WO2024196752A2 - Compositions for cell specific snca-targeted gene therapy and methods of making and using same - Google Patents
Compositions for cell specific snca-targeted gene therapy and methods of making and using same Download PDFInfo
- Publication number
- WO2024196752A2 WO2024196752A2 PCT/US2024/020123 US2024020123W WO2024196752A2 WO 2024196752 A2 WO2024196752 A2 WO 2024196752A2 US 2024020123 W US2024020123 W US 2024020123W WO 2024196752 A2 WO2024196752 A2 WO 2024196752A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- disclosed
- promoter
- nucleic acid
- seq
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- Synucleinopathies are neurodegenerative disorders that share a common pathological lesion of intracellular protein aggregates largely composed of the a-synuclein protein named, Lewy Bodies (LBs) and Lewy-related neurites.
- LBs Lewy Bodies
- Lewy-related neurites each disease presents distinct characteristics.
- the cell types and brain regions containing the LBs differ, particularly in early disease stages, so that while LBs in dopaminergic neurons are the primary early disease characteristic of Parkinson’s disease (PD), early stages of dementia with Lewy bodies (DLB) has LBs primarily in the amygdala and cerebral cortex, as well as basal forebrain cholinergic neurons.
- PD Parkinson’s disease
- DLB dementia with Lewy bodies
- the SNCA gene (encoding the a-synuclein protein) was implicated as a highly significant genetic risk factor for synucleinopathies including, Parkinson’s disease (PD) and dementia with Lewy bodies (DLB). Accumulating evidence has suggested that elevated levels of wild type a-synuclein are causative in the pathogenesis of synucleinopathies.
- FIG. 1 shows the generation of the hiPSC-derived neuronal proof-of-concept models.
- FIG. 1A-1B depict detailed (FIG. 1A) and representative (FIG. IB) schematics describing the structure of lentivirus (LV) THp-Repressor, THp-CT, ChATp-Repressor, and ChATp-CT vectors.
- FIG. 1A-1B depict detailed (FIG. 1A) and representative (FIG. IB) schematics describing the structure of lentivirus (LV) THp-Repressor, THp-CT, ChATp-Repressor, and ChATp-CT vectors.
- LV lentivirus
- 1C displays representative plots showing markers of successful differentiation (quantified using RT-PCR) of P-Tubulin III (TUBB3), Nestin (NES), and tyrosine hydroxylase (TH) transcripts in midbrain dopaminergic progenitor cells (MD) transduced with Thp-Repressor lentiviral vectors before (MD) and after (mDA) differentiation into final midbrain dopaminergic (mDA) neurons.
- TUBB3 P-Tubulin III
- NES Nestin
- TH tyrosine hydroxylase
- ID displays representative plots showing markers of successful differentiation (quantified using RT-PCR) of TUBB3, NES, and ChaT (choline acetyltransferase) in medial ganglionic eminence (MGE) progenitor cells transduced with ChATp-Repressor lentiviral vectors before (MGE) and after (BFCN) differentiation into final basal forebrain cholinergic neurons (BFCN).
- MGE medial ganglionic eminence
- BFCN basal forebrain cholinergic neurons
- the levels of mRNAs were measured by TaqMan expression assays and calculated relatively to the geometric mean of GAPDH-mRNN and 7774 -mRN A reference controls using the 2' AACT method.
- Each column in the data represents the mean value derived from four biological replicates, each of which comprises two technical replicates.
- FIG. IE shows representative fluorescence images of the mDA cell lines transduced with THp-Repressor (upper) and -CT (lower) vectors.
- TH left
- Flag M2 middleleft
- DAPI middle-right
- merge right
- TH marker of dopaminergic neurons
- Flag M2 tags the all-in-one lentiviral CRISPR/dN/Cas9 vectors.
- FIG. IF displays pie charts that indicate the percentage of TH + cells (green) out of all cells (DAPI + , blue) from FIG. IE.
- FIG. 1G depicts representative fluorescence images of the BFCN cell lines transduced with ChAT -Repressor (upper) and -CT (lower) vectors.
- ChAT left
- Flag M2 middle-left
- DAPI middle-right
- merge right
- ChAT marker of cholinergic neurons
- Flag M2 tags the all-in-one lentiviral CRISPR/dN/Cas9 vectors.
- FIG. 1H displays pie charts that indicate the percentage of ChAT + cells (green) out of all cells (blue, DAPI + ) from FIG. 1G.
- FIG. 2 shows neuronal-type specific downregulation of 57VC4-mRNA and protein levels.
- FIG. 2A is a schematic diagram adapted from the UCSC Genome Browser.
- Left panel Viewer of SNCA gene, [chr: chr4:89724099-89836240 (Dec.2013(GRCh38/hg38)], with the annotated set of SNCA NCBI RefSeq.
- the cyan custom tack denoted the position of the intron 1 CpG island
- the red custom track denoted the position gRNA targeting site.
- Right panel Zooming into CPG island viewer showing the gRNA targeting sequence within the CpG island.
- FIG. 2B-2C show levels of 57VC4-mRNA (assessed using quantitative RT-PCR) in dopaminergic neurons and predecessors thereof (MD, mDA, FIG. 2B) and cholinergic neurons and predecessors thereof (MGE, BFCN, FIG. 2C) after transduction with THp-Repressor and ChATp-Repressor, respectively.
- the SNCA- mRNA levels in the different lines were measured by TaqMan-based gene expression assay and calculated relatively to the geometric mean of GAPDH-mRNA and EE/d-mRNA referencecontrols using the 2' AACt method.
- FIG. 2D show representative immunofluorescence images for the a - synuclein (left), Flag M2 (middle-left), DAPI (middle-right), and merge (right) signals in mDA cell lines transduced with THp-Repressor (upper) and -CT (lower) vectors.
- FIG. 2E is a plot quantifying a-synuclein protein signals in mDA expressing the THp-Repressor compared to the control THp-CT as identified by Flag co-expression.
- FIG. 2F shows representative immunofluorescence images for the a -synuclein (left), Flag M2 (middleleft), DAPI (middle-right), and merge (right) signals in BFCN cell lines transduced with ChATp- Repressor (upper) and -CT (lower) vectors.
- FIG. 2G is a plot quantifying a-synuclein protein signals in BFCN expressing the ChATp-Repressor compared to the control ChATp-CT as identified by Flag co-expression.
- the quantification analysis was performed 3 times independently, in each time 50 co-expressed cells per BFCN line were analyzed. / J - value ⁇ 0.02 (*), ⁇ 0.005(**), or ⁇ 0.0002 (***); Student’s Z-test.
- FIG. 3 depicts the effects of the neuronal-type specific repression of SNCA overexpression on a-synuclein aggregates, cell viability, and mitochondria function.
- FIG. 3A shows a representative western blot of a-synuclein and pS129-a-synuclein in mDA stably transduced with THp-Repressor compared to THp-CT.
- FIG. 3B-3D shows quantitative analyses of total a- synuclein protein (FIG. 3B) and pS129-a-synuclein protein (FIG.
- FIG. 3C normalized to P-actin, and of pS129-a-synuclein normalized to total a-synuclein expression (FIG. 3D) in mDA cells.
- FIG. 3E is a representative western blot of a-synuclein and pS129-a-synuclein in BFCN stably transduced with ChATp-Repressor compared to ChATp-CT.
- FIG. 3F-3H show quantitative analyses of total a-synuclein protein (FIG. 3F) and pS129-a-synuclein protein (FIG.
- FIG. 3G normalized to P-actin, and of pS129-a-synuclein normalized to total a-synuclein expression (FIG. 3H) in BFCN cells. -value ⁇ 0.05 (*), ⁇ 0.01(**), or ⁇ 0.001(***); Student’s Z-test.
- FIG. 3I-3J show a cell viability assay using the Incucyte S3 live-cell analysis system. Plots were generated using the built-in software.
- FIG. 31 shows the effect of the THp-Repressor vector (red, top line) compared to the respective control vector (THp-CT, blue, bottom line) on cell viability in mDA during the differentiation process from MD cell lines.
- FIG. 3J shows the effect of the ChATp- Repressor vector (red, top line) compared to the respective control vector (ChATp-CT, blue, bottom line) on cell viability in BFCN during the differentiation process from MGE cell lines.
- the assay was performed 3 times for each line. / J - value ⁇ 0.05 (*), ⁇ 0.01(**), or ⁇ 0.001(***); Multiple student’s /-test.
- FIG. 3K-3L shows mitochondrial membrane potential (MMP) analysis using the Incucyte Sx5 live-cell analysis system. Cells were monitored along a period of 48 hours at day 10 of the differentiation into mDA (FIG. 3K) and BFCN (FIG. 3L). Plots were generated using the built-in software.
- MMP mitochondrial membrane potential
- FIG. 3K specifically shows quantification of the orange fluorescence intensities the mDA lines stably transduced with THp-Repressor vector (green), the respective control vector (THp-CT, red), and the naive cells (blue).
- the THp-Repressor vector rescued the loss of MPP observed in the THp-CT and naive neuronal lines.
- FIG. 3L specifically shows quantification of the orange fluorescence intensities the BFCN lines stably transduced with ChATp-Repressor vector (green), the respective control vector (ChATp-CT, red), and the naive cells (blue).
- the ChATp-Repressor vector rescued the loss of MPP observed in the THp-CT and naive neuronal lines.
- FIG. 4A-4B show gene expression profiles of different genes in transduced and naive mDA (FIG. 4A) and BFCN (FIG. 4B) cell lines.
- FIG. 5 shows a representative schematic of the neuron specific epigenome modulating system of the instant disclosure.
- FIG. 6 show in vivo epigenetic modulation of a-synuclein (SNCA) expression.
- FIG. 6A shows representative images (2X magnification) of brain slices 6 weeks post-injection in the right hemisphere with a THp-Repressor LV vector and in the left hemisphere with a THp-CT (control) vector, showing DAPI staining, expression of total, phosphorylated and aggregated human alpha- synuclein in the SN, and mouse tyrosine hydroxylase in the SN and striatum.
- FIG. 6B-6D are plots quantifying relative levels of total SNCA, phosphorylated SNCA or aggregated SNCA (FIG. 6B), TH in the SN (FIG. 6C) or TH in the striatum (FIG. 6D) between the right and left hemispheres.
- an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- the one or more neuron specific regulatory element may comprise a promtoer, where the promoter comprises a wild-type promoter, a synthetic promoter, a minimal promoter, or any combination thereof.
- the one or more neuron specific regulatory elements are operably linked to the nucleic acid sequence encoding the dCas endonuclease.
- the one or more neuron specific regulatory elements are operably linked to the nucleic acid encoding the at least one polypeptide having enzymatic activity.
- the one or more neuron specific regulatory elements are operably linked to the nucleic acid encoding the dCas endonuclease and the nucleic acid encoding the at least one polypeptide having enzymatic activity.
- the one or more neuron specific promoters may comprise a dopaminergic promoter a cholinergic promoter or any combination thereof.
- the one or more neuron specific promoters comprise at least one dopaminergic promoter (e.g., a tyrosine hydroxylase (TH) promoter, a FOXA2 promoter, or any combination thereof).
- the at least one dopaminergic promoter can comprise a TH promoter.
- the TH promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- the at least one dopaminergic promoter comprises a FOXA2 promoter.
- the FOXA2 promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- the one or more neuron specific promoters may comprise at least one cholinergic promoter (e.g., a ChAT promoter, aNkx2.1 promoter or a combination thereof).
- the at least one cholinergic promoter can comprise a ChAT promoter.
- the ChAT promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- the at least one dopaminergic promoter comprises a Nkx2.1 promoter.
- the Nkx2.1 promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- disclosed isolated nucleic acid may comprise a nucleic acid sequence encoding a dCas endonuclease.
- the dCas endonuclease may comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
- the dCas endonuclease comprises a variant dCas9 endonuclease selected from a VRER, EQR or VQR variant of dCas9.
- the dCas endonuclease comprises a dSaCas9 endonuclease having an amino acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 13 or a fragment thereof.
- isolated nucleic acid may comprise a nucleic acid sequence encoding a polypeptide having enzymatic activity.
- the enzymatic activity comprises transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
- the at least one encoded polypeptide having enzymatic activity comprises HP la, HP lb, MBD1, MBD2, Kriippel -Associated Box (KRAB), NIPP1, Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- the fusion can comprise KRAB-MeCP2 (KRAB-MeCP2).
- the KRAB-MeCP2 comprises an amino acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- the disclosed isolated nucleic acid may comprise a nucleic acid sequence encoding at least one gRNA which targets the SNCA gene or the promoter of the SNCA gene.
- the at least one gRNA targets a nucleic acid sequence comprising any one of SEQ ID NOs: 59 - 71 or a sequence at least 90% identical thereto.
- the isolated nucleic acids may further comprise one or more additional regulatory elements.
- the one or more additional regulatory elements are selected from one or more primer binding sites (PBS), one or more splice donor (SD) sites, one or more splice acceptor (SA) sites, one or more central polypurine tracts (cPPT), one or more polypurine tracts (PPT), one or more Rev Response elements (RRE), one or more Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE), one or more retroviral vector packaging elements, or any combination thereof.
- the retroviral vector packaging element comprises a psi (y) signal.
- a viral vector comprising an isolated nucleic acid as disclosed herein.
- the disclosed viral vector may be an adeno-associated virus (AAV), an integrase-deficient lentivirus (IDLV), or integrase competent lentivirus (ICLV).
- the viral vector may comprise a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-4.
- a pharmaceutical formulation comprising an isolated nucleic acid as disclosed herein or the viral vector as disclosed herein and a pharmaceutically acceptable carrier.
- the pharmaceutical formulation is for the treatment of a synucleinopathy or other SNCA associated disease or disorder.
- the pharmaceutical formulation is for the treatment of Parkinson’s disease or dementia with Lewy bodies (DLB).
- the disclosed method comprises contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid or a disclosed viral vector, wherein the expression of one or more genes of interest in the one or more neurons is modulated.
- modulating comprises increasing or augmenting the expression and/or activity of the one or more genes of interest.
- modulating comprises decreasing or reducing the expression and/or activity of the one or more genes of interest.
- the gene of interest or portion thereof comprises SNCA or the promoter region of SNCA.
- the neurons may be in a subject.
- the subject may be suspected of having or have already been diagnosed with a synucleinopathy.
- the method of effecting precision epigenetic modulation in a neuron in the subject may further comprise reducing the pathological phenotype associated with the synucleinopathy.
- the synucleinopathy may be selected from Parkinson’s disease or dementia with Lewy bodies (DLB).
- contacting the one or more neurons in a subject comprises administering the viral vector through intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-ci sterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof.
- the method may further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof.
- Also disclosed herein is a method of treating and/or preventing a synucleinopathy in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector disclosed herein, an isolated nucleic acid disclosed herein, and/or a pharmaceutical formulation disclosed herein, thereby reducing the pathological phenotype associated with the synucleinopathy.
- the synucleinopathy can be selected from Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- administering the viral vector, the isolated nucleic acid, and/or the pharmaceutical formulation comprises intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-cistema magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof.
- the disclosed method further comprises administering to the subject a therapeutically effective amount of a therapeutic agent.
- the disclosed method may further comprise administering to the subject a therapeutically effective amount of the one or more immune modulators (e.g., methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof).
- the one or more immune modulators e.g., methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof.
- Described herein is a system that comprises an all-in-one viral vector system (e.g., an AAV, lentiviral vector, etc.) for the targeted epigenomic editing of the SNCA gene in a neuronaltype specific manner.
- the disclosed epigenome modifier compositions can be used to modify any regulatory target in a SNCA gene.
- the system is based on CRISPR/deactivated-Cas9 nuclease (dCas9) fused with the catalytic domain, such as a KRAB-MeCP2.
- dCas9 nuclease CRISPR/deactivated-Cas9 nuclease
- KRAB-MeCP2 CRISPR/deactivated-Cas9 nuclease
- the present disclosure provides proof of concept that manipulation of gene expression, e.g., reversing overexpression, by epigenome-editing is a valuable therapeutic strategy for synucleinopathies that involve dysregulation of gene expression.
- the CRISPR/Cas9 system provided herein provides a unique opportunity to modulate gene expression in a precise fashion that is cell-type specific.
- the use of epigenome-editing is an approach for gene therapy and represents new smart drugs since it is designed to target specific genes and specific cell types.
- the development and implementation of an innovative epigenome editing approach to manipulate the endogenous SNCA levels for rescuing disease related phenotypes is described.
- Neurodegenerative diseases are disorders characterized by, resulting from, or resulting in the progressive loss of structure or function of neurons, including death of neurons.
- Neurodegenerative diseases include, for example, Alzheimer’s Disease (AD), amyloidosis, amyotrophic lateral sclerosis (ALS), Parkinson’s Disease (PD), Huntington’s Disease, prion disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, neuronal loss, cognitive defect, primary age-related tauopathy (PART)/Neurofibrillary tangle-predominant senile dementia, chronic traumatic encephalopathy including dementia pugilistica, dementia with Lewy Bodies (DLB) (also referred to as Lewy body dementia (LBD)), neuroaxonal dystrophies, and multiple system atrophy, progressive supranuclear palsy, Pick’s Disease, corticobasal degeneration, some forms of frontotemporal lobar degeneration, frontotemporal dementia and parkinsonism linked
- AD Alzheimer
- SNCA -related diseases or disorders are characterized by abnormal expression of the SNCA gene compared to control subjects without the SNCA -related disorder.
- the SNCA related disease or disorder is characterized by increased expression of SNCA gene compared to control.
- the A N -related disease or disorder is characterized by decreased expression of SNCA gene compared to control.
- the SNCA -related disease or disorder is a neurodegenerative disorder.
- Synucleinopathies are neurodegenerative diseases characterized by the abnormal accumulation of aggregates of alpha-synuclein protein (which is encoded by the SNCA gene). Accumulation of aggregates may occur in neurons, nerve fibers, or glial cells. In some aspects, these aggregates are clinically referred to as “Lewy bodies” (LBs) and/or Lewy-related neurites. Different synucleinopathies can occur depending on the location of these aggregates.
- LBs Lewy bodies
- Lewy-related neurites Different synucleinopathies can occur depending on the location of these aggregates.
- LBs in dopaminergic neurons are the primary early disease characteristic of Parkinson’s disease (PD), early stages of dementia with Lewy bodies (DLB) has LBs primarily in the amygdala and cerebral cortex, as well as basal forebrain cholinergic neurons.
- synucleinopathies can include Parkinson’s disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy.
- a synucleinopathy disclosed herein may be Parkinson’s disease (PD).
- the synucleinopathy disclosed herein may be dementia with Lewy bodies (DLB).
- the disclosure herein provides new methods of targeting the SNCA gene in specific neuronal populations to allow for targeted, tailored, control of synuclein expression in different regions to allow for improved treatment of different synucleinopathies.
- Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, a further aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
- references in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed.
- X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.
- a disclosed method can optionally comprise one or more additional steps, such as, for example, repeating an administering step or altering an administering step.
- the term “subject” refers to the target of administration, e.g., a human being.
- the term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.).
- the subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian.
- the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent.
- the term does not denote a particular age or sex, and thus, adult and child subj ects, as well as fetuses, whether male or female, are intended to be covered.
- a subject can be a human patient.
- a subject can have a synucleinopathy, be suspected of having a synucleinopathy, or be at risk of developing and/or acquiring a synucleinopathy.
- a subject can have Parkinson’s disease, be suspected of having Parkinson’s disease (PD), or be at risk of developing and/or acquiring Parkinson’s disease (PD).
- the subject can have dementia with Lewy bodies (DLB), be suspected of having dementia with Lewy bodies (DLB), or be at risk of developing and/or acquiring dementia with Lewy bodies (DLB).
- diagnosisd means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or treated by one or more of the disclosed agents, disclosed therapeutic agents, disclosed pharmaceutical formulations, or a combination thereof, or by one or more of the disclosed methods.
- “diagnosed with synucleinopathy, ” “diagnosed with Parkinson’s disease (PD), ” or “diagnosed with dementia with Lewy bodies” means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can be treated by one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or by one or more of the disclosed methods.
- “suspected of having synucleinopathy” or “suspected of having Parkinson’s disease (PD)” or “suspected of having dementia with Lewy bodies” can mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can likely be treated by one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or by one or more of the disclosed methods.
- an examination can be physical, can involve various tests (e.g, blood tests, genotyping, biopsies, etc.) and assays (e.g, enzymatic assay), or a combination thereof.
- a “patient” can refer to a subject that has been diagnosed with or is suspected of having a synucleinopathy (e.g., Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)).
- a patient can refer to a subject that has been diagnosed with or is suspected of having Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) and is seeking treatment or receiving treatment for Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- PD Parkinson’s disease
- DLB dementia with Lewy bodies
- the phrase “identified to be in need of treatment for a disorder,” or the like refers to selection of a subject based upon need for treatment of the disorder.
- a subject can be identified as having a need for treatment of a disorder (e.g., such as a synucleinopathy like Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)) based upon an earlier diagnosis by a person of skill and thereafter subjected to treatment for the disorder (e.g., Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)).
- a disorder e.g., such as a synucleinopathy like Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)
- PD Parkinson’s disease
- DLB dementia with Lewy bodies
- the identification can be performed by a person different from the person making the diagnosis.
- the administration can be performed by one who performed the diagnosis.
- inhibitor means to diminish or decrease an activity, level, response, expression, condition, severity, disease, or other biological parameter. This can include, but is not limited to, the complete ablation of the activity, level, response, expression, condition, severity, disease, or other biological parameter. This can also include, for example, a 10% inhibition or reduction in the activity, level, response, condition, severity, disease, or other biological parameter as compared to the native or control level (e.g., a subject not having a synucleinopathy such as Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder).
- PD Parkinson’s disease
- DLB dementia with Lewy bodies
- the inhibition or reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of reduction in between as compared to native or control levels.
- the inhibition or reduction can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% as compared to native or control levels.
- the inhibition or reduction can be 0-25%, 25-50%, 50- 75%, or 75-100% as compared to native or control levels.
- a native or control level can be a pre-disease or pre-disorder level.
- treat or “treating” or “treatment” include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder (such as a synucleinopathy like Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder).
- palliative treatment that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder
- preventative treatment that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder
- supportive treatment that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder (such as a synucleinopathy like Parkinson’s disease (PD
- the terms cover any treatment of a subject, including a mammal (e.g., a human), and includes: (i) preventing the undesired physiological change, disease, pathological condition, or disorder from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it; (ii) inhibiting the physiological change, disease, pathological condition, or disorder, i.e., arresting its development; or (iii) relieving the physiological change, disease, pathological condition, or disorder, i.e., causing regression of the disease.
- a mammal e.g., a human
- treating a synucleinopathy can reduce the severity of an established disease in a subject by 1%- 100% as compared to a control (such as, for example, an individual not having the synucleinopathy).
- treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of the synucleinopathy.
- treating an SNCA associated disease or disorder can reduce the severity of an established disease in a subject by 1%- 100% as compared to a control (such as, for example, an individual not having an SNCA associated disease or disorder.
- treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity SNCA associated disease or disorder.
- treating Parkinson’s disease (PD) can reduce the severity of an established disease in a subject by 1 %-l 00% as compared to a control (such as, for example, an individual not having Parkinson’s disease (PD)).
- treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of Parkinson’s disease.
- treating dementia with Lewy bodies can reduce the severity of an established disease in a subject by 1%- 100% as compared to a control (such as, for example, an individual not having dementia with Lewy bodies (DLB).
- treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of dementia with Lewy bodies (DLB).
- treatment does not necessarily refer to a cure or complete ablation or eradication of the synucleinopathy, SNCA associated disease or disorder, Parkinson’ s disease (PD) or dementia with Lewy bodies (DLB).
- treatment can refer to a cure or complete ablation or eradication of the synucleinopathy, SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- a “biomarker” refers to a defined characteristic that is measured as an indicator of normal biological processes, pathogenic processes, or response to an exposure of intervention.
- a biomarker can be diagnostic (z.e., detects or classifies a pathological condition), prognostic (z.e., predicts the probability of disease occurrence or progression), pharmacodynamic/responsive (z.e., identifies a change in response to a therapeutic intervention), predictive (z.e., predicts how an individual or subject might respond to a particular intervention or event).
- a biomarker can be diagnostic, prognostic, pharmacodynamic/responsive, and/or predictive at the same time.
- a biomarker can be diagnostic, prognostic, pharmacodynamic/responsive, and/or predictive at different times (e.g, first a biomarker can be diagnostic and then later, the same biomarker can be prognostic, pharmacodynamic/responsive, and/or predictive).
- a biomarker can be an objective measure that can be linked to a clinical outcome assessment.
- a biomarker can be used by the skilled person to make a clinical decision based on its context of use.
- operably linked means that expression of a gene is under the control of a regulatory element with which it is spatially connected.
- the regulatory element is a promoter and when used in this context, the expression of a gene is under control of the promoter with which it is spatially connected.
- a regulatory element e.g., a promoter
- the distance between the regulatory element (e.g., a promoter) and a gene can be approximately the same as the distance between that regulatory element (e.g, a promoter) and the gene it controls in the gene from which the regulatory element (e.g., a promoter) is derived.
- regulatory elements refer to any sequence elements that regulate, positively or negatively, the expression of an operably linked sequence. “Regulatory elements” include, without being limiting, a promoter, an enhancer, a leader, a transcription start site (TSS), a linker, 5' and 3' untranslated regions (UTRs), an intron, a polyadenylation signal, and a termination region or sequence, etc., that are suitable, necessary, or preferred for regulating or allowing expression of the gene or transcribable DNA sequence in a cell.
- a regulatory sequence can, for example, be inducible, noninducible, constitutive, cell-cycle regulated, metabolically regulated, and the like.
- a regulatory sequence may be a promoter.
- promoter refers to a DNA sequence that comprises an RNA polymerase binding site, a transcription start site, and/or a TATA box and assists or promotes the transcription and expression of an associated transcribable polynucleotide sequence and/or gene (or transgene).
- a promoter can be synthetically produced, varied, or derived from a known or naturally occurring promoter sequence or other promoter sequence.
- a promoter can also include a chimeric promoter comprising a combination of two or more heterologous sequences.
- a promoter of the present application can thus include variants of promoter sequences that are similar in composition, but not identical to, other promoter sequence(s) known or provided herein.
- the promoter sequence is adapted to enable expression of a polynucleotide in neurons.
- the promoter is a TH promoter, a FOXA2 promoter, a Ch AT promoter, an Nkx2.1 promoter, or a derivative thereof.
- neuron specific regulatory element encompasses a regulatory element (as defined supra) which regulates the expression of an operably linked sequence, such that expression is increased or enhanced in a neuron when compared to other cell-types.
- the enhanced expression may result in at least about 1.1 -fold to about 100- fold or more expression of the protein or nucleic acid as compared to other cell types.
- a neuron specific regulatory element may comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence, or any combination thereof.
- promoter or “promoters” are known to the art. Depending on the level and tissue-specific expression desired, a variety of promoter elements can be used. A promoter can be tissue-specific or ubiquitous and can be constitutive or inducible, depending on the pattern of the gene expression desired. A promoter can be native (endogenous) or foreign (exogenous) and can be a natural or a synthetic sequence. The promoter can be a derivative of a natural or synthetic sequence, meaning that it has one or more genetic modifications from the patent natural or synthetic sequence. By foreign or exogenous, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced.
- Neuron-specific promoters are also known in the art and include, but are not limited to, “dopaminergic promoters” and “cholinergic promoters” which are defined herein below.
- exemplary neuron-specific promoters can include but are not limited to tyrorosine hydroxylase (TH) promoter, FOXA2 promoter, choline acetyltransferase (ChAT) promoter, and Nkx2.1 promoters.
- TH tyrorosine hydroxylase
- FOXA2 choline acetyltransferase
- Nkx2.1 promoters Nkx2.1 promoters.
- Dopaminergic promoters refer to neuron-specific promoters such that expression is increased or enhanced in a dopaminergic neuron when compared to other neurons or other cell types.
- the enhanced expression may result in at least about 1.1 -fold to about 100- fold or more expression of the protein or nucleic acid as compared to other neurons.
- exemplary dopaminergic promoters include, but are not limited to, tyrosine hydroxylase (TH) promoter and FOXA2 promoter.
- TH tyrosine hydroxylase
- FOXA2 FOXA2 promoter.
- “Cholinergic promoters” as used herein refer to neuron-specific promoters such that expression is increased or enhanced in a cholinergic neuron when compared to other neurons or other cell types.
- the enhanced expression may result in at least about 1.1-fold to about 100- fold or more expression of the protein or nucleic acid as compared to other neurons.
- Exemplary cholinergic promoters include but are not limited to choline acetyltransferase (ChAT) promoter and Nkx2.1 promoters.
- “Ubiquitous/constitutive promoters” are known to the art and include, but are not limited to, a CMV major immediate-early enhancer/chicken beta-actin promoter, a cytomegalovirus (CMV) major immediate-early promoter, an Elongation Factor 1-a (EFl -a) promoter, a simian vacuolating virus 40 (SV40) promoter, an AmpR promoter, a PyK promoter, a human ubiquitin C gene (Ubc) promoter, a MFG promoter, a human beta actin promoter, a CAG promoter, a EGR1 promoter, a FerH promoter, a FerL promoter, a GRP78 promoter, a GRP94 promoter, a HSP70 promoter, a [3-kin promoter, a murine phosphoglycerate kinase (mPGK) or human PGK (hPGK) promoter,
- an “inducible promoter” refers to a promoter that can be regulated by positive or negative control.
- Factors that can regulate an inducible promoter include, but are not limited to, chemical agents (e.g., the metallothionein promoter or a hormone inducible promoter), temperature, and light.
- RNA binding proteins consist of multiple repetitive sequences that contain only a few specific basic domains.
- common RNA-binding domains mainly include RNA-recognition motif (RRM), K homology (KH) domain, double-stranded RBD (dsRBD), cold-shock domain (CSD), arginine-glycine-glycine (RGG) motif, tyrosine-rich domain, and zinc fingers (ZnF) of the CCHC, CCCH, ZZ type etc.
- RBPs can be divided into epithelial splicing regulatory proteins (ESRP1), cytoplasmic polyadenylation element binding protein family (CPEB1/2), Hu-antigen R (HuR), heterogeneous nuclear ribonucleoprotein family members (hnRNP A/D/H/K/MZE/L), insulin-like growth factor 2 mRNA family members (IMP 1/2/3), zfh family of transcription factors (ZEB 1/2), KH-type splicing regulatory protein (KHSRP), La ribonucleoprotein domain family members (LARP 1/6/7), Lin-28 homolog proteins (Lin28), Musashi protein family (MSI1/2), Pumilio protein family (PUM1/2), Quaking (QK), RNA-binding motif protein family (4/10/38/47), Src-associated substrate during mitosis of 68 kDa (SAM68), serine and arginine rich splicing factor (SRSF1/3), T cell intracellular antigen
- ESRP1 epithelial
- immune tolerance refers to a state of unresponsiveness or blunted response of the immune system to substances (e.g., a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed transgene product, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, etc.) that have the capacity to elicit an immune response in a subject.
- Immune tolerance is induced by prior exposure to a specific antigen. Immune tolerance can be determined in a subject by measuring antibodies against a particular antigen or by liver-restricted transgene expression with a viral vector (such as, for example, AAV).
- immune tolerance can be established by having IgG antibody titers of less than or equal to about 12,000, 11,500, 11,000, 10,500, 10,000, 9,500, 9,000, 8,500, 8,000, 7,500, 7,000, 6,500, or 6,000 within following gene therapy (such as the administration of the transgene encoding, for example, a missing, deficient, and/or mutant protein or enzyme).
- peptide As used herein, “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
- a protein must contain at least two amino acids and there is no limitation on the maximum number of amino acids that can comprise a protein’s sequence.
- peptide can refer to a short chain of amino acids including, for example, natural peptides, recombinant peptides, synthetic peptides, or any combination thereof.
- Proteins and peptides can include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, and fusion proteins, among others.
- “Nucleic acid” or “oligonucleotide” or “polynucleotide” as used herein means at least two nucleotides covalently linked together. The depiction of a single strand can also define the sequence of the complementary strand. Thus, a nucleic acid can encompass the complementary strand of a depicted single strand.
- nucleic acid can encompass substantially identical nucleic acids and complements thereof.
- a single strand can provide a probe that can hybridize to a target sequence under stringent hybridization conditions.
- a nucleic acid can encompass a probe that hybridizes under stringent hybridization conditions.
- a nucleic acid can be single-stranded, or double-stranded, or can contain portions of both double-stranded and single-stranded sequence.
- the nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods.
- nucleic acid can refer to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof.
- the term can encompass RNA/DNA hybrids.
- less common bases such as inosine, 5- methylcytosine, 6-methyladenine, hypoxanthine and others can also be used for antisense, dsRNA, and ribozyme pairing.
- nucleic acid or polynucleotide refers to a nucleic acid or polynucleotide that is not found in nature but is constructed by the hand of man and therefore is not a product of nature.
- a nucleic acid may be isolated as defined further below.
- an “isolated” refers to a biological component (such as a nucleic acid molecule, nucleic acid sequence, protein, or virus) that has been substantially separated or purified away from other biological components (e.g., other chromosomal and extra-chromosomal DNA and RNA, proteins and/or organelles).
- An isolated biological component may not be substantially separated or purified away from all other biological components (e.g., an isolated nucleic acid may comprise a coding sequence and one or more regulatory elements as opposed to just the coding sequence or just a regulatory element).
- an isolated nucleic acid molecule may comprise any one or more of a gene, a transcription regulatory sequence, a translation regulatory sequence, coding sequence, non-coding sequence, plasmids, vector, or viral vector.
- Nucleic acids, proteins, and/or viruses that have been “isolated” include nucleic acids, proteins, and viruses purified by standard purification methods. The term also embraces nucleic acids, proteins, and viruses prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins. The term “isolated” (or purified) does not require absolute purity; rather, it is intended as a relative term.
- an isolated or purified nucleic acid, protein, virus, or other active compound is one that is isolated in whole or in part from associated nucleic acids, proteins, and other contaminants.
- the term “substantially purified” refers to a nucleic acid, protein, virus or other active compound that has been isolated from a cell, cell culture medium, or other crude preparation and subjected to fractionation to remove various components of the initial preparation, such as proteins, cellular debris, and other components.
- isolated proteins or nucleic acids, or cells containing such in some examples are at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% pure.
- Isolated nucleic acid molecules may comprise one or more naturally occurring sequences, recombinant sequences, or combinations thereof.
- the isolated nucleic acid molecule may also comprise one or more modified nucleotides.
- a “fragment” or “portion” of a nucleotide sequence can be understood to mean a nucleotide sequence of reduced length relative (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
- nucleic acid or nucleotide sequence comprising, consisting essentially of, or consisting of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the reference nucleic acid or nucleotide sequence.
- a nucleotide sequence of contiguous nucleotides identical or almost identical e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
- nucleic acid fragment or portion can be, where appropriate, included in a larger polynucleotide of which it is a constituent.
- a fragment or portion of a nucleotide sequence or nucleic acid sequence can comprise the sequence encoding an exon having one or more mutations.
- a fragment or portion of a nucleotide sequence or nucleic acid sequence can comprise a target of interest.
- a “fragment” or “portion” of an amino acid sequence can be understood to mean an amino acid sequence of reduced length relative (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
- a “heterologous” or a “recombinant” nucleotide or amino acid sequence as used interchangeably herein can refer to a nucleotide or an amino acid sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleotide or amino acid sequence.
- homologues Different nucleic acids or proteins having homology can be referred to as “homologues.”
- the term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species.
- “Homology” refers to the level of similarity between two or more nucleic acid and/or amino acid sequences in terms of percent of positional identity (z.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins.
- the disclosed compositions and disclosed methods can comprise homologues to the disclosed nucleotide sequences and/or disclosed polypeptide sequences.
- Orthologous can refer to homologous nucleotide sequences and/or amino acid sequences in different species that arose from a common ancestral gene during speciation.
- a homologue of a disclosed nucleotide sequence or a disclosed polypeptide can have substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and/or 100%) to a disclosed nucleotide sequence or a disclosed polypeptide.
- “Complement” or “complementary” as used herein means a nucleic acid can mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules. “Complementarity” refers to a property shared between two nucleic acid sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary.
- lentiviral vector can refer to a vector including one or more “heterologous” (i.e., non-lentiviral) nucleic acid sequences.
- lentiviral vectors herein may contain non-coding sequences of one or more proteins from a lentivirus.
- a “lentiviral transfer vector” for use herein may include a heterologous nucleic acid sequence, for example, to be transferred into a cell, and may further include, for example, one or more lentiviral genes, or portions thereof.
- a “lentiviral packaging vector” for use herein may include one or more genes encoding lentiviral proteins, or portions thereof.
- a lentiviral envelope protein may include a gene encoding an envelope (Env) protein, or a portion thereof.
- host cells can be transfected with lentiviral vectors, and optionally additional vectors for expressing lentiviral packaging proteins (e.g., VSV-G, Rev, and Gag/Pol) to produce lentiviral particles in the culture medium.
- lentiviral packaging proteins e.g., VSV-G, Rev, and Gag/Pol
- serotype is a distinction used to refer to an AAV having a capsid that is serologically distinct from other AAV serotypes.
- Serologic distinctiveness can be determined by the lack of cross-reactivity between antibodies to one AAV as compared to another AAV. Such cross-reactivity differences are usually due to differences in capsid protein sequences/antigenic determinants (e.g., due to VP1, VP2, and/or VP3 sequence differences of AAV serotypes).
- tropism refers to the specificity of an AAV capsid protein present in an AAV viral particle, for infecting a particular type of cell or tissue.
- the tropism of an AAV capsid for a particular type of cell or tissue may be determined by measuring the ability of AAV vector particles comprising the hybrid AAV capsid protein to infect or to transduce a particular type of cell or tissue, using standard assays that are well-known in the art such as those disclosed in the examples of the present application.
- liver tropism or “hepatic tropism” refers to the tropism for liver or hepatic tissue and cells, including hepatocytes.
- codon optimization can refer to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing one or more codons or more of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
- Various species exhibit particular bias for certain codons of a particular amino acid.
- genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database.” Many methods and software tools for codon optimization have been reported previously. (See, for example, genomes.urv.es/OPTIMIZER/).
- expression cassette or “transgene cassette” can refer to a distinct component of vector DNA comprising a transgene and one or more regulatory sequences to be expressed by a transfected cell.
- an expression cassette or transgene cassette can comprise a promoter sequence, an open reading frame (i.e., the transgene), and a 3’ untranslated region (e.g., in eukaryotes a polyadenylation site).
- neurodeg enerative disease or disorder refers to disorders characterized by, resulting from, or resulting in the progressive loss of structure or function of neurons, including death of neurons.
- Neurodegenerative diseases include, for example, Alzheimer’s Disease (AD), amyloidosis, amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), Huntington’s Disease, prion disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, neuronal loss, cognitive defect, primary age-related tauopathy (PART)/Neurofibrillary tangle-predominant senile dementia, chronic traumatic encephalopathy including dementia pugilistica, dementia with Lewy bodies (DLB), neuroaxonal dystrophies, and multiple system atrophy, progressive supranuclear palsy, Pick’s Disease, corticobasal degeneration, some forms of frontotemporal lobar degeneration, frontotemporal dementia and parkinsonism linked to AD.
- AD Alzheimer’s Disease
- SNCA related disease or disorder is a disease or disorder characterized by abnormal expression of SNCA gene compared to control subjects without the SNCA -related disease or disorder.
- the SNCA related disease or disorder may be characterized by increased expression of SNCA gene compared to control subjects without the SNCA -related disease or disorder.
- the SNCA related disease or disorder may be characterized by decreased expression of SNCA gene compared to control subjects without the SNCA -related disease or disorder.
- synucleinopathy refers to a neurodegenerative disorder that is caused or associated with a pathological lesion of intracellular protein aggregates largely composed of the a-synuclein protein. These lesions are known clinically as Lewy Bodies (LBs) and Lewy-related neurites. Depending on the location of the Lewy bodies other clinical diseases or conditions can arise. For example, LBs in dopaminergic neurons lead to Parkinson’s disease (PD) and LBs primarily localized in the amygdala and cerebral cortex can lead to dementia with Lewy Bodies (DLB).
- PD Parkinson’s disease
- LBs primarily localized in the amygdala and cerebral cortex can lead to dementia with Lewy Bodies (DLB).
- synucleinopathy can encompass any disease or condition characterized by the presence of Lewy Bodies or Lewy-related neurites in the brain.
- the term synucleinopathy can comprise Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- PD Parkinson’s disease
- DLB dementia with Lewy bodies
- Normal gene refers to a gene that has not undergone a change, such as a loss, gain, or exchange of genetic material. The normal gene undergoes normal gene transmission and gene expression.
- the term “prevent” or “preventing” or “prevention” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. In an aspect, preventing progression of a synucleinopathy is intended. The words “prevent” and “preventing” and “prevention” also refer to prophylactic or preventative measures for protecting or precluding a subject (e.g., an individual) not having a synucleinopathy or a synucleinopathy - related complication from progressing to that complication. In an aspect, preventing or reducing SNCA expression and/or activity is intended.
- administering refers to any method of providing one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof to a subject.
- Such methods are well known to those skilled in the art and include, but are not limited to, the following routes: oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, in utero administration, intrahepatic administration, intravaginal administration, ophthalmic administration, intraaural administration, otic administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-CSF administration, intra-arterial administration, intramuscular administration, and subcutaneous administration.
- Administration can also include hepatic intraarterial administration or administration through the hepatic portal vein (HPV).
- Administration of a disclosed therapeutic agent, a disclosed pharmaceutical composition, or a combination thereof can comprise administration directly into the CNS (e.g., intraparenchymal, intracerebroventriular, inthrathecal cisternal, intrathecal (lumbar), deep gray matter delivery, convection-enhanced delivery to deep gray matter) or the PNS.
- Administration can be continuous or intermittent.
- a “therapeutic agent” can be a “biologically active agent” or “biologic active agent” or “bioactive agent, ” which refers to an agent that is capable of providing a local or systemic biological, physiological, or therapeutic effect in the biological system to which it is applied.
- the bioactive agent can act to control infection or inflammation, enhance cell growth and tissue regeneration, control tumor growth, act as an analgesic, promote anti-cell attachment, and enhance bone growth, among other functions.
- bioactive agents can include anti-viral agents, vaccines, hormones, antibodies (including active antibody fragments sFv, Fv, and Fab fragments), aptamers, peptide mimetics, functional nucleic acids, therapeutic proteins, peptides, or nucleic acids.
- bioactive agents include prodrugs, which are agents that are not biologically active when administered but, upon administration to a subject are converted to bioactive agents through metabolism or some other mechanism.
- any of the compositions of the disclosure can contain combinations of two or more bioactive agents. It is understood that a biologically active agent can be used in connection with administration to various subjects, for example, to humans (z.e., medical administration) or to animals (z.e., veterinary administration). As used herein, the recitation of a biologically active agent inherently encompasses the pharmaceutically acceptable salts thereof.
- a “therapeutic agent” can be any agent that effects a desired clinical outcome in a subject having a synucleinopathy, suspected of having a synucleinopathy, and/or likely to develop or acquire a synucleinopathy.
- a disclosed therapeutic agent can be an oligonucleotide therapeutic agent.
- a disclosed oligonucleotide therapeutic agent can comprise a single-stranded or double-stranded DNA, iRNA, shRNA, siRNA, mRNA, non-coding RNA (ncRNA), an antisense molecule, miRNA, a morpholino, a peptide-nucleic acid (PNA), or an analog or conjugate thereof.
- a disclosed oligonucleotide therapeutic agent can be an ASO or an RNAi.
- a disclosed oligonucleotide therapeutic agent can comprise one or more modifications at any position applicable.
- determining the amount is meant both an absolute quantification of a particular analyte (e.g., an mRNA sequence) or a determination of the relative abundance of a particular analyte (e.g., an amount as compared to a mRNA sequence).
- the phrase includes both direct or indirect measurements of abundance (e.g., individual mRNA transcripts may be quantified or the amount of amplification of an mRNA sequence under certain conditions for a certain period may be used a surrogate for individual transcript quantification) or both.
- modifying the method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method.
- a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, by changing the duration of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject, or by substituting for one or more of the disclosed components and/or reagents with a similar or equivalent component and/or reagent.
- a therapeutic agent can be a “drug” or a “vaccine” and means a molecule, group of molecules, complex or substance administered to an organism for diagnostic, therapeutic, preventative medical, or veterinary purposes.
