WO2024092216A2 - Methods and compositions regarding modulation of poultry genes - Google Patents

Abstract

Transgenic avians comprising an artificial heterozygous or homozygous disruption in its myostatin gene (MSTN), wherein said disruption results in an artificial suppression of myostatin; and further wherein resulting offspring of the transgenic avian also comprise the disruption are described herein. Also described are transgenic avians comprising an artificial heterozygous or homozygous disruption in its myostatin gene (MLPH), wherein said disruption results in an artificial suppression of melanophilin; and further wherein resulting offspring of the transgenic avian also comprise the disruption. Methods of making these transgenic animals, as well as vectors which comprise the CRISPR/Cas9 system capable of making these modified transgenic animals are also disclosed.

Description

METHODS AND COMPOSITIONS REGARDING MODULATION OF POULTRY GENES

GOVERNMENT SUPPORT CLAUSE

This invention was made with government support under grant number 2020-67015- 31537 awarded by the United States Department of Agriculture. The government has certain rights in the invention.

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims benefit of U.S. Provisional Application No. 63/419,915, filed October 27, 2022, incorporated herein by reference in its entirety.

REFERENCE TO SEQUENCE LISTING

The sequence listing submitted on October 27, 2023, as an .XML file entitled “103361-370W01_ST26.xml” created on October 27, 2023, and having a file size of 33,963 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).

BACKGROUND

Genome editing has been conducted in previous studies to understand gene function and utilized in medical and agricultural industries to treat diseases and improve agricultural production. Genome editing in chickens has been performed by using a conventional method that requires in vitro culturing and genome editing of primordial germ cells (PGCs), and transplantation of the genome-edited PGCs into recipient embryos to produce germline chimeric chickens (Schusser 2013; Park 2014; Oishi 2016). Subsequently, heterozygous mutant chickens can be identified by screening offspring from breeding of the germline chimeric chickens, and further breeding of the heterozygous mutant males and females eventually can lead to production of homozygous mutant chickens. Success when using the conventional method is largely determined by effective utilization of PGC-mediated procedures including isolation, culture, and genome editing of PGCs, screening and propagating the genome-edited PGCs, and transplantation of the PGCs into recipient embryos. These technically difficult additional procedures are inevitable due to the absence of efficient genome editing of PGCs directly within the avian embryos. In addition, production of genome-edited offspring of avian species by using the conventional method other than with chickens has not been reported, although culture of PGCs has been reported from multiple avian species (Kim 2005; Park 2008; Wade 2014; Jung 2019). This limitation is indicative of the need for development of alternative methodologies that can be effectively utilized for production of genome-edited offspring of various avian species.

What is needed in the art are accurate and efficient ways of creating transgenic avians with specific disruptions in desired genes.

SUMMARY

Disclosed herein is a transgenic avian comprising an artificial heterozygous or homozygous disruption in its myostatin gene (MSTN), wherein said disruption results in an artificial suppression of myostatin; and further wherein resulting offspring of the transgenic avian also comprise the disruption.

Further disclosed herein is a vector encoding a CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises gRNAs which are specific for MSTN gene, and further wherein expression of the CRISPR/Cas9 system is under control of an avian 7SK promoter.

Also disclosed herein is a method of producing an avian with targeted mutations in MSTN gene to inactivate function of myostatin, the method comprising the steps of: introducing the vector described above into an avian primordial germ cell in blastoderm; utilizing the promoter within the vector which controls the CRISPR/Cas9 system, thereby expressing the CRISPR/Cas9 system, which results in alteration of the MSTN gene thereof, thereby producing avian embryos containing genome-edited germ cells; placing eggs containing embryos with genome-edited germ cells under conditions suitable for development, thereby producing chimeric avian with genome-edited germ cells in MSTN gene; and producing genome-edited offspring from breeding of chimeric avians.

Disclosed herein is a transgenic avian comprising an artificial heterozygous or homozygous disruption in its melanophilin gene (MLPPL), wherein said disruption results in an artificial suppression of melanophilin; and further wherein resulting offspring of the transgenic avian also comprise the disruption.

Further disclosed herein is a vector encoding a CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises gRNAs which are specific for MLPH gene, and further wherein expression of the CRISPR/Cas9 system is under control of an avian 7SK promoter.

