab', F(ab')2, Fv, Fab-Fv, Fab-dsFv, single domain antibodies (e.g. VH or VL or VHH), scFv.
  • An antigen-binding function of an antibody can be performed by fragments of a ⁇ full-length antibody. The methods for creating and manufacturing these antibody fragments are well known in the art (see for example Verma R et al., 1998, J. Immunol. Methods, 216, 165-181).
  • an antibody of the invention may be able to neutralise at least one biological activity of SAR-CoV-2 (a neutralising antibody), particularly to ⁇ neutralise virus infectivity. Neutralisation may also be determined using IC 50 or IC 90 values.
  • the antibody may have an IC 50 value of ⁇ 0.1 ⁇ g/ml, ⁇ 0.05 ⁇ g/ml, ⁇ 0.01 ⁇ g/ml ⁇ 0.005 ⁇ g/ml or ⁇ 0.002 ⁇ g/ml.
  • an antibody of the invention may have an IC50 value of ⁇ ⁇ between 0.0001 ⁇ g/ml and 0.1 ⁇ g/ml, sometimes between 0.0001 ⁇ g/ml and 0.05 ⁇ g/ml or even between 0.0001 ⁇ g/ml and 0.001 ⁇ g/ml.
  • the IC 50 values of some of the antibodies of Table 1 are provided in Figure 2A and Figure 2B.
  • the ability of an antibody to neutralise virus infectivity may be measured using an appropriate assay, particularly using a cell-based neutralisation assay, as is known in the art.
  • the neutralisation ability may be measured in a focus reduction neutralisation assay (FRNT) where the reduction in the number of cells (e.g. human cells) infected with the virus (e.g. for 2 hours at 37 oC) in the presence of the antibody is ⁇ compared to a negative control in which no antibodies were added.
  • An antibody of the invention may block the interaction between the spike protein of SAR-CoV-2 with the cell surface receptor, angiotensin-converting enzyme 2 (ACE2), of the target cell, e.g. by direct blocking or by disrupting the pre-fusion conformation of the spike protein.
  • ACE2 angiotensin-converting enzyme 2
  • Blocking of the interaction between spike and ACE2 can be total or partial.
  • an antibody of the invention may reduce spike-ACE2 formation by ⁇ 50%, ⁇ 60%, ⁇ 70%, ⁇ 80%, ⁇ 90%, ⁇ 95%, ⁇ 99% or 100%.
  • Blocking of spike-ACE2 formation can be measured by any suitable means known in the art, for example, by ELISA. Most antibodies showing neutralisation also showed blocking of the interaction ⁇ between the spike protein and ACE2. Furthermore, a number of non-neutralising antibodies are good ACE2 blockers.
  • an antibody of the invention may have an affinity constant (KD) value for the spike protein of SARS-CoV-2 of ⁇ 5nM, ⁇ 4nM, ⁇ 3nM, ⁇ 2nM, ⁇ 1nM, ⁇ 0.5nM, ⁇ 0.4nM, ⁇ 0.3nM, ⁇ 0.2nM or ⁇ 0.1nM.
  • KD affinity constant
  • the KD value can be measured by any suitable means known in the art, for example, by ELISA or Surface Plasmon Resonance (Biacore) at 25 °C.
  • Binding affinity (K D ) may be quantified by determining the dissociation constant (K d ) and association constant (K a ) for an antibody and its target.
  • the antibody may have an association constant (K a ) of ⁇ 10000 M -1 s -1 , ⁇ 50000 M -1 s -1 , ⁇ 100000 M -1 s -1 , ⁇ 200000 M -1 s -1 or ⁇ 500000 M -1 s -1 , and/or a dissociation constant (K d ) of ⁇ 0.001 s -1 , ⁇ 0.0005 s -1 , ⁇ 0.004 s -1 , ⁇ 0.003 s -1 , ⁇ 0.002 s -1 or ⁇ 0.0001 s -1 .
  • An antibody of the invention is preferably able to provide in vivo protection in coronavirus (e.g.
  • SARS-CoV-2) infected animals For example, administration of an antibody of the invention to coronavirus (e.g. SARS-CoV-2) infected animals may result in ⁇ ⁇ a survival rate of ⁇ 30%, ⁇ 40%, ⁇ 50%, ⁇ 60%, ⁇ 70%, ⁇ 80%, ⁇ 90%, ⁇ 95% or 100%. Survival rates may be determined using routine methods.
  • Antibodies of the invention may have any combination of one or more of the above properties.
  • ⁇ Antibodies of the invention may bind to the same epitope as, or compete for binding to SARS-CoV-2 spike protein with, any one of the antibodies described herein (i.e. in particular with antibodies with the heavy and light chain variable regions described above).
  • An antibody of the invention may or may not comprise an Fc domain.
  • the antibodies of the invention may be modified in the Fc region in order to improve their stability. Such modifications are known in the art. Modifications may improve the stability of the antibody during storage of the antibody.
  • the in vivo half-life ⁇ of the antibody may be improved by modifications of the Fc-region. For example, cysteine residue(s) can be introduced into the Fc region, thereby allowing interchain disulphide bond formation in this region.
  • the homodimeric antibody thus generated can have improved internalization capability and/or increased complement- mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC).
  • ADCC antibody-dependent cellular cytotoxicity
  • an antibody can be engineered that has dual Fc regions and can thereby have enhanced complement lysis and ADCC capabilities.
  • an antibody of the invention may be modified to promote the ⁇ interaction of the Fc domain with FcRn.
  • the Fc domain may be modified to improve the stability of the antibody by affecting Fc and FcRn interaction at low pH, such as in the endosome.
  • the M252Y/S254T/T256E (YTE) mutation may be used to improve the half- life of an IgG1 antibody.
  • the antibody may be modified to affect the interaction of the antibody with other ⁇ receptors, such as Fc ⁇ RI, Fc ⁇ RIIA, Fc ⁇ RIIB, Fc ⁇ RIII, and Fc ⁇ R. Such modifications may be used to affect the effector functions of the antibody.
  • an antibody of the invention comprises an altered Fc domain as described herein below.
  • an antibody of the invention ⁇ ⁇ comprises an Fc domain, but the sequence of the Fc domain has been altered to modify one or more Fc effector functions.
  • an antibody of the invention comprises a “silenced” Fc region.
  • an antibody of the invention does not display the effector ⁇ function or functions associated with a normal Fc region.
  • An Fc region of an antibody of the invention does not bind to one or more Fc receptors.
  • an antibody of the invention does not comprise a CH 2 domain.
  • an antibody of the invention does not comprise a CH 3 domain.
  • an antibody of the invention comprises additional CH 2 and/or CH 3 domains.
  • an antibody of the invention does not bind Fc receptors.
  • an antibody of the invention does not bind complement.
  • an antibody of the invention does not bind Fc ⁇ R, but does bind complement.
  • an antibody of the invention in general may comprise modifications that alter serum half-life of the antibody.
  • an ⁇ antibody of the invention has Fc region modification(s) that alter the half-life of the antibody. Such modifications may be present as well as those that alter Fc functions.
  • an antibody of the invention has modification(s) that alter the serum half-life of the antibody.
  • an antibody of the invention may comprise a human constant ⁇ region, for instance IgA, IgD, IgE, IgG or IgM domains.
  • human IgG constant region domains may be used, especially of the IgG1 and IgG3 isotypes when the antibody molecule is intended for therapeutic uses where antibody effector functions are required.
  • the antibody heavy chain comprises a CH 1 domain and the antibody light chain comprises a CL domain, either kappa or lambda.
  • the antibody heavy chain comprises a CH 1 domain, a CH 2 domain and a CH 3 domain and the antibody light chain comprises a CL domain, either kappa or lambda.
  • the four human IgG isotypes bind the activating Fc ⁇ receptors (Fc ⁇ RI, Fc ⁇ RIIa, ⁇ FcKRIIc, Fc ⁇ RIIIa), the inhibitory Fc ⁇ RIIb receptor, and the first component of complement (C1q) with different affinities, yielding very different effector functions (Bruhns P. et al., 2009. Specificity and affinity of human Fc ⁇ receptors and their polymorphic variants for human IgG subclasses. Blood. 113(16):3716-25), see also Jeffrey B. Stavenhagen, et al. Cancer Research 2007 Sep 15; 67(18):8882-90.
  • an antibody of the invention does not bind to Fc receptors. In another embodiment of the invention, the antibody does bind to one or more type of Fc receptors.
  • the Fc region employed is mutated, in particular a mutation described herein.
  • the Fc mutation is selected from the group ⁇ comprising a mutation to remove or enhance binding of the Fc region to an Fc receptor, a mutation to increase or remove an effector function, a mutation to increase or decrease half-life of the antibody and a combination of the same. In one embodiment, where reference is made to the impact of a modification it may be demonstrated by comparison to the equivalent antibody but lacking the modification.
  • ⁇ alanine substitution at position 333 was reported to increase both ADCC and CDC.
  • a modification at position 333 may be present, and in particular one that alters ability to recruit complement.
  • Lazar et al. described a triple mutant (S239D/I332E/A330L) with a higher affinity for Fc ⁇ RIIIa and a lower affinity for Fc ⁇ RIIb resulting in enhanced ADCC (Lazar GA. et al., 2006).
  • modifications at ⁇ S239/I332/A330 may be present, particularly those that alter affinity for Fc receptors and in particular S239D/I332E/A330L .
  • S239D/I332E/G236A modified triple mutant with improved Fc ⁇ RIIIa affinity and Fc ⁇ RIIa/Fc ⁇ RIIb ratio that mediates enhanced phagocytosis of target cells by macrophages
  • S239D/I332E/G236A modifications may be therefore present.
  • an antibody of the invention may have a modified hinge region and/or CH1 region.
  • the isotype employed may be chosen as it has a particular hinge regions.
  • Public V-regions also described as public V-genes herein, are the V regions of the germline heavy chain and light chain regions that are found in a large proportion of the antibody responses to SARS-CoV-2 found within the population.
  • the V regions are specific responses to the original BA.4/5 SARS-CoV-2 variant. That is to say, ⁇ many individuals utilise the same v-regions from their germline v-region repertoire when generating an immune response to SARS-CoV-2 variants.
  • an antibody “derived” from a specific v-region refers to antibodies that were generated by V(D)J recombination using that germline v-region sequence.
  • the germline IGHV1-69 v-region sequence may undergo somatic recombination ⁇ and somatic mutation to arrive at an antibody that specifically binds to the spike protein of SARS-CoV-2.
  • the nucleotide sequence encoding the antibody does not comprise a sequence identical to the IGHV1-69 germline sequence, nevertheless, the antibody is still derived from this v-region.
  • An antibody of the invention typically comprises no more than 20 non-silent mutations in the v-region, when compared to the germline sequence, such as ⁇ no more than 17 non-silent mutations.
  • An antibody of the invention typically comprises between 5-20 non-silent mutations in the v-region, when compared to the germline sequence, such as between 6-18, 7-17 and 8-15 non-silent mutations.
  • An antibody of the invention typically comprises between 5-15 amino acid changes in the v-region, when compared to the amino acid sequence encoded by the germline sequence, such as between ⁇ 6-14 and 7-12 amino acid changes.
  • Germline v-region sequences are well known in the art, and methods of identifying whether a certain region of an antibody is derived from a particular germline v-region sequence are also well known in the art.
  • an antibody of the invention derives from a v-region selected from IGHV4-39, IGHV3-30, IGHV3-53, IGHV3-66, IGHV1-46, IGHV3-33, IGHV3-9, IGHV1-69 or IGHV3-23.
  • an antibody of the invention is encoded by a v- region selected from IGHV4-39, IGHV3-30, IGHV3-53, IGHV3-66, IGHV1-46, IGHV3- 33, IGHV3-9, IGHV1-69 or IGHV3-23 and having 5-20 non-silent nucleotide mutations, such as 6-18, 7-17 and 8-15 non-silent mutations, when compared to the naturally occurring germline sequence.
  • an antibody of the invention is encoded ⁇ by a v-region selected from IGHV1-69 and having 10-20 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence.
  • an antibody of the invention is encoded by a v-region selected from IGHV3-66 and having 2- 15 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region ⁇ selected from IGHV3-53 and having 8-18 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region selected from IGHV3-9 and having 7-13 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence.
  • an antibody of the invention is encoded by a v-region selected from IGHV3- ⁇ 30 and having 10-16 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region selected from IGHV4-39 and having 5-6 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence.
  • a silent mutation is defined herein is a change in the nucleotide sequence without a ⁇ change in the amino acid sequence for which the nucleotide sequence encodes. A non- silent mutation is therefore a mutation that leads to a change in the amino acid sequence encoded by the nucleotide sequence.
  • the inventors have surprisingly found that the light chain variable region of two antibodies having the same heavy chain v-region may be exchanged to produce a mixed- ⁇ chain antibody comprising the heavy chain variable region of a first antibody and the light chain variable region of a second antibody.
  • the two antibodies may both comprise a heavy chain variable region derived from IGHV3-53.
  • both antibodies also comprise a light chain variable region derived from the same light chain v- region, although this is not essential because, for example, the light chain of some ⁇ ⁇ antibodies having a heavy chain variable region derived from IGHV3-53 may be matched with any heavy chain variable region derived from IGHV3-53 and lead to a potent neutralising antibody.
  • an antibody of the invention comprises the CDRs of an heavy chain variable domain of an antibody derived from a major public v-region selected from IGHV1-69, IGHV3-9, IGHV3-53/3-66, IGHV3-30 and IGHV4-39, such as antibodies BA.4/5-1 and BA.4/5-31 for IGHV4-39, antibodies BA.4/5-2 and BA.4/5-12 for IGHV3- 30, antibodies BA.4/5-6, BA.4/5-7, BA.4/5-17, BA.4/5-23, BA.4/5-8, BA.4/5-10, BA.4/5- ⁇ 28 and BA.4/5-32 for IGHV3-53/3-66, antibodies BA.4/5-13, BA.4/5-18, BA.4/5-22, BA.4/5-25 and BA.4/5-34 for IGHV1-69, or antibodies BA.4/5-15, BA.4/5-20
  • an antibody of the invention comprises the heavy chain ⁇ variable domain of an antibody derived from a major public v-region selected from IGHV1-69, IGHV3-9, IGHV3-53/3-66, IGHV3-30 and IGHV4-39, such as antibodies BA.4/5-1 and BA.4/5-31 for IGHV4-39, antibodies BA.4/5-2 and BA.4/5-12 for IGHV3- 30, antibodies BA.4/5-6, BA.4/5-7, BA.4/5-17, BA.4/5-23, BA.4/5-8, BA.4/5-10, BA.4/5- 28 and BA.4/5-32 for IGHV3-53/3-66, antibodies BA.4/5-13, BA.4/5-18, BA.4/5-22, ⁇ BA.4/5-25 and BA.4/5-34 for IGHV1-69, or antibodies BA.4/5-15, BA.4/5-20, BA.4/5-21 and BA.4/5-24 for IGHV1-69, or antibodies BA.4/5-15, BA.4/5-20, BA.4/5-21 and BA
  • the invention provides a method of generating an antibody that binds specifically to the spike protein of SARS-CoV-2 (e.g. a SARS-CoV-2 strain of the ⁇ Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.10.4, BA.2.12.1, BA.2.30.2, BA.2.75, BA.2.75.2, BA.4/5, BA.4.6, BQ.1, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, XBB, XBB.1 and/or XBB.1.5), the method comprising identifying two or more antibodies derived from the same light chain and/or heavy chain v-regions, replacing the light chain of a first antibody with the light chain of a second antibody, to thereby generate a mixed- ⁇ chain antibody comprising the heavy chain of the first antibody and the light chain of the second antibody.
  • SARS-CoV-2 e.g. a SARS-CoV-2 strain of the ⁇ Victoria, Alpha, Beta, Gamm
  • the method further comprises determining the affinity for and/or neutralisation of SARS-CoV-2 of the mixed-chain antibody.
  • the method may further comprise comparing the affinity of the mixed-chain antibody with that ⁇ ⁇ of the first and/or second antibodies.
  • the method may further comprise selecting a mixed chain antibody that has the same or greater affinity than the first and/or second antibodies.
  • the invention provides an antibody that specifically binds to the BA.4/5 variant of SARS-CoV-2, wherein the antibody has a v-region derived from ⁇ IGHV1-69, IGHV3-9, IGHV3-53 or IGHV3-66.
  • the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 ⁇ from BA.4/5-13, BA.4/5-18, BA.4/5-22, BA.4/5-25 or BA.4/5-34.
  • the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 from BA.4/5-15, BA.4/5-20, BA.4/5-21 or BA.4/5-24. In one embodiment, wherein the antibody heavy chain is derived from IGHV3-53, the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 ⁇ from BA.4/5-6, BA.4/5-7, BA.4/5-17 or BA.4/5-23.
  • the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 from BA.4/5-8, BA.4/5-10, BA.4/5-28 or BA.4/5-32.
  • Antibody conjugates The invention also pertains to immunoconjugates comprising an antibody ⁇ conjugated to a cytotoxic agent such as a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate).
  • a cytotoxic agent such as a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate).
  • Conjugates of the antibody and cytotoxic agent may be made using a variety of bifunctional protein-coupling agents known in the art.
  • An antibody, of the invention may be conjugated to a molecule that modulates or ⁇ alters serum half-life.
  • An antibody, of the invention may bind to albumin, for example in order to modulate the serum half-life.
  • an antibody of the invention will also include a binding region specific for albumin.
  • an antibody of the invention may include a peptide linker which is an albumin binding peptide. Examples of albumin binding peptides are included in WO2015/197772 and WO2007/106120 the ⁇ entirety of which are incorporated by reference.
  • albumin binding peptides are included in WO2015/197772 and WO2007/106120 the ⁇ entirety of which are incorporated by reference.
  • ⁇ ⁇ ⁇ Polynucleotides, vectors and host cells The invention also provides one or more isolated polynucleotides (e.g. DNA) encoding the antibody of the invention.
  • the polynucleotide sequence is collectively present on more than one polynucleotide, but collectively together they are ⁇ able to encode an antibody of the invention.
  • the polynucleotides may encode the heavy and/or light chain variable regions(s) of an antibody of the invention.
  • the polynucleotides may encode the full heavy and/or light chain of an antibody of the invention.
  • one polynucleotide would encode each of the heavy and light chains.
  • the invention provides a first polynucleotide encoding the heavy chain variable ⁇ domain of an antibody of the invention and a second polynucleotide encoding the light chain variable domain of said antibody.
  • the invention also provides a polynucleotide encoding the heavy chain variable domain and the light chain variable domain of an antibody according to the invention.
  • Polynucleotides which encode an antibody of the invention can be obtained by ⁇ methods well known to those skilled in the art. For example, DNA sequences coding for part or all of the antibody heavy and light chains may be synthesised as desired from the corresponding amino acid sequences. General methods by which the vectors may be constructed, transfection methods and culture methods are well known to those skilled in the art. In this respect, reference is ⁇ made to “Current Protocols in Molecular Biology”, 1999, F. M. Ausubel (ed), Wiley Interscience, New York and the Maniatis Manual produced by Cold Spring Harbor Publishing.
  • a polynucleotide of the invention may be provided in the form of an expression cassette, which includes control sequences operably linked to the inserted sequence, thus ⁇ allowing for expression of the antibody of the invention in vivo.
  • the invention also provides one or more expression cassettes encoding the one or more polynucleotides that encoding an antibody of the invention.
  • These expression cassettes are typically provided within vectors (e.g. plasmids or recombinant viral vectors).
  • the invention provides a vector encoding an antibody of the invention.
  • the invention provides vectors which collectively encode an antibody of the invention.
  • the vectors may be cloning vectors or expression vectors.
  • a suitable vector may be any vector which is capable of carrying a sufficient amount of genetic information, and allowing expression of a polypeptide of the invention.
  • the polynucleotides, expression cassettes or vectors of the invention are introduced into a host cell, e.g. by transfection.
  • the invention also provides a host cell comprising the one or more polynucleotides, expression cassettes or vectors of the invention.
  • the polynucleotides, expression cassettes or vectors of the invention may be ⁇ introduced transiently or permanently into the host cell, allowing expression of an antibody from the one or more polynucleotides, expression cassettes or vectors.
  • Such host cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, lower eukaryotic cells, such as yeast, or prokaryotic cells, such as bacteria cells.
  • eukaryotic cell lines such as mammalian cells or insect cells, lower eukaryotic cells, such as yeast, or prokaryotic cells, such as bacteria cells.
  • cells include mammalian HEK293, such as HEK293F, ⁇ HEK293T, HEK293S or HEK Expi293F, CHO, HeLa, NS0 and COS cells, or any other cell line used herein, such as the ones used in the Examples.
  • the cell line selected will be one which is not only stable, but also allows for mature glycosylation.
  • the invention also provides a process for the production of an antibody of the invention, comprising culturing a host cell containing one or more vectors of the invention ⁇ under conditions suitable for the expression of the antibody from the one or more polynucleotides of the invention, and isolating the antibody from said culture.
  • Combination of antibodies Certain Table 1 antibodies may be particularly effective when used in combination, e.g. to minimise loss of activity due to SARS-CoV-2 variants, maximise therapeutic effects ⁇ and/or increase diagnostic power. Useful combinations include antibodies that do not cross-compete with one another and/or bind to non-overlapping epitopes.
  • the invention provides a combination of the antibodies of the invention, wherein each antibody is capable of binding to the spike protein of coronavirus SARS- CoV-2, wherein at least one antibody comprises all six CDRs of an antibody in Table 1.
  • the invention also provides a combination of antibodies, comprising a first antibody which is an antibody according to the invention, in combination with at least one further antibody that does not compete with the first antibody for binding to the spike protein of coronavirus SARS-CoV-2.
  • the first and the at least one further antibodies may bind to different epitopes in the same domain, or may bind to epitopes in different domains ⁇ in the spike protein.
  • the first antibody may bind to the RBD domain and the at least one further antibody may bind to the NTD of the spike protein.
  • the first antibody may bind to the NTD domain and the at least one further antibody may bind to the RBD of the spike protein.
  • ⁇ ⁇ A combination of the antibodies of the invention may be useful as a therapeutic cocktail.
  • the invention also provides a pharmaceutical composition comprising a combination of the antibodies of the invention. This is because a new SARS-CoV-2 variant may circulate that is not neutralised by a first of the antibodies in the cocktail but is ⁇ neutralised by a second antibody in the cocktail, whilst the converse may be true for a further SARS-CoV-2 variant that circulates.
  • a cocktail of antibodies of the invention may provide a more robust treatment for SARS-CoV-2 than a single antibody of the invention alone.
  • a combination of the antibodies of the invention may be useful for diagnosis.
  • the invention also provides a diagnostic kit comprising a combination of the antibodies of the invention. Also provided herein are methods of diagnosing a disease or complication associated with coronavirus infections in a subject, as explained further below.
  • a fully cross-neutralising antibody e.g. BA.4/5-2, may be used as a reference to ⁇ confirm the presence and/or amount of any variants of concern (VoC) SARS-CoV-2 in the sample.
  • an antibody that binds to a limited number of VoCs may be used to confirm the presence and/or amount of that VoC in the sample.
  • the spike protein may be the spike protein of the BN.1 VoC.
  • This may be ⁇ determined by any method known to the skilled person, such as via an immunoassay, e.g. an ELISA or an immunochromatographic assay. Reduced binding may be determined by comparison and/or normalisation to the reference, and/or by comparison to positive/negative control samples or data.
  • Pharmaceutical composition ⁇ The invention provides a pharmaceutical composition comprising an antibody of the invention.
  • the composition may comprise a combination (such as two, three or four) of the antibodies of the invention.
  • the pharmaceutical composition may also comprise a pharmaceutically acceptable carrier.
  • the composition of the invention may include one or more pharmaceutically ⁇ acceptable salts.
  • a "pharmaceutically acceptable salt” refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include acid addition salts and base addition salts.
  • ⁇ Suitable pharmaceutically acceptable carriers comprise aqueous carriers or diluents. Examples of suitable aqueous carriers include water, buffered water and saline.
  • Suitable pharmaceutically acceptable carriers include ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures ⁇ thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, ⁇ microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • compositions of the invention may comprise additional therapeutic agents, for example an anti-viral agent.
  • the anti-viral agent may bind to coronavirus and inhibit viral activity. Alternatively, the anti-viral agent may not bind directly to coronavirus but still affect viral activity/infectivity.
  • the anti-viral agent could be a further ⁇ anti-coronavirus antibody, which binds somewhere on SARS-CoV-2 other than the spike protein. Examples of an anti-viral agent useful with the invention include Remdesivir, Lopinavir, ritonavir, APN01, and Favilavir.
  • the additional therapeutic agent may be an anti-inflammatory agent, such as a corticosteroid (e.g.
  • kits comprising antibodies or other ⁇ compositions of the invention and instructions for use.
  • the kit may further contain one or more additional reagents, such as an additional therapeutic or prophylactic agent as discussed herein.
  • additional reagents such as an additional therapeutic or prophylactic agent as discussed herein.
  • the method of treatment may be therapeutic or prophylactic.
  • the invention relates to methods of treating coronavirus (e.g. SARS- CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19.
  • the method may comprise administering a therapeutically effective amount of an antibody, a combination of antibodies, or a pharmaceutical composition of the invention.
  • the method ⁇ may further comprise identifying the presence of coronavirus, or fragments thereof, in a sample, e.g. SARS-CoV-2, from the subject.
  • the invention also relates to an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention for use in a method of treating coronavirus (e.g.
  • the invention also relates to a method of formulating a composition for treating coronavirus (e.g. SARS-CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19, wherein said method comprises mixing an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention with an acceptable carrier to prepare said composition.
  • the invention also relates to the use of an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention for treating coronavirus (e.g. SARS-CoV-2) infections or a disease or complication associated therewith, e.g. COVID- 19.
  • the invention also relates to the use of an antibody, a combination of antibodies, or ⁇ a pharmaceutical composition according to the invention for the manufacture of a medicament for treating or preventing coronavirus (e.g. SARS-CoV-2) infections or a disease or complication associated therewith, e.g. COVID-19.
  • coronavirus e.g. SARS-CoV-2
  • the invention also relates to preventing, treating or diagnosing coronavirus infection caused by any SARS-CoV-2 strain.
  • the coronavirus infection may be caused by ⁇ any SARS-CoV-2 strain.
  • the SARS-CoV-2 strain may be the earliest identified Wuhan strain (hCoV- 19/Wuhan/WIV04/2019 (WIV04); GISAID accession no. EPI_ISL_402124), and variants thereof.
  • the SARS-CoV-2 strain may be a member of lineage Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.10.4, BA.2.12.1, BA.2.3.20, ⁇ BA.2.75, BA.2.75.2, BA.4/5, BA.4.6, BQ.1, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, XBB, XBB.1, or XBB1.5.
  • the strain may be an as-yet-unidentified strain of SARS-CoV-2 comprising mutations in the RBD and/or NTD already identified in the existing strains, as shown in Figure 6.
  • the SARS-CoV-2 strain may comprise one or more mutations, e.g.
  • the SARS-CoV-2 strain may be a modified hCoV- 19/Wuhan/WIV04/2019 (WIV04) strain comprising one or more modifications, e.g. in the ⁇ spike protein.
  • the mutation may be the mutations (e.g. substitutions) observed in the BA.4/5 strain of SARS-CoV-2.
  • the mutation may be the mutations (e.g.
  • the methods and uses of the invention may comprise inhibiting the disease state (such as COVID-19), e.g. arresting its development; and/or relieving the disease state (such as COVID-19), e.g. causing regression of the disease state until a desired endpoint is reached.
  • the methods and uses of the invention may comprise the amelioration or the ⁇ reduction of the severity, duration or frequency of a symptom of the disease state (such as COVID-19) (e.g. lessen the pain or discomfort), and such amelioration may or may not be directly affecting the disease.
  • the symptoms or complications may be fever, headache, fatigue, loss of appetite, myalgia, diarrhoea, vomiting, abdominal pain, dehydration, respiratory tract infections, cytokine storm, acute respiratory distress syndrome (ARDS) ⁇ sepsis, and/or organ failure (e.g. heart, kidneys, liver, GI, lungs).
  • the methods and uses of the invention may lead to a decrease in the viral load of coronavirus (e.g. SARS-CoV-2), e.g. by ⁇ 10%, ⁇ 20%, ⁇ 30%, ⁇ 40%, ⁇ 50%, ⁇ 60%, ⁇ 70%, ⁇ 80%, ⁇ 90%, or 100% compared to pre-treatment.
  • coronavirus e.g. SARS-CoV-2
  • the methods and uses of the invention may comprise preventing the coronavirus infection from occurring in a subject (e.g. humans), in particular, when such subject is predisposed to complications associated with coronavirus infection.
  • the invention also relates to identifying subjects that have a coronavirus infection, such as by SARS-CoV-2.
  • the methods and uses of the invention may involve ⁇ ⁇ identifying the presence of coronavirus (e.g. SARS-CoV-2), or a protein or a fragment thereof, in a sample.
  • the detection may be carried out in vitro or in vivo.
  • the invention relates to population screening.
  • the invention relates to identifying any SARS-CoV-2 strain, as described herein.
  • the invention may also relate to a method of identifying escape mutants of SARS- CoV-2, comprising contacting a sample with a combination of antibodies of the invention and identifying if each antibody binds to the virus.
  • escape mutants refers to variants of SARS-CoV-2 comprising non-silent mutations that may affect the efficacy of existing treatments of SARS-CoV-2 infection.
  • the non-silent mutations is on an ⁇ epitope recognised by a prior art antibody and/or antibodies described herein that specifically binds to an epitope of SARS-CoV-2, e.g. on the spike protein of SARS-CoV-2.
  • the methods and uses of the invention may include contacting a sample with an ⁇ antibody or a combination of the antibodies of the invention, and detecting the presence or absence of an antibody-antigen complex, wherein the presence of the antibody-antigen complex indicates that the subject is infected with SARS-CoV-2.
  • Methods of determining the presence of an antibody-antigen complex are known in the art. For example, in vitro detection techniques include enzyme linked immunosorbent ⁇ assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence.
  • In vivo techniques include introducing into a subject a labelled anti-analyte protein antibody.
  • the antibody can be labelled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
  • the detection techniques may provide a qualitative or a quantitative readout depending on the assay ⁇ employed.
  • the invention relates to methods and uses for a human subject in need thereof.
  • non-human animals such as rats, rabbits, sheep, pigs, cows, cats, or dogs is also contemplated.
  • the subject may be at risk of exposure to coronavirus infection, such as a ⁇ healthcare worker or a person who has come into contact with an infected individual.
  • a subject may have visited or be planning to visit a country known or suspected of having a coronavirus outbreak.
  • a subject may also be at greater risk, such as an immunocompromised individual, for example an individual receiving immunosuppressive ⁇ ⁇ therapy or an individual suffering from human immunodeficiency syndrome (HIV) or acquired immune deficiency syndrome (AIDS).
  • the subject may be asymptomatic or pre-symptomatic.
  • the subject may be early, middle or late phase of the disease.
  • the subject may be in hospital or in the community at first presentation, and/or later times in hospital.
  • the subject may be male or female. In certain embodiments, the subject is typically male.
  • the subject may not have been infected with coronavirus, such as SARS-CoV-2.
  • the subject may have a predisposition to the more severe symptoms or complications associated with coronavirus infections.
  • the method or use of the invention may comprise a step of identifying whether or not a patient is at risk of developing the more severe symptoms or complications associated with coronavirus.
  • the subject ⁇ may or may not have been diagnosed to be infected with coronavirus, such as SARS-CoV- 2.
  • the invention relates to analysing samples from subjects.
  • the sample may be tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.
  • the sample may be blood and a fraction or component of ⁇ blood including blood serum, blood plasma, or lymph.
  • the sample is from a throat swab, nasal swab, or saliva.
  • the antibody-antigen complex detection assays may be performed in situ, in which case the sample is a tissue section (fixed and/or frozen) of the tissue obtained from biopsies or resections from a subject.
  • the antibodies pharmaceutical compositions and combinations may be administered subcutaneously, intravenously, intradermally, orally, intranasally, intramuscularly or intracranially.
  • the antibodies pharmaceutical compositions and combinations are administered intravenously or subcutaneously.
  • the dose of an antibody may vary depending on the age and size of a subject, as well as on the disease, conditions and route of administration.
  • Antibodies may be administered at a dose of about 0.1 mg/kg body weight to a dose of about 100 mg/kg body weight, such as at a dose of about 5 mg/kg to about 10 mg/kg. Antibodies may also be administered at a dose of about 50 mg/kg, 10 mg/kg or about 5 mg/kg body weight.
  • ⁇ ⁇ A combination of the invention may for example be administered at a dose of about 5 mg/kg to about 10 mg/kg for each antibody, or at a dose of about 10 mg/kg or about 5 mg/kg for each antibody. Alternatively, a combination may be administered at a dose of about 5 mg/kg total (e.g. a dose of 1.67 mg/kg of each antibody in a three antibody ⁇ combination).
  • the antibody or combination of antibodies of the invention may be administered in a multiple dosage regimen.
  • the initial dose may be followed by administration of a second or plurality of subsequent doses.
  • the second and subsequent doses may be separated by an appropriate time.
  • the antibodies of the invention are typically used in a single pharmaceutical composition/combination (co-formulated).
  • the invention also generally includes the combined use of antibodies of the invention in separate preparations/compositions.
  • the invention also includes combined use of the antibodies with additional therapeutic agents, as described above.
  • Combined administration of the two or more agents and/or antibodies may be achieved in a number of different ways. In one embodiment, all the components may be administered together in a single composition. In another embodiment, each component may be administered separately as part of a combined therapy.
  • the antibody of the invention may be administered before, after or ⁇ concurrently with another antibody, or binding fragment thereof, of the invention.
  • the antibody of the invention may be administered before, after or concurrently with an anti-viral agent or an anti-inflammatory agent.
  • the antibody contains a detectable label.
  • Methods of attaching a label to an antibody are known in the art, e.g. by direct labelling of the antibody by coupling (i.e., physically linking) a detectable substance to the antibody.
  • the antibody may be indirect labelled, e.g. by reactivity with another reagent that is directly labelled.
  • ⁇ indirect labelling include detection of a primary antibody using a fluorescently-labelled secondary antibody and end-labelling of a DNA probe with biotin such that it can be detected with fluorescently-labelled streptavidin.
  • the detection may further comprise: (i) an agent known to be useful for detecting the presence of coronavirus, , e.g. SARS-CoV-2, or a protein or a fragment thereof, e.g.
  • the antibody is modified to have increased stability. Suitable modifications are explained above.
  • the invention also encompasses kits for detecting the presence of coronavirus, e.g. SARS-CoV-2, in a sample.
  • the kit may comprise: a labelled antibody or a combination of labelled antibodies of the invention; means for determining the amount of ⁇ coronavirus, e.g. SARS-CoV-2, in a sample; and means for comparing the amount of coronavirus, e.g. SARS-CoV-2, in the sample with a standard.
  • the labelled antibody or the combination of labelled antibodies can be packaged in a suitable container.
  • the kit can further comprise instructions for using the kit to detect coronavirus, e.g. SARS-CoV-2, in a sample.
  • the kit may further comprise other agents known to be useful for detecting the ⁇ presence of coronavirus, as discussed above.
  • the antibodies or combinations of antibodies of the invention are used in a lateral flow test.
  • the lateral flow test kit is a hand-held device with an absorbent pad, which based on a series of capillary beds, such as pieces of porous paper, microstructured polymer, or sintered polymer.
  • the test runs the liquid sample along the ⁇ surface of the pad with reactive molecules that show a visual positive or negative result.
  • the test may further comprise using other agents known to be useful for detecting the presence of coronavirus, e.g. SARS-CoV-2, or a fragment thereof, as discussed above, such as anti- an anti-nucleocapsid antibody.
  • the sequences are ⁇ aligned for optimal comparison purposes (e.g. gaps can be introduced in a first sequence for optimal alignment with a second sequence).
  • the nucleotide or amino acid residues at each position are then compared.
  • a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, then the nucleotides or amino acids are identical at that position.
  • sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence ⁇ is 95% identical to SEQ ID NO: 3, SEQ ID NO: 3 would be the reference sequence.
  • test sequence ⁇ 95% identical to SEQ ID NO: 3
  • SEQ ID NO: 3 would be the reference sequence.
  • the skilled person would carry out an alignment over the length of SEQ ID NO: 3, and identify how many positions in the test sequence were identical to those of SEQ ID NO: 3.
  • test sequence is ⁇ at least 95% identical to SEQ ID NO: 3. If the sequence is shorter than SEQ ID NO: 3, the gaps or missing positions should be considered to be non-identical positions.
  • the skilled person is aware of different computer programs that are available to determine the homology or identity between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be ⁇ accomplished using a mathematical algorithm.
  • the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (1970) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http://www.accelrys.com/products/gcg/), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, ⁇ 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • CDRH heavy chain
  • CDRL light chain variable domain
  • BA.4+all an S trimer termed BA.4+all, that was constructed to harbour additional mutations seen in recent sub-lineages (G339H, R346T, L368I, K444R, V445P, G446S, N450D, L452M, N460K, V483A, E484R, F486S, F490V and S494P) in a BA.4/5 ⁇ background.
  • a degenerate PCR reaction was used to amplify heavy and light chains, which were assembled into an expression vector using Gibson assembly and the products expressed by transient transfection.
  • Somatic mutation was comparable to a previous set of antibodies we developed following BA.1 infection, significantly greater ⁇ than seen in early pandemic mAbs (Fig. 1D).
  • a number of mAbs showed little or no ACE2 blocking ability (e.g. BA.4/5-12, 15, 20 and 33) (Fig. 1E).
  • ⁇ ⁇ Pseudo-typed virus neutralisation assays (Nie et al. Emerg Microbes Infect 9, 680- 686 (2020)) were used to test the antibodies against 30 variants seen throughout the pandemic with particular emphasis on Omicron sub-lineages (Fig. 2A).
  • BA.4/5 mAbs shown cross-neutralize early pandemic pseudovirus Victoria ⁇ (IC50 ⁇ 100 ng/ml) and may have been selected from B cell clones originally generated following vaccination (Fig. 2A). Neutralization assays were performed using wild-type viruses (Fig. 2B). BA.4/5-33 was the only anti-NTD antibody isolated, which was specific to BA.2 derived variants, although failed to neutralize Delta. Many BA.4/5 mAbs showed >5-fold reduction of neutralization titre on at least one ⁇ Omicron sub-lineage, compared to BA.4/5 (Fig.
  • BS.1 contains a number of mutations in the RBD shared with other variants ( Figure 6), but uniquely expresses G476S at the back of the left shoulder, which is likely responsible for the reduction in activity of BA.4/5-1 and 31 on BS.1.
  • the R346T mutation which exists in a number of variants including BA.4.6, BA.2.75.2, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, XBB, CA.3.1, CH.1.1, XBB.1, XBF, XBB.1.5 ⁇ and DS.1, disrupts the binding of many potent BA.4/5 mAbs, (BA.4/5-11, 12, 13, 15, 18, 20, 21 and 25, when comparing BA.4 with BA.4.6). Finally, the activity of mAbs developed for clinical use were tested against newly emerging Omicron variants (Fig. 2C).
  • Delta RBD was used since it yields better crystals.
  • the high resolution crystal structure of Delta-RBD with Omi-42 and Beta-49 was also determined, complementing the previously reported lower resolution cryo-EM structure of the spike/Omi-42 complex (Tuekprakhon et al. Cell 185, 2422-2433 e2413 (2022)) to facilitate structure analysis and comparison (Figs 3 to 5).
  • ⁇ BA.4/5-2 IGHV3-30
  • the second ultra cross-reactive mAb binds the RBD with the heavy chain (HC) at the back of the left shoulder and light chain at the back of the neck.
  • the HC makes the majority of contacts with the RBD with a footprint of 650 ⁇ 2 , compared to 305 ⁇ 2 for the LC (Fig. 3B, 4B, 5D). Of the 27 residues within this footprint, 12 overlap with the footprint of ACE2.
  • CDR-H3 makes extensive interactions with RBD ⁇ residues 416-417, 420-421, 455-460, 473 and 489. In contrast, CDR-L3 makes only weak contact to T415 of the RBD.
  • CDR-H1 contacts residues 475-477 and 486-487 (Fig. 3H- L). Residues 405, 408, 417, 460, 476-477 and 505, which are mutated in VoC (Fig.
  • BA.4/5-1 (IGHV4-39) is another RBD binding antibody that approaches the binding site from the back of the RBD, the HC binds at the top of the neck and LC at the back of the left shoulder making a large footprint of 1310 ⁇ 2 (HC 670 ⁇ 2 and LC 640 ⁇ 2 ) (Fig. 3A, 3C-G. 4A and 5C). This antibody also heavily overlaps the ACE2 binding site; of the 35 RBD residues in the BA.4/5-1 footprint, 20 overlap with the ACE2 footprint.
  • F486 also makes ring stacking contacts with Y35 and Y60 from the framework regions of the HC (Fig. 3C-J). Residue F486 undergoes a number of mutations in recently identified SARS CoV-2 variants: F486V in BA.4/5 and BQ.1, F486S in BA.2.75.2 and XBB and F486P in BA.2.10.4 and XBB.1.5 ( Figure 6). It appears that ⁇ despite showing close interaction with residue 486, BA.4/5-1 can tolerate mutations of F486 showing only modest reduction in titres to some of the newly described variants compared to BA.4/5 (Fig. 2A).
  • BS.1 contains the unique mutation G476S ( Figure 6) compared to ⁇ ⁇ the other variants tested in Fig. 2A, G476 has close contact with Y92 of CDR-L3 and the change to Ser likely disrupts this interaction (Fig. 3G).
  • G476S Figure 6
  • Fig. 3G The continued evolution of SARS CoV-2 is expected, prompted by vaccination and multiple rounds of natural infection, placing the virus under extreme selective pressure.
  • Bacterial Strains and Cell Culture Vero (ATCC CCL-81) and VeroE6/TMPRSS2 cells were cultured in Dulbecco’s Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100 ⁇ U/ml of ⁇ penicillin–streptomycin at 37 °C.
  • Human mAbs were expressed in HEK293T cells cultured in FreeStyleTM 293 Expression Medium (Cat# 12338018, GibcoTM) at 37 °C with 5% CO 2 .
  • HEK293T ATCC CRL-11268 cells were cultured in DMEM high glucose (Sigma- Aldrich) supplemented with 10% FBS, 1% 100X Mem Neaa (Gibco) and 1% 100X L- Glutamine (Gibco) at 37 °C with 5% CO 2 .
  • DMEM high glucose Sigma- Aldrich
  • FBS 1% 100X Mem Neaa
  • TM L- Glutamine Gibco
  • ⁇ HEK293T cells were cultured in DMEM high glucose (Sigma) supplemented with 2% FBS, 1% 100X Mem Neaa and 1% 100X L-Glutamine at 37 °C for transfection.
  • BA.5 RBD were expressed in HEK293T (ATCC CRL-11268) cells cultured in FreeStyleTM 293 Expression Medium (Cat# 12338018, GibcoTM) at 37 °C with 5% CO 2 .
  • ⁇ ⁇ E.coli DH5 ⁇ bacteria were used for transformation and large-scale preparation of plasmids. A single colony was picked and cultured in LB broth at 37 °C at 200 rpm in a shaker overnight.
  • HEK293T/17 cell was cultured in Dulbecco’s Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented ⁇ with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100 ⁇ U/ml of penicillin–streptomycin at 37 °C.
  • DMEM Modified Eagle medium
  • FBS fetal bovine serum
  • GlutaMAX Gibco, 35050061
  • penicillin–streptomycin 100 ⁇ U/ml of penicillin–streptomycin at 37 °C.
  • Diagnosis was confirmed ⁇ through reporting of symptoms consistent with COVID-19, hospital presentation, and a test positive for SARS-CoV-2 using reverse transcriptase polymerase chain reaction (RT-PCR) from an upper respiratory tract (nose/throat) swab tested in accredited laboratories and lineage sequence confirmed through national reference laboratories in the United Kingdom.
  • RT-PCR reverse transcriptase polymerase chain reaction
  • a blood sample was taken following consent at least 14 days after PCR test ⁇ confirmation.
  • Clinical information including severity of disease (mild, severe or critical infection according to recommendations from the World Health Organisation) and times between symptom onset and sampling and age of participant was captured for all individuals at the time of sampling. Isolation of BA.4/5 S-specific single B cells by FACS ⁇ BA.4/5 S-specific single B cell sorting was performed.
  • PBMC peripheral blood mononuclear cells
  • IgG+ memory B ⁇ cells were gated as CD19+, IgG+, CD3-, CD14-, CD56-, CD16-, IgM-, IgA- and IgD-, and S+ was further selected and single cells were sorted into 96-well PCR plates with 10 ⁇ l of catching buffer (Tris, Nuclease free-H2O and RNase inhibitor). Plates were briefly centrifuged at 2000 ⁇ g for 1 min and left on dry ice before being stored at -80 °C. Cloning and expression of BA.4/5 S-specific human mAbs ⁇ ⁇ BA.4/5 S-specific human mAbs were cloned and expressed.
  • genes for Ig IGHV, Ig V ⁇ and Ig V ⁇ were recovered from positive wells by RT-PCR. Genes encoding Ig IGHV, Ig V ⁇ and Ig V ⁇ were then amplified using Nested-PCR by a cocktail of primers specific to human IgG. PCR products of HCs and LCs were ligated into the expression ⁇ vectors of human IgG1 or immunoglobulin ⁇ -chain or ⁇ -chain by Gibson assembly.
  • plasmids encoding HCs and LCs were co-transfected by PEI-transfection into a HEK293T cell line, and supernatants containing mAbs were collected and filtered 4- 5 days after transfection, and the supernatants were further characterized or purified.
  • ACE2 binding inhibition assay by ELISA ⁇ MAXISORP immunoplates were coated with 5 ⁇ g/ml of purified ACE2-His protein overnight at 4 ⁇ and then blocked by 2% BSA in PBS. Meanwhile, mAbs were serially diluted and mixed with 2.5 ⁇ g/ml of recombinant BA.4/5 trimeric S-twin-Strep.
  • Antibody-S protein mixtures were incubated at 37 ⁇ for 1 hr. After incubation, the mixtures were transferred into the ACE2-coated plates and incubated for 1 hr at 37 ⁇ . ⁇ After washing, StrepMAB-Classic (2-1507-001, iba) was diluted at 0.2 ⁇ g/ml by 2% BSA and used as primary antibody followed by Goat anti-mouse IgG-AP (A9316, Sigma- Aldrich) at 1:10,000 dilution. The reaction was developed by adding PNPP substrate and stopped with NaOH. The absorbance was measured at 405nm. The ACE2/S binding inhibition was calculated by comparing to the antibody-free control well.
  • IC50 was ⁇ determined using the Probit program from the SPSS package. Pseudovirus plasmid construction and lentiviral particles production Pseudotyped lentivirus expressing SARS-CoV-2 S proteins from ancestral strain (Victoria, S247R), BA.2, BA.4/5, BA.2.75, BA.2.75.2, BA.2.3.20, BA.2.10.4, BJ.1, BN.1, and BA.4.6 were constructed and described in the art. The same method to construct ⁇ BQ.1, BQ.1.1, BS.1, and BF.7 was employed, by adding more mutations into the BA.4 construct. BA.5.9 was created by adding R346I mutation into BA.4/5 backbone.
  • BQ.1 K444T and N460K were added into BA.4/5 backbone, and then R346T was introduced into BQ.1 to create BQ.1.1.
  • A475V was added into BQ.1.1 to create BQ.1.1+A475V.
  • R346T, L452R, N460K and G476S was added into ⁇ BA.2 backbone.
  • XBB was constructed by adding the following mutations into BA.2 backbone: V83A, H146Q, Q183E, R346T, L368I, V445P, G446S, N460K, F486S, F490S, and R493Q.
  • XBB.1 G252V was introduced into XBB, and F486P was added into XBB.1 to make XBB.1.5.
  • XBF was constructed by adding F486P into BN.1, and then reverse mutated 356T in BN.1 to 356K in the original strain.
  • R346T was ⁇ ⁇ introduced in BA.4 backbone.
  • CH.1.1 was created by adding K444T and L452R into BA.2.12.1, and changed T444 in CH.1.1 to M444 to construct CA.3.1.
  • DS.1 R403K and F486S were added into BN.1 template.
  • the resulting pcDNA3.1 plasmid carrying S gene was used for generating pseudoviral particles together with the lentiviral ⁇ packaging vector and transfer vector encoding luciferase reporter. All the constructs were Sanger sequence confirmed. Pseudoviral neutralization test The pseudoviral neutralization test has been described previously.
  • FRNT Focus Reduction Neutralization Assay
  • the mixtures were then transferred to microplates containing confluent Vero cell monolayers in duplicate and incubated for a further 2 hrs followed by the addition of 1.5% semi-solid ⁇ carboxymethyl cellulose (CMC) overlay medium to each well to limit virus diffusion.
  • CMC carboxymethyl cellulose
  • a focus forming assay was then performed by staining Vero cells with human anti-NP mAb (mAb206) followed by peroxidase-conjugated goat anti-human IgG (A0170; Sigma). Finally, the foci (infected cells) approximately 100 per well in the absence of antibodies, were visualized by adding TrueBlue Peroxidase Substrate. Virus-infected cell foci were ⁇ ⁇ counted on the classic AID EliSpot reader using AID ELISpot software.
  • His-tagged RBDs were purified with a 5 mL HisTrap nickel column (GE Healthcare), followed by a Superdex 7510/300 GL gel filtration column (GE Healthcare).
  • IgG mAbs and Fabs production ⁇ AstraZeneca and Regeneron antibodies were provided by AstraZeneca, Vir, Lilly and Adagio antibodies were provided by Adagio, LY-CoV1404 was provided by LifeArc.
  • heavy and light chains of the indicated antibodies were transiently transfected into 293T cells and antibody purified from supernatant on protein A as previously described 24 .
  • Fabs were digested from purified IgGs with papain using a ⁇ Pierce Fab Preparation Kit (Thermo Fisher), following the manufacturer’s protocol. Crystallization, X-ray data collection and structure determination Purified Delta RBD was deglycosylated with Endoglycosidase H1. Fabs BA.4/5-1 and EY6A, BA.4/5-2 and Beta-49, and Omi-42 and Beta-49 were mixed with Delta RBD separately in a 1:1:1 molar ratio, with a final concentration of 7.0 mg ml -1 .
  • Crystalquick 96-well X plates (Greiner Bio-One) with a Cartesian Robot using the nanoliter sitting-drop vapor-diffusion method, with 100 nL of protein plus 100 nL of reservoir in each drop.
  • Crystals of Delta-RBD/BA.4/5-1/EY6A and Delta- RBD/Omi-42/Beta-49 were formed in Hampton Research PEGRx condition 1-17, containing 0.1 M sodium citrate tribasic dihydrate pH 5.5 and 22% (w/v) PEG 1000.
  • ⁇ ⁇ Crystals of Delta-RBD/BA.4/5-2/Beta-49 were formed in Hampton Research PEGRx condition 1-46, containing 0.1 M sodium citrate tribasic dihydrate pH 5.0 and 18% (w/v) PEG 20000. Crystals of Delta-RBD/BA.4/5-35 were grown in condition containing 0.1 M Sodium citrate tribasic dihydrate pH 5.5, 18% (w/v) PEG 3,350. ⁇ Crystals were mounted in loops and dipped in solution containing 25% glycerol and 75% mother liquor for a second before frozen in liquid nitrogen.
  • Diffraction data of Delta RBD/EY6A/BA.4/5-1 and Delta RBD/Beta-49/BA.4/5-2 were collected at beamline i04, and Delta-RBD/BA.4/5-35 and Delta RBD/Beta-49/Omi-42 at i03 of Diamond Light Source, UK, using the automated queue system that allows unattended automated data ⁇ collection.
  • 3600 diffraction images of 0.1o each were collected at 100 K from a single crystal for each data set.
  • Data integration, scaling and reduction were automatically done with Xia2-dials
  • the structures were determined using molecular replacement with Phaser, model rebuilding is done with COOT and refinement with Phenix.
  • Grids were prepared using a 3 ⁇ L aliquot of this complex mixture and ⁇ plasma-cleaned (35 s, high with a Plasma Cleaner PDC-002-CE, Harrick Plasma) Quantifoil 2/1300 mesh grids using a Vitrobot Mark IV (Thermo Fisher). Excess liquid was removed by blotting for 5 s with a force of -1 using vitrobot filter paper (grade 595, Ted Pella Inc.) in a chamber set to 4.5 oC, 100 % reported humidity before plunge freezing into liquid ethane.
  • vitrobot filter paper grade 595, Ted Pella Inc.
  • cryoSPARC v3.3.2 ‘static’ version with a circular mask diameter of 155 ⁇ , 23 online iterations and 300 batch size per class.
  • Heterogeneous refinement was then performed on the filtered particle set comprising 154,454, separating data into three classes ⁇ ⁇ (initial references generated during on-the-fly processing ab initio model generation from a subset of 100,000 particles). The predominant class, with 89,552, was selected for further refinement.
  • Fabs and Spike were mixed at a molar ratio of 6:1 such that there was a two-fold molar excess of fab to sites, and fab/antigen complexes prepared ⁇ 5 minutes prior to application to the freshly glow discharged grid and excess liquid was removed by blotting for 5 s with a force of -1 using vitrobot filter paper (grade 595, Ted Pella Inc.) at 4.5 oC, 100 % reported humidity before plunge ⁇ freezing into liquid ethane using a Vitrobot Mark IV (Thermo Fisher).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to antibodies capable of binding to the spike protein of coronavirus SARS-CoV-2, and methods and uses thereof in the prevention, treatment and/or diagnosis of coronavirus infections, and diseases and/or complications associated with coronavirus infections, including COVID-19.