- This term includes externally and internally administered topical, localized and systemic human and animal pharmaceuticals, treatments, remedies, nutraceuticals, cosmeceuticals, biologicals, devices, diagnostics and contraceptives, including preparations useful in clinical and veterinary screening, prevention, prophylaxis, healing, wellness, detection, imaging, diagnosis, therapy, surgery, monitoring, cosmetics, prosthetics, forensics and the like.
- This term may also be used in reference to agricultural, workplace, military, industrial and environmental therapeutics or remedies comprising selected molecules or selected nucleic acid sequences capable of recognizing cellular receptors, membrane receptors, hormone receptors, therapeutic receptors, microbes, viruses or selected targets comprising or capable of contacting plants, animals and/or humans.
- Examples include but are not limited to a radiosensitizer, the combination of a radiosensitizer and a chemotherapeutic, a steroid, a xanthine, a beta-2-agonist bronchodilator, an anti-inflammatory agent, an analgesic agent, a calcium antagonist, an angiotensin-converting enzyme inhibitors, a beta-blocker, a centrally active alpha-agonist, an alpha- 1 -antagonist, carbonic anhydrase inhibitors, prostaglandin analogs, a combination of an alpha agonist and a beta blocker, a combination of a carbonic anhydrase inhibitor and a beta blocker, an anticholinergic/antispasmodic agent, a vasopressin analogue, an anti arrhythmic agent, an antiparkinsonian agent, an antiangina/antihypertensive agent, an anticoagulant agent, an antiplatelet agent, a sedative, an ansiolytic agent, a
- the pharmaceutically active agent can be coumarin, albumin, bromolidine, steroids such as betamethasone, dexamethasone, methylprednisolone, prednisolone, prednisone, triamcinolone, budesonide, hydrocortisone, and pharmaceutically acceptable hydrocortisone derivatives; xanthines such as theophylline and doxophylline; beta-2-agonist bronchodilators such as salbutamol, fenterol, clenbuterol, bambuterol, salmeterol, fenoterol; antiinflammatory agents, including antiasthmatic antiinflammatory agents, antiarthritis antiinflammatory agents, and non-steroidal antiinflammatory agents, examples of which include but are not limited to sulfides, mesalamine, budesonide, salazopyrin, diclofenac, pharmaceutically acceptable diclofenac salts, nimesulide, naproxene, acetominophen,
- steroids such as
- acetylcholine receptor agonists such as pilocarpine hydrochloride and carbachol
- glutamate receptor agonists such as the N-methyl D-aspartate receptor agonist memantine
- anti-Vascular endothelial growth factor (VEGF) aptamers such as pegaptanib
- anti-VEGF antibodies including but not limited to anti-VEGF-A antibodies
- carbonic anhydrase inhibitors such as methazolamide, brinzolamide, dorzolamide hydrochloride, and acetazolamide
- anti arrhythmic agents such as quinidine, lidocaine, tocainide hydrochloride, mexiletine hydrochloride, digoxin, verapamil hydrochloride, propafenone hydrochloride, flecaimide acetate, procainamide hydrochloride, moricizine hydrochloride, and diisopyramide phosphate; antiparkinsonian
- a pharmaceutically active agent can be used in connection with administration to various subjects, for example, to humans (z.e., medical administration) or to animals (z.e., veterinary administration).
- a pharmaceutically active agent inherently encompasses the pharmaceutically acceptable salts thereof.
- sequence identity and “sequence similarity” can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences may then be referred to as “substantially identical” or “essentially similar” when they are optimally aligned. For example, sequence similarity or identity can be determined by searching against databases such as FASTA, BLAST, etc., but hits should be retrieved and aligned pairwise to compare sequence identity.
- Two proteins or two protein domains, or two nucleic acid sequences can have “substantial sequence identity” if the percentage sequence identity is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, preferably 90%, 95%, 98%, 99% or more.
- Such sequences are also referred to as “variants” herein, e.g., other variants of glycogen branching enzymes and amylases. Sequences with substantial sequence identity do not necessarily have the same length and may differ in length. For example, sequences that have the same nucleotide sequence but of which one has additional nucleotides on the 3’- and/or 5’-side are 100% identical.
- the skilled person can determine an efficacious dose, an efficacious schedule, and an efficacious route of administration for one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof so as to treat or prevent a synucleinopathy such as Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder.
- a synucleinopathy such as Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder.
- the skilled person can also alter, change, or modify an aspect of an administering step to improve efficacy of one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof.
- the skilled person can determine an efficacious dose, an efficacious schedule, and an efficacious route of administration for any disclosed isolated nucleic acid molecule, disclosed pharmaceutical formulation, disclosed vector, disclosed therapeutic agent, or any combination thereof.
- modifying the method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method.
- a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed rAAV vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed rAAV vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or by changing the duration of time that the one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed lentiviral vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or are administered to a subject.
- isolated refers to a nucleic acid molecule or a nucleic acid sequence that has been substantially separated, produced apart from, or purified away from other biological components in the cell or tissue of an organism in which the component occurs, such as other cells, chromosomal and extrachromosomal DNA and RNA, and proteins.
- Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins. Isolated proteins or nucleic acids, or cells containing such, in some examples are at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% pure.
- “concurrently” means (1) simultaneously in time, or (2) at different times during the course of a common treatment schedule.
- contacting refers to bringing one or more of disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof together with a target area or intended target area in such a manner that the one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof exert an effect on the intended target or targeted area either directly or indirectly.
- a target area or intended target area can be one or more of a subject’s organs (e.g., lungs, heart, liver, kidney, brain, etc.).
- a target area or intended target area can be any cell or any organ targeted, infected, or affected by a synucleinopathy like Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder.
- a target area or intended target area can be any cell or any organ targeted, infected, or affected by a-synuclein aggregates, particularly in a disease state (such as dopaminergic or cholinergic neurons).
- a target area or intended target area can be the brain or various neuronal populations.
- a target area or intended target area can be any cell or any organ infected by an over-expression or an under-expression of one or more genes.
- determining can refer to measuring or ascertaining the presence and severity of a synucleinopathy, an SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- Methods and techniques used to determine the presence and/or severity of a synucleinopathy, an SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) are typically known to the medical arts.
- the art is familiar with the ways to identify and/or diagnose the presence, severity, or both of a synucleinopathy, an SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- “determining” can also refer to measuring or ascertaining the level of one or more proteins or peptides in a biosample, or measuring or ascertaining the level or one or more RNAs or miRNAs in a biosample. Methods and techniques for determining the expression and/or activity level of relevant proteins, peptides, mRNA, DNA, or any combination thereof known to the art and are disclosed herein.
- an “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired result such as, for example, the treatment and/or prevention of a synucleinopathy.
- the terms “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired an effect on an undesired condition (e.g., a synucleinopathy).
- a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects.
- “therapeutically effective amount” means an amount of a disclosed isolated nucleic acid molecule, a disclosed pharmaceutical formulation, a disclosed vector, or any combination thereof that (i) treats the particular disease, condition, or disorder (e.g., synucleinopathy), (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder (e.g., synucleinopathy), or (iii) delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein (e.g., synucleinopathy).
- treats the particular disease, condition, or disorder e.g., synucleinopathy
- attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder e.g., synucleinopathy
- delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein e.g., synucleinopathy
- the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof employed; the disclosed methods employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof employed; the duration of the treatment; drugs used in combination or coincidental with the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof employed, and other like factors well known in the medical arts.
- the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, a single dose of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof can contain such amounts or submultiples thereof to make up the daily dose.
- the dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.
- a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition, such as, for example, synucleinopathy.
- a pharmaceutical carrier refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
- suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate.
- a pharmaceutical carrier employed can be a solid, liquid, or gas.
- examples of solid carriers can include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid.
- examples of liquid carriers can include sugar syrup, peanut oil, olive oil, and water.
- examples of gaseous carriers can include carbon dioxide and nitrogen.
- oral liquid preparations such as suspensions, elixirs and solutions
- carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like
- oral solid preparations such as powders, capsules and tablets.
- tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed.
- tablets can be coated by standard aqueous or nonaqueous techniques.
- Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
- These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
- Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like.
- Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption.
- Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.
- the injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use.
- Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
- the term “excipient” refers to an inert substance which is commonly used as a diluent, vehicle, preservative, binder, or stabilizing agent, and includes, but is not limited to, proteins (e.g., serum albumin, etc.), amino acids (e.g., aspartic acid, glutamic acid, lysine, arginine, glycine, histidine, etc.), fatty acids and phospholipids (e.g., alkyl sulfonates, caprylate, etc.), surfactants (e.g., SDS, polysorbate, nonionic surfactant, etc.), saccharides (e.g., sucrose, maltose, trehalose, etc.) and polyols (e.g., mannitol, sorbitol, etc.). See, also, for reference, Remington’s Pharmaceutical Sciences, (1990) Mack Publishing Co., Easton, Pa., which is hereby
- package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products.
- the term “in combination” in the context of the administration of one or more of the disclosed agents, disclosed therapeutic agents, disclosed nucleic acid molecules, disclosed viral vectors, disclosed rAAV vectors, disclosed pharmaceutical formulations or a combination thereof includes the use of more than one therapy (e.g., additional therapeutic agents).
- Administration “in combination with” one or more additional therapeutic agents includes simultaneous (e.g., concurrent) and consecutive administration in any order.
- the use of the term “in combination” does not restrict the order in which therapies are administered to a subject.
- a first therapy e.g., one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof
- a second therapy may be administered prior to (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks), concurrently, or after (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks or longer) the administration of a second therapy (
- CRISPR or clustered regularly interspaced short palindromic repeat is an ideal tool for correction of genetic abnormalities associated with diseases such as a synucleinopathy.
- the system can be designed to target genomic DNA directly.
- a CRISPR system involves two main components: a Cas9 enzyme and a guide (gRNA).
- the gRNA contains a targeting sequence for DNA binding (at, for example, the SNCA promoter region) and a scaffold sequence for Cas9 binding.
- Cas9 nuclease is often used to “knockout” target genes such as for example, the SNCA gene.
- multiple gRNAs can be employed to suppress or activate multiple genes simultaneously, hence increasing the treatment efficacy and reducing resistance potentially caused by new mutations in the target genes.
- CRISPR-based endonucleases include RNA-guided endonucleases that comprise at least one nuclease domain and at least one domain that interacts with a guide RNA.
- a guide RNA directs the CRISPR-based endonucleases to a targeted site in a nucleic acid at which site the CRISPR-based endonucleases cleaves at least one strand of the targeted nucleic acid sequence.
- the CRISPR-based endonuclease is universal and can be used with different guide RNAs to cleave different target nucleic acid sequences.
- CRISPR-based endonucleases are RNA-guided endonucleases derived from CRISPR/Cas systems.
- a disclosed CRISPR-based endonuclease can be derived from a CRISPR/Cas type I, type II, or type III system.
- suitable CRISPR/Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cm
- a disclosed CRISPR-based endonuclease can be derived from a type II CRISPR/Cas system.
- a CRISPR-based endonuclease can be derived from a Cas9 protein.
- the Cas9 protein can be from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp, Nocardiopsis rougevillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp
- the CRISPR-based nuclease can be derived from a Cas9 protein from Streptococcus pyogenes. In an aspect, the CRISPR-based nuclease can be derived from a Cas9 protein from Staphylococcus aureus. In an aspect, the CRISPR-based nuclease can be derived from a Cas9 protein from Campylobacter jejuni. In an aspect, the CRISPR-based nuclease can be a deactivated Cas9 protein (dCas9) derived from Streptococcus pyogenes Staphylococcus aureus , or Campylobacter jejuni.
- dCas9 deactivated Cas9 protein
- the CRISPR-based nuclease can comprise an amino acid sequence set forth in any one of SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, and SEQ ID NO: 18.
- the CRISPR-based nuclease can be encoded by a nucleic acid comprising a sequence set forth in any one of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 16, and SEQ ID NO: 18.
- CRISPRa refers to CRISPR Activation, which is using a dCas9 or dCas9-activator with a gRNA to increase transcription of a target gene.
- CRISPRi refers to CRISPR Interference, which is using a dCas9 or dCas9-repressor with a gRNA to repress/decrease transcription of a target gene.
- dCas9 refers to enzymatically inactive form of Cas9, which can bind, but cannot cleave, DNA.
- Protospacer Adjacent Motif or “PAM” refers to a sequence adjacent to the target sequence that is necessary for Cas enzymes to bind target DNA.
- these and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein.
- an isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- an isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- an isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- an isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- the neuron specific regulatory sequence may comprise a wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof.
- the neuron specific regulatory sequence is a neuron specific promoter.
- the term “neuron specific promoter” includes wild-type promoter, or derivatives thereof, synthetic promoter, minimal promoter, and any combination of promoter and enhancers sequence, that drives enhanced expression of a gene-of-interest to which it is operably linked in the neuron cells.
- the neuron specific promoter may drive enhanced expression of the gene-of-interest to which it is operably linked, in the neuron compared to other brain cells, for example, glia.
- the neuron specific promoter may be functional in enhancing expression in the neuron, of gene-of-interest to which it is operably linked, by about 1.1 -fold to about 100-fold or more.
- the neuron specific promoter may be functional in enhancing expression in the neuron, of gene-of-interest to which it is operably linked, by about 1.1 -fold to about 2-fold, about 2-fold to about 10-fold, about 10-fold to about 20-fold, about 20-fold to about 30-fold, about 30-fold to about 40-fold, about 40-fold to about 50-fold, about 50-fold to about 60-fold, about 60-fold to about 70-fold, about 70-fold to about 80-fold, about 80-fold to about 90-fold, about 90-fold to about 100-fold or more compared to other brain cells.
- the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter).
- neuron specific promoters include a TH promoter, a FOXA2 promoter, a Ch AT promoter, a Nkx2.1 promoter or a derivative thereof.
- the neuron specific regulatory element may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron).
- the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (z.e., a cholinergic promoter).
- the neuron specific regulatory element can comprise a neuron specific promoter.
- a disclosed neuron specific promoter can comprise a TH promoter, a F0XA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
- a disclosed dopaminergic promoter can comprise a TH promoter, a F0XA2 promoter, a fragment, or any combination thereof.
- a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
- the neuron specific promoter is a TH promoter, or a derivative thereof.
- a disclosed TH promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 5, or a fragment, or a derivative thereof.
- a disclosed TH promoter can comprise a sequence as set forth in SEQ ID NO: 5.
- the neuron specific promoter is a FOXA2 promoter, or a derivative thereof.
- a disclosed FOXA2 promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 6, or a fragment, or a derivative thereof.
- a disclosed FOXA2 promoter can comprise a sequence as set forth in SEQ ID NO: 6.
- the neuron specific promoter is a ChAT promoter, or a derivative thereof.
- a disclosed ChAT promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 7, or a fragment, or a derivative thereof.
- a disclosed ChAT promoter can comprise a sequence as set forth in SEQ ID NO: 7.
- the neuron specific promoter is a Nkx2.1 promoter, or a derivative thereof.
- a disclosed Nkx2.1 promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 8, or a fragment, or a derivative thereof.
- a disclosed Nkx2.1 promoter can comprise a sequence as set forth in SEQ ID NO: 8.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a F0XA2 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the fusion protein having one or more enzymatic activities can comprise a Ch AT promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a fragment thereof, or a derivative thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
- a disclosed dCas endonuclease can comprise a dCas9 endonuclease.
- a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
- a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9.
- a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
- a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof.
- a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof.
- a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof.
- a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof.
- a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof.
- a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof.
- a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
- a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10.
- a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof.
- a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- KRAB Kriippel-Associated Box
- NIPP1 the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb- HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2- MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRA
- a nucleic acid sequence encoding the disclosed HPla may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed HPla endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof.
- a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof.
- a disclosed HP la can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof.
- the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof
- the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a disclosed encoded KRAB- MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed DNMT3 A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded DNMT3A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity.
- a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain.
- a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
- a nucleic acid sequence encoding the disclosed VP 16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof.
- a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription repression activity.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 hi stone-dem ethyl ase repressor activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise transcription release factor activity.
- a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
- a disclosed encoded polypeptide can comprise histone modification activity.
- a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise nucleic acid association activity.
- a disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
- a disclosed encoded polypeptide can comprise methyltransferase activity.
- a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A).
- DNMT3A DNA
- a disclosed encoded polypeptide can comprise demethylase activity.
- a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1).
- a disclosed encoded polypeptide can comprise acetyltransferase activity.
- a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase.
- a disclosed encoded polypeptide can comprise deacetylase activity.
- a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
- a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb- MBD1, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1- MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBD1- MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPl
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed fusion can comprise KRAB-MeCP2.
- a disclosed dCas endonuclease can comprise dSaCas9, and a disclosed fusion can comprise KRAB-MeCP2.
- an isolated nucleic acid can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity.
- the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity.
- the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HP la, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HP la, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP
- the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A.
- a disclosed gene of interest or portion thereof can demonstrate a reduced expression and/or activity level when compared to wild-type or control expression level.
- a disclosed gRNA can target a gene of interest or portion thereof that demonstrates a reduced expression and/or activity level when compared to wild-type or control expression level.
- a disclosed gene of interest or portion thereof can demonstrate an increased expression and/or activity level when compared to wild-type or control expression level.
- a disclosed gRNA can target a gene of interest or portion thereof that demonstrates increased expression and/or activity level when compared to wild-type or control expression level.
- a disclosed gene of interest can comprise a neuronal gene of interest implicated in a synucleinopathy or other neurodegenerative disease.
- a disclosed gene of interest can comprise SNCA, LRRK2, RAB8, oxRABlO.
- a disclosed gene of interest can comprise SNCA.
- a disclosed gene of interest can comprise SNCA (UniProt ID: P37840), LRRK2 (UniProt ID: Q5S007), RAB8 (UniProt ID: P61026), RAB10 (UniProt ID: P61006) or any variant thereof, or any fragment thereof, or any portion thereof.
- a disclosed gene of interest can comprise SNCA (UniProt ID: P37840) or any variant thereof, or any fragment thereof, or any portion thereof.
- a disclosed isolated nucleic acid can comprise at least one gRNA that can target a gene of interest or portion thereof (e.g., an SNCA gene).
- a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs.
- disclosed gRNAs can target the same gene of interest or portion thereof.
- disclosed gRNAs can target different genes of interest or portions thereof.
- a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function.
- a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function.
- a disclosed gRNA can target the SNCA gene.
- a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90.
- a disclosed gRNA can target the promoter of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target intron 1 of the SNCA gene.
- a disclosed gRNA can target intron 4 of the SNCA gene.
- a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpG18, CpG19, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto.
- a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
- a disclosed isolated nucleic acid can further comprise a gRNA scaffold.
- a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
- a disclosed isolated nucleic acid molecule can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter).
- a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof a derivative thereof, or any combination thereof.
- a disclosed EF- la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a promoter can be a short EFl alpha (EFS-NF) promoter.
- a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a fragment thereof, or a derivative thereof.
- a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a fragment thereof, or a derivative thereof.
- a disclosed isolated nucleic acid molecule can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof.
- the second promoter operably linked to the gRNA may not be a neuron specific promoter.
- the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a FOXA2 promoter, a ChAT promoter, or a Nkx2.1 promoter, a fragment thereof, or a derivative thereof and a second promoter comprising a U6 promoter, a fragment thereof, or a derivative thereof.
- a disclosed isolated nucleic acid molecule can further comprise one or more additional regulatory elements.
- a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
- a disclosed NLS can comprise the sequence set forth in any of SEQ ID NO: 80 - SEQ ID NO: 83 or a fragment thereof.
- a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof.
- a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
- a disclosed nucleic acid sequence can be CpG depleted and codon-optimized for expression in a human cell.
- CpG-free can mean completely free of CpGs or partially free of CpGs.
- CpG-free can mean “CpG-depleted”.
- CpG- depleted can mean “CpG-free”.
- CpG-depleted can mean completely depleted of CpGs or partially depleted of CpGs.
- CpG-free can mean “CpG-optimized” for a desired and/or ideal expression level.
- any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
- a disclosed isolated nucleic acid molecule can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
- an isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a disclosed isolated nucleic acid molecule can treat and/or prevent a synucleinopathy (or progression thereof).
- a disclosed isolated nucleic acid molecule can treat and/or prevent an SNCA associated disease or disorder (or progression thereof).
- a disclosed isolated nucleic acid molecule can treat and/or prevent Parkinson’s disease (PD) (or progression thereof).
- a disclosed isolated nucleic acid molecule can treat and/or prevent dementia with Lewy bodies (DLB) (or progression thereof).
- a viral vector comprising a disclosed isolated nucleic acid molecule.
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a disclosed isolated nucleic acid molecule comprises one or more neuron specific regulatory elements.
- the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof.
- the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wild-type promoter or a neuron specific synthetic promoter).
- the neuron specific regulatory element may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron).
- the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter).
- the neuron specific regulatory element can comprise a neuron specific promoter.
- a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
- a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a fragment, or any combination thereof.
- a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
- a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a FOXA2 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
- a disclosed dCas endonuclease can comprise a dCas9 endonuclease.
- a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
- a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9.
- a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
- a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof.
- a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof.
- a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof.
- a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof.
- a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof.
- a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof.
- a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
- a disclosed dVQR can comprise DI 135 V, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10.
- a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof.
- a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel -Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla- NIPP1, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1- DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2- NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-
- a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof.
- a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof.
- a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof.
- the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
- nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof
- the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity.
- a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain.
- a disclosed transactivation domain can comprise a VP 16 protein, a series of linked VP 16 proteins, a p65 domain of NFKB, or any combination thereof.
- a nucleic acid sequence encoding the disclosed VP16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- a disclosed encoded VP16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof.
- a disclosed encoded VP 16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription repression activity.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise transcription release factor activity.
- a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a disclosed encoded polypeptide can comprise histone modification activity.
- a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise nucleic acid association activity.
- a disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-turn-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
- a disclosed encoded polypeptide can comprise methyltransferase activity.
- a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)- methyltransferase 3a (DNMT3A).
- a disclosed encoded polypeptide can comprise demethylase activity.
- a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1).
- a disclosed encoded polypeptide can comprise acetyltransferase activity.
- a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase.
- a disclosed encoded polypeptide can comprise deacetylase activity.
- a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
- a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- Methyl- CpG Binding Protein 2 Methyl- CpG Binding Protein 2
- DNMT3 A any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- MBD1 Methyl-CpG Binding Protein 2
- DNMT3 A any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB- MeCP2.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPl
- the vector can comprise a nucleic acid encoding a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity.
- the nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity.
- the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla- HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb- NIPP1, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBD1- MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP
- the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A.
- the encoded fusion protein can comprise a dSaCas9 and DNMT3 A.
- a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level.
- a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.
- a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs.
- disclosed gRNAs can target the same gene of interest or portion thereof.
- disclosed gRNAs can target different genes of interest or portions thereof.
- a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect of a disclosed viral vector, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function. Disclosed target genes and disclosed genes of interest are discussed supra.
- a disclosed gRNA can target the SNCA gene.
- a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90.
- a disclosed gRNA can target the promoter of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target intron 1 of the SNCA gene.
- a disclosed gRNA can target intron 4 of the SNCA gene.
- a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene and/or the promoter of the SNCA gene can comprise any sequence set forth in SEQ ID NO: 59 - SEQ ID NO: 71.
- a disclosed viral vector can further comprise a gRNA scaffold.
- a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73 or a fragment thereof.
- a disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter).
- a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof.
- a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 89, or a fragment thereof.
- a promoter can be a short EFl alpha (EFS-NF) promoter.
- a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter.
- a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter.
- a disclosed viral vector can further comprise two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed viral vector can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof.
- the second promoter operably linked to the gRNA may not be a neuron specific promoter.
- the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a FOXA2 promoter, a ChAT promoter, or a Nkx2.1 promoter and a second promoter comprising a U6 promoter.
- a disclosed viral vector can further comprise one or more additional regulatory elements.
- a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
- a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80 - SEQ ID NO: 83, or a fragment thereof.
- a disclosed PolyA sequence can comprise the sequence set forth in in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof.
- a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77, or a fragment thereof.
- a disclosed viral vector can comprise a nucleic acid that is CpG depleted and codon-optimized for expression in a human cell.
- CpG-free can mean completely free of CpGs or partially free of CpGs.
- CpG-free can mean “CpG-depleted”.
- CpG-depleted can mean “CpG-free”.
- CpG-depleted can mean completely depleted of CpGs or partially depleted of CpGs.
- CpG-free can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art.
- any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
- a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
- a viral vector comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a viral vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a viral vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a viral vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a viral vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a viral vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a viral vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a disclosed viral vector can be an adenovirus vector, an AAV vector, a herpes simplex virus vector, a retrovirus vector, a lentivirus vector, and alphavirus vector, a flavivirus vector, a rhabdovirus vector, a measles virus vector, a Newcastle disease viral vector, a poxvirus vector, or a picomavirus vector.
- a disclosed viral vector can be a lentiviral vector.
- a disclosed viral vector can be an AAV vector.
- a disclosed viral vector may comprise a lentiviral vector.
- a disclosed lentiviral vector can comprise a disclosed isolated nucleic acid molecule, as discussed supra.
- a disclosed lentiviral vector can comprise comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof.
- dCas deactivated Cas
- a disclosed lentiviral vector can comprise a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion protein having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof.
- dCas deactivated Cas
- the large packaging capacity of lentiviral vectors a commonly used method to stably deliver CRISPR/Cas9 components in vitro, can accommodate the 4.2 kb S. pyogenes Cas9, epigenetic modulator fusions, a single gRNA, and associated regulatory elements required for expression.
- the lentiviral vector may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene, including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 -71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.
- a disclosed lentiviral vector may be a modified lentiviral vector.
- the lentiviral vector may be modified to increase vector titer.
- the viral vector may be an episomal integrase-deficient lentiviral vector (IDLV).
- the IDLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of an SNCA gene, including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 - 71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.
- IDLVs Episomal integrase-deficient lentiviral vectors
- PPT 3g polypurine tract
- a disclosed lentiviral vector may comprise an episomal integrase-competent lentiviral vector (ICLV).
- the ICLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 - 71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB- MECP2 fusion protein is operably linked to a neuron specific regulatory element.
- a disclosed lentiviral vector may include an episomal integrase-deficient lentiviral vector (IDLV).
- IDLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 - 71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB- MECP2 fusion protein is operably linked to a neuron specific regulatory element.
- a viral vector disclosed herein may comprise an adeno-associated virus (AAV) vector (e.g., a recombinant AAV vector).
- AAV adeno-associated virus
- a disclosed AAV vector e.g., a recombinant AAV vector
- a disclosed AAV vector e.g., a recombinant AAV vector
- dCas deactivated Cas
- a disclosed AAV vector e.g., a recombinant AAV vector
- the AAV vector is a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species.
- AAV vectors may be used to deliver the composition for epigenome modification of a gene using various construct configurations.
- AAV vectors may deliver Cas fusion protein and gRNA expression cassettes on separate vectors or on the same vector.
- the small Cas9 proteins derived from species such as Staphylococcus aureus or Neisseria meningitidis or Campylobacter jejuni are used then both the Cas fusion protein and up to two gRNA expression cassettes may be combined in a single AAV vector within the 4.7 kb packaging limit.
- the AAV vector is a modified AAV vector.
- the modified AAV vector may be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:635-646).
- the modified AAV vector may deliver nucleases to skeletal and cardiac muscle in vivo.
- the modified AAV vector may be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9.
- the modified AAV vector may be based on AAV2 pseudotype with alternative muscle-tropic AAV capsids, such as AAV2/1, AAV2/6, AAV2/7, AAV2/8, AAV2/9, AAV2.5 and AAV/SASTG vectors that efficiently transduce skeletal muscle or cardiac muscle by systemic and local delivery (Seto et al. Current Gene Therapy (2012) 12: 139-151).
- the modified AAV vector may be AAV2i8G9 (Shen et al. J. Biol. Chem. (2013) 288:28814-28823)
- a disclosed AAV vector can include naturally isolated serotypes including, but not limited to, AAV1, AAV2, AAV3 (including 3a and 3b), AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, AAVrh39, AAVrh43, AAVcy.7 as well as bovine AAV, caprine AAV, canine AAV, equine AAV, ovine AAV, avian AAV, primate AAV, non-primate AAV, and any other virus classified by the International Committee on Taxonomy of Viruses (ICTV) as an AAV.
- AAV1, AAV2, AAV3 including 3a and 3b
- AAV4 AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, AAVrh39,
- an AAV capsid can be a chimera either created by capsid evolution or by rational capsid engineering from a naturally isolated AAV variants to capture desirable serotype features such as enhanced or specific tissue tropism and/or a host immune response escape.
- Naturally isolated AAV variants include, but not limited to, AAV-DJ, AAV-HAE1, AAV-HAE2, AAVM41, AAV- 1829, AAV2 Y/F, AAV2 T/V, AAV2i8, AAV2.5, AAV9.45, AAV9.61, AAV-B1, AAV-AS, AAV9.45A-String (e.g., AAV9.45-AS), AAV9.45Angiopep, AAV9.47-Angiopep, and AAV9.47-AS, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAV-F, AAVcc.47, and AAVcc.81.
- AAV-PHP.B AAV-PHP.eB
- AAV-PHP.S AAV-F, AAVcc.47, and AAVcc.81.
- a disclosed AAV vector can be AAV-Rh74 or a related variant (e.g., capsid variants like RHM4-1).
- a disclosed AAV vector can be AAV8.
- a disclosed AAV vector e.g., a recombinant AAV vector
- AAVhum.8 e.g., a recombinant AAV vector
- AAV9 e.g., a recombinant AAV vector
- Plasmid Vectors [0233] Disclosed herein is a plasmid comprising a disclosed isolated nucleic acid molecule.
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- a disclosed plasmid may comprise a disclosed viral vector provided herein.
- a disclosed isolated nucleic acid molecule comprises one or more neuron specific regulatory elements.
- the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof.
- the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wild-type promoter or a neuron specific synthetic promoter).
- the neuron specific regulatory element may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron).
- the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter).
- the neuron specific regulatory element can comprise a neuron specific promoter.
- a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
- a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a fragment, or any combination thereof.
- a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
- a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a FOXA2 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
- a disclosed dCas endonuclease can comprise a dCas9 endonuclease.
- a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
- a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9.
- a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
- a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof.
- a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof.
- a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof.
- a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof.
- a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof.
- a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof.
- a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
- a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10.
- a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof.
- a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Krtippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- KRAB Krtippel-Associated Box
- NIPP1 the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed fusion can comprise HPla- HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb- NIPP1, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1- MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-
- a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof.
- a disclosed HP la endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof.
- a disclosed HP la can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed HP lb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof.
- the sequence encoding the disclosed HP lb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof
- the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity.
- a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain.
- a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
- a nucleic acid sequence encoding the disclosed VP16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof.
- a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription repression activity.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise transcription release factor activity.
- a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: SEQ ID NO: 57, or a fragment thereof.
- a disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
- a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
- a disclosed encoded polypeptide can comprise histone modification activity.
- a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise nucleic acid association activity.
- a disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
- a disclosed encoded polypeptide can comprise methyltransferase activity.
- a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A).
- DNMT3A DNA
- a disclosed encoded polypeptide can comprise demethylase activity.
- a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1).
- a disclosed encoded polypeptide can comprise acetyltransferase activity.
- a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase.
- a disclosed encoded polypeptide can comprise deacetylase activity.
- a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
- a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- MBD1 Methyl-CpG Binding Protein 2
- DNMT3 A any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB- MeCP2.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla
- the plasmid can comprise a nucleic acid encoding a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity.
- the nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity.
- the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl -CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl -CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla- HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb- NIPP1, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBD1- MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-M
- the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A.
- the encoded fusion protein can comprise a dSaCas9 and DNMT3 A
- a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level.
- a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.
- a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs.
- disclosed gRNAs can target the same gene of interest or portion thereof.
- disclosed gRNAs can target different genes of interest or portions thereof.
- a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect of a disclosed plasmid, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function. Disclosed target genes and disclosed genes of interest are discussed supra.
- a disclosed gRNA can target the SNCA gene.
- a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90.
- a disclosed gRNA can target the promoter of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target intron 1 of the SNCA gene.
- a disclosed gRNA can target intron 4 of the SNCA gene.
- a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpG18, CpG19, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene and/or the promoter of the SNCA gene can comprise any sequence set forth in SEQ ID NO: 59 - SEQ ID NO: 71.
- a disclosed plasmid can further comprise a gRNA scaffold.
- a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
- a disclosed plasmid can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter).
- a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof.
- a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a promoter can be a short EFlalpha (EFS-NF) promoter.
- a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter.
- a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter.
- a disclosed plasmid can further comprise two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed plasmid can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof.
- the second promoter operably linked to the gRNA may not be a neuron specific promoter.
- the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a F0XA2 promoter, a ChAT promoter, or a Nkx2.1 promoter and a second promoter comprising a U6 promoter.
- a disclosed plasmid can further comprise one or more additional regulatory elements.
- a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post- transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’- LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
- a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80- SEQ ID NO: 83, or a fragment thereof.
- a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof.
- a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77, or a fragment thereof.
- a disclosed plasmid can comprise a nucleic acid that is CpG depleted and codon-optimized for expression in a human cell.
- CpG-free can mean completely free of CpGs or partially free of CpGs.
- CpG-free can mean “CpG-depleted”.
- CpG-depleted can mean “CpG-free”.
- CpG-depleted can mean completely depleted of CpGs or partially depleted of CpGs.
- CpG-free can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art.
- any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon- optimized.
- a disclosed plasmid can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
- a plasmid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a viral vector or plasmid comprising : (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- dCas deactivated Cas
- a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
- a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- a viral vector or a recombinant AAV vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
- a disclosed viral vector or plasmid can comprise the sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a variant thereof, or a fragment thereof, or a portion thereof.
- a disclosed viral vector can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a variant thereof, or a fragment thereof, or a portion thereof.
- a disclosed viral vector or plasmid can treat and/or prevent a synucleinopathy (or progression thereof).
- a disclosed viral vector or plasmid can treat and/or prevent an SNCA associated disease or disorder (or progression thereof).
- a disclosed viral vector or disclosed plasmid can treat and/or prevent Parkinson’s disease (PD) (or progression thereof).
- a disclosed viral vector or disclosed plasmid can treat and/or prevent dementia with Lewy bodies (DLB) (or progression thereof).
- DLB Lewy bodies
- a pharmaceutical formulation comprising a disclosed isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- pharmaceutical formulation comprising (1) an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
- dCas deactivated Cas
- a pharmaceutical formulation comprising a disclosed isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- pharmaceutical formulation comprising (1) an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
- dCas deactivated Cas
- a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
- dCas deactivated Cas
- a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof ; and (2) a pharmaceutically acceptable carrier.
- dCas deactivated Cas
- a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and
- a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and
- a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii) and (c) a promoter operably linked to (
- a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii) and (c) a promoter operably linked to (
- a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
- a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(i
- a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
- a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(i
- composition comprising a (1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, and (2) a pharmaceutically acceptable carrier.
- a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i)
- composition comprising a (1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, and (2) a pharmaceutically acceptable carrier.
- a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i
- a pharmaceutical formulation comprising 1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), and (2) a pharmaceutically acceptable carrier.
- dCas deactivated Cas
- a pharmaceutical formulation comprising 1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), and (2) a pharmaceutically acceptable carrier.
- dCas deactivated Cas
- a disclosed formulation can comprise (i) one or more active agents, (ii) biologically active agents, (iii) one or more pharmaceutically active agents, (iv) one or more immune-based therapeutic agents, (v) one or more clinically approved agents, or (vi) a combination thereof.
- a disclosed composition can comprise one or more proteasome inhibitors.
- a disclosed composition can comprise one or more immunosuppressives or immunosuppressive agents.
- an immunosuppressive agent can be anti-thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), or a combination thereof.
- a disclosed formulation can comprise a RNA therapeutic.
- An RNA therapeutic can comprise RNA-mediated interference (RNAi) and/or antisense oligonucleotides (ASO).
- a disclosed formulation can comprise a disclosed small molecule.
- a disclosed pharmaceutical formulation can treat and/or prevent progression of a synucleinopathy.
- a disclosed pharmaceutical formulation can treat and/or prevent progression of an SNCA associated disease disorder.
- a disclosed pharmaceutical formulation can treat and/or prevent Parkinson’s disease (PD) progression.
- a disclosed pharmaceutical formulation can treat and/or prevent progression of dementia with Lewy Bodies (DLB).
- PD Parkinson’s disease
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
- dCas deactivated Cas
- a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
- dCas deactivated Cas
- a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
- dCas deactivated Cas
- a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
- dCas deactivated Cas
- a host cell or a host cell line transduced by a viral vector comprising the sequence set forth in any one of SEQ ID NOs: 1 - 4.
- a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
- dCas deactivated Cas
- a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
- dCas deactivated Cas
- a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
- dCas deactivated Cas
- a host cell or a host cell line transfected by a plasmid comprising the sequence set forth in any one of SEQ ID NOs: 1 - 4.
- gRNAs Guide RNAs
- a guide RNA or gRNA comprising the sequence set forth in any one of SEQ ID NO: 59 -71, a sequence at least 90% identical thereoto, or a complement thereof.
- a guide RNA or gRNA targeting a disclosed gene of interest or portion thereof Disclosed gRNAs are listed below.
- a gRNA provides the targeting of a CRISPR/Cas9-based epigenome modifying system.
- a guide RNA is a specific RNA sequence that recognizes the target DNA region of interest (such as, for example, the SNCA gene) and directs the Cas endonuclease there for editing.
- the gRNA is made up of two parts: crisprRNA (crRNA), a 17-20 nucleotide sequence complementary to the target DNA, and a tracr RNA, which serves as a binding scaffold for the Cas nuclease.
- a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72 or SEQ ID NO: 73.
- a disclosed gRNA can serve to direct a disclosed deactivated Cas9 endonuclease (e.g., dSpCas9, dSaCas9, or dCjCas9) or a disclosed fusion product having a deactivated endonuclease to a target area of interest (such as, for example, the promoter of the SNCA gene or a targeted gene of interest as disclosed above).
- a target area of interest such as, for example, the promoter of the SNCA gene or a targeted gene of interest as disclosed above.
- a disclosed gRNA can serve to direct a disclosed deactivated Cas9 endonuclease (e.g., dSpCas9, dSaCas9, or dCjCas9) or a disclosed fusion product having a disclosed deactivated endonuclease to a target area of interest (such as, for example, a gene having a loss of function).
- a disclosed deactivated Cas9 endonuclease e.g., dSpCas9, dSaCas9, or dCjCas9
- a disclosed fusion product having a disclosed deactivated endonuclease e.g., dSpCas9, dSaCas9, or dCjCas9
- a target area of interest such as, for example, a gene having a loss of function
- Disclosed herein is a method of effecting precision epigenetic modulation of neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated.
- a method of effecting precision epigenetic modulation the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is reduced or decreased.
- Disclosed herein is a method of effecting precision epigenetic modulation, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is augmented or increased.
- Disclosed herein is a method of effecting precision epigenetic modulation, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of SNCA in the one or more neurons is reduced or decreased.
- a method of effecting precision epigenetic modulation in neurons comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the gene of interest in the one or more neurons is modulated.
- a disclosed isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and
- a method of effecting precision epigenetic modulation in neurons comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the gene of interest in the one or more neurons is modulated.
- a disclosed isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity and (i
- a method of effecting precision epigenetic modulation in neurons comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof
- the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g., SEQ ID NO: 8
- the gene of interest in the SNCA gene may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g.,
- a method of effecting precision epigenetic modulation in neurons comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof
- the neuron specific promoter of b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g., SEQ ID NO: 8
- the gene of interest in the SNCA gene may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter (e.g.,
- a method of effecting precision epigenetic modulation in neurons comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific regulatory element operably linked (a)(i) and/or (a)(ii), and (c) a promoter operably linked
- the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), any derivative thereof, any fragment thereof, or any combination thereof.
- the promoter of (c) comprises a U6 promoter, a derivative thereof, or a fragment thereof.
- the gene of interest in the SNCA gene is a promoter that promote the SNCA gene.
- a method of effecting precision epigenetic modulation in neurons comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably
- the neuron specific promoter of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the promoter of (v) comprises a U6 promoter a derivative thereof or a fragment thereof.
- the gene of interest in the SNCA gene is a promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the promoter of (v) comprises a U6 promoter
- a method of effecting precision epigenetic modulation in neurons in a subject comprising contacting one or more neurons in a subject with a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), wherein the expression and/or activity of one or more genes of interest in the one or more cells is modulated.
- a method of effecting precision epigenetic modulation in neurons comprising contacting one or more cells in a subject with a therapeutically effective amount of a disclosed viral vector e.g., a lentiviral vector), wherein the expression and/or activity of one or more genes of interest in the one or more neurons is reduced or decreased.
- Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more cells in a subject with a therapeutically effective amount of a disclosed viral vector e.g., a lentiviral vector), wherein the expression and/or activity of one or more genes of interest in the one or more neurons is augmented or increased.
- a method of effecting precision epigenetic modulation the method comprising contacting one or more cells in a subject with a therapeutically effective amount of a disclosed viral vector e.g., a lentiviral vector), wherein the expression and/or activity of SNCA in the one or more neurons is reduced or decreased.
- a method of effecting precision epigenetic modulation in neurons in a subject comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated.
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity and (ii
- the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof.
- the neuron specific regulatory element of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a method of effecting precision epigenetic modulation in neurons in a subject comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more cells is modulated.
- a viral vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, (iii) at least one guide
- the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof.
- the neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a method of effecting precision epigenetic modulation in neurons in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated.
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities,
- a method of effecting precision epigenetic modulation in neurons in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated.
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities,
- a method of effecting precision epigenetic modulation in neurons in a subject comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any
- the dCas of (a)(i) is dSaCas9.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof.
- the neuron specific regulatory element of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g., SEQ ID NO: 8
- a method of effecting precision epigenetic modulation in neurons in a subject comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or
- the dCas of (a)(i) is dSaCas9.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof.
- the neuron specific promoter of (b) can comprise a TH promoter e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g., SEQ ID NO: 8
- a method of effecting precision epigenetic modulation in neurons in a subject comprising contacting one or more cells in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked
- the dCas of (a)(i) is dSaCas9.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof.
- the neuron specific regulatory element of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the promoter of (c) can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a method of effecting precision epigenetic modulation in neurons in a subject comprising contacting one or more cells in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific promoter element operably linked to (a)(i) and/or (a)(ii) and (c) a promoter
- the dCas of (a)(i) is dSaCas9.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof.
- the neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or a combination thereof.
- the promoter of (c) can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed gene of interest or portion thereof can demonstrate a reduced expression and/or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gene of interest or portion thereof can demonstrate an increased expression and/or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates a reduced expression and/or activity level when compared to wild-type or control expression level.
- a disclosed method of effecting precision epigenetic modulation comprises measuring the level of expression and/or the level of activity of the disclosed gene of interest. In an aspect, a disclosed method can comprise repeating the measuring step one or more times.
- a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same gene of interest or portion thereof. In an aspect, disclosed gRNAs can target different genes of interest or portions thereof. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function.
- a disclosed gene of interest can comprise SNCA, LRRK2, RAB8, or RAB10.
- a disclosed gene of interest can comprise SNCA (UniProt ID: P37840), LRRK2 (UniProt ID: Q5S007), RAB8 (UniProt ID: P61026), RAB10 (UniProt ID: P61006) or any variant thereof, or any fragment thereof, or any portion thereof.
- a disclosed gene of interest can comprise the SNCA gene, any variant thereof, any fragment thereof, or any portion thereof.
- the disclosed gene of interest can comprise SNCA (UniProt ID: P37840).
- a disclosed isolated nucleic acid or disclosed viral vector comprises one or more neuron specific regulatory elements.
- the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof.
- the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter).
- the neuron specific regulatory element may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron).
- the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter).
- the neuron specific regulatory element can comprise a neuron specific promoter.
- a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed F0XA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed F0XA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a F0XA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed dCas endonuclease can comprise a dCas9 endonuclease.
- a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
- a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9.
- a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
- a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof.
- a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof.
- a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof.
- a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof.
- a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof.
- a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof.
- a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
- a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10.
- a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof.
- a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise HPla, HP lb, MBD1, MBD2, Kriippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed fusion or disclosed fusion product can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb- KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBD1- HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, MBD2-MBD2, MBD2-HP
- nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof.
- sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof.
- a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof.
- a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof.
- the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof
- the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity.
- a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain.
- a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
- a nucleic acid sequence encoding the disclosed VP16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof.
- a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription repression activity.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise transcription release factor activity.