Description

ANTIBODIES Field of invention The invention relates to antibodies useful for the prevention, treatment and/or diagnosis of coronavirus infections, and diseases and/or complications associated with ϱ^ coronavirus infections, including COVID-19. Background of the invention Since emerging in late 2019 severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) is estimated to have led to 757 million infections and 6.9 million deaths. Effective vaccines and increasing herd immunity from natural infection have greatly ϭϬ^ reduced the mortality from SARS-CoV-2 infection but are less effective at preventing infection. SARS-CoV-2 therefore still causes significant mortality in high-risk groups such as the immunosuppressed or elderly who show reduced or absent responses to vaccination. To date, two domains of the S1 region of spike, the N-terminal domain (NTD) and ϭϱ^ the receptor binding domain (RBD), have been described as binding sites for potent neutralizing mAbs. Most potent anti-RBD mAbs bind on or in close proximity to the receptor binding motif (Yuan, et al. Science 369, 1119-1123 (2020)), a small 25 amino acid patch that lies at the tip of the RBD. mAbs binding here mediate neutralization by blocking binding of S to the SARS-CoV-2 cellular receptor angiotensin converting enzymeϮϬ^ 2 (ACE-2). A second group of antibodies, exemplified by S309, bind on or around the N- linked glycan at residue N453, these do not block interaction with ACE2 and may function to destabilize the S-trimer. Potent anti-NTD mAbs bind to a so-called supersite on the NTD, do not block ACE2 interaction and their mechanism of action is not well understood. All commercially developed mAbs to date target the RBD (Westendorf et al. Cell Rep 39,Ϯϱ^ 110812 (2022); Weinreich et al. N Engl J Med 384, 238-251 (2021); Dong, et al. bioRxiv (2021)), whilst anti-NTD mAbs are frequently SARS-CoV-2 variant specific because of the extensive mutation of the supersite between variants. Both RBD and NTD are hot spots of mutation in SARS-CoV-2. RBD mutations can impart selective advantages to the virus, firstly some can increase the affinity to ACE2 ϯϬ^ and are believed to drive increased transmissibility, the N501Y mutation found in the Alpha variant is an example of this. Secondly, mutations in the RBD and NTD may also ϭ^ ^ lead to escape from neutralizing antibody responses. As herd immunity from vaccination and natural infection increases there is intense selective pressure to allow the virus to break through pre-existing immunity. Evolution of S has therefore been rapid with many mutations mapping closely to the sites of interaction of potent mAbs in the RBD and NTD. ϱ^ SARS-CoV-2, in a period of 3 years since its emergence, evolved variants that escape all mAbs that have been developed for clinical use. The arrival of Omicron in late 2021 caused often profound drops in neutralization titres in serum from vaccinees and from natural infection, leading Omicron to spread globally with a large wave of infection and become the dominant variant in a matter of weeks, since when it has dominated. ϭϬ^ However, Omicron has continued to evolve rapidly, BA.1 was replaced by BA.1.1 and BA.2 which were in turn been replaced by BA.4/5, BA.4.6 and BF.7. Since late 2022, an increasing number of BA.2 sub-variants have begun to cocirculate, with convergent evolution leading to the acquisition of subsets of common mutations in related variants. Currently XBB.1.5 and CH.1.1 are the dominant strains, with frequently several strains ϭϱ^ cocirculating such as XBF, BQ.1.1, BF.7, showing large differences in frequency in different geographical locations. Therefore, it is an object of the invention to identify further and improved antibodies useful for preventing, treating and/or diagnosing coronavirus infections, and diseases and/or complications associated with coronavirus infections (e.g. COVID-19), ϮϬ^ especially those caused by the Omicron variants of concern (VoCs) and variants having further mutations in the spike protein of SARS-CoV-2. Summary of the invention The inventors have identified 24 potent spike binding mAbs (IC50 < 50 ng/ml) from vaccinees who suffered vaccine break-through infections with Omicron sublineages Ϯϱ^ BA.4/5. One mAb, BA.4/5-2, binds at the back of the left shoulder of the RBD in an area which is so far not in a mutational hot spot. Accordingly, the invention provides an antibody capable of binding to the spike protein of coronavirus SARS-CoV-2, wherein the antibody comprises the six CDRs of antibody BA.4/5-2 described herein, or of any one of the antibodies in Tables 1 and 3 to 9 ϯϬ^ as described herein. In a further embodiment, the invention provides an antibody capable of binding to the spike protein of coronavirus SARS-CoV-2, wherein the antibody comprises CDRH1, CDRH2 and CDRH3, from a first antibody in Table 1 and CDRL1, CDRL2 and CDRL3 Ϯ^ ^ from a second antibody in Table 1, with the proviso that the first antibody and the second antibody are different. In a further embodiment, the invention provides one or more polynucleotides encoding the antibody, one or more vectors comprising said polynucleotides, or a host cell ϱ^ comprising said vectors. In a further embodiment, the invention provides a method for producing an antibody that is capable of binding to the spike protein of coronavirus SARS-CoV-2, the method comprising culturing the host cell and isolating the antibody from said culture. In a further embodiment, the invention provides a pharmaceutical composition ϭϬ^ comprising: (a) the antibody, and (b) at least one pharmaceutically acceptable diluent or carrier. In a further embodiment, the invention provides the antibody or the pharmaceutical composition for use in a method for treatment of a human or animal by therapy, or for use in a method of treating or preventing coronavirus infection, or a disease or complication ϭϱ^ associated with coronavirus infection. In a further embodiment, the invention provides a method of treating or preventing coronavirus infection, or a disease or complication associated with coronavirus infection in a subject, comprising administering a therapeutically effective amount of the antibody or the pharmaceutical composition to said subject. ϮϬ^ In a further embodiment, the invention provides a method of identifying the presence of coronavirus, or a protein fragment thereof, in a sample, comprising: (i) contacting the sample with the antibody; and (ii) detecting the presence or absence of an antibody-antigen complex, wherein the presence of the antibody-antigen complex indicates the presence of coronavirus, or a fragment thereof, in the sample. Ϯϱ^ In a further embodiment, the invention provides a method of treating or preventing coronavirus infection, or a disease or complication associated therewith, in a subject, the method comprising identifying the presence of coronavirus according to the method above, and treating the subject with the antibody, an anti-viral drug or an anti-inflammatory agent. In a further embodiment, the invention provides the use of the antibody or the ϯϬ^ pharmaceutical composition for preventing, treating and/or diagnosing coronavirus infection, or a disease or complication associated therewith. In a further embodiment, the invention provides the use of the antibody or the pharmaceutical composition for the manufacture of a medicament for treating or preventing coronavirus infection, or a disease or complication associated therewith. ϯ^ ^ Brief description of the figures Figure 1. Generation of BA.4/5 mAb. (A) Live virus neutralization FRNT50 titres against Victoria, an ancestral SARS-CoV-2 isolate, BA.2, BA.4 and BA.5 viruses using serum from vaccine breakthrough BA.4/5. (B) Sorting strategy for BA.4/5 specific B cells. ϱ^ (C) Heavy chain and light chain gene usage of potent BA.4/5 mAbs. (D) Number of somatic mutations found in BA.4/5 mAbs compared to sets previously isolated from early pandemic, Beta, BA.1 and BA.2 infection. (E) Blocking of ACE2-S interaction by potent BA.4/5 mAbs. Figure 2. Heatmaps of antibody IC50 neutralisation titres and live virus ϭϬ^ neutralising activity of BA.4/5-2 and BA.4/5-5. (A) Heatmap of IC50s of potent BA.4/5 mAbs against pseudoviruses expressing variant S sequences. (B) Neutralisation curves and IC50s of BA.4/5-2 against 19 live virus variants. (C) Heatmap of IC50s of therapeutic monoclonal antibodies against pseudoviruses. Figure 3. Structures of BA.4/5-1 and BA.4/5-2 complexes with RBD or spike. a, ϭϱ^ b, Binding mode of BA.4/5-1 and BA.4/5-2, respectively, as viewed from front (left) and back (right) of the RBD. RBD is drawn as grey surface representation with BA.4 mutation sites shown in magenta and further mutation sites found in Omicron sublineages in cyan. Only VhVl domains of the Fabs are shown as ribbons for clarity with HC in red LC in blue. C-G, Binding position of the CDRs and detailed interactions for BA.4/5-1/RBD, H-L ϮϬ^ for BA.4/5-2/RBD. Protein main chains are drawn as ribbons and coils, and side chains as sticks with Fab HC in red and LC in blue, RBD in grey. Hydrogen bonds are shown as yellow broken sticks. Figure 4. Structures of RBD and Fab complexes and comparisons. a-c, Crystal structures of Delta-RBB/BA.4/5-1/EY6A, Delta-RBD/BA.4/5-2/Beta-49, and Delta-Ϯϱ^ RBD/Omi-42/Beta-49, respectively. d, Cryo-EM structure of Delta-RBD/BA.2-07/SAR1- 34/C1 complex. e, Binding of BA.4/5-5 stabilizes the nearby loops 620-640 from SD2 and 835-848 immediately after the fusion peptide from an adjacent chain. The start and end of each loop are marked by spheres. f-h, The binding mode of Omi-42 is compared with that of BA.4/5-2 by overlapping the RBD. Protein main chains are drawn as ribbons and coils, ϯϬ^ and side chains as sticks with Fab HC in red and LC in blue, SD1 in grey. Hydrogen bonds are shown as yellow broken sticks. Omi-42 HC and LC are in brown and pale blue, respectively. ϰ^ ^ Figure 5. ACE2 footprint, mutation sites of Omicron variants and Fab footprints on RBD. a, Surface representation of RBD with residues on the ACE2 footprint showing in green. b, RBD with the known mutation sites of Omicron variants in magenta. c-f, BA.4/5-1, BA.4/5-2, BA.2-07 and Omi-42 footprints shown in cyan, respectively, and ϱ^ ACE2 footprint marked by black outlines. Figure 6. Mutations in RBD for variants shown in Fig. 2a. Indicated mutations are those additional mutations relative to the sequence of BA.2. Figure 7. Data collection, structure determination and refinement statistics. Detailed description of the invention ϭϬ^ Antibodies of the invention An antibody of the invention specifically binds to the spike protein of SAR-CoV-2. In particular, it specifically binds to the S1 subunit of the spike protein, such as the receptor binding domain (RBD) or the N-terminal domain (NTD). An antibody of the invention may comprise all six CDRs of an antibody in Table 1. ϭϱ^ The antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having at least 80% sequence identity, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, to the heavy chain variable domain of an antibody in Table 1. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having at ϮϬ^ least 80% sequence identity, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, to the light chain variable domain of an antibody in Table 1. The antibody may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having at least 80% sequence identity, such as at least 90%, at least 95%, at least 96%, at least 97%, Ϯϱ^ at least 98%, at least 99% or 100% sequence identity, to the heavy chain variable domain and light chain domain, respectively, of an antibody in Table 1. The antibody may comprise mutations in the framework regions of the variable domains compared to the antibody in Table 1. For example, the antibody may comprise a heavy chain variable domain comprising the CDRH1, CDRH2 and CDRH3 of an antibody in Table 1, and a ϯϬ^ light chain variable domain comprising the CDRL1, CDRL2 and CDRL3 of the antibody in Table 1, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having at least 80% sequence identity, ϱ^ ^ such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, to the heavy chain variable domain and light chain variable domain, respectively of the antibody in Table 1. The antibody may be any one of the antibodies in Table 1. ϱ^ Table 1 lists 24 individual antibodies that were identified from recovered BA.4/5 SARS-CoV-2 infected patients. Table 1 also lists the SEQ ID NOs for the heavy chain variable domain and light chain variable domain nucleotide and amino acid sequences, and the complementarity determining regions (CDRs) of the variable domains, of each of the antibodies. Typically, the CDRH3 is the CDRH3 provided in the penultimate column of ϭϬ^ Table 1, and/or the CDRL3 is the CDRL3 provided in the penultimate column of Table 1. In some cases, the CDRH3 is the CDRH3 AA Junction provided in the ultimate column of Table 1 and/or the CDRL3 is the CDRL3 AA Junction provided in the ultimate column of Table 1. The “AA Junction” CDR3 sequences are the CDR3 sequences defined by the IMGT numbering scheme plus an additional amino acid on the N-terminal and C-terminal ϭϱ^ sides of the CDR taken from the framework region. The antibody in Table 1 may be selected from the group consisting of BA.4/5-2 and BA.4/5-1. These antibodies were surprisingly found to retain strong neutralisation of pseudoviral constructs of the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, ϮϬ^ BJ.1, BA.2.75.2, BF.7, BS.1, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1. The antibody in Table 1 may be selected from the group consisting of BA.4/5-2, BA.4/5-1, BA.4/5-8, BA.4/5-9, BA.4/5-22, BA.4/5-28, BA.4/5-31 and BA.4/5-34. These antibodies were surprisingly found to retain strong neutralisation of pseudoviral constructs of the SARS-CoV-2 variant strains Victoria, Ϯϱ^ Alpha, Beta, Gamma, Delta, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BQ.1, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1. The neutralisation data presented herein were performed in vitro and may underestimate in vivo neutralization due to antibody dependent cell mediated cytotoxicity and complement activity. ϯϬ^ In one embodiment, the antibody in Table 1 may be BA.4/5-2. BA.4/5-2 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BS.1, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ^ 0.02 μg/ml. BA.4/5-2 is ϲ^ ^ further advantageous as it binds at the back of the left shoulder of the receptor binding domain (RBD) in an area that has resisted mutational change to date. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 15, 16 and 17, respectively, and a ϱ^ CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 21, 22 and 23, respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 14). In ϭϬ^ one embodiment, an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 20). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising ϭϱ^ or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-2 (i.e. SEQ ID NOs: 14 and 20, respectively). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid ϮϬ^ sequences specified in SEQ ID NOs: 15, 16 and 17, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 21, 22 and 23, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and Ϯϱ^ light chain variable domain, respectively, of antibody BA.4/5-2 (i.e. SEQ ID NOs: 14 and 22, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 14 and 22, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region. ϯϬ^ The heavy chain domain of BA.4/5-2 is derived from a IGHV3-30 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below). Hence, an antibody of the invention may comprise the heavy chain of BA.4/5-2, and not the light chain of BA.4/5-2. ϳ^ ^ For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 15, 16 and 17, respectively. The antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence ϱ^ identity to the heavy chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 14). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 14. Alternatively, in an embodiment of the invention, the antibody may comprise the light chain of BA.4/5-2, and not the heavy chain of BA.4/5-2. For example, the antibody ϭϬ^ may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 21, 22 and 23, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-2 (i.e. SEQ ID NO: 20). The antibody may comprise a light ϭϱ^ chain variable domain comprising or consisting of SEQ ID NO: 20. In one embodiment, the antibody in Table 1 may be BA.4/5-1. BA.4/5-1 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BS.1, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1,ϮϬ^ XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ^ 0.15 μg/ml, and the SARS- CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ^ 0.04 μg/ml. In one embodiment, an antibody of the Ϯϱ^ invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 3, 4 and 5, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 9, 10 and 11, respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ϯϬ^ ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID NO: 2). In one embodiment, an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID ^^ ^ NO: 8). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, ϱ^ of antibody BA.4/5-1 (i.e. SEQ ID NOs: 2 and 8, respectively). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 3, 4 and 5, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 9, 10 and 11, respectively, wherein the heavy chain ϭϬ^ variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-1 (i.e. SEQ ID NOs: 2 and 8, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy ϭϱ^ chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 2 and 8, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region. The heavy chain domain of BA.4/5-1 is derived from a IGHV4-39 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light ϮϬ^ chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below). Hence, an antibody of the invention may comprise the heavy chain of BA.4/5-1, and not the light chain of BA.4/5-1. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 3, 4 and 5, respectively. The antibody Ϯϱ^ may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID NO: 2). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 2. ϯϬ^ Alternatively, in an embodiment of the invention, the antibody may comprise the light chain of BA.4/5-1, and not the heavy chain of BA.4/5-1. For example, the antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 9, 10 and 11, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^^ ^ ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-1 (i.e. SEQ ID NO: 8). The antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 8. In one embodiment, the antibody in Table 1 may be BA.4/5-8. BA.4/5-8 was found ϱ^ to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BS.1, BA.2.3.20, BQ.1, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF and XBB.1.5 with an IC50 of ^ 0.1 μg/ml and inter alia the SARS-CoV-2 variant strains BQ.1.1, CH.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ^ 0.05 μg/ml. In one embodiment, an antibody ϭϬ^ of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 51, 52 and 53, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 57, 58 and 59, respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ϭϱ^ ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-8 (i.e. SEQ ID NO: 50). In one embodiment, an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-8 ϮϬ^ (i.e. SEQ ID NO: 56). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-8 (i.e. SEQ ID NOs: 50 and 56, respectively). In one Ϯϱ^ embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 51, 52 and 53, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 57, 58 and 59, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of ϯϬ^ an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-8 (i.e. SEQ ID NOs: 50 and 56, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in ϭϬ^ ^ SEQ ID NOs: 50 and 56, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region. The heavy chain domain of BA.4/5-8 is derived from a IGHV3-66 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light ϱ^ chains between antibodies derived from the same v-region, and in the case of IGHV3-66 also derived from IGHV3-53, results in an antibody that is particularly useful with the invention (explained further below). Hence, an antibody of the invention may comprise the heavy chain of BA.4/5-8, and not the light chain of BA.4/5-8. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences ϭϬ^ specified in SEQ ID NOs: 51, 52 and 53, respectively. The antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-8 (i.e. SEQ ID NO: 50). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 50. ϭϱ^ Alternatively, in an embodiment of the invention, the antibody may comprise the light chain of BA.4/5-2, and not the heavy chain of BA.4/5-8. For example, the antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 57, 58 and 59, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ϮϬ^ ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-8 (i.e. SEQ ID NO: 56). The antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 56. In one embodiment, the antibody in Table 1 may be BA.4/5-9. BA.4/5-9 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, Ϯϱ^ BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, XBF, and DS.1 with an IC50 of ^ 0.05 μg/ml. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 63, 64 and 65, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences ϯϬ^ specified in SEQ ID NOs: 69, 70 and 71, respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 62). In one embodiment, an antibody of the invention may comprise a light chain ϭϭ^ ^ variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 68). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable ϱ^ domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-9 (i.e. SEQ ID NOs: 62 and 68, respectively). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the ϭϬ^ amino acid sequences specified in SEQ ID NOs: 63, 64 and 65, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 69. 70 and 71, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable ϭϱ^ domain and light chain variable domain, respectively, of antibody BA.4/5-9 (i.e. SEQ ID NOs: 62 and 68, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 62 and 68, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM ϮϬ^ constant region. The heavy chain domain of BA.4/5-9 is derived from a IGHV1-46 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below). Hence, an antibody of the Ϯϱ^ invention may comprise the heavy chain of BA.4/5-9, and not the light chain of BA.4/5-9. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 63, 64 and 65, respectively. The antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence ϯϬ^ identity to the heavy chain variable domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 62). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 62. Alternatively, in an embodiment of the invention, the antibody may comprise the light chain of BA.4/5-9, and not the heavy chain of BA.4/5-9. For example, the antibody ϭϮ^ ^ may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 69, 70 and 71, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable ϱ^ domain of antibody BA.4/5-9 (i.e. SEQ ID NO: 68). The antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 68. In one embodiment, the antibody in Table 1 may be BA.4/5-22. BA.4/5-22 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BN.1, ϭϬ^ BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ^ 0.025 μg/ml and inter alia the SARS-CoV-2 variant strains XBF, CH.1.1, BQ.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ^ 0.02 μg/ml. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 183, 184 and 185, ϭϱ^ respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 189, 190 and 191, respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5- ϮϬ^ 22 (i.e. SEQ ID NO: 182). In one embodiment, an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-22 (i.e. SEQ ID NO: 188). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain Ϯϱ^ variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-22 (i.e. SEQ ID NOs: 182 and 188, respectively). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 ϯϬ^ having the amino acid sequences specified in SEQ ID NOs: 183, 184 and 185, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 189, 190 and 191, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence ϭϯ^ ^ identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-2 (i.e. SEQ ID NOs: 182 and 188, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: ϱ^ 182 and 188, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region. The heavy chain domain of BA.4/5-22 is derived from a IGHV1-69 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is ϭϬ^ particularly useful with the invention (explained further below). Hence, an antibody of the invention may comprise the heavy chain of BA.4/5-22, and not the light chain of BA.4/5- 22. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 183, 184 and 185, respectively. The antibody may comprise a heavy chain variable domain comprising or consisting of an ϭϱ^ amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-22 (i.e. SEQ ID NO: 182). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 182. Alternatively, in an embodiment of the invention, the antibody may comprise the ϮϬ^ light chain of BA.4/5-22, and not the heavy chain of BA.4/5-22. For example, the antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 189, 190 and 191, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light Ϯϱ^ chain variable domain of antibody BA.4/5-22 (i.e. SEQ ID NO: 188). The antibody may comprise a light chain variable domain comprising or consisting of SEQ ID NO: 188. In one embodiment, the antibody in Table 1 may be BA.4/5-28. BA.4/5-28 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, ϯϬ^ BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ^ 0.1 μg/ml. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 231, 232 and 233, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 237, 238 and 239, ϭϰ^ ^ respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 230). In one embodiment, an ϱ^ antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 236). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of ϭϬ^ an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-28 (i.e. SEQ ID NOs: 230 and 236, respectively). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in ϭϱ^ SEQ ID NOs: 231, 232 and 233, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 237, 238 and 239, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain ϮϬ^ variable domain, respectively, of antibody BA.4/5-28 (i.e. SEQ ID NOs: 230 and 236, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 230 and 236, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region. Ϯϱ^ The heavy chain domain of BA.4/5-28 is derived from a IGHV3-66 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region, and in the case of IGHV3-66 also derived from IGHV3-53, results in an antibody that is particularly useful with the invention (explained further below). Hence, an antibody of the invention may comprise ϯϬ^ the heavy chain of BA.4/5-28, and not the light chain of BA.4/5-28. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 231, 232 and 233, respectively. The antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy ϭϱ^ ^ chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 230). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 230. Alternatively, in an embodiment of the invention, the antibody may comprise the light chain of BA.4/5-28, and not the heavy chain of BA.4/5-28. For example, the ϱ^ antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 237, 238 and 239, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-28 (i.e. SEQ ID NO: 236). The antibody may ϭϬ^ comprise a light chain variable domain comprising or consisting of SEQ ID NO: 236. In one embodiment, the antibody in Table 1 may be BA.4/5-31. BA.4/5-31 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BJ.1, BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, ϭϱ^ CH.1.1, XBF, XBB.1.5 and DS.1 with an IC50 of ^ 0.2 μg/ml and the SARS-CoV-2 variant strains XBF, CH.1.1, BQ.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ^ 0.03 μg/ml. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 243, 244 and 245, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid ϮϬ^ sequences specified in SEQ ID NOs: 249, 250 and 251, respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5- 31 (i.e. SEQ ID NO: 242). In one embodiment, an antibody of the invention may comprise Ϯϱ^ a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-31 (i.e. SEQ ID NO: 248). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ϯϬ^ ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-31 (i.e. SEQ ID NOs: 242 and 248, respectively). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 243, 244 and 245, ϭϲ^ ^ respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 249, 250 and 251, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence ϱ^ identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-31 (i.e. SEQ ID NOs: 242 and 248, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 242 and 248, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, ϭϬ^ IgG2, IgG3 or IgG4) or IgM constant region. The heavy chain domain of BA.4/5-31 is derived from a IGHV4-39 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below). Hence, an antibody of theϭϱ^ invention may comprise the heavy chain of BA.4/5-31, and not the light chain of BA.4/5- 31. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 243, 244 and 245, respectively. The antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% ϮϬ^ sequence identity to the heavy chain variable domain of antibody BA.4/5-31 (i.e. SEQ ID NO: 242). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 242. Alternatively, in an embodiment of the invention, the antibody may comprise the light chain of BA.4/5-31, and not the heavy chain of BA.4/5-31. For example, the Ϯϱ^ antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 249, 250 and 251, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-31 (i.e. SEQ ID NO: 248). The antibody may ϯϬ^ comprise a light chain variable domain comprising or consisting of SEQ ID NO: 248. In one embodiment, the antibody in Table 1 may be BA.4/5-34. BA.4/5-34 was found to neutralise the SARS-CoV-2 variant strains Victoria, Alpha, Beta, Gamma, Delta, BA.4/BA.5, BA.4.6, BA.5.9, BA.2.75, BA.2.10.4, BA.2.75.2, BF.7, BA.2.3.20, BN.1, BQ.1, BQ.1.1+A475V, BQ1.1, XBB, CA.3.1, XBB.1, CH.1.1, XBF, XBB.1.5 and DS.1 ϭϳ^ ^ with an IC50 of ^ 0.1 μg/ml and the SARS-CoV-2 variant strains XBF, CH.1.1, BQ.1.1, BF.7, XBB, XBB.1 and XBB.1.5 with an IC50 of ^ 0.05 μg/ml. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 279, 280 and 281, respectively, and a CDRL1, ϱ^ CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 285, 286 and 287, respectively. In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 278). In one embodiment, ϭϬ^ an antibody of the invention may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 284). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain comprising or consisting of ϭϱ^ an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody BA.4/5-34 (i.e. SEQ ID NOs: 278 and 284, respectively). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain comprising a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in ϮϬ^ SEQ ID NOs: 279, 280 and 281, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 285, 286 and 287, respectively, wherein the heavy chain variable domain and the light chain variable domain comprises or consists of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain and light chain Ϯϱ^ variable domain, respectively, of antibody BA.4/5-34 (i.e. SEQ ID NOs: 278 and 284, respectively). In one embodiment, the antibody may be a full-length antibody, for example, the antibody may comprise a heavy chain variable domain and a light chain variable domain as set out in SEQ ID NOs: 278 and 284, respectively, and a constant region, such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region. ϯϬ^ The heavy chain domain of BA.4/5-34 is derived from a IGHV1-69 v-region, and the inventors have previously demonstrated that switching of the heavy chains and light chains between antibodies derived from the same v-region results in an antibody that is particularly useful with the invention (explained further below). Hence, an antibody of the invention may comprise the heavy chain of BA.4/5-34, and not the light chain of BA.4/5- ϭ^^ ^ 34. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 279, 280 and 281, respectively. The antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% ϱ^ sequence identity to the heavy chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 278). The antibody may comprise a heavy chain variable domain comprising or consisting of SEQ ID NO: 278. Alternatively, in an embodiment of the invention, the antibody may comprise the light chain of BA.4/5-34, and not the heavy chain of BA.4/5-34. For example, the ϭϬ^ antibody may comprise a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 285, 286 and 287, respectively. The antibody may comprise a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of antibody BA.4/5-34 (i.e. SEQ ID NO: 284). The antibody may ϭϱ^ comprise a light chain variable domain comprising or consisting of SEQ ID NO: 284. Mixed chain antibodies of the invention An antibody of the invention may comprise a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a first antibody in Table 1 and a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a second antibody ϮϬ^ in Table 1, with the proviso that the first and second antibodies are different. Such antibodies are referred to as mixed chain antibodies herein. Examples of the mixed chain antibodies useful with the invention are provided in Tables 3 to 9. Table 3 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV 4-39. Ϯϱ^ Table 4 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV3-30. Table 5 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV3-53. Table 6 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline ϯϬ^ heavy chain IGHV3-66. Table 7 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV3-53 and IGHV3-66. Table 8 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV1-69. ϭ^^ ^ Table 9 shows examples of mixed chain antibodies generated from antibodies in Table 1 that are derived from the same germline heavy chain IGHV3-9. Examples of mixed chain antibodies that are derived from the same germline heavy chain IGHV1-69 are BA.4/5- 22H+BA.4/5-34L and BA.4/5-34H+BA.4/5-22L. ϱ^ Hence, in one embodiment, an antibody of the invention comprises a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, with the proviso that the first and second antibodies are different. The antibody may comprise a heavy chain variable domain amino acid sequence having at least ϭϬ^ 80% sequence identity to the heavy chain variable domain from a first antibody in Table 1, and a light chain variable domain amino acid sequence having at least 80% sequence identity to the light chain variable domain from a second antibody in Table 1, with the proviso that the first and second antibodies are different. For example, the antibody may comprise a heavy chain variable domain comprising or consisting of an amino acid ϭϱ^ sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the heavy chain variable domain of an antibody in Table 1, and a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of an antibody in Table 1, with the proviso that the first and second antibodies are ϮϬ^ different. In some embodiments, an antibody of the invention comprises a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, and comprise a heavy chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or Ϯϱ^ 100% sequence identity to the heavy chain variable domain of the first antibody in Table 1, and a light chain variable domain comprising or consisting of an amino acid sequence having ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity to the light chain variable domain of the second antibody in Table 1, with the proviso that the first and second antibodies are different. ϯϬ^ The antibody in Table 1 may be selected from the group consisting of: BA.4/5-2, BA.4/5-1, BA.4/5-8, BA.4/5-22, BA.4/5-28, BA.4/5-31 and BA.4/5-34. In one embodiment, the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-1 and BA.4/5-31. The heavy chain variable domain of these antibodies are derived from^IGHV 4-39. The resulting mixed chain antibodies are ϮϬ^ ^ set out in Table 3. Hence, the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100%) sequence identity to the ϱ^ corresponding variable domain of any one of the mixed chain antibodies as set out in Table 3. In one embodiment, the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-2 and BA.4/5-12. The heavy chain variable domain of these antibodies are derived from^IGHV 3-30. The resulting mixed chain antibodies are ϭϬ^ set out in Table 4. Hence, the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100%) sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Tableϭϱ^ 4. In one embodiment, the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-6, BA.4/5-7, BA.4/5-17 and BA.4/5-23. The heavy chain variable domain of these antibodies are derived from^IGHV3-53. The resulting mixed chain antibodies are set out in Table 5. Hence, the antibody of the invention may ϮϬ^ comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 5. In one embodiment, the first antibody and the second antibody are both selected Ϯϱ^ from the group consisting of: BA.4/5-8, BA.4/5-10, BA.4/5-28 and BA.4/5-32. The heavy chain variable domain of these antibodies are derived from^IGHV3-66. The resulting mixed chain antibodies are set out in Table 6. Hence, the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid ϯϬ^ sequence having at least 80% sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 6. Antibodies derived from IGHV3-53 may be used to produce mixed-chain antibodies with antibodies from IGHV3-66 (see, e.g. Dejnirattisai, Wanwisa, et al. "The antigenic anatomy of SARS-CoV-2 receptor binding domain." Cell 184(8) (2021): 2183- Ϯϭ^ ^ 2200; Supasa, Piyada, et al. "Reduced neutralization of SARS-CoV-2 B.1.1.7 variant by convalescent and vaccine sera." Cell 184(8) (2021): 2201-2211; Zhou, Daming, et al. "Evidence of escape of SARS-CoV-2 variant B.1.351 from natural and vaccine-induced sera." Cell 184(9) (2021): 2348-2361; Dejnirattisai, Wanwisa, et al. "Antibody evasion by ϱ^ the P.1 strain of SARS-CoV-2." Cell 184(11) (2021): 2939-2954; Liu, Chang, et al. "Reduced neutralization of SARS-CoV-2 B.1.617 by vaccine and convalescent serum." Cell 184(16) (2021): 4220-4236)). Accordingly, in one embodiment, the first antibody is selected from the group consisting of BA.4/5-6, BA.4/5-7, BA.4/5-17 and BA.4/5-23, and the second antibody is selected from the group consisting of BA.4/5-8, BA.4/5-10, BA.4/5- ϭϬ^ 28 and BA.4/5-32. In an alternative embodiment, the first antibody is selected from the group consisting of BA.4/5-8, BA.4/5-10, BA.4/5-28 and BA.4/5-32, and the second antibody is selected from the group consisting of BA.4/5-6, BA.4/5-7, BA.4/5-17 and BA.4/5-23. The heavy chain variable domain of these antibodies are derived from^IGHV3- 53 and IGVH3-66. Examples of the resulting mixed chain antibodies are set out in Table ϭϱ^ 7. Hence, the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 7. ϮϬ^ In one embodiment, the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-13, BA.4/5-18, BA.4/5-22, BA.4/5-25 and BA.4/5- 34. The heavy chain variable domain of these antibodies are derived from^IGHV1-69. The resulting mixed chain antibodies are set out in Table 8. Hence, the antibody of the Ϯϱ^ invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100%)sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 8. ϯϬ^ In one embodiment, the first antibody and the second antibody are both selected from the group consisting of: BA.4/5-15, BA.4/5-20, BA.4/5-21 and BA.4/5-24. The heavy chain variable domain of these antibodies are derived from^IGHV3-9. The resulting mixed chain antibodies are set out in Table 9. Hence, the antibody of the invention may comprise all six CDRs (CDRH1-3 and CDRL1-3), and/or a heavy chain variable domain ϮϮ^ ^ and a light chain variable domain, each comprising or consisting of an amino acid sequence having at least 80% (e.g. ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100%) sequence identity to the corresponding variable domain of any one of the mixed chain antibodies as set out in Table 9. ϱ^ The constant region domains of an antibody molecule of the invention, if present, may be selected having regard to the proposed function of the antibody molecule, and in particular the effector functions which may be required. For example, the constant region domains may be human IgA, IgD, IgE, IgG or IgM domains. Typically, the constant regions are of human origin. In particular, human IgG (i.e. IgG1, IgG2, IgG3 or IgG4) ϭϬ^ constant region domains may be used. Typically, the constant region is a human IgG1 constant region. Properties of the antibodies of the invention An antibody of the invention may be or may comprise a modification from the amino acid sequence of an antibody in Tables 1 and 3 to 9, whilst maintaining the activity ϭϱ^ and/or function of the antibody. The modification may a substitution, deletion and/or addition. For example, the modification may comprise 1, 2, 3, 4, 5, up to 10, up to 20, up to 30 or more amino acid substitutions and/or deletions from the amino acid sequence of an antibody in Tables 1 and 3 to 9. For example, the modification may comprise an amino acid substituted with an alternative amino acid having similar properties. Some properties ϮϬ^ of the 20 main amino acids, which can be used to select suitable substituents, are as follows: Ala aliphatic, hydrophobic, neutral Met hydrophobic, neutral Cys polar, hydrophobic, neutral Asn polar, hydrophilic, neutral Asp polar, hydrophilic, charged (-) Pro hydrophobic, neutral Glu polar, hydrophilic, charged (-) Gln polar, hydrophilic, neutral Phe aromatic, hydrophobic, neutral Arg polar, hydrophilic, charged (+) Gly aliphatic, neutral Ser polar, hydrophilic, neutral His aromatic, polar, hydrophilic, Thr polar, hydrophilic, neutral charged (+) Ile aliphatic, hydrophobic, neutral Val aliphatic, hydrophobic, neutral Lys polar, hydrophilic, charged (+) Trp aromatic, hydrophobic, neutral Leu aliphatic, hydrophobic, neutral Tyr aromatic, polar, hydrophobic The modification may comprise a derivatised amino acid, e.g. a labelled or non- natural amino acid, providing the function of the antibody is not significantly adversely Ϯϱ^ affected. Ϯϯ^ ^ Modification of antibodies of the invention as described above may be prepared during synthesis of the antibody or by post-production modification, or when the antibody is in recombinant form using the known techniques of site-directed mutagenesis, random mutagenesis, or enzymatic cleavage and/or ligation of nucleic acids. ϱ^ Antibodies of the invention may be modified (e.g. as described above) to improve the potency of said antibodies or to adapt said antibodies to new SARS-CoV-2 variants. The modifications may be amino acid substitutions to adapt the antibody to substitutions in a virus variant. For example, the known mode of binding of an antibody to the spike protein (e.g. by crystal structure determination, or modelling) may be used to identify the ϭϬ^ amino acids of the antibody that interact with the substitution in the virus variant. This information can then be used to identify possible substitutions of the antibody that will compensate for the change in the epitope characteristics. For example, a substitution of a hydrophobic amino acid in the spike protein to a negatively changes amino acid may be compensated by substituting the amino acid from the antibody that interacts with said ϭϱ^ amino acid in the spike protein to a positively charged amino acid. Methods for identifying residues of an antibody that may be substituted are encompassed by the present disclosure, for example, by determining the structure of antibody-antigen complexes as described herein. The antibodies of the invention may contain one or more modifications to increase ϮϬ^ their cross-lineage neutralisation property. For example, E484 of the spike protein, which is a key residue that mediates the interaction with ACE2, is mutated in almost all currently circulating SARS-CoV-2 strains (see e.g. Figure 6, demonstrating that the Victoria, Delta and Gamma strains comprise E484 and that all remaining strains shown comprise an E484K, E484A or E484R mutation) resulting in differing neutralisation effects of the Ϯϱ^ antibodies. Thus, antibodies that bind to E484 can be modified to compensate for the changes in E484 of the spike protein. For example, E484 is mutated from a negatively charged amino acid in the Victoria strain to a positively charged amino acid in the BA.2.3.20 SARs-CoV-2 strain. The amino acid residues of antibodies that bind to or near E484 may be mutated to compensate for the change in charge. ϯϬ^ Antibodies of the invention may be isolated antibodies. A composition consisting of an isolated antibody is substantially free of other antibodies having different antigenic specificities. The term 'antibody' as used herein may relate to whole antibodies (i.e. comprising the elements of two heavy chains and two light chains inter-connected by disulphide Ϯϰ^ ^ bonds) as well as antigen-binding fragments thereof. Antibodies typically comprise immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. By "specifically binds" or "immunoreacts with", it is meant that the antibody reacts with one ϱ^ or more antigenic determinants of the desired antigen and does not react with other polypeptides. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and at least one heavy chain constant region. Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The variable regions of the heavy and light chains contain a binding ϭϬ^ domain that interacts with an antigen. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, dAb (domain antibody), single chain, Fab, Fab’ and F(ab’)2 fragments, scFvs, and Fab ϭϱ^ expression libraries An antibody of the invention may be a monoclonal antibody. Monoclonal antibodies (mAbs) of the invention may be produced by a variety of techniques, including conventional monoclonal antibody methodology, for example those disclosed in “Monoclonal Antibodies: a manual of techniques” (Zola H, 1987, CRC Press) and in ϮϬ^ “Monoclonal Hybridoma Antibodies: techniques and applications” (Hurrell JGR, 1982 CRC Press). An antibody of the invention may be multispecific, such as bispecific. A bispecific antibody of the invention binds two different epitopes. The epitopes may be in the same protein (e.g. two epitopes in spike protein of SARS-CoV-2) or different proteins (e.g. oneϮϱ^ epitope in spike protein and one epitope in another protein (such as coat protein) of SARS- CoV-2). In one embodiment, a bispecific antibody of the invention may bind to two separate epitopes on the spike protein of SARS-CoV-2. The bispecific antibody may bind to the NTD of the spike protein and to the RBD of the spike protein. The bispecific antibody ϯϬ^ may bind to two different epitopes in the RBD of the spike protein. One or more (e.g. two) antibodies of the invention can be coupled to form a multispecific (e.g. bispecific) antibody. Methods to prepare multispecific, e.g. bispecific, antibodies are well known in the art. Ϯϱ^ ^ An antibody may be selected from the group consisting of single chain antibodies, single chain variable fragments (scFvs), variable fragments (Fvs), fragment antigen- binding regions (Fabs), recombinant antibodies, monoclonal antibodies, fusion proteins comprising the antigen-binding domain of a native antibody or an aptamer, single-domain ϱ^ antibodies (sdAbs), also known as VHH antibodies, nanobodies (Camelid-derived single- domain antibodies), shark IgNAR-derived single-domain antibody fragments called VNAR, diabodies, triabodies, Anticalins, aptamers (DNA or RNA) and active components or fragments thereof. The constant region domains of an antibody molecule of the invention, if present, ϭϬ^ may be selected having regard to the proposed function of the antibody molecule, and in particular the effector functions which may be required. For example, the constant region domains may be human IgA, IgD, IgE, IgG or IgM domains. Typically, the constant regions are of human origin. In particular, human IgG (i.e. IgG1, IgG2, IgG3 or IgG4) constant region domains may be used. Typically, the constant region is a human IgG1 ϭϱ^ constant region. The light chain constant region may be either lambda or kappa. Antibodies of the invention may be mono-specific or multi-specific (e.g. bi- specific). A multi-specific antibody comprises at least two different variable domains, wherein each variable domain is capable of binding to a separate antigen or to a different ϮϬ^ epitope on the same antigen. An antibody of the invention may be a chimeric antibody, a CDR-grafted antibody, a nanobody, a human or humanised antibody. Typically, the antibody is a human antibody. Fully human antibodies are those antibodies in which the variable regions and the constant regions (where present) of both the heavy and the light chains are all of human origin, or Ϯϱ^ substantially identical to sequences of human origin, but not necessarily from the same antibody. The antibody of the invention may be a full-length antibody. For example, the antibody may comprise a heavy chain variable domain of an antibody in Table 1 or 3 to 9, a light chain variable domain of an antibody in Table 1 or 3 to 9, and a constant region, ϯϬ^ such as an IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3 or IgG4) or IgM constant region. The antibody of the invention may be an antigen-binding fragment. An antigen- binding fragment of the invention binds to the same epitope of the parent antibody, i.e. the antibody from which the antigen-binding fragment is derived. An antigen-binding fragment of the invention typically retains the parts of the parent antibody that interact with Ϯϲ^ ^ the epitope. The antigen-binding fragment typically comprise the complementarity- determining regions (CDRs) that interact with the antigen, such as one, two, three, four, five or six CDRs. In some embodiments, the antigen-binding fragment further comprises the structural scaffold surrounding the CDRs of the parent antibody, such as the variable ϱ^ region domains of the heavy and/or light chains. Typically, the antigen-binding fragment retains the same or similar binding affinity to the antigen as the parent antibody. An antigen-binding fragment does not necessarily have an identical sequence to the parent antibody. In one embodiment, the antigen-binding fragment may have ^70%, ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity with the ϭϬ^ respective CDRs of the parent antibody. In one embodiment, the antigen-binding fragment may have ^70%, ^80%, ^90%, ^95%, ^96%, ^97%, ^98%, ^99% or 100% sequence identity with the respective variable region domains of the parent antibody. Typically, the non-identical amino acids of a variable region are not in the CDRs. The antigen-binding fragments of antibodies of the invention retain the ability to ϭϱ^ selectively bind to an antigen. Antigen-binding fragments of antibodies include single chain antibodies (i.e. a full-length heavy chain and light chain); Fab, modified Fab, Fab', modified Fab', F(ab')2, Fv, Fab-Fv, Fab-dsFv, single domain antibodies (e.g. VH or VL or VHH), scFv. An antigen-binding function of an antibody can be performed by fragments of a ϮϬ^ full-length antibody. The methods for creating and manufacturing these antibody fragments are well known in the art (see for example Verma R et al., 1998, J. Immunol. Methods, 216, 165-181). Methods for screening antibodies of the invention that do not share 100% amino acid sequence identity with one of the antibodies disclosed herein, that possess the desired Ϯϱ^ specificity, affinity and functional activity include the methods described herein, e.g. enzyme linked immunosorbent assays, biacore, focus reduction neutralisation assay (FRNT), and other techniques known within the art. With regards to function, an antibody of the invention may be able to neutralise at least one biological activity of SAR-CoV-2 (a neutralising antibody), particularly to ϯϬ^ neutralise virus infectivity. Neutralisation may also be determined using IC50 or IC90 values. For example, the antibody may have an IC50 value of ^0.1μg/ml, ^0.05μg/ml, ^0.01μg/ml ^0.005μg/ml or ^0.002μg/ml. In some instances an antibody of the invention may have an IC50 value of Ϯϳ^ ^ between 0.0001 μg/ml and 0.1 μg/ml, sometimes between 0.0001μg/ml and 0.05 μg/ml or even between 0.0001 μg/ml and 0.001 μg/ml. For example, the IC50 values of some of the antibodies of Table 1 are provided in Figure 2A and Figure 2B. ϱ^ The ability of an antibody to neutralise virus infectivity may be measured using an appropriate assay, particularly using a cell-based neutralisation assay, as is known in the art. For example, the neutralisation ability may be measured in a focus reduction neutralisation assay (FRNT) where the reduction in the number of cells (e.g. human cells) infected with the virus (e.g. for 2 hours at 37 ºC) in the presence of the antibody is ϭϬ^ compared to a negative control in which no antibodies were added. An antibody of the invention may block the interaction between the spike protein of SAR-CoV-2 with the cell surface receptor, angiotensin-converting enzyme 2 (ACE2), of the target cell, e.g. by direct blocking or by disrupting the pre-fusion conformation of the spike protein. ϭϱ^ Blocking of the interaction between spike and ACE2 can be total or partial. For example, an antibody of the invention may reduce spike-ACE2 formation by ^50%, ^60%, ^70%, ^80%, ^90%, ^95%, ^99% or 100%. Blocking of spike-ACE2 formation can be measured by any suitable means known in the art, for example, by ELISA. Most antibodies showing neutralisation also showed blocking of the interaction ϮϬ^ between the spike protein and ACE2. Furthermore, a number of non-neutralising antibodies are good ACE2 blockers. In terms of binding kinetics, an antibody of the invention may have an affinity constant (KD) value for the spike protein of SARS-CoV-2 of ^5nM, ^4nM, ^3nM, ^2nM, ^1nM, ^0.5nM, ^0.4nM, ^0.3nM, ^0.2nM or ^0.1nM. Ϯϱ^ The KD value can be measured by any suitable means known in the art, for example, by ELISA or Surface Plasmon Resonance (Biacore) at 25 °C. Binding affinity (KD) may be quantified by determining the dissociation constant (Kd) and association constant (Ka) for an antibody and its target. For example, the antibody may have an association constant (Ka) of ^ 10000 M-1s-1 , ^ 50000 M-1s-1, ^ϯϬ^ 100000 M-1s-1, ^ 200000 M-1s-1 or ^ 500000 M-1s-1, and/or a dissociation constant (Kd) of ^ 0.001 s-1, ^ 0.0005 s-1, ^ 0.004 s-1, ^ 0.003 s-1, ^ 0.002 s-1 or ^ 0.0001 s-1. An antibody of the invention is preferably able to provide in vivo protection in coronavirus (e.g. SARS-CoV-2) infected animals. For example, administration of an antibody of the invention to coronavirus (e.g. SARS-CoV-2) infected animals may result in Ϯ^^ ^ a survival rate of ^30%, ^40%, ^50%, ^60%, ^70%, ^80%, ^90%, ^95% or 100%. Survival rates may be determined using routine methods. Antibodies of the invention may have any combination of one or more of the above properties. ϱ^ Antibodies of the invention may bind to the same epitope as, or compete for binding to SARS-CoV-2 spike protein with, any one of the antibodies described herein (i.e. in particular with antibodies with the heavy and light chain variable regions described above). Methods for identifying antibodies binding to the same epitope, or cross- competing with one another, are used in the Examples and discussed further below. ϭϬ^ Fc regions An antibody of the invention may or may not comprise an Fc domain. The antibodies of the invention may be modified in the Fc region in order to improve their stability. Such modifications are known in the art. Modifications may improve the stability of the antibody during storage of the antibody. The in vivo half-life ϭϱ^ of the antibody may be improved by modifications of the Fc-region. For example, cysteine residue(s) can be introduced into the Fc region, thereby allowing interchain disulphide bond formation in this region. The homodimeric antibody thus generated can have improved internalization capability and/or increased complement- mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). (See Caron et ϮϬ^ al., J. Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-2922 (1992)). Alternatively, an antibody can be engineered that has dual Fc regions and can thereby have enhanced complement lysis and ADCC capabilities. (See Stevenson et al., Anti-Cancer Drug Design, 3: 219-230 (1989)). For example, an antibody of the invention may be modified to promote the Ϯϱ^ interaction of the Fc domain with FcRn. The Fc domain may be modified to improve the stability of the antibody by affecting Fc and FcRn interaction at low pH, such as in the endosome. The M252Y/S254T/T256E (YTE) mutation may be used to improve the half- life of an IgG1 antibody. The antibody may be modified to affect the interaction of the antibody with other ϯϬ^ receptors, such as FcȖRI, FcȖRIIA, FcȖRIIB, FcȖRIII, and FcĮR. Such modifications may be used to affect the effector functions of the antibody. In one embodiment, an antibody of the invention comprises an altered Fc domain as described herein below. In another preferred embodiment an antibody of the invention Ϯ^^ ^ comprises an Fc domain, but the sequence of the Fc domain has been altered to modify one or more Fc effector functions. In one embodiment, an antibody of the invention comprises a “silenced” Fc region. For example, in one embodiment an antibody of the invention does not display the effector ϱ^ function or functions associated with a normal Fc region. An Fc region of an antibody of the invention does not bind to one or more Fc receptors. In one embodiment, an antibody of the invention does not comprise a CH2 domain. In one embodiment, an antibody of the invention does not comprise a CH3 domain. In one embodiment, an antibody of the invention comprises additional CH2 and/or CH3 domains. ϭϬ^ In one embodiment, an antibody of the invention does not bind Fc receptors. In one embodiment, an antibody of the invention does not bind complement. In an alternative embodiment, an antibody of the invention does not bind FcȖR, but does bind complement. In one embodiment, an antibody of the invention in general may comprise modifications that alter serum half-life of the antibody. Hence, in another embodiment, an ϭϱ^ antibody of the invention has Fc region modification(s) that alter the half-life of the antibody. Such modifications may be present as well as those that alter Fc functions. In one preferred embodiment, an antibody of the invention has modification(s) that alter the serum half-life of the antibody. In one embodiment, an antibody of the invention may comprise a human constant ϮϬ^ region, for instance IgA, IgD, IgE, IgG or IgM domains. In particular, human IgG constant region domains may be used, especially of the IgG1 and IgG3 isotypes when the antibody molecule is intended for therapeutic uses where antibody effector functions are required. Alternatively, IgG2 and IgG4 isotypes may be used when the antibody molecule is intended for therapeutic purposes and antibody effector functions are not required. Ϯϱ^ In one embodiment, the antibody heavy chain comprises a CH1 domain and the antibody light chain comprises a CL domain, either kappa or lambda. In one embodiment, the antibody heavy chain comprises a CH1 domain, a CH2 domain and a CH3 domain and the antibody light chain comprises a CL domain, either kappa or lambda. The four human IgG isotypes bind the activating FcȖ receptors (FcȖRI, FcȖRIIa, ϯϬ^ FcKRIIc, FcȖRIIIa), the inhibitory FcȖRIIb receptor, and the first component of complement (C1q) with different affinities, yielding very different effector functions (Bruhns P. et al., 2009. Specificity and affinity of human FcȖ receptors and their polymorphic variants for human IgG subclasses. Blood. 113(16):3716-25), see also Jeffrey B. Stavenhagen, et al. Cancer Research 2007 Sep 15; 67(18):8882-90. In one ϯϬ^ ^ embodiment, an antibody of the invention does not bind to Fc receptors. In another embodiment of the invention, the antibody does bind to one or more type of Fc receptors. In one embodiment the Fc region employed is mutated, in particular a mutation described herein. In one embodiment the Fc mutation is selected from the group ϱ^ comprising a mutation to remove or enhance binding of the Fc region to an Fc receptor, a mutation to increase or remove an effector function, a mutation to increase or decrease half-life of the antibody and a combination of the same. In one embodiment, where reference is made to the impact of a modification it may be demonstrated by comparison to the equivalent antibody but lacking the modification. ϭϬ^ Some antibodies that selectively bind FcRn at pH 6.0, but not pH 7.4, exhibit a higher half-life in a variety of animal models. Several mutations located at the interface between the CH2 and CH3 domains, such as T250Q/M428L (Hinton PR. et al., 2004. Engineered human IgG antibodies with longer serum half-lives in primates. J Biol Chem. 279(8):6213-6) and M252Y/S254T/T256E + H433K/N434F (Vaccaro C. et al., 2005. ϭϱ^ Engineering the Fc region of immunoglobulin G to modulate in vivo antibody levels. Nat Biotechnol. 23(10):1283-8), have been shown to increase the binding affinity to FcRn and the half-life of IgG1 in vivo. Hence, modifications may be present at M252/S254/T256 + H44/N434 that alter serum half-life and in particular M252Y/S254T/T256E + H433K/N434F may be present. In one embodiment, it is desired to increase half-life. In ϮϬ^ another embodiment, it may be actually desired to decrease serum half-life of the antibody and so modifications may be present that decrease serum half-life. Numerous mutations have been made in the CH2 domain of human IgG1 and their effect on ADCC and CDC tested in vitro (Idusogie EE. et al., 2001. Engineered antibodies with increased activity to recruit complement. J Immunol. 166(4):2571-5). Notably, Ϯϱ^ alanine substitution at position 333 was reported to increase both ADCC and CDC. Hence, in one embodiment a modification at position 333 may be present, and in particular one that alters ability to recruit complement. Lazar et al. described a triple mutant (S239D/I332E/A330L) with a higher affinity for FcȖRIIIa and a lower affinity for FcȖRIIb resulting in enhanced ADCC (Lazar GA. et al., 2006). Hence, modifications at ϯϬ^ S239/I332/A330 may be present, particularly those that alter affinity for Fc receptors and in particular S239D/I332E/A330L . Engineered antibody Fc variants with enhanced effector function. PNAS 103(11): 4005–4010). The same mutations were used to generate an antibody with increased ADCC (Ryan MC. et al., 2007. Antibody targeting of B-cell maturation antigen on malignant plasma cells. Mol. Cancer Ther., 6: 3009 – 3018). ϯϭ^ ^ Richards et al. studied a slightly different triple mutant (S239D/I332E/G236A) with improved FcȖRIIIa affinity and FcȖRIIa/FcȖRIIb ratio that mediates enhanced phagocytosis of target cells by macrophages (Richards JO et al 2008. Optimization of antibody binding to Fcgamma RIIa enhances macrophage phagocytosis of tumor cells. Mol ϱ^ Cancer Ther. 7(8):2517-27). In one embodiment, S239D/I332E/G236A modifications may be therefore present. In another embodiment, an antibody of the invention may have a modified hinge region and/or CH1 region. Alternatively, the isotype employed may be chosen as it has a particular hinge regions. ϭϬ^ Major public V regions Public V-regions, also described as public V-genes herein, are the V regions of the germline heavy chain and light chain regions that are found in a large proportion of the antibody responses to SARS-CoV-2 found within the population. In this application, the V regions are specific responses to the original BA.4/5 SARS-CoV-2 variant. That is to say, ϭϱ^ many individuals utilise the same v-regions from their germline v-region repertoire when generating an immune response to SARS-CoV-2 variants. As used herein, an antibody “derived” from a specific v-region refers to antibodies that were generated by V(D)J recombination using that germline v-region sequence. For example, the germline IGHV1-69 v-region sequence may undergo somatic recombination ϮϬ^ and somatic mutation to arrive at an antibody that specifically binds to the spike protein of SARS-CoV-2. The nucleotide sequence encoding the antibody does not comprise a sequence identical to the IGHV1-69 germline sequence, nevertheless, the antibody is still derived from this v-region. An antibody of the invention typically comprises no more than 20 non-silent mutations in the v-region, when compared to the germline sequence, such as Ϯϱ^ no more than 17 non-silent mutations. An antibody of the invention typically comprises between 5-20 non-silent mutations in the v-region, when compared to the germline sequence, such as between 6-18, 7-17 and 8-15 non-silent mutations. An antibody of the invention typically comprises between 5-15 amino acid changes in the v-region, when compared to the amino acid sequence encoded by the germline sequence, such as between ϯϬ^ 6-14 and 7-12 amino acid changes. Germline v-region sequences are well known in the art, and methods of identifying whether a certain region of an antibody is derived from a particular germline v-region sequence are also well known in the art. ϯϮ^ ^ In one embodiment, an antibody of the invention derives from a v-region selected from IGHV4-39, IGHV3-30, IGHV3-53, IGHV3-66, IGHV1-46, IGHV3-33, IGHV3-9, IGHV1-69 or IGHV3-23. The inventors found that the potent neutralising antibodies identified herein comprised non-silent mutations in the CDRs of these v-regions, as set out ϱ^ in Table 2. Thus, in one embodiment, an antibody of the invention is encoded by a v- region selected from IGHV4-39, IGHV3-30, IGHV3-53, IGHV3-66, IGHV1-46, IGHV3- 33, IGHV3-9, IGHV1-69 or IGHV3-23 and having 5-20 non-silent nucleotide mutations, such as 6-18, 7-17 and 8-15 non-silent mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded ϭϬ^ by a v-region selected from IGHV1-69 and having 10-20 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region selected from IGHV3-66 and having 2- 15 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region ϭϱ^ selected from IGHV3-53 and having 8-18 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region selected from IGHV3-9 and having 7-13 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region selected from IGHV3- ϮϬ^ 30 and having 10-16 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. In one embodiment, an antibody of the invention is encoded by a v-region selected from IGHV4-39 and having 5-6 non-silent nucleotide mutations, when compared to the naturally occurring germline sequence. A silent mutation is defined herein is a change in the nucleotide sequence without aϮϱ^ change in the amino acid sequence for which the nucleotide sequence encodes. A non- silent mutation is therefore a mutation that leads to a change in the amino acid sequence encoded by the nucleotide sequence. The inventors have surprisingly found that the light chain variable region of two antibodies having the same heavy chain v-region may be exchanged to produce a mixed- ϯϬ^ chain antibody comprising the heavy chain variable region of a first antibody and the light chain variable region of a second antibody. For example, the two antibodies may both comprise a heavy chain variable region derived from IGHV3-53. Preferably, both antibodies also comprise a light chain variable region derived from the same light chain v- region, although this is not essential because, for example, the light chain of some ϯϯ^ ^ antibodies having a heavy chain variable region derived from IGHV3-53 may be matched with any heavy chain variable region derived from IGHV3-53 and lead to a potent neutralising antibody. As described above, the two antibodies may comprise a heavy chain variable region derived from IGHV3-53 and/or IGHV3-66. ϱ^ In one embodiment, an antibody of the invention comprises the CDRs of an heavy chain variable domain of an antibody derived from a major public v-region selected from IGHV1-69, IGHV3-9, IGHV3-53/3-66, IGHV3-30 and IGHV4-39, such as antibodies BA.4/5-1 and BA.4/5-31 for IGHV4-39, antibodies BA.4/5-2 and BA.4/5-12 for IGHV3- 30, antibodies BA.4/5-6, BA.4/5-7, BA.4/5-17, BA.4/5-23, BA.4/5-8, BA.4/5-10, BA.4/5- ϭϬ^ 28 and BA.4/5-32 for IGHV3-53/3-66, antibodies BA.4/5-13, BA.4/5-18, BA.4/5-22, BA.4/5-25 and BA.4/5-34 for IGHV1-69, or antibodies BA.4/5-15, BA.4/5-20, BA.4/5-21 and BA.4/5-24 for IGHV3-9. The SEQ ID NOs corresponding to the CDRs of each of these antibodies are shown in Table 1. In one embodiment, an antibody of the invention comprises the heavy chain ϭϱ^ variable domain of an antibody derived from a major public v-region selected from IGHV1-69, IGHV3-9, IGHV3-53/3-66, IGHV3-30 and IGHV4-39, such as antibodies BA.4/5-1 and BA.4/5-31 for IGHV4-39, antibodies BA.4/5-2 and BA.4/5-12 for IGHV3- 30, antibodies BA.4/5-6, BA.4/5-7, BA.4/5-17, BA.4/5-23, BA.4/5-8, BA.4/5-10, BA.4/5- 28 and BA.4/5-32 for IGHV3-53/3-66, antibodies BA.4/5-13, BA.4/5-18, BA.4/5-22, ϮϬ^ BA.4/5-25 and BA.4/5-34 for IGHV1-69, or antibodies BA.4/5-15, BA.4/5-20, BA.4/5-21 and BA.4/5-24 for IGHV3-9. The SEQ ID NOs corresponding to the CDRs of each of these antibodies are shown in Table 1. In one embodiment, the invention provides a method of generating an antibody that binds specifically to the spike protein of SARS-CoV-2 (e.g. a SARS-CoV-2 strain of the Ϯϱ^ Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.10.4, BA.2.12.1, BA.2.30.2, BA.2.75, BA.2.75.2, BA.4/5, BA.4.6, BQ.1, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, XBB, XBB.1 and/or XBB.1.5), the method comprising identifying two or more antibodies derived from the same light chain and/or heavy chain v-regions, replacing the light chain of a first antibody with the light chain of a second antibody, to thereby generate a mixed- ϯϬ^ chain antibody comprising the heavy chain of the first antibody and the light chain of the second antibody. In one embodiment, the method further comprises determining the affinity for and/or neutralisation of SARS-CoV-2 of the mixed-chain antibody. The method may further comprise comparing the affinity of the mixed-chain antibody with that ϯϰ^ ^ of the first and/or second antibodies. The method may further comprise selecting a mixed chain antibody that has the same or greater affinity than the first and/or second antibodies. In another embodiment, the invention provides an antibody that specifically binds to the BA.4/5 variant of SARS-CoV-2, wherein the antibody has a v-region derived from ϱ^ IGHV1-69, IGHV3-9, IGHV3-53 or IGHV3-66. It has been surprisingly discovered that antibody responses to infection with the BA.4/5 variant of SARS-CoV-2 is biased towards antibodies with a heavy chain variable region derived from IGHV1-69, IGHV3-9, IGHV3- 53 or IGHV3-66. In one embodiment, wherein the antibody heavy chain is derived from IGHV1-69, the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 ϭϬ^ from BA.4/5-13, BA.4/5-18, BA.4/5-22, BA.4/5-25 or BA.4/5-34. In one embodiment, wherein the antibody heavy chain is derived from IGHV3-9, the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 from BA.4/5-15, BA.4/5-20, BA.4/5-21 or BA.4/5-24. In one embodiment, wherein the antibody heavy chain is derived from IGHV3-53, the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 ϭϱ^ from BA.4/5-6, BA.4/5-7, BA.4/5-17 or BA.4/5-23. In one embodiment, wherein the antibody heavy chain is derived from IGHV3-66, the antibody of the invention comprises the CDRH1, CDRH2 and CDRH3 from BA.4/5-8, BA.4/5-10, BA.4/5-28 or BA.4/5-32. Antibody conjugates The invention also pertains to immunoconjugates comprising an antibody ϮϬ^ conjugated to a cytotoxic agent such as a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate). Conjugates of the antibody and cytotoxic agent may be made using a variety of bifunctional protein-coupling agents known in the art. An antibody, of the invention may be conjugated to a molecule that modulates or Ϯϱ^ alters serum half-life. An antibody, of the invention may bind to albumin, for example in order to modulate the serum half-life. In one embodiment, an antibody of the invention will also include a binding region specific for albumin. In another embodiment, an antibody of the invention may include a peptide linker which is an albumin binding peptide. Examples of albumin binding peptides are included in WO2015/197772 and WO2007/106120 the ϯϬ^ entirety of which are incorporated by reference. ^ ϯϱ^ ^ Polynucleotides, vectors and host cells The invention also provides one or more isolated polynucleotides (e.g. DNA) encoding the antibody of the invention. In one embodiment, the polynucleotide sequence is collectively present on more than one polynucleotide, but collectively together they are ϱ^ able to encode an antibody of the invention. For example, the polynucleotides may encode the heavy and/or light chain variable regions(s) of an antibody of the invention. The polynucleotides may encode the full heavy and/or light chain of an antibody of the invention. Typically, one polynucleotide would encode each of the heavy and light chains. Hence, the invention provides a first polynucleotide encoding the heavy chain variable ϭϬ^ domain of an antibody of the invention and a second polynucleotide encoding the light chain variable domain of said antibody. The invention also provides a polynucleotide encoding the heavy chain variable domain and the light chain variable domain of an antibody according to the invention. Polynucleotides which encode an antibody of the invention can be obtained by ϭϱ^ methods well known to those skilled in the art. For example, DNA sequences coding for part or all of the antibody heavy and light chains may be synthesised as desired from the corresponding amino acid sequences. General methods by which the vectors may be constructed, transfection methods and culture methods are well known to those skilled in the art. In this respect, reference is ϮϬ^ made to “Current Protocols in Molecular Biology”, 1999, F. M. Ausubel (ed), Wiley Interscience, New York and the Maniatis Manual produced by Cold Spring Harbor Publishing. A polynucleotide of the invention may be provided in the form of an expression cassette, which includes control sequences operably linked to the inserted sequence, thus Ϯϱ^ allowing for expression of the antibody of the invention in vivo. Hence, the invention also provides one or more expression cassettes encoding the one or more polynucleotides that encoding an antibody of the invention. These expression cassettes, in turn, are typically provided within vectors (e.g. plasmids or recombinant viral vectors). Hence, in one embodiment, the invention provides a vector encoding an antibody of the invention. In ϯϬ^ another embodiment, the invention provides vectors which collectively encode an antibody of the invention. The vectors may be cloning vectors or expression vectors. A suitable vector may be any vector which is capable of carrying a sufficient amount of genetic information, and allowing expression of a polypeptide of the invention. ϯϲ^ ^ The polynucleotides, expression cassettes or vectors of the invention are introduced into a host cell, e.g. by transfection. Hence, the invention also provides a host cell comprising the one or more polynucleotides, expression cassettes or vectors of the invention. The polynucleotides, expression cassettes or vectors of the invention may be ϱ^ introduced transiently or permanently into the host cell, allowing expression of an antibody from the one or more polynucleotides, expression cassettes or vectors. Such host cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, lower eukaryotic cells, such as yeast, or prokaryotic cells, such as bacteria cells. Particular examples of cells include mammalian HEK293, such as HEK293F, ϭϬ^ HEK293T, HEK293S or HEK Expi293F, CHO, HeLa, NS0 and COS cells, or any other cell line used herein, such as the ones used in the Examples. Preferably the cell line selected will be one which is not only stable, but also allows for mature glycosylation. The invention also provides a process for the production of an antibody of the invention, comprising culturing a host cell containing one or more vectors of the invention ϭϱ^ under conditions suitable for the expression of the antibody from the one or more polynucleotides of the invention, and isolating the antibody from said culture. Combination of antibodies Certain Table 1 antibodies may be particularly effective when used in combination, e.g. to minimise loss of activity due to SARS-CoV-2 variants, maximise therapeutic effects ϮϬ^ and/or increase diagnostic power. Useful combinations include antibodies that do not cross-compete with one another and/or bind to non-overlapping epitopes. Thus, the invention provides a combination of the antibodies of the invention, wherein each antibody is capable of binding to the spike protein of coronavirus SARS- CoV-2, wherein at least one antibody comprises all six CDRs of an antibody in Table 1. Ϯϱ^ The invention also provides a combination of antibodies, comprising a first antibody which is an antibody according to the invention, in combination with at least one further antibody that does not compete with the first antibody for binding to the spike protein of coronavirus SARS-CoV-2. The first and the at least one further antibodies may bind to different epitopes in the same domain, or may bind to epitopes in different domains ϯϬ^ in the spike protein. For example, the first antibody may bind to the RBD domain and the at least one further antibody may bind to the NTD of the spike protein. Alternatively, the first antibody may bind to the NTD domain and the at least one further antibody may bind to the RBD of the spike protein. ϯϳ^ ^ A combination of the antibodies of the invention may be useful as a therapeutic cocktail. Hence, the invention also provides a pharmaceutical composition comprising a combination of the antibodies of the invention. This is because a new SARS-CoV-2 variant may circulate that is not neutralised by a first of the antibodies in the cocktail but is ϱ^ neutralised by a second antibody in the cocktail, whilst the converse may be true for a further SARS-CoV-2 variant that circulates. Thus, a cocktail of antibodies of the invention may provide a more robust treatment for SARS-CoV-2 than a single antibody of the invention alone. A combination of the antibodies of the invention may be useful for diagnosis. ϭϬ^ Hence, the invention also provides a diagnostic kit comprising a combination of the antibodies of the invention. Also provided herein are methods of diagnosing a disease or complication associated with coronavirus infections in a subject, as explained further below. A fully cross-neutralising antibody, e.g. BA.4/5-2, may be used as a reference to ϭϱ^ confirm the presence and/or amount of any variants of concern (VoC) SARS-CoV-2 in the sample. An antibody that binds to a limited number of VoCs may be used to confirm the presence and/or amount of that VoC in the sample. For example, if BA.4/5-2 exhibits binding to the sample but BA.4/5-8 does not exhibit binding to the sample of SARS-CoV- 2, then the spike protein may be the spike protein of the BN.1 VoC. This may be ϮϬ^ determined by any method known to the skilled person, such as via an immunoassay, e.g. an ELISA or an immunochromatographic assay. Reduced binding may be determined by comparison and/or normalisation to the reference, and/or by comparison to positive/negative control samples or data. Pharmaceutical composition Ϯϱ^ The invention provides a pharmaceutical composition comprising an antibody of the invention. The composition may comprise a combination (such as two, three or four) of the antibodies of the invention. The pharmaceutical composition may also comprise a pharmaceutically acceptable carrier. The composition of the invention may include one or more pharmaceutically ϯϬ^ acceptable salts. A "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include acid addition salts and base addition salts. ϯ^^ ^ Suitable pharmaceutically acceptable carriers comprise aqueous carriers or diluents. Examples of suitable aqueous carriers include water, buffered water and saline. Other suitable pharmaceutically acceptable carriers include ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures ϱ^ thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. In many cases, it will be desirable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, ϭϬ^ microemulsion, liposome, or other ordered structure suitable to high drug concentration. Pharmaceutical compositions of the invention may comprise additional therapeutic agents, for example an anti-viral agent. The anti-viral agent may bind to coronavirus and inhibit viral activity. Alternatively, the anti-viral agent may not bind directly to coronavirus but still affect viral activity/infectivity. The anti-viral agent could be a further ϭϱ^ anti-coronavirus antibody, which binds somewhere on SARS-CoV-2 other than the spike protein. Examples of an anti-viral agent useful with the invention include Remdesivir, Lopinavir, ritonavir, APN01, and Favilavir. The additional therapeutic agent may be an anti-inflammatory agent, such as a corticosteroid (e.g. Dexamethasone) or a non-steroidal anti-inflammatory drug (e.g. ϮϬ^ Tocilizumab). The additional therapeutic agent may be an anti-coronavirus vaccine. The pharmaceutical composition may be administered subcutaneously, intravenously, intradermally, intramuscularly, intranasally or orally. Also within the scope of the invention are kits comprising antibodies or other Ϯϱ^ compositions of the invention and instructions for use. The kit may further contain one or more additional reagents, such as an additional therapeutic or prophylactic agent as discussed herein. Methods and uses of the invention The invention further relates to the use of the antibodies and the pharmaceutical ϯϬ^ compositions, described herein, e.g. in a method for treatment of the human or animal body by therapy, or in a diagnostic method. The method of treatment may be therapeutic or prophylactic. ϯ^^ ^ For example, the invention relates to methods of treating coronavirus (e.g. SARS- CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19. The method may comprise administering a therapeutically effective amount of an antibody, a combination of antibodies, or a pharmaceutical composition of the invention. The method ϱ^ may further comprise identifying the presence of coronavirus, or fragments thereof, in a sample, e.g. SARS-CoV-2, from the subject. The invention also relates to an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention for use in a method of treating coronavirus (e.g. SARS-CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19. ϭϬ^ The invention also relates to a method of formulating a composition for treating coronavirus (e.g. SARS-CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19, wherein said method comprises mixing an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention with an acceptable carrier to prepare said composition. ϭϱ^ The invention also relates to the use of an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention for treating coronavirus (e.g. SARS-CoV-2) infections or a disease or complication associated therewith, e.g. COVID- 19. The invention also relates to the use of an antibody, a combination of antibodies, or ϮϬ^ a pharmaceutical composition according to the invention for the manufacture of a medicament for treating or preventing coronavirus (e.g. SARS-CoV-2) infections or a disease or complication associated therewith, e.g. COVID-19. The invention also relates to preventing, treating or diagnosing coronavirus infection caused by any SARS-CoV-2 strain. The coronavirus infection may be caused by Ϯϱ^ any SARS-CoV-2 strain. The SARS-CoV-2 strain may be the earliest identified Wuhan strain (hCoV- 19/Wuhan/WIV04/2019 (WIV04); GISAID accession no. EPI_ISL_402124), and variants thereof. For example, the SARS-CoV-2 strain may be a member of lineage Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.10.4, BA.2.12.1, BA.2.3.20, ϯϬ^ BA.2.75, BA.2.75.2, BA.4/5, BA.4.6, BQ.1, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, XBB, XBB.1, or XBB1.5. The strain may be an as-yet-unidentified strain of SARS-CoV-2 comprising mutations in the RBD and/or NTD already identified in the existing strains, as shown in Figure 6. ϰϬ^ ^ The SARS-CoV-2 strain may comprise one or more mutations, e.g. in the spike protein, relative to the hCoV-19/Wuhan/WIV04/2019 (WIV04)^(GISAID accession no. EPI_ISL_402124). In other words, the SARS-CoV-2 strain may be a modified hCoV- 19/Wuhan/WIV04/2019 (WIV04) strain comprising one or more modifications, e.g. in the ϱ^ spike protein. The mutation may be the mutations (e.g. substitutions) observed in the BA.4/5 strain of SARS-CoV-2. The mutation may be the mutations (e.g. substitutions) observed in the Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.10.4, BA.2.12.1, BA.2.3.20, BA.2.75, BA.2.75.2, BA.4/5, BA.4.6, BQ.1, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, ϭϬ^ XBB, XBB.1, or XBB1.5 strains of SARS-CoV-2. All of the antibodies provided in Table 1 are effective in neutralising the BA.4/5 SARS-Cov-2 strain (see Figure 2A). Hence, the invention may relate to these antibodies for use in treating, prevent, treating or diagnosing coronavirus infection caused by a SARS-Cov-2 strain. ϭϱ^ The methods and uses of the invention may comprise inhibiting the disease state (such as COVID-19), e.g. arresting its development; and/or relieving the disease state (such as COVID-19), e.g. causing regression of the disease state until a desired endpoint is reached. The methods and uses of the invention may comprise the amelioration or the ϮϬ^ reduction of the severity, duration or frequency of a symptom of the disease state (such as COVID-19) (e.g. lessen the pain or discomfort), and such amelioration may or may not be directly affecting the disease. The symptoms or complications may be fever, headache, fatigue, loss of appetite, myalgia, diarrhoea, vomiting, abdominal pain, dehydration, respiratory tract infections, cytokine storm, acute respiratory distress syndrome (ARDS) Ϯϱ^ sepsis, and/or organ failure (e.g. heart, kidneys, liver, GI, lungs). The methods and uses of the invention may lead to a decrease in the viral load of coronavirus (e.g. SARS-CoV-2), e.g. by ^10%, ^20%, ^30%, ^40%, ^50%, ^60%, ^70%, ^80%, ^90%, or 100% compared to pre-treatment. Methods of determining viral load are well known in the art, e.g. infection assays. ϯϬ^ The methods and uses of the invention may comprise preventing the coronavirus infection from occurring in a subject (e.g. humans), in particular, when such subject is predisposed to complications associated with coronavirus infection. The invention also relates to identifying subjects that have a coronavirus infection, such as by SARS-CoV-2. For example, the methods and uses of the invention may involve ϰϭ^ ^ identifying the presence of coronavirus (e.g. SARS-CoV-2), or a protein or a fragment thereof, in a sample. The detection may be carried out in vitro or in vivo. In certain embodiments, the invention relates to population screening. The invention relates to identifying any SARS-CoV-2 strain, as described herein. ϱ^ The invention may also relate to a method of identifying escape mutants of SARS- CoV-2, comprising contacting a sample with a