- a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
- a disclosed encoded polypeptide can comprise histone modification activity.
- a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise nucleic acid association activity.
- a disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
- a disclosed encoded polypeptide can comprise methyltransferase activity.
- a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3 A).
- a disclosed encoded polypeptide can comprise demethylase activity.
- a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1).
- a disclosed encoded polypeptide can comprise acetyltransferase activity.
- a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase.
- a disclosed encoded polypeptide can comprise deacetylase activity.
- a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
- a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB-MeCP2.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD
- an isolated nucleic acid or viral vector can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity.
- the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity.
- the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP
- the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A.
- a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level.
- a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.
- a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs.
- disclosed gRNAs can target the same gene of interest or portion thereof.
- disclosed gRNAs can target different genes of interest or portions thereof.
- a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function.
- a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function. Disclosed target genes and disclosed genes of interest are discussed supra.
- a disclosed gRNA can target the SNCA gene.
- a disclosed SNCA gene cam comprise the sequence set forth in SEQ ID NO: 90.
- a disclosed gRNA can target the promoter of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target intron 1 of the SNCA gene.
- a disclosed gRNA can target intron 4 of the SNCA gene.
- a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl 1, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto.
- a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
- a disclosed viral vector can further comprise a gRNA scaffold.
- a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
- a disclosed isolated nucleic acid or disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter).
- a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof.
- a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a promoter can be a short EFlalpha (EFS-NF) promoter.
- a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed isolated nucleic acid molecule or viral vector can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof.
- the second promoter operably linked to the gRNA may not be a neuron specific promoter.
- the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a F0XA2 promoter, a Ch AT promoter, or a Nkx2.1 promoter, a fragment thereof, a derivative thereof, or any combination thereof, and a second promoter comprising a U6 promoter.
- a disclosed isolated nucleic acid molecule or viral vector can further comprise one or more additional regulatory elements.
- a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
- a disclosed NLS can comprise the sequence set forth in any of 80- SEQ ID NO: 83 or a fragment thereof.
- a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof.
- a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
- a disclosed viral vector or isolated nucleic acid can comprise a nucleic acid that is CpG depleted and codon-optimized for expression in a human cell.
- CpG-free can mean completely free of CpGs or partially free of CpGs.
- CpG-free can mean “CpG-depleted”.
- CpG-depleted can mean “CpG- free”.
- CpG-depleted can mean completely depleted of CpGs or partially depleted of CpGs.
- CpG-free can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art.
- any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon- optimized.
- a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
- modulating can comprise increasing expression and/or activity of one or more genes of interest. In an aspect of a disclosed method of effecting precision epigenetic modulation, modulating can comprise decreasing expression and/or activity of one or more genes of interest.
- a disclosed method of effecting precision epigenetic modulation can comprise reducing expression and/or activity of SNCA.
- the disclosed cells can be neurons (e.g., cholinergic neurons, dopaminergic neurons, etc.). In an aspect, the disclosed cells can be cells affected by an overexpression level and/or activity level of one or more genes of interest or one or more target genes.
- neurons e.g., cholinergic neurons, dopaminergic neurons, etc.
- the disclosed cells can be cells affected by an overexpression level and/or activity level of one or more genes of interest or one or more target genes.
- the disclosed cells can be in a subject.
- a subject can be a human.
- a subject can be suspected of having or can be diagnosed with having a synucleinopathy (such as, for example, Parkinson’s disease or dementia with Lewy bodies (DLB)).
- a subject can be suspected of having or can be diagnosed with having Parkinson’s disease or dementia with Lewy bodies (DLB).
- a disclosed subject can be symptomatic or asymptomatic.
- a disclosed method of effecting precision epigenetic modulation can comprise reducing the pathological phenotype associated with a synucleinopathy.
- reducing the pathological phenotype associated with a synucleinopathy can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies).
- a disclosed method can comprise diagnosing the subject with a synucleinopathy.
- a disclosed method of effecting precision epigenetic modulation can comprise reducing the pathological phenotype associated with Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- reducing the pathological phenotype associated with Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies).
- a disclosed method can comprise diagnosing the subject with Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
- a subject can be a subject having a disease or disorder.
- a disease or disorder can be any disease or disorder disclosed herein, for example, characterized by an overexpression and/or over-activity or characterized by a loss of function.
- a subject can be a subject in need of treatment of a disclosed disease or disorder (e.g., a genetic disease or disorder).
- a disclosed disease or disorder e.g., a genetic disease or disorder.
- a disclosed method of effecting precision epigenetic modulation can restore the functionality and/or structural integrity of a missing, deficient, and/or mutant protein or enzyme.
- a disclosed method of effecting precision epigenetic modulation can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation.
- restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise reducing the expression and/or activity level of at least one gene of interest or at least one target gene.
- a gene of interest can be a gene that demonstrates over expression and/or over activity.
- restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise increasing the expression and/or activity level of at least one gene of interest or at least one target gene.
- a gene of interest can be a gene that demonstrates a loss of function or reduced expression and/or activity level.
- restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and/or ameliorating autophagy); (iii) improving, enhancing, restoring, and/or preserving mitochondrial functionality and/or structural integrity; (iv) improving, enhancing, restoring, and/or preserving organelle functionality and/or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of the multi -systemic manifestations of a genetic disease or disorder; (vii) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of a genetic disease or disorder, or (viii) any combination thereof.
- restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and/or preserving one or more aspects of cellular structural and/or functional integrity.
- restoring the activity and/or functionality of a missing, deficient, and/or mutant protein or enzyme can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of restoration when compared to a pre-existing level such as, for example, a pre-treatment level.
- the amount of restoration can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% more than a pre-existing level such as, for example, a pre-treatment level.
- restoration can be measured against a control level or a reference level (e.g., determined, for example, using one or more subjects not having a missing, deficient, and/or mutant protein or enzyme).
- restoration can be a partial or incomplete restoration.
- restoration can be complete or near complete restoration such that the level of expression, activity, and/or functionality is like that of a wild-type or control level.
- restoring the activity and/or functionality of a gene of interest can comprise increasing or enhancing the expression and/or activity level of that gene.
- increasing or enhancing can comprise an elevation of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level).
- restoring the activity and/or functionality of a gene of interest can comprise decreasing or reducing the expression and/or activity level of that gene.
- decreasing or reducing can comprise a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level).
- techniques to monitor, measure, and/or assess the restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are discussed supra.
- administering can comprise intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-ci sterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, intrahepatic administration, hepatic intra-arterial administration, hepatic portal vein (HPV) administration, or any combination thereof.
- a disclosed vector can be administered via LNP administration.
- administering can comprise use of non-viral vectors to deliver a disclosed isolated nucleic acid.
- these non-viral vectors can include, but are not limited to, nanoparticles or liposomes.
- the disclosed isolated nucleic acids may be delivered via viral vectors (such as the disclosed viral vectors provided herein).
- Exemplary viral vectors are described supra and include adenovirus, adeno-associated virus (AAV), and lentivirus (LV). Viral vectors are used more commonly due to their robust delivery, long-lasting expression, low immunogenicity and toxicity, and compatibility with the advanced manufacturing techniques.
- a disclosed method of effecting precision epigenetic modulation can employ multiple routes of administration to the subject.
- a disclosed method can employ a first route of administration that can be the same or different as a second and/or subsequent routes of administration.
- a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can be concurrently and/or serially administered to a subject via multiple routes of administration.
- administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise intravenous administration and intra-cistem magna (ICM) administration.
- administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise IV administration and intrathecal (ITH) administration.
- a therapeutically effective amount of disclosed vector can be delivered via intravenous (IV) administration and can comprise a range of about 1 x IO 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg to about 8 x 10 13 vg/kg or about 1 x 10 12 vg/kg to about 8 x 10 13 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 10 13 vg/kg to about 6 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of at least about 1 x IO 10 vg/kg, at least about 5 x IO 10 vg/kg, at least about 1 x 10 11 vg/kg, at least about 5 x 10 11 vg/kg, at least about 1 x 10 12 vg/kg, at least about 5 x 10 12 vg/kg, at least about 1 x 10 13 vg/kg, at least about 5 x 10 13 vg/kg, or at least about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of no more than about 1 x IO 10 vg/kg, no more than about 5 x IO 10 vg/kg, no more than about 1 x 10 11 vg/kg, no more than about 5 x 10 11 vg/kg, no more than about 1 x 10 12 vg/kg, no more than about 5 x 10 12 vg/kg, no more than about 1 x 10 13 vg/kg, no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- a disclosed method of effecting precision epigenetic modulation can further comprise monitoring the subject for adverse effects. In an aspect, in the absence of adverse effects, the method can further comprise continuing to treat the subject. In an aspect, in the presence of adverse effects, the method can further comprise modifying the treating step. Methods of monitoring a subject’s well-being can include both subjective and objective criteria (and are discussed supra). Such methods are known to the skilled person. [0416] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- a therapeutic agent can be any disclosed agent that effects a desired clinical outcome.
- a disclosed method of effecting precision epigenetic modulation can further comprise administering to the subject a therapeutically effective amount of an agent that can correct one or more aspects of a dysregulated metabolic or enzymatic pathway.
- an agent can comprise an enzyme for enzyme replacement therapy.
- a disclosed enzyme can replace any enzyme in a dysregulated or dysfunctional metabolic or enzymatic pathway.
- a disclosed method can comprise replacing one or more enzymes in a dysregulated or dysfunctional metabolic pathway.
- a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more immune modulators.
- a disclosed immune modulator can be methotrexate, rituximab, intravenous gamma globulin, or bortezomib, or a combination thereof.
- a disclosed immune modulator can be bortezomib or SVP- Rapamycin.
- a disclosed immune modulator can be Tacrolimus.
- a disclosed immune modulator such as methotrexate can be administered at a transient low to high dose.
- a disclosed immune modulator can be administered at a dose of about 0.1 mg/kg body weight to about 0.6 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.4 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for 3 to 5 or greater cycles, with up to three days per cycle. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for a minimum of 3 cycles, with three days per cycle. In an aspect, a person skilled in the art can determine the appropriate number of cycles. In an aspect, a disclosed immune modulator can be administered as many times as necessary to achieve a desired clinical effect.
- a disclosed immune modulator can be administered orally about one hour before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered orally about one hour or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof.
- a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more proteasome inhibitors (e.g., bortezomib, carfilzomib, marizomib, ixazomib, and oprozomib).
- a proteasome inhibitor can be an agent that acts on plasma cells (e.g., daratumumab).
- an agent that acts on a plasma cell can be melphalan hydrochloride, melphalan, pamidronate disodium, carmustine, carfilzomib, carmustine, cyclophosphamide, daratumumab, doxorubicin hydrochloride liposome, doxorubicin hydrochloride liposome, elotuzumab, melphalan hydrochloride, panobinostat, ixazomib citrate, carfilzomib, lenalidomide, melphalan, melphalan hydrochloride, plerixafor, ixazomib citrate, pamidronate disodium, panobinostat, plerixafor, pomalidomide, pomalidomide, lenalidomide, selinexor, thalidomide, thalidomide, bortezomib, selinexor, zoledronic acid, or zoledron
- a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more proteasome inhibitors or agents that act on plasma cells prior to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation.
- a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells concurrently with administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation.
- a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells subsequent to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation.
- a disclosed method can further comprise administering one or more proteasome inhibitors more than 1 time.
- a disclosed method can comprise administering one or more proteasome inhibitors repeatedly over time.
- a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more immunosuppressive agents.
- an immunosuppressive agent can be, but is not limited to, azathioprine, methotrexate, sirolimus, antithymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), steroids, or a combination thereof.
- a disclosed method can comprise administering one or more immunosuppressive agents more than 1 time.
- a disclosed method can comprise administering one or more one or more immunosuppressive agents repeatedly over time.
- a disclosed method can comprise administering a compound that targets or alters antigen presentation or humoral or cell mediated or innate immune responses.
- a disclosed method of effecting precision epigenetic modulation can further comprise administering a compound that exerts a therapeutic effect against B cells and/or a compound that targets or alters antigen presentation or humoral or cell mediated immune response.
- a disclosed compound can be rituximab, methotrexate, intravenous gamma globulin, anti CD4 antibody, anti CD2, an anti-FcRN antibody, a BTK inhibitor, an anti-IGFIR antibody, a CD 19 antibody (e.g., inebilizumab), an anti-IL6 antibody (e.g., tocilizumab), an antibody to CD40, an IL2 mutein, or a combination thereof.
- Treg infusions that can be administered as a way to help with immune tolerance (e.g., antigen specific Treg cells to AAV).
- a subject can be a human.
- a subject can be suspected of having or can be diagnosed with having a synucleinopathy (such as, for example, Parkinson’s disease (PD) and dementia with Lewy bodies (DLB)).
- a disclosed subject can be symptomatic or asymptomatic.
- a disclosed method can comprise repeating one or more steps of the method and/or modifying one or more steps of the method (such as, for example, an administering step).
- a disclosed method of effecting precision epigenetic modulation can comprise modifying one or more of the disclosed steps.
- modifying one or more of steps of a disclosed method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method.
- a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, or by changing the duration of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject.
- a disclosed method of effecting precision epigenetic modulation can be altered by changing the amount of one or more disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject, or by changing the frequency of administration of one or more of the disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject.
- a disclosed method of effecting precision epigenetic modulation can further comprise generating and/or validating one or more of the disclosed isolated nucleic acid molecules, one or more of the disclosed vectors, one or more of the disclosed pharmaceutical formulations, or any combination thereof.
- a disclosed method of effecting precision epigenetic modulation can further comprise contacting the cells with a second disclosed isolated nucleic acid molecule, a second disclosed vector, a second disclosed pharmaceutical formulations, or any combination thereof.
- a disclosed method of effecting precision epigenetic modulation can further comprise contacting the cells with additional disclosed isolated nucleic acid molecules, additional disclosed vectors, additional disclosed pharmaceutical formulations, or any combination thereof.
- Disclosed herein is a method of treating and/or preventing progression of an SNCA associated disease or disorder, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, thereby reducing the pathological phenotype associated with the SNCA associated disease or disorder.
- a method of treating and/or preventing an SNCA associated disease or disorder comprises administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with the SNCA associated disease or disorder.
- a disclosed viral vector e.g., a lentiviral vector
- the method comprises administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, thereby reducing the pathological phenotype associated with the synucleinopathy.
- a method of treating and/or preventing a synucleinopathy comprises administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with the synucleinopathy.
- a disclosed viral vector e.g., a lentiviral vector
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- a disclosed isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonu
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- a disclosed isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonu
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclea
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting an SNCA gene or portion thereof and b) at least one neuron specific regulatory element operably linked to (a)(i), (a)
- the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), derivative thereof, a fragment thereof, or any combination thereof.
- a TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g., SEQ ID NO: 8
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a) a deactivated Cas (dCa
- the neuron specific promoter of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g., SEQ ID NO: 8
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)
- the neuron specific regulatory element of (iv) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the promoter of (c) comprises a U6 promoter, a derivative thereof or a fragment thereof.
- Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- a disclosed viral vector e.g., a lentiviral vector
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- a disclosed viral vector e.g., a lentiviral vector
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising ((a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- a viral vector comprising ((a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii),
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to the (a)(i) and/or
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to the (a)(i) and/or (a)
- a viral vector comprising
- the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or
- a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding
- dCas deactivated Cas endonuclease
- dCas deactivated Cas endonuclease
- the dCas is a dSpCas9, dSaCas9, or dCjCas9
- a fusion product having one or more enzymatic activities comprising any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- the promoter of (c) comprises a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can reduce and/or decrease the expression and/or activity of SNCA.
- the expression and/or activity of SNCA is reduced and/or decreased.
- a disclosed method can comprise diagnosing the subject with synucleinopathy or other SNCA associated disease or disorder.
- a disclosed method of treating and/or preventing synucleinopathy or other SNCA associated disease or disorder comprises measuring the level of expression and/or the level of activity of the SNCA gene.
- a disclosed method can comprise repeating the measuring step one or more times.
- the expression and/or activity level of SNCA can be elevated and/or increased when compared to wild-type or control expression level. In an aspect, following the administering step, the expression and/or activity level of SNCA can be reduced and/or decreased when compared to the pre-administering step level.
- a disclosed gRNA targeting a portion of the SNCA gene can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same portion of the SNCA gene or different portions of the SNCA gene. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto.
- a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
- a disclosed isolated nucleic acid or disclosed viral vector comprises one or more neuron specific regulatory elements.
- the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof.
- the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter).
- the neuron specific regulatory element may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron).
- the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter).
- the neuron specific regulatory element can comprise a neuron specific promoter.
- a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific promoter operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed dCas endonuclease can comprise a dCas9 endonuclease.
- a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
- a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9.
- a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
- a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof.
- a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof.
- a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof.
- a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof.
- a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof.
- a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof.
- a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
- a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10.
- a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof.
- a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed fusion or disclosed fusion product can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb- KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBD1- HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, MBD2-MBD2, MBD2-HP
- a disclosed fusion or disclosed fusion product can comprise KRAB-MeCP2.
- a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof.
- a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof.
- a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed HP lb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof.
- the sequence encoding the disclosed HP lb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof
- the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity.
- a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain.
- a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
- a nucleic acid sequence encoding the disclosed VP 16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof.
- a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription repression activity.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise transcription release factor activity.
- a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
- a disclosed encoded polypeptide can comprise histone modification activity.
- a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise nucleic acid association activity.
- a disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
- a disclosed encoded polypeptide can comprise methyltransferase activity.
- a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A).
- a disclosed encoded polypeptide can comprise demethylase activity.
- a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1).
- TTT1 ten-eleven translocation methylcytosine dioxygenase 1
- LSD1 lysine-specific histone demethylase 1
- a disclosed encoded polypeptide can comprise acetyltransferase activity.
- a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase.
- a disclosed encoded polypeptide can comprise deacetylase activity.
- a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
- a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB-MeCP2.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl
- an isolated nucleic acid or viral vector can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity.
- the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity.
- the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP
- the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A.
- a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level.
- a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.
- a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA can target the SNCA gene.
- a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90.
- a disclosed gRNA targeting the SNCA gene can comprise at least two gRNAs.
- a disclosed gRNA can target the promoter of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target intron 1 of the SNCA gene.
- a disclosed gRNA can target intron 4 of the SNCA gene.
- a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto.
- a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
- a disclosed viral vector can further comprise a gRNA scaffold.
- a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
- a disclosed isolated nucleic acid or disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter).
- a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof
- a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a promoter can be a short EFlalpha (EFS-NF) promoter.
- a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed isolated nucleic acid molecule or viral vector can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof.
- the second promoter operably linked to the gRNA may not be a neuron specific promoter.
- the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a FOXA2 promoter, a Ch AT promoter, or a Nkx2.1 promoter, a fragment thereof, a derivative thereof, or any combination thereof, and a second promoter comprising a U6 promoter.
- a disclosed isolated nucleic acid molecule or viral vector can further comprise one or more additional regulatory elements.
- a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
- a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80- SEQ ID NO: 83 or a fragment thereof.
- a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof.
- a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
- a disclosed viral vector or isolated nucleic acid can be CpG depleted and codon-optimized for expression in a human cell.
- CpG-free can mean completely free of CpGs or partially free of CpGs.
- CpG-free can mean “CpG-depleted”.
- CpG-depleted can mean “CpG-free”.
- CpG- depleted can mean completely depleted of CpGs or partially depleted of CpGs.
- CpG-free can mean “CpG-optimized” for a desired and/or ideal expression level.
- any disclosed dCas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
- a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
- a disclosed method can further comprise effecting precision epigenetic modulation of the SNCA gene or a portion of the SNCA gene.
- modulating can comprise decreasing and/or reducing expression and/or activity of the SNCA gene or a portion of the SNCA gene.
- the disclosed cells can be neurons (e.g., cholinergic neurons, dopaminergic neurons, etc.). In an aspect, the disclosed cells can be cells affected by an overexpression level and/or activity level of the SNCA gene or a portion of the SNCA gene.
- neurons e.g., cholinergic neurons, dopaminergic neurons, etc.
- the disclosed cells can be cells affected by an overexpression level and/or activity level of the SNCA gene or a portion of the SNCA gene.
- the disclosed cells can be in a subject.
- a subject can be a human.
- a subject can be suspected of having or can be diagnosed with having synucleinopathy or other SNCA associated disease or disorder (e.g., Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)).
- PD Parkinson’s disease
- DLB dementia with Lewy bodies
- a disclosed method can comprise reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
- reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder can comprise reducing the number and/or amount of alpha- synuclein aggregates (e.g., Lewy Bodies).
- a disclosed method can comprise diagnosing the subject with synucleinopathy or other SNCA associated disease or disorder.
- a subject can be a subject in need of treatment of synucleinopathy or other SNCA associated disease or disorder.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation.
- restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene.
- restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and/or ameliorating autophagy); (iii) improving, enhancing, restoring, and/or preserving mitochondrial functionality and/or structural integrity; (iv) improving, enhancing, restoring, and/or preserving organelle functionality and/or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of the multi -systemic manifestations of a genetic disease or disorder; (
- restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and/or preserving one or more aspects of cellular structural and/or functional integrity.
- restoring the activity and/or functionality of a missing, deficient, and/or mutant protein or enzyme can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of restoration when compared to a pre-existing level such as, for example, a pre-treatment level.
- the amount of restoration can be 10-20%, 20- 30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% more than a pre-existing level such as, for example, a pre-treatment level.
- restoration can be measured against a control level or a reference level (e.g., determined, for example, using one or more subjects not having a missing, deficient, and/or mutant protein or enzyme).
- restoration can be a partial or incomplete restoration.
- restoration can be complete or near complete restoration such that the level of expression, activity, and/or functionality is like that of a wildtype or control level.
- restoring the activity and/or functionality of the SNCA gene or a portion of the SNCA gene can comprise decreasing or reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene.
- decreasing or reducing can comprise a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level).
- techniques to monitor, measure, and/or assess the restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are discussed supra.
- administering can comprise intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-cistema magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, intrahepatic administration, hepatic intra-arterial administration, hepatic portal vein (HPV) administration, or any combination thereof.
- a disclosed vector can be administered via LNP administration.
- administering can comprise use of non-viral vectors to deliver a disclosed isolated nucleic acid.
- these non-viral vectors can include, but are not limited to, nanoparticles or liposomes.
- the disclosed isolated nucleic acids may be delivered via viral vectors (such as the disclosed viral vectors provided herein).
- Exemplary viral vectors are described supra and include adenovirus, adeno-associated virus (AAV), and lentivirus (LV).
- AAV adeno-associated virus
- LV lentivirus
- Viral vectors are used more commonly due to their robust delivery, long-lasting expression, low immunogenicity and toxicity, and compatibility with the advanced manufacturing techniques. Most research in gene therapy has utilized AAV or LV due to their lowered immunogenicity compared to adenovirus.
- LV integrates its viral genome into the host gene to create permanent change in gene expression.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can employ multiple routes of administration to the subject.
- a disclosed method can employ a first route of administration that can be the same or different as a second and/or subsequent routes of administration.
- a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can be concurrently and/or serially administered to a subject via multiple routes of administration.
- administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise intravenous administration and intra-cistem magna (ICM) administration.
- ICM intra-cistem magna
- administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise IV administration and intrathecal (ITH) administration.
- IV administration and intrathecal (ITH) administration can comprise IV administration and intrathecal (ITH) administration.
- a therapeutically effective amount of disclosed vector can be delivered via intravenous (IV) administration and can comprise a range of about 1 x IO 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg to about 8 x 10 13 vg/kg or about 1 x 10 12 vg/kg to about 8 x 10 13 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 10 13 vg/kg to about 6 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of at least about 1 x IO 10 vg/kg, at least about 5 x IO 10 vg/kg, at least about 1 x 10 11 vg/kg, at least about 5 x 10 11 vg/kg, at least about 1 x 10 12 vg/kg, at least about 5 x 10 12 vg/kg, at least about 1 x 10 13 vg/kg, at least about 5 x 10 13 vg/kg, or at least about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of no more than about 1 x IO 10 vg/kg, no more than about 5 x IO 10 vg/kg, no more than about 1 x 10 11 vg/kg, no more than about 5 x 10 11 vg/kg, no more than about 1 x 10 12 vg/kg, no more than about 5 x 10 12 vg/kg, no more than about 1 x 10 13 vg/kg, no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise monitoring the subject for adverse effects.
- the method in the absence of adverse effects, can further comprise continuing to treat the subject.
- the method in the presence of adverse effects, can further comprise modifying the treating step.
- Methods of monitoring a subject’s well-being can include both subjective and objective criteria (and are discussed supra). Such methods are known to the skilled person.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- a therapeutic agent can be any disclosed agent that effects a desired clinical outcome.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject a therapeutically effective amount of an agent that can correct one or more aspects of a dysregulated metabolic or enzymatic pathway.
- such an agent can comprise an enzyme for enzyme replacement therapy.
- a disclosed enzyme can replace any enzyme in a dysregulated or dysfunctional metabolic or enzymatic pathway.
- a disclosed method can comprise replacing one or more enzymes in a dysregulated or dysfunctional metabolic pathway.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more immune modulators.
- a disclosed immune modulator can be methotrexate, rituximab, intravenous gamma globulin, or bortezomib, or a combination thereof.
- a disclosed immune modulator can be bortezomib or SVP-Rapamycin.
- a disclosed immune modulator can be Tacrolimus.
- a disclosed immune modulator such as methotrexate can be administered at a transient low to high dose.
- a disclosed immune modulator can be administered at a dose of about 0.1 mg/kg body weight to about 0.6 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.4 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for 3 to 5 or greater cycles, with up to three days per cycle. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for a minimum of 3 cycles, with three days per cycle. In an aspect, a person skilled in the art can determine the appropriate number of cycles. In an aspect, a disclosed immune modulator can be administered as many times as necessary to achieve a desired clinical effect.
- a disclosed immune modulator can be administered orally about one hour before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered orally about one hour or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more proteasome inhibitors (e.g., bortezomib, carfilzomib, marizomib, ixazomib, and oprozomib).
- a proteasome inhibitor can be an agent that acts on plasma cells (e.g., daratumumab).
- an agent that acts on a plasma cell can be melphalan hydrochloride, melphalan, pamidronate disodium, carmustine, carfilzomib, carmustine, cyclophosphamide, daratumumab, doxorubicin hydrochloride liposome, doxorubicin hydrochloride liposome, elotuzumab, melphalan hydrochloride, panobinostat, ixazomib citrate, carfilzomib, lenalidomide, melphalan, melphalan hydrochloride, plerixafor, ixazomib citrate, pamidronate disodium, panobinostat, plerixafor, pomalidomide, pomalidomide, lenalidomide, selinexor, thalidomide, thalidomide, bortezomib, selinexor, zoledronic acid, or zoledron
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more proteasome inhibitors or agents that act on plasma cells prior to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation.
- a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells concurrently with administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation.
- a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells subsequent to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can further comprise administering one or more proteasome inhibitors more than 1 time. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors repeatedly over time.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more immunosuppressive agents.
- an immunosuppressive agent can be, but is not limited to, azathioprine, methotrexate, sirolimus, anti-thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), steroids, or a combination thereof.
- a disclosed method can comprise administering one or more immunosuppressive agents more than 1 time.
- a disclosed method can comprise administering one or more one or more immunosuppressive agents repeatedly over time.
- a disclosed method can comprise administering a compound that targets or alters antigen presentation or humoral or cell mediated or innate immune responses.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering a compound that exerts a therapeutic effect against B cells and/or a compound that targets or alters antigen presentation or humoral or cell mediated immune response.
- a disclosed compound can be rituximab, methotrexate, intravenous gamma globulin, anti CD4 antibody, anti CD2, an anti-FcRN antibody, a BTK inhibitor, an anti-IGFIR antibody, a CD 19 antibody (e.g., inebilizumab), an anti-IL6 antibody (e.g., tocilizumab), an antibody to CD40, an IL2 mutein, or a combination thereof.
- Treg infusions that can be administered as a way to help with immune tolerance (e.g., antigen specific Treg cells to AAV).
- a subject in an aspect of a disclosed method, can be a human.
- a subject can be suspected of having or can be diagnosed with having synucleinopathy or other SNCA associated disease or disorder (such as, for example, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)).
- PD Parkinson’s disease
- DLB dementia with Lewy bodies
- a disclosed subject can be symptomatic or asymptomatic.
- a disclosed method can comprise repeating one or more steps of the method and/or modifying one or more steps of the method (such as, for example, an administering step).
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can comprise modifying one or more of the disclosed steps.
- modifying one or more of steps of a disclosed method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method.
- a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, or by changing the duration of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can be altered by changing the amount of one or more disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject, or by changing the frequency of administration of one or more of the disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise generating and/or validating one or more of the disclosed isolated nucleic acid molecules, one or more of the disclosed vectors, one or more of the disclosed pharmaceutical formulations, or any combination thereof.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject a second disclosed isolated nucleic acid molecule, a second disclosed vector, a second disclosed pharmaceutical formulations, or any combination thereof.
- a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject additional disclosed isolated nucleic acid molecules, additional disclosed vectors, additional disclosed pharmaceutical formulations, or any combination thereof.
- PD Parkinson’s disease
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a disclosed isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an en
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a disclosed isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an en
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting an SNCA gene or portion thereof and b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii)
- the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- a TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g., SEQ ID NO: 8
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii),
- the neuron specific promoter of (b) may comprise TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g, SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- TH promoter e.g., SEQ ID NO: 5
- a FoxA2 promoter e.g., SEQ ID NO: 6
- a ChAT promoter e.g., SEQ ID NO: 7
- a NKX2.1 promoter e.g, SEQ ID NO: 8
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(i
- the neuron specific regulatory element of (iv) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the promoter of (c) comprises a U6 promoter, a derivative thereof or a fragment thereof.
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a disclosed viral vector e.g., a lentiviral vector
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a disclosed viral vector e.g., a lentiviral vector
- a nucleic acid sequence encoding i) a deactivated Cas (dCas) endonuclease, (
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising ((a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a viral vector comprising ((a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
- a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(ii)
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to the (a)(i) and/or (a)(ii), and (
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to the (a)(i) and/or (a)(ii), and (c) a
- the neuron specific regulatory element or neuron specific promoter of (b) can comprise TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c
- a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii), and (c) a promoter
- the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (c.g, SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
- the fusion product of (a)(ii) can comprise KRAB-MeCP2.
- the promoter of (c) comprises a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can reduce and/or decrease the expression and/or activity of SNCA.
- the expression and/or activity of SNCA is reduced and/or decreased.
- a disclosed method can comprise diagnosing the subject with Parkinson’s disease (PD).
- a disclosed method of treating and/or preventing Parkinson’s disease comprises measuring the level of expression and/or the level of activity of the SNCA gene.
- a disclosed method can comprise repeating the measuring step one or more times.
- the expression and/or activity level of SNCA can be elevated and/or increased when compared to wild-type or control expression level. In an aspect, following the administering step, the expression and/or activity level of SNCA can be reduced and/or decreased when compared to the pre-administering step level.
- a disclosed gRNA targeting a portion of the SNCA gene can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same portion of the SNCA gene or different portions of the SNCA gene. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGll, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto.
- a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
- a disclosed isolated nucleic acid or disclosed viral vector comprises one or more neuron specific regulatory elements.
- the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof.
- the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter).
- the neuron specific regulatory element may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron).
- the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter).
- the neuron specific regulatory element can comprise a neuron specific promoter.
- a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, a derivative thereof, a fragment thereof, or any combination thereof.
- a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
- a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
- a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a disclosed neuron specific regulatory element operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof.
- a disclosed neuron specific regulatory element i.e., a neuron specific promoter
- a neuron specific promoter operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities
- a neuron specific regulatory element i.e., a neuron specific promoter
- operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
- a disclosed dCas endonuclease can comprise a dCas9 endonuclease.
- a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
- a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9.
- a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
- a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof.
- a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof.
- a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof.
- a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof.
- a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof.
- a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof.
- a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
- a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10.
- a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10.
- a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof.
- a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Krtippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed fusion or disclosed fusion product can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb- KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBD1- HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, MBD2-MBD2, MBD2-HP
- a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof.
- the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof.
- a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof.
- a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof.
- the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof.
- a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof.
- a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof
- the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof.
- a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription activation activity.
- a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain.
- a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
- a nucleic acid sequence encoding the disclosed VP 16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof.
- a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof.
- a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
- a disclosed encoded polypeptide can comprise transcription repression activity.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof.
- a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise transcription release factor activity.
- a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity.
- a disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 71 or a fragment thereof.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
- a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
- a disclosed encoded polypeptide can comprise histone modification activity.
- a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
- a disclosed encoded polypeptide can comprise nucleic acid association activity.
- a disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
- a disclosed encoded polypeptide can comprise methyltransferase activity.
- a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A).
- a disclosed encoded polypeptide can comprise demethylase activity.
- a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1).
- TTT1 ten-eleven translocation methylcytosine dioxygenase 1
- LSD1 lysine-specific histone demethylase 1
- a disclosed encoded polypeptide can comprise acetyltransferase activity.
- a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase.
- a disclosed encoded polypeptide can comprise deacetylase activity.
- a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
- a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB-MeCP2.
- a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9
- a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD
- an isolated nucleic acid or viral vector can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity.
- the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity.
- the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
- the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP
- the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2.
- the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A.
- a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level.
- a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.
- a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
- a disclosed gRNA can target the SNCA gene.
- a disclosed SNCA gene cam comprise the sequence set forth in SEQ ID NO: 90.
- a disclosed gRNA targeting the SNCA gene can comprise at least two gRNAs.
- a disclosed gRNA can target the promoter of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target exon 1 of the SNCA gene.
- a disclosed gRNA can target intron 1 of the SNCA gene.
- a disclosed gRNA can target intron 4 of the SNCA gene.
- a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene.
- the CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof.
- the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof.
- a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto.
- a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
- a disclosed viral vector can further comprise a gRNA scaffold.
- a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
- a disclosed isolated nucleic acid or disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter).
- a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof.
- a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof.
- a promoter can be a short EFlalpha (EFS-NF) promoter.
- a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
- a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
- a disclosed isolated nucleic acid molecule or viral vector can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof.
- a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof.
- the second promoter operably linked to the gRNA may not be a neuron specific promoter.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Plant Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Disclosed herein are methods of effecting precision epigenetic modulation of one or more genes of interest in neurons. Disclosed herein are isolated nucleic acid molecules, viral vectors, pharmaceutical formulations, host cells, guide RNAs, and plasmids for use in the disclosed methods.
Description
COMPOSITIONS FOR CELL SPECIFIC 5WC4-TARGETED GENE THERAPY AND METHODS OF MAKING AND USING SAME
I. CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63/452,801 filed March 17, 2023 and U.S. Provisional Patent Application No. 63/538,396 filed September 14, 2023, which are both incorporated by reference herein in their entirety.
II. REFERENCE TO THE SEQUENCE LISTING
[0002] This application contains a Sequence Listing that has been submitted electronically as a computer readable XML format via Patent Center and is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5). The XML file, created on March 14, 2024, is named “24-3007-WO_109726-790005_SL.xml ” and is 217,088 bytes in size.
III. BACKGROUND
[0003] Synucleinopathies are neurodegenerative disorders that share a common pathological lesion of intracellular protein aggregates largely composed of the a-synuclein protein named, Lewy Bodies (LBs) and Lewy-related neurites. However, each disease presents distinct characteristics. The cell types and brain regions containing the LBs differ, particularly in early disease stages, so that while LBs in dopaminergic neurons are the primary early disease characteristic of Parkinson’s disease (PD), early stages of dementia with Lewy bodies (DLB) has LBs primarily in the amygdala and cerebral cortex, as well as basal forebrain cholinergic neurons. The SNCA gene (encoding the a-synuclein protein) was implicated as a highly significant genetic risk factor for synucleinopathies including, Parkinson’s disease (PD) and dementia with Lewy bodies (DLB). Accumulating evidence has suggested that elevated levels of wild type a-synuclein are causative in the pathogenesis of synucleinopathies. Moreover, published works by the inventors describe elevated levels of wild-type 57VC4-mRNA in affected brain regions obtained from synucleinopathies patients: in midbrain tissues from sporadic Parkinson’s disease (PD) brains compared to controls, and in cortical brain tissues from Alzheimer’s Disease with Lewy bodies (LBV/AD) compared to Alzheimer’s Disease (AD)-only controls. These observations further underscore the unmet need for precision medicine in synucleinopathies; that is to say, targeting the precise gene in the precise brain cell-type of the affected brain region. For example, targeting SNCA gene in cholinergic neurons of the cortex and dopaminergic neurons of the sub- nigra as a therapeutics strategy for Parkinson’s disease (PD) and dementia with Lewy bodies (DLB), respectively.
[0004] Thus, there remains an unmet medical need for developing methods of effecting precision epigenetic modulation in neurons of SNCA which is implicated in these disorders.
IV. BRIEF DESCRIPTION OF THE FIGURES
[0005] FIG. 1 shows the generation of the hiPSC-derived neuronal proof-of-concept models. FIG. 1A-1B depict detailed (FIG. 1A) and representative (FIG. IB) schematics describing the structure of lentivirus (LV) THp-Repressor, THp-CT, ChATp-Repressor, and ChATp-CT vectors. FIG. 1C displays representative plots showing markers of successful differentiation (quantified using RT-PCR) of P-Tubulin III (TUBB3), Nestin (NES), and tyrosine hydroxylase (TH) transcripts in midbrain dopaminergic progenitor cells (MD) transduced with Thp-Repressor lentiviral vectors before (MD) and after (mDA) differentiation into final midbrain dopaminergic (mDA) neurons. FIG. ID displays representative plots showing markers of successful differentiation (quantified using RT-PCR) of TUBB3, NES, and ChaT (choline acetyltransferase) in medial ganglionic eminence (MGE) progenitor cells transduced with ChATp-Repressor lentiviral vectors before (MGE) and after (BFCN) differentiation into final basal forebrain cholinergic neurons (BFCN). The levels of mRNAs were measured by TaqMan expression assays and calculated relatively to the geometric mean of GAPDH-mRNN and 7774 -mRN A reference controls using the 2'AACT method. Each column in the data represents the mean value derived from four biological replicates, each of which comprises two technical replicates. The error bars represent the S.E.M. FIG. IE shows representative fluorescence images of the mDA cell lines transduced with THp-Repressor (upper) and -CT (lower) vectors. TH (left), Flag M2 (middleleft), DAPI (middle-right), and merge (right). TH, marker of dopaminergic neurons; Flag M2, tags the all-in-one lentiviral CRISPR/dN/Cas9 vectors. FIG. IF displays pie charts that indicate the percentage of TH+ cells (green) out of all cells (DAPI+, blue) from FIG. IE. FIG. 1G depicts representative fluorescence images of the BFCN cell lines transduced with ChAT -Repressor (upper) and -CT (lower) vectors. ChAT (left), Flag M2 (middle-left), DAPI (middle-right), and merge (right). ChAT, marker of cholinergic neurons; Flag M2, tags the all-in-one lentiviral CRISPR/dN/Cas9 vectors. FIG. 1H displays pie charts that indicate the percentage of ChAT + cells (green) out of all cells (blue, DAPI+) from FIG. 1G.
[0006] FIG. 2 shows neuronal-type specific downregulation of 57VC4-mRNA and protein levels. FIG. 2A is a schematic diagram adapted from the UCSC Genome Browser. Left panel, Viewer of SNCA gene, [chr: chr4:89724099-89836240 (Dec.2013(GRCh38/hg38)], with the annotated set of SNCA NCBI RefSeq. The cyan custom tack denoted the position of the intron 1 CpG island, and the red custom track denoted the position gRNA targeting site. Right panel, Zooming into CPG island viewer showing the gRNA targeting sequence within the CpG island. The sequence of gRNA (SEQ ID NO: 59) was labeled at the top of gRNA track. FIG. 2B-2C show levels of 57VC4-mRNA (assessed using quantitative RT-PCR) in dopaminergic neurons and predecessors
thereof (MD, mDA, FIG. 2B) and cholinergic neurons and predecessors thereof (MGE, BFCN, FIG. 2C) after transduction with THp-Repressor and ChATp-Repressor, respectively. The SNCA- mRNA levels in the different lines were measured by TaqMan-based gene expression assay and calculated relatively to the geometric mean of GAPDH-mRNA and EE/d-mRNA referencecontrols using the 2'AACt method. Each column in the data represents the mean value derived from four biological replicates, each of which comprises two technical replicates. The error bars represent the S.E.M. FIG. 2D show representative immunofluorescence images for the a - synuclein (left), Flag M2 (middle-left), DAPI (middle-right), and merge (right) signals in mDA cell lines transduced with THp-Repressor (upper) and -CT (lower) vectors. FIG. 2E is a plot quantifying a-synuclein protein signals in mDA expressing the THp-Repressor compared to the control THp-CT as identified by Flag co-expression. The quantification analysis was performed 3 times independently, in each time 50 co-expressed cells per mDA line were analyzed. FIG. 2F shows representative immunofluorescence images for the a -synuclein (left), Flag M2 (middleleft), DAPI (middle-right), and merge (right) signals in BFCN cell lines transduced with ChATp- Repressor (upper) and -CT (lower) vectors. FIG. 2G is a plot quantifying a-synuclein protein signals in BFCN expressing the ChATp-Repressor compared to the control ChATp-CT as identified by Flag co-expression. The quantification analysis was performed 3 times independently, in each time 50 co-expressed cells per BFCN line were analyzed. /J- value < 0.02 (*), <0.005(**), or < 0.0002 (***); Student’s Z-test.
[0007] FIG. 3 depicts the effects of the neuronal-type specific repression of SNCA overexpression on a-synuclein aggregates, cell viability, and mitochondria function. FIG. 3A shows a representative western blot of a-synuclein and pS129-a-synuclein in mDA stably transduced with THp-Repressor compared to THp-CT. FIG. 3B-3D shows quantitative analyses of total a- synuclein protein (FIG. 3B) and pS129-a-synuclein protein (FIG. 3C) normalized to P-actin, and of pS129-a-synuclein normalized to total a-synuclein expression (FIG. 3D) in mDA cells. FIG. 3E is a representative western blot of a-synuclein and pS129-a-synuclein in BFCN stably transduced with ChATp-Repressor compared to ChATp-CT. FIG. 3F-3H show quantitative analyses of total a-synuclein protein (FIG. 3F) and pS129-a-synuclein protein (FIG. 3G) normalized to P-actin, and of pS129-a-synuclein normalized to total a-synuclein expression (FIG. 3H) in BFCN cells. -value < 0.05 (*), <0.01(**), or < 0.001(***); Student’s Z-test. FIG. 3I-3J show a cell viability assay using the Incucyte S3 live-cell analysis system. Plots were generated using the built-in software. FIG. 31 shows the effect of the THp-Repressor vector (red, top line) compared to the respective control vector (THp-CT, blue, bottom line) on cell viability in mDA during the differentiation process from MD cell lines. FIG. 3J shows the effect of the ChATp-
Repressor vector (red, top line) compared to the respective control vector (ChATp-CT, blue, bottom line) on cell viability in BFCN during the differentiation process from MGE cell lines. The assay was performed 3 times for each line. /J- value < 0.05 (*), <0.01(**), or < 0.001(***); Multiple student’s /-test. FIG. 3K-3L shows mitochondrial membrane potential (MMP) analysis using the Incucyte Sx5 live-cell analysis system. Cells were monitored along a period of 48 hours at day 10 of the differentiation into mDA (FIG. 3K) and BFCN (FIG. 3L). Plots were generated using the built-in software. The assay was performed 3 times for each line. FIG. 3K specifically shows quantification of the orange fluorescence intensities the mDA lines stably transduced with THp-Repressor vector (green), the respective control vector (THp-CT, red), and the naive cells (blue). The THp-Repressor vector rescued the loss of MPP observed in the THp-CT and naive neuronal lines. FIG. 3L specifically shows quantification of the orange fluorescence intensities the BFCN lines stably transduced with ChATp-Repressor vector (green), the respective control vector (ChATp-CT, red), and the naive cells (blue). The ChATp-Repressor vector rescued the loss of MPP observed in the THp-CT and naive neuronal lines.
[0008] FIG. 4A-4B show gene expression profiles of different genes in transduced and naive mDA (FIG. 4A) and BFCN (FIG. 4B) cell lines.
[0009] FIG. 5 shows a representative schematic of the neuron specific epigenome modulating system of the instant disclosure.