combination of antibodies of the invention and identifying if each antibody binds to the virus. The term “escape mutants” refers to variants of SARS-CoV-2 comprising non-silent mutations that may affect the efficacy of existing treatments of SARS-CoV-2 infection. Typically, the non-silent mutations is on an ϭϬ^ epitope recognised by a prior art antibody and/or antibodies described herein that specifically binds to an epitope of SARS-CoV-2, e.g. on the spike protein of SARS-CoV-2. If the antibody does not bind to the target, it may indicate that the target comprises a mutation that may alter the efficacy of existing SARS-CoV-2 treatments. The methods and uses of the invention may include contacting a sample with an ϭϱ^ antibody or a combination of the antibodies of the invention, and detecting the presence or absence of an antibody-antigen complex, wherein the presence of the antibody-antigen complex indicates that the subject is infected with SARS-CoV-2. Methods of determining the presence of an antibody-antigen complex are known in the art. For example, in vitro detection techniques include enzyme linked immunosorbent ϮϬ^ assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In vivo techniques include introducing into a subject a labelled anti-analyte protein antibody. For example, the antibody can be labelled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques. The detection techniques may provide a qualitative or a quantitative readout depending on the assay Ϯϱ^ employed. Typically, the invention relates to methods and uses for a human subject in need thereof. However, non-human animals such as rats, rabbits, sheep, pigs, cows, cats, or dogs is also contemplated. The subject may be at risk of exposure to coronavirus infection, such as a ϯϬ^ healthcare worker or a person who has come into contact with an infected individual. A subject may have visited or be planning to visit a country known or suspected of having a coronavirus outbreak. A subject may also be at greater risk, such as an immunocompromised individual, for example an individual receiving immunosuppressive ϰϮ^ ^ therapy or an individual suffering from human immunodeficiency syndrome (HIV) or acquired immune deficiency syndrome (AIDS). The subject may be asymptomatic or pre-symptomatic. The subject may be early, middle or late phase of the disease. ϱ^ The subject may be in hospital or in the community at first presentation, and/or later times in hospital. The subject may be male or female. In certain embodiments, the subject is typically male. The subject may not have been infected with coronavirus, such as SARS-CoV-2. ϭϬ^ The subject may have a predisposition to the more severe symptoms or complications associated with coronavirus infections. The method or use of the invention may comprise a step of identifying whether or not a patient is at risk of developing the more severe symptoms or complications associated with coronavirus. In embodiments of the invention relating to prevention or treatment, the subjectϭϱ^ may or may not have been diagnosed to be infected with coronavirus, such as SARS-CoV- 2. The invention relates to analysing samples from subjects. The sample may be tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. The sample may be blood and a fraction or component of ϮϬ^ blood including blood serum, blood plasma, or lymph. Typically, the sample is from a throat swab, nasal swab, or saliva. The antibody-antigen complex detection assays may be performed in situ, in which case the sample is a tissue section (fixed and/or frozen) of the tissue obtained from biopsies or resections from a subject. Ϯϱ^ In the embodiments of the invention where the antibodies pharmaceutical compositions and combinations are administered, they may be administered subcutaneously, intravenously, intradermally, orally, intranasally, intramuscularly or intracranially. Typically, the antibodies pharmaceutical compositions and combinations are administered intravenously or subcutaneously. ϯϬ^ The dose of an antibody may vary depending on the age and size of a subject, as well as on the disease, conditions and route of administration. Antibodies may be administered at a dose of about 0.1 mg/kg body weight to a dose of about 100 mg/kg body weight, such as at a dose of about 5 mg/kg to about 10 mg/kg. Antibodies may also be administered at a dose of about 50 mg/kg, 10 mg/kg or about 5 mg/kg body weight. ϰϯ^ ^ A combination of the invention may for example be administered at a dose of about 5 mg/kg to about 10 mg/kg for each antibody, or at a dose of about 10 mg/kg or about 5 mg/kg for each antibody. Alternatively, a combination may be administered at a dose of about 5 mg/kg total (e.g. a dose of 1.67 mg/kg of each antibody in a three antibody ϱ^ combination). The antibody or combination of antibodies of the invention may be administered in a multiple dosage regimen. For example, the initial dose may be followed by administration of a second or plurality of subsequent doses. The second and subsequent doses may be separated by an appropriate time. ϭϬ^ As discussed above, the antibodies of the invention are typically used in a single pharmaceutical composition/combination (co-formulated). However, the invention also generally includes the combined use of antibodies of the invention in separate preparations/compositions. The invention also includes combined use of the antibodies with additional therapeutic agents, as described above. ϭϱ^ Combined administration of the two or more agents and/or antibodies may be achieved in a number of different ways. In one embodiment, all the components may be administered together in a single composition. In another embodiment, each component may be administered separately as part of a combined therapy. For example, the antibody of the invention may be administered before, after or ϮϬ^ concurrently with another antibody, or binding fragment thereof, of the invention. The particularly useful combinations are described above for example. For example, the antibody of the invention may be administered before, after or concurrently with an anti-viral agent or an anti-inflammatory agent. In embodiments where the invention relates to detecting the presence of Ϯϱ^ coronavirus, e.g. SARS-CoV-2, or a protein or a fragment thereof, in a sample, the antibody contains a detectable label. Methods of attaching a label to an antibody are known in the art, e.g. by direct labelling of the antibody by coupling (i.e., physically linking) a detectable substance to the antibody. Alternatively, the antibody may be indirect labelled, e.g. by reactivity with another reagent that is directly labelled. Examples of ϯϬ^ indirect labelling include detection of a primary antibody using a fluorescently-labelled secondary antibody and end-labelling of a DNA probe with biotin such that it can be detected with fluorescently-labelled streptavidin. The detection may further comprise: (i) an agent known to be useful for detecting the presence of coronavirus, , e.g. SARS-CoV-2, or a protein or a fragment thereof, e.g. an ϰϰ^ ^ antibody against other epitopes of the spike protein, or other proteins of the coronavirus, such as an anti-nucleocapsid antibody; and/or (ii) an agent known to not be capable of detecting the presence of coronavirus, , e.g. SARS-CoV-2, or a fragment thereof, i.e. providing a negative control. ϱ^ In certain embodiments, the antibody is modified to have increased stability. Suitable modifications are explained above. The invention also encompasses kits for detecting the presence of coronavirus, e.g. SARS-CoV-2, in a sample. For example, the kit may comprise: a labelled antibody or a combination of labelled antibodies of the invention; means for determining the amount of ϭϬ^ coronavirus, e.g. SARS-CoV-2, in a sample; and means for comparing the amount of coronavirus, e.g. SARS-CoV-2, in the sample with a standard. The labelled antibody or the combination of labelled antibodies can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect coronavirus, e.g. SARS-CoV-2, in a sample. The kit may further comprise other agents known to be useful for detecting the ϭϱ^ presence of coronavirus, as discussed above. For example, the antibodies or combinations of antibodies of the invention are used in a lateral flow test. Typically, the lateral flow test kit is a hand-held device with an absorbent pad, which based on a series of capillary beds, such as pieces of porous paper, microstructured polymer, or sintered polymer. The test runs the liquid sample along the ϮϬ^ surface of the pad with reactive molecules that show a visual positive or negative result. The test may further comprise using other agents known to be useful for detecting the presence of coronavirus, e.g. SARS-CoV-2, or a fragment thereof, as discussed above, such as anti- an anti-nucleocapsid antibody. Other Ϯϱ^ It is to be understood that different applications of the disclosed antibodies combinations, or pharmaceutical compositions of the invention may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. ϯϬ^ In addition as used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural references unless the content clearly dictates otherwise. Thus, for example, reference to “an antibody” includes two or more “antibodies”. ϰϱ^ ^ Furthermore, when referring to “^x” herein, this means equal to or greater than x. When referred to “^x” herein, this means less than or equal to x. For the purpose of this invention, in order to determine the percent identity of two sequences (such as two polynucleotide or two polypeptide sequences), the sequences are ϱ^ aligned for optimal comparison purposes (e.g. gaps can be introduced in a first sequence for optimal alignment with a second sequence). The nucleotide or amino acid residues at each position are then compared. When a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, then the nucleotides or amino acids are identical at that position. The percent identity between ϭϬ^ the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions /total number of positions in the reference sequence × 100). Typically the sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence ϭϱ^ is 95% identical to SEQ ID NO: 3, SEQ ID NO: 3 would be the reference sequence. To assess whether a sequence is at least 95% identical to SEQ ID NO: 3 (an example of a reference sequence), the skilled person would carry out an alignment over the length of SEQ ID NO: 3, and identify how many positions in the test sequence were identical to those of SEQ ID NO: 3. If at least 95% of the positions are identical, the test sequence is ϮϬ^ at least 95% identical to SEQ ID NO: 3. If the sequence is shorter than SEQ ID NO: 3, the gaps or missing positions should be considered to be non-identical positions. The skilled person is aware of different computer programs that are available to determine the homology or identity between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be Ϯϱ^ accomplished using a mathematical algorithm. In an embodiment, the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (1970) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http://www.accelrys.com/products/gcg/), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, ϯϬ^ 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. The CDRs of the heavy chain (CDRH) and light chain variable domain (CDRL) are located at residues 27-38 (CDR1), residues 56-65 (CDR2) and residues 105-117 (CDR3) of each chain according to the IMGT numbering system (http://www.imgt.org; Lefranc ϰϲ^ ^ MP, 1997, J, Immunol. Today, 18, 509). This numbering system is used in the present specification except where otherwise indicated. All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. ϱ^ The following examples illustrate the invention. Examples Example 1. Generation of mAbs from BA.4/5 infection samples Blood was taken from 11 triple vaccinated volunteers >23 days (median 38) after ϭϬ^ PCR test confirmed SARS-CoV-2 BA.4 infection (n=3) or BA.5 infection (n=8). Focus reduction neutralisation tests (FRNT) were performed on Victoria (an early pandemic strain), together with BA.2, BA.4 and BA.5 live virus, to select the highest titre samples for antibody production (Fig. 1A). Seven samples with the highest titres against BA.4 or BA.5 were used for mAb production. ϭϱ^ PBMCs were stained with BA.4/5 S trimer (the S sequence is the same for BA.4 and BA.5) and single IgG positive memory B cells were sorted (Fig. 1B), meanwhile, 4 samples were stained with an S trimer termed BA.4+all, that was constructed to harbour additional mutations seen in recent sub-lineages (G339H, R346T, L368I, K444R, V445P, G446S, N450D, L452M, N460K, V483A, E484R, F486S, F490V and S494P) in a BA.4/5 ϮϬ^ background. From the selected cells, a degenerate PCR reaction was used to amplify heavy and light chains, which were assembled into an expression vector using Gibson assembly and the products expressed by transient transfection. Supernatants were tested for binding to full length BA.4/5 or BA.4+all S trimer, BA.4/5 or BA.4+all RBD and BA.4/5 NTD. From 861 sorted cells 414 antibodies were recovered leading to the selection of 29 Ϯϱ^ potent mAbs (BA.4/5-34 was derived from the BA.4+all sort) showing FRNT 50% of BA.5 virus at <100 ng/ml. Heavy chain gene usage is evenly distributed on IGHV1-69 (5/29), IGHV3-9 (4/29), and public gene family IGHV3-53 (4/29) and IGHV3-66 (5/29) (Fig. 1C, Table 2 (some antibodies not shown)). Somatic mutation was comparable to a previous set of antibodies we developed following BA.1 infection, significantly greater ϯϬ^ than seen in early pandemic mAbs (Fig. 1D). A number of mAbs showed little or no ACE2 blocking ability (e.g. BA.4/5-12, 15, 20 and 33) (Fig. 1E). ϰϳ^ ^ Pseudo-typed virus neutralisation assays (Nie et al. Emerg Microbes Infect 9, 680- 686 (2020)) were used to test the antibodies against 30 variants seen throughout the pandemic with particular emphasis on Omicron sub-lineages (Fig. 2A). All potent BA.4/5 mAbs shown, except BA.4/5-33, cross-neutralize early pandemic pseudovirus Victoria ϱ^ (IC50<100 ng/ml) and may have been selected from B cell clones originally generated following vaccination (Fig. 2A). Neutralization assays were performed using wild-type viruses (Fig. 2B). BA.4/5-33 was the only anti-NTD antibody isolated, which was specific to BA.2 derived variants, although failed to neutralize Delta. Many BA.4/5 mAbs showed >5-fold reduction of neutralization titre on at least one ϭϬ^ Omicron sub-lineage, compared to BA.4/5 (Fig. 2A) with activity completely knocked out for many antibodies for the most frequent variants, BA.2.75.2, BQ.1.1, BN.1, XBB.1.5 and CH.1.1. Cross reactivity between different viral variants was mixed, BA.4/5-2 was broadly and potently neutralizing of all the variants tested (Fig. 2A and 2B) whilst BA.4/5-1 and ϭϱ^ 31, had a single vulnerability to BS.1. BS.1 contains a number of mutations in the RBD shared with other variants (Figure 6), but uniquely expresses G476S at the back of the left shoulder, which is likely responsible for the reduction in activity of BA.4/5-1 and 31 on BS.1. The R346T mutation, which exists in a number of variants including BA.4.6, BA.2.75.2, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, XBB, CA.3.1, CH.1.1, XBB.1, XBF, XBB.1.5 ϮϬ^ and DS.1, disrupts the binding of many potent BA.4/5 mAbs, (BA.4/5-11, 12, 13, 15, 18, 20, 21 and 25, when comparing BA.4 with BA.4.6). Finally, the activity of mAbs developed for clinical use were tested against newly emerging Omicron variants (Fig. 2C). Activity was knocked out for most mAbs tested and notably activity of S309 was knocked out against BN.1 and DS.1, likely due to mutation Ϯϱ^ K356T. Example 2. Structures of anti-BA.4/5 mAbs To elucidate the binding mode and detailed interactions of the cross-reactive mAbs, structures of complexes of Delta-RBD with BA.4/5-1 and EY6A, and Delta-RBD with BA.4/5-2 and Beta-49, were determined by crystallography, as well as structures of BA.4 ϯϬ^ spike with BA.4/5-5, BA.2.12.1 spike with BA.2-07, and Delta-RBD with SARS1-31 (an antibody generated from a Delta infected case selected by single cell sorting with SARS1 S protein), where the early pandemic mAbs, EY6A, Beta-49 and SARS1-34 are used as chaperones for structure determination. Delta RBD was used since it yields better crystals. ϰ^^ ^ In addition, the high resolution crystal structure of Delta-RBD with Omi-42 and Beta-49 was also determined, complementing the previously reported lower resolution cryo-EM structure of the spike/Omi-42 complex (Tuekprakhon et al. Cell 185, 2422-2433 e2413 (2022)) to facilitate structure analysis and comparison (Figs 3 to 5). ϱ^ BA.4/5-2 (IGHV3-30), the second ultra cross-reactive mAb, binds the RBD with the heavy chain (HC) at the back of the left shoulder and light chain at the back of the neck. The HC makes the majority of contacts with the RBD with a footprint of 650 Å2, compared to 305 Å2 for the LC (Fig. 3B, 4B, 5D). Of the 27 residues within this footprint, 12 overlap with the footprint of ACE2. CDR-H3 makes extensive interactions with RBD ϭϬ^ residues 416-417, 420-421, 455-460, 473 and 489. In contrast, CDR-L3 makes only weak contact to T415 of the RBD. CDR-H1 contacts residues 475-477 and 486-487 (Fig. 3H- L). Residues 405, 408, 417, 460, 476-477 and 505, which are mutated in VoC (Fig. 6), have direct contacts with BA.4/5-2, despite this, BA.4/5-2 retains the ability to broadly neutralize all of the variants tested (Fig. 2A). ϭϱ^ BA.4/5-1 (IGHV4-39) is another RBD binding antibody that approaches the binding site from the back of the RBD, the HC binds at the top of the neck and LC at the back of the left shoulder making a large footprint of 1310 Å2 (HC 670 Å2 and LC 640 Å2) (Fig. 3A, 3C-G. 4A and 5C). This antibody also heavily overlaps the ACE2 binding site; of the 35 RBD residues in the BA.4/5-1 footprint, 20 overlap with the ACE2 footprint. ϮϬ^ However, in this case a large number of mutation sites in the Omicron variants have either direct contact with, or are on the footprint of BA.4/5-1, including 405, 408, 417, 476, 477, 484, 486, 490, 493-494, 498, 501 and 505, but interestingly most of these mutations have little or no effect on the neutralization potency of BA.4/5-1, which maintains broad cross- reactivity (Fig. 2A). RBD residues L455, F456, Y489 and Q493 make extensive Ϯϱ^ hydrophobic interactions (^ 4 Å) with CDR-H3, while F486, G476 and S477 contact CDR- L3 of BA.4/5-1. F486 also makes ring stacking contacts with Y35 and Y60 from the framework regions of the HC (Fig. 3C-J). Residue F486 undergoes a number of mutations in recently identified SARS CoV-2 variants: F486V in BA.4/5 and BQ.1, F486S in BA.2.75.2 and XBB and F486P in BA.2.10.4 and XBB.1.5 (Figure 6). It appears that ϯϬ^ despite showing close interaction with residue 486, BA.4/5-1 can tolerate mutations of F486 showing only modest reduction in titres to some of the newly described variants compared to BA.4/5 (Fig. 2A). Neutralization titres to BS.1 (a rarely described variant, which has failed to achieve a major break-through) were reduced 32-fold compared to BA.4/5 or BA.2.12.1. BS.1 contains the unique mutation G476S (Figure 6) compared to ϰ^^ ^ the other variants tested in Fig. 2A, G476 has close contact with Y92 of CDR-L3 and the change to Ser likely disrupts this interaction (Fig. 3G). The continued evolution of SARS CoV-2 is expected, prompted by vaccination and multiple rounds of natural infection, placing the virus under extreme selective pressure. ϱ^ Fig. 6 shows that in response, 16% of the residues of the RBD have mutated, corresponding to 26% of the accessible surface of the RBD, however over half (56%) of the area of the ACE footprint has been mutated in the drive to escape ACE-blocking antibodies and optimise ACE2 binding. All monoclonal antibodies selected for prophylactic or therapeutic use bind to the RBD, some were derived from mAb isolated ϭϬ^ following SARS-CoV-1 infection (S309 and ADG20), whilst others were isolated from cases infected with SARS-CoV2 during the early pandemic. These first generation SARS- CoV-2 mAbs bind to areas of the RBD that were hotspots for neutralising antibody binding and therefore also hotspots for mutational escape. It is therefore unsurprising that the evolution of SARS-CoV-2 has led to the steady attrition of the available prophylactic andϭϱ^ therapeutic mAbs, such that in many countries most are now recommended Encouragingly for the prospects of second generation COVID-19 therapeutics we have identified here potent mAbs which show extreme breadth, being able to neutralize all variants tested. BA.4/5-2 binds the RBD at the back of the left shoulder, in an area that has been relatively resistant to mutational change to date (Fig. 3 and 5D). ϮϬ^ Example 3. Materials and Methods Bacterial Strains and Cell Culture Vero (ATCC CCL-81) and VeroE6/TMPRSS2 cells were cultured in Dulbecco’s Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100ௗU/ml of Ϯϱ^ penicillin–streptomycin at 37 °C. Human mAbs were expressed in HEK293T cells cultured in FreeStyle™ 293 Expression Medium (Cat# 12338018, Gibco™) at 37 °C with 5% CO2. HEK293T (ATCC CRL-11268) cells were cultured in DMEM high glucose (Sigma- Aldrich) supplemented with 10% FBS, 1% 100X Mem Neaa (Gibco) and 1% 100X L- Glutamine (Gibco) at 37 °C with 5% CO2. To express RBD, RBD variants and ACE2, ϯϬ^ HEK293T cells were cultured in DMEM high glucose (Sigma) supplemented with 2% FBS, 1% 100X Mem Neaa and 1% 100X L-Glutamine at 37 °C for transfection. BA.5 RBD were expressed in HEK293T (ATCC CRL-11268) cells cultured in FreeStyle™ 293 Expression Medium (Cat# 12338018, Gibco™) at 37 °C with 5% CO2. ϱϬ^ ^ E.coli DH5Į bacteria were used for transformation and large-scale preparation of plasmids. A single colony was picked and cultured in LB broth at 37 °C at 200 rpm in a shaker overnight. To produce pseudo-typed lentivirus, HEK293T/17 cell was cultured in Dulbecco’s Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented ϱ^ with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100ௗU/ml of penicillin–streptomycin at 37 °C. Sera and PBMC from BA.4/5 infected cases, study subjects Following informed consent, individuals with omicron BA.4 or BA.5 were co- enrolled into one or more of the following three studies: the ISARIC/WHO Clinical ϭϬ^ Characterisation Protocol for Severe Emerging Infections [Oxford REC C, reference 13/SC/0149], the “Innate and adaptive immunity against SARS-CoV-2 in healthcare worker family and household members” protocol (approved by the University of Oxford Central University Research Ethics Committee), or the Gastro-intestinal illness in Oxford: COVID sub study [Sheffield REC, reference: 16/YH/0247]. Diagnosis was confirmed ϭϱ^ through reporting of symptoms consistent with COVID-19, hospital presentation, and a test positive for SARS-CoV-2 using reverse transcriptase polymerase chain reaction (RT-PCR) from an upper respiratory tract (nose/throat) swab tested in accredited laboratories and lineage sequence confirmed through national reference laboratories in the United Kingdom. A blood sample was taken following consent at least 14 days after PCR test ϮϬ^ confirmation. Clinical information including severity of disease (mild, severe or critical infection according to recommendations from the World Health Organisation) and times between symptom onset and sampling and age of participant was captured for all individuals at the time of sampling. Isolation of BA.4/5 S-specific single B cells by FACS Ϯϱ^ BA.4/5 S-specific single B cell sorting was performed. Briefly, PBMC were stained with LIVE/DEAD Fixable Aqua dye (Invitrogen) followed by recombinant trimeric S- twin-Strep of BA.4/5. Cells were then incubated with CD3-FITC, CD14-FITC, CD16- FITC, CD56-FITC, IgM-FITC, IgA-FITC, IgD-FITC, IgG-BV786 and CD19-BUV395, along with Strep-MAB-DY549 to stain the twin strep tag of the S protein. IgG+ memory B ϯϬ^ cells were gated as CD19+, IgG+, CD3-, CD14-, CD56-, CD16-, IgM-, IgA- and IgD-, and S+ was further selected and single cells were sorted into 96-well PCR plates with 10 μl of catching buffer (Tris, Nuclease free-H2O and RNase inhibitor). Plates were briefly centrifuged at 2000×g for 1 min and left on dry ice before being stored at -80 °C. Cloning and expression of BA.4/5 S-specific human mAbs ϱϭ^ ^ BA.4/5 S-specific human mAbs were cloned and expressed. Briefly, genes for Ig IGHV, Ig V^ and Ig V^ were recovered from positive wells by RT-PCR. Genes encoding Ig IGHV, Ig V^ and Ig V^ were then amplified using Nested-PCR by a cocktail of primers specific to human IgG. PCR products of HCs and LCs were ligated into the expression ϱ^ vectors of human IgG1 or immunoglobulin ^-chain or ^-chain by Gibson assembly. For mAb expression, plasmids encoding HCs and LCs were co-transfected by PEI-transfection into a HEK293T cell line, and supernatants containing mAbs were collected and filtered 4- 5 days after transfection, and the supernatants were further characterized or purified. ACE2 binding inhibition assay by ELISA ϭϬ^ MAXISORP immunoplates were coated with 5 μg/ml of purified ACE2-His protein overnight at 4 ^ and then blocked by 2% BSA in PBS. Meanwhile, mAbs were serially diluted and mixed with 2.5 μg/ml of recombinant BA.4/5 trimeric S-twin-Strep. Antibody-S protein mixtures were incubated at 37^ for 1 hr. After incubation, the mixtures were transferred into the ACE2-coated plates and incubated for 1 hr at 37 ^. ϭϱ^ After washing, StrepMAB-Classic (2-1507-001, iba) was diluted at 0.2 ^g/ml by 2% BSA and used as primary antibody followed by Goat anti-mouse IgG-AP (A9316, Sigma- Aldrich) at 1:10,000 dilution. The reaction was developed by adding PNPP substrate and stopped with NaOH. The absorbance was measured at 405nm. The ACE2/S binding inhibition was calculated by comparing to the antibody-free control well. IC50 was ϮϬ^ determined using the Probit program from the SPSS package. Pseudovirus plasmid construction and lentiviral particles production Pseudotyped lentivirus expressing SARS-CoV-2 S proteins from ancestral strain (Victoria, S247R), BA.2, BA.4/5, BA.2.75, BA.2.75.2, BA.2.3.20, BA.2.10.4, BJ.1, BN.1, and BA.4.6 were constructed and described in the art. The same method to construct Ϯϱ^ BQ.1, BQ.1.1, BS.1, and BF.7 was employed, by adding more mutations into the BA.4 construct. BA.5.9 was created by adding R346I mutation into BA.4/5 backbone. To generate BQ.1, K444T and N460K were added into BA.4/5 backbone, and then R346T was introduced into BQ.1 to create BQ.1.1. A475V was added into BQ.1.1 to create BQ.1.1+A475V. To construct BS.1, R346T, L452R, N460K and G476S was added into ϯϬ^ BA.2 backbone. XBB was constructed by adding the following mutations into BA.2 backbone: V83A, H146Q, Q183E, R346T, L368I, V445P, G446S, N460K, F486S, F490S, and R493Q. To construct XBB.1, G252V was introduced into XBB, and F486P was added into XBB.1 to make XBB.1.5. XBF was constructed by adding F486P into BN.1, and then reverse mutated 356T in BN.1 to 356K in the original strain. To create BF.7, R346T was ϱϮ^ ^ introduced in BA.4 backbone. CH.1.1 was created by adding K444T and L452R into BA.2.12.1, and changed T444 in CH.1.1 to M444 to construct CA.3.1. To create DS.1, R403K and F486S were added into BN.1 template. The resulting pcDNA3.1 plasmid carrying S gene was used for generating pseudoviral particles together with the lentiviral ϱ^ packaging vector and transfer vector encoding luciferase reporter. All the constructs were Sanger sequence confirmed. Pseudoviral neutralization test The pseudoviral neutralization test has been described previously. Briefly, the neutralizing activity of potent monoclonal antibodies generated from donors who had ϭϬ^ recovered from BA.4 and BA.5 infections were tested against Victoria, Alpha, Beta, Gamma, Delta, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.2.75, BA.2.75.2, BA.2.3.20, BA.2.10.4, BJ.1, BA.4/5, BA.4.6, BA.5.9, BQ.1, BQ.1.1, BQ.1.1+A475V, BS.1, BF.7, BN.1, XBB, XBB.1, XBB.1.5, XBF, CH.1.1, CA.3.1 and DS.1. Four-fold serial diluted mAbs were incubated with pseudoviral particles at 37 ^ with 5% CO2 for 1 hr. Stableϭϱ^ HEK293T/17 cells expressing human ACE2 were then added to the mixture at 1.5 × 104 cells/well. 48 hr post infection, culture supernatants were removed and 50 ^L of 1:2 Bright-Glo TM Luciferase assay system (Promega, USA) in 1 × PBS was added to each well. The reaction was incubated at room temperature for 5 mins and firefly luciferase activity was measured using CLARIOstar® (BMG Labtech, Ortenberg, Germany). The ϮϬ^ percentage neutralization was calculated relative to the control. Probit analysis was used to estimate the dilution that inhibited half maximum pseudotyped lentivirus infection (PVNT50). Focus Reduction Neutralization Assay (FRNT) The neutralization potential of Ab was measured using a Focus Reduction Ϯϱ^ Neutralization Test (FRNT), where the reduction in the number of the infected foci is compared to a negative control well without antibodies. Briefly, serially diluted Ab or plasma was mixed with SARS-CoV-2 strains and incubated for 1 hr at 37 °C. The mixtures were then transferred to microplates containing confluent Vero cell monolayers in duplicate and incubated for a further 2 hrs followed by the addition of 1.5% semi-solid ϯϬ^ carboxymethyl cellulose (CMC) overlay medium to each well to limit virus diffusion. A focus forming assay was then performed by staining Vero cells with human anti-NP mAb (mAb206) followed by peroxidase-conjugated goat anti-human IgG (A0170; Sigma). Finally, the foci (infected cells) approximately 100 per well in the absence of antibodies, were visualized by adding TrueBlue Peroxidase Substrate. Virus-infected cell foci were ϱϯ^ ^ counted on the classic AID EliSpot reader using AID ELISpot software. The percentage of focus reduction was calculated and IC50 was determined using the probit program from the SPSS package. Cloning of spike, RBD and NTD ϱ^ Expression plasmids encoding BA.4 spike and RBD were constructed with human codon-optimized sequence from BA.4 spike. Mutations of G339H, R346T, L368I, K444R, V445P, G446S, N450D, L452M, N460K, V483A, A484R, V486S, F490S and S494P were introduced into BA.4 spike and RBD expression plasmids to create BA.4+all spike and BA.4+all RBD. The constructs were verified by Sanger sequencing. ϭϬ^ Protein production Twin-strep tagged BA.4 and BA.4+all spikes were transiently expressed in HEK293T cells and purified with Strep-Tactin XT resin (IBA lifesciences). Plasmids encoding BA.4 and BA.4+all RBD were transiently expressed in Expi293F™ Cells (ThermoFisher), cultured in FreeStyle™ 293 Expression Medium (ThermoFisher) at 30°C ϭϱ^ with 8% CO2 for 4 days. The harvested medium was concentrated using a QuixStand benchtop system. His-tagged RBDs were purified with a 5 mL HisTrap nickel column (GE Healthcare), followed by a Superdex 7510/300 GL gel filtration column (GE Healthcare). IgG mAbs and Fabs production ϮϬ^ AstraZeneca and Regeneron antibodies were provided by AstraZeneca, Vir, Lilly and Adagio antibodies were provided by Adagio, LY-CoV1404 was provided by LifeArc. For the in-house antibodies, heavy and light chains of the indicated antibodies were transiently transfected into 293T cells and antibody purified from supernatant on protein A as previously described 24. Fabs were digested from purified IgGs with papain using a Ϯϱ^ Pierce Fab Preparation Kit (Thermo Fisher), following the manufacturer’s protocol. Crystallization, X-ray data collection and structure determination Purified Delta RBD was deglycosylated with Endoglycosidase H1. Fabs BA.4/5-1 and EY6A, BA.4/5-2 and Beta-49, and Omi-42 and Beta-49 were mixed with Delta RBD separately in a 1:1:1 molar ratio, with a final concentration of 7.0 mg ml-1. Initial screening ϯϬ^ of crystals was set up in Crystalquick 96-well X plates (Greiner Bio-One) with a Cartesian Robot using the nanoliter sitting-drop vapor-diffusion method, with 100 nL of protein plus 100 nL of reservoir in each drop. Crystals of Delta-RBD/BA.4/5-1/EY6A and Delta- RBD/Omi-42/Beta-49 were formed in Hampton Research PEGRx condition 1-17, containing 0.1 M sodium citrate tribasic dihydrate pH 5.5 and 22% (w/v) PEG 1000. ϱϰ^ ^ Crystals of Delta-RBD/BA.4/5-2/Beta-49 were formed in Hampton Research PEGRx condition 1-46, containing 0.1 M sodium citrate tribasic dihydrate pH 5.0 and 18% (w/v) PEG 20000. Crystals of Delta-RBD/BA.4/5-35 were grown in condition containing 0.1 M Sodium citrate tribasic dihydrate pH 5.5, 18% (w/v) PEG 3,350. ϱ^ Crystals were mounted in loops and dipped in solution containing 25% glycerol and 75% mother liquor for a second before frozen in liquid nitrogen. Diffraction data of Delta RBD/EY6A/BA.4/5-1 and Delta RBD/Beta-49/BA.4/5-2 were collected at beamline i04, and Delta-RBD/BA.4/5-35 and Delta RBD/Beta-49/Omi-42 at i03 of Diamond Light Source, UK, using the automated queue system that allows unattended automated data ϭϬ^ collection. 3600 diffraction images of 0.1º each were collected at 100 K from a single crystal for each data set. Data integration, scaling and reduction were automatically done with Xia2-dials The structures were determined using molecular replacement with Phaser, model rebuilding is done with COOT and refinement with Phenix. Structural comparisons used SHP and figures were prepared with PyMOL (The PyMOL Molecular Graphics ϭϱ^ System, Version 1.2r3pre, Schrödinger, LLC). Delta RBD/mAb BA2.07/nbC1/mAb 1-34 For Delta-RBD/mAbBA.2-07/nbC1/mAb1-34, nanobody C1 and fab 1-34 were incubated with delta RBD at a 1.1 molar excess of each on ice for ca. 30 minutes prior to plunge freezing. Grids were prepared using a 3 ^L aliquot of this complex mixture and ϮϬ^ plasma-cleaned (35 s, high with a Plasma Cleaner PDC-002-CE, Harrick Plasma) Quantifoil 2/1300 mesh grids using a Vitrobot Mark IV (Thermo Fisher). Excess liquid was removed by blotting for 5 s with a force of -1 using vitrobot filter paper (grade 595, Ted Pella Inc.) in a chamber set to 4.5 ºC, 100 % reported humidity before plunge freezing into liquid ethane. Ϯϱ^ Movies, in eer format, 13,121 in total, were collected at 165 kX magnification on a 300 kV Titan Krios equipped with a Falcon-IV Selectris, corresponding to a calibrated pixel size of 0.7303 Å2 with a total dose of 50 e-/Å2 using EPU software (ThermoFisher scientific, defocus range of 0.8-2.6 ^m). Data were 4x binned and pre-processed on-the-fly in the cryoSPARC live interface ϯϬ^ v3.3.2 patch motion and ctf tools, and particles picked using the blob picker. Initially picked particles, 867189, were then subjected to two rounds of classification into 250 then 150 classes in cryoSPARC v3.3.2 ‘static’ version with a circular mask diameter of 155 Å, 23 online iterations and 300 batch size per class. Heterogeneous refinement was then performed on the filtered particle set comprising 154,454, separating data into three classes ϱϱ^ ^ (initial references generated during on-the-fly processing ab initio model generation from a subset of 100,000 particles). The predominant class, with 89,552, was selected for further refinement. Curiously, one of the other classes, with 39,987 particles, appeared to have RBDs in a trimeric arrangement was observed, but the resulting map was too anisotropic ϱ^ for clear interpretation and thus excluded from further refinement. The final class appeared to be ‘junk’. This subset of 89,552 particles were then non-uniform refined before unbinning and further refinement, resulting in a final reconstruction to 3.2 Å reported resolution (-103.3 reported global b-factor) with clear side-chain density could be seen at the RBD/immunobody interfaces. ϭϬ^ For model generation, a previously published C1 VHH structure, 7oap and our model of delta-RBD with antibody 1-34 were rigid body-fitted into this final map using ChimeraX37 before cycles of refinement/model building in coot/Phenix. BA.2.12.1-Spike/BA.2-07 For the two Spike complexes, C-flat R2/1 grids glow discharged for 20 s using ϭϱ^ Plasma Cleaner PDC-002-CE, Harrick Plasma. Fabs and Spike were mixed at a molar ratio of 6:1 such that there was a two-fold molar excess of fab to sites, and fab/antigen complexes prepared < 5 minutes prior to application to the freshly glow discharged grid and excess liquid was removed by blotting for 5 s with a force of -1 using vitrobot filter paper (grade 595, Ted Pella Inc.) at 4.5 ºC, 100 % reported humidity before plunge ϮϬ^ freezing into liquid ethane using a Vitrobot Mark IV (Thermo Fisher). Movies, see Table 1 for totals, were collected on a Titan Krios operating at 300 kV equipped with a Falcon-IV Selectris at 165 kX magnification, corresponding to a calibrated pixel size of 0.7303 Å2 with a total dose of 50 e-/Å2 for both Spike complexes, using EPU software (ThermoFisher scientific) and defocus range of 0.8-2.6 ^m in EER format. Ϯϱ^ Data were binned four times pre-processed in the cryoSPARC live interface, with down-stream processing performed using cryoSPARC. For BA2.12.1-S/BA.2-07, on-the-fly template-based picking using a template of a side-view of Spike was employed, and the resulting set of 1,467,174 particles were 2D classified into 150 classes. To generate an initial model for 3D refinement, from this ϯϬ^ classification, one class, with a projection image seemingly of a side view spike decorated with three fabs (2283 particles) was used for ab-initio model generation, split to two classes, with the predominant class, of 1785 particles, used as a template for classification. This ab initio volume already appeared to be S decorated with three fabs in a C3- symmetrical fashion (note that no symmetry had been imposed at this stage). In parallel, ϱϲ^ ^ 109,708 particles were selected from the 2D classification job and used in a heterogeneous refinement job using the two ab-initio models (good predominant class, and smaller ‘rubbish’ class volume as templates, with C3 symmetry. Particles in the ‘good’ class, 62,197 in total, were then used in a non-uniform refinement job 39 before re-extraction to ϱ^ un-bin and further non-uniform refinement to 3.1 Å b-factor -67.3 reported resolution (gold-standard FSC in cryoSPARC = 0.146). Global CTF refinement and local ctf refinement followed by further non-uniform environment with the un-binned dataset resulting in a final map to 2.96 Å reported resolution (again gold-standard FSC in cryoSPARC = 0.146, b-factor -65.6). ϱϳ^ ^ 3 n D 2 1 4 2 6 3 8 4 0 6 2 7 4 8 6 9 8 R o 0 02 2 4 6 8 0 2 Ai t I ) 1 1 3 1 4 1 5 1 6 1 8 1 9 1 D Ac C n QO u E N J S ( -3 T ) 1 1 3 2 5 7 9 1 3 5 7 9 1 3 5 7 9 1 RGQ 3 4 5 7 8 9 E D 0 1 3 4 5 6 7 9 I O 1 1 1 1 1 1 1 1 D CM I S ( N - D S S S S S S S S S S N S S F A A A N N 2 T I RG ) A O T A A A A A V E D G D N A A D D N N V T D D N A V S A K n i D a CMQ I E N 0 2 4 6 8 0 2 6 8 0 2 4 6 8 0h S ( 1 2 3 4 5 7 8 4 9 0 1 1 1 3 1 4 1 5 1 6 1 7 9 C 1 1 t h - 1 T ) 9 1 2 3 3 5 4 7 9 1 3 5 7 9 1 3 5 7 9g i QO 5 6 8 9 0 1 1 1 2 1 4 1 5 1 6 1 7 8 L RGE N 1 1 D CM I S ( D I ec D 8 0 2 2 3 4 4 6 5 8 6 0 8 2 9 40 61 82 04 25 46 67 88 An e I Q) O 1 1 1 1 1 1 1 1 Au q e E S N S ( ec D 7 9 1 1 3 3 4 5 5 7 6 9 7 1 9 30 51 72 93 15 36 57 78 t n Ne I ) 1 1 1 1 1 1 1 1 u O q Q e E N S S ( 3 n oi D I 6 ) 8 1 0 3 2 4 4 5 6 6 8 7 0 9 20 4 6 8 0 2 4 6 ^ 1 1 1 2 1 3 1 5 1 6 1 7 8 ^ ϱ ^ RAt c O 1 1 D A Q C n u E N J S ( -3 T RGQ ) 5 7 1 9 2 1 4 3 5 5 6 7 7 9 8 10 3 5 7 9 1 3 5 1 1 1 2 1 3 1 4 1 6 1 7 1 8 1 D E CM I S D ( I O N -2 T Q ) 4 6 1 8 2 0 4 2 5 4 6 6 7 8 8 00 2 4 6 8 0 2 4 1 1 1 2 1 3 4 6 7 8 n i RG 1 1 1 1 1 D E D I O a CM I S ( N h C y v -a 1 T ) 3 5 1 7 2 9 3 1 5 3 6 5 7 7 8 9 9 11 32 53 74 95 1 3e RGQ 1 1 1 1 1 7 1 8 1 D E S D I O H CM I ( N ec D 2 4 1 6 2 8 3 0 5 2 6 4 7 6 8 8 9 01 22 43 64 8 0 2 An e I ) 1 1 1 1 5 1 7 1 8 1 Au q QO e E N S S ( ec D 1 3 1 5 2 7 3 9 4 1 6 3 7 5 8 7 9 90 12 33 54 7 9 1 t n I ) 1 1 1 1 5 1 6 1 8 1 Ne u q QO e E N S S ( y d o 1 0 1 - 2 5 - 6 5 - 7 8 9 1 1 21 31 51 71 81 02 12 22 5 -5 -5 -5 -5 -5 -5 -5 -5 -5 -5 -5 - - bi t / n 4 / . 4 / 4 / 4 / 4 / 4 / 4 / 4 / 4 / / / / / 5 / 5 / A . A . A . A . . . . . 4 . 4 . 4 . 4 . 4 . 4 . 4 . A A A A A A A A A A A A A B B B B B B B B B B B B B B B B 40 61 82 04 2 4 6 8 2 2 2 2 5 2 6 2 7 2 8 2 30 51 72 93 1 3 5 7 2 2 2 2 5 2 6 2 7 2 8 2 S S S A R S S S SA A T A D A V D T D S T A G K 20 41 62 83 0 2 4 6 2 2 2 2 5 2 6 2 7 2 8 2 10 31 52 73 94 1 3 5 2 2 2 2 2 6 2 7 2 8 2 00 21 42 63 84 0 2 4 2 2 2 2 2 6 2 7 2 8 2 99 11 32 53 74 9 1 3 1 2 2 2 2 5 2 7 2 8 2 89 0 ^ 1 1 2 4 6 8 0 2 2 2 2 3 2 4 2 5 2 7 2 8 2 ^ ϱ ^ 79 90 1 3 5 7 9 1 1 2 2 2 3 2 4 2 5 2 6 2 8 2 69 80 0 2 4 6 8 0 1 2 2 2 3 2 4 2 5 2 6 2 8 2 59 70 9 1 3 5 7 9 1 2 1 2 3 2 4 2 5 2 6 2 7 2 49 60 8 0 2 4 6 8 1 2 1 2 3 2 4 2 5 2 6 2 7 2 39 50 71 9 1 3 5 7 1 2 2 2 2 4 2 5 2 6 2 7 2 32 42 52 8 1 2 3 4 - - - 2- 3- 3- 3- 3 5 5 5 5 5 -/ / / 5 5 5 4 4 4 / 4 / 4 / 4 / 4 / . . . . A . 4 A A A A . A . A . A B B B B B B B B
Figure imgf000061_0111
Figure imgf000061_0065
Figure imgf000061_0088
Figure imgf000061_0112
Figure imgf000061_0113
Figure imgf000061_0054
Figure imgf000061_0087
Figure imgf000061_0114
6 1 1 3
Figure imgf000061_0115
Figure imgf000061_0036
Figure imgf000061_0052
Figure imgf000061_0082
Figure imgf000061_0097
Figure imgf000061_0116
9 1 1 1 1 3 1 3 1 8 1 2 2 F F F F F F F 1 F 0 1 0 1 0 1 0 1 0 1 0 1 1
Figure imgf000061_0037
Figure imgf000061_0046
Figure imgf000061_0089
* * * * * * 0 * 0 * 1
Figure imgf000061_0061
Figure imgf000061_0117
Figure imgf000061_0024
Figure imgf000061_0062
Figure imgf000061_0118
6 2 5 7 7 6 3 F 6 2 0 * - 1 1 - 1 2 - 1 4 - 2 4 - 2 1 - 4 R 2 2 9
Figure imgf000061_0119
Figure imgf000061_0027
Figure imgf000061_0064
Figure imgf000061_0098
Figure imgf000061_0120
O - 1 - 3 - 3 F F F F F F F F F
Figure imgf000061_0121
Figure imgf000061_0122
Figure imgf000061_0001
Figure imgf000061_0002
Figure imgf000061_0003
Figure imgf000061_0004
Figure imgf000061_0005
Figure imgf000061_0006
Figure imgf000061_0081
Figure imgf000061_0096
Figure imgf000061_0109
2 0 2 2 2 2 *
Figure imgf000061_0016
0 * 0 * 0 0 2 0 2 0 2 0 2 0
Figure imgf000061_0123
Figure imgf000061_0007
Figure imgf000061_0017
Figure imgf000061_0033
Figure imgf000061_0072
Figure imgf000061_0110
Figure imgf000061_0124
4 6 4 * 4 * 6 * 4 * 6 * 3 * 6
Figure imgf000061_0125
Figure imgf000061_0018
Figure imgf000061_0042
Figure imgf000061_0048
Figure imgf000061_0083
Figure imgf000061_0092
Figure imgf000061_0126
Figure imgf000061_0127
Figure imgf000061_0021
Figure imgf000061_0047
Figure imgf000061_0060
Figure imgf000061_0071
Figure imgf000061_0108
Figure imgf000061_0128
Figure imgf000061_0073
Figure imgf000061_0129
Figure imgf000061_0056
Figure imgf000061_0074
Figure imgf000061_0099
Figure imgf000061_0130
6 3 7 5 0
Figure imgf000061_0131
Figure imgf000061_0009
Figure imgf000061_0028
Figure imgf000061_0066
Figure imgf000061_0100
Figure imgf000061_0132
5 1 1 1 6 1 2 6 1
Figure imgf000061_0133
Figure imgf000061_0019
Figure imgf000061_0043
Figure imgf000061_0049
Figure imgf000061_0084
Figure imgf000061_0093
Figure imgf000061_0134
Figure imgf000061_0038
Figure imgf000061_0075
Figure imgf000061_0135
Figure imgf000061_0008
Figure imgf000061_0026
Figure imgf000061_0034
Figure imgf000061_0039
Figure imgf000061_0057
Figure imgf000061_0076
Figure imgf000061_0101
Figure imgf000061_0136
Figure imgf000061_0137
Figure imgf000061_0010
Figure imgf000061_0029
Figure imgf000061_0067
Figure imgf000061_0102
Figure imgf000061_0138
3 3 3 5 6 4 2 1 5
Figure imgf000061_0139
Figure imgf000061_0020
Figure imgf000061_0044
Figure imgf000061_0050
Figure imgf000061_0085
Figure imgf000061_0094
Figure imgf000061_0140
Figure imgf000061_0077
Figure imgf000061_0141
Figure imgf000061_0058
Figure imgf000061_0078
Figure imgf000061_0103
Figure imgf000061_0142
91 6 1 2 2 2 1 9
Figure imgf000061_0143
Figure imgf000061_0011
Figure imgf000061_0030
Figure imgf000061_0068
Figure imgf000061_0104
Figure imgf000061_0144
8 1 4 7 5 1
Figure imgf000061_0145
Figure imgf000061_0035
Figure imgf000061_0041
Figure imgf000061_0055
Figure imgf000061_0090
Figure imgf000061_0146
Figure imgf000061_0040
^ ϲ ^
Figure imgf000061_0079
Figure imgf000061_0147
Figure imgf000061_0025
Figure imgf000061_0059
Figure imgf000061_0080
Figure imgf000061_0105
Figure imgf000061_0148
4
Figure imgf000061_0149
Figure imgf000061_0012
Figure imgf000061_0031
Figure imgf000061_0069
Figure imgf000061_0106
Figure imgf000061_0150
5 1 0 1 4 1 6 3 1 2 6 9 tn t n t n t n t n t n t n t t 1 8 5 5 5 n n 9
Figure imgf000061_0015
Figure imgf000061_0053
Figure imgf000061_0063
Figure imgf000061_0152
2 8 2 8 2 8 2
Figure imgf000061_0022
8 8 2 8 5 8 8 8 8 8
Figure imgf000061_0151
Figure imgf000061_0023
Figure imgf000061_0091
/ 2 2 2 2 3 / / / / / / / / 8 0 7 0 7 4 6 3 7 0 1 1 4
Figure imgf000061_0153
Figure imgf000061_0013
Figure imgf000061_0032
Figure imgf000061_0070
Figure imgf000061_0107
Figure imgf000061_0154
2 2 2 2 2 7 2 8 2 8 2 7 2
Figure imgf000061_0014
Figure imgf000061_0155
Figure imgf000061_0045
Figure imgf000061_0051
Figure imgf000061_0086
Figure imgf000061_0095
Figure imgf000061_0156
5 7 . 5 2 6 . 2 . 7 3 . 1 2 . 5 2 0 3 6 . 4 . 4 . 8 .
Figure imgf000061_0169
Figure imgf000061_0157
Figure imgf000061_0160
Figure imgf000061_0164
Figure imgf000061_0167
Figure imgf000061_0170
2 6 5 7 4 6 1 2 4
Figure imgf000061_0162
Figure imgf000061_0172
5 2 4 3 9
Figure imgf000061_0159
Figure imgf000061_0171
Figure imgf000061_0163
Figure imgf000061_0166
. 5 5 0 7 4 7 7 . 7 6 7 3 . 4 . 2 . 5 7 . 6 3 . 5 . 1 .
Figure imgf000061_0173
Figure imgf000061_0158
Figure imgf000061_0161
Figure imgf000061_0165
Figure imgf000061_0168
Figure imgf000061_0174
9 9 9 9 9 9 8 9 7 9 5 9 n r o r r o r r o r s i e a i h d c F , o F o 1 F 3 F 1 8 0 F F F , o FF F F , o , F FF F 8 1 - * 4 2 2 1 2 3 2 1 3 6 3 * 0 0 3 b i y v 0
Figure imgf000061_0179
Figure imgf000061_0182
* 0 9 * 1 5 0 0 0 0 0 0 0 0 0 0 0 0 * 0 -0 * 3 * 3 * * * * * * * * * 0 3- -3r F 1
Figure imgf000061_0178
Figure imgf000061_0181
t n a e
Figure imgf000061_0175
Figure imgf000061_0176
Figure imgf000061_0177
Figure imgf000061_0180
3- 3- 3- 3- 5- 5 6 - 6 6 6 6 6 3 3 3 - 4- 4- 4- 6- 3- 3- 3 - 3- 3 , r o , 0
Figure imgf000061_0186
a H
Figure imgf000061_0183
Figure imgf000061_0184
Figure imgf000061_0185
Figure imgf000061_0187
4 3 3 3 3 3 * f 3 3 1 1 1 3 3 3 3 o F 5 o s e i t r DD DDDD DD D
Figure imgf000061_0197
e p
Figure imgf000061_0188
Figure imgf000061_0189
Figure imgf000061_0190
Figure imgf000061_0191
Figure imgf000061_0192
Figure imgf000061_0193
Figure imgf000061_0194
Figure imgf000061_0195
Figure imgf000061_0196
Figure imgf000061_0198
B B B B B B B B B R R R R R R R R R o r P 1 2 6 0 1 2 2 . - 5 - - 7- 8- 9- 1- 1 1 e / 5 5 5 5 5 5 -5 -5 l d i 4 / b . 4 / . 4 / / / / / / . 4 . 4 . 4 . 4 . 4 4 a b AA AAAA A. A . A T A B B B B B B B B B 1 2 7 1 6 1 1 2 7 1 8 1 4 1 1 1 8 1 9 2 1 9 0 1 8 4 1 F F F F F F F F F F F F F 1 1 F F 0 1 0 1 0 1 1 1 1 1 1 1 2 1 1 * 0 * * 0 0 0 0 0 1 0 0 0 0 8 * 9 8 0 * * * * * 0 * * * * 1 9 1 1 * 2 2 7 2 8 * 6 0 8 2 - - - - 9 2 1 1 2 1 1 2 1 1 1 5 3 6 5 - 3 - 3 - 5 - 4 - 3 - 5 - 1 - 1 - 3 - 5 - 5 F F F F F F F F F F F F F F F 2 0 2 0 2 0 2 2 2 2 2 2 2 2 2 1 2 2 * * * 0 0 0 0 0 0 0 0 0 0 0 0 6 6 6 * 6 * 6 * 4 * 4 * 4 * 5 * 4 * 6 * 4 * 3 * 4 * 4 ) 8 1 ( 0 1 7 8 2 1 3 1 3 1 5 1 8 1 9 0 2 3 1 6 5 1 6 1 6 1 3 4 5 6 3 4 1 1 9 7 7 3 4 3 5 8 3 1 1 1 3 1 8 1 6 1 7 1 6 2 7 2 6 1 7 2 6 1 0 1 8 1 1 2 4 2 ^ ϲ ^ 9 6 8 1 1 1 1 1 1 3 1 5 1 9 6 1 0 1 6 2 1 3 1 2 1 t n t n t n t t n t n t t n t n t n t t n t n t n t 8 8 5 n n n n 8 8 8 8 8 8 5 8 8 5 1 5 8 8 2 2 8 8 8 8 8 8 8 8 8 9 8 8 8 / / 2 2 2 2 2 2 2 2 2 2 2 2 2 5 7 / / / / / / / / / / / / / 7 7 2 1 2 2 2 8 2 1 9 1 7 7 4 2 2 7 2 7 2 7 2 7 2 6 2 5 2 7 2 6 2 6 2 8 2 6 2 6 2 6 2 1 5 2 8 6 0 6 6 3 7 6 8 1 4 2 9 3 . 4 . 3 5 . 4 9 . 5 5 . 5 5 . 5 0 . 4 9 . 9 5 . 5 3 . 9 6 . 4 5 . 3 3 . 6 2 . 7 3 . 8 9 4 8 . 1 4 4 0 4 4 7 3 4 3 9 6 8 1 7 5 . . 1 . 4 . 4 . 9 . 5 . 4 . 6 . 3 . 5 . 6 . 7 . 6 . 9 6 9 5 9 4 9 4 9 4 9 0 9 0 9 4 9 0 9 4 9 6 9 3 9 2 9 1 9 r o r , F o r , F o r , F o 1F F F F F F ,FF F F F ,F0 1 1 0 F 4 1 1 0 F F 1 0 F 2 * 0 * * 1 * 1 9 1 4 1 0 4 1 D ^* D 1 0 0 * 0 * D 1 0 1 0 0 * D 0 * 1 0 0 * 0 * 0 0 * 0 0 9 9 9 * 3 9 9 * * 9 * * 6 * * 6 6 6 9 5 9 3 * 9 6 6 9 6 3 9 - - - - - 6- 6- 9- 9- 6- 6- 5- 9- 6- 6 6 3 - 2 6 1 1 1 3 3 1 1 3 3 1 1 3 3 1 - 3 - 3 - 4 3 - 3 - 1 r o FD DDD DDD DDDD DDDT DB B B B B B B B B B B B B B R R R R R R R R R R R R R N R 3 1 5 1 7 1 8 0 1 2 3 4 5 8 1 2 3 4 - - 1 2 2 2 2 2 2 2 3 3 3 3 5 5 - - - - - - - - - - - - - / / 5 5 5 5 5 5 5 5 5 5 5 5 5 4 4 / / / / / / / / / / / / / . . 4 4 4 4 4 4 4 4 4 4 4 4 4A A. A. A . A. A. A . A. A. A. A . A. A. A. A B B B B B B B B B B B B B B B ^ ^
Figure imgf000063_0067
Figure imgf000063_0035
Figure imgf000063_0052
Figure imgf000063_0001
Figure imgf000063_0068
Figure imgf000063_0048
Figure imgf000063_0057
Figure imgf000063_0070
9 9 9 9 9 0
Figure imgf000063_0069
Figure imgf000063_0002
Figure imgf000063_0008
Figure imgf000063_0020
Figure imgf000063_0030
1 9 0 1 9 8 2 1 1 1 8 F F F F F F F F F F F
Figure imgf000063_0071
Figure imgf000063_0047
Figure imgf000063_0056
Figure imgf000063_0065
Figure imgf000063_0072
1 0 1 2 1 1 3 1 1 1 1 1 1 1
Figure imgf000063_0039
Figure imgf000063_0066
Figure imgf000063_0074
* 0 0 0 0 0 0 0 0 0 0 0 0
Figure imgf000063_0073
Figure imgf000063_0003
Figure imgf000063_0009
Figure imgf000063_0018
2 * 3 * 2 * 1 * 2 * 2 * 2 * 2 * 5 * 3 * 1 * 1 * 3
Figure imgf000063_0075
Figure imgf000063_0010
Figure imgf000063_0023
Figure imgf000063_0027
Figure imgf000063_0049
Figure imgf000063_0053
Figure imgf000063_0076
Figure imgf000063_0077
Figure imgf000063_0013
Figure imgf000063_0026
Figure imgf000063_0034
Figure imgf000063_0040
Figure imgf000063_0064
Figure imgf000063_0078
Figure imgf000063_0041
Figure imgf000063_0079
Figure imgf000063_0031
Figure imgf000063_0042
Figure imgf000063_0058
Figure imgf000063_0080
Figure imgf000063_0081
Figure imgf000063_0005
Figure imgf000063_0015
Figure imgf000063_0036
Figure imgf000063_0059
Figure imgf000063_0082
8 6 3 1 5 4 7 5 3 5 1 1 6 5 5 1
Figure imgf000063_0083
Figure imgf000063_0011
Figure imgf000063_0024
Figure imgf000063_0028
Figure imgf000063_0050
Figure imgf000063_0054
Figure imgf000063_0084
Figure imgf000063_0021
Figure imgf000063_0043
Figure imgf000063_0085
Figure imgf000063_0004
Figure imgf000063_0014
Figure imgf000063_0019
Figure imgf000063_0022
Figure imgf000063_0032
Figure imgf000063_0044
Figure imgf000063_0060
Figure imgf000063_0086
Figure imgf000063_0087
Figure imgf000063_0006
Figure imgf000063_0016
Figure imgf000063_0037
Figure imgf000063_0061
Figure imgf000063_0088
1 1 5 1 2 4 1 1 3 3 3 2 3
Figure imgf000063_0089
Figure imgf000063_0012
Figure imgf000063_0025
Figure imgf000063_0029
Figure imgf000063_0051
Figure imgf000063_0055
Figure imgf000063_0090
Figure imgf000063_0045
Figure imgf000063_0091
Figure imgf000063_0033
Figure imgf000063_0046
Figure imgf000063_0062
Figure imgf000063_0092
7 8 1 6 6 1
Figure imgf000063_0093
Figure imgf000063_0007
Figure imgf000063_0017
Figure imgf000063_0038
Figure imgf000063_0063
Figure imgf000063_0094
9 1 6 4 8 4 1 9 7 8 1 tn t n t n t n t n t n t n t n t n t n t n t n t n 9 7 9 7 2 8 9 7 9 7 9 7 9 7 9 7 9 9 5 5 9
Figure imgf000063_0095
Figure imgf000063_0098
Figure imgf000063_0099
Figure imgf000063_0102
2 2 2 2 2 2 2 2 7 7 8 8 7
Figure imgf000063_0096
Figure imgf000063_0101
Figure imgf000063_0097
Figure imgf000063_0100
/ 0 / 4 / 4 / 3 / 3 / 8 / / 2 / 2 / 2 / 2 / 2 / 7 7 6 7 7 6 3 5 1 6 6 8 2 ^
Figure imgf000063_0107
Figure imgf000063_0103
Figure imgf000063_0104
Figure imgf000063_0105
Figure imgf000063_0106
Figure imgf000063_0108
2 2 2 2 2 2 7 2 7 2 7 2 6 2 7 2 7 2 6 2 ϲ ^
Figure imgf000063_0109
Figure imgf000063_0114
Figure imgf000063_0110
Figure imgf000063_0111
Figure imgf000063_0112
Figure imgf000063_0113
Figure imgf000063_0115
3 2 9 7 8 3 5 1 5 1 4 9 5 1 3 4 7 8 6 6 6 1 6 4 9
Figure imgf000063_0120
Figure imgf000063_0116
Figure imgf000063_0117
Figure imgf000063_0118
Figure imgf000063_0119
Figure imgf000063_0121
. 3 . 1 . 6 . 2 . 2 . 3 . 2 . 1 . 2 . 4 . 3 . 0 2 . 6 7 . 1 . 2 . 5 . 5 6 5 7 3 4 4
Figure imgf000063_0122
Figure imgf000063_0126
Figure imgf000063_0123
Figure imgf000063_0124
Figure imgf000063_0125
Figure imgf000063_0127
7 2 6 8 8 . 0 . 8 . 5 . 1 4 1 . 3 . 8 . 5 9 6 8 3 7 7 6 7 8 7 5 6 . 7 .
Figure imgf000063_0132
Figure imgf000063_0128
Figure imgf000063_0129
Figure imgf000063_0130
Figure imgf000063_0131
Figure imgf000063_0133
9 9 9 9 9 9 9 9 9 9 9 9 3 9
Figure imgf000063_0138
Figure imgf000063_0134
Figure imgf000063_0135
Figure imgf000063_0136
Figure imgf000063_0137
Figure imgf000063_0139
0
Figure imgf000063_0141
Figure imgf000063_0143
Figure imgf000063_0146
Figure imgf000063_0140
Figure imgf000063_0142
Figure imgf000063_0144
Figure imgf000063_0145
Figure imgf000063_0147
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 .
Figure imgf000063_0152
Figure imgf000063_0148
Figure imgf000063_0149
Figure imgf000063_0150
Figure imgf000063_0151
Figure imgf000063_0153
. 7 . 5 . 9 . 5 . 4 . 6 . 5 . 3 . 5 . 9 0 . 6 0 . 4 2 1 F r o r o r o r r o r o 1 F , F , F , F o , F , F , F 0 F F F n i * a 1 1 0 1 0 1 0 1 1 0 0 F F * 1 1 1 0 F 1 0 F 1 0 F 1 0 F F F1 0 3 0 0 * 1 0 * 1 0 * 1 0 * 1 0 1 0 1 0 *
Figure imgf000063_0157
h
Figure imgf000063_0154
Figure imgf000063_0155
Figure imgf000063_0156
Figure imgf000063_0158
L * c N1 * 1 0 * 2 5 * 1 3 3 3 - * 1 * 3 1 3 3 3 - * 9 9 3 3 - * 3 3 3 3 - * 3 3 3 - * 4 * 1 * 3 3 3-
Figure imgf000063_0160
Figure imgf000063_0165
t
Figure imgf000063_0159
Figure imgf000063_0161
Figure imgf000063_0162
Figure imgf000063_0163
Figure imgf000063_0164
Figure imgf000063_0166
- - - - - D - - D - D - D 3 - D 4- 5- 3 - D h 1 3 3 3 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 g i
Figure imgf000063_0170
Figure imgf000063_0173
L
Figure imgf000063_0167
Figure imgf000063_0168
Figure imgf000063_0169
Figure imgf000063_0171
Figure imgf000063_0172
Figure imgf000063_0174
K K K K K K K K K K ^ ^ K DDDDD DD D D D DDD
Figure imgf000063_0182
Figure imgf000063_0175
Figure imgf000063_0176
Figure imgf000063_0177
Figure imgf000063_0178
Figure imgf000063_0179
Figure imgf000063_0180
Figure imgf000063_0181
Figure imgf000063_0183
B B B B B B B B B B B B B R R R R R R R R R R R R R . 1 2 6 7 0 1 2 3 5 7 8 - d i 5 - - - 8- 9- 1 1 1 1 1 1 1 / 5 / 5 / 5 / 5 / 5 - / 5 - / 5 - - - - - / 5 / 5 5 5 5 b 4 . 4 A. 4 A. 4 A. 4 A. 4 A . 4 A. 4 A . 4 / A . 4 / / / A . 4 A . 4 4 A. A. A A B B B B B B B B B B B B B 2 1 9 9 9 9 9 1 1 9 1 1 0 1 9 F F F F , F 1 )F ( , F 1 1 0 * 0 * F F F F F 0 1 0 1 0 1 0 1 0 4 2 1 3 r 2 1 1 1 1 * 1 * 4 * 1 * 1 * 3 r 0 o F * 0 2 * 2 r o o 0 0 F* 3 * 0 2 * 0 1 * 0 2 * 1 5 0 1 6 6 0 2 0 1 2 2 2 1 3 1 5 8 3 2 5 6 4 2 3 3 1 2 8 8 2 1 1 1 2 1 4 2 2 1 5 2 5 1 4 1 7 6 1 t n t n t n t n t n t n t n t n t n t n t n 5 8 9 7 4 9 2 8 9 7 9 7 9 7 9 9 9 4 2 2 2 2 2 2 7 7 7 9 / / / / 2 2 2 2 2 8 7 3 / / / / / / / 7 2 6 2 8 0 2 7 5 2 5 8 2 6 5 2 5 4 2 6 6 2 6 2 2 7 8 2 7 2 ^ ϲ ^ 6 4 0 . 3 2 . 4 4 7 . 6 3 2 . 0 4 6 . 4 8 9 . 0 3 6 . 8 8 3 . 6 5 6 . 1 4 5 . 4 2 4 . 5 4 5 0 7 6 2 4 7 0 4 6 0 0 4 2 6 4 3 9 4 6 . 7 . . 9 5 9 6 . 9 5 . 9 1 . . . 9 6 9 1 9 4 . . 9 5 9 7 5 . 9 4 9 0 0 0 0 0 0 . 0 5 0 . 0 8 0 . 0 6 0 . 0 . 0 5 7 1 0 . 0 . 0 9 6 1 0 . 0 . 9 0 1 0 . 0 5 0 . 8 FF F F F 1 0 F F F 1 F 1 F F 0 1 0 1 0 4 * 2 1 1 * 0 * 1 1 0 1 0 0 0 4 * 0 0 * L * * * 4 * 0 0 * * 1 1 5 0 - 9- 3- 2- 9- 5- 2- N- 2- 1- 3 1 1 2 3 1 1 3 1 3 3 - 2 ^ K K K K K ^ K ^ K KDDDDD DD DDDDB B B B B B B B B T B R R R R R R R R R N R 0 2 1 - 2 2 2 3 2 4 2 5 2 8 2 1 3 2 3 3 3 4 3 5 -5 -5 -5 -5 -5 -5 -5 - - - / / / / / / / 5 5 5 4 4 4 4 4 4 / / / / . . . . 4 4 4 4 4AAAA. A . A. A . A. A. A. A B B B B B B B B B B B ^ ^ Table 3 – Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain v-gene 4-39 Heavy chain (H) / light chain (L) BA.4/5-1H BA.4/5-31H of antibody BA.4/5-1L - BA.4/5-31H BA.4/5-1L BA.4/5-31L BA.4/5-1H BA.4/5-31L - ϱ^ Table 4 – Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain v-gene 3-30 Heavy chain (H) / light chain (L) BA.4/5-2H BA.4/5-12H of antibody BA.4/5-2L - BA.4/5-12H BA.4/5-2L BA.4/5-12L BA.4/5-2H - BA.4/5-12L Table 5 – Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain v-gene 3-53 Heavy chain (H) / light chain (L) BA.4/5-6H BA.4/5-7H BA.4/5-17H BA.4/5-23H of antibody BA.4/5-6L - BA.4/5-7H BA.4/5-17H BA.4/5-23H BA.4/5-6L BA.4/5-6L BA.4/5-6L BA.4/5-7L BA.4/5-6H BA.4/5-17H BA.4/5-23H BA.4/5-7L - BA.4/5-7L BA.4/5-7L BA.4/5-17L BA.4/5-6H BA.4/5-7H BA.4/5-23H - BA.4/5-17L BA.4/5-17L BA.4/5-17L BA.4/5-23L BA.4/5-6H BA.4/5-7H BA.4/5-17H - BA.4/5-23L BA.4/5-23L BA.4/5-23L ϭϬ^ ^ ϲϰ^ ^ Table 6 – Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain v-gene 3-66 Heavy chain (H) / light chain (L) BA.4/5-8H BA.4/5-10H BA.4/5-28H BA.4/5-32H of antibody BA.4/5-8L - BA.4/5-10H BA.4/5-28H BA.4/5-32H BA.4/5-8L BA.4/5-8L BA.4/5-8L BA.4/5-10L BA.4/5-8H BA.4/5-28H BA.4/5-32H BA.4/5-10L - BA.4/5-10L BA.4/5-10L BA.4/5-28L BA.4/5-8H BA.4/5-10H BA.4/5-32H - BA.4/5-28L BA.4/5-28L BA.4/5-28L BA.4/5-32L BA.4/5-8H BA.4/5-10H BA.4/5-28H - BA.4/5-32L BA.4/5-32L BA.4/5-32L Table 7 – Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain v-genes 3-53 and 3-66 Heavy chain (H) / H H H H light H H - 7 7 1 3 H 6 2 H8 0 1 8 2 2 3 chain 5 - - - - - - - / 5 / 5 5 5 5 5 5 (L) of 4 . 4 / . 4 / . 4 / . 4 / . 4 / . 4 / . 4 . A A A A A A A ntibody B B B B A a B B B B BA.4/5- 6L H7 L H 6 7 1 L H 6 3 2 L HL H 0 L H 8 L H 2 L - 6 8 6 1 6 2 6 3 6 5 -5 -5 -5 -5 -5 -5 - - - - - - - / / / / / / / 5 / 5 / 5 / 5 / 5 / 5 / 5 4 4 4 4 4 4 . 4 . 4 . 4 / . . . . . . 4 . 4 . 4 . 4 . 4 . - AA AA AA AA AA AA AA B B B B B B B B B B B B B B BA.4/5- 7L H6 L H - 7 7 1 L H 7 3 2 L7 H8 L H 7 0 1 L H H 7 8 2 L7 2 3 L7 5 -5 -5 -5 -5 -5 - - - - - - - - / / / / / / 5 / 5 / 5 / 5 / 5 / 5 / 5 5 4 4 4 4 4 . 4 . 4 . 4 / / . . . . . 4 . 4 . 4 . 4 . 4 . 4 . AA AA AA AA AA AA AA B B - B B B B B B B B B B B B BA.4/5- 17L HL 6 7 L H L L H L H L H L 1 H7 7 1 3 2 7 H7 0 7 8 7 2 7 - - - - - 1- 8- 1- 1- 1- 2- 1 3 1 5 5 5 5 5 5 5 - - - / / / 5 5 5 5 5 5 5 4 4 4 / 4 / 4 / 4 / 4 / 4 / 4 / / / / / . . . . . . . . . 4 . 4 . 4 . 4 . 4 . AA AA - AA AA AA AA AA B B B B B B B B B B B B B B BA.4/5- 23L HL 6 3 HL 3 H 7 L 3 HL 3 H 0 L 3 H 8 L 3 H 2 L 3 - 2- 7- 2 1 2 8 2 1 2 2 2 3 2 5 5 5 -5 -5 -5 -5 -5 -5 - - - - - / / / / / 5 5 5 5 5 4 / / / / / / / / / . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . AA AA AA - AA AA AA AA B B B B B B B B B B B B B B ϲϱ^ ^ BA.4/5- 8L H6 L8 H7 L H 8 7 1 L H 8 3 H H H 2 L8 0 1 L8 8 L 2 L - - - - - 2 8 3 8 5 - - - - - - - - - / 5 / 5 / 5 / 5 / 5 / 5 / 5 5 5 5 5 5 5 4 4 4 4 4 4 4 / 4 / 4 / 4 / 4 / 4 / / . . . . . . . . . . . . 4 . 4 . AA AA AA AA - AA AA AA B B B B B B B B B B B B B B BA.4/5- 10L HL L H L H L L 6 0 H0 7 0 3 0 H0 H 8 L 0 H 2 L 0 - 1- 7- 1 1 1 2 1 8 1 2 1 3 1 5 5 5 -5 -5 -5 -5 -5 - - - - - - / 4 / / / / / / / 5 / 5 / 5 / 5 / 5 / 5 / . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . AA AA AA AA AA - AA AA B B B B B B B B B B B B B B BA.4/5- 28L HL 6 8 2 HL H L H L L H L H L 7 8 2 7 1 8 3 8 H8 0 8 2 8 - - - - - 2- 2- 2- 8- 2- 1 2 3 2 5 5 5 5 5 - - - - / 5 5 5 5 5 5 5 5 5 4 / 4 / 4 / 4 / 4 / 4 / 4 / / / / / / / . . . . . . . 