[0010] FIG. 6 show in vivo epigenetic modulation of a-synuclein (SNCA) expression. FIG. 6A shows representative images (2X magnification) of brain slices 6 weeks post-injection in the right hemisphere with a THp-Repressor LV vector and in the left hemisphere with a THp-CT (control) vector, showing DAPI staining, expression of total, phosphorylated and aggregated human alpha- synuclein in the SN, and mouse tyrosine hydroxylase in the SN and striatum. FIG. 6B-6D are plots quantifying relative levels of total SNCA, phosphorylated SNCA or aggregated SNCA (FIG. 6B), TH in the SN (FIG. 6C) or TH in the striatum (FIG. 6D) between the right and left hemispheres.
V. BRIEF SUMMARY
[0011] Disclosed herein is an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0012] In an aspect, the one or more neuron specific regulatory element may comprise a promtoer, where the promoter comprises a wild-type promoter, a synthetic promoter, a minimal promoter,
or any combination thereof. In an aspect, the one or more neuron specific regulatory elements are operably linked to the nucleic acid sequence encoding the dCas endonuclease. In an aspect, the one or more neuron specific regulatory elements are operably linked to the nucleic acid encoding the at least one polypeptide having enzymatic activity. In an aspect, the one or more neuron specific regulatory elements are operably linked to the nucleic acid encoding the dCas endonuclease and the nucleic acid encoding the at least one polypeptide having enzymatic activity. [0013] In an aspect, the one or more neuron specific promoters may comprise a dopaminergic promoter a cholinergic promoter or any combination thereof. In an aspect, the one or more neuron specific promoters comprise at least one dopaminergic promoter (e.g., a tyrosine hydroxylase (TH) promoter, a FOXA2 promoter, or any combination thereof). In an aspect, the at least one dopaminergic promoter can comprise a TH promoter. In an aspect, the TH promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, the at least one dopaminergic promoter comprises a FOXA2 promoter. In an aspect, the FOXA2 promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
[0014] In an aspect, the one or more neuron specific promoters may comprise at least one cholinergic promoter (e.g., a ChAT promoter, aNkx2.1 promoter or a combination thereof). In an aspect, the at least one cholinergic promoter can comprise a ChAT promoter. In an aspect, the ChAT promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, the at least one dopaminergic promoter comprises a Nkx2.1 promoter. In an aspect, the Nkx2.1 promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
[0015] In an aspect, disclosed isolated nucleic acid may comprise a nucleic acid sequence encoding a dCas endonuclease. In an aspect, the dCas endonuclease may comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an
aspect, the dCas endonuclease comprises a variant dCas9 endonuclease selected from a VRER, EQR or VQR variant of dCas9. In an aspect, the dCas endonuclease comprises a dSaCas9 endonuclease having an amino acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 13 or a fragment thereof.
[0016] In an aspect, disclosed isolated nucleic acid may comprise a nucleic acid sequence encoding a polypeptide having enzymatic activity. In an aspect, the enzymatic activity comprises transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. In an aspect, the at least one encoded polypeptide having enzymatic activity comprises HP la, HP lb, MBD1, MBD2, Kriippel -Associated Box (KRAB), NIPP1, Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. For instance, in an aspect, the fusion can comprise KRAB-MeCP2 (KRAB-MeCP2). In an aspect, the KRAB-MeCP2 comprises an amino acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0017] In an aspect, the disclosed isolated nucleic acid may comprise a nucleic acid sequence encoding at least one gRNA which targets the SNCA gene or the promoter of the SNCA gene. In an aspect, the at least one gRNA targets a nucleic acid sequence comprising any one of SEQ ID NOs: 59 - 71 or a sequence at least 90% identical thereto.
[0018] In an aspect, the isolated nucleic acids may further comprise one or more additional regulatory elements. In an aspect, the one or more additional regulatory elements are selected from one or more primer binding sites (PBS), one or more splice donor (SD) sites, one or more splice acceptor (SA) sites, one or more central polypurine tracts (cPPT), one or more polypurine tracts (PPT), one or more Rev Response elements (RRE), one or more Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE), one or more retroviral vector packaging elements, or any combination thereof. In an aspect, the retroviral vector packaging element comprises a psi (y) signal.
[0019] Also disclosed herein is a viral vector comprising an isolated nucleic acid as disclosed herein. In an aspect, the disclosed viral vector may be an adeno-associated virus (AAV), an
integrase-deficient lentivirus (IDLV), or integrase competent lentivirus (ICLV). In an aspect, the viral vector may comprise a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-4.
[0020] Also disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid as disclosed herein or the viral vector as disclosed herein and a pharmaceutically acceptable carrier. In an aspect, the pharmaceutical formulation is for the treatment of a synucleinopathy or other SNCA associated disease or disorder. In an aspect, the pharmaceutical formulation is for the treatment of Parkinson’s disease or dementia with Lewy bodies (DLB).
[0021] Also disclosed herein is a method of effecting precision epigenetic modulation in a neuron. In an aspect, the disclosed method comprises contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid or a disclosed viral vector, wherein the expression of one or more genes of interest in the one or more neurons is modulated. In an aspect of the present disclosure, modulating comprises increasing or augmenting the expression and/or activity of the one or more genes of interest. In another aspect of the present disclosure, modulating comprises decreasing or reducing the expression and/or activity of the one or more genes of interest. In an aspect, the gene of interest or portion thereof comprises SNCA or the promoter region of SNCA.
[0022] In an aspect of a method of effecting precision epigenetic modulation in a neuron, the neurons may be in a subject. In an aspect, the subject may be suspected of having or have already been diagnosed with a synucleinopathy. In an aspect, the method of effecting precision epigenetic modulation in a neuron in the subject may further comprise reducing the pathological phenotype associated with the synucleinopathy. In an aspect, the synucleinopathy may be selected from Parkinson’s disease or dementia with Lewy bodies (DLB). In an aspect, contacting the one or more neurons in a subject comprises administering the viral vector through intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-ci sterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof. In an aspect, the method may further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof.
[0023] Also disclosed herein is a method of treating and/or preventing a synucleinopathy in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector disclosed herein, an isolated nucleic acid disclosed herein, and/or a pharmaceutical formulation disclosed herein, thereby reducing the pathological
phenotype associated with the synucleinopathy. In an aspect, the synucleinopathy can be selected from Parkinson’s disease (PD) or dementia with Lewy bodies (DLB). In an aspect, administering the viral vector, the isolated nucleic acid, and/or the pharmaceutical formulation comprises intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-cistema magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof. In an aspect, the disclosed method further comprises administering to the subject a therapeutically effective amount of a therapeutic agent. For instance, in an aspect, the disclosed method may further comprise administering to the subject a therapeutically effective amount of the one or more immune modulators (e.g., methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof).
VI. DETAILED DESCRIPTION
[0024] Described herein is a system that comprises an all-in-one viral vector system (e.g., an AAV, lentiviral vector, etc.) for the targeted epigenomic editing of the SNCA gene in a neuronaltype specific manner. The disclosed epigenome modifier compositions can be used to modify any regulatory target in a SNCA gene. The system is based on CRISPR/deactivated-Cas9 nuclease (dCas9) fused with the catalytic domain, such as a KRAB-MeCP2. The present disclosure provides proof of concept that manipulation of gene expression, e.g., reversing overexpression, by epigenome-editing is a valuable therapeutic strategy for synucleinopathies that involve dysregulation of gene expression.
[0025] The CRISPR/Cas9 system provided herein provides a unique opportunity to modulate gene expression in a precise fashion that is cell-type specific. The use of epigenome-editing is an approach for gene therapy and represents new smart drugs since it is designed to target specific genes and specific cell types. Herein, the development and implementation of an innovative epigenome editing approach to manipulate the endogenous SNCA levels for rescuing disease related phenotypes is described.
[0026] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting. Further, the present disclosure describes formulations, compounded compositions, kits, capsules, containers, and/or methods thereof. It is to be understood that the inventive aspects of which are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any
methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, example methods and materials are now described.
[0027] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure.
A. Neurodegenerative Disorders/Synucleinopathies
[0028] “Neurodegenerative diseases” are disorders characterized by, resulting from, or resulting in the progressive loss of structure or function of neurons, including death of neurons. Neurodegenerative diseases include, for example, Alzheimer’s Disease (AD), amyloidosis, amyotrophic lateral sclerosis (ALS), Parkinson’s Disease (PD), Huntington’s Disease, prion disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, neuronal loss, cognitive defect, primary age-related tauopathy (PART)/Neurofibrillary tangle-predominant senile dementia, chronic traumatic encephalopathy including dementia pugilistica, dementia with Lewy Bodies (DLB) (also referred to as Lewy body dementia (LBD)), neuroaxonal dystrophies, and multiple system atrophy, progressive supranuclear palsy, Pick’s Disease, corticobasal degeneration, some forms of frontotemporal lobar degeneration, frontotemporal dementia and parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson-dementia complex of Guam), ganglioglioma, gangliocytoma, meningioangiomatosis, postencephalitic parkinsonism, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, and lipofuscinosis.
[0029] SNCA -related diseases or disorders are characterized by abnormal expression of the SNCA gene compared to control subjects without the SNCA -related disorder. In some aspects, the SNCA related disease or disorder is characterized by increased expression of SNCA gene compared to control. In other aspects, the A N -related disease or disorder is characterized by decreased expression of SNCA gene compared to control. In some aspects, the SNCA -related disease or disorder is a neurodegenerative disorder.
[0030] Synucleinopathies are neurodegenerative diseases characterized by the abnormal accumulation of aggregates of alpha-synuclein protein (which is encoded by the SNCA gene). Accumulation of aggregates may occur in neurons, nerve fibers, or glial cells. In some aspects, these aggregates are clinically referred to as “Lewy bodies” (LBs) and/or Lewy-related neurites. Different synucleinopathies can occur depending on the location of these aggregates. For instance, LBs in dopaminergic neurons are the primary early disease characteristic of Parkinson’s disease
(PD), early stages of dementia with Lewy bodies (DLB) has LBs primarily in the amygdala and cerebral cortex, as well as basal forebrain cholinergic neurons. Thus, synucleinopathies can include Parkinson’s disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy. In some aspects, a synucleinopathy disclosed herein may be Parkinson’s disease (PD). In other aspects, the synucleinopathy disclosed herein may be dementia with Lewy bodies (DLB).
[0031] The disclosure herein provides new methods of targeting the SNCA gene in specific neuronal populations to allow for targeted, tailored, control of synuclein expression in different regions to allow for improved treatment of different synucleinopathies.
B. Relevant Definitions
[0032] Before the present compounds, compositions, articles, systems, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, example methods and materials are now described.
[0033] This disclosure describes inventive concepts with reference to specific examples. However, the intent is to cover all modifications, equivalents, and alternatives of the inventive concepts that are consistent with this disclosure.
[0034] As used in the specification and the appended claims, the singular forms “a, ” “an, ” and “the” include plural referents unless the context clearly dictates otherwise.
[0035] The phrase “consisting essentially of’ limits the scope of a claim to the recited components in a composition or the recited steps in a method as well as those that do not materially affect the basic and novel characteristic or characteristics of the claimed composition or claimed method. The phrase “consisting of’ excludes any component, step, or element that is not recited in the claim. The phrase “comprising” is synonymous with “including, ” “containing, ” or “characterized by, ” and is inclusive or open-ended. “Comprising” does not exclude additional, unrecited components or steps.
[0036] As used herein, when referring to any numerical value, the term “about” means a value falling within a range that is ± 10% of the stated value.
[0037] Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, a further aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value
forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0038] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.
[0039] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. In an aspect, a disclosed method can optionally comprise one or more additional steps, such as, for example, repeating an administering step or altering an administering step.
[0040] As used herein, the term “subject” refers to the target of administration, e.g., a human being. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). Thus, the subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Alternatively, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not denote a particular age or sex, and thus, adult and child subj ects, as well as fetuses, whether male or female, are intended to be covered. In an aspect, a subject can be a human patient. In an aspect, a subject can have a synucleinopathy, be suspected of having a synucleinopathy, or be at risk of developing and/or acquiring a synucleinopathy. In an aspect, a subject can have Parkinson’s disease, be suspected of having Parkinson’s disease (PD), or be at risk of developing and/or acquiring Parkinson’s disease (PD). In an aspect, the subject can have dementia with Lewy bodies (DLB), be suspected of having dementia with Lewy bodies (DLB), or be at risk of developing and/or acquiring dementia with Lewy bodies (DLB).
[0041] As used herein, the term “diagnosed” means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or
treated by one or more of the disclosed agents, disclosed therapeutic agents, disclosed pharmaceutical formulations, or a combination thereof, or by one or more of the disclosed methods. For example, “diagnosed with synucleinopathy, ” “diagnosed with Parkinson’s disease (PD), ” or “diagnosed with dementia with Lewy bodies” means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can be treated by one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or by one or more of the disclosed methods. For example, “suspected of having synucleinopathy” or “suspected of having Parkinson’s disease (PD)” or “suspected of having dementia with Lewy bodies” can mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can likely be treated by one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or by one or more of the disclosed methods. In an aspect, an examination can be physical, can involve various tests (e.g, blood tests, genotyping, biopsies, etc.) and assays (e.g, enzymatic assay), or a combination thereof.
[0042] A “patient” can refer to a subject that has been diagnosed with or is suspected of having a synucleinopathy (e.g., Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)). In an aspect, a patient can refer to a subject that has been diagnosed with or is suspected of having Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) and is seeking treatment or receiving treatment for Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
[0043] As used herein, the phrase “identified to be in need of treatment for a disorder,” or the like, refers to selection of a subject based upon need for treatment of the disorder. For example, a subject can be identified as having a need for treatment of a disorder (e.g., such as a synucleinopathy like Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)) based upon an earlier diagnosis by a person of skill and thereafter subjected to treatment for the disorder (e.g., Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)). In an aspect, the identification can be performed by a person different from the person making the diagnosis. In an aspect, the administration can be performed by one who performed the diagnosis.
[0044] As used herein, “inhibit,” “inhibiting, ” and “inhibition” mean to diminish or decrease an activity, level, response, expression, condition, severity, disease, or other biological parameter. This can include, but is not limited to, the complete ablation of the activity, level, response, expression, condition, severity, disease, or other biological parameter. This can also include, for example, a 10% inhibition or reduction in the activity, level, response, condition, severity, disease,
or other biological parameter as compared to the native or control level (e.g., a subject not having a synucleinopathy such as Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder). Thus, in an aspect, the inhibition or reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of reduction in between as compared to native or control levels. In an aspect, the inhibition or reduction can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% as compared to native or control levels. In an aspect, the inhibition or reduction can be 0-25%, 25-50%, 50- 75%, or 75-100% as compared to native or control levels. In an aspect, a native or control level can be a pre-disease or pre-disorder level.
[0045] The words “treat” or “treating” or “treatment” include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder (such as a synucleinopathy like Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder). In an aspect, the terms cover any treatment of a subject, including a mammal (e.g., a human), and includes: (i) preventing the undesired physiological change, disease, pathological condition, or disorder from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it; (ii) inhibiting the physiological change, disease, pathological condition, or disorder, i.e., arresting its development; or (iii) relieving the physiological change, disease, pathological condition, or disorder, i.e., causing regression of the disease.
[0046] For example, in an aspect, treating a synucleinopathy can reduce the severity of an established disease in a subject by 1%- 100% as compared to a control (such as, for example, an individual not having the synucleinopathy). In an aspect, treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of the synucleinopathy. For example, in an aspect, treating an SNCA associated disease or disorder can reduce the severity of an established disease in a subject by 1%- 100% as compared to a control (such as, for example, an individual not having an SNCA associated disease or disorder. In an aspect, treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity SNCA associated disease or disorder. For example, in an aspect, treating Parkinson’s disease (PD) can reduce the severity of an established disease in a subject by 1 %-l 00% as compared to a control (such as, for
example, an individual not having Parkinson’s disease (PD)). In an aspect, treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of Parkinson’s disease. For example, in an aspect, treating dementia with Lewy bodies (DLB) can reduce the severity of an established disease in a subject by 1%- 100% as compared to a control (such as, for example, an individual not having dementia with Lewy bodies (DLB). In an aspect, treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of dementia with Lewy bodies (DLB). It is understood that treatment does not necessarily refer to a cure or complete ablation or eradication of the synucleinopathy, SNCA associated disease or disorder, Parkinson’ s disease (PD) or dementia with Lewy bodies (DLB). However, in an aspect, treatment can refer to a cure or complete ablation or eradication of the synucleinopathy, SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
[0047] As used herein, a “biomarker” refers to a defined characteristic that is measured as an indicator of normal biological processes, pathogenic processes, or response to an exposure of intervention. In an aspect, a biomarker can be diagnostic (z.e., detects or classifies a pathological condition), prognostic (z.e., predicts the probability of disease occurrence or progression), pharmacodynamic/responsive (z.e., identifies a change in response to a therapeutic intervention), predictive (z.e., predicts how an individual or subject might respond to a particular intervention or event). In an aspect, a biomarker can be diagnostic, prognostic, pharmacodynamic/responsive, and/or predictive at the same time. In an aspect, a biomarker can be diagnostic, prognostic, pharmacodynamic/responsive, and/or predictive at different times (e.g, first a biomarker can be diagnostic and then later, the same biomarker can be prognostic, pharmacodynamic/responsive, and/or predictive). A biomarker can be an objective measure that can be linked to a clinical outcome assessment. A biomarker can be used by the skilled person to make a clinical decision based on its context of use.
[0048] As used herein, “operably linked” means that expression of a gene is under the control of a regulatory element with which it is spatially connected. In some instance the regulatory element is a promoter and when used in this context, the expression of a gene is under control of the promoter with which it is spatially connected. A regulatory element (e.g., a promoter) can be positioned 5’ (upstream) or 3’ (downstream) of a gene under its control. The distance between the regulatory element (e.g., a promoter) and a gene can be approximately the same as the distance between that regulatory element (e.g, a promoter) and the gene it controls in the gene from which the regulatory element (e.g., a promoter) is derived. As is known in the art, variation in this distance can be accommodated without loss of function (z.e., without loss of promoter function).
[0049] As used herein, “regulatory elements” refer to any sequence elements that regulate, positively or negatively, the expression of an operably linked sequence. “Regulatory elements” include, without being limiting, a promoter, an enhancer, a leader, a transcription start site (TSS), a linker, 5' and 3' untranslated regions (UTRs), an intron, a polyadenylation signal, and a termination region or sequence, etc., that are suitable, necessary, or preferred for regulating or allowing expression of the gene or transcribable DNA sequence in a cell. Such additional regulatory element(s) can be optional and used to enhance or optimize expression of the gene or transcribable DNA sequence. A regulatory sequence can, for example, be inducible, noninducible, constitutive, cell-cycle regulated, metabolically regulated, and the like. A regulatory sequence may be a promoter. As used herein, the term “promoter” refers to a DNA sequence that comprises an RNA polymerase binding site, a transcription start site, and/or a TATA box and assists or promotes the transcription and expression of an associated transcribable polynucleotide sequence and/or gene (or transgene). A promoter can be synthetically produced, varied, or derived from a known or naturally occurring promoter sequence or other promoter sequence. A promoter can also include a chimeric promoter comprising a combination of two or more heterologous sequences. A promoter of the present application can thus include variants of promoter sequences that are similar in composition, but not identical to, other promoter sequence(s) known or provided herein. In some exemplary aspects the promoter sequence is adapted to enable expression of a polynucleotide in neurons. In an aspect, the promoter is a TH promoter, a FOXA2 promoter, a Ch AT promoter, an Nkx2.1 promoter, or a derivative thereof.
[0050] As used herein, the term “neuron specific” regulatory element encompasses a regulatory element (as defined supra) which regulates the expression of an operably linked sequence, such that expression is increased or enhanced in a neuron when compared to other cell-types. In as aspect, the enhanced expression may result in at least about 1.1 -fold to about 100- fold or more expression of the protein or nucleic acid as compared to other cell types. A neuron specific regulatory element may comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence, or any combination thereof.
[0051] As used herein, “promoter” or “promoters” are known to the art. Depending on the level and tissue-specific expression desired, a variety of promoter elements can be used. A promoter can be tissue-specific or ubiquitous and can be constitutive or inducible, depending on the pattern of the gene expression desired. A promoter can be native (endogenous) or foreign (exogenous) and can be a natural or a synthetic sequence. The promoter can be a derivative of a natural or synthetic sequence, meaning that it has one or more genetic modifications from the patent natural
or synthetic sequence. By foreign or exogenous, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced.
[0052] Neuron-specific promoters are also known in the art and include, but are not limited to, “dopaminergic promoters” and “cholinergic promoters” which are defined herein below. Exemplary neuron-specific promoters can include but are not limited to tyrorosine hydroxylase (TH) promoter, FOXA2 promoter, choline acetyltransferase (ChAT) promoter, and Nkx2.1 promoters. “Dopaminergic promoters” as used herein refer to neuron-specific promoters such that expression is increased or enhanced in a dopaminergic neuron when compared to other neurons or other cell types. In as aspect, the enhanced expression may result in at least about 1.1 -fold to about 100- fold or more expression of the protein or nucleic acid as compared to other neurons. Exemplary dopaminergic promoters include, but are not limited to, tyrosine hydroxylase (TH) promoter and FOXA2 promoter. “Cholinergic promoters” as used herein refer to neuron-specific promoters such that expression is increased or enhanced in a cholinergic neuron when compared to other neurons or other cell types. In as aspect, the enhanced expression may result in at least about 1.1-fold to about 100- fold or more expression of the protein or nucleic acid as compared to other neurons. Exemplary cholinergic promoters include but are not limited to choline acetyltransferase (ChAT) promoter and Nkx2.1 promoters.
[0053] “Ubiquitous/constitutive promoters” are known to the art and include, but are not limited to, a CMV major immediate-early enhancer/chicken beta-actin promoter, a cytomegalovirus (CMV) major immediate-early promoter, an Elongation Factor 1-a (EFl -a) promoter, a simian vacuolating virus 40 (SV40) promoter, an AmpR promoter, a PyK promoter, a human ubiquitin C gene (Ubc) promoter, a MFG promoter, a human beta actin promoter, a CAG promoter, a EGR1 promoter, a FerH promoter, a FerL promoter, a GRP78 promoter, a GRP94 promoter, a HSP70 promoter, a [3-kin promoter, a murine phosphoglycerate kinase (mPGK) or human PGK (hPGK) promoter, a ROSA promoter, human Ubiquitin B promoter, a Rous sarcoma virus promoter, or any other natural or synthetic ubiquitous/constitutive promoters.
[0054] As used herein, an “inducible promoter” refers to a promoter that can be regulated by positive or negative control. Factors that can regulate an inducible promoter include, but are not limited to, chemical agents (e.g., the metallothionein promoter or a hormone inducible promoter), temperature, and light.
[0055] As known to the art, RNA binding proteins consist of multiple repetitive sequences that contain only a few specific basic domains. Structurally, common RNA-binding domains mainly include RNA-recognition motif (RRM), K homology (KH) domain, double-stranded RBD
(dsRBD), cold-shock domain (CSD), arginine-glycine-glycine (RGG) motif, tyrosine-rich domain, and zinc fingers (ZnF) of the CCHC, CCCH, ZZ type etc. According to the different functions of RBPs in cells, RBPs can be divided into epithelial splicing regulatory proteins (ESRP1), cytoplasmic polyadenylation element binding protein family (CPEB1/2), Hu-antigen R (HuR), heterogeneous nuclear ribonucleoprotein family members (hnRNP A/D/H/K/MZE/L), insulin-like growth factor 2 mRNA family members (IMP 1/2/3), zfh family of transcription factors (ZEB 1/2), KH-type splicing regulatory protein (KHSRP), La ribonucleoprotein domain family members (LARP 1/6/7), Lin-28 homolog proteins (Lin28), Musashi protein family (MSI1/2), Pumilio protein family (PUM1/2), Quaking (QK), RNA-binding motif protein family (4/10/38/47), Src-associated substrate during mitosis of 68 kDa (SAM68), serine and arginine rich splicing factor (SRSF1/3), T cell intracellular antigens (TIA1/TIAR), and Upstream of N-Ras (UNR).
[0056] As used herein, “immune tolerance,” “immunological tolerance,” and “immunotolerance” refers to a state of unresponsiveness or blunted response of the immune system to substances (e.g., a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed transgene product, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, etc.) that have the capacity to elicit an immune response in a subject. Immune tolerance is induced by prior exposure to a specific antigen. Immune tolerance can be determined in a subject by measuring antibodies against a particular antigen or by liver-restricted transgene expression with a viral vector (such as, for example, AAV). Low or absent antibody titers over time is an indicator of immune tolerance. For example, in an aspect, immune tolerance can be established by having IgG antibody titers of less than or equal to about 12,000, 11,500, 11,000, 10,500, 10,000, 9,500, 9,000, 8,500, 8,000, 7,500, 7,000, 6,500, or 6,000 within following gene therapy (such as the administration of the transgene encoding, for example, a missing, deficient, and/or mutant protein or enzyme).
[0057] As used herein, “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein must contain at least two amino acids and there is no limitation on the maximum number of amino acids that can comprise a protein’s sequence. The term “peptide” can refer to a short chain of amino acids including, for example, natural peptides, recombinant peptides, synthetic peptides, or any combination thereof. Proteins and peptides can include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, and fusion proteins, among others.
[0058] “Nucleic acid” or “oligonucleotide” or “polynucleotide” as used herein means at least two nucleotides covalently linked together. The depiction of a single strand can also define the sequence of the complementary strand. Thus, a nucleic acid can encompass the complementary strand of a depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid can encompass substantially identical nucleic acids and complements thereof. A single strand can provide a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid can encompass a probe that hybridizes under stringent hybridization conditions. A nucleic acid can be single-stranded, or double-stranded, or can contain portions of both double-stranded and single-stranded sequence. The nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods. Also as used herein, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid construct,” “nucleotide sequence, ” and “polynucleotide” can refer to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term can encompass RNA/DNA hybrids. When dsRNA is produced synthetically, less common bases, such as inosine, 5- methylcytosine, 6-methyladenine, hypoxanthine and others can also be used for antisense, dsRNA, and ribozyme pairing. For example, polynucleotides that contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression. Other modifications, such as modification to the phosphodiester backbone, or the 2’-hydroxy in the ribose sugar group of the RNA can also be made. A “synthetic” nucleic acid or polynucleotide, as used herein, refers to a nucleic acid or polynucleotide that is not found in nature but is constructed by the hand of man and therefore is not a product of nature. In an aspect, a nucleic acid may be isolated as defined further below.
[0059] As used herein, an “isolated” refers to a biological component (such as a nucleic acid molecule, nucleic acid sequence, protein, or virus) that has been substantially separated or purified away from other biological components (e.g., other chromosomal and extra-chromosomal DNA and RNA, proteins and/or organelles). An isolated biological component may not be substantially separated or purified away from all other biological components (e.g., an isolated nucleic acid may comprise a coding sequence and one or more regulatory elements as opposed to just the coding sequence or just a regulatory element). For example, an isolated nucleic acid molecule may comprise any one or more of a gene, a transcription regulatory sequence, a translation regulatory sequence, coding sequence, non-coding sequence, plasmids, vector, or viral vector. Nucleic acids,
proteins, and/or viruses that have been “isolated” include nucleic acids, proteins, and viruses purified by standard purification methods. The term also embraces nucleic acids, proteins, and viruses prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins. The term “isolated” (or purified) does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated or purified nucleic acid, protein, virus, or other active compound is one that is isolated in whole or in part from associated nucleic acids, proteins, and other contaminants. In an aspect, the term “substantially purified” refers to a nucleic acid, protein, virus or other active compound that has been isolated from a cell, cell culture medium, or other crude preparation and subjected to fractionation to remove various components of the initial preparation, such as proteins, cellular debris, and other components. In an aspect, isolated proteins or nucleic acids, or cells containing such, in some examples are at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% pure. Isolated nucleic acid molecules may comprise one or more naturally occurring sequences, recombinant sequences, or combinations thereof. The isolated nucleic acid molecule may also comprise one or more modified nucleotides.
[0060] A “fragment” or “portion” of a nucleotide sequence can be understood to mean a nucleotide sequence of reduced length relative (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides) to a reference nucleic acid or nucleotide sequence and comprising, consisting essentially of, or consisting of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment or portion according to the disclosure can be, where appropriate, included in a larger polynucleotide of which it is a constituent. In an aspect, a fragment or portion of a nucleotide sequence or nucleic acid sequence can comprise the sequence encoding an exon having one or more mutations. In an aspect, a fragment or portion of a nucleotide sequence or nucleic acid sequence can comprise a target of interest.
[0061] A “fragment” or “portion” of an amino acid sequence can be understood to mean an amino acid sequence of reduced length relative (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, or more amino acids) to a reference amino acid sequence and comprising, consisting essentially of, or consisting of an amino acid sequence of contiguous amino acids identical or almost identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the reference amino
acid sequence. Such an amino acid fragment or portion according to the disclosure can be, where appropriate, included in a larger amino acid sequence of which it is a constituent.
[0062] A “heterologous” or a “recombinant” nucleotide or amino acid sequence as used interchangeably herein can refer to a nucleotide or an amino acid sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleotide or amino acid sequence.
[0063] Different nucleic acids or proteins having homology can be referred to as “homologues.” The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. “Homology” refers to the level of similarity between two or more nucleic acid and/or amino acid sequences in terms of percent of positional identity (z.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins. Thus, the disclosed compositions and disclosed methods can comprise homologues to the disclosed nucleotide sequences and/or disclosed polypeptide sequences.
[0064] “Orthologous,” as used herein, can refer to homologous nucleotide sequences and/or amino acid sequences in different species that arose from a common ancestral gene during speciation. A homologue of a disclosed nucleotide sequence or a disclosed polypeptide can have substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and/or 100%) to a disclosed nucleotide sequence or a disclosed polypeptide.
[0065] “Complement” or “complementary” as used herein means a nucleic acid can mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules. “Complementarity” refers to a property shared between two nucleic acid sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary.
[0066] The term “lentiviral vector” as used herein can refer to a vector including one or more “heterologous” (i.e., non-lentiviral) nucleic acid sequences. In some aspects, lentiviral vectors herein may contain non-coding sequences of one or more proteins from a lentivirus. A “lentiviral transfer vector” for use herein may include a heterologous nucleic acid sequence, for example, to be transferred into a cell, and may further include, for example, one or more lentiviral genes, or portions thereof. A “lentiviral packaging vector” for use herein may include one or more genes encoding lentiviral proteins, or portions thereof. For example, a lentiviral envelope protein may include a gene encoding an envelope (Env) protein, or a portion thereof. In certain aspects, host
cells can be transfected with lentiviral vectors, and optionally additional vectors for expressing lentiviral packaging proteins (e.g., VSV-G, Rev, and Gag/Pol) to produce lentiviral particles in the culture medium.
[0067] As used herein, the term “serotype” is a distinction used to refer to an AAV having a capsid that is serologically distinct from other AAV serotypes. Serologic distinctiveness can be determined by the lack of cross-reactivity between antibodies to one AAV as compared to another AAV. Such cross-reactivity differences are usually due to differences in capsid protein sequences/antigenic determinants (e.g., due to VP1, VP2, and/or VP3 sequence differences of AAV serotypes).
[0068] As used herein, “tropism” refers to the specificity of an AAV capsid protein present in an AAV viral particle, for infecting a particular type of cell or tissue. The tropism of an AAV capsid for a particular type of cell or tissue may be determined by measuring the ability of AAV vector particles comprising the hybrid AAV capsid protein to infect or to transduce a particular type of cell or tissue, using standard assays that are well-known in the art such as those disclosed in the examples of the present application. As used herein, the term “liver tropism” or “hepatic tropism” refers to the tropism for liver or hepatic tissue and cells, including hepatocytes.
[0069] As used herein, “codon optimization” can refer to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing one or more codons or more of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. As contemplated herein, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database.” Many methods and software tools for codon optimization have been reported previously. (See, for example, genomes.urv.es/OPTIMIZER/).
[0070] As used herein, “expression cassette” or “transgene cassette” can refer to a distinct component of vector DNA comprising a transgene and one or more regulatory sequences to be expressed by a transfected cell. Generally, an expression cassette or transgene cassette can comprise a promoter sequence, an open reading frame (i.e., the transgene), and a 3’ untranslated region (e.g., in eukaryotes a polyadenylation site).
[0071] As used herein, the term “neurodeg enerative disease or disorder” refers to disorders characterized by, resulting from, or resulting in the progressive loss of structure or function of neurons, including death of neurons. Neurodegenerative diseases include, for example, Alzheimer’s Disease (AD), amyloidosis, amyotrophic lateral sclerosis (ALS), Parkinson’s disease
(PD), Huntington’s Disease, prion disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, neuronal loss, cognitive defect, primary age-related tauopathy (PART)/Neurofibrillary tangle-predominant senile dementia, chronic traumatic encephalopathy including dementia pugilistica, dementia with Lewy bodies (DLB), neuroaxonal dystrophies, and multiple system atrophy, progressive supranuclear palsy, Pick’s Disease, corticobasal degeneration, some forms of frontotemporal lobar degeneration, frontotemporal dementia and parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson-dementia complex of Guam), ganglioglioma, gangliocytoma, meningioangiomatosis, postencephalitic parkinsonism, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, and lipofuscinosis.
[0072] As used herein, the term “SNCA related disease or disorder” is a disease or disorder characterized by abnormal expression of SNCA gene compared to control subjects without the SNCA -related disease or disorder. The SNCA related disease or disorder may be characterized by increased expression of SNCA gene compared to control subjects without the SNCA -related disease or disorder. The SNCA related disease or disorder may be characterized by decreased expression of SNCA gene compared to control subjects without the SNCA -related disease or disorder.
[0073] As used herein, the term “synucleinopathy” refers to a neurodegenerative disorder that is caused or associated with a pathological lesion of intracellular protein aggregates largely composed of the a-synuclein protein. These lesions are known clinically as Lewy Bodies (LBs) and Lewy-related neurites. Depending on the location of the Lewy bodies other clinical diseases or conditions can arise. For example, LBs in dopaminergic neurons lead to Parkinson’s disease (PD) and LBs primarily localized in the amygdala and cerebral cortex can lead to dementia with Lewy Bodies (DLB). Accordingly, in aspects, the term synucleinopathy can encompass any disease or condition characterized by the presence of Lewy Bodies or Lewy-related neurites in the brain. In further aspects, the term synucleinopathy can comprise Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
[0074] “Normal gene” as used herein refers to a gene that has not undergone a change, such as a loss, gain, or exchange of genetic material. The normal gene undergoes normal gene transmission and gene expression.
[0075] As used herein, the term “prevent” or “preventing” or “prevention” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. In an
aspect, preventing progression of a synucleinopathy is intended. The words “prevent” and “preventing” and “prevention” also refer to prophylactic or preventative measures for protecting or precluding a subject (e.g., an individual) not having a synucleinopathy or a synucleinopathy - related complication from progressing to that complication. In an aspect, preventing or reducing SNCA expression and/or activity is intended.
[0076] As used herein, the terms “administering” and “administration” refer to any method of providing one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, the following routes: oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, in utero administration, intrahepatic administration, intravaginal administration, ophthalmic administration, intraaural administration, otic administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-CSF administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can also include hepatic intraarterial administration or administration through the hepatic portal vein (HPV). Administration of a disclosed therapeutic agent, a disclosed pharmaceutical composition, or a combination thereof can comprise administration directly into the CNS (e.g., intraparenchymal, intracerebroventriular, inthrathecal cisternal, intrathecal (lumbar), deep gray matter delivery, convection-enhanced delivery to deep gray matter) or the PNS. Administration can be continuous or intermittent.
[0077] In an aspect, a “therapeutic agent” can be a “biologically active agent” or “biologic active agent” or “bioactive agent, ” which refers to an agent that is capable of providing a local or systemic biological, physiological, or therapeutic effect in the biological system to which it is applied. For example, the bioactive agent can act to control infection or inflammation, enhance cell growth and tissue regeneration, control tumor growth, act as an analgesic, promote anti-cell attachment, and enhance bone growth, among other functions. Other suitable bioactive agents can include anti-viral agents, vaccines, hormones, antibodies (including active antibody fragments sFv, Fv, and Fab fragments), aptamers, peptide mimetics, functional nucleic acids, therapeutic proteins, peptides, or nucleic acids. Other bioactive agents include prodrugs, which are agents that are not biologically active when administered but, upon administration to a subject are converted to bioactive agents through metabolism or some other mechanism. Additionally, any of the compositions of the disclosure can contain combinations of two or more bioactive agents. It is understood that a biologically active agent can be used in connection with administration to
various subjects, for example, to humans (z.e., medical administration) or to animals (z.e., veterinary administration). As used herein, the recitation of a biologically active agent inherently encompasses the pharmaceutically acceptable salts thereof.
[0078] In an aspect, a “therapeutic agent” can be any agent that effects a desired clinical outcome in a subject having a synucleinopathy, suspected of having a synucleinopathy, and/or likely to develop or acquire a synucleinopathy. In an aspect, a disclosed therapeutic agent can be an oligonucleotide therapeutic agent. A disclosed oligonucleotide therapeutic agent can comprise a single-stranded or double-stranded DNA, iRNA, shRNA, siRNA, mRNA, non-coding RNA (ncRNA), an antisense molecule, miRNA, a morpholino, a peptide-nucleic acid (PNA), or an analog or conjugate thereof. In an aspect, a disclosed oligonucleotide therapeutic agent can be an ASO or an RNAi. In an aspect, a disclosed oligonucleotide therapeutic agent can comprise one or more modifications at any position applicable.
[0079] By “determining the amount” is meant both an absolute quantification of a particular analyte (e.g., an mRNA sequence) or a determination of the relative abundance of a particular analyte (e.g., an amount as compared to a mRNA sequence). The phrase includes both direct or indirect measurements of abundance (e.g., individual mRNA transcripts may be quantified or the amount of amplification of an mRNA sequence under certain conditions for a certain period may be used a surrogate for individual transcript quantification) or both.
[0080] As used herein, “modifying the method” can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. For example, in an aspect, a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, by changing the duration of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject, or by substituting for one or more of the disclosed components and/or reagents with a similar or equivalent component and/or reagent. The same applies to all disclosed therapeutic agents, immune modulators, immunosuppressive agents, proteosome inhibitors, etc.
[0081] In an aspect, a therapeutic agent can be a “drug” or a “vaccine” and means a molecule, group of molecules, complex or substance administered to an organism for diagnostic, therapeutic, preventative medical, or veterinary purposes. This term includes externally and internally administered topical, localized and systemic human and animal pharmaceuticals, treatments,
remedies, nutraceuticals, cosmeceuticals, biologicals, devices, diagnostics and contraceptives, including preparations useful in clinical and veterinary screening, prevention, prophylaxis, healing, wellness, detection, imaging, diagnosis, therapy, surgery, monitoring, cosmetics, prosthetics, forensics and the like. This term may also be used in reference to agricultural, workplace, military, industrial and environmental therapeutics or remedies comprising selected molecules or selected nucleic acid sequences capable of recognizing cellular receptors, membrane receptors, hormone receptors, therapeutic receptors, microbes, viruses or selected targets comprising or capable of contacting plants, animals and/or humans. Examples include but are not limited to a radiosensitizer, the combination of a radiosensitizer and a chemotherapeutic, a steroid, a xanthine, a beta-2-agonist bronchodilator, an anti-inflammatory agent, an analgesic agent, a calcium antagonist, an angiotensin-converting enzyme inhibitors, a beta-blocker, a centrally active alpha-agonist, an alpha- 1 -antagonist, carbonic anhydrase inhibitors, prostaglandin analogs, a combination of an alpha agonist and a beta blocker, a combination of a carbonic anhydrase inhibitor and a beta blocker, an anticholinergic/antispasmodic agent, a vasopressin analogue, an anti arrhythmic agent, an antiparkinsonian agent, an antiangina/antihypertensive agent, an anticoagulant agent, an antiplatelet agent, a sedative, an ansiolytic agent, a peptidic agent, a biopolymeric agent, an antineoplastic agent, a laxative, an antidiarrheal agent, an antimicrobial agent, an antifungal agent, or a vaccine. In a further aspect, the pharmaceutically active agent can be coumarin, albumin, bromolidine, steroids such as betamethasone, dexamethasone, methylprednisolone, prednisolone, prednisone, triamcinolone, budesonide, hydrocortisone, and pharmaceutically acceptable hydrocortisone derivatives; xanthines such as theophylline and doxophylline; beta-2-agonist bronchodilators such as salbutamol, fenterol, clenbuterol, bambuterol, salmeterol, fenoterol; antiinflammatory agents, including antiasthmatic antiinflammatory agents, antiarthritis antiinflammatory agents, and non-steroidal antiinflammatory agents, examples of which include but are not limited to sulfides, mesalamine, budesonide, salazopyrin, diclofenac, pharmaceutically acceptable diclofenac salts, nimesulide, naproxene, acetominophen, ibuprofen, ketoprofen and piroxicam; analgesic agents such as salicylates; calcium channel blockers such as nifedipine, amlodipine, and nicardipine; angiotensin-converting enzyme inhibitors such as captopril, benazepril hydrochloride, fosinopril sodium, trandolapril, ramipril, lisinopril, enalapril, quinapril hydrochloride, and moexipril hydrochloride; beta-blockers (z.e., beta adrenergic blocking agents) such as sotalol hydrochloride, timolol maleate, timol hemihydrate, levobunolol hydrochloride, esmolol hydrochloride, carteolol, propanolol hydrochloride, betaxolol hydrochloride, penbutolol sulfate, metoprolol tartrate, metoprolol succinate, acebutolol hydrochloride, atenolol, pindolol, and bisoprolol fumarate; centrally active
alpha-2-agonists (z.e., alpha adrenergic receptor agonist) such as clonidine, brimonidine tartrate, and apraclonidine hydrochloride; alpha- 1 -antagonists such as doxazosin and prazosin; anticholinergic/antispasmodic agents such as dicyclomine hydrochloride, scopolamine hydrobromide, glycopyrrolate, clidinium bromide, flavoxate, and oxybutynin; vasopressin analogues such as vasopressin and desmopressin; prostaglandin analogs such as latanoprost, travoprost, and bimatoprost; cholinergics (i.e. , acetylcholine receptor agonists) such as pilocarpine hydrochloride and carbachol; glutamate receptor agonists such as the N-methyl D-aspartate receptor agonist memantine; anti-Vascular endothelial growth factor (VEGF) aptamers such as pegaptanib; anti-VEGF antibodies (including but not limited to anti-VEGF-A antibodies) such as ranibizumab and bevacizumab; carbonic anhydrase inhibitors such as methazolamide, brinzolamide, dorzolamide hydrochloride, and acetazolamide; anti arrhythmic agents such as quinidine, lidocaine, tocainide hydrochloride, mexiletine hydrochloride, digoxin, verapamil hydrochloride, propafenone hydrochloride, flecaimide acetate, procainamide hydrochloride, moricizine hydrochloride, and diisopyramide phosphate; antiparkinsonian agents, such as dopamine, L-Dopa/Carbidopa, selegiline, dihydroergocryptine, pergolide, lisuride, apomorphine, and bromocryptine; antiangina agents and antihypertensive agents such as isosorbide mononitrate, isosorbide dinitrate, propranolol, atenolol and verapamil; anticoagulant and antiplatelet agents such as coumadin, warfarin, acetylsalicylic acid, and ticlopidine; sedatives such as benzodiazapines and barbiturates; ansiolytic agents such as lorazepam, bromazepam, and diazepam; peptidic and biopolymeric agents such as calcitonin, leuprolide and other LHRH agonists, hirudin, cyclosporin, insulin, somatostatin, protirelin, interferon, desmopressin, somatotropin, thymopentin, pidotimod, erythropoietin, interleukins, melatonin, granulocyte/macrophage-CSF, and heparin; antineoplastic agents such as etoposide, etoposide phosphate, cyclophosphamide, methotrexate, 5 -fluorouracil, vincristine, doxorubicin, cisplatin, hydroxyurea, leucovorin calcium, tamoxifen, flutamide, asparaginase, altretamine, mitotane, and procarbazine hydrochloride; laxatives such as senna concentrate, casanthranol, bisacodyl, and sodium picosulphate; antidiarrheal agents such as difenoxine hydrochloride, loperamide hydrochloride, furazolidone, diphenoxylate hydrochloride, and microorganisms; vaccines such as bacterial and viral vaccines; antimicrobial agents such as penicillins, cephalosporins, and macrolides, antifungal agents such as imidazolic and triazolic derivatives; and nucleic acids such as DNA sequences encoding for biological proteins, and antisense oligonucleotides. It is understood that a pharmaceutically active agent can be used in connection with administration to various subjects, for example, to humans (z.e., medical administration) or to animals (z.e.,
veterinary administration). As used herein, the recitation of a pharmaceutically active agent inherently encompasses the pharmaceutically acceptable salts thereof.
[0082] “Sequence identity” and “sequence similarity” can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences may then be referred to as “substantially identical” or “essentially similar” when they are optimally aligned. For example, sequence similarity or identity can be determined by searching against databases such as FASTA, BLAST, etc., but hits should be retrieved and aligned pairwise to compare sequence identity. Two proteins or two protein domains, or two nucleic acid sequences can have “substantial sequence identity” if the percentage sequence identity is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, preferably 90%, 95%, 98%, 99% or more. Such sequences are also referred to as “variants” herein, e.g., other variants of glycogen branching enzymes and amylases. Sequences with substantial sequence identity do not necessarily have the same length and may differ in length. For example, sequences that have the same nucleotide sequence but of which one has additional nucleotides on the 3’- and/or 5’-side are 100% identical. [0083] In an aspect, the skilled person can determine an efficacious dose, an efficacious schedule, and an efficacious route of administration for one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof so as to treat or prevent a synucleinopathy such as Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder. In an aspect, the skilled person can also alter, change, or modify an aspect of an administering step to improve efficacy of one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof. In an aspect, the skilled person can determine an efficacious dose, an efficacious schedule, and an efficacious route of administration for any disclosed isolated nucleic acid molecule, disclosed pharmaceutical formulation, disclosed vector, disclosed therapeutic agent, or any combination thereof.
[0084] As used herein, “modifying the method” can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. For example, in an aspect, a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed rAAV vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed rAAV vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or by changing the duration of time that the one or more of
the disclosed isolated nucleic acid molecules, disclosed viral vectors, disclosed lentiviral vectors, disclosed pharmaceutical formulations, disclosed host cells, disclosed gRNAs, disclosed plasmids, or any combination thereof, or are administered to a subject.
[0085] As used herein, “isolated” refers to a nucleic acid molecule or a nucleic acid sequence that has been substantially separated, produced apart from, or purified away from other biological components in the cell or tissue of an organism in which the component occurs, such as other cells, chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins. Isolated proteins or nucleic acids, or cells containing such, in some examples are at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% pure.
[0086] As used herein, “concurrently” means (1) simultaneously in time, or (2) at different times during the course of a common treatment schedule.
[0087] The term “contacting” as used herein refers to bringing one or more of disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof together with a target area or intended target area in such a manner that the one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof exert an effect on the intended target or targeted area either directly or indirectly. A target area or intended target area can be one or more of a subject’s organs (e.g., lungs, heart, liver, kidney, brain, etc.). In an aspect, a target area or intended target area can be any cell or any organ targeted, infected, or affected by a synucleinopathy like Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder. In an aspect, a target area or intended target area can be any cell or any organ targeted, infected, or affected by a-synuclein aggregates, particularly in a disease state (such as dopaminergic or cholinergic neurons). In an aspect, a target area or intended target area can be the brain or various neuronal populations. In an aspect, a target area or intended target area can be any cell or any organ infected by an over-expression or an under-expression of one or more genes.
[0088] As used herein, “determining” can refer to measuring or ascertaining the presence and severity of a synucleinopathy, an SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB). Methods and techniques used to determine the presence and/or severity of a synucleinopathy, an SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) are typically known to the medical arts. For example,
the art is familiar with the ways to identify and/or diagnose the presence, severity, or both of a synucleinopathy, an SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB). In an aspect, “determining” can also refer to measuring or ascertaining the level of one or more proteins or peptides in a biosample, or measuring or ascertaining the level or one or more RNAs or miRNAs in a biosample. Methods and techniques for determining the expression and/or activity level of relevant proteins, peptides, mRNA, DNA, or any combination thereof known to the art and are disclosed herein.
[0089] As used herein, “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired result such as, for example, the treatment and/or prevention of a synucleinopathy. As used herein, the terms “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired an effect on an undesired condition (e.g., a synucleinopathy). For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. In an aspect, “therapeutically effective amount” means an amount of a disclosed isolated nucleic acid molecule, a disclosed pharmaceutical formulation, a disclosed vector, or any combination thereof that (i) treats the particular disease, condition, or disorder (e.g., synucleinopathy), (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder (e.g., synucleinopathy), or (iii) delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein (e.g., synucleinopathy). The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof employed; the disclosed methods employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof employed; the duration of the treatment; drugs used in combination or coincidental with the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof employed, and other like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, then the effective daily dose can be divided into multiple doses for purposes of
administration. Consequently, a single dose of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition, such as, for example, synucleinopathy.
[0090] As used herein, the term “pharmaceutically acceptable carrier” refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. In an aspect, a pharmaceutical carrier employed can be a solid, liquid, or gas. In an aspect, examples of solid carriers can include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. In an aspect, examples of liquid carriers can include sugar syrup, peanut oil, olive oil, and water. In an aspect, examples of gaseous carriers can include carbon dioxide and nitrogen. In preparing a disclosed composition for oral dosage form, any convenient pharmaceutical media can be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like can be used to form oral liquid preparations such as suspensions, elixirs and solutions; while carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like can be used to form oral solid preparations such as powders, capsules and tablets. Because of their ease of administration, tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed. Optionally, tablets can be coated by standard aqueous or nonaqueous techniques. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged
absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
[0091] As used herein, the term “excipient” refers to an inert substance which is commonly used as a diluent, vehicle, preservative, binder, or stabilizing agent, and includes, but is not limited to, proteins (e.g., serum albumin, etc.), amino acids (e.g., aspartic acid, glutamic acid, lysine, arginine, glycine, histidine, etc.), fatty acids and phospholipids (e.g., alkyl sulfonates, caprylate, etc.), surfactants (e.g., SDS, polysorbate, nonionic surfactant, etc.), saccharides (e.g., sucrose, maltose, trehalose, etc.) and polyols (e.g., mannitol, sorbitol, etc.). See, also, for reference, Remington’s Pharmaceutical Sciences, (1990) Mack Publishing Co., Easton, Pa., which is hereby incorporated by reference in its entirety.
[0092] As used herein, the term “package insert” is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products.
[0093] As used herein, the term “in combination” in the context of the administration of one or more of the disclosed agents, disclosed therapeutic agents, disclosed nucleic acid molecules, disclosed viral vectors, disclosed rAAV vectors, disclosed pharmaceutical formulations or a combination thereof includes the use of more than one therapy (e.g., additional therapeutic agents). Administration “in combination with” one or more additional therapeutic agents includes simultaneous (e.g., concurrent) and consecutive administration in any order. The use of the term “in combination” does not restrict the order in which therapies are administered to a subject. By way of non-limiting example, a first therapy (e.g., one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof) may be administered prior to (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour,
2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks), concurrently, or after (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks or longer) the administration of a second therapy (e.g., one or more of the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof or one or more additional therapeutic agents) to a subject having or diagnosed with a synucleinopathy, an SNCA associated disease or disorder, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
[0094] As used herein, “CRISPR or clustered regularly interspaced short palindromic repeat” is an ideal tool for correction of genetic abnormalities associated with diseases such as a synucleinopathy. The system can be designed to target genomic DNA directly. A CRISPR system involves two main components: a Cas9 enzyme and a guide (gRNA). The gRNA contains a targeting sequence for DNA binding (at, for example, the SNCA promoter region) and a scaffold sequence for Cas9 binding. Cas9 nuclease is often used to “knockout” target genes such as for example, the SNCA gene. Also, multiple gRNAs can be employed to suppress or activate multiple genes simultaneously, hence increasing the treatment efficacy and reducing resistance potentially caused by new mutations in the target genes.
[0095] As used herein, “CRISPR-based endonucleases” include RNA-guided endonucleases that comprise at least one nuclease domain and at least one domain that interacts with a guide RNA. As known to the art, a guide RNA directs the CRISPR-based endonucleases to a targeted site in a nucleic acid at which site the CRISPR-based endonucleases cleaves at least one strand of the targeted nucleic acid sequence. As the guide RNA provides the specificity for the targeted cleavage, the CRISPR-based endonuclease is universal and can be used with different guide RNAs to cleave different target nucleic acid sequences. CRISPR-based endonucleases are RNA-guided endonucleases derived from CRISPR/Cas systems.
[0096] In an aspect, a disclosed CRISPR-based endonuclease can be derived from a CRISPR/Cas type I, type II, or type III system. Non-limiting examples of suitable CRISPR/Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966.
[0097] In an aspect, a disclosed CRISPR-based endonuclease can be derived from a type II CRISPR/Cas system. For example, in an aspect, a CRISPR-based endonuclease can be derived from a Cas9 protein. The Cas9 protein can be from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalter omonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Campylobacter jejuni, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina. In an aspect, the CRISPR-based nuclease can be derived from a Cas9 protein from Streptococcus pyogenes. In an aspect, the CRISPR-based nuclease can be derived from a Cas9 protein from Staphylococcus aureus. In an aspect, the CRISPR-based nuclease can be derived from a Cas9 protein from Campylobacter jejuni. In an aspect, the CRISPR-based nuclease can be a deactivated Cas9 protein (dCas9) derived from Streptococcus pyogenes Staphylococcus aureus , or Campylobacter jejuni. In an aspect, the CRISPR-based nuclease can comprise an amino acid sequence set forth in any one of SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, and SEQ ID NO: 18. In an aspect, the CRISPR-based nuclease can be encoded by a nucleic acid comprising a sequence set forth in any one of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 16, and SEQ ID NO: 18.
[0098] As used herein, “CRISPRa” refers to CRISPR Activation, which is using a dCas9 or dCas9-activator with a gRNA to increase transcription of a target gene.
[0099] As used herein, “CRISPRi” refers to CRISPR Interference, which is using a dCas9 or dCas9-repressor with a gRNA to repress/decrease transcription of a target gene.
[0100] As used herein, “dCas9” refers to enzymatically inactive form of Cas9, which can bind, but cannot cleave, DNA.
[0101] As used herein, “Protospacer Adjacent Motif’ or “PAM” refers to a sequence adjacent to the target sequence that is necessary for Cas enzymes to bind target DNA.
[0102] Disclosed are the components to be used to prepare the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof as well the disclosed isolated nucleic acid molecules, disclosed pharmaceutical formulations, disclosed vectors, or any combination thereof used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the compositions of the disclosure. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific aspects or combination of aspects of the disclosed methods.
C. Compositions
1. Isolated Nucleic Acid Molecules
[0103] Disclosed herein is an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof. Disclosed herein is an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0104] Disclosed herein is an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof. Disclosed herein is an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
Neuron specific regulatory elements
[0105] In an aspect, the neuron specific regulatory sequence may comprise a wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the neuron specific regulatory sequence is a neuron specific promoter. As used herein, the term “neuron specific promoter” includes wild-type promoter, or derivatives thereof, synthetic promoter, minimal promoter, and any combination of promoter and enhancers sequence, that drives enhanced expression of a gene-of-interest to which it is operably linked in the neuron cells. In an exemplary aspect, the neuron specific promoter may drive enhanced expression of the gene-of-interest to which it is operably linked, in the neuron compared to other brain cells, for example, glia. In an aspect, the neuron specific promoter may be functional in enhancing expression in the neuron, of gene-of-interest to which it is operably linked, by about 1.1 -fold to about 100-fold or more. In an aspect, the neuron specific promoter may be functional in enhancing expression in the neuron, of gene-of-interest to which it is operably linked, by about 1.1 -fold to about 2-fold, about 2-fold to about 10-fold, about 10-fold to about 20-fold, about 20-fold to about 30-fold, about 30-fold to about 40-fold, about 40-fold to about 50-fold, about 50-fold to about 60-fold, about 60-fold to about 70-fold, about 70-fold to about 80-fold, about 80-fold to about 90-fold, about 90-fold to about 100-fold or more compared to other brain cells. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter). Non-limiting examples of neuron specific promoters include a TH promoter, a FOXA2 promoter, a Ch AT promoter, a Nkx2.1 promoter or a derivative thereof.
[0106] In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a
dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (z.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a F0XA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a F0XA2 promoter, a fragment, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
[0107] In an aspect, the neuron specific promoter is a TH promoter, or a derivative thereof. In an aspect, a disclosed TH promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 5, or a fragment, or a derivative thereof. In an aspect, a disclosed TH promoter can comprise a sequence as set forth in SEQ ID NO: 5.
[0108] In an aspect, the neuron specific promoter is a FOXA2 promoter, or a derivative thereof. In an aspect, a disclosed FOXA2 promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 6, or a fragment, or a derivative thereof. In an aspect, a disclosed FOXA2 promoter can comprise a sequence as set forth in SEQ ID NO: 6.
[0109] In an aspect, the neuron specific promoter is a ChAT promoter, or a derivative thereof. In an aspect, a disclosed ChAT promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 7, or a fragment, or a derivative thereof. In an aspect, a disclosed ChAT promoter can comprise a sequence as set forth in SEQ ID NO: 7.
[0110] In an aspect, the neuron specific promoter is a Nkx2.1 promoter, or a derivative thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 8, or a fragment, or a derivative thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise a sequence as set forth in SEQ ID NO: 8.
[01 11] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas
endonuclease can comprise a TH promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a F0XA2 promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a ChAT promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
[0112] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can be operably linked to the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
[0113] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas
endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
[0114] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Ch AT promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
[0115] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a fragment thereof, or a derivative thereof.
Encoded dCas endonucleases
[0116] In an aspect, a disclosed dCas endonuclease can comprise a dCas9 endonuclease.
[0117] In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an aspect, a disclosed
variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
[0118] In an aspect, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
[0119] In an aspect, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
[0120] In an aspect, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof. In an aspect, a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
[0121] In an aspect, a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10. In an aspect, a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof. In an aspect, a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
Encoded Polypeptides having Enzymatic Activity
[0122] In an aspect, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
[0123] In an aspect, a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb- HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2- MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPPl-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2- HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2.
[0124] In an aspect, a nucleic acid sequence encoding the disclosed HPla may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HPla endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof. In an aspect, a disclosed HPla endonuclease can comprise the amino acid
sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof. In an aspect, a disclosed HP la can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
[0125] In an aspect, a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
[0126] In an aspect, a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
[0127] In an aspect, a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
[0128] In an aspect, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
[0129] In an aspect, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
[0130] In an aspect, a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
[0131] In an aspect, a nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment
thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB- MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0132] In an aspect, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3 A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
[0133] In an aspect, a disclosed encoded polypeptide can comprise transcription activation activity. In an aspect, a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain. In an aspect, a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
[0134] In an aspect, a nucleic acid sequence encoding the disclosed VP 16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof. In an aspect, a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
[0135] In an aspect, a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at
least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
[0136] In an aspect, a disclosed encoded polypeptide can comprise transcription repression activity. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 hi stone-dem ethyl ase repressor activity, or any combination thereof.
[0137] In an aspect, a disclosed encoded polypeptide can comprise transcription release factor activity. In an aspect, a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
[0138] In an aspect, a disclosed encoded polypeptide can comprise histone modification activity. In an aspect, a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
[0139] In an aspect, a disclosed encoded polypeptide can comprise nucleic acid association activity. In an aspect, a disclosed encoded polypeptide comprising nucleic acid association
activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
[0140] In an aspect, a disclosed encoded polypeptide can comprise methyltransferase activity. In an aspect, a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A). In an aspect, a disclosed encoded polypeptide can comprise demethylase activity. In an aspect, a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1). In an aspect, a disclosed encoded polypeptide can comprise acetyltransferase activity. In an aspect, a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In an aspect, a disclosed encoded polypeptide can comprise deacetylase activity. In an aspect, a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase. Exemplary Combinations o f dCas Endonucleases and Polypeptides Having Enzymatic Activity [0141] In an aspect, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
[0142] In an aspect, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb- MBD1, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-
MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBD1- MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2- KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB- DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1- KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A- DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A-MeCP2. In an aspect, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed fusion can comprise KRAB-MeCP2. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9, and a disclosed fusion can comprise KRAB-MeCP2.
[0143] In an aspect, an isolated nucleic acid can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HP la, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
[0144] In an aspect, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b-
HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB- KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB- MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1- MBD2, NIPPl-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2- DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2. In an aspect, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A. gRNAs and Genes of Interest
[0145] In an aspect, a disclosed gene of interest or portion thereof can demonstrate a reduced expression and/or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates a reduced expression and/or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gene of interest or portion thereof can demonstrate an increased expression and/or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates increased expression and/or activity level when compared to wild-type or control expression level. [0146] In an aspect, a disclosed gene of interest can comprise a neuronal gene of interest implicated in a synucleinopathy or other neurodegenerative disease. In an aspect, a disclosed gene of interest can comprise SNCA, LRRK2, RAB8, oxRABlO. In an aspect, a disclosed gene of interest can comprise SNCA. In an aspect, a disclosed gene of interest can comprise SNCA (UniProt ID: P37840), LRRK2 (UniProt ID: Q5S007), RAB8 (UniProt ID: P61026), RAB10 (UniProt ID: P61006) or any variant thereof, or any fragment thereof, or any portion thereof. In an aspect, a
disclosed gene of interest can comprise SNCA (UniProt ID: P37840) or any variant thereof, or any fragment thereof, or any portion thereof.
[0147] In an aspect, a disclosed isolated nucleic acid can comprise at least one gRNA that can target a gene of interest or portion thereof (e.g., an SNCA gene). In an aspect, a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same gene of interest or portion thereof. In an aspect, disclosed gRNAs can target different genes of interest or portions thereof. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function.
[0148] In an aspect, a disclosed gRNA can target the SNCA gene. In an aspect, a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpG18, CpG19, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
[0149] In an aspect, a disclosed isolated nucleic acid can further comprise a gRNA scaffold. In an aspect of a disclosed isolated nucleic acid, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
Additional Elements in Isolated Nucleic Acid Molecules
[0150] In an aspect, a disclosed isolated nucleic acid molecule can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect, a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof a derivative thereof, or any combination thereof. In an aspect, a disclosed EF-
la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a promoter can be a short EFl alpha (EFS-NF) promoter. In an aspect, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
[0151] In an aspect, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a fragment thereof, or a derivative thereof.
[0152] In an aspect, a disclosed isolated nucleic acid molecule can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect, the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect, the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a FOXA2 promoter, a ChAT promoter, or a Nkx2.1 promoter, a fragment thereof, or a derivative thereof and a second promoter comprising a U6 promoter, a fragment thereof, or a derivative thereof.
[0153] In an aspect, a disclosed isolated nucleic acid molecule can further comprise one or more additional regulatory elements. In an aspect, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional
regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
[0154] In an aspect, a disclosed NLS can comprise the sequence set forth in any of SEQ ID NO: 80 - SEQ ID NO: 83 or a fragment thereof. In an aspect, a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof. In an aspect, a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
[0155] In an aspect, a disclosed nucleic acid sequence can be CpG depleted and codon-optimized for expression in a human cell. In an aspect, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect, “CpG-free” can mean “CpG-depleted”. In an aspect, “CpG- depleted” can mean “CpG-free”. In an aspect, “CpG-depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art. In an aspect, any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
[0156] In an aspect, a disclosed isolated nucleic acid molecule can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
[0157] Disclosed herein is an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0158] Disclosed herein is an isolated nucleic acid molecule, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
[0159] Disclosed herein is an isolated nucleic acid molecule, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion
product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
[0160] Disclosed herein is an isolated nucleic acid molecule, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0161] Disclosed herein is an isolated nucleic acid molecule, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0162] Disclosed herein is an isolated nucleic acid molecule, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0163] Disclosed herein is an isolated nucleic acid molecule, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0164] In an aspect, a disclosed isolated nucleic acid molecule can treat and/or prevent a synucleinopathy (or progression thereof). In an aspect, a disclosed isolated nucleic acid molecule can treat and/or prevent an SNCA associated disease or disorder (or progression thereof). In an aspect, a disclosed isolated nucleic acid molecule can treat and/or prevent Parkinson’s disease (PD) (or progression thereof). In an aspect, a disclosed isolated nucleic acid molecule can treat and/or prevent dementia with Lewy bodies (DLB) (or progression thereof).
2. Vectors
Viral Vectors
[0165] Disclosed herein is a viral vector comprising a disclosed isolated nucleic acid molecule. In view of this, disclosed herein is a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0166] In an aspect of a disclosed viral vector, a disclosed isolated nucleic acid molecule comprises one or more neuron specific regulatory elements. In an aspect, the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wild-type promoter or a neuron specific synthetic promoter). In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a fragment, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
[0167] In an aspect of a disclosed viral vector, a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed ChAT promoter can
comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof. In an aspect, a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
[0168] In an aspect of a disclosed viral vector, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter.
[0169] In an aspect of a disclosed viral vector, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can be operably linked to the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
[0170] In an aspect of a disclosed viral vector, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to
the at dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a F0XA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
[0171] In an aspect of a disclosed viral vector, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
[0172] In an aspect of a disclosed viral vector, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
[0173] In an aspect of a disclosed viral vector, a disclosed dCas endonuclease can comprise a dCas9 endonuclease. In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9),
a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an aspect, a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
[0174] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
[0175] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
[0176] In an aspect of a disclosed viral vector (e.g., a lentiviral vector) or disclosed recombinant AAV vector, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof. In an aspect, a
disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
[0177] In an aspect of a disclosed viral vector, a disclosed dVQR can comprise DI 135 V, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10. In an aspect, a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof. In an aspect, a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
[0178] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. [0179] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel -Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed viral vector, a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla- NIPP1, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1- DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2- NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB- MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2- MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A- HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A- NIPP1, or DNMT3 A-MeCP2.
[0180] In an aspect of a disclosed vector, a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof. In an aspect, a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof. In an aspect, a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
[0181] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
[0182] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
[0183] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence set forth
SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
[0184] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
[0185] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
[0186] In an aspect of a disclosed viral vectora nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
[0187] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0188] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof. In an aspect, a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
[0189] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise transcription activation activity. A disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain. In an aspect of a disclosed viral vector, a disclosed transactivation domain can comprise a VP 16 protein, a series of linked VP 16 proteins, a p65 domain of NFKB, or any combination thereof.
[0190] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed VP16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, a disclosed encoded VP16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof. In an aspect, a disclosed encoded VP 16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
[0191] In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
[0192] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise transcription repression activity. A disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect of a disclosed viral vector, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
[0193] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise transcription release factor activity. A disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity. In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect of a disclosed viral vector, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof.
[0194] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise histone modification activity. A disclosed encoded polypeptide comprising histone modification
activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
[0195] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise nucleic acid association activity. A disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-turn-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
[0196] In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise methyltransferase activity. In an aspect of a disclosed viral vector, a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)- methyltransferase 3a (DNMT3A). In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise demethylase activity. In an aspect of a disclosed viral vector, a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1). In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise acetyltransferase activity. In an aspect of a disclosed viral vector, a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In an aspect of a disclosed viral vector, a disclosed encoded polypeptide can comprise deacetylase activity. A disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase. [0197] In an aspect of a disclosed viral vector, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. In an aspect of a disclosed viral vector, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. In an aspect of a disclosed viral vector, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0198] In an aspect of a disclosed viral vector, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1,
MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed viral vector, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB- MeCP2.
[0199] In an aspect of a disclosed viral vector, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB- KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB- MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1- MBD2, NIPPl-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2- DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2.
[0200] In an aspect of a disclosed viral vector, the vector can comprise a nucleic acid encoding a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A,
any combination thereof, or any fusion thereof. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0201] In an aspect of a disclosed viral vector, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla- HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb- NIPP1, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1- MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2- MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A- MeCP2. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect of a disclosed viral vector, the encoded fusion protein can comprise a dSaCas9 and DNMT3 A.
[0202] In an aspect of a disclosed viral vector, a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed viral vector, a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.
[0203] In an aspect of a disclosed viral vector, a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed viral vector, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
[0204] In an aspect of a disclosed viral vector, a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect of a disclosed viral vector, disclosed gRNAs can target the same gene of interest or portion thereof. In an aspect of a disclosed viral vector, disclosed gRNAs can target different genes of interest or portions thereof.
[0205] In an aspect of a disclosed viral vector, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect of a disclosed viral vector, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function. Disclosed target genes and disclosed genes of interest are discussed supra.
[0206] In an aspect of a disclosed viral vector, a disclosed gRNA can target the SNCA gene. In an aspect of a disclosed viral vector, a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90. In an aspect of a disclosed viral vector, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect of a disclosed viral vector, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect of a disclosed viral vector, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect of a disclosed viral vector, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect of a disclosed viral vector, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect of a disclosed viral vector, a disclosed gRNA targeting the SNCA gene and/or the promoter of the SNCA gene can comprise any sequence set forth in SEQ ID NO: 59 - SEQ ID NO: 71.
[0207] In an aspect of a disclosed viral vector, a disclosed viral vector can further comprise a gRNA scaffold. In an aspect of a disclosed viral vector, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73 or a fragment thereof.
[0208] In an aspect of a disclosed viral vector, a disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect of a disclosed viral vector, a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter,
a CMV promoter/enhancer, a fragment thereof, or any combination thereof. In an aspect of a disclosed viral vector, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect of a disclosed viral vector, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect of a disclosed viral vector, a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect of a disclosed viral vector, a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 89, or a fragment thereof. In an aspect of a disclosed viral vector, a promoter can be a short EFl alpha (EFS-NF) promoter.
[0209] In an aspect of a disclosed viral vector, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect of a disclosed viral vector, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter. In an aspect of a disclosed viral vector, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter.
[0210] In an aspect of a disclosed viral vector, a disclosed viral vector can further comprise two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect of a disclosed viral vector, a disclosed viral vector can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect of a disclosed viral vector, the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect of a disclosed viral vector, the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a FOXA2 promoter, a ChAT promoter, or a Nkx2.1 promoter and a second promoter comprising a U6 promoter.
[0211] In an aspect of a disclosed viral vector, a disclosed viral vector can further comprise one or more additional regulatory elements. In an aspect of a disclosed viral vector, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a
promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
[0212] In an aspect of a disclosed viral vector, a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80 - SEQ ID NO: 83, or a fragment thereof. In an aspect of a disclosed viral vector, a disclosed PolyA sequence can comprise the sequence set forth in in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof. In an aspect of a disclosed viral vector, a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77, or a fragment thereof.
[0213] In an aspect of a disclosed viral vector, a disclosed viral vector can comprise a nucleic acid that is CpG depleted and codon-optimized for expression in a human cell. In an aspect of a disclosed viral vector, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect of a disclosed viral vector, “CpG-free” can mean “CpG-depleted”. In an aspect of a disclosed viral vector, “CpG-depleted” can mean “CpG-free”. In an aspect of a disclosed viral vector, “CpG-depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect of a disclosed viral vector, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art. In an aspect of a disclosed viral vector, any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
[0214] In an aspect of a disclosed viral vector, a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
[0215] Disclosed herein is a viral vector, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0216] Disclosed herein is a viral vector, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at
least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
[0217] Disclosed herein is a viral vector, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
[0218] Disclosed herein is a viral vector, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0219] Disclosed herein is a viral vector, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0220] Disclosed herein is a viral vector, comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0221] Disclosed herein is a viral vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0222] In an aspect, a disclosed viral vector can be an adenovirus vector, an AAV vector, a herpes simplex virus vector, a retrovirus vector, a lentivirus vector, and alphavirus vector, a flavivirus vector, a rhabdovirus vector, a measles virus vector, a Newcastle disease viral vector, a poxvirus vector, or a picomavirus vector. In an aspect, a disclosed viral vector can be a lentiviral vector. In an aspect, a disclosed viral vector can be an AAV vector.
Lentiviral Vectors
[0223] In an aspect, a disclosed viral vector may comprise a lentiviral vector. In an aspect a disclosed lentiviral vector can comprise a disclosed isolated nucleic acid molecule, as discussed supra. In an aspect, a disclosed lentiviral vector can comprise comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed lentiviral vector can comprise a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion protein having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof.
[0224] The large packaging capacity of lentiviral vectors, a commonly used method to stably deliver CRISPR/Cas9 components in vitro, can accommodate the 4.2 kb S. pyogenes Cas9, epigenetic modulator fusions, a single gRNA, and associated regulatory elements required for expression. In some embodiments, the lentiviral vector may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene, including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 -71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.
[0225] In an aspect, a disclosed lentiviral vector may be a modified lentiviral vector. For example, the lentiviral vector may be modified to increase vector titer. In an aspect, the viral vector may be an episomal integrase-deficient lentiviral vector (IDLV). The IDLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of an SNCA gene, including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 - 71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.
[0226] Episomal integrase-deficient lentiviral vectors (IDLVs) are an ideal platform for delivery of large genetic cargos where only transient expression of the transgene is desired. IDLVs retain
residual (integrase-independent and illegitimate) integration rates of A0.2%-0.5% (one integration event per 200-500 transduced cells), which could be further reduced by packaging a novel 3g polypurine tract (PPT)-deleted lentiviral vector into integrase-deficient particles. While efficacious for in vitro delivery, under certain circumstances, lentiviral delivery is typically not suitable for in vivo gene regulation due to concerns for insertional mutagenesis. In contrast, the IDLV may display lower capacity to induce off-target mutations than other lentiviral vectors.
[0227] In an aspect, a disclosed lentiviral vector may comprise an episomal integrase-competent lentiviral vector (ICLV). The ICLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 - 71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB- MECP2 fusion protein is operably linked to a neuron specific regulatory element.
[0228] In an aspect, a disclosed lentiviral vector may include an episomal integrase-deficient lentiviral vector (IDLV). The IDLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs: 59 - 71, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB- MECP2 fusion protein is operably linked to a neuron specific regulatory element.
AAV Vectors
[0229] In an aspect, a viral vector disclosed herein may comprise an adeno-associated virus (AAV) vector (e.g., a recombinant AAV vector). In an aspect a disclosed AAV vector (e.g., a recombinant AAV vector) can comprise a disclosed isolated nucleic acid molecule, as discussed supra. In an aspect, a disclosed AAV vector (e.g., a recombinant AAV vector) can comprise comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed AAV vector (e.g., a recombinant AAV vector) can comprise a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion protein having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof.
[0230] The AAV vector is a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. AAV vectors may be used to deliver the composition for epigenome modification of a gene using various construct configurations. For
example, AAV vectors may deliver Cas fusion protein and gRNA expression cassettes on separate vectors or on the same vector. Alternatively, if the small Cas9 proteins, derived from species such as Staphylococcus aureus or Neisseria meningitidis or Campylobacter jejuni are used then both the Cas fusion protein and up to two gRNA expression cassettes may be combined in a single AAV vector within the 4.7 kb packaging limit.
[0231] In certain aspects, the AAV vector is a modified AAV vector. For example, the modified AAV vector may be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:635-646). The modified AAV vector may deliver nucleases to skeletal and cardiac muscle in vivo. The modified AAV vector may be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9. The modified AAV vector may be based on AAV2 pseudotype with alternative muscle-tropic AAV capsids, such as AAV2/1, AAV2/6, AAV2/7, AAV2/8, AAV2/9, AAV2.5 and AAV/SASTG vectors that efficiently transduce skeletal muscle or cardiac muscle by systemic and local delivery (Seto et al. Current Gene Therapy (2012) 12: 139-151). The modified AAV vector may be AAV2i8G9 (Shen et al. J. Biol. Chem. (2013) 288:28814-28823)
[0232] In an aspect, a disclosed AAV vector (e.g., a recombinant AAV vector) can include naturally isolated serotypes including, but not limited to, AAV1, AAV2, AAV3 (including 3a and 3b), AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, AAVrh39, AAVrh43, AAVcy.7 as well as bovine AAV, caprine AAV, canine AAV, equine AAV, ovine AAV, avian AAV, primate AAV, non-primate AAV, and any other virus classified by the International Committee on Taxonomy of Viruses (ICTV) as an AAV. In an aspect, an AAV capsid can be a chimera either created by capsid evolution or by rational capsid engineering from a naturally isolated AAV variants to capture desirable serotype features such as enhanced or specific tissue tropism and/or a host immune response escape. Naturally isolated AAV variants include, but not limited to, AAV-DJ, AAV-HAE1, AAV-HAE2, AAVM41, AAV- 1829, AAV2 Y/F, AAV2 T/V, AAV2i8, AAV2.5, AAV9.45, AAV9.61, AAV-B1, AAV-AS, AAV9.45A-String (e.g., AAV9.45-AS), AAV9.45Angiopep, AAV9.47-Angiopep, and AAV9.47-AS, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAV-F, AAVcc.47, and AAVcc.81. In an aspect, a disclosed AAV vector can be AAV-Rh74 or a related variant (e.g., capsid variants like RHM4-1). In an aspect, a disclosed AAV vector can be AAV8. In an aspect, a disclosed AAV vector (e.g., a recombinant AAV vector) can be AAVhum.8. In an aspect, a disclosed AAV vector (e.g., a recombinant AAV vector) can be AAV9.
Plasmid Vectors
[0233] Disclosed herein is a plasmid comprising a disclosed isolated nucleic acid molecule. In view of this, disclosed herein is a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof. In an aspect, a disclosed plasmid may comprise a disclosed viral vector provided herein.
[0234] In an aspect of a disclosed plasmid, a disclosed isolated nucleic acid molecule comprises one or more neuron specific regulatory elements. In an aspect, the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wild-type promoter or a neuron specific synthetic promoter). In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a fragment, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.
[0235] In an aspect of a disclosed plasmid, a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed
ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof. In an aspect, a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
[0236] In an aspect of a disclosed plasmid, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter.
[0237] In an aspect of a disclosed plasmid, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can be operably linked to the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
[0238] In an aspect of a disclosed plasmid, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise
a F0XA2 promoter. In an aspect, a disclosed neuron specific regulatory element i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter.
[0239] In an aspect of a disclosed plasmid, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
[0240] In an aspect of a disclosed plasmid, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter.
[0241] In an aspect of a disclosed plasmid, a disclosed dCas endonuclease can comprise a dCas9 endonuclease. In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an
aspect, a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
[0242] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
[0243] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
[0244] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof. In an aspect, a disclosed dCjCas9 can comprise a sequence having at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
[0245] In an aspect of a disclosed plasmid, a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10. In an aspect, a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof. In an aspect, a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
[0246] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. [0247] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Krtippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed plasmid, a disclosed fusion can comprise HPla- HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb- NIPP1, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1- MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2- MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A- MeCP2.
[0248] In an aspect, a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or
100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof. In an aspect, a disclosed HP la endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof. In an aspect, a disclosed HP la can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
[0249] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed HP lb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP lb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
[0250] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
[0251] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at
least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
[0252] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
[0253] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
[0254] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
[0255] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment
thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0256] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof. In an aspect, a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
[0257] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise transcription activation activity. A disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain. In an aspect of a disclosed plasmid, a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
[0258] In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed VP16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof. In an aspect, a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
[0259] In an aspect of a disclosed plasmida nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
[0260] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise transcription repression activity. A disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect of a disclosed plasmid, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
[0261] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise transcription release factor activity. A disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity. In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect of a disclosed plasmid, a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: SEQ ID NO: 57, or a fragment thereof. In an aspect of a disclosed plasmid, a disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 58, or a fragment thereof. In an aspect of a disclosed plasmid, a disclosed encoded ERF1 can comprise an amino acid sequence having at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
[0262] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise histone modification activity. A disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
[0263] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise nucleic acid association activity. A disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
[0264] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise methyltransferase activity. In an aspect of a disclosed plasmid, a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A). In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise demethylase activity. In an aspect of a disclosed plasmid, a disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1). In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise acetyltransferase activity. In an aspect of a disclosed plasmid, a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise deacetylase activity. A disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
[0265] In an aspect of a disclosed plasmid, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed plasmid, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. In an aspect of a disclosed plasmid, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription
repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0266] In an aspect of a disclosed plasmid, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed plasmid, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB- MeCP2.
[0267] In an aspect of a disclosed plasmid, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2- MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPPl-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2- HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2.
[0268] In an aspect of a disclosed plasmid, the plasmid can comprise a nucleic acid encoding a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Krtippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any
combination thereof, or any fusion thereof. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl -CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HP lb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0269] In an aspect of a disclosed plasmid, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla- HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb- NIPP1, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1- MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2- MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A- MeCP2. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect of a disclosed plasmid, the encoded fusion protein can comprise a dSaCas9 and DNMT3 A
[0270] In an aspect of a disclosed plasmid, a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level.
In an aspect of a disclosed plasmid, a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.
[0271] In an aspect of a disclosed plasmid, a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed plasmid, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
[0272] In an aspect of a disclosed plasmid, a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect of a disclosed plasmid, disclosed gRNAs can target the same gene of interest or portion thereof. In an aspect of a disclosed plasmid, disclosed gRNAs can target different genes of interest or portions thereof.
[0273] In an aspect of a disclosed plasmid, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect of a disclosed plasmid, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function. Disclosed target genes and disclosed genes of interest are discussed supra.
[0274] In an aspect of a disclosed plasmid, a disclosed gRNA can target the SNCA gene. In an aspect of a disclosed plasmid, a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90. In an aspect of a disclosed plasmid, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect of a disclosed plasmid, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect of a disclosed plasmid, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect of a disclosed plasmid, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect of a disclosed plasmid, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpG18, CpG19, CpG20, CpG21, CpG22, or a combination thereof. In an aspect of a disclosed plasmid, a disclosed gRNA targeting the SNCA gene and/or the promoter of the SNCA gene can comprise any sequence set forth in SEQ ID NO: 59 - SEQ ID NO: 71.
[0275] In an aspect of a disclosed plasmid, a disclosed plasmid can further comprise a gRNA scaffold. In an aspect of a disclosed plasmid, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
[0276] In an aspect of a disclosed plasmid, a disclosed plasmid can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect of a disclosed plasmid, a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof. In an aspect of a disclosed plasmid, a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect of a disclosed plasmid, a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect of a disclosed plasmid, a promoter can be a short EFlalpha (EFS-NF) promoter. In an aspect of a disclosed plasmid, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect of a disclosed plasmid, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
[0277] In an aspect of a disclosed plasmid, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect of a disclosed plasmid, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter. In an aspect of a disclosed plasmid, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter.
[0278] In an aspect of a disclosed plasmid, a disclosed plasmid can further comprise two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect of a disclosed plasmid, a disclosed plasmid can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect of a disclosed plasmid, the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect of a disclosed plasmid, the isolated nucleic acid can comprise a
first promoter selected from a TH promoter, a F0XA2 promoter, a ChAT promoter, or a Nkx2.1 promoter and a second promoter comprising a U6 promoter.
[0279] In an aspect of a disclosed plasmid, a disclosed plasmid can further comprise one or more additional regulatory elements. In an aspect of a disclosed plasmid, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post- transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’- LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
[0280] In an aspect of a disclosed plasmid, a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80- SEQ ID NO: 83, or a fragment thereof. In an aspect of a disclosed plasmid, a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof. In an aspect of a disclosed plasmid, a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77, or a fragment thereof. [0281] In an aspect of a disclosed plasmid, a disclosed plasmid can comprise a nucleic acid that is CpG depleted and codon-optimized for expression in a human cell. In an aspect of a disclosed plasmid, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect of a disclosed plasmid, “CpG-free” can mean “CpG-depleted”. In an aspect of a disclosed plasmid, “CpG-depleted” can mean “CpG-free”. In an aspect of a disclosed plasmid, “CpG-depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect of a disclosed plasmid, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art. In an aspect of a disclosed plasmid, any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon- optimized.
[0282] In an aspect of a disclosed plasmid, a disclosed plasmid can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
[0283] Disclosed herein is a plasmid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0284] Disclosed herein is a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
[0285] Disclosed herein is a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA.
[0286] Disclosed herein is a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0287] Disclosed herein is a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0288] Disclosed herein is a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0289] Disclosed herein is a plasmid comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at
least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0290] Disclosed herein is a viral vector or plasmid comprising : (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) a neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof. Disclosed herein is a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA. Disclosed herein is a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a neuron specific promoter operably linked to the dCas endonuclease and the fusion product, and (v) a promoter operably linked to the at least one guide RNA. Disclosed herein is a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a TH promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA. Disclosed herein is a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB- MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a FOXA2 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA. Disclosed herein is a viral vector or a recombinant AAV vector comprising: a nucleic acid sequence encoding (i) a deactivated Cas (dCas)
endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a ChAT promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA. Disclosed herein is a viral vector or a recombinant AAV vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSaCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises KRAB-MeCP2, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (iv) a Nkx2.1 promoter operably linked to the dCas endonuclease and the fusion product, and (v) a U6 promoter operably linked to the at least one guide RNA.
[0291] In an aspect, a disclosed viral vector or plasmid can comprise the sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a variant thereof, or a fragment thereof, or a portion thereof. In an aspect, a disclosed viral vector can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a variant thereof, or a fragment thereof, or a portion thereof.
[0292] In an aspect, a disclosed viral vector or plasmid can treat and/or prevent a synucleinopathy (or progression thereof). In an aspect, a disclosed viral vector or plasmid can treat and/or prevent an SNCA associated disease or disorder (or progression thereof). In an aspect, a disclosed viral vector or disclosed plasmid can treat and/or prevent Parkinson’s disease (PD) (or progression thereof). In an aspect, a disclosed viral vector or disclosed plasmid can treat and/or prevent dementia with Lewy bodies (DLB) (or progression thereof).
3. Pharmaceutical Formulations
[0293] Disclosed herein is a pharmaceutical formulation comprising a disclosed isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is pharmaceutical formulation comprising (1) an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
[0294] Disclosed herein is a pharmaceutical formulation comprising a disclosed isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is pharmaceutical formulation comprising (1) an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having
an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
[0295] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
[0296] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof ; and (2) a pharmaceutically acceptable carrier.
[0297] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
[0298] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b)
one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
[0299] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii) and (c) a promoter operably linked to (a)(iii); and (2) a pharmaceutically acceptable carrier.
[0300] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule and a pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising (1) an isolated nucleic acid comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii) and (c) a promoter operably linked to (a)(iii); and (2) a pharmaceutically acceptable carrier.
[0301] Disclosed herein is pharmaceutical formulation comprising (1) a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier.
[0302] Disclosed herein is pharmaceutical formulation comprising (1) a viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof; and (2) a pharmaceutically acceptable carrier. [0303] Disclosed herein is pharmaceutical formulation comprising a (1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more
enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, and (2) a pharmaceutically acceptable carrier.
[0304] Disclosed herein is pharmaceutical formulation comprising a (1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, and (2) a pharmaceutically acceptable carrier.
[0305] Disclosed herein is a pharmaceutical formulation comprising 1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), and (2) a pharmaceutically acceptable carrier.
[0306] Disclosed herein is a pharmaceutical formulation comprising 1) viral vector or plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), and (2) a pharmaceutically acceptable carrier.
[0307] In an aspect, a disclosed formulation can comprise (i) one or more active agents, (ii) biologically active agents, (iii) one or more pharmaceutically active agents, (iv) one or more immune-based therapeutic agents, (v) one or more clinically approved agents, or (vi) a combination thereof. In an aspect, a disclosed composition can comprise one or more proteasome inhibitors. In an aspect, a disclosed composition can comprise one or more immunosuppressives
or immunosuppressive agents. In an aspect, an immunosuppressive agent can be anti-thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), or a combination thereof. In an aspect, a disclosed formulation can comprise a RNA therapeutic. An RNA therapeutic can comprise RNA-mediated interference (RNAi) and/or antisense oligonucleotides (ASO). In an aspect, a disclosed formulation can comprise a disclosed small molecule.
[0308] In an aspect, a disclosed pharmaceutical formulation can treat and/or prevent progression of a synucleinopathy. In an aspect, a disclosed pharmaceutical formulation can treat and/or prevent progression of an SNCA associated disease disorder. In an aspect, a disclosed pharmaceutical formulation can treat and/or prevent Parkinson’s disease (PD) progression. In an aspect, a disclosed pharmaceutical formulation can treat and/or prevent progression of dementia with Lewy Bodies (DLB).
4. Host Cells
[0309] Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof. Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0310] Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof. Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0311] Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas)
endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof. Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
[0312] Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii). Disclosed herein is a host cell or a host cell line comprising an isolated nucleic acid molecule comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
[0313] Disclosed herein is a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
[0314] Disclosed herein is a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
[0315] Disclosed herein is a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
[0316] Disclosed herein is a host cell or a host cell line transduced by a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
[0317] Disclosed herein is a host cell or a host cell line transduced by a viral vector comprising the sequence set forth in any one of SEQ ID NOs: 1 - 4.