4 . 4 . 4 . 4 . 4 . 4 . 4 . AA AA AA AA AA AA - AA B B B B B B B B B B B B B B BA.4/5- 32L HL 6 2 3 HL 7 2 H 3 7 L 1 2 H 3 3 L 2 2 3 HL 8 2 H L H L 3 0 1 2 3 8 2 - - - - - - - - 2 3 5 5 5 5 - - - - - - / / / / 5 / 5 / 5 / 5 / 5 / 5 5 5 5 5 4 4 . 4 . 4 . 4 / / / / / . . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 . AA AA AA AA AA AA AA B B B B B B B B B B B B B B - Table 8 – Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain v-gene 1-69 Heavy chain (H) / light BA.4/5- BA.4/5- BA.4/5- BA.4/5- BA.4/5- chain (L) of 13H 18H 22H 25H 34H antibody BA.4/5-13L - BA.4/5-18H BA.4/5-22H BA.4/5-25H BA.4/5-34H BA.4/5-13L BA.4/5-13L BA.4/5-13L BA.4/5-13L BA.4/5-18L BA.4/5-13H BA.4/5-22H BA.4/5-25H BA.4/5-34H - BA.4/5-18L BA.4/5-18L BA.4/5-18L BA.4/5-18L BA.4/5-22L BA.4/5-13H BA.4/5-18H - BA.4/5-25H BA.4/5-34H BA.4/5-22L BA.4/5-22L BA.4/5-22L BA.4/5-22L BA.4/5-25L BA.4/5-13H BA.4/5-18H BA.4/5-22H BA.4/5-34H BA.4/5-25L BA.4/5-25L BA.4/5-25L - BA.4/5-25L BA.4/5-34L BA.4/5-13H BA.4/5-18H BA.4/5-22H BA.4/5-25H - BA.4/5-34L BA.4/5-34L BA.4/5-34L BA.4/5-34L ϱ^ ϲϲ^ ^ Table 9 – Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain v-gene 3-9 Heavy chain (H) / light chain (L) of BA.4/5-15H BA.4/5-20H BA.4/5- 21H BA.4/5-24H antibody BA.4/5-15L - BA.4/5-20H BA.4/5-21H BA.4/5-24H BA.4/5-15L BA.4/5-15L BA.4/5-15L BA.4/5-20L BA.4/5-15H BA.4/5-21H BA.4/5-24H BA.4/5-20L - BA.4/5-20L BA.4/5-20L BA.4/5-21L BA.4/5-15H BA.4/5-20H BA.4/5-24H - BA.4/5-21L BA.4/5-21L BA.4/5-21L BA.4/5-24L BA.4/5-15H BA.4/5-20H BA.4/5-21H - BA.4/5-24L BA.4/5-24L BA.4/5-24L ϲϳ^ ^ Sequence Listing Amino acid and nucleotide sequences of heavy chain and light chain variable regions of selected antibodies ϱ^ Antibody Heavy Chain Nt Sequence SEQ AA Sequence SEQ ID ID NO: NO: BA.4/5-1 caggtgcagctgcaggagtcgggcccaggact 1 QVQLQESGPGLVK 2 ggtgaagccttcggagaccctgtccctcacctgc PSETLSLTCTVSGG actgtctctggtggctccatcagcagtagtaatta SISSSNYYWGWIRQ ctactggggctggatccgccagcccccaggga PPGKGLEWIGSIYY aggggctggagtggattgggagtatctattatagt SGSSYYSPSLKSRV gggagctcctactatagcccgtccctcaagagtc TISVDTSKSQFSLK gggtcaccatatccgtagacacgtccaagagcc LSSVTAADTAVYY agttctccctgaagctgagctctgtgaccgccgc CASTLGATFYWGQ agacacggctgtttattactgtgcgagcacactg GTLVTVSS ggagctacgttctactggggccagggaaccctg gtcaccgtctcctcag BA.4/5-2 gaagtgcagctggtggagtctgggggaggcgt 13 EVQLVESGGGVVQ 14 ggtccagcctgggaggtccctgagactctcctgt PGRSLRLSCAASGF gcagcctctggtttcaccctcagaagctttggcat TLRSFGIHWVRQAP acactgggtccgccaggctccaggcaaggggc GKGLEWVAFISYD tggagtgggtggcatttatttcatatgatggaagta GSNQYYEDSVKGR atcaatactatgaagactccgtgaagggccgatt FTISRDNSKNTVDL caccatctccagagacaattccaagaacacggtg QMNSLSTEDTAVY gatctgcagatgaacagcctgagtactgaggac WCAKDLLPLLALY acggctgtgtattggtgtgcgaaagatcttttgcc YGMDVWGQGTTV gctactcgctctgtactacggtatggacgtctggg TVSS gccaagggaccacggtcaccgtctcttca BA.4/5-6 caggtgcagctggtggagtctggaggaggcttg 25 QVQLVESGGGLVQ 26 gtccagcctggggggtccctgagactctcctgtg PGGSLRLSCAVSET cagtctctgagaccatcgtcagtagaaactacatg IVSRNYMSWVRQA agttgggtccgccaggctccagggaaggggct PGKGLEWVSVIYP ggagtgggtctcagttatttatcccggtggtagta GGSTFYADSVKGR cattctacgcagactccgtgaagggccgattcac FTISRHNSKNTLYL catctccagacacaattccaagaacacgctgtatc RMNSLRAEDTAVY ttagaatgaacagcctgagagctgaggacacgg YCVRDFGDFYFDY ccgtatattactgtgtgagagacttcggtgacttct WGQGTLVTVSS actttgactactggggccagggaaccctggtcac cgtctcctcag BA.4/5-7 gaagtgcagctggtggagactggaggaggcttg 37 EVQLVETGGGLMQ 38 atgcagcctggggggtccctgagactctcctgtg PGGSLRLSCAASEII cagcctctgagatcattgtcagtagaaactacatg VSRNYMNWVRQA aactgggtccgccaggctccagggaaggggct PGKGLEWVSILYSG ggagtgggtctcaattctttatagcggtggtagca GSTFYADSVKGRF cattctacgcagactccgtgaagggtcgcttcac TISRDEPINTLFLQM ϲ^^ ^ catctccagagacgagcccataaacacactgttt NSLRVEDTAVYYC cttcaaatgaacagcctgagagtcgaggacacg ARSYGDFYIDIWGR gccgtgtattactgtgccagatcttacggtgacttc GTLVTVSS tacattgacatctggggccggggaaccctggtca ccgtctcctcag BA.4/5-8 gaagtgcagctggtggagtctgggggaggcttg 49 EVQLVESGGGLVQ 50 gtccagccgggggggtccctgagactgtcctgt PGGSLRLSCAGSGI gcaggctctggaatcaccgtcagtagcaactaca TVSSNYMIWVRQA tgatctgggtccgccaggctccagggaagggg PGKGLEWVSVIYS ctggagtgggtctcagtaatttatagtggtggtac GGTTYYADSVKGR cacatactacgcagactccgtgaagggccgattc FTIARDKSKNTLYL accatcgccagagacaagtccaagaacacgctg QMNSLRAEDTAVY tatcttcaaatgaacagcctgagagctgaggaca YCARPIMGAISGM cggctgtctattactgtgcgagacctataatggga DVWGQGTTVTVSS gctatatctggtatggacgtctggggccaaggga ccacggtcaccgtctcctca BA.4/5-9 gaggtgcagctggtgcagtctgggcctgaggtg 61 EVQLVQSGPEVKK 62 aagaagcctggggcctcagtgaaggtttcctgca PGASVKVSCKASG aggcatctggagacaccttcatcaactccttttttc DTFINSFFHWVRQA actgggtgcgacaggcccctggacaaggacttg PGQGLEWMGIINPS agtggatgggaataatcaaccctagtggtgttag GVSTTYAQKFQGR cacaacctacgcacagaagttccagggcagagt VTMTRDTSTTTFY caccatgaccagggacacgtccacgactactttc MELSSLRSADTAV tacatggagctgagcagcctgagatctgcggac YYCARENGGNSGD acggccgtctattactgtgccagagagaacggtg FDYWGQGALVTVS gtaactccggagactttgactactggggccagg S gagccctggtcaccgtctcctcag BA.4/5-10 gaggtgcagctggtggagtctgggggaggcttg 73 EVQLVESGGGLVQ 74 gtccagcctggggggtccctgagactctcctgtg PGGSLRLSCAASGF cagcctctggattcaccgtcagtaggaattacatg TVSRNYMSWVRQ agctgggtccgccaggctccggggaaggggct APGKGLEWVSLIYS ggagtgggtctcacttatttatagcggtggtagca GGSTYYADSVKGR catactacgcagactccgtgaagggccgattcac FTISRDNSKNTLYL catctccagagacaattccaagaacacgctgtat QMNSLRAEDTAVY cttcaaatgaacagcctgagagctgaggacacg YCARPIVGVISGMD gctgtgtattactgtgcgagacctatagtgggagt VWGQGTTVTVSS tatatctggtatggacgtctggggccaagggacc acggtcaccgtctcctca BA.4/5-11 caggtgcagctggtggagtctgggggaggcgt 85 QVQLVESGGGVVQ 86 ggtccagcctgggaggtccctgagactctcctgt PGRSLRLSCAASGF gcagcgtctggattcaccttcagtaactatggcat TFSNYGMHWVRQ gcactgggtccgccaggctccaggcaaggggc APGKGLEWVAVIW tggagtgggtggcagttatatggtctgatggaaat SDGNSKYNADSVK agtaaatataatgcagactccgtgaagggccgat GRFTISRDKSKNTL tcaccatctccagagacaaatccaagaacacgct YLQMNSLRAEDTA gtatctgcaaatgaacagcctgagagccgagga VYYCARDHYYDSS cacggctgtgtattactgtgcgagagatcattact GYTLDAFDIWGQG atgatagtagtggttacacccttgatgcttttgatat TMVTVSS ctggggccaagggacaatggtcaccgtctcctc ag ϲ^^ ^ BA.4/5-12 gaagtgcagctggtggagtctgggggaggcgt 97 EVQLVESGGGVVQ 98 ggtccagcctgggaggtccctgagactctcctgt PGRSLRLSCAASGF gcagcctctggattcaccttcagtatctatggcat TFSIYGMYWVRQA gtactgggtccgccaggctccaggcaaggggct PGKGLEWVAVISY ggagtgggtggcagtgatatcatatgacggaagt DGSNKNYADSVKG aacaaaaactatgcagattccgtgaagggccgat RFTISRDNSKNTVY tcaccatctccagagacaattccaagaacacggt LQMSSLRAEDTGM gtatctgcaaatgagcagcctgagagctgagga YYCAKDSKGYVD cacgggtatgtactactgtgcgaaagattcaaaa WSLGTYYYYAMD ggatatgttgactggtcattggggacttattactac VWGQGTTVTVSS tacgctatggacgtctggggccaagggaccacg gtcaccgtctcctca BA.4/5-13 gaggtgcagctggtgcagtctggggctgaggtg 109 EVQLVQSGAEVKK 110 aagaagcctgggtcctcggtgaaagtctcctgca PGSSVKVSCKASG aggcttctggaggcagtttcagcagatatgctata GSFSRYAISWVRQ agctgggtgcgacaggcccctggacaagggctt APGQGLEWMGGII gagtggatgggagggatcatccctatgtatggga PMYGTPNYAQKFQ caccaaactacgcacagaagttccagggcagag GRVTITAVESTTTA tcacgattaccgcggtcgaatccacgaccacag YMELTSLRSEDTA cctacatggagctgaccagcctgagatctgagg VYYCARESNKYTY acacggccgtgtattactgtgcgagagaatcgaa GFPSYYYYGMDV caaatacacctatggttttccgagctactactacta WGQGTTVTVSS cggtatggacgtctggggccaagggaccacgg tcaccgtctcctca BA.4/5-15 gaggtgcagctggtggagtctgggggaggcttg 121 EVQLVESGGGLVE 122 gtagaacctggcaggtccctgagactctcctgtg PGRSLRLSCAASGF cagcctctggattcacctttgatgattctgccatgc TFDDSAMHWVRQ actgggtccggcaagctccagggaagggcctg APGKGLEWVSGIS gagtgggtctcaggtattagttggaatagtgctag WNSASIAYADSVK tattgcctatgcggactctgtgaagggccgattca GRFTISRDNAKKSL ccatctccagagacaacgccaagaaatccctgta YLQMKSLRAEDTA tttgcaaatgaaaagtctgagagctgaggacacg LYYCAKDITSILTD gccttgtattactgtgcaaaagacataacctccatt KDYGMDVWGQGT ttgacagacaaagactacggtatggacgtctggg TVTVSS gccaagggaccacggtcaccgtctcctca BA.4/5-17 gaggtgcagctggtggagtctggaggaggcttg 133 EVQLVESGGGLVQ 134 gtccagcctggggggtccctgagactctcctgtg PGGSLRLSCAASGL cagcctctggactcatcgtcagtagcaactacatg IVSSNYMSWVRQT agttgggtccgccagactccagggaaggggct PGKGLEWVSVIYS ggagtgggtctcagttatttatagcggtggtagca GGSTFYADSVRGR cattctacgcagattccgtgaggggccgattcac FTISRHNSKNTLFL catctccagacacaattccaagaacaccctgtttc QMDSLRAEDSAVY ttcaaatggacagcctgagagcggaggactcgg YCARSIAVAAHGA ccgtgtattactgtgcgaggagtatagcagtggct YGVDVWGQGTTV gcccacggcgcctacggtgtggacgtctgggg TVSS ccaagggaccacggtcaccgtctcctca BA.4/5-18 gaggtgcagctggtggagtctggggctgaggtg 145 EVQLVESGAEVKK 146 aagaagcctgggtcctcggtgaaggtctcctgca PGSSVKVSCKASG aggcttctggagacaatttcagcagatatgctata DNFSRYAISWVRQ agttgggtgcgacaggcccctggacaagggctt APGQGLEWMGGII ϳϬ^ ^ gagtggatgggagggatcatcccgatgtatggg PMYGTPNYAQKFQ acaccaaactacgcacagaagttccagggcaga GRVTITAVESTSTA gtcacgattaccgcggtcgaatccacaagcaca YMELTSLRSEDTA gcctacatggagctgaccagcctgagatctgag MYYCARESNKYTY gacacggccatgtattactgtgcaagagaatcga GFPSYYYYGMNIW ataaatacacctatggttttccgagctactactact GQGTTVTVSS acggtatgaatatctggggccaagggaccacgg tcaccgtctcctca BA.4/5-20 gaggtgcagctgttggagtctgggggaggcttg 157 EVQLLESGGGLVQ 158 gtacagcctggcaggtccctgagactctcctgtg PGRSLRLSCAASRF cagcctctcgattcacttttgctgattatgccatgc TFADYAMHWVRQ actgggtccggcaagttcctgggaagggcctgg VPGKGLEWVSGIA agtgggtctcaggtattgcttggaatagtgctaat WNSANIAYAGSVR atagcctatgcgggctctgtgaggggccgattca GRFTISRDNAKNSL ccatctccagagacaacgccaagaactccctgta YLQMNSLRVEDTA tctgcaaatgaacagtctgagagttgaggacacg LYYCAKDITPILTD gccttgtattactgtgcaaaagatataacccccatt QEYGMDVWGQGT ttgacagaccaggaatacggcatggacgtctgg TVTVSS ggccaagggaccacggtcaccgtctcctca BA.4/5-21 gaggtgcagctggtggagtctgggggaggcttg 169 EVQLVESGGGLVH 170 gtccaccctggcaggtccctgagactctcctgtgt PGRSLRLSCVTSGFI aacctctggattcatatttgatcatcatgccctgca FDHHALHWVRQAP ctgggtccggcaagctccagggaagggcctgg GKGLEWVSGISWN agtgggtctcaggtattagttggaatagtgggact SGTIGYAASVKGRF ataggctatgcggcctctgtgaagggccggttca TISRDNAKNSLFLQ ccatctccagagacaacgccaagaactccctgtt MNSLRAEDTALYY tctgcaaatgaacagtctgagagctgaggacac CVKDLNYDFSGYF ggccttgtattactgtgtaaaagatttgaactatgat KNGFEDWGRGTLV tttagtggttatttcaaaaacggctttgaggattgg TVSS ggccggggaaccctggtcaccgtctcctcag BA.4/5-22 caggtgcagctggtgcagtctggggccgaggtg 181 QVQLVQSGAEVKK 182 aagaagcctgggtcgtcggtgaaggtctcctgta PGSSVKVSCKISGG agatttctggaggctccatcaggaactatgctatt SIRNYAITWVRQAP acttgggtgcgacaggcccctggccaagggctt GQGLEWMGGIIPIF gagtggatgggggggatcatccctatctttggtc GPATYAQKFQGRL cagcaacctacgcacagaaattccagggcagac TIAADESTGTVYM tcacaatagccgcggacgaatccacgggcaca DLSSLRSEDTAVYY gtctacatggacttgagcagcctgagatctgagg CAPLGYSGYNFGF acacggccgtgtactactgtgccccactgggttat QHWGQGTTVTVSS agtggctacaattttggctttcaacactggggcca gggaaccacggtcaccgtctcctcag BA.4/5-23 gaggtgcagctgttggagtctggaggaggcctg 193 EVQLLESGGGLIQP 194 atccagcctggggggtccctgagactctcctgtg GGSLRLSCAASEFI cagcctctgagttcatcgtcagcaggaactacat VSRNYMSWVRRTP gagctgggtccgccggactccagggaggggac GRGLEWVSTIYPG tggaatgggtctcaacaatttatcccggtggaagt GSTFYADSVKGRF acattctacgcagactccgtgaagggccgattca TISRDHSQNTLFLQ ccatctccagagaccattcccagaatacactgttt MNNLRAADTAVY cttcaaatgaacaacctgagagccgcggacacg YCARDYGDFFFDY gccgtctattactgtgcgagagactacggtgactt WGQGTLVTVSS ϳϭ^ ^ cttttttgactactggggccagggaaccctggtca ccgtctcctcag BA.4/5-24 gaggtgcagctggtggagtctgggggagactta 205 EVQLVESGGDLVQ 206 gtacagcctggcaggtccctgagactctcctgtg PGRSLRLSCAASGF cagcctccggattcacctttgatgactttgccatgc TFDDFAMHWVRQP actgggtccggcaacctccagggaagggcctg PGKGLEWVSGISW gagtgggtctcaggtattagttggaatagcggta NSGNIGYADSVKG acatagggtatgcggactctgtgaagggccgatt RFTISRDNGKSSLY caccatctccagagacaacggcaagagctccct LQMNSLKTEDTAF gtatctgcaaatgaacagtctgaaaactgaagac YYCAKDLNYDSSG acggccttctattactgtgcaaaagatctgaactat YLYNGFALWGQGT gacagtagtggttatctttacaatggctttgccctct LVTVSS ggggccagggaaccctggtcaccgtctcttcag BA.4/5-25 caggtgcagctggtggagtctggggctgaggtg 217 QVQLVESGAEVKQ 218 aagcagcctgggtcctcggtcaaggtctcctgca PGSSVKVSCKASG aggcttctggagacaccttcagcctctctgctatc DTFSLSAITWVRQA acctgggtgcgccaggcccctggacaagggctt PGQGLEWMGRIVPI gagtggatgggaaggatcgtccctatccctaata PNIAQNSEKFQGRV tagctcagaactctgagaagttccagggcagagt TITANKSTSTAYME caccattaccgcgaacaaatccacgagcacagc LSRLTSEDTAVYYC ctacatggaactgagccgcctgacatctgagga ARGDEAMAFWGQ cacggccgtctattattgtgcgagaggggatgag GTLVTVSS gccatggccttctggggccagggaaccctggtc accgtctcctcag BA.4/5-28 gaggtgcagctggtgcagtctgggggaggcttg 229 EVQLVQSGGGLVQ 230 gtccagcctggggggtccctgagactctcctgtg PGGSLRLSCAASGV cagcctctggagtcaccgtcagtcacaactacat TVSHNYMNWVRQ gaattgggtccgccaggctccagggaaggggc APGKGLEWVSIIYA tggagtgggtctcaattatttatgccggtgggacc GGTTYYADSVRGR acatactacgcagactccgtgaggggcagattc FTISRDNSKNTLYL accatctccagagacaattccaagaacaccctgt QLNSLRGEDTAVY atcttcaactgaacagcctgagaggcgaggaca YCARDLLERGGMD cggctgtctattactgtgcgagagatctactggag VWGQGTTVTVSS cggggcggtatggacgtctggggccaagggac cacggtcaccgtctcctca BA.4/5-31 caggtgcagctgcaggagtcgggcccaggact 241 QVQLQESGPGLVK 242 ggtgaagccttcggagaccctgtccctcacctgc PSETLSLTCTVSGG actgtctctggtggctccatcagcagtagtaatta SISSSNYYWGWIRQ ctactggggctggatccgccagcccccaggga PPGKGLEWIGSIYY aggggctggagtggattgggagtatctattatagt SGRSYYSPSLKSRV gggagatcctactatagcccgtccctcaagagtc TISVDTSKSQFSLK gggtcaccatatccgtagacacgtccaagagcc LSSVTAADTAVYY agttctccctgaagctgagctctgtgaccgccgc CASTLGATFYWGQ agacacggctgtttattattgtgcgagcacactgg GTLVTVSS gagctacgttctactggggccagggaaccctgg tcaccgtctcctcag BA.4/5-32 gaggtgcagctggtggagtctgggggaggcttg 253 EVQLVESGGGLVQ 254 gtccagcctggggggtccctgagactctcctgtg PGGSLRLSCAASEII cagcctctgaaatcatcgtcagcagaaactacat VSRNYMTWVRQA gacctgggtccgccaggctccagggaaggggc PGKGLEWVSVLYP ϳϮ^ ^ tggagtgggtctcagttctttatcctgggggtacc GGTTFYADSVKGR acattctacgcagactccgtgaagggccgattca FTISRDSSKNTLYL ccatctccagagacagttccaagaacacgctgta QMHGLRAEDTAV tctgcaaatgcatggcctgagagctgaggacac YYCARDVRDAFDV ggctgtgtattactgtgcgagagatgttcgagatg WGQGTTVTVSS cttttgatgtctggggccaagggaccacggtcac cgtctcctcag BA.4/5-33 caggtgcagctggtggagtctgggggaggcttg 265 QVQLVESGGGLVQ 266 gtacagcctggggggtccctgagactctcctgc PGGSLRLSCAASGF gcagcctctggattcacctttagcagctctgccat TFSSSAMSWVRQA gagctgggtccgccaggctccagggaaggggc PGKGLEWVSGISD tggagtgggtctcaggtattagtgatgctggtctta AGLNTYYGDSVKG acacgtactacggagactccgtgaagggccgct RFIISRDNSKNTVH tcatcatctccagagacaattccaagaacacggt LQLNSLRAEDTAV gcatctgcaattgaacagtctgagagccgagga YFCAIGYSPDYWG cacggccgtctatttttgtgcgattggatacagcc QGTLVTVSS ccgactactggggccagggaaccctggtcacc gtctcctcag BA.4/5-34 caggtgcagctggtggagtctggggctgaggtg 277 QVQLVESGAEVKK 278 aagaagcctgggtcctcggtgaaagtctcctgca PGSSVKVSCKVSG aggtctctggagggagcttcagaaattatgctatc GSFRNYAISWVRQ agttgggtacgacaggcccctggacaagggctt APGQGLEWMGGII gagtggatgggagggatcatcccgatctttggtc PIFGPATYTQKFKG cggcaacctacacacagaagttcaagggcaga RVKITADESTNTAY gtcaaaatcaccgcggacgaatccacgaacaca MEMSSLRSEDTAV gcctacatggagatgagcagcctgagatctgaa YYCAPLGYSGYNF gacacggccgtgtactactgtgccccacttggat GFEYWGQGTLVTV atagtggctacaattttgggtttgagtattggggcc SS agggaaccctggtcaccgtctcctcag Antibody Light Chain Nt Sequence SEQ AA Sequence SEQ ID ID NO: NO: BA.4/5-1 gacatccagttgacccagtctccatcctccctgtc 7 DIQLTQSPSSLSASV 8 tgcatctgtaggagacaaagtcaccatcacttgc GDKVTITCRASQGI cgggcgagtcagggcattagcaattctttagcct SNSLAWYQQNPGK ggtatcagcagaacccagggaaagcccctaaa APKLLLYTASTLES ctcctgctctatactgcatccacattggaaagtgg GVPSRFSGSGSGTD ggtcccatccaggttcagtggcagtggatctgg FTLTISSLQPEDFAT gacggatttcactctcaccatcagcagcctgcag YYCQQYYDTWYT cctgaagattttgcaacttattactgtcaacagtatt FGQGTKVDIK atgatacctggtacacttttggccaggggaccaa agtggatatcaaac BA.4/5-2 gatattgtgatgactcagtctccagccaccctgtc 19 DIVMTQSPATLSLS 20 tttgtctccaggggaaagagccaccctctcctgc PGERATLSCRASQS agggccagtcagagtgttagcagctacttagcct VSSYLAWYQQKPG ggtaccaacagaaacctggccaggctcccagg QAPRLLIYEASNRA ctcctcatctatgaagcatccaacagggccactg TGIPARFSGSGSGT ϳϯ^ ^ gcatcccagccaggttcagtggcagtgggtctg DFTLTISSLEPEDFA ggacagacttcactctcaccatcagcagcctaga AYYCQQRSNFPFIF gcctgaagattttgcagcttattactgtcagcagc GPGTKVEIK gtagcaacttccccttcattttcggccctgggacc aaggtggaaatcaaac BA.4/5-6 gacatccagatgacccagtctccaggcaccctg 31 DIQMTQSPGTLSLS 32 tctttgtctccaggggaaagagccaccctctcct PGERATLSCRASQS gcagggccagtcagagtgttgacagcggctcct VDSGSLAWYQQKP tagcctggtaccagcaaaagcctggccaggctc GQAPRLLIYDASSR ccaggctcctcatctatgatgcatccagcagggc ATGIPDRFSGSGSG cactggcatcccagacaggttcagtggcagtgg TDFTLTISVLEPEDF gtctgggacagacttcactctcaccatcagcgtg AVYYCQQYSSSPR ctggagcctgaagactttgcagtgtattactgtca TFGQGTKVEIK gcagtatagtagctcacctcgaacttttggccag gggaccaaggtggaaatcaaac BA.4/5-7 gaaatagtgatgacgcagtctccagccaccctgt 43 EIVMTQSPATLSVS 44 ctgtgtctccaggggaaggagccaccctctcct PGEGATLSCRASQS gcagggccagtcagagtgttagcagcaacttag VSSNLAWYQQEPG cctggtaccagcaagaacctggccaggctccca QAPRLLIYGASSRA ggctcctcatctatggtgcatcctccagggccac TGIPTRFSGSGSGTE tggtatcccaaccaggttcagtggcagtgggtct FTLTISSLQSEDFAV gggacagagttcactctcaccatcagcagcctg YYCQQYNDWPGTF cagtctgaagattttgcagtttattactgtcagcag GRGTKVDIK tataatgactggcccgggacgttcggccgaggg accaaagtggatatcaaac BA.4/5-8 gccatccagatgacccagtctccatcctccctgt 55 AIQMTQSPSSLSAS 56 ctgcatctgtaggcgacagagtcaccatcacttg VGDRVTITCQASQ ccaggcgagtcaggaccttaacaaatatttaaatt DLNKYLNWYQQK ggtatcaacagaaaccagggaaagcccctaag PGKAPKLLIYDASN ctcctgatctacgatgcatccaatttggaaacagg LETGVPSRFSGSGS ggtcccatcaaggttcagtggaagtggatctgg GTDFTFTISSLQPED gacagattttactttcaccatcagcagcctgcagc IATYYCQQYDNLP ctgaagatattgcaacatattactgtcaacagtat YTFGQGTKVEIK gataatctcccgtacacttttggccaggggacca aggtggaaatcaaac BA.4/5-9 gaaatagggatgacgcagtctccggccaccctg 67 EIGMTQSPATLSLS 68 tctttgtctccaggggaaagaggcaccctctcct PGERGTLSCRASQS gcagagccagtcagagtgttagcagctacttag VSSYLAWYQQKPG cctggtaccaacagaaacctggccaggctccca QAPRLLIYNASNRA ggctcctcatctataatgcatccaacagggccac TGIPARFSGSGSGT tggcatcccagccaggttcagtggcagtgggtct DFTLTISSLEPEDFA gggacagacttcactctcaccatcagcagccta VYYCQQHYNWPR gagcctgaagattttgcagtttattactgtcagca YSFGQGTKVDIK gcattacaactggcctcggtacagttttggccag gggaccaaagtggatatcaaac BA.4/5-10 gacatccagatgacccagtctccatcctccctgt 79 DIQMTQSPSSLSAS 80 ctgcatctgtaggagacagagtcaccatcacttg VGDRVTITCQASQ ccaggcgagtcaggacattaacaactatttaaatt DINNYLNWYQQKP ggtatcaacagaaaccagggaaagcccctaag GKAPKLLIYAASNL ctcctgatctacgctgcatccaatttggaaacagg ETGVPSKFSGSGSG ϳϰ^ ^ ggtcccatcaaagttcagtggaagtggatctggg TDFTFTINSLQPEDI acagattttactttcaccatcaacagcctgcagcc ATYYCHQYDNLPY tgaagatattgcaacatattactgtcaccagtatg TFGQGTKVEIK ataatctcccgtacacttttggccaggggaccaa ggtggaaatcaaac BA.4/5-11 gccatccagttgacccagtctccatcctccctgtc 91 AIQLTQSPSSLSASV 92 tgcatctgtaggagacagagtcaccatcacttgc GDRVTITCRASQSI cgggcaagtcagagcattagcagctatttaaatt SSYLNWYQQKPGK ggtatcagcagaaaccagggaaagcccctaag APKLLIYAASTLQS ctccttatctatgctgcatccactttgcaaagtggg GVPSRFSGSGSGTD gtcccatcaaggttcagtggcagtggatctggga FTLTISSLQPEDFAT cagatttcactctcaccatcagcagtctgcaacct YYCQQSYSTLMYT gaagattttgcaacttactactgtcaacagagtta FGQGTKVEIK cagtaccctcatgtacacttttggccaggggacc aaggtggagatcaaac BA.4/5-12 gccatccagttgacccagtctccatcctccctgtc 103 AIQLTQSPSSLSASV 104 tgcatctgtaggagatagagtcaccatcacttgc GDRVTITCQASQDI caggcgagtcaggacattagcaactatttaaatt SNYLNWYQQKSG ggtatcagcagaaatcagggaaagcccctgag KAPELLIYDASNLE ctcctgatctacgatgcatccaatttggaaacagg TGVPSRFSGSGSGT ggtcccatcaaggttcagtggaagtggatctgg DFTFTISSLQPEDFA gacagattttactttcaccatcagcagcctgcagc TYYCQQYDNLPLT ctgaagattttgcaacatattactgtcaacaatatg FGQGTRLEIK acaatctccccctcaccttcggccaagggacac gactggagattaaac BA.4/5-13 gccatccggatgacccagtctccatcctccctgt 115 AIRMTQSPSSLSASI 116 ctgcatctataggagacagagtcaccatcacttg GDRVTITCQASQDI ccaggcgagtcaggacataagcaaccacttaaa SNHLNWYQQKPG ttggtatcagcagaaaccagggaaagcccctaa KAPKLLIYDVSDLE gctcctgatctacgatgtttccgatttggaaacag TGVPSRFSGSGSGT gggtcccctcaaggttcagtggaagtggatctg EFTFTISSLQPEDIA ggacagaatttactttcactatcagcagcctgcag TYYCQQYDDFPLF cctgaagatattgcaacatattactgtcaacagtat GPGTKVDIK gatgatttccctcttttcggccctgggaccaaagt ggatatcaaac BA.4/5-15 cagtctgtcgtgacgcagccaccctcagcgtctg 127 QSVVTQPPSASETP 128 agacccccgggcggagggtcaccatctcttgtt GRRVTISCSGSSSNI ctggaagcagctccaacatcggaattaatactgt GINTVNWYQQLPG aaactggtaccagcagctccccggaacggccc TAPKLLIYTNNQRP ccaaactcctcatctatactaataatcagcggccc SGVPDRFSGSKSGT tcaggggtccctgaccgattctctggctccaagt SASLAISGLQSEDE ctggcacctcagcctccctggccatcagtgggct ADYYCASWDDSLN ccagtctgaggatgaggctgattattactgtgcat GFYVFGTGTKVTV catgggatgacagcctgaatggtttttatgtcttcg L gaactgggaccaaggtcaccgtcctag BA.4/5-17 aattttatgctgactcagccgccctcagtgtctgc 139 NFMLTQPPSVSAAP 140 ggccccaggacagaaggtcaccatctcctgctc GQKVTISCSGSISNI tggaagcatctccaacattgggaataattatgtat GNNYVSWYQQLP cctggtaccagcagctcccaggaacagccccc GTAPKLLIYDNNK aaactcctcatttatgacaataataagcgaccctc RPSGIPDRFSGSKS ϳϱ^ ^ agggattcctgaccgattctctggctccaagtctg GTSATLGITGLQTG gcacgtcagccaccctgggcatcaccggactcc DEADYYCGTWDSS agactggggacgaggccgattattactgcggaa LSALVFGTGTEVTV catgggatagcagcctgagtgctcttgtcttcgg L aactgggaccgaggtcaccgtcctcg BA.4/5-18 gtcatctggatgacccagtctccatcctccctgtc 151 VIWMTQSPSSLSAS 152 tgcatctataggagacagagtcaccatcacttgc IGDRVTITCQASQD caggcgagtcaggacataagcaatcacttaaatt ISNHLNWYQQKPG ggtatcagcagaaaccagggaaagcccctaag KAPKLLIYDVSDLE ctcctgatctacgatgtgtccgatttggaaacagg TGVPSRFSGGGSGT ggtcccctcaaggttcagtggaggtggatctgg EFTFTISSLQPEDVA gacagaatttactttcaccatcagcagcctgcag TYYCQEYDDFPLF cctgaagatgttgcaacatattactgtcaagagta GPGTKVEIK tgatgatttccctcttttcggccctgggaccaagg tggaaatcaaac BA.4/5-20 cagtctgtggtgactcagccaccctcagcgtctg 163 QSVVTQPPSASGTP 164 ggacccccgggcagagggtcaccatctcttgtt GQRVTISCSGSSSNI ccggaagcagctccaacatcggaagcaatactg GSNTVNWFQQFPG taaactggttccagcagttcccaggaacggccc TAPKLLIYSNNQRP ccaaactcctcatctatagtaataatcagcggccc SGVPDRFSGSKSGT tcaggggtccctgaccgattctctggctccaagt SASLAISGLRSEDE ctggcacctcagcctccctggccatcagtgggct ADYYCAAWDDSLS ccggtctgaggatgaggctgattattactgtgca GFYVFGTGTKVSV gcttgggatgacagcctgagtggtttttatgtcttc L ggaactgggaccaaggtcagcgtcctag BA.4/5-21 gacatccagttgacccagtctccatccttcctgtct 175 DIQLTQSPSFLSASV 176 gcgtctgtaggagacagagtcgttatcacttgcc GDRVVITCRASQDI gggccagtcaggacattagcacttatttagcctg STYLAWYQQEPGK gtatcagcaagaaccagggaaagcccctaagct APKLLIYAASTLQS cctgatctatgctgcatccactttgcaaagtgggg GVPSRFSGSGSGPE tcccatcaaggttcagcggcagtggatctgggc FTLTISSLQPEDFAT cagagttcactctcacaatcagcagcctgcagcc YYCQQHYTYPVTF tgaagattttgcaacttattactgtcaacagcattat GGGTKVEIK acttacccagtcactttcggcggagggaccaag gtggagatcaaac BA.4/5-22 gatattgtgatgactcagtctccactctccctgcc 187 DIVMTQSPLSLPVT 188 cgtcacccttggacagccggcctccatctcctgc LGQPASISCRSNLS aggtctaatctaagcctcgtatacagagatggag LVYRDGDTYLNWF acacctacttgaattggtttcagcagaggccagg QQRPGQSPRRLIYK ccaatctccaaggcgcctcatttataaagtttttaa VFNRDSGVPDRFS ccgggactctggggtcccagacagattcagcg GSGSGTDFTLKISR gcagtgggtccggcactgatttcacactgaaaat VEAEDVGVYYCM cagcagagtggaggctgaggatgttggggtttat QGTHWPGTFGQGT tactgcatgcaaggtacgcactggccggggac KVEIK gttcggccaagggaccaaggtggagatcaaac BA.4/5-23 gacatccagttgacgcagtctccaggcaccctgt 199 DIQLTQSPGTLSLSP 200 ctttgtctccaggggaaagagccaccctctcctg GERATLSCRASQSL cagggccagtcagagtctttctagcagttacttag SSSYLAWYQQKPG cctggtaccagcagaaacctggccaggctccca QAPRLLIYDASSRA ggctcctcatctatgatgcatccagcagggccac TGIPDRFSGSGSGT ϳϲ^ ^ tggcatcccagacaggttcagtggcagtgggtct DFTLTISRLEPEDFA gggacagacttcactctcaccatcagcagactg VYYCQQYGRSPRT gaacctgaagattttgcagtgtattactgtcagca FGQGTKVDIK gtatggtaggtcacctcggacgttcggccaagg gaccaaagtggatatcaaac BA.4/5-24 gccatccggatgacccagtctccatcctttctgtc 211 AIRMTQSPSFLSAS 212 tgcatctgtaggagacagagtcaccgtcacttgc VGDRVTVTCRASE cgggccagtgaagacattagtacttatgtagcct DISTYVAWYQQKP ggtatcagcaaaaaccaggtaaagcccctaggc GKAPRLLIYTASTL tcctgatctatactgcatccactttgcataatgatgt HNDVPSRFSGSGSG cccatcaaggttcagcggcagtggatctggggc AEFTLTISSLQPDDF agaattcactctcacaatcagcagcctgcagcct ATYYCQQLHTYPV gacgattttgcaacttattactgtcaacaacttcat TFGGGTKVDIK acctacccagtcactttcggcggagggaccaaa gtggatatcaaac BA.4/5-25 gccatccagatgacccagtctccttccaccctgt 223 AIQMTQSPSTLSAS 224 ctgcatctgtaggaggcagagtcaccatcacttg VGGRVTITCRASQT ccgggccagtcagactattaattcctggttggcct INSWLAWYQHKPG ggtatcagcacaaaccagggaaagcccctcaa KAPQLLIYDASSLQ ctcctgatctatgatgcctccagtttgcaaagtgg SGVPSRFSGSGSGT ggtcccatcaaggttcagcggcagtggatctgg EFTLTISSLQPDDFA gacagaattcactctcaccatcagcagcctgcag TYYCQQYKSYPCT cctgatgattttgcaacttattactgccaacagtat FGQGTKVDIK aaaagttatccttgcacttttggccaggggacca aagtggatatcaaac BA.4/5-28 caggctgtgctgactcagccaccctcaatgtcgg 235 QAVLTQPPSMSVA 236 tggccccaggaaagacggccaccattacctgtg PGKTATITCGGDNF ggggagacaactttggaggtcaaagtgtgcact GGQSVHWYQQRP ggtaccagcagaggccaggccaggcccctgtc GQAPVLVIYSTRDR ttggtcatctattctactcgcgaccggccctcagg PSGVPERFSGSASG ggtccctgagcgattctctggctccgcctctggg NTATLTITRVEAGD aacacggccaccctgaccatcaccagggtcga EADYYCQVWDSSN agccggggatgaggccgactattactgtcaggt DHQVFGGGTKLTV gtgggatagtagtaatgatcatcaggttttcggcg L gagggaccaagctgaccgtcctag BA.4/5-31 gatgttgtgatgactcagtctccatcctccctgtct 247 DVVMTQSPSSLSAS 248 gcatctgtaggagacaaaatcaccatcacttgcc VGDKITITCRASQG gggcgagtcagggcattagcaattctttagcctg ISNSLAWYQQNPG gtatcagcagaacccagggaaagcccctaaact KAPKLLLYTASTLE cctgctctatactgcatccacattggaaagtggg SGVPSRFSGSGSGT gtcccatccaggttcagtggcagtggatctggga DFTLTISSLQPEDFA cggatttcactctcaccatcagcagcctgcagcc TYYCQQYYDTWY tgaagattttgcaacttattactgtcaacagtattat TFGQGTKVDIK gatacctggtacacttttggccaggggaccaaa gtggatatcaaac BA.4/5-32 cagactgtggtgactcagccaccctcggtgtca 259 QTVVTQPPSVSVAP 260 gtggccccaggacagacggccaggattacctgt GQTARITCGGNDIG gggggaaacgacattggaagtaaaggtgtgca SKGVHWYQQKPG ctggtaccagcagaagccgggccaggcccctg QAPVLVVSADSDR tgctggtcgtctctgctgatagcgaccggccctc PSGIPERFSGSNSGN ϳϳ^ ^ agggatccctgagcgattctctggctccaactct TATLTISRVEVGDE gggaacacggccaccctgaccatcagcagggt ADYYCQVWDISID cgaagtcggggatgaggccgactattactgtca HYVFGTGTKVTVL ggtgtgggatattagtattgatcattatgtcttcgg gactgggaccaaggtcaccgtcctag BA.4/5-33 gaaatagtgatgacgcagtctccagccaccctgt 271 EIVMTQSPATLSVS 272 ctgtgtctccaggggaaagagccaccctctcctg PGERATLSCRASQS cagggccagtcagagtgttaacagcgacttagc VNSDLAWYQQKP ctggtaccagcagaaacctggccgggctccca GRAPRLLIYGASTR ggctcctcatctatggtgcgtccaccagggccac ATGIPARFSGSGSG tggtatcccagccaggttcagcggcagtgggtct TEFTLTISSLQSEDF gggacagagttcactctcaccatcagcagcctg AVYYCQHYNSWPP cagtctgaagattttgcagtttattactgtcagcac YTFGQGTKVDIK tataatagctggcctccgtacacttttggccaggg gaccaaagtggatatcaaac BA.4/5-34 gaaattgtgttgacgcagtctccgctctccctgcc 283 EIVLTQSPLSLPVTL 284 cgtcacccttggacagccggcctccatctcctgc GQPASISCRSSQSL aggtctagtcaaagcctcgtatacagtgatggag VYSDGDTYLNWFQ acacctacttgaattggtttcagcagaggccggg QRPGQSPRRLIYKV ccaatctccaaggcgcctaatttataaggtttctaa SNRESGVPDRFSGS tcgagagtctggggtcccagacagattcagcgg GSGTEFTLKISRVE cagtggttcaggcactgaattcacactgaaaatc AEDIGIYYCMQGT agcagggtggaggccgaggatattgggatttatt HWPGTFGQGTKVE actgcatgcaaggaacacactggccggggacg IK ttcggccaagggaccaaggtggagatcaaac CDR sequences of selected antibodies Heavy Chain T : T : T : : G O O O O yd M o I N G - M N G M N A N b D I- D I- D An i 1 I 2 I 3 I 3 o i D I t n R D Q R D Q R D Q Rt c n Q A C E S C E S C E D S Cu J E S BA.4/5-1 GGSISS 3 IYYSG 4 ASTLGA 5 CASTLG 6 SNYY SS TFY ATFYW BA.4/5-2 GFTLRS 15 ISYDG 16 AKDLLP 17 CAKDLL 18 FG SNQ LLALYY PLLALY GMDV YGMDV W BA.4/5-6 ETIVSR 27 IYPGG 28 VRDFGD 29 CVRDFG 30 NY ST FYFDY DFYFDY W BA.4/5-7 EIIVSR 39 LYSG 40 ARSYGD 41 CARSYG 42 NY GST FYIDI DFYIDIW BA.4/5-8 GITVSS 51 IYSGG 52 ARPIMG 53 CARPIM 54 NY TT AISGMD GAISGM V DVW ϳ^^ ^ BA.4/5-9 GDTFIN 63 INPSG 64 ARENGG 65 CARENG 66 SF VST NSGDFD GNSGDF Y DYW BA.4/5-10 GFTVS 75 IYSGG 76 ARPIVG 77 CARPIVG 78 RNY ST VISGMD VISGMD V VW BA.4/5-11 GFTFSN 87 IWSD 88 ARDHYY 89 CARDHY 90 YG GNSK DSSGYT YDSSGY LDAFDI TLDAFDI W BA.4/5-12 GFTFSI 99 ISYDG 100 AKDSKG 101 CAKDSK 102 YG SNK YVDWSL GYVDWS GTYYYY LGTYYY AMDV YAMDV W BA.4/5-13 GGSFSR 111 IIPMY 112 ARESNK 113 CARESN 114 YA GTP YTYGFP KYTYGF SYYYYG PSYYYY MDV GMDVW BA.4/5-15 GFTFD 123 ISWNS 124 AKDITSI 125 CAKDITS 126 DSA ASI LTDKDY ILTDKD GMDV YGMDV W BA.4/5-17 GLIVSS 135 IYSGG 136 ARSIAV 137 CARSIAV 138 NY ST AAHGAY AAHGAY GVDV GVDVW BA.4/5-18 GDNFS 147 IIPMY 148 ARESNK 149 CARESN 150 RYA GTP YTYGFP KYTYGF SYYYYG PSYYYY MNI GMNIW BA.4/5-20 RFTFA 159 IAWN 160 AKDITPI 161 CAKDITP 162 DYA SANI LTDQEY ILTDQEY GMDV GMDVW BA.4/5-21 GFIFDH 171 ISWNS 172 VKDLNY 173 CVKDLN 174 HA GTI DFSGYF YDFSGY KNGFED FKNGFE DW BA.4/5-22 GGSIRN 183 IIPIFG 184 APLGYS 185 CAPLGY 186 YA PA GYNFGF SGYNFG QH FQHW BA.4/5-23 EFIVSR 195 IYPGG 196 ARDYGD 197 CARDYG 198 NY ST FFFDY DFFFDY W BA.4/5-24 GFTFD 207 ISWNS 208 AKDLNY 209 CAKDLN 210 DFA GNI DSSGYL YDSSGY YNGFAL LYNGFA LW BA.4/5-25 GDTFSL 219 IVPIPN 220 ARGDEA 221 CARGDE 222 SA IA MAF AMAFW ϳ^^ ^ BA.4/5-28 GVTVS 231 IYAGG 232 ARDLLE 233 CARDLL 234 HNY TT RGGMD ERGGMD V VW BA.4/5-31 GGSISS 243 IYYSG 244 ASTLGA 245 CASTLG 246 SNYY RS TFY ATFYW BA.4/5-32 EIIVSR 255 LYPG 256 ARDVRD 257 CARDVR 258 NY GTT AFDV DAFDVW BA.4/5-33 GFTFSS 267 ISDAG 268 AIGYSPD 269 CAIGYSP 270 SA LNT Y DYW BA.4/5-34 GGSFR 279 IIPIFG 280 APLGYS 281 CAPLGY 282 NYA PA GYNFGF SGYNFG EY FEYW Light Chain T : T : T : : G O G O O O yd M o I N - M I N G MI N A N b D i 1 I - D I - D I An o i D I t n R 2 3 3 D Q R Q R Q Rt c Q E D E D Dn A C S C S C E S Cu J E S BA.4/5-1 QGISNS 9 TAS 10 QQYYDT 11 CQQYYD 12 WYT TWYTF BA.4/5-2 QSVSSY 21 EAS 22 QQRSNF 23 CQQRSN 24 PFI FPFIF BA.4/5-6 QSVDSG 33 DAS 34 QQYSSSP 35 CQQYSS 36 S RT SPRTF BA.4/5-7 QSVSSN 45 GAS 46 QQYND 47 CQQYND 48 WPGT WPGTF BA.4/5-8 QDLNKY 57 DAS 58 QQYDNL 59 CQQYDN 60 PYT LPYTF BA.4/5-9 QSVSSY 69 NAS 70 QQHYN 71 CQQHYN 72 WPRYS WPRYSF BA.4/5-10 QDINNY 81 AAS 82 HQYDNL 83 CHQYDN 84 PYT LPYTF BA.4/5-11 QSISSY 93 AAS 94 QQSYST 95 CQQSYS 96 LMYT TLMYTF BA.4/5-12 QDISNY 105 DAS 106 QQYDNL 107 CQQYDN 108 PLT LPLTF BA.4/5-13 QDISNH 117 DVS 118 QQYDDF 119 CQQYDD 120 PL FPLF BA.4/5-15 SSNIGIN 129 TNN 130 ASWDDS 131 CASWDD 132 T LNGFYV SLNGFY VF BA.4/5-17 ISNIGNN 141 DNN 142 GTWDSS 143 CGTWDS 144 Y LSALV SLSALVF BA.4/5-18 QDISNH 153 DVS 154 QEYDDF 155 CQEYDD 156 PL FPLF BA.4/5-20 SSNIGSN 165 SNN 166 AAWDDS 167 CAAWD 168 T LSGFYV DSLSGF YVF ^Ϭ^ ^ BA.4/5-21 QDISTY 177 AAS 178 QQHYTY 179 CQQHYT 180 PVT YPVTF BA.4/5-22 LSLVYR 189 KVF 190 MQGTH 191 CMQGTH 192 DGDTY WPGT WPGTF BA.4/5-23 QSLSSSY 201 DAS 202 QQYGRS 203 CQQYGR 204 PRT SPRTF BA.4/5-24 EDISTY 213 TAS 214 QQLHTY 215 CQQLHT 216 PVT YPVTF BA.4/5-25 QTINSW 225 DAS 226 QQYKSY 227 CQQYKS 228 PCT YPCTF BA.4/5-28 NFGGQS 237 STR 238 QVWDSS 239 CQVWDS 240 NDHQV SNDHQV F BA.4/5-31 QGISNS 249 TAS 250 QQYYDT 251 CQQYYD 252 WYT TWYTF BA.4/5-32 DIGSKG 261 ADS 262 QVWDISI 263 CQVWDI 264 DHYV SIDHYVF BA.4/5-33 QSVNSD 273 GAS 274 QHYNSW 275 CQHYNS 276 PPYT WPPYTF BA.4/5-34 QSLVYS 285 KVS 286 MQGTH 287 CMQGTH 288 DGDTY WPGT WPGTF ^ϭ^ ^