[0318] Disclosed herein is a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
[0319] Disclosed herein is a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB,
NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i), (a)(ii), (a)(iii) or any combination thereof.
[0320] Disclosed herein is a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific regulatory elements operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
[0321] Disclosed herein is a host cell or a host cell line transfected by a plasmid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) one or more neuron specific promoters operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii).
[0322] Disclosed herein is a host cell or a host cell line transfected by a plasmid comprising the sequence set forth in any one of SEQ ID NOs: 1 - 4.
5. Guide RNAs (gRNAs)
[0323] Disclosed herein is a guide RNA or gRNA comprising the sequence set forth in any one of SEQ ID NO: 59 -71, a sequence at least 90% identical thereoto, or a complement thereof. Disclosed herein is a guide RNA or gRNA targeting a disclosed gene of interest or portion thereof. Disclosed gRNAs are listed below.
[0324] As known to the art, a gRNA provides the targeting of a CRISPR/Cas9-based epigenome modifying system. A guide RNA is a specific RNA sequence that recognizes the target DNA region of interest (such as, for example, the SNCA gene) and directs the Cas endonuclease there for editing. The gRNA is made up of two parts: crisprRNA (crRNA), a 17-20 nucleotide sequence complementary to the target DNA, and a tracr RNA, which serves as a binding scaffold for the Cas nuclease. In an aspect, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72 or SEQ ID NO: 73.
[0325] In an aspect, a disclosed gRNA can serve to direct a disclosed deactivated Cas9 endonuclease (e.g., dSpCas9, dSaCas9, or dCjCas9) or a disclosed fusion product having a deactivated endonuclease to a target area of interest (such as, for example, the promoter of the SNCA gene or a targeted gene of interest as disclosed above). In an aspect, a disclosed gRNA can serve to direct a disclosed deactivated Cas9 endonuclease (e.g., dSpCas9, dSaCas9, or dCjCas9) or a disclosed fusion product having a disclosed deactivated endonuclease to a target area of interest (such as, for example, a gene having a loss of function).
D. Methods of Effecting Precision Epigenetic Modulation
[0326] Disclosed herein is a method of effecting precision epigenetic modulation of neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated. Disclosed herein is a method of effecting precision epigenetic modulation, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is reduced
or decreased. Disclosed herein is a method of effecting precision epigenetic modulation, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is augmented or increased.
[0327] Disclosed herein is a method of effecting precision epigenetic modulation, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, wherein the expression and/or activity of SNCA in the one or more neurons is reduced or decreased.
[0328] Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the gene of interest in the one or more neurons is modulated. Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the gene of interest in the one or more neurons is modulated. [0329] Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the gene of interest in the one or more neurons is modulated. In some aspects, the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO:
7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In some aspects, the gene of interest in the SNCA gene.
[0330] Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the gene of interest in the one or more neurons is modulated. In some aspects, the neuron specific promoter of b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In some aspects, the gene of interest in the SNCA gene.
[0331] Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific regulatory element operably linked (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), wherein the expression and/or activity the gene of interest in the one or more neurons is modulated. In some aspects, the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), any derivative thereof, any fragment thereof, or any combination thereof. In some aspects, the promoter of (c) comprises a U6 promoter, a derivative thereof, or a fragment thereof. In some aspects, the gene of interest in the SNCA gene. [0332] Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more neurons with a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises
any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii) wherein the expression and/or activity the gene of interest in the one or more neurons is modulated. In some aspects, the neuron specific promoter of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In some aspects, the promoter of (v) comprises a U6 promoter a derivative thereof or a fragment thereof. In some aspects, the gene of interest in the SNCA gene.
[0333] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising contacting one or more neurons in a subject with a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), wherein the expression and/or activity of one or more genes of interest in the one or more cells is modulated. Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more cells in a subject with a therapeutically effective amount of a disclosed viral vector e.g., a lentiviral vector), wherein the expression and/or activity of one or more genes of interest in the one or more neurons is reduced or decreased. Disclosed herein is a method of effecting precision epigenetic modulation in neurons, the method comprising contacting one or more cells in a subject with a therapeutically effective amount of a disclosed viral vector e.g., a lentiviral vector), wherein the expression and/or activity of one or more genes of interest in the one or more neurons is augmented or increased. Disclosed herein is a method of effecting precision epigenetic modulation, the method comprising contacting one or more cells in a subject with a therapeutically effective amount of a disclosed viral vector e.g., a lentiviral vector), wherein the expression and/or activity of SNCA in the one or more neurons is reduced or decreased.
[0334] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated. In an aspect, the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof. In an aspect, the neuron specific regulatory element of (b) can comprise a TH promoter
(e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0335] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more cells is modulated. In an aspect, the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof. In an aspect, the neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0336] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated.
[0337] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated.
[0338] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any
combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof wherein the expression and/or activity of one or more genes of interest in the one or more cells is modulated. In an aspect, the dCas of (a)(i) is dSaCas9. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2. In an aspect, the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof. In an aspect, the neuron specific regulatory element of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0339] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising contacting one or more neurons in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof wherein the expression and/or activity of one or more genes of interest in the one or more cells is modulated. In an aspect, the dCas of (a)(i) is dSaCas9. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2. In an aspect, the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof. In an aspect, the neuron specific promoter of (b) can comprise a TH promoter e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0340] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising contacting one or more cells in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), wherein the expression and/or activity of one or more genes of interest in the one or more cells is
modulated. In an aspect, the dCas of (a)(i) is dSaCas9. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2. In an aspect, the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof. In an aspect, the neuron specific regulatory element of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, the promoter of (c) can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
[0341] Disclosed herein is a method of effecting precision epigenetic modulation in neurons in a subject, the method comprising contacting one or more cells in a subject with a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting a gene of interest or portion thereof, (b) a neuron specific promoter element operably linked to (a)(i) and/or (a)(ii) and (c) a promoter operably linked to (a)(iii), wherein the expression and/or activity of one or more genes of interest in the one or more cells is modulated. In an aspect, the dCas of (a)(i) is dSaCas9. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2. In an aspect, the at least one guide RNA of (a)(iii) targets the SNCA gene or a portion thereof. In an aspect, the neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or a combination thereof. In an aspect, the promoter of (c) can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
[0342] In an aspect, a disclosed gene of interest or portion thereof can demonstrate a reduced expression and/or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gene of interest or portion thereof can demonstrate an increased expression and/or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates a reduced expression and/or activity level when compared to wild-type or control expression level.
[0343] In an aspect, a disclosed method of effecting precision epigenetic modulation comprises measuring the level of expression and/or the level of activity of the disclosed gene of interest. In an aspect, a disclosed method can comprise repeating the measuring step one or more times.
[0344] In an aspect, a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same gene of interest or portion thereof. In an aspect, disclosed gRNAs can target different genes of interest or portions thereof. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function.
[0345] In an aspect, a disclosed gene of interest can comprise SNCA, LRRK2, RAB8, or RAB10. In an aspect, a disclosed gene of interest can comprise SNCA (UniProt ID: P37840), LRRK2 (UniProt ID: Q5S007), RAB8 (UniProt ID: P61026), RAB10 (UniProt ID: P61006) or any variant thereof, or any fragment thereof, or any portion thereof. In an aspect, a disclosed gene of interest can comprise the SNCA gene, any variant thereof, any fragment thereof, or any portion thereof. In an aspect, the disclosed gene of interest can comprise SNCA (UniProt ID: P37840).
[0346] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector comprises one or more neuron specific regulatory elements. In an aspect, the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter). In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, a derivative thereof, a fragment thereof, or any combination thereof.
[0347] In an aspect of a disclosed method, a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in
SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed F0XA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed F0XA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof. In an aspect, a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
[0348] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0349] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can be operably linked to the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In
an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0350] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0351] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0352] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion
protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a F0XA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0353] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise a dCas9 endonuclease. In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an aspect, a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
[0354] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
[0355] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can
comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
[0356] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof. In an aspect, a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
[0357] In an aspect of a disclosed method, a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10. In an aspect, a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof. In an aspect, a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
[0358] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. [0359] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise HPla, HP lb, MBD1, MBD2, Kriippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0360] In an aspect of a disclosed method, a disclosed fusion or disclosed fusion product can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb- KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBD1-
HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A- MeCP2. In an aspect of the disclosed method, a disclosed fusion or disclosed fusion product can comprise KRAB-MeCP2.
[0361] In an aspect of a disclosed methoda nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof. In an aspect, a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof. In an aspect, a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
[0362] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
[0363] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
In an aspect, the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
[0364] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
[0365] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
[0366] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ
ID NO: 42 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
[0367] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
[0368] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0369] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof. In an aspect, a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
[0370] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity. A disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain. In an aspect, a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
[0371] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed VP16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof. In an aspect, a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
[0372] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
[0373] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription repression activity. A disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity,
KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof. In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription release factor activity. A disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
[0374] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise histone modification activity. A disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
[0375] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise nucleic acid association activity. A disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof. In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise methyltransferase activity. A disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3 A).
[0376] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise demethylase activity. A disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1).
[0377] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise acetyltransferase activity. A disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise deacetylase activity. A disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
[0378] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
[0379] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0380] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB-MeCP2.
[0381] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2- MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2- HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2.
[0382] In an aspect of a disclosed method, an isolated nucleic acid or viral vector can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the isolated nucleic acid can encode for a “fusion protein” wherein the
fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0383] In an aspect, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB- KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB- MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1- MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2- DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2. In an aspect, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or
dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A.
[0384] In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
[0385] In an aspect of a disclosed method, a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same gene of interest or portion thereof. In an aspect, disclosed gRNAs can target different genes of interest or portions thereof. In an aspect of a disclosed method, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function. Disclosed target genes and disclosed genes of interest are discussed supra.
[0386] In an aspect of a disclosed method, a disclosed gRNA can target the SNCA gene. In an aspect, a disclosed SNCA gene cam comprise the sequence set forth in SEQ ID NO: 90. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl 1, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed
gRNA targeting the SNCA gene comprises any sequence set forth in any of SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
[0387] In an aspect of a disclosed method, a disclosed viral vector can further comprise a gRNA scaffold. In an aspect, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
[0388] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect, a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof. In an aspect, a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a promoter can be a short EFlalpha (EFS-NF) promoter. In an aspect, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
[0389] In an aspect of a disclosed method, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
[0390] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides
having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect, the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect, the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a F0XA2 promoter, a Ch AT promoter, or a Nkx2.1 promoter, a fragment thereof, a derivative thereof, or any combination thereof, and a second promoter comprising a U6 promoter.
[0391] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further comprise one or more additional regulatory elements. In an aspect, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
[0392] In an aspect of the disclosed method, a disclosed NLS can comprise the sequence set forth in any of 80- SEQ ID NO: 83 or a fragment thereof. In an aspect, a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof. In an aspect, a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
[0393] In an aspect of a disclosed method, a disclosed viral vector or isolated nucleic acid can comprise a nucleic acid that is CpG depleted and codon-optimized for expression in a human cell. In an aspect, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect, “CpG-free” can mean “CpG-depleted”. In an aspect, “CpG-depleted” can mean “CpG- free”. In an aspect, “CpG-depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art. In an aspect, any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon- optimized.
[0394] In an aspect of a disclosed method, a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
[0395] In an aspect of a disclosed method of effecting precision epigenetic modulation, modulating can comprise increasing expression and/or activity of one or more genes of interest.
In an aspect of a disclosed method of effecting precision epigenetic modulation, modulating can comprise decreasing expression and/or activity of one or more genes of interest.
[0396] In an aspect, a disclosed method of effecting precision epigenetic modulation can comprise reducing expression and/or activity of SNCA.
[0397] In an aspect, the disclosed cells can be neurons (e.g., cholinergic neurons, dopaminergic neurons, etc.). In an aspect, the disclosed cells can be cells affected by an overexpression level and/or activity level of one or more genes of interest or one or more target genes.
[0398] In an aspect, the disclosed cells can be in a subject. In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having a synucleinopathy (such as, for example, Parkinson’s disease or dementia with Lewy bodies (DLB)). In an aspect, a subject can be suspected of having or can be diagnosed with having Parkinson’s disease or dementia with Lewy bodies (DLB). In an aspect, a disclosed subject can be symptomatic or asymptomatic.
[0399] In an aspect, a disclosed method of effecting precision epigenetic modulation can comprise reducing the pathological phenotype associated with a synucleinopathy. In an aspect, reducing the pathological phenotype associated with a synucleinopathy can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies). In an aspect, a disclosed method can comprise diagnosing the subject with a synucleinopathy.
[0400] In an aspect, of a disclosed method of effecting precision epigenetic modulation can comprise reducing the pathological phenotype associated with Parkinson’s disease (PD) or dementia with Lewy bodies (DLB). In an aspect, reducing the pathological phenotype associated with Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies). In an aspect, a disclosed method can comprise diagnosing the subject with Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).
[0401] In an aspect of a disclosed method of effecting precision epigenetic modulation, by knowing what disease or disorder is affecting the subject, the skilled person can identify the relevant gene or genes. In an aspect, a subject can be a subject having a disease or disorder. In an aspect, a disease or disorder can be any disease or disorder disclosed herein, for example, characterized by an overexpression and/or over-activity or characterized by a loss of function.
[0402] In an aspect, a subject can be a subject in need of treatment of a disclosed disease or disorder (e.g., a genetic disease or disorder).
[0403] In an aspect, a disclosed method of effecting precision epigenetic modulation can restore the functionality and/or structural integrity of a missing, deficient, and/or mutant protein or
enzyme. In an aspect, a disclosed method of effecting precision epigenetic modulation can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation.
[0404] In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise reducing the expression and/or activity level of at least one gene of interest or at least one target gene. In an aspect, a gene of interest can be a gene that demonstrates over expression and/or over activity.
[0405] In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise increasing the expression and/or activity level of at least one gene of interest or at least one target gene. In an aspect, a gene of interest can be a gene that demonstrates a loss of function or reduced expression and/or activity level.
[0406] In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and/or ameliorating autophagy); (iii) improving, enhancing, restoring, and/or preserving mitochondrial functionality and/or structural integrity; (iv) improving, enhancing, restoring, and/or preserving organelle functionality and/or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of the multi -systemic manifestations of a genetic disease or disorder; (vii) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of a genetic disease or disorder, or (viii) any combination thereof.
[0407] In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and/or preserving one or more aspects of cellular structural and/or functional integrity.
[0408] In an aspect, restoring the activity and/or functionality of a missing, deficient, and/or mutant protein or enzyme can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of restoration when compared to a pre-existing level such as, for example, a pre-treatment level. In an aspect, the amount of restoration can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% more than a pre-existing level such as, for example, a pre-treatment level. In an aspect, restoration can be measured against a control level or a reference level (e.g., determined, for example, using one or more subjects not having a missing, deficient, and/or mutant protein or enzyme). In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration
such that the level of expression, activity, and/or functionality is like that of a wild-type or control level.
[0409] In an aspect, restoring the activity and/or functionality of a gene of interest can comprise increasing or enhancing the expression and/or activity level of that gene. In an aspect, increasing or enhancing can comprise an elevation of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level). In an aspect, restoring the activity and/or functionality of a gene of interest can comprise decreasing or reducing the expression and/or activity level of that gene. In an aspect, decreasing or reducing can comprise a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level).
[0410] In an aspect of a disclosed method of effecting precision epigenetic modulation, techniques to monitor, measure, and/or assess the restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are discussed supra.
[0411] In an aspect of a disclosed method of effecting precision epigenetic modulation, administering can comprise intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-ci sterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, intrahepatic administration, hepatic intra-arterial administration, hepatic portal vein (HPV) administration, or any combination thereof. In an aspect, a disclosed vector can be administered via LNP administration.
[0412] In an aspect of a disclosed method of effecting precision epigenetic modulation, administering can comprise use of non-viral vectors to deliver a disclosed isolated nucleic acid. These non-viral vectors can include, but are not limited to, nanoparticles or liposomes. Alternatively, the disclosed isolated nucleic acids may be delivered via viral vectors (such as the disclosed viral vectors provided herein). Exemplary viral vectors are described supra and include adenovirus, adeno-associated virus (AAV), and lentivirus (LV). Viral vectors are used more commonly due to their robust delivery, long-lasting expression, low immunogenicity and toxicity, and compatibility with the advanced manufacturing techniques. Most research in gene therapy has utilized AAV or LV due to their lowered immunogenicity compared to adenovirus. Derived from HIV, LV integrates its viral genome into the host gene to create permanent change in gene expression.
[0413] In an aspect, a disclosed method of effecting precision epigenetic modulation can employ multiple routes of administration to the subject. In an aspect, a disclosed method can employ a first route of administration that can be the same or different as a second and/or subsequent routes of administration. In an aspect, a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can be concurrently and/or serially administered to a subject via multiple routes of administration. For example, in an aspect, administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise intravenous administration and intra-cistem magna (ICM) administration. In an aspect, administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise IV administration and intrathecal (ITH) administration. [0414] In an aspect of a disclosed method of effecting precision epigenetic modulation, a therapeutically effective amount of disclosed vector can be delivered via intravenous (IV) administration and can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg to about 8 x 1013 vg/kg or about 1 x 1012 vg/kg to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 vg/kg to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x IO10 vg/kg, at least about 5 x IO10 vg/kg, at least about 1 x 1011 vg/kg, at least about 5 x 1011 vg/kg, at least about 1 x 1012 vg/kg, at least about 5 x 1012 vg/kg, at least about 1 x 1013 vg/kg, at least about 5 x 1013 vg/kg, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10 vg/kg, no more than about 5 x IO10 vg/kg, no more than about 1 x 1011 vg/kg, no more than about 5 x 1011 vg/kg, no more than about 1 x 1012 vg/kg, no more than about 5 x 1012 vg/kg, no more than about 1 x 1013 vg/kg, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
[0415] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise monitoring the subject for adverse effects. In an aspect, in the absence of adverse effects, the method can further comprise continuing to treat the subject. In an aspect, in the presence of adverse effects, the method can further comprise modifying the treating step. Methods of monitoring a subject’s well-being can include both subjective and objective criteria (and are discussed supra). Such methods are known to the skilled person.
[0416] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. A therapeutic agent can be any disclosed agent that effects a desired clinical outcome.
[0417] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering to the subject a therapeutically effective amount of an agent that can correct one or more aspects of a dysregulated metabolic or enzymatic pathway. In an aspect, such an agent can comprise an enzyme for enzyme replacement therapy. In an aspect, a disclosed enzyme can replace any enzyme in a dysregulated or dysfunctional metabolic or enzymatic pathway. In an aspect, a disclosed method can comprise replacing one or more enzymes in a dysregulated or dysfunctional metabolic pathway.
[0418] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more immune modulators. In an aspect, a disclosed immune modulator can be methotrexate, rituximab, intravenous gamma globulin, or bortezomib, or a combination thereof. In an aspect, a disclosed immune modulator can be bortezomib or SVP- Rapamycin. In an aspect, a disclosed immune modulator can be Tacrolimus. In an aspect, a disclosed immune modulator such as methotrexate can be administered at a transient low to high dose. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.1 mg/kg body weight to about 0.6 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.4 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for 3 to 5 or greater cycles, with up to three days per cycle. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for a minimum of 3 cycles, with three days per cycle. In an aspect, a person skilled in the art can determine the appropriate number of cycles. In an aspect, a disclosed immune modulator can be administered as many times as necessary to achieve a desired clinical effect.
[0419] In an aspect, a disclosed immune modulator can be administered orally about one hour before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered orally about one hour or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical
formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof.
[0420] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more proteasome inhibitors (e.g., bortezomib, carfilzomib, marizomib, ixazomib, and oprozomib). In an aspect, a proteasome inhibitor can be an agent that acts on plasma cells (e.g., daratumumab). In an aspect, an agent that acts on a plasma cell can be melphalan hydrochloride, melphalan, pamidronate disodium, carmustine, carfilzomib, carmustine, cyclophosphamide, daratumumab, doxorubicin hydrochloride liposome, doxorubicin hydrochloride liposome, elotuzumab, melphalan hydrochloride, panobinostat, ixazomib citrate, carfilzomib, lenalidomide, melphalan, melphalan hydrochloride, plerixafor, ixazomib citrate, pamidronate disodium, panobinostat, plerixafor, pomalidomide, pomalidomide, lenalidomide, selinexor, thalidomide, thalidomide, bortezomib, selinexor, zoledronic acid, or zoledronic acid.
[0421] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more proteasome inhibitors or agents that act on plasma cells prior to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells concurrently with administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells subsequent to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can further comprise administering one or more proteasome inhibitors more than 1 time. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors repeatedly over time.
[0422] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering one or more immunosuppressive agents. In an aspect, an immunosuppressive agent can be, but is not limited to, azathioprine, methotrexate, sirolimus, antithymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), steroids, or a combination thereof. In an aspect, a disclosed method can comprise administering one or more immunosuppressive agents more than 1 time. In an aspect, a disclosed method can comprise administering one or more one or more immunosuppressive agents repeatedly over time. In an aspect, a disclosed method can comprise administering a compound that targets or alters antigen presentation or humoral or cell mediated or innate immune responses.
[0423] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise administering a compound that exerts a therapeutic effect against B cells and/or a compound that targets or alters antigen presentation or humoral or cell mediated immune response. In an aspect, a disclosed compound can be rituximab, methotrexate, intravenous gamma globulin, anti CD4 antibody, anti CD2, an anti-FcRN antibody, a BTK inhibitor, an anti-IGFIR antibody, a CD 19 antibody (e.g., inebilizumab), an anti-IL6 antibody (e.g., tocilizumab), an antibody to CD40, an IL2 mutein, or a combination thereof. Also disclosed herein are Treg infusions that can be administered as a way to help with immune tolerance (e.g., antigen specific Treg cells to AAV). [0424] In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having a synucleinopathy (such as, for example, Parkinson’s disease (PD) and dementia with Lewy bodies (DLB)). In an aspect, a disclosed subject can be symptomatic or asymptomatic.
[0425] In an aspect, a disclosed method can comprise repeating one or more steps of the method and/or modifying one or more steps of the method (such as, for example, an administering step). [0426] In an aspect, a disclosed method of effecting precision epigenetic modulation can comprise modifying one or more of the disclosed steps. For example, modifying one or more of steps of a disclosed method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. For example, in an aspect, a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, or by changing the duration of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject.
[0427] In an aspect, a disclosed method of effecting precision epigenetic modulation can be altered by changing the amount of one or more disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject, or by changing the frequency of administration of one or more of the disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells
and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject.
[0428] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise generating and/or validating one or more of the disclosed isolated nucleic acid molecules, one or more of the disclosed vectors, one or more of the disclosed pharmaceutical formulations, or any combination thereof.
[0429] In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise contacting the cells with a second disclosed isolated nucleic acid molecule, a second disclosed vector, a second disclosed pharmaceutical formulations, or any combination thereof. In an aspect, a disclosed method of effecting precision epigenetic modulation can further comprise contacting the cells with additional disclosed isolated nucleic acid molecules, additional disclosed vectors, additional disclosed pharmaceutical formulations, or any combination thereof.
E. Methods of Treating and/or Preventing Synucleinopathies and Other SNCA Associated Diseases or Disorders
[0430] Disclosed herein is a method of treating and/or preventing progression of an SNCA associated disease or disorder, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, thereby reducing the pathological phenotype associated with the SNCA associated disease or disorder. Disclosed herein is a method of treating and/or preventing an SNCA associated disease or disorder. In an aspect, the method comprises administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with the SNCA associated disease or disorder.
[0431] Disclosed herein is a method of treating and/or preventing a synucleinopathy. In an aspect, the method comprises administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, thereby reducing the pathological phenotype associated with the synucleinopathy. Disclosed herein is a method of treating and/or preventing a synucleinopathy. In an aspect, the method comprises administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with the synucleinopathy.
[0432] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide
RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
[0433] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
[0434] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting an SNCA gene or portion thereof and b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the SNCA gene in the one or more neurons is modulated, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. In some aspects, the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO:
7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), derivative thereof, a fragment thereof, or any combination thereof.
[0435] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. In some aspects, the neuron specific promoter of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0436] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. In some aspects, the neuron specific regulatory element of (iv) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In some aspects, the promoter of (c) comprises a U6 promoter, a derivative thereof or a fragment thereof.
[0437] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a
lentiviral vector), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
[0438] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
[0439] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising ((a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
[0440] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i),
(a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
[0441] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder.
[0442] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to the (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to
a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to the (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. In an aspect, the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2.
[0443] Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. Disclosed herein is a method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding
(i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9,
(ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. In an aspect, the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a
NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2. In an aspect, the promoter of (c) comprises a U6 promoter, a derivative thereof, or a fragment thereof. [0444] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can reduce and/or decrease the expression and/or activity of SNCA. In an aspect of a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder, the expression and/or activity of SNCA is reduced and/or decreased. In an aspect, a disclosed method can comprise diagnosing the subject with synucleinopathy or other SNCA associated disease or disorder.
[0445] In an aspect, a disclosed method of treating and/or preventing synucleinopathy or other SNCA associated disease or disorder comprises measuring the level of expression and/or the level of activity of the SNCA gene. In an aspect, a disclosed method can comprise repeating the measuring step one or more times.
[0446] In an aspect, prior to the administering step, the expression and/or activity level of SNCA can be elevated and/or increased when compared to wild-type or control expression level. In an aspect, following the administering step, the expression and/or activity level of SNCA can be reduced and/or decreased when compared to the pre-administering step level. In an aspect, a disclosed gRNA targeting a portion of the SNCA gene can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same portion of the SNCA gene or different portions of the SNCA gene. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
[0447] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector comprises one or more neuron specific regulatory elements. In an aspect, the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter). In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, a derivative thereof, a fragment thereof, or any combination thereof.
[0448] In an aspect of a disclosed method, a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof. In an aspect, a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%,
at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
[0449] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0450] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can be operably linked to the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0451] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment
thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0452] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0453] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0454] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise a dCas9 endonuclease. In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an aspect, a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
[0455] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
[0456] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
[0457] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth
in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof. In an aspect, a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
[0458] In an aspect, a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10. In an aspect, a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof. In an aspect, a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
[0459] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. [0460] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0461] In an aspect of a disclosed method, a disclosed fusion or disclosed fusion product can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb- KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBD1- HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A- MeCP2. In an aspect of the disclosed method, a disclosed fusion or disclosed fusion product can comprise KRAB-MeCP2.
[0462] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof. In an aspect, a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof. In an aspect, a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
[0463] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed HP lb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP lb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
[0464] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
[0465] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof.
In an aspect, the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
[0466] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
[0467] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
[0468] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence
set forth in SEQ ID NO: 45, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
[0469] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0470] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof. In an aspect, a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
[0471] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity. A disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain. In an aspect, a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
[0472] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed VP 16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a
fragment thereof. In an aspect, a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof. In an aspect, a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
[0473] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
[0474] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription repression activity. A disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
[0475] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription release factor activity. A disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least
95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
[0476] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise histone modification activity. A disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
[0477] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise nucleic acid association activity. A disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
[0478] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise methyltransferase activity. A disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A). In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise demethylase activity. A disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1). In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise acetyltransferase activity. A disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise deacetylase activity. A disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
[0479] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2,
Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
[0480] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0481] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB-MeCP2.
[0482] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2- MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2- HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2.
[0483] In an aspect of a disclosed method, an isolated nucleic acid or viral vector can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any
fusion thereof. In an aspect, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0484] In an aspect, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB- KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB- MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1- MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2- DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2. In an aspect, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A.
[0485] In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control
expression level. In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
[0486] In an aspect of a disclosed method, a disclosed gRNA can target the SNCA gene. In an aspect, a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 90. In an aspect of a disclosed method, a disclosed gRNA targeting the SNCA gene can comprise at least two gRNAs. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
[0487] In an aspect of a disclosed method, a disclosed viral vector can further comprise a gRNA scaffold. In an aspect, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
[0488] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect, a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof In an aspect, a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a promoter can be a short EFlalpha (EFS-NF)
promoter. In an aspect, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
[0489] In an aspect of a disclosed method, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
[0490] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect, the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect, the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a FOXA2 promoter, a Ch AT promoter, or a Nkx2.1 promoter, a fragment thereof, a derivative thereof, or any combination thereof, and a second promoter comprising a U6 promoter.
[0491] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further comprise one or more additional regulatory elements. In an aspect, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
[0492] In an aspect of the disclosed method, a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80- SEQ ID NO: 83 or a fragment thereof. In an aspect, a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof. In an aspect, a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
[0493] In an aspect of a disclosed method, a disclosed viral vector or isolated nucleic acid can be CpG depleted and codon-optimized for expression in a human cell. In an aspect, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect, “CpG-free” can mean “CpG-depleted”. In an aspect, “CpG-depleted” can mean “CpG-free”. In an aspect, “CpG- depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art. In an aspect, any disclosed dCas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
[0494] In an aspect of a disclosed method, a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
[0495] In an aspect, a disclosed method can further comprise effecting precision epigenetic modulation of the SNCA gene or a portion of the SNCA gene. In an aspect, modulating can comprise decreasing and/or reducing expression and/or activity of the SNCA gene or a portion of the SNCA gene.
[0496] In an aspect, the disclosed cells can be neurons (e.g., cholinergic neurons, dopaminergic neurons, etc.). In an aspect, the disclosed cells can be cells affected by an overexpression level and/or activity level of the SNCA gene or a portion of the SNCA gene.
[0497] In an aspect, the disclosed cells can be in a subject. In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having synucleinopathy or other SNCA associated disease or disorder (e.g., Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)).
[0498] In an aspect, a disclosed method can comprise reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder. In an aspect, reducing the pathological phenotype associated with the synucleinopathy or other SNCA associated disease or disorder can comprise reducing the number and/or amount of alpha- synuclein aggregates (e.g., Lewy Bodies). In an aspect, a disclosed method can comprise diagnosing the subject with synucleinopathy or other SNCA associated disease or disorder.
[0499] In an aspect, a subject can be a subject in need of treatment of synucleinopathy or other SNCA associated disease or disorder. In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation.
[0500] In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene. In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and/or ameliorating autophagy); (iii) improving, enhancing, restoring, and/or preserving mitochondrial functionality and/or structural integrity; (iv) improving, enhancing, restoring, and/or preserving organelle functionality and/or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of the multi -systemic manifestations of a genetic disease or disorder; (vii) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of a genetic disease or disorder, or (viii) any combination thereof.
[0501] In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and/or preserving one or more aspects of cellular structural and/or functional integrity. In an aspect, restoring the activity and/or functionality of a missing, deficient, and/or mutant protein or enzyme can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of restoration when compared to a pre-existing level such as, for example, a pre-treatment level. In an aspect, the amount of restoration can be 10-20%, 20- 30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% more than a pre-existing level such as, for example, a pre-treatment level. In an aspect, restoration can be measured against a control level or a reference level (e.g., determined, for example, using one or more subjects not having a missing, deficient, and/or mutant protein or enzyme). In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and/or functionality is like that of a wildtype or control level.
[0502] In an aspect, restoring the activity and/or functionality of the SNCA gene or a portion of the SNCA gene can comprise decreasing or reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene. In an aspect, decreasing or reducing can comprise a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%,
97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level).
[0503] In an aspect of a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder, techniques to monitor, measure, and/or assess the restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are discussed supra.
[0504] In an aspect of a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder, administering can comprise intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-cistema magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, intrahepatic administration, hepatic intra-arterial administration, hepatic portal vein (HPV) administration, or any combination thereof. In an aspect, a disclosed vector can be administered via LNP administration.
[0505] In an aspect of a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder, administering can comprise use of non-viral vectors to deliver a disclosed isolated nucleic acid. These non-viral vectors can include, but are not limited to, nanoparticles or liposomes. Alternatively, the disclosed isolated nucleic acids may be delivered via viral vectors (such as the disclosed viral vectors provided herein). Exemplary viral vectors are described supra and include adenovirus, adeno-associated virus (AAV), and lentivirus (LV). Viral vectors are used more commonly due to their robust delivery, long-lasting expression, low immunogenicity and toxicity, and compatibility with the advanced manufacturing techniques. Most research in gene therapy has utilized AAV or LV due to their lowered immunogenicity compared to adenovirus. Derived from HIV, LV integrates its viral genome into the host gene to create permanent change in gene expression.
[0506] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can employ multiple routes of administration to the subject. In an aspect, a disclosed method can employ a first route of administration that can be the same or different as a second and/or subsequent routes of administration. In an aspect, a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can be concurrently and/or serially administered to a subject via multiple routes of administration. For example, in an aspect, administering a disclosed nucleic
acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise intravenous administration and intra-cistem magna (ICM) administration. In an aspect, administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise IV administration and intrathecal (ITH) administration. [0507] In an aspect of a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder, a therapeutically effective amount of disclosed vector can be delivered via intravenous (IV) administration and can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg to about 8 x 1013 vg/kg or about 1 x 1012 vg/kg to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 vg/kg to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x IO10 vg/kg, at least about 5 x IO10 vg/kg, at least about 1 x 1011 vg/kg, at least about 5 x 1011 vg/kg, at least about 1 x 1012 vg/kg, at least about 5 x 1012 vg/kg, at least about 1 x 1013 vg/kg, at least about 5 x 1013 vg/kg, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10 vg/kg, no more than about 5 x IO10 vg/kg, no more than about 1 x 1011 vg/kg, no more than about 5 x 1011 vg/kg, no more than about 1 x 1012 vg/kg, no more than about 5 x 1012 vg/kg, no more than about 1 x 1013 vg/kg, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
[0508] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise monitoring the subject for adverse effects. In an aspect, in the absence of adverse effects, the method can further comprise continuing to treat the subject. In an aspect, in the presence of adverse effects, the method can further comprise modifying the treating step. Methods of monitoring a subject’s well-being can include both subjective and objective criteria (and are discussed supra). Such methods are known to the skilled person.
[0509] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. A therapeutic agent can be any disclosed agent that effects a desired clinical outcome.
[0510] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject a therapeutically effective amount of an agent that can correct one or more aspects of a dysregulated metabolic or enzymatic pathway. In an aspect, such an agent can comprise an enzyme for enzyme replacement therapy. In an aspect, a disclosed enzyme can replace any enzyme in a dysregulated or dysfunctional metabolic or enzymatic pathway. In an aspect, a disclosed method can comprise replacing one or more enzymes in a dysregulated or dysfunctional metabolic pathway.
[0511] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more immune modulators. In an aspect, a disclosed immune modulator can be methotrexate, rituximab, intravenous gamma globulin, or bortezomib, or a combination thereof. In an aspect, a disclosed immune modulator can be bortezomib or SVP-Rapamycin. In an aspect, a disclosed immune modulator can be Tacrolimus. In an aspect, a disclosed immune modulator such as methotrexate can be administered at a transient low to high dose. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.1 mg/kg body weight to about 0.6 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.4 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for 3 to 5 or greater cycles, with up to three days per cycle. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for a minimum of 3 cycles, with three days per cycle. In an aspect, a person skilled in the art can determine the appropriate number of cycles. In an aspect, a disclosed immune modulator can be administered as many times as necessary to achieve a desired clinical effect.
[0512] In an aspect, a disclosed immune modulator can be administered orally about one hour before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered orally about one hour or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be
administered concurrently with a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof.
[0513] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more proteasome inhibitors (e.g., bortezomib, carfilzomib, marizomib, ixazomib, and oprozomib). In an aspect, a proteasome inhibitor can be an agent that acts on plasma cells (e.g., daratumumab). In an aspect, an agent that acts on a plasma cell can be melphalan hydrochloride, melphalan, pamidronate disodium, carmustine, carfilzomib, carmustine, cyclophosphamide, daratumumab, doxorubicin hydrochloride liposome, doxorubicin hydrochloride liposome, elotuzumab, melphalan hydrochloride, panobinostat, ixazomib citrate, carfilzomib, lenalidomide, melphalan, melphalan hydrochloride, plerixafor, ixazomib citrate, pamidronate disodium, panobinostat, plerixafor, pomalidomide, pomalidomide, lenalidomide, selinexor, thalidomide, thalidomide, bortezomib, selinexor, zoledronic acid, or zoledronic acid.
[0514] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more proteasome inhibitors or agents that act on plasma cells prior to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells concurrently with administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells subsequent to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can further comprise administering one or more proteasome inhibitors more than 1 time. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors repeatedly over time.
[0515] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering one or more immunosuppressive agents. In an aspect, an immunosuppressive agent can be, but is not limited to, azathioprine, methotrexate, sirolimus, anti-thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), steroids, or a combination thereof. In an aspect, a disclosed method can comprise administering one or more immunosuppressive agents more than 1 time. In an aspect, a disclosed method can comprise administering one or more one or more immunosuppressive agents repeatedly over time. In an aspect, a disclosed method can
comprise administering a compound that targets or alters antigen presentation or humoral or cell mediated or innate immune responses.
[0516] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering a compound that exerts a therapeutic effect against B cells and/or a compound that targets or alters antigen presentation or humoral or cell mediated immune response. In an aspect, a disclosed compound can be rituximab, methotrexate, intravenous gamma globulin, anti CD4 antibody, anti CD2, an anti-FcRN antibody, a BTK inhibitor, an anti-IGFIR antibody, a CD 19 antibody (e.g., inebilizumab), an anti-IL6 antibody (e.g., tocilizumab), an antibody to CD40, an IL2 mutein, or a combination thereof. Also disclosed herein are Treg infusions that can be administered as a way to help with immune tolerance (e.g., antigen specific Treg cells to AAV).
[0517] In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having synucleinopathy or other SNCA associated disease or disorder (such as, for example, Parkinson’s disease (PD) or dementia with Lewy bodies (DLB)). In an aspect, a disclosed subject can be symptomatic or asymptomatic.
[0518] In an aspect, a disclosed method can comprise repeating one or more steps of the method and/or modifying one or more steps of the method (such as, for example, an administering step). [0519] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can comprise modifying one or more of the disclosed steps. For example, modifying one or more of steps of a disclosed method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. For example, in an aspect, a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, or by changing the duration of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject.
[0520] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can be altered by changing the amount of one or more disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen
presentation or humoral or cell mediated immune response administered to a subject, or by changing the frequency of administration of one or more of the disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject.
[0521] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise generating and/or validating one or more of the disclosed isolated nucleic acid molecules, one or more of the disclosed vectors, one or more of the disclosed pharmaceutical formulations, or any combination thereof.
[0522] In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject a second disclosed isolated nucleic acid molecule, a second disclosed vector, a second disclosed pharmaceutical formulations, or any combination thereof. In an aspect, a disclosed method of treating and/or preventing progression of a synucleinopathy or other SNCA associated disease or disorder can further comprise administering to the subject additional disclosed isolated nucleic acid molecules, additional disclosed vectors, additional disclosed pharmaceutical formulations, or any combination thereof.
F. Methods of Treating and/or Preventing Parkinson’s disease (PD) Progression
[0523] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0524] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a
nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0525] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0526] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting an SNCA gene or portion thereof and b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the SNCA gene in the one or more neurons is modulated, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). In some aspects, the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0527] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA
gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). In some aspects, the neuron specific promoter of (b) may comprise TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g, SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0528] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). In some aspects, the neuron specific regulatory element of (iv) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In some aspects, the promoter of (c) comprises a U6 promoter, a derivative thereof or a fragment thereof.
[0529] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0530] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), comprising (a) a nucleic acid sequence
encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0531] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising ((a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0532] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0533] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb,
MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with Parkinson’s disease (PD).
[0534] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to the (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to the (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). In an aspect, the neuron specific regulatory element or neuron specific promoter of (b) can comprise TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2.
[0535] Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to
(a)(iii), thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). Disclosed herein is a method of treating and/or preventing Parkinson’s disease (PD) progression in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with Parkinson’s disease (PD). In an aspect, the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (c.g, SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2. In an aspect, the promoter of (c) comprises a U6 promoter, a derivative thereof, or a fragment thereof. [0536] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can reduce and/or decrease the expression and/or activity of SNCA. In an aspect of a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression, the expression and/or activity of SNCA is reduced and/or decreased. In an aspect, a disclosed method can comprise diagnosing the subject with Parkinson’s disease (PD).
[0537] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) comprises measuring the level of expression and/or the level of activity of the SNCA gene. In an aspect, a disclosed method can comprise repeating the measuring step one or more times.
[0538] In an aspect, prior to the administering step, the expression and/or activity level of SNCA can be elevated and/or increased when compared to wild-type or control expression level. In an aspect, following the administering step, the expression and/or activity level of SNCA can be reduced and/or decreased when compared to the pre-administering step level. In an aspect, a disclosed gRNA targeting a portion of the SNCA gene can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same portion of the SNCA gene or different portions of the SNCA gene. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island
region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGll, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof. [0539] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector comprises one or more neuron specific regulatory elements. In an aspect, the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter). In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, a derivative thereof, a fragment thereof, or any combination thereof.
[0540] In an aspect of a disclosed method, a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed FOXA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence
set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof. In an aspect, a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
[0541] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0542] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can be operably linked to the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0543] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0544] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0545] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or
more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0546] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise a dCas9 endonuclease. In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an aspect, a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
[0547] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
[0548] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least
65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
[0549] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof. In an aspect, a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
[0550] In an aspect, a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10. In an aspect, a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof. In an aspect, a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
[0551] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. [0552] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Krtippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0553] In an aspect of a disclosed method, a disclosed fusion or disclosed fusion product can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb- KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBD1- HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1,
MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A- MeCP2. In an aspect of the disclosed method, a disclosed fusion or disclosed fusion product can comprise KRAB-MeCP2.
[0554] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof. In an aspect, a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof. In an aspect, a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
[0555] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
[0556] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least
95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
[0557] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
[0558] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
[0559] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 42 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least
85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
[0560] In an aspect of a disclosed methods, a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
[0561] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0562] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof. In an aspect, a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
[0563] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity. A disclosed encoded polypeptide comprising transcription
activation activity can comprise a transactivation domain. In an aspect, a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
[0564] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed VP 16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof. In an aspect, a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
[0565] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
[0566] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription repression activity. A disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF
insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
[0567] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription release factor activity. A disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity. In an aspect, a disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 71 or a fragment thereof. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
[0568] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise histone modification activity. A disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
[0569] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise nucleic acid association activity. A disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
[0570] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise methyltransferase activity. A disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A). In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise demethylase activity. A disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1). In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise acetyltransferase activity. A disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In an aspect of a disclosed method, a disclosed encoded
polypeptide can comprise deacetylase activity. A disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
[0571] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
[0572] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0573] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB-MeCP2.
[0574] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2- MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2- HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2.
[0575] In an aspect of a disclosed method, an isolated nucleic acid or viral vector can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0576] In an aspect, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB- KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB- MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1- MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2- DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2. In an aspect, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and
a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3 A.
[0577] In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
[0578] In an aspect of a disclosed method, a disclosed gRNA can target the SNCA gene. In an aspect, a disclosed SNCA gene cam comprise the sequence set forth in SEQ ID NO: 90. In an aspect of a disclosed method, a disclosed gRNA targeting the SNCA gene can comprise at least two gRNAs. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
[0579] In an aspect of a disclosed method, a disclosed viral vector can further comprise a gRNA scaffold. In an aspect, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
[0580] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect, a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof. In an aspect, a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a promoter can be a short EFlalpha (EFS-NF) promoter. In an aspect, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
[0581] In an aspect of a disclosed method, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
[0582] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect,
the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect, the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a F0XA2 promoter, a Ch AT promoter, or a Nkx2.1 promoter, a fragment thereof, a derivative thereof, or any combination thereof, and a second promoter comprising a U6 promoter.
[0583] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further comprise one or more additional regulatory elements. In an aspect, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
[0584] In an aspect of the disclosed method, a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80 - SEQ ID NO: 83 or a fragment thereof. In an aspect, a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof. In an aspect, a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
[0585] In an aspect of a disclosed method, a disclosed viral vector or isolated nucleic acid can be CpG depleted and codon-optimized for expression in a human cell. In an aspect, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect, “CpG-free” can mean “CpG-depleted”. In an aspect, “CpG-depleted” can mean “CpG-free”. In an aspect, “CpG- depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art. In an aspect, any disclosed dCas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
[0586] In an aspect of a disclosed method, a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
[0587] In an aspect, a disclosed method can further comprise effecting precision epigenetic modulation of the SNCA gene or a portion of the SNCA gene. In an aspect, modulating can comprise decreasing and/or reducing expression and/or activity of the SNCA gene or a portion of the SNCA gene.
[0588] In an aspect, the disclosed cells can be neurons (e.g., cholinergic neurons, dopaminergic neurons, etc.). In an aspect, the disclosed cells can be cells affected by an overexpression level and/or activity level of the SNCA gene or a portion of the SNCA gene.
[0589] In an aspect, the disclosed cells can be in a subject. In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having Parkinson’s disease (PD).
[0590] In an aspect, a disclosed method can comprise reducing the pathological phenotype associated with Parkinson’s disease (PD). In an aspect, reducing the pathological phenotype associated with Parkinson’s disease (PD) can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies). In an aspect, reducing the pathological phenotype associated with Parkinson’s disease (PD) can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies) in dopaminergic neurons. In an aspect, a disclosed method can comprise diagnosing the subject with Parkinson’s disease (PD).
[0591] In an aspect, a subject can be a subject in need of treatment of Parkinson’s disease (PD). In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation.
[0592] In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene. In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and/or ameliorating autophagy); (iii) improving, enhancing, restoring, and/or preserving mitochondrial functionality and/or structural integrity; (iv) improving, enhancing, restoring, and/or preserving organelle functionality and/or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of the multi -systemic manifestations of a genetic disease or disorder; (vii) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of a genetic disease or disorder, or (viii) any combination thereof.
[0593] In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and/or preserving one or more aspects of cellular structural and/or functional integrity. In an aspect, restoring the activity and/or functionality of a missing, deficient, and/or mutant protein or enzyme can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of restoration when compared to a pre-existing level such
as, for example, a pre-treatment level. In an aspect, the amount of restoration can be 10-20%, 20- 30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% more than a pre-existing level such as, for example, a pre-treatment level. In an aspect, restoration can be measured against a control level or a reference level (e.g., determined, for example, using one or more subjects not having a missing, deficient, and/or mutant protein or enzyme). In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and/or functionality is like that of a wildtype or control level.
[0594] In an aspect, restoring the activity and/or functionality of the SNCA gene or a portion of the SNCA gene can comprise decreasing or reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene. In an aspect, decreasing or reducing can comprise a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level).
[0595] In an aspect of a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression, techniques to monitor, measure, and/or assess the restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are discussed supra.
[0596] In an aspect of a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression, administering can comprise intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-ci sterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, intrahepatic administration, hepatic intraarterial administration, hepatic portal vein (HPV) administration, or any combination thereof. In an aspect, a disclosed vector can be administered via LNP administration.
[0597] In an aspect of a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression, administering can comprise use of non-viral vectors to deliver a disclosed isolated nucleic acid. These non-viral vectors can include, but are not limited to, nanoparticles or liposomes. Alternatively, the disclosed isolated nucleic acids may be delivered via viral vectors (such as the disclosed viral vectors provided herein). Exemplary viral vectors are described supra and include adenovirus, adeno-associated virus (AAV), and lentivirus (LV). Viral vectors are used more commonly due to their robust delivery, long-lasting expression, low immunogenicity and
toxicity, and compatibility with the advanced manufacturing techniques. Most research in gene therapy has utilized AAV or LV due to their lowered immunogenicity compared to adenovirus. Derived from HIV, LV integrates its viral genome into the host gene to create permanent change in gene expression.
[0598] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can employ multiple routes of administration to the subject. In an aspect, a disclosed method can employ a first route of administration that can be the same or different as a second and/or subsequent routes of administration. In an aspect, a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can be concurrently and/or serially administered to a subject via multiple routes of administration. For example, in an aspect, administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise intravenous administration and intra-cistem magna (ICM) administration. In an aspect, administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise IV administration and intrathecal (ITH) administration.
[0599] In an aspect of a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression, a therapeutically effective amount of disclosed vector can be delivered via intravenous (IV) administration and can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg to about 8 x 1013 vg/kg or about 1 x 1012 vg/kg to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 vg/kg to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x IO10 vg/kg, at least about 5 x IO10 vg/kg, at least about 1 x 1011 vg/kg, at least about 5 x 1011 vg/kg, at least about 1 x 1012 vg/kg, at least about 5 x 1012 vg/kg, at least about 1 x 1013 vg/kg, at least about 5 x 1013 vg/kg, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10 vg/kg, no more than about 5 x IO10 vg/kg, no more than about 1 x 1011 vg/kg, no more than about 5 x 1011 vg/kg, no more than about 1 x 1012 vg/kg, no more than about 5 x 1012 vg/kg, no more than about 1 x 1013 vg/kg, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
[0600] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise monitoring the subject for adverse effects. In an aspect, in the
absence of adverse effects, the method can further comprise continuing to treat the subject. In an aspect, in the presence of adverse effects, the method can further comprise modifying the treating step. Methods of monitoring a subject’s well-being can include both subjective and objective criteria (and are discussed supra). Such methods are known to the skilled person.
[0601] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. A therapeutic agent can be any disclosed agent that effects a desired clinical outcome.
[0602] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering to the subject a therapeutically effective amount of an agent that can correct one or more aspects of a dysregulated metabolic or enzymatic pathway. In an aspect, such an agent can comprise an enzyme for enzyme replacement therapy. In an aspect, a disclosed enzyme can replace any enzyme in a dysregulated or dysfunctional metabolic or enzymatic pathway. In an aspect, a disclosed method can comprise replacing one or more enzymes in a dysregulated or dysfunctional metabolic pathway.
[0603] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering one or more immune modulators. In an aspect, a disclosed immune modulator can be methotrexate, rituximab, intravenous gamma globulin, or bortezomib, or a combination thereof. In an aspect, a disclosed immune modulator can be bortezomib or SVP-Rapamycin. In an aspect, a disclosed immune modulator can be Tacrolimus. In an aspect, a disclosed immune modulator such as methotrexate can be administered at a transient low to high dose. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.1 mg/kg body weight to about 0.6 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.4 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for 3 to 5 or greater cycles, with up to three days per cycle. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for a minimum of 3 cycles, with three days per cycle. In an aspect, a person skilled in the art can determine the appropriate number of cycles. In an aspect, a disclosed immune modulator can be administered as many times as necessary to achieve a desired clinical effect.
[0604] In an aspect, a disclosed immune modulator can be administered orally about one hour before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed therapeutic
agent. In an aspect, a disclosed immune modulator can be administered orally about one hour or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof.
[0605] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering one or more proteasome inhibitors e.g., bortezomib, carfilzomib, marizomib, ixazomib, and oprozomib). In an aspect, a proteasome inhibitor can be an agent that acts on plasma cells (e.g., daratumumab). In an aspect, an agent that acts on a plasma cell can be melphalan hydrochloride, melphalan, pamidronate disodium, carmustine, carfilzomib, carmustine, cyclophosphamide, daratumumab, doxorubicin hydrochloride liposome, doxorubicin hydrochloride liposome, elotuzumab, melphalan hydrochloride, panobinostat, ixazomib citrate, carfilzomib, lenalidomide, melphalan, melphalan hydrochloride, plerixafor, ixazomib citrate, pamidronate disodium, panobinostat, plerixafor, pomalidomide, pomalidomide, lenalidomide, selinexor, thalidomide, thalidomide, bortezomib, selinexor, zoledronic acid, or zoledronic acid.
[0606] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering one or more proteasome inhibitors or agents that act on plasma cells prior to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells concurrently with administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells subsequent to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can further comprise administering one or more proteasome inhibitors more than 1 time. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors repeatedly over time.
[0607] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering one or more immunosuppressive agents. In an aspect, an immunosuppressive agent can be, but is not limited to, azathioprine, methotrexate,
sirolimus, anti-thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), steroids, or a combination thereof. In an aspect, a disclosed method can comprise administering one or more immunosuppressive agents more than 1 time. In an aspect, a disclosed method can comprise administering one or more one or more immunosuppressive agents repeatedly over time. In an aspect, a disclosed method can comprise administering a compound that targets or alters antigen presentation or humoral or cell mediated or innate immune responses.
[0608] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering a compound that exerts a therapeutic effect against B cells and/or a compound that targets or alters antigen presentation or humoral or cell mediated immune response. In an aspect, a disclosed compound can be rituximab, methotrexate, intravenous gamma globulin, anti CD4 antibody, anti CD2, an anti-FcRN antibody, a BTK inhibitor, an anti -IGF 1R antibody, a CD 19 antibody (e.g., inebilizumab), an anti-IL6 antibody (e.g., tocilizumab), an antibody to CD40, an IL2 mutein, or a combination thereof. Also disclosed herein are Treg infusions that can be administered as a way to help with immune tolerance (e.g., antigen specific Treg cells to AAV).
[0609] In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having Parkinson’s disease (PD). In an aspect, a disclosed subject can be symptomatic or asymptomatic.
[0610] In an aspect, a disclosed method can comprise repeating one or more steps of the method and/or modifying one or more steps of the method (such as, for example, an administering step).
[0611] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can comprise modifying one or more of the disclosed steps. For example, modifying one or more of steps of a disclosed method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. For example, in an aspect, a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, or by changing the duration of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject.
[0612] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can be altered by changing the amount of one or more disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive
agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject, or by changing the frequency of administration of one or more of the disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject.
[0613] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise generating and/or validating one or more of the disclosed isolated nucleic acid molecules, one or more of the disclosed vectors, one or more of the disclosed pharmaceutical formulations, or any combination thereof.
[0614] In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering to the subject a second disclosed isolated nucleic acid molecule, a second disclosed vector, a second disclosed pharmaceutical formulations, or any combination thereof. In an aspect, a disclosed method of treating and/or preventing Parkinson’s disease (PD) progression can further comprise administering to the subject additional disclosed isolated nucleic acid molecules, additional disclosed vectors, additional disclosed pharmaceutical formulations, or any combination thereof.
G. Methods of Treating and/or Preventing Progression of Dementia with Lewy Bodies (DLB)
[0615] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0616] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed isolated nucleic acid
molecule, comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0617] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0618] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting an SNCA gene or portion thereof and b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, wherein the expression and/or activity the SNCA gene in the one or more neurons is modulated, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). In some aspects, the neuron specific regulatory element of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0619] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of
the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). In some aspects, the neuron specific promoter of (b) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof.
[0620] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of an isolated nucleic acid molecule, comprising: (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HP la, HP lb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). In some aspects, the neuron specific regulatory element of (iv) may comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter (e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In some aspects, the promoter of (c) comprises a U6 promoter, a derivative thereof or a fragment thereof.
[0621] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0622] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a disclosed viral vector (e.g., a lentiviral vector), comprising
(a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a SNCA gene or portion thereof and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii),
(a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0623] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising ((a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and
(b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0624] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) a fusion product having one or more enzymatic activities, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or a combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0625] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding
(i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9,
(ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or
dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3 A, (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, and (b) at least one neuron specific promoter operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof, thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB).
[0626] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding
(i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9,
(ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to the (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to the (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). In an aspect, the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2.
[0627] Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding
(i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9,
(ii) a fusion product having one or more enzymatic activities, wherein the fusion product
comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific regulatory element operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). Disclosed herein is a method of treating and/or preventing progression of dementia with Lewy bodies (DLB) in a subject, the method comprising administering to a subject a therapeutically effective amount of a viral vector comprising (a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, wherein the dCas is a dSpCas9, dSaCas9, or dCjCas9, (ii) a fusion product having one or more enzymatic activities, wherein the fusion product comprises any combination of HPla, HPlb, MBD1, MBD2, KRAB, NIPP1, MeCP2, or DNMT3A, and (iii) at least one guide RNA targeting the SNCA gene or a portion of the SNCA gene, (b) a neuron specific promoter operably linked to (a)(i) and/or (a)(ii), and (c) a promoter operably linked to (a)(iii), thereby reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). In an aspect, the neuron specific regulatory element or neuron specific promoter of (b) can comprise a TH promoter (e.g., SEQ ID NO: 5), a FoxA2 promoter e.g., SEQ ID NO: 6), a ChAT promoter (e.g., SEQ ID NO: 7), a NKX2.1 promoter (e.g., SEQ ID NO: 8), a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, the fusion product of (a)(ii) can comprise KRAB-MeCP2. In an aspect, the promoter of (c) comprises a U6 promoter, a derivative thereof, or a fragment thereof.
[0628] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can reduce and/or decrease the expression and/or activity of SNCA. In an aspect of a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB), the expression and/or activity of SNCA is reduced and/or decreased. In an aspect, a disclosed method can comprise diagnosing the subject with dementia with Lewy bodies (DLB). [0629] In an aspect, a disclosed method of treating and/or preventing dementia with Lewy bodies (DLB) comprises measuring the level of expression and/or the level of activity of the SNCA gene. In an aspect, a disclosed method can comprise repeating the measuring step one or more times.
[0630] In an aspect, prior to the administering step, the expression and/or activity level of SNCA can be elevated and/or increased when compared to wild-type or control expression level. In an aspect, following the administering step, the expression and/or activity level of SNCA can be reduced and/or decreased when compared to the pre-administering step level. In an aspect, a disclosed gRNA targeting a portion of the SNCA gene can comprise at least two gRNAs. In an aspect, disclosed gRNAs can target the same portion of the SNCA gene or different portions of the SNCA gene. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an
aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof. [0631] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector comprises one or more neuron specific regulatory elements. In an aspect, the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wildtype promoter or a neuron specific synthetic promoter). In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and/or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a derivative thereof, a fragment thereof, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, a derivative thereof, a fragment thereof, or any combination thereof.
[0632] In an aspect of a disclosed method, a disclosed TH promoter can comprise the sequence set forth in SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed TH promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in
SEQ ID NO: 5 or a fragment thereof. In an aspect, a disclosed F0XA2 promoter can comprise the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed F0XA2 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed ChAT promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise the sequence set forth in SEQ ID NO: 8 or a fragment thereof. In an aspect, a disclosed Nkx2. 1 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 8 or a fragment thereof.
[0633] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0634] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease can be operably linked to the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In
an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0635] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the at dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the at least one polypeptide having enzymatic activity can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0636] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a FOXA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0637] In an aspect of a disclosed method, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion
protein having one or more enzymatic activities can comprise a TH promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a F0XA2 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a ChAT promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed neuron specific regulatory element i.e., a neuron specific promoter) operably linked to the dCas endonuclease and the fusion protein having one or more enzymatic activities can comprise a Nkx2.1 promoter, a derivative thereof, or a fragment thereof.
[0638] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise a dCas9 endonuclease. In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an aspect, a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCa9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.
[0639] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO: 9 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 10, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 10, or a fragment thereof.
[0640] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 11, SEQ ID NO: 12, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can
comprise the amino acid sequence as set forth in SEQ ID NO: 13, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.
[0641] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 14, SEQ ID NO: 15, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 14, SEQ ID NO: 15, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 16, or a fragment, or a derivative thereof. In an aspect, a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof.
[0642] In an aspect, a disclosed dVQR can comprise DI 135V, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dEQR can comprise DI 135E, R1335Q, and T1337R according to SEQ ID NO: 10. In an aspect, a disclosed dVRER can comprise DI 135V, G1218R, R1335E, and T1337R according to SEQ ID NO: 10. In an aspect, a nucleic acid sequence encoding a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 17, or a fragment thereof. In an aspect, a disclosed dVRER can comprise a sequence set forth in SEQ ID NO: 18, or a fragment thereof.
[0643] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. [0644] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise HP la, HP lb, MBD1, MBD2, Kriippel-Associated Box (KRAB), NIPP1, the Transcription Repression Domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0645] In an aspect of a disclosed method, a disclosed fusion or disclosed fusion product can comprise HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb- KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBD1-
HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A- MeCP2. In an aspect of the disclosed method, a disclosed fusion or disclosed fusion product can comprise KRAB-MeCP2.
[0646] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed HP la may comprise a sequence as set forth in any one of SEQ ID NO: 19, SEQ ID NO: 20, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP la endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, or a fragment thereof. In an aspect, a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment, or a derivative thereof. In an aspect, a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 21, SEQ ID NO: 22, or a fragment thereof.
[0647] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed HPlb can comprise the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HPlb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 23, SEQ ID NO: 24, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence as set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof. In an aspect, a disclosed encoded HPlb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 25, SEQ ID NO: 26, or a fragment thereof.
[0648] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD1 can comprise the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof.
In an aspect, the sequence encoding the disclosed MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 27, SEQ ID NO: 28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof. In an aspect, a disclosed encoded MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or a fragment thereof.
[0649] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed MBD2 can comprise the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 32, SEQ ID NO: 33, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence set forth SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof. In an aspect, a disclosed encoded MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 34, SEQ ID NO: 35, or a fragment thereof.
[0650] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 36, SEQ ID NO: 37, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 38, SEQ ID NO: 39 or a fragment thereof.
[0651] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 40, SEQ ID NO: 41, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ
ID NO: 42 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 42, or a fragment thereof.
[0652] In an aspect of a disclosed methods, a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 45, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 45, or a fragment thereof.
[0653] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed KRAB- MeCP2 can comprise the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 46, SEQ ID NO: 47, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 48, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
[0654] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 49, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO: 50, or a fragment thereof. In an aspect, a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 50, or a fragment thereof.
[0655] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription activation activity. A disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain. In an aspect, a disclosed transactivation domain can comprise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.
[0656] In an aspect of a disclosed method, a nucleic acid sequence encoding the disclosed VP 16 can comprise the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VP 16 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 51, SEQ ID NO: 52, or a fragment thereof. In an aspect, a disclosed encoded VP 16 can comprise an amino acid sequence set forth in SEQ ID NO: 70 or a fragment thereof. In an aspect, a disclosed encoded VP16 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 53, or a fragment thereof.
[0657] In an aspect of a disclosed methoda nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed p65 domain of NFKB or RELA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 54, SEQ ID NO: 55, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence set forth in SEQ ID NO: 56, or a fragment thereof. In an aspect, a disclosed encoded p65 domain of NFKB or RELA can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 56, or a fragment thereof.
[0658] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription repression activity. A disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity,
KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.
[0659] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise transcription release factor activity. A disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release Factor 1 (ERF1) activity or Eukaryotic Release Factor 3 (ERF3) activity. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a nucleic acid sequence encoding the disclosed ERF1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 57, or a fragment thereof. In an aspect, a disclosed encoded ERF1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 58, or a fragment thereof.
[0660] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise histone modification activity. A disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.
[0661] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise nucleic acid association activity. A disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, a HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof.
[0662] In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise methyltransferase activity. A disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-methyltransferase 3a (DNMT3A). In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise demethylase activity. A disclosed encoded polypeptide comprising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1). In an aspect of a disclosed method, a disclosed encoded polypeptide can comprise acetyltransferase activity. A disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In an aspect of a disclosed method, a disclosed encoded
polypeptide can comprise deacetylase activity. A disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase.
[0663] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.
[0664] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0665] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed encoded polypeptide can comprise KRAB-MeCP2.
[0666] In an aspect of a disclosed method, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HPla-HPla, HPla-HPlb, HPla- MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP1 a-DNMT3 A, HP Ib-HP lb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2- MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2- HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2.
[0667] In an aspect of a disclosed method, an isolated nucleic acid or viral vector can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the isolated nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first component comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
[0668] In an aspect, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HP 1 a-MBD 1 , HP 1 a-MBD2, HP 1 a-KRAB, HP 1 a-NIPP 1 , HP 1 a-MeCP2, HP 1 a-DNMT3 A, HP 1b- HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB- KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB- MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1- MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2- DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3 A-KRAB, DNMT3A-NIPP1, or DNMT3 A-MeCP2. In an aspect, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and
a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3A.
[0669] In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed method, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level.
[0670] In an aspect of a disclosed method, a disclosed gRNA can target the SNCA gene. In an aspect, a disclosed SNCA gene cam comprise the sequence set forth in SEQ ID NO: 90. In an aspect of a disclosed method, a disclosed gRNA targeting the SNCA gene can comprise at least two gRNAs. In an aspect, a disclosed gRNA can target the promoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpGl 8, CpGl 9, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target any one sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71 or a sequence at least 90% identical thereto. In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in SEQ ID NO: 59 to SEQ ID NO: 71, a sequence at least 90% identical thereto, or a complement thereof.
[0671] In an aspect of a disclosed method, a disclosed viral vector can further comprise a gRNA scaffold. In an aspect, a disclosed gRNA scaffold can comprise the sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73, or a fragment thereof.
[0672] In an aspect of a disclosed method, a disclosed isolated nucleic acid or disclosed viral vector can further comprise one or more regulatory elements (z.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect, a disclosed additional promoter can comprise a U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter/enhancer, a fragment thereof, or any combination thereof. In an aspect, a disclosed EF-la promoter can comprise the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a disclosed EF-la promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 87, SEQ ID NO: 88, or a fragment thereof. In an aspect, a promoter can be a short EFlalpha (EFS-NF) promoter. In an aspect, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO: 89 or a fragment thereof. In an aspect, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 89 or a fragment thereof.
[0673] In an aspect of a disclosed method, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a derivative thereof, or a fragment thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a derivative thereof, or a fragment thereof.
[0674] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed isolated nucleic acid molecule can further comprise one or more promoters, wherein a first promoter comprises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect,
the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect, the isolated nucleic acid can comprise a first promoter selected from a TH promoter, a F0XA2 promoter, a Ch AT promoter, or a Nkx2.1 promoter, a fragment thereof, a derivative thereof, or any combination thereof, and a second promoter comprising a U6 promoter.
[0675] In an aspect of the disclosed method, a disclosed isolated nucleic acid molecule or viral vector can further comprise one or more additional regulatory elements. In an aspect, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter/enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and/or NF-kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’-LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.
[0676] In an aspect of the disclosed method, a disclosed NLS can comprise the sequence set forth in any of SEQ ID NOs: 80- SEQ ID NO: 83 or a fragment thereof. In an aspect, a disclosed PolyA sequence can comprise the sequence set forth in SEQ ID NO: 78, SEQ ID NO: 79, or a fragment thereof. In an aspect, a disclosed ITR can comprise the sequence set forth in any of SEQ ID NO: 74 - SEQ ID NO: 77 or a fragment thereof.
[0677] In an aspect of a disclosed method, a disclosed viral vector or isolated nucleic acid can be CpG depleted and codon-optimized for expression in a human cell. In an aspect, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect, “CpG-free” can mean “CpG-depleted”. In an aspect, “CpG-depleted” can mean “CpG-free”. In an aspect, “CpG- depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art. In an aspect, any disclosed dCas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon-optimized.
[0678] In an aspect of a disclosed method, a disclosed viral vector can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.
[0679] In an aspect, a disclosed method can further comprise effecting precision epigenetic modulation of the SNCA gene or a portion of the SNCA gene. In an aspect, modulating can comprise decreasing and/or reducing expression and/or activity of the SNCA gene or a portion of the SNCA gene.
[0680] In an aspect, the disclosed cells can be neurons (e.g., cholinergic neurons, dopaminergic neurons, etc.). In an aspect, the disclosed cells can be cells affected by an overexpression level and/or activity level of the SNCA gene or a portion of the SNCA gene.
[0681] In an aspect, the disclosed cells can be in a subject. In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having dementia with Lewy bodies (DLB).
[0682] In an aspect, a disclosed method can comprise reducing the pathological phenotype associated with dementia with Lewy bodies (DLB). In an aspect, reducing the pathological phenotype associated with dementia with Lewy bodies (DLB) can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies). In an aspect, reducing the pathological phenotype associated with dementia with Lewy bodies (DLB) can comprise reducing the number and/or amount of alpha-synuclein aggregates (e.g., Lewy Bodies) in dopaminergic neurons. In an aspect, a disclosed method can comprise diagnosing the subject with dementia with Lewy bodies (DLB).
[0683] In an aspect, a subject can be a subject in need of treatment of dementia with Lewy bodies (DLB). In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation.
[0684] In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality and/or metabolic dysregulation can comprise reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene. In an aspect, restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and/or ameliorating autophagy); (iii) improving, enhancing, restoring, and/or preserving mitochondrial functionality and/or structural integrity; (iv) improving, enhancing, restoring, and/or preserving organelle functionality and/or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of the multi -systemic manifestations of a genetic disease or disorder; (vii) reversing, inhibiting, preventing, stabilizing, and/or slowing the rate of progression of a genetic disease or disorder, or (viii) any combination thereof.
[0685] In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and/or preserving one or more aspects of cellular structural and/or functional integrity. In an aspect, restoring the activity and/or functionality of a missing, deficient, and/or mutant protein or enzyme can comprise a 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 100%, or any amount of restoration when compared to a pre-existing level such as, for example, a pre-treatment level. In an aspect, the amount of restoration can be 10-20%, 20- 30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% more than a pre-existing level such as, for example, a pre-treatment level. In an aspect, restoration can be measured against a control level or a reference level (e.g., determined, for example, using one or more subjects not having a missing, deficient, and/or mutant protein or enzyme). In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and/or functionality is like that of a wildtype or control level.
[0686] In an aspect, restoring the activity and/or functionality of the SNCA gene or a portion of the SNCA gene can comprise decreasing or reducing the expression and/or activity level of the SNCA gene or a portion of the SNCA gene. In an aspect, decreasing or reducing can comprise a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more as compared to a control (such as a pre-treatment level).
[0687] In an aspect of a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB), techniques to monitor, measure, and/or assess the restoring one or more aspects of cellular homeostasis and/or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are discussed supra.
[0688] In an aspect of a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB), administering can comprise intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-cisterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, intrahepatic administration, hepatic intra-arterial administration, hepatic portal vein (HPV) administration, or any combination thereof. In an aspect, a disclosed vector can be administered via LNP administration.
[0689] In an aspect of a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB), administering can comprise use of non-viral vectors to deliver a disclosed isolated nucleic acid. These non-viral vectors can include, but are not limited to, nanoparticles or liposomes. Alternatively, the disclosed isolated nucleic acids may be delivered via viral vectors (such as the disclosed viral vectors provided herein). Exemplary viral vectors are described supra and include adenovirus, adeno-associated virus (AAV), and lentivirus (LV). Viral
vectors are used more commonly due to their robust delivery, long-lasting expression, low immunogenicity and toxicity, and compatibility with the advanced manufacturing techniques. Most research in gene therapy has utilized AAV or LV due to their lowered immunogenicity compared to adenovirus. Derived from HIV, LV integrates its viral genome into the host gene to create permanent change in gene expression.
[0690] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can employ multiple routes of administration to the subject. In an aspect, a disclosed method can employ a first route of administration that can be the same or different as a second and/or subsequent routes of administration. In an aspect, a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can be concurrently and/or serially administered to a subject via multiple routes of administration. For example, in an aspect, administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise intravenous administration and intra-cistem magna (ICM) administration. In an aspect, administering a disclosed nucleic acid molecule, a disclosed vector, and/or a disclosed pharmaceutical formulation can comprise IV administration and intrathecal (ITH) administration.
[0691] In an aspect of a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB), a therapeutically effective amount of disclosed vector can be delivered via intravenous (IV) administration and can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg to about 8 x 1013 vg/kg or about 1 x 1012 vg/kg to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 vg/kg to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x IO10 vg/kg, at least about 5 x IO10 vg/kg, at least about 1 x 1011 vg/kg, at least about 5 x 1011 vg/kg, at least about 1 x 1012 vg/kg, at least about 5 x 1012 vg/kg, at least about 1 x 1013 vg/kg, at least about 5 x 1013 vg/kg, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10 vg/kg, no more than about 5 x IO10 vg/kg, no more than about 1 x 1011 vg/kg, no more than about 5 x 1011 vg/kg, no more than about 1 x 1012 vg/kg, no more than about 5 x 1012 vg/kg, no more than about 1 x 1013 vg/kg, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
[0692] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise monitoring the subject for adverse effects. In an aspect, in the absence of adverse effects, the method can further comprise continuing to treat the subject. In an aspect, in the presence of adverse effects, the method can further comprise modifying the treating step. Methods of monitoring a subject’s well-being can include both subjective and objective criteria (and are discussed supra). Such methods are known to the skilled person.
[0693] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. A therapeutic agent can be any disclosed agent that effects a desired clinical outcome.
[0694] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering to the subject a therapeutically effective amount of an agent that can correct one or more aspects of a dysregulated metabolic or enzymatic pathway. In an aspect, such an agent can comprise an enzyme for enzyme replacement therapy. In an aspect, a disclosed enzyme can replace any enzyme in a dysregulated or dysfunctional metabolic or enzymatic pathway. In an aspect, a disclosed method can comprise replacing one or more enzymes in a dysregulated or dysfunctional metabolic pathway.
[0695] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering one or more immune modulators. In an aspect, a disclosed immune modulator can be methotrexate, rituximab, intravenous gamma globulin, or bortezomib, or a combination thereof. In an aspect, a disclosed immune modulator can be bortezomib or SVP-Rapamycin. In an aspect, a disclosed immune modulator can be Tacrolimus. In an aspect, a disclosed immune modulator such as methotrexate can be administered at a transient low to high dose. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.1 mg/kg body weight to about 0.6 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at a dose of about 0.4 mg/kg body weight. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for 3 to 5 or greater cycles, with up to three days per cycle. In an aspect, a disclosed immune modulator can be administered at about a daily dose of 0.4 mg/kg body weight for a minimum of 3 cycles, with three days per cycle. In an aspect, a person skilled in the art can determine the appropriate number of cycles. In an aspect, a disclosed immune modulator can be administered as many times as necessary to achieve a desired clinical effect.
[0696] In an aspect, a disclosed immune modulator can be administered orally about one hour before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed therapeutic agent. In an aspect, a disclosed immune modulator can be administered orally about one hour or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered subcutaneously about 15 minutes before or a few days before a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof. In an aspect, a disclosed immune modulator can be administered concurrently with a disclosed isolated nucleic acid molecule, a disclosed vector, a disclosed pharmaceutical formulation, or a combination thereof.
[0697] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering one or more proteasome inhibitors (e.g., bortezomib, carfilzomib, marizomib, ixazomib, and oprozomib). In an aspect, a proteasome inhibitor can be an agent that acts on plasma cells (e.g., daratumumab). In an aspect, an agent that acts on a plasma cell can be melphalan hydrochloride, melphalan, pamidronate disodium, carmustine, carfilzomib, carmustine, cyclophosphamide, daratumumab, doxorubicin hydrochloride liposome, doxorubicin hydrochloride liposome, elotuzumab, melphalan hydrochloride, panobinostat, ixazomib citrate, carfilzomib, lenalidomide, melphalan, melphalan hydrochloride, plerixafor, ixazomib citrate, pamidronate disodium, panobinostat, plerixafor, pomalidomide, pomalidomide, lenalidomide, selinexor, thalidomide, thalidomide, bortezomib, selinexor, zoledronic acid, or zoledronic acid.
[0698] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering one or more proteasome inhibitors or agents that act on plasma cells prior to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells concurrently with administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise administering one or more proteasome inhibitors or one or more agents that act on plasma cells subsequent to administering a disclosed isolated nucleic acid molecule, a disclosed vector, or a disclosed pharmaceutical formulation. In an aspect, a disclosed method can further comprise administering one or more proteasome inhibitors more than 1 time. In an aspect, a
disclosed method can comprise administering one or more proteasome inhibitors repeatedly over time.
[0699] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering one or more immunosuppressive agents. In an aspect, an immunosuppressive agent can be, but is not limited to, azathioprine, methotrexate, sirolimus, anti -thymocyte globulin (ATG), cyclosporine (CSP), my cophenolate mofetil (MMF), steroids, or a combination thereof. In an aspect, a disclosed method can comprise administering one or more immunosuppressive agents more than 1 time. In an aspect, a disclosed method can comprise administering one or more one or more immunosuppressive agents repeatedly over time. In an aspect, a disclosed method can comprise administering a compound that targets or alters antigen presentation or humoral or cell mediated or innate immune responses. [0700] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering a compound that exerts a therapeutic effect against B cells and/or a compound that targets or alters antigen presentation or humoral or cell mediated immune response. In an aspect, a disclosed compound can be rituximab, methotrexate, intravenous gamma globulin, anti CD4 antibody, anti CD2, an anti-FcRN antibody, a BTK inhibitor, an anti-IGFIR antibody, a CD19 antibody (e.g., inebilizumab), an anti-IL6 antibody (e.g., tocilizumab), an antibody to CD40, an IL2 mutein, or a combination thereof. Also disclosed herein are Treg infusions that can be administered as a way to help with immune tolerance (e.g., antigen specific Treg cells to AAV).
[0701] In an aspect of a disclosed method, a subject can be a human. In an aspect, a subject can be suspected of having or can be diagnosed with having dementia with Lewy bodies (DLB). In an aspect, a disclosed subject can be symptomatic or asymptomatic.
[0702] In an aspect, a disclosed method can comprise repeating one or more steps of the method and/or modifying one or more steps of the method (such as, for example, an administering step).
[0703] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can comprise modifying one or more of the disclosed steps. For example, modifying one or more of steps of a disclosed method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. For example, in an aspect, a method can be altered by changing the amount of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof administered to a subject, or by changing the frequency of administration of one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination thereof to a subject, or by changing the duration
of time one or more of the disclosed isolated nucleic acid molecules, disclosed vectors, disclosed pharmaceutical formulations, or a combination are administered to a subject.
[0704] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can be altered by changing the amount of one or more disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject, or by changing the frequency of administration of one or more of the disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed immunosuppressive agents, disclosed compounds that exert therapeutic effect against B cells and/or disclosed compounds that targets or alters antigen presentation or humoral or cell mediated immune response administered to a subject.
[0705] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise generating and/or validating one or more of the disclosed isolated nucleic acid molecules, one or more of the disclosed vectors, one or more of the disclosed pharmaceutical formulations, or any combination thereof.
[0706] In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering to the subject a second disclosed isolated nucleic acid molecule, a second disclosed vector, a second disclosed pharmaceutical formulations, or any combination thereof. In an aspect, a disclosed method of treating and/or preventing progression of dementia with Lewy bodies (DLB) can further comprise administering to the subject additional disclosed isolated nucleic acid molecules, additional disclosed vectors, additional disclosed pharmaceutical formulations, or any combination thereof.
H. Kits
[0707] Disclosed herein is a kit comprising one or more disclosed isolated nucleic acid molecules, disclosed viral vectors (e.g., disclosed lentiviral or AAV vectors), disclosed pharmaceutical formulations, disclosed host cells, disclosed guide RNAs, disclosed plasmids, or any combination thereof with or without additional therapeutic agents to effect precision epigenetic modulation.
[0708] Disclosed herein is a kit comprising one or more disclosed isolated nucleic acid molecules, disclosed viral vectors (e.g., disclosed lentiviral or AAV vectors), disclosed pharmaceutical formulations, disclosed host cells, disclosed guide RNAs, disclosed plasmids, or any combination thereof with or without additional therapeutic agents to treat and/or prevent progression of a synucleinopathy or other SNCA associated disease or disorder. Disclosed herein is a kit comprising one or more disclosed isolated nucleic acid molecules, disclosed viral vectors (e.g.,
disclosed lentiviral or AAV vectors), disclosed pharmaceutical formulations, disclosed host cells, disclosed guide RNAs, disclosed plasmids, or any combination thereof with or without additional therapeutic agents to treat and/or prevent Parkinson’s disease (PD) progression. Disclosed herein is a kit comprising one or more disclosed isolated nucleic acid molecules, disclosed viral vectors (e.g., disclosed lentiviral or AAV vectors), disclosed pharmaceutical formulations, disclosed host cells, disclosed guide RNAs, disclosed plasmids, or any combination thereof with or without additional therapeutic agents to treat and/or prevent progression of dementia with Lewy bodies (DLB).
[0709] In an aspect, a disclosed kit can be used in a disclosed method to reduce expression and/or activity of SNCA.
[0710] In an aspect, a disclosed kit can comprise at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose (such as, for example, treating a subject diagnosed with or suspected of having a synucleinopathy or other SNCA associated disease or disorder). Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation. In an aspect, a kit for use in a disclosed method can comprise one or more containers holding a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed reagent, or a combination thereof, and a label or package insert with instructions for use. In an aspect, suitable containers include, for example, bottles, vials, syringes, blister pack, etc. The containers can be formed from a variety of materials such as glass or plastic. The container can hold, for example, a disclosed pharmaceutical formulation and/or a disclosed therapeutic agent and can have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The label or package insert can indicate that a disclosed pharmaceutical formulation and/or a disclosed therapeutic agent can be used for treating, preventing, inhibiting, and/or ameliorating a synucleinopathy such as Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder or complications and/or symptoms associated with synucleinopathy such as Parkinson’s disease (PD) or dementia with Lewy bodies (DLB) or any other SNCA associated disease or disorder. In an aspect, a disclosed kit can comprise additional components necessary for administration such as, for example, other buffers, diluents, filters, needles, and syringes. In an aspect, a disclosed kit can comprise those components (e.g., primers)
necessary to measure one or more times the level of expression and/or the level of activity of the disclosed gene of interest.
VII. EXAMPLES
[0711] As detailed herein, innovative epigenome editing tools to downregulate SNCA expression precisely are described and claimed. [0712] Epigenome editing represents a novel appealing approach for gene therapy mediated by altering expression of a specific gene based on CRISPR/dCas9 technology. While genome editing approaches change the genetic code via DNA cleavage and are prone to introduce new mutations,
epigenome editing as described herein uses deactivated nuclease. Thus, the DNA remains intact, and the deactivated nuclease does not change the DNA sequence.
[0713] The approach described herein is innovative allowing a precise and fine-tuned downregulation of SNCA expression specifically in dopaminergic and cholinergic neurons that are primarily afflicted in Parkinson’s disease (PD) and dementia with Lewy bodies (DLB). As described herein a new all-in-one LV dCas9-repressor vectors were modified and improved to include (a) neuron specific promoters driving expression in dopaminergic and cholinergic neurons specifically and (b) an enhanced transcription repressor (synthetic Kriippel-associated box (KRAB)/methyl CpG binding protein 2 (MeCP2) transcription repression domain (TRD) molecule (KRAB-MeCP2(TRD)) to increase efficacy of the system in reducing SNCA expression. [0714] The systems and methods described herein enable targeted epigenetic modulation of SNCA expression in targeted neuron populations - thus improving treatment options for various synucleinopathies.
Materials and Methods
[0715] Plasmid Design and Construction: The triple-Flag tagged KRAB-MeCP2(TRD) repressor was amplified from pCL52 and cloned into a lentivirus (LV) vector carrying dV/Cas9-p2a- puromycin with an effector cloning site under the control of EF-la promoter and a gRNA-cloning site (two BsmBI cutting sites) located downstream of the U6 promoter. The EF-la promoter was then replaced with human tyrosine hydroxylase (TH) promoter and human Choline acetyltransferase (ChAT) promoter to generate two separate neuronal-type specific vectors. Next the p2A sequence was replaced with SV40 promoter to support the expression of the puromycin resistance gene in the selection of the neural progenitor cells. The gRNA sequence (gRNAl, ACCTCCCAGAGACCTGGCCCAG (SEQ ID NO: 59) targeting SNCA gene was inserted into the two BsmB I sites. These resulted vectors were named THP-Repressor (SEQ ID NO: 4), ChATp- Repressor (SEQ ID NO: 2), respectively. To generate the negative control vectors, the vectors without gRNAs were used and the KRAB-MeCP2(TRD) cassette was removed by digestion with Agel and Fsel, resulting in negative control plasmid THP-CT (SEQ ID NO: 3) and ChATp-CT (SEQ ID NO: 1), respectively. The cell-type-specific promoters (TH and ChAT promoter) were synthesized using Genscript Biotech Corp (Piscataway, NJ) service.
[0716] Lentiviral Particle Production: Lentiviral vectors were generated using the transient transfection protocol, as described in Vijayraghavan, S. et al., (J Vis Exp. (2017). 10.3791/56915). Briefly, 15 pg vector plasmid, 10 pg psPAX2 packaging plasmid (Addgene 12260), 5 ug pMD2.G envelope plasmid (Addgene 12259), and 2.5 pg pRSV-Rev plasmid (Addgene 12253) were transfected into 293T cells. Vector particles were collected from filtered conditioned medium at
72 hr. post-transfection. The particles were purified using the sucrose-gradient method and concentrated >250-fold by ultracentrifugation (2 hr. at 20,000 rpm). Vector and viral stocks were aliquoted and stored at- 80 °C.
[0717] Transduction and Puromycin Selection: MD and MGE were transduced with each of the constructed LV repressor and control vectors at the MOI = 0.2. At 16 hr. post-transduction the media were replaced, and at 48 hr. post-transduction puromycin was applied at the final concentration of 1 ug/ml. The cells were maintained on the puromycin selection medium for 21 days to obtain the stable MD and MGE lines that carry each of the different LV repressor and control vectors.
[0718] Cell Culture and Neuronal Differentiation: Human induced pluripotent stem cells (hiPSCs) from a patient with a triplication of the SNCA gene (SVG4-Tri, ND34391, RRID:CVCL_F202) was purchased from the NINDS Human Cell and Data Repository. ND34391 line was previously differentiated into progenitor neurons, Ventral Midbrain (MD) and Medial Ganglionic Eminence (MGE) as described in Liu, H et al. (Cell Mol Life Sci 68, 3995-4008) and Tagliafierro, L. et al., (Hum Mol Genet 28, 407-421), which are both incorporated herein by reference in their entirety. [0719] Differentiation of MD into mDA was performed following the following protocol. Briefly, 5xl05 cell/ml MD were seeded on poly-L-omithine/laminin-coated plates in N2B27 medium supplemented with 3 pM CHIR99021, 2 pM SB431542, 5 pg/ml BSA, 20 ng/ml bFGF, and 20 ng/ml EGF. 24 hours post-passage MD maintenance medium was substituted by final differentiation medium consisting of N2B27 medium supplemented with 100 ng/ml FGF8 (Peprotech), 2 pM Purmorphamine, 300 ng/ml Dibutyryl-cAMP (db-cAMP), and 200 pM L- ascorbic acid (L-AA) for 14 days. From days 14, cells were fed with maturation medium consisting of 20 ng/ml GDNF, 20 ng/ml BDNF, 10 pM DAPT, 0.5 mM db-cAMP, and 200 pM L-AA. Medium was changed every other day.
[0720] Differentiation of MGE into BFCN was performed the following protocol. Briefly, 5xl05 cell/ml MGE were seeded on poly-L-omithine/laminin-coated plates in NEM (7 parts KO- DMEM to 3 parts Fl 2, 2 mM Glutamax, 1% penicillin and streptomycin, supplemented with 2% B27 ), plus 20 ng/ml FGF, 20 ng/ml EGF, 5 pg/ml heparin, 20 pM SB431542 and 10 pM Y27632 medium supplemented with 3 pM CHIR99021, 2 pM SB431542, 5 pg/ml BSA, 20 ng/ml bFGF, and 20 ng/ml. 24 hours post-passage MGE maintenance medium was substituted by final differentiation medium, BrainPhys Medium (Stemcell Technologies) supplemented withN2, B27, BDNF, GDNF, L-ascorbic acid, and db-cAMP for 3 weeks. Medium was changed every other day.
[0721] Cell count assay: To determine the differentiation efficiency of MD into mDA and MGE into BFCN, fluorescence images were collected using an EVOS microscope, The numbers of total cell (DAPI+), mDA(TH+), BFCN(ChAT+) were counted manually. Total differentiation efficiency of MGE/MD was assessed by the ratio of TH+ cells or ChAT+ and DAPI labeling cells. From each coverslip 5 randomly chosen fields were counted.
[0722] RNA extraction and cDNA synthesis: 3 x 105 cells were grown in cell differential medium for neuron differentiation. At day 21 days cells samples were harvested and total RNA was extracted and purified from cells using Total RNA Purification Kits (Norgen Biotek Corp, Canada). RNA concentration was determined spectrophotometrically at 260 nm using Nanodrop One Spectrophotometer (Thermo Scientific), while the quality of the purification was determined by 260 nm/280 nm ratio that showed values between 1.9 and 2.1, indicating high RNA quality. cDNA was synthesized using SuperScript IV VILO Master Mix (Thermo Scientific) according to the manufacturer’s manual.
[0723] Real time PCR: Real-time PCR was used to quantify the mRNAs expression of the neuronal markers and to evaluate possible off-target effects. Quantification of neuronal markers was performed using established protocols. Briefly, triplicates of each sample were assayed by relative quantitative real-time PCR using TaqMan expression assays and the ABI QuantStudio 7 (Applied Biosystems) to determine the level of the mRNA of the neuronal markers in the different cell-lines relative to mRNAs encoding housekeeping genes. The TaqMan MGB probe and primer set assays (Applied Biosystems) were used to amplify the target neuronal markers and the housekeeping reference controls were listed in Table 2, below.