Claims

Claims 1. An antibody capable of binding to the spike protein of coronavirus SARS-CoV-2, wherein the antibody comprises the six CDRs of antibody BA.4/5-2, or of any one of the ϱ^ antibodies in Tables 1 and 3 to 9. 2. The antibody according to claim 1, comprising a heavy chain variable domain and a light chain variable domain comprising or consisting of an amino acid sequence having at least 80% identity to the heavy chain variable domain and light chain variable domain, ϭϬ^ respectively, of an antibody in any one of Tables 1 and 3 to 9. 3. The antibody of claim 1 or claim 2, wherein the antibody is selected from the group consisting of BA.4/5-2, BA.4/5-1, BA.4/5-8, BA.4/5-9, BA.4/5-22, BA.4/5-28, BA.4/5-31 and BA.4/5-34, optionally wherein: ϭϱ^ (i) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 15, 16, 17, 21, 22 and 23, respectively, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 14 and 20, respectively; ϮϬ^ (ii) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 3, 4, 5, 9, 10 and 11, respectively, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 2 and 8, respectively; Ϯϱ^ (iii) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 51, 52, 53, 57, 58 and 59, respectively, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 50 and 56, respectively; ϯϬ^ (iv) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 63, 64, 65, 69, 70 and 71, respectively, optionally wherein the antibody comprises a heavy chain variable domain ^Ϯ^ ^ and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 62 and 68, respectively; (v) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 183, 184, 185, 189, ϱ^ 190 and 191, respectively, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 182 and 188, respectively; (vi) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 231, 232, 233, 237, ϭϬ^ 238 and 239, respectively, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 230 and 236, respectively; (vii) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 243, 244, 245, 249, ϭϱ^ 250 and 251, respectively, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 242 and 248, respectively; or (viii) the antibody comprises a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 279, 280, 281, 285, ϮϬ^ 286 and 287, respectively, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the amino acid sequences specified in SEQ ID NOs: 278 and 284, respectively. 4. An antibody capable of binding to the spike protein of coronavirus SARS-CoV-2, Ϯϱ^ wherein the antibody comprises CDRH1, CDRH2 and CDRH3, from a first antibody in Table 1 and CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, with the proviso that the first antibody and the second antibody are different. 5. The antibody according to claim 4, comprising a heavy chain variable domain ϯϬ^ amino acid sequence having at least 80% sequence identity to the heavy chain variable domain from a first antibody in Table 1, and a light chain variable domain amino acid sequence having at least 80% sequence identity to the light chain variable domain from a second antibody in Table 1. ^ϯ^ ^
6. The antibody according to claim 4 or claim 5, wherein the first and second antibodies derive from the same germline heavy chain v-region, optionally wherein the heavy chain v-region is IGHV4-39, IGHV3-30, IGHV3-53/3-66, IGHV1-69, or IGHV3-9. ϱ^ 7. The antibody according to any one of claims 4 to 6, wherein the first antibody and the second antibody are both selected from one of the following groups: (a) BA.4/5-1 and BA.4/5-31; optionally wherein the antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of one of the antibodies as set out in Table 3, optionally wherein the antibody comprises a heavy chain variable domain ϭϬ^ and a light chain variable domain having at least 80% identity to the heavy chain variable domain and a light chain variable domain, respectively, to one of the antibodies as set out in Table 3; (b) BA.4/5-2 and BA.4/5-12; optionally wherein the antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of one of the antibodies as set ϭϱ^ out in Table 4, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the heavy chain variable domain and a light chain variable domain, respectively, to one of the antibodies as set out in Table 4; (c) BA.4/5-6, BA.4/5-7, BA.4/5-17 and BA.4/5-23; optionally wherein the antibody ϮϬ^ comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of one of the antibodies as set out in Table 5, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the heavy chain variable domain and a light chain variable domain, respectively, to one of the antibodies as set out in Table 5; Ϯϱ^ (d) BA.4/5-8, BA.4/5-10, BA.4/5-28 and BA.4/5-32; optionally wherein the antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of one of the antibodies as set out in Table 6, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the heavy chain variable domain and a light chain variable domain, respectively, to one of the ϯϬ^ antibodies as set out in Table 6; (e) BA.4/5-6, BA.4/5-7, BA.4/5-17, BA.4/5-23, BA.4/5-8, BA.4/5-10, BA.4/5-28 and BA.4/5-32; optionally wherein the antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of one of the antibodies as set out in Table 7, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable ^ϰ^ ^ domain having at least 80% identity to the heavy chain variable domain and a light chain variable domain, respectively, to one of the antibodies as set out in Table 7; (f) BA.4/5-13, BA.4/5-18, BA.4/5-22, BA.4/5-25 and BA.4/5-34; optionally wherein the antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and ϱ^ CDRL3 of one of the antibodies as set out in Table 8, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the heavy chain variable domain and a light chain variable domain, respectively, to one of the antibodies as set out in Table 8; or (g) BA.4/5-15, BA.4/5-20, BA.4/5-21 and BA.4/5-24; optionally wherein the ϭϬ^ antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of one of the antibodies as set out in Table 9, optionally wherein the antibody comprises a heavy chain variable domain and a light chain variable domain having at least 80% identity to the heavy chain variable domain and a light chain variable domain, respectively, to one of the antibodies as set out in Table 9. ϭϱ^ 8. The antibody according to any one of the preceding claims, which is a full-length antibody, optionally (i) comprising an IgG1 constant region, and/or (ii) comprising an Fc region comprising at least one modification such that serum half-life is extended. ϮϬ^ 9. One or more polynucleotides encoding the antibody according to any one of the preceding claims, such as a first polynucleotide encoding the heavy chain variable domain of the antibody and a second polynucleotide encoding the light chain variable domain of the antibody, one or more vectors comprising said polynucleotides, or a host cell comprising said vectors. Ϯϱ^ 10. A method for producing an antibody that is capable of binding to the spike protein of coronavirus SARS-CoV-2, the method comprising culturing the host cell of claim 9 and isolating the antibody from said culture. ϯϬ^ 11. A pharmaceutical composition comprising: (a) one or more antibody according to any one of claims 1 to 8, and (b) at least one pharmaceutically acceptable diluent or carrier. ^ϱ^ ^
12. The antibody according to any one of claims 1 to 8, or the pharmaceutical composition according to claim 11, for use in a method for treatment of a human or animal by therapy. ϱ^ 13. The antibody according to any one of claims 1 to 8, or the pharmaceutical composition according to claim 11, for use in a method of treating or preventing coronavirus infection, or a disease or complication associated with coronavirus infection. 14. A method of treating or preventing coronavirus infection, or a disease or ϭϬ^ complication associated with coronavirus infection in a subject, comprising administering a therapeutically effective amount of the antibody according to any one of claims 1 to 8, or the pharmaceutical composition according to claim 11, to said subject. 15. The method according to claim 14, wherein the method is for treating SARS-CoV- ϭϱ^ 2 infection, or a disease or complication associated therewith, such as COVID-19. 16. A method of identifying the presence of coronavirus, or a protein fragment thereof, in a sample, comprising: (i) contacting the sample with the antibody according to any one of claims 1 to 8, ϮϬ^ and (ii) detecting the presence or absence of an antibody-antigen complex, wherein the presence of the antibody-antigen complex indicates the presence of coronavirus, or a fragment thereof, in the sample. Ϯϱ^ 17. A method of treating or preventing coronavirus infection, or a disease or complication associated therewith, in a subject, the method comprising identifying the presence of coronavirus according to the method of claim 16 in a sample, and treating the subject with the antibody according to any one of claims 1 to 8, an anti-viral drug or an anti-inflammatory agent. ϯϬ^ 18. Use of the antibody according to any one of claims 1 to 8, or the pharmaceutical composition according to claim 11, for preventing, treating and/or diagnosing coronavirus infection, or a disease or complication associated therewith. ^ϲ^ ^
19. Use of the antibody according to any one of claims 1 to 8, or the pharmaceutical composition according to claim 11, for the manufacture of a medicament for treating or preventing coronavirus infection, or a disease or complication associated therewith. ϱ^ 20. The antibody for use according to claim 12 or 13, the method according to any one of claims 14 to 17, or the use according to claim 18 or 19, wherein the coronavirus infection is caused by a SARS-CoV-2 strain of the lineage Victoria, alpha, beta, gamma, delta, omicron, BA.1, BA.1.1, BA.2, BA.2.10.4, BA.2.12.1, BA.2.30.2, BA.2.75, BA.2.75.2, BA.4/5, BA.4/6, BQ.1, BQ.1.1, BJ.1, BS.1, BF.7, BN.1, XBB, XBB.1 and/or ϭϬ^ XBB.1.5. ^ϳ^ ^
PCT/GB2024/050859 2023-03-28 2024-03-28 Antibodies Ceased WO2024201056A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB2304512.3 2023-03-28
GBGB2304512.3A GB202304512D0 (en) 2023-03-28 2023-03-28 Antibodies

Publications (1)

Publication Number Publication Date
WO2024201056A1 true WO2024201056A1 (en) 2024-10-03

Family

ID=86228130

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2024/050859 Ceased WO2024201056A1 (en) 2023-03-28 2024-03-28 Antibodies

Country Status (2)

Country Link
GB (1) GB202304512D0 (en)
WO (1) WO2024201056A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119331085A (en) * 2024-10-16 2025-01-21 中国科学院合肥物质科学研究院 Sabei coronavirus broad-spectrum neutralizing antibodies and their applications

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007106120A2 (en) 2006-03-02 2007-09-20 Genentech, Inc. Serum albumin binding peptides for tumor targeting
WO2015197772A1 (en) 2014-06-25 2015-12-30 Ucb Biopharma Sprl Multispecific antibody constructs
WO2022167816A2 (en) * 2021-02-04 2022-08-11 Oxford University Innovation Limited Antibodies
WO2023156636A1 (en) * 2022-02-18 2023-08-24 Rq Biotechnology Limited Antibodies capable of binding to the spike protein of coronavirus sars-cov-2

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007106120A2 (en) 2006-03-02 2007-09-20 Genentech, Inc. Serum albumin binding peptides for tumor targeting
WO2015197772A1 (en) 2014-06-25 2015-12-30 Ucb Biopharma Sprl Multispecific antibody constructs
WO2022167816A2 (en) * 2021-02-04 2022-08-11 Oxford University Innovation Limited Antibodies
WO2023156636A1 (en) * 2022-02-18 2023-08-24 Rq Biotechnology Limited Antibodies capable of binding to the spike protein of coronavirus sars-cov-2

Non-Patent Citations (31)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", 1999, WILEY
BRUHNS P. ET AL.: "Specificity and affinity of human Fcy receptors and their polymorphic variants for human IgG subclasses", BLOOD, vol. 113, no. 16, 2009, pages 3716 - 25, XP055077761, DOI: 10.1182/blood-2008-09-179754
CARON ET AL., J. EXP MED., vol. 176, 1992, pages 1191 - 1195
CHANGROB SIRIRUK ET AL: "Site of vulnerability on SARS-CoV-2 spike induces broadly protective antibody against antigenically distinct Omicron subvariants", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 133, no. 8, 2 March 2023 (2023-03-02), US, XP093173807, ISSN: 1558-8238, DOI: 10.1172/JCI166844 *
CHANGROB SIRIRUK ET AL: "Suppl. Material: Site of vulnerability on SARS-CoV-2 spike induces broadly protective antibody to antigenically distinct omicron SARS-CoV-2 subvariants: Site of vulnerability on SARS-CoV-2 spike induces broadly protective antibody to antigenically distinct omicron SARS-CoV-2 subvariants", BIORXIV, 1 November 2022 (2022-11-01), XP093173816, DOI: 10.1101/2022.10.31.514592 *
CUI LINGYAN ET AL: "Comprehensive Overview of Broadly Neutralizing Antibodies against SARS-CoV-2 Variants", VIRUSES, vol. 16, no. 6, 1 June 2024 (2024-06-01), CH, pages 900, XP093173370, ISSN: 1999-4915, DOI: 10.3390/v16060900 *
DEJNIRATTISAI, WANWISA ET AL.: "The antigenic anatomy of SARS-CoV-2 receptor binding domain", CELL, vol. 184, no. 8, 2021, pages 2183 - 2200, XP086538665, DOI: 10.1016/j.cell.2021.02.032
DEJNIRATTISAIWANWISA ET AL.: "Antibody evasion by the P.1 strain of SARS-CoV-2.", CELL, vol. 184, no. 11, 2021, pages 2939 - 2954, XP086581581, DOI: 10.1016/j.cell.2021.03.055
DONG ET AL., BIORXIV, 2021
HINTON PR. ET AL.: "Engineered human IgG antibodies with longer serum half-lives in primates", J BIOL CHEM., vol. 279, no. 8, 2004, pages 6213 - 6, XP002482523, DOI: 10.1074/jbc.C300470200
IDUSOGIE EE ET AL.: "Engineered antibodies with increased activity to recruit complement", J IMMUNOL., vol. 166, no. 4, 2001, pages 2571 - 5, XP002781370, DOI: 10.4049/jimmunol.166.4.2571
JEFFREY B. STAVENHAGEN ET AL., CANCER RESEARCH, vol. 67, no. 18, 15 September 2007 (2007-09-15), pages 8882 - 90
LEFRANC MP, J, IMMUNOL. TODAY, vol. 18, 1997, pages 509
LIUCHANG ET AL.: "Reduced neutralization of SARS-CoV-2 B. 1.617 by vaccine and convalescent serum", CELL, vol. 184, no. 16, 2021, pages 4220 - 4236, XP086722314, DOI: 10.1016/j.cell.2021.06.020
LUO MENGXIAO ET AL: "EPUB VERSION: Structural insights into broadly neutralizing antibodies elicited by hybrid immunity against SARS-CoV-2", EMERGING MICROBES & INFECTIONS, vol. 12, no. 1, 3 January 2023 (2023-01-03), XP093174409, ISSN: 2222-1751, DOI: 10.1080/22221751.2022.2146538 *
MENGXIAO LUO ET AL: "Suppl. Data: Structural insights into broadly neutralizing antibodies elicited by hybrid immunity against SARS-CoV-2", 3 January 2023 (2023-01-03), XP093173367, Retrieved from the Internet <URL:https://www.tandfonline.com/action/downloadSupplement?doi=10.1080%2F22221751.2022.2146538&file=temi_a_2146538_sm6437.pdf> *
NIE ET AL., EMERG MICROBES INFECT, vol. 9, 2020, pages 680 - 686
PNAS, vol. 103, no. 11, pages 4005 - 4010
RICHARDS JO ET AL.: "Optimization of antibody binding to Fcgamma RIIa enhances macrophage phagocytosis of tumor cells", MOL CANCER THER., vol. 7, no. 8, 2008, pages 2517 - 27
RYAN MC. ET AL.: "Antibody targeting of B-cell maturation antigen on malignant plasma cells", MOL. CANCER THER., vol. 6, 2007, pages 3009 - 3018, XP002581270
SHOPES, J. IMMUNOL., vol. 148, 1992, pages 2918 - 2922
STEVENSON ET AL., ANTI-CANCER DRUG DESIGN, vol. 3, 1989, pages 219 - 230
SUPASAPIYADA ET AL.: "Reduced neutralization of SARS-CoV-2 B. 1. 1.7 variant by convalescent and vaccine sera.", CELL, vol. 184, no. 8, 2021, pages 2201 - 2211, XP086538660, DOI: 10.1016/j.cell.2021.02.033
TUEKPRAKHON AEKKACHAI ET AL: "Antibody escape of SARS-CoV-2 Omicron BA.4 and BA.5 from vaccine and BA.1 serum", CELL, ELSEVIER, AMSTERDAM NL, vol. 185, no. 14, 9 June 2022 (2022-06-09), pages 2422, XP087112659, ISSN: 0092-8674, [retrieved on 20220609], DOI: 10.1016/J.CELL.2022.06.005 *
TUEKPRAKHON ET AL., CELL, vol. 185, pages 2422 - 2433
VACCARO C. ET AL.: "Engineering the Fc region of immunoglobulin G to modulate in vivo antibody levels", NAT BIOTECHNOL., vol. 23, no. 10, 2005, pages 1283 - 8, XP055049342, DOI: 10.1038/nbt1143
VERMA R ET AL., J. IMMUNOL. METHODS, vol. 216, 1998, pages 165 - 181
WEINREICH ET AL., N ENGLJ MED, vol. 384, 2021, pages 238 - 251
WESTENDORF ET AL., CELL REP, vol. 39, 2022, pages 110812
YUAN ET AL., SCIENCE, vol. 369, 2020, pages 1119 - 1123
ZHOUDARNING ET AL.: "Evidence of escape of SARS-CoV-2 variant B.1.351 from natural and vaccine-induced sera.", CELL, vol. 184, no. 9, 2021, pages 2348 - 2361, XP086555062, DOI: 10.1016/j.cell.2021.02.037

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119331085A (en) * 2024-10-16 2025-01-21 中国科学院合肥物质科学研究院 Sabei coronavirus broad-spectrum neutralizing antibodies and their applications

Also Published As

Publication number Publication date
GB202304512D0 (en) 2023-05-10

Similar Documents

Publication Publication Date Title
US11634477B2 (en) Neutralizing anti-SARS-CoV-2 antibodies and methods of use thereof
US11365239B2 (en) Anti-SARS-COV-2 antibodies and uses thereof
US20240043507A1 (en) Antibodies
CN113817053A (en) Antibody molecule for dengue virus and its application
US12030927B2 (en) Antibodies capable of binding to the spike protein of coronavirus SARS-CoV-2
CN110088131B (en) anti-CHIKV antibodies and uses thereof
CN119403828B (en) Antibodies that can bind to the spike protein of the coronavirus SARS-CoV-2
BR112021004130A2 (en) anti-cd38 antibody, antigen-binding fragment thereof, and pharmaceutical use
CA3115102A1 (en) Anti-npr1 antibodies and uses thereof
JP2023526469A (en) Potent neutralizing antibodies against SARS-CoV-2, their generation and use
WO2021105669A1 (en) Antibodies
JP7599186B2 (en) Antibodies specific to coronavirus spike protein and uses thereof
CN114181301B (en) ADE-effect-free neutralizing antibodies against SARS-CoV-2
WO2024089277A2 (en) Antibodies
WO2025083216A1 (en) Antibodies specific for the spike protein of sars cov-2 coronavirus
WO2025003500A1 (en) Antibodies against sars-cov2 spike protein
EP4385999A1 (en) Antibodies
HK40098138B (en) Antibodies capable of binding to the spike protein of coronavirus sars-cov-2
HK40098138A (en) Antibodies capable of binding to the spike protein of coronavirus sars-cov-2
CN117715930A (en) Antibodies to
EP4493586A1 (en) Broadly neutralizing antibodies against hepatitis e virus
WO2024192280A2 (en) Antibodies against orthohantaviruses
SG175451A1 (en) Binding molecules against chikungunya virus and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24719246

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 24719246

Country of ref document: EP

Kind code of ref document: A1