Table 2 TaqMan Assays used for characterization of hiPSC-derived dopaminergic and cholinergic neurons and for SAC l-niRNA quantification
0724] Each cDNA (5 ng) was amplified in duplicate in at least two independent runs (overall > 4 repeats), using TaqMan Fast Advanced Master Mix reagent (Applied Biosystems) and the following conditions: 2 min at 50 °C, 10 min at 95 °C, 40 cycles: 15 sec at 95 °C, and 1 min at
60°C. Data were analyzed using a comparative delta-delta Ct method, also known as the 2-AACt method. The cycle number at which any sample crossed that threshold (Ct) was then used to determine fold difference, whereas the geometric mean of the two control genes served as a reference for normalization. Fold difference was calculated as 2-AACt. ACt=[Ct(target)-Ct (geometric mean of reference)]. AACt =[ACt(sample)] -[ACt(calibrator)]. The calibrator was a particular RNA sample obtained either from human total Brain RNA (Thermo Scientific) or control cells, used repeatedly in each plate for normalization within and across runs. The variation of the ACt values among the calibrator replicates was smaller than 10%.
[0725] Off-target analysis was performed using a commercial array (Applied Biosystems) consisting of 32 genes (J8S, GADPH, HPRT1, GUSB, ACTB, B2M, HMBS, IPO8, PGK1, RPLPO, TBP, TFRC, UBC, YWHAZ, PPIA, POLR1A, CASC3, CDKN1A, CDKN1B, GADD45A, PUM1, PSMC4, EIF2B1, PES1, ABL1, ELF1, MT-AT6, MRPL19, POP 4, RPL37A, RPL30, RPS17). Data was uploaded to the ThermoFisher Cloud and analyzed with Applied Biosystems qPCR Analysis Modules.
[0726] Immunocytochemistry: For imaging, 2.6 x 104 cells were plated onto Nunc™ Lab-Tek™ Chamber Slide System (Thermo Scientific). Cells were fixed in 4% paraformaldehyde and permeabilized in 0.1% Triton-XlOO prior to immunofluorescence staining. Cells were then blocked in 5% goat serum for 1 hour before incubating with primary antibodies overnight at 4°C. Following washes with PBS cell were incubated with secondary antibodies (Alexa fluor, Life Technologies) for 1 hour at room temperature. Nuclei were stained with NucBlue® Fixed Cell ReadyProbes® Reagent (ThermoFisher), following manufacturers’ instructions. Images were captured on Evos (Invitrogen). Primary and secondary antibodies were listed in Table 3 below.
[0727] For the quantitative analysis of immunofluorescence, 50 cells from each mDA/BFCN lines were imaged. The immunofluorescence intensity of a-synuclein protein and the Flag were measured using Image J software. The percentage of successfully differentiated mDA and BFCN were determined by the number of TH-positive and ChAT -positive cells, respectively, divided to the total number of DAPI-positive cells.
[0728] Western Blotting: 2 x 106 cells were grown in cell differential medium for neuron differentiation. At day 21 days cells samples were harvested and lysed with RIPA buffer (Millipore, Germany). Expression levels of the total human a-synuclein protein and the Serl29 phosphorylated a-synuclein protein (pS129-a-synuclein) in the mDA/BFCN lines were determined by western blotting with the a-synuclein rabbit monoclonal antibody (1 :2,000), pS 129- a-synuclein polyclonal antibody (1 :500) and with monoclonal antibody (mAb) b-actin (1 :5,000) for normalization. The list of antibodies used for the western blotting can be found in Table 4 below.
[0729] The cells were scraped from the dish and homogenized in RIPA buffer (EMD Millipore, MA) in the presence of a protease and phosphatase repressor cocktail (Sigma, St. Louis, MO). Total protein concentrations were determined by the BCA Protein Assay (Thermo Scientific), and 25 mg of each sample was run on 4%- 12% NuPAGE gels. Proteins were transferred to PVDF membranes, and blots were firstly incubated with 0.4% PFA and then blocked with Blocker™ FL Fluorescent Blocking Buffer (Thermo Scientific). Primary antibodies were incubated at 4C overnight. Alexa Fluor 790 donkey anti-rabbit IgG), and Alexa Fluor 680 donkey anti-mouse IgG-conjugated secondary antibodies were incubated for 1 hr. at room temperature (Abeam; 1 : 10,000). The signal was detected and imaged using iBright system (Thermo Scientific). Total a-synuclein and pS129-a-synuclein expression was normalized to b-actin expression in the same lane. Relative pS129-a-synuclein was normalized to total a-synuclein in the same line. Each experiment was repeated twice.
[0730] Cell Viability: mDA/BFCN differentiation assays were carried out as described above, briefly, 2.5 xlO5 indicated cell lines were cultured in differentiation medium for 4 days and then placed in incucyte S3 (Sartorius, Germany), a simple, reliable, and easy method through
Incucyte S3 live-cell analysis system for cell viability assay , for over time image acquisition . The plate was scanned from 9 separate regions per well using a 20* objective lens every 24 h for 21 days. The images were then analyzed using the built-in tools, and the viable cell number (object count) changes over time, normalized to the indicated day, were plotted using the built-in software. [0731] Mitochondrial membrane potential analysis: Changes in the mitochondrial membrane potential of the differentiated mDA and BFCN cells were analyzed using Incucyte® MMP Orange Reagent Kit (Sartorius, Germany). 2.5 x 104 MD cells stably transduced with THp-Repressor and THp-CT and the MGE cells stably transduced with ChATp-Repressor and ChATp-CT were cultured in Poly omithine/Laminin coated 96-well plates with differentiation media. At day 10 cells were incubated with culture medium containing 20nM Incucyte MMP Orange Reagent for Ih, and then placed in an incucyte Sx5 (Sartorius, Germany) for imaging. Cells exhibiting orange fluorescing mitochondria were considered healthy. The images were analyzed with the Incucyte® Basic Analysis Software Module.
[0732] Statistical analyses: Each RT-PCR experiment was repeated four times. The immunofluorescence assay, western blotting assay, cell viability assay and Mitochondrial membrane potential assay were repeated three times each to ensure accuracy and reproducibility. [0733] All data are presented as mean ± standard error of the mean (S.E.M.). Error bars in figures represent S.E.M. to visualize data variability. The significance of the differences between the mean values were analyzed by the two-tailed unpaired Student's /-test using GraphPad Prism 9. To perform statistical analysis on the cell viability assay, the raw data were exported from the Incucyte instrument, and the values of arguments "Area" were used to perform multiple /-tests. P- values <0.05 were considered to indicate statistically significant differences.
Example 1 Summary of Experiments Described Herein
[0734] Synucleinopathies are neurodegenerative disorders that share a common pathological lesion of intracellular protein aggregates largely composed of the a-synuclein protein, known as Lewy Bodies (LBs) and Lewy-related neurites. While these spectrum diseases exhibit neuropathological similarities, each disease presents distinct characteristics. For example, the cell types and brain regions containing the LBs differ, particularly in early disease stages, so that while LBs in dopaminergic neurons are the primary early disease characteristic of Parkinson’s disease (PD), early stages of dementia with Lewy bodies (DLB) has LBs primarily in the amygdala and cerebral cortex, as well as basal forebrain cholinergic neurons.
[0735] Genetic studies including GWAS for the most common synucleinopathies, Parkinson’s Disease (PD) and dementia with Lewy bodies (DLB), have implicated SNCA gene, encodes the a-synuclein protein, as a highly significant genetic risk factor for these diseases. Although the
precise mechanisms underlying the associations of SNCA with Parkinson’s Disease (PD) and dementia with Lewy bodies (DLB) are yet to be discovered, accumulating evidence suggested that overexpression of SNCA may play a crucial role in etiology of these diseases. Notably, elevated levels of alpha-synuclein (the protein encoded by the SNCA gene) were described in disease affected brain tissues compared to healthy controls. Moreover, lowering alpha-synuclein levels have demonstrated a beneficial impact. Changes in the levels of SNCA expression are regulated by different factors including epigenetics. Specifically, the role of DNA-methylation across SNCA intron 1 was studied in relation to SNCA dysregulation in the context of disease. Thus, epigenetic editing is an attractive approach for manipulation of SNCA expression back to normal physiological levels.
[0736] These Examples describe a method of epigenetically modulating SNCA expression specifically in dopaminergic and cholinergic neurons that are primarily afflicted in Parkinson’s Disease (PD) and dementia with Lewy bodies (DLB), respectively. As described below, an all-in- one LV dCas9-repressor vector was modified to include the Tyrosine hydroxylase (TH) and choline acetyltransferase (ChAT) promoters that are specifically expressed in dopaminergic and cholinergic neurons, respectively. In addition, an enhanced transcription repressor, the synthetic Kriippel-associated box (KRAB)/methyl CpG binding protein 2 (MeCP2) transcription repression domain (TRD) molecule, was used to achieve an improved efficacy of the system in reducing SNCA expression. Experiments below validated neuronal-type specificity and efficacy in hiPSC- derived mature neurons, i.e., midbrain dopaminergic neurons (mDA) and basal forebrain cholinergic neurons (BFCN) to model Parkinson’s disease (PD) and dementia with Lewy bodies (DLB), respectively, and assessed the impact on disease related pathological phenotypes as depicted in FIG. 5.
Example 2
Designing a Lentiviral Vector Carrying KRAB-MeCP2(TRD) to Target the SNCA Gene in Neurons
[0737] FIG. 1A shows the schematic representation of two all-in-one lentiviral (LV) vectors that contain a dN/Cas9 component fused with the synthetic repressor molecule KRAB -MeCP2(TRD) to target the SNCA gene in cholinergic (top) and dopaminergic (bottom) neurons, respectively. The 5’-LTR and the 3’-LTR represent long terminal repeats. Phi represents the packaging signal of the vector. RRE represents the rev responsive element responsible for binding REV protein of the virus. The Spl responsive element inclusion (Ortiniski et al., 2017; Kantor et al., 2018) demonstrated high production yield. The hU6 promoter drives expression of the gRNA in both vectors. In one vector designed to target cholinergic neurons (top panels in FIG. 1A and FIG. IB), the ChAT promoter drives the expression of dCAS9 and KRAB-MeCP2. This vector
(ChATp/gRNA/d&Cas9Cas9/KRAB-MeCP2(TRD), SEQ ID NO: 2) is referred hereafter as “ChATp-Repressor”. Alternatively, or in addition, the Nkx2.1 promoter may also be used for cholinergic targeting (FIG. 1A, top). In the other vector designed to target dopaminergic neurons (bottom panels in FIG. 1A and FIG. IB) the TH promoter drives expression of the dCAS9 and KRAB-MeCP2. Alternatively, the F0XA1 promoter may be used here to target dopaminergic neurons (FIG. 1A, bottom). This vector (THp-gRNA/d&Cas9/KRAB-MeCP2(TRD), SEQ ID NO: 4) is referred hereafter as “THp-Repressor”. Other elements in these vectors include: a p2A signal separating the effector molecule from GFP/Puro reporters, and Woodchuck Hepatitis Virus (WHP) Post-Transcriptional Regulatory Element (WPRE), which is a DNA sequence that when transcribed creates a tertiary structure enhancing expression. Finally, a set of control vectors were also prepared containing all elements described herein but lacking the gRNA and KRAB- MeCP2(TRD) repressor and referred to herein as THp-CT (dopaminergic control, SEQ ID NO: 3) and ChATp-CT (cholinergic control, SEQ ID NO: 1) (FIG. IB).
[0738] More details on the plasmid design and construction of the lentiviral vectors used herein are provided in the Materials and Methods, above.
Example 2 Differentiation of iPSCs into dopaminergic and cholinergic cell lines after transfection with all-in-one LV vectors
[0739] Patients with the triplication of the SNCA locus show a constitutively double expression of the SVG4-mRNA expression levels, and manifest early onset of Parkinson’s disease (PD) and dementia with Lewy bodies (DLB). Therefore, hiPSC lines derived from a patient with SNCA triplication (hereafter, SVC -Tri) represent adequate models to study Parkinson’s disease (PD) and dementia with Lewy bodies (DLB) in the context of the overexpression of SNCA. The four all-in-one LV vectors (THp-Repressor, THp-CT, ChATp-Repressor, ChATp-CT) described in Example 1 were transduced into SVG4-Tri hiPSC-derived dopaminergic (MD) and cholinergic (MGE) progenitor neurons to generate a total of eight lines. Four stable transduced MD and four MGE lines were selected and differentiated into dopaminergic neurons (mDAs) and basal forebrain cholinergic neurons (BFCNs), which are primarily affected in Parkinson’s disease (PD) and dementia with Lewy bodies (DLB), respectively.
[0740] To validate successful differentiation, the neuronal type and differentiation stage of the stably transduced neuronal progenitor cells, MD and MGE, and the fully differentiated mature neurons, mDA and BFCN, were characterized by real-time RT-PCR and immunocytochemistry using specific markers. The analysis included: (1) P-Tubulin III (TUBB3), an established marker of proliferative and terminally differentiated neurons, highly expressed in central nervous system, (2) Nestin (NES), biomarker of neuron progenitor cells, (3) TH, a biomarker for dopaminergic
neurons, and (4) Ch AT, a marker for cholinergic neurons in the brain as well as the central nervous system.
[0741] All lines of the terminally differentiated neurons, mDA and BFCN, showed high mRNA expression of TUBB3, while the parental MD and MGE lines didn’t express TUBB3 as expected (see left panels in FIG. 1C and FIG. ID). The expression of NES was low in mDA compared to their parental MD and was nearly undetectable in BFCN (see middle panels in FIG. 1C and FIG. ID). The analysis of the neuronal -type specific markers showed high expression of TH in all mDA lines compared to the corresponding parental MD lines (FIG. 1C, right panel) and 27% of the cells expressed TH (FIG. IE and FIG. IF). Similarly, ChAT was strongly expressed in the BFCN lines compared to the parental MGE lines (FIG. ID, right panel) and 30% of the cells were positive to ChAT (FIG. 1G and FIG. 1H). These results are consistent with earlier validation studies of the neuronal differentiation protocols showing similar efficiencies of the fully neuronal maturation (see Tagliafierro L et al., Alzheimers Dement 13, 1237-1250 and Tagliafierro L et al Hum Mol Genet 28, 407-421, which are both incorporated herein by reference in their entirety). In addition, co-expression of the all-in-one LV dCas9-repressor vectors was confirmed in the corresponding matured neuronal lines (FIG. IE and FIG. 1G). These findings indicated that all 4 stably transduced MD lines were successfully differentiated into mDA and the 4 stably transduced MGE lines were efficiently differentiated into BFCN. The evidence of high and specific expression of TH and ChAT in the mDA and BFCN lines, respectively, provided support that the TH and ChAT promoters are effectively active in each specific differentiated neuronal type, thus, each line is expected to effectively express the transduced LV vectors. Collectively, these results demonstrated the establishment of the dopaminergic and cholinergic neuronal models for in vitro validation studies of the neuronal-type specific epigenome editing system described herein.
Example 3 Targeted neuronal delivery of CRISPR mediated KRAB-MeCP2 repressor downregulates SNCA mRNA and protein level
[0742] Targeted hypermethylation of SNCA CpGs island within intron 1 by the catalytic domain of DNMT3A can downregulate SNCA expression. In this example, a new synthetic repressor comprising KRAB and the TRD domain of MeCP2 was tested for its effect on reducing the expression level of endogenous SNCA. As described above, all in one LV vectors were used to deliver this synthetic repressor linked to a deactivated Cas (dCas) alongside a gRNA targeting the 5’ end of intron 1 CpG island known to regulate SNCA transcription (SEQ ID NO: 59, see FIG. 2A).
[0743] In initial experiments, the levels of SVCri-mRNA and a-synuclein protein in the four mDA lines and four BFCN lines stably transduced with the THp-Repressor, THp-CT, ChATp- Repressor and ChATp-CT vectors were measured. In addition, the parental progenitor DA and MGE lines were analyzed and found to have relatively low levels of 57VC4-mRNA (FIG. 2B, FIG. 2C)
[0744] mDA line carrying the THp-Repressor vector showed a significant decrease in SNCA- mRNA amounting to nearly 50% compared to the mDA control line with the THp-CT vector (/?=0.0015, student’s Z-test; FIG. 2B, left panel). On the other hand, there was no significant change in 5 VG4-mRNA levels in BFCN with THp-Repressor vector compared to their control BFCN with THp-CT line (FIG. 2B, right panel), demonstrating the neuronal -type specificity of SNCA reduction effect to mDA.
[0745] In another experiment, the efficacy of the synthetic repressor molecule on reducing protein levels was assessed by immunofluorescence assay using double staining for a-synuclein and M2 Flag and Western blotting. The Flag marker allowed for the quantification of a-synuclein signal intensities directly only in cells in which the THp-Repressor and control vectors were successfully expressed. Quantification analysis of a-synuclein protein was conducted on a subset of mDA cells co-expressing the Flag at day 21 of the differentiation. The results showed a significant -30% decrease in a-synuclein protein in the mDA stably transduced with THp-Repressor vector compared to mDA with the control THp-CT vector (/?=0.0002, student’s Z-test; FIG. 2D and FIG. 2E). Western blotting analysis validated the significant reduction in a-synuclein protein (-40%,/? <0.001, student’s Z-test; FIG. 3 A and FIG. 3B).
[0746] Similar SNCA expression analyses were carried out for the ChATp lines. -30% lower levels of 5 VG4-mRNA were observed in BFCN carrying the ChATp-Repressor compared to ChATp-CT vectors (/?=0.0174, student’s Z-test; FIG. 2C, left panel), while there was no effect on A' N-mRNA levels in the mDA with the ChATp-Repressor vector vs the control mDA (FIG. 2C, right panel). Thus, the SNCA repression effect of ChATp-Repressor was specific to BFCN. Next, the effect on a-synuclein protein level was assessed. Immunofluorescent analysis of the Flag co-expressing BFCN cells at day 21 of the differentiation validated a significant reduction in the endogenous a-synuclein levels by approximately 20% in the BFCN with the ChATp-Repressor vector vs the control ChATp-CT vector (/?=0.004, student’s Z-test; FIG. 2F, and FIG. 2G). Western blotting analysis confirmed the significant repression effect on a-synuclein protein level (~44%,/?=0.0419, student’s Z-test; FIG. 3E and FIG. 3F).
[0747] Earlier experiments using a first-generation ectopic-expressed system driven by a constitutive promoter demonstrated a minimal off-target effect (Kantor et al., Mol Ther 26, 2638-
2649, incorporated herein by reference in its entirety). Here the target specificity of the novel neuronal-type specific system harboring this engineered transcription-repressor molecule was determined by a comprehensive gene expression analysis using TaqMan array. Since the effector molecule directly represses transcription, the expression of 32 random genes was assessed by qRT-PCR. These results showed similar gene expression profiles for most tested genes in all transduced (repressor and control vectors) and naive mDA and BFCN cell lines (FIG. 4A-4B). Notably, the expression of CDKN1A and PES1 genes was significantly reduced in the BFCN line transduced with the no-gRNA/no-repressor vector compared to the cells with the vector harboring the gRNA-repressor (FIG. 4A-4B). These results further supported the specificity and accuracy of the effect of the neuron-specific vectors containing the gRNA-Repressor component on SNCA- mRNA expression and show that this system improves upon earlier systems using constitutive promoters.
[0748] Collectively, the effects of the all-in-one LV THp-Repressor and ChATp-Repressor vectors were consistent on the mRNA and protein levels in the mDA and BFCN, respectively. Overall, these data demonstrated consistently the efficacy and specificity of the THp-Repressor and the ChATp-Repressor vectors on repressing SNCA expression in dopaminergic and cholinergic neurons, respectively.
Example 4
Neuron specific SNCA transcriptional repression rescues pathological markers of synucleinopathies
[0749] The predominant post-translational modification of a-synuclein in Lewy Bodies is phosphorylation at Serine (Ser)129, a marker of the pathological a-synuclein aggregates, which is a hallmark of synucleinopathies. Thus, to determine the effect of the reduction in a-synuclein levels mediated by the disclosed system on ameliorating disease related neuropathological characteristics, the reactivity of a-synuclein (pS129-a-synuclein) to Serl29 phosphorylation in the stably transduced mDA and BFCN lines was assessed by Western blotting. Fully differentiated (day 21) mDA carrying the THp-Repressor vector showed significant lower levels of pS129-a- synuclein compared to the control mDA line (~60%, =0.0041, student’s Ltest; FIG. 3A, FIG. 3C). To control for the effect of the overall decrease in of a-synuclein level (FIG. 3A, FIG. 3B) the ratios of pS129-a-synuclein /total a-synuclein were determined. The ratio found for the mDA with the THp-Repressor vector was significantly lower in comparison to the control (-40%, /?=0.0305, student’s Ltest; FIG. 3A, FIG. 3D). Thus, the decreased level of pS129-a-synuclein was greater than the overall reduction in a-synuclein, suggesting that the exemplary epigenome therapy system described herein rescued the pathological surrogate marker of a-synuclein aggregates. Similarly, the levels of pS129-a-synuclein in the mature BFCN carrying the ChATp-
Repressor vector were significantly decreased compared to the control BFCN (-70%, /?=0.0425, student’s /-test; FIG. 3E, FIG. 3G). Upon normalization to total a-synuclein the reduction remained substantial, showing a significant lower pS129-a-synuclein /total a-synuclein ratio in the BFCN with the ChATp-Repressor vector vs the control line (-50%, /?=0.0462, student’ s /-test; FIG. 3E, FIG. 3H), indicating the rescue of the surrogate marker of a-synuclein aggregates.
[0750] The neurotoxicity effects of elevated levels of a-synuclein has been well established and numerous reports demonstrated the relationship between SNCA overexpression and neuron death. To understand the effect of the decrease in a-synuclein levels mediated by neuron-specific SNCA repression on neuron loss a cell viability assay was performed over a period of 21 days using the IncuCyte S3 system. This technology allows for real-time, continuous monitoring of cell growth and health by utilizing an imaging platform to quantify the number of live cells in a culture.
[0751] The MD cells stably transduced with THp-Repressor and THp-CT and the MGE cells stably transduced with ChATp-Repressor and ChATp-CT were placed in the IncuCyte S3 system, and images were taken at every 24 hours for 21-22 days during which the differentiation protocols were applied. The images were analyzed using the IncuCyte software, which automatically quantifies the number of live cells based on their morphological features. The results showed a higher cell viability in the MD line carrying the THp-Repressor vector compared to MD with the control vector from day 7 and throughout the differentiation process to mature mDA neurons (FIG. 31), reaching statistical significance in days 11-15 (Table 5, below). By day 15 of the differentiation more than 40% of the dopaminergic neurons with the THp-Repressor vectors were viable while the viability of the control neurons was significantly lower (p=0.013052, student’s t- test, Table 5). At the end of the experimental period (day 22) -30% of the THp-Repressor stable transduced dopaminergic neurons remained viable (FIG. 31)
Table 5: Comparison analysis of dopaminergic cell viability (THp-Repressor vs THp-CT, multiple t-test).
[0752] Similar results were found with the cholinergic lines, demonstrating a higher level of viable cells for the MGE carrying the ChATp-Repressor vector compared to the corresponding
control cells along the differentiation process to mature BFCN (FIG. 3J), showing significant differences in days 4-7 (Table 6). Specifically, at day 6 the control cholinergic neurons already exhibited the lowest cell viability value compared to -50% viability at day 6 for the cholinergic neurons with the ChATp-Repressor (/?=0.001, student’s /-test; FIG. 3J, Table 6). Noteworthy, only at day 16 the ChATp-Repressor cholinergic neurons showed a comparable low level of viable cells to that observed for the control ChATp-CT cholinergic neuronal line at day 6 (FIG. 3J).
Table 6: Comparison analysis of cholinergic cell viability (ChATp-Repressor vs ChATp- C, multiple t-test)
[0753] These findings are consistent with the significant differences in viable cells between these lines. Together, these results suggested that downregulation of SNCA mediated by this epigenome editing system enhanced dopaminergic and cholinergic neuronal survival during the differentiation process.
[0754] Mitochondrial dysfunction has been implicated in driving the pathology of several neurodegenerative diseases, including Parkinson’s disease (PD) and dementia with Lewy bodies (DLB), and the association between overexpression of a-synuclein and dysfunctional mitochondria has been established. To explore the beneficial effect of a-synuclein downregulation mediated by this system on mitochondrial function, the Incucyte mitochondrial membrane potential (MMP) assay was conducted at day 10 of the differentiation process. A drop in MMP indicates a disruption in mitochondrial function and integrity. The MMP assay utilizes the Incucyte MMP Orange Reagent that accumulated in active mitochondria in proportion to the MMP and by that enables real-time detection of transient and long-term changes in MMP in live cells. The control THp-CT dopaminergic and ChATp-CT cholinergic neuronal lines demonstrated a robust decrease in the orange fluorescence intensity compared to their counterpart neuronal lines stably transduced with the THp-Repressor and the ChATp-Repressor, respectively (FIG. 3K, FIG. 3L). The results showed similar decline trends in the orange fluorescence intensities for the control and the naive cells of each neuronal type along a period of 28 hours (FIG. 3K, FIG. 3L). Thus, the MMP remained more stable in the THp-Repressor dopaminergic and the ChATp-
Repressor cholinergic neurons relative to the drops observed in monitoring the respective naive and control neuronal lines (FIG. 3K, FIG. 3L) These results indicated that our epigenome therapy system ameliorated mitochondrial dysfunction and perturbed integrity in dopaminergic and cholinergic disease model neurons.
[0755] Collectively, the results demonstrated that the epigenome editing mediated neuronal -type specific reduction in SNCA -expression levels reversed the phenotypic perturbations of the SNCA- Tri hiPSC-derived dopaminergic and cholinergic neurons.
Example 5 Neuron Specific Epigenomic Modulation in vivo
[0756] In this Example, the LV repressor vectors described above (TH specific) were tested in an in vivo setting. Specifically, A53T alpha-synuclein AAV vector (described in Wang et al., Acta Neuropathol Commun. 2017 Feb 1; 5(1): 11, which is incorporated herein by reference in its entirety) was co-injected with an LV-inactive control (THP-CT, SEQ ID NO: 3, 1 pl) into the left substantia nigra (SN), and an A53T alpha-synuclein AAV vector was co-injected with an LV- repressor targeted to TH promotor (THP-Repressor, SEQ ID NO: 4, 1 pl) into the right SN of wildtype mice. Animals were sacrificed 6 weeks after injection and their brains analyzed using immunohistochemistry. FIG. 6A shows representative images (2X magnification) of brain slices 6 weeks post-injection, showing DAPI staining, expression of total, phosphorylated and aggregated human alpha-synuclein in the SN (top images), and mouse tyrosine hydroxylase in the SN and striatum (bottom). The LV repressor significantly repressed the expression of total (37%), phosphorylated (67%), and aggregated (77%) human alpha-synuclein in the right SN relative to the left SN (FIG. 6B). At the same time, expression of tyrosine hydroxylase was higher in the right SN (1.2 fold) (FIG. 6C) and striatum (1.9 fold) (FIG. 6D) relative to the left SN and striatum, suggesting a greater retention of dopaminergic neurons.
[0757] These experiments demonstrate the in vivo efficacy of the neuron specific epigenome editing system described herein.
Summary of Experiments
[0758] These Examples describe the development of the first cell-type specific A A -targeted epigenome editing tool applicable as gene therapy approach for synucleinopathies spectrum disorders. Specifically, a novel all-in-one LV vector harboring gRNA, dCas9 and the fused KRAB-MeCP2(TRD) repressor molecule driven by TH and ChAT promoters was developed to precisely target a regulatory element within SNCA intron 1 region with specificity to dopaminergic and cholinergic neurons, respectively. Validation of the neuronal-specific epigenome editing system, using mDA and BFCN mature neurons derived from a patient with SNCA triplication,
resulted in neuronal-type specific downregulation of &VG4-mRNA and protein expression. Further, neuronal-type specific SNCA reduction rescued disease related pathological hallmarks such as neuronal survival, mitochondrial dysfunction, as well as levels of Serl29-phophorylated a-synuclein which is the predominant modification of a-synuclein in the pathological aggregate. [0759] Earlier studies were aimed at constitutive expression of CRISPR mediated repressors and so did not distinguish between cell types or specific disease states. In these Examples, a refined system is presented designed for therapeutic applications specific for specific synucleinopathies z.e., Parkinson’s disease (PD) and dementia with Lewy bodies (DLB).
[0760] The system described herein have many improvements over earlier systems. First, prior viral vectors were expressed from a constitutive promoter (EFl alpha core promoter (EFS-NC)). In contrast, the improved systems here can achieve efficient and specific expression in the vulnerable neuronal types for specific diseases, by placing the repressor elements under the control of TH and ChAT promoters, specific promoters of dopaminergic and cholinergic neurons, respectively. This modification also circumvents undesirable manipulation of SNCA expression in other cell types. Second, the novel synthetic repressor protein used herein (fusion of KRAB and the transcriptional repression domain (TRD) of MeCP2) shows a stronger efficacy to reduce expression compared to earlier repressors (e.g., DNMT3A) and is also a smaller size (relative to DNMT3A). Thirdly, the system uses a more compact dCas9 (Staphylococcus aureus d5 Cas9) which in combination with the more compact KRAB-MeCP2(TRD) repressor allows packaging of the entire all-in-one vector in a payload-limited adeno-associated viral (AAV) vector that is commonly used for in vivo gene editing. Finally, this system facilitates the assessment of routes of administration (ROA) that are not directed into the affected brain region such as, intracerebroventricular (ICV) and the non-invasive intranasal drug delivery routes to the brain. Collectively, the new system brings crucial advancements and strengthens the translational potential for precision medicine in synucleinopathies.
[0761] In the Examples described above, the new all-in-one dV/Cas9/KRAB-MeCP2(TRD) vector is validated using hiPSC-derived mDA and BFCN lines obtained from a patient carrying the triplication of the SNCA locus (&VG4-Tri hiPSC). Patients with the SNCA triplication manifest early onset Parkinson’s disease (PD) and dementia with Lewy bodies (DLB), therefore, hiPSC lines obtained from these patients represent an adequate model for Parkinson’s disease (PD) and dementia with Lewy bodies (DLB) drug discovery and preclinical studies. Application of hiPSC- derived systems as disease models for drug discovery has become increasingly common specifically, in early preclinical phase to explore the cellular disease pathophysiology and validate drug targets, and as screening and optimization platforms of early therapeutics strategies). hiPSC-
derived disease models are beneficial in preclinical phase for several reasons, primarily, they represent the only available human-based models in which the full genetic landscape of the patients is captured. In addition, they are cost effective, versatile, and overcome many of the innate limitations of available animal models. We recently performed in-depth characterization of SNCA- Tri hiPSC-derived mDA and BFCN provided further support for their suitability to model Parkinson’s disease (PD) and dementia with Lewy bodies (DLB), respectively, for basic, translational and preclinical studies. Our current preclinical study demonstrated the utility and feasibility of patients hiPSC-derived neuronal models in early stage of drug development and provided evidence for the importance of hiPSC technology in offering the opportunity to perform validation studies using the relevant cell-type for each disease indication.
[0762] Manipulations of SNCA levels have demonstrated a beneficial impact. However, neurotoxicity associated with robust reduction of SNCA levels was reported. Familial patients with the triplication or duplication of the SNCA locus showed constitutively 200% and 150% higher levels of SNCA, respectively, compared to subjects with diploid copy of SNCA, and these patients manifest early onset Parkinson’s disease (PD) and dementia with Lewy bodies (DLB). Thus, it is predicted that a reduction of 33%-50% in &VG4-mRNA and protein expression should restore normal physiological levels of SNCA and be sufficient for therapeutic benefits. A goal in the previous Examples and in this present disclosure is to fine-tune SNCA levels in sporadic Parkinson’s disease (PD) and dementia with Lewy bodies (DLB) caused by SNCA dysregulation, with the presumption that a reduction of 30% or less could serve as the therapeutic window. Here a neuronal -type specific reduction in SNCA overexpression of 41% and 44% was achieved in dopaminergic and cholinergic neurons, respectively. Furthermore, it was also demonstrated that these reduction levels were sufficient to effectively reverse key neuropathological features i.e., the presence Serl29- phophorylated a-synuclein, surrogate of a-synuclein aggregates, neuron loss, and mitochondrial dysfunction. These results provided an in vitro proof -of -concept for the efficacy and efficiency of our new neuronal -type specific therapeutic strategy and a strong premise to moving forward into animal studies towards IND enablement.
[0763] In conclusion, the new SNCA -targeted epigenome therapy presents a strategy for targeting the precise gene in the precise brain cell-type in the affected brain region. The platform offers the opportunity to refine the vector for packaging in AAV for safer and efficient delivery into the brain. This study introduces Parkinson’s disease (PD) and dementia with Lewy bodies (DLB) specific gene therapy technologies and by that advances precision medicine in synucleinopathies.
Claims
1. An isolated nucleic acid comprising:
(a) a nucleic acid sequence encoding (i) a deactivated Cas (dCas) endonuclease, (ii) at least one polypeptide having an enzymatic activity, and (iii) at least one guide RNA targeting a gene of interest or portion thereof; and
(b) one or more neuron specific regulatory element operably linked to (a)(i), (a)(ii), (a)(iii), or any combination thereof.
2. The isolated nucleic acid of Claim 1, wherein the neuron specific regulatory element comprises one or more neuron specific promoters.
3. The isolated nucleic acid of Claim 2, wherein the one or more neuron specific promoters comprise a wild-type promoter, a synthetic promoter, a minimal promoter, or any combination thereof.
4. The isolated nucleic acid of Claim 2, wherein the one or more neuron specific promoters comprise at least one dopaminergic promoter.
5. The isolated nucleic acid of Claim 4, wherein the at least one dopaminergic promoter comprises a tyrosine hydroxylase (TH) promoter, a F0XA2 promoter, or any combination thereof.
6. The isolated nucleic acid of Claim 5, wherein the at least one dopaminergic promoter comprises a TH promoter.
7. The isolated nucleic acid of Claim 6, wherein the TH promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 5 or a fragment thereof.
8. The isolated nucleic acid of Claim 5, wherein the at least one dopaminergic promoter comprises a FOXA2 promoter.
9. The isolated nucleic acid of Claim 8, wherein the FOXA2 promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 6 or a fragment thereof.
10. The isolated nucleic acid of Claim 2, wherein the one or more neuron specific promoters comprises at least one cholinergic promoter.
11. The isolated nucleic acid of Claim 10, wherein the at least one cholinergic promoter comprises a choline acetyltransferase (ChAT) promoter, a Nkx2.1 promoter, or any combination thereof.
12. The isolated nucleic acid of Claim 11, wherein the at least one cholinergic promoter comprises a ChAT promoter.
13. The isolated nucleic acid of Claim 12, wherein the ChAT promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.
14. The isolated nucleic acid of Claim 11, wherein the at least one cholinergic promoter comprises a Nkx2.1 promoter.
15. The isolated nucleic acid of Claim 14, wherein the Nkx2.1 promoter comprises a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 8or a fragment thereof.
16. The isolated nucleic acid of Claim 1, wherein the one or more neuron specific regulatory elements are operably linked to the nucleic acid encoding the dCas endonuclease.
17. The isolated nucleic acid of Claim 1, wherein the one or more neuron specific regulatory elements are operably linked to the nucleic acid encoding the at least one polypeptide having enzymatic activity.
18. The isolated nucleic acid of Claim 1, wherein the one or more neuron specific regulatory elements are operably linked to the nucleic acid encoding the dCas endonuclease and the nucleic acid encoding the at least one polypeptide having enzymatic activity.
19. The isolated nucleic acid of Claim 1, wherein the dCas endonuclease comprises a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease.
20. The isolated nucleic acid of Claim 19, wherein the dCas endonuclease comprises a variant dCas9 endonuclease selected from a VRER, EQR or VQR variant of dCas9.
21. The isolated nucleic acid of Claim 19, wherein the dCas endonuclease comprises a dSaCas9 endonuclease having an amino acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least
96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 13 or a fragment thereof.
22. The isolated nucleic acid of Claim 1, wherein the enzymatic activity comprises transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.
23. The isolated nucleic acid of Claim 22, wherein the at least one encoded polypeptide having enzymatic activity comprises HP la, HP lb, MBD1, MBD2, Krtippel-Associated Box (KRAB), NIPP1, Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof.
24. The isolated nucleic acid of Claim 23, wherein the fusion comprises KRAB-MeCP2 (KRAB-MeCP2).
25. The isolated nucleic acid of Claim 24, wherein the KRAB-MeCP2 comprises an amino acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 48, or a fragment thereof.
26. The isolated nucleic acid of Claim 1 , wherein the at least one gRNA targets the SNCA gene or the promoter of the SNCA gene.
27. The isolated nucleic acid of Claim 26, wherein the at least one gRNA targets a nucleic acid sequence comprising any one of SEQ ID NOs: 59 - 71 or a sequence at least about 90% identical thereto.
28. The isolated nucleic acid of Claim 1, further comprising one or more additional regulatory elements.
29. The isolated nucleic acid of Claim 28, wherein the one or more additional regulatory elements are selected from one or more primer binding sites (PBS), one or more splice donor (SD) sites, one or more splice acceptor (SA) sites, one or more central polypurine tracts (cPPT), one or more polypurine tracts (PPT), one or more Rev Response elements (RRE), one or more Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE), one or more retroviral vector packaging elements, or any combination thereof.
30. The isolated nucleic acid of Claim 29, wherein the retroviral vector packaging element comprises a psi (y) signal.
31. A viral vector comprising the isolated nucleic acid of any one of Claims 1-30.
32. The viral vector of Claim 31, wherein the viral vector comprises an adeno-associated virus (AAV), an integrase-deficient lentivirus (IDLV), or integrase competent lentivirus (ICLV).
33. A pharmaceutical formulation comprising the viral vector of Claim 31, and a pharmaceutically acceptable carrier.
34. A method of effecting precision epigenetic modulation in a neuron, the method comprising: contacting one or more neurons with a therapeutically effective amount of the viral vector of viral vector of Claim 31, wherein the expression and/or activity of one or more genes of interest in the one or more neurons is modulated.
35. The method of Claim 34, wherein modulating comprises increasing or augmenting the expression and/or activity of the one or more genes of interest.
36. The method of any Claim 34, wherein modulating comprises decreasing or reducing the expression and/or activity of the one or more genes of interest.
37. The method of any Claim 34, wherein the neurons are in a subject.
38. The method of Claim 37, wherein the subject is suspected of having or has been diagnosed with a synucleinopathy.
39. The method of Claim 38, further comprising reducing the pathological phenotype associated with the synucleinopathy.
40. The method of claim 38, wherein the synucleinopathy is selected from Parkinson’s disease (PD) and dementia with Lewy bodies (DLB).
41. The method of Claim 34, wherein the gene of interest or portion thereof comprises SNCA or the promoter region of SNCA.
42. The method of Claim 41, wherein the expression and/or activity level of SNCA is decreased or reduced when compared to a pre-contacting step level.
43. The method of Claim 37, wherein contacting the one or more cells in a subject comprises administering the viral vector through intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-ci sterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof.
44. The method of Claim 43, further comprising administering to the subject a therapeutically effective amount of one or more immune modulators.
45. The method of Claim 44, wherein the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof.
46. A method of treating and/or preventing a synucleinopathy in a subject, the method comprising: administering to a subject in need thereof a therapeutically effective amount of the viral vector of Claim 31, thereby reducing the pathological phenotype associated with the synucleinopathy.
47. The method of claim 46, wherein the synucleinopathy is selected from Parkinson’ s disease (PD) and dementia with Lewy bodies (DLB).
48. The method of Claim 46, wherein administering the viral vector comprises intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra- cistema magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof.
49. The method of Claim 46, further comprising administering to the subject a therapeutically effective amount of a therapeutic agent.
50. The method of Claim 46, further comprising administering to the subject a therapeutically effective amount of the one or more immune modulators.
51. The method of Claim 50, wherein the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363452801P | 2023-03-17 | 2023-03-17 | |
| US63/452,801 | 2023-03-17 | ||
| US202363538396P | 2023-09-14 | 2023-09-14 | |
| US63/538,396 | 2023-09-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2024196752A2 true WO2024196752A2 (en) | 2024-09-26 |
| WO2024196752A3 WO2024196752A3 (en) | 2024-10-31 |
Family
ID=92842269
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2024/020123 Ceased WO2024196752A2 (en) | 2023-03-17 | 2024-03-15 | Compositions for cell specific snca-targeted gene therapy and methods of making and using same |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2024196752A2 (en) |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002018548A2 (en) * | 2000-08-30 | 2002-03-07 | Thomas Jefferson University | Tyrosine hydroxylase 5' control elements and uses thereof |
| US11530396B2 (en) * | 2017-09-05 | 2022-12-20 | The University Of Tokyo | Modified CAS9 protein, and use thereof |
| US12241065B2 (en) * | 2018-01-12 | 2025-03-04 | Bristol-Myers Squibb Company | Antisense oligonucleotides targeting alpha-synuclein and uses thereof |
| US20210047627A1 (en) * | 2018-01-30 | 2021-02-18 | Parkinson's Institute | Crispr-based downregulation of alpha-synuclein expression as a novel parkinson's disease therapeutic |
| CN114375198A (en) * | 2019-05-16 | 2022-04-19 | 波士顿大学董事会 | Regulated synthetic gene expression system |
| EP4118206A1 (en) * | 2020-03-11 | 2023-01-18 | The Broad Institute Inc. | Stat3-targeted base editor therapeutics for the treatment of melanoma and other cancers |
| WO2023069923A1 (en) * | 2021-10-18 | 2023-04-27 | Duke University | Compositions and methods relating to epigenetic modulation |
-
2024
- 2024-03-15 WO PCT/US2024/020123 patent/WO2024196752A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024196752A3 (en) | 2024-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250082778A1 (en) | Rna guided eradication of human jc virus and other polyomaviruses | |
| US12590320B2 (en) | Cellular models of and therapies for ocular diseases | |
| JP7401432B2 (en) | engineered DNA binding protein | |
| JP7432621B2 (en) | Compositions and methods for selective gene regulation | |
| US20200261589A1 (en) | Use of a Syncytin for Targeting Drug and Gene Delivery to Regenerate Muscle Tissue | |
| US20210189361A1 (en) | Downregulation of snca expression by targeted editing of dna-methylation | |
| WO2021031810A1 (en) | Application of ptbp1 inhibitor in preventing and/or treating nervous system disease related to functional neuronal death | |
| CN113966400A (en) | Interneuron-specific therapeutic agents for normalizing neuronal cell excitability and treating delaviru syndrome | |
| WO2019152433A1 (en) | Crispr-based downregulation of alpha-synuclein expression as a novel parkinson's disease therapeutic | |
| WO2021032068A1 (en) | Application of ptbp1 inhibitor in preventing and/or treating nervous system disease related to functional neuronal death | |
| US20240409890A1 (en) | Ufmylation inhibition to target tauopathy in human neurons | |
| WO2022072325A1 (en) | Neurod1 combination vector | |
| CN114364392A (en) | Methods and compositions relating to TERT activation therapy | |
| WO2023069923A1 (en) | Compositions and methods relating to epigenetic modulation | |
| US20230392133A1 (en) | Compositions and Methods Relating to Alzheimer's Disease | |
| US20240366684A1 (en) | Compositions comprising a zim3 effector and methods of use thereof | |
| WO2024196955A2 (en) | Apoe-targeted microglia-specific gene therapy for neurological diseases | |
| US20230270818A1 (en) | Tcf7l2 mediated remyelination in the brain | |
| Lian et al. | Intranuclear polyglycine aggregation drives neurodegeneration through epigenetic repression of chromatin accessibility and transcription | |
| JP2026505771A (en) | Competitive replacement of glial cells | |
| CN113373144A (en) | Composition for skin regeneration and repair, preparation method and application thereof | |
| WO2025016362A1 (en) | Therapy based on intracerebral phosphate homeostasis promoter | |
| CN121729239A (en) | Compositions and methods for the treatment and prevention of neurodegenerative diseases and disorders | |
| HK40029090A (en) | Cellular models of and therapies for ocular diseases | |
| EA046157B1 (en) | COMPOSITIONS AND METHODS FOR SELECTIVE REGULATION OF GENE EXPRESSION |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 24775436 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 24775436 Country of ref document: EP Kind code of ref document: A2 |