Also disclosed herein is a method of producing an avian with targeted mutations in MLPH gene to inactivate functions of melanophilin proteins, the method comprising the steps of: introducing the vector described above into an avian primordial germ cell in blastoderm; utilizing the promoter within the vector which controls the CRISPR/Cas9 system, thereby expressing the CRISPR/Cas9 system, which results in alteration of the MLPH gene thereof, thereby producing avian embryos containing genome-edited germ cells; placing eggs containing embryos with genome-edited germ cells under conditions suitable for development, thereby producing chimeric avian with genome-edited germ cells in MLPH gene; and producing genome-edited offspring from breeding of chimeric avians.

DESCRIPTION OF DRAWINGS

Figure 1 shows the generation of genome-edited chicken and duck lines using the adenovirus-mediated method. The adenovirus containing the CRISPR/Cas9 system is injected into the avian blastoderm through a small opening made on the lateral apex of the eggs. The injected adenovirus in the subgerminal cavity transduces blastodermal cells, including primordial germ cells (PGCs). Potential germline mosaic founder birds (GO) are hatched from the adenovirus-injected eggs and are utilized for mating with wild-type (WT) birds. Offspring from the founder lines are genotyped and heterozygous mutant (+/-) males and females (Gl) are mated to produce homozygous mutant (-/-) birds (G2).

Figure 2A-B shows (A) Sequences of genomic DNA of WT and Gl heterozygous mutants (SEQ ID NOS: 24-30 as shown from top to bottom of figure, with wild type being SEQ ID NO: 24, one deletion is SEQ ID NO: 25; three deletions is SEQ ID NO: 26; nine deletions is SEQ ID NO: 27; thirteen deletions is SEQ ID NO: 28; twenty-one deletions is SEQ ID NO: 29; and twenty-three deletions is SEQ ID NO: 30). The PAM motifs and gRNA sequences are highlighted in gray and light gray, respectively. Deleted (del) nucleotides were marked with dashes and an inserted (ins) nucleotide was boxed. Efficiencies of germline transmission of GO germline founder lines were calculated by the number of mutant offspring out of total Gl offspring from the founders. The orientation of MLPH gRNA and PAM motif is negative. (B) Lateral views of G2 WT, heterozygous, and homozygous mutant chickens and Gl WT and heterozygous mutant ducks and corresponding DNA sequencing chromatograms of the target genes. Dashed lines indicate the point where deletion mutations occur.

Figure 3A-E shows steps for creating genome-edited ducks. Step A: Selection of gRNAs (SEQ ID NO: 32 shown for duck MSTN gene). Step B: Production of recombinant adenovirus containing CRISPR/Cas9. Step C: Microinjection of the recombinant adenovirus into duck blastoderm. Step D: Breeding chimera with wild-type duck (SEQ ID NO: 33 shown). Step E: Screening offspring with genome-edition in myostatin gene (SEQ ID NOS: 34 and 35 shown, respectively, from top to bottom).

DETAILED DESCRIPTION

General Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs.

Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. By “about” is meant within 10% of the value, e.g., within 9, 8, 8, 7, 6, 5, 4, 3, 2, or 1% of the value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed.

The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of’ can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. Throughout the description and claims of this specification the word “comprise” and other forms of the word, such as “comprising” and “comprises,” means including but not limited to, and is not intended to exclude, for example, other additives, components, integers, or steps.

As used in the specification and claims, the singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “an agent” includes a plurality of agents, including mixtures thereof.

As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

"Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.

By “reduce,” or “abrogate,” (used interchangeably) or other forms of the word, such as “reducing” or “reduction,” or “abrogating” or “abrogation” is meant lowering of an event or characteristic. It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to.

By “increase” or other forms of the word, such as “increasing,” is meant raising or elevating. It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to.

“Control” refers to a sample or standard used for comparison with an experimental sample. In some embodiments, the control is a sample obtained from a healthy subject (or a plurality of healthy subjects), such as a subject or subjects not expected or known to have a particular polymorphism. In additional embodiments, the control is a historical control or standard reference value or range of values (such as a previously tested control sample or plurality of such samples), or group of samples that represent baseline or normal values. A positive control can be an established standard that is indicative of a specific methylated nucleotide. In some embodiments a control nucleic acid is one that lacks a particular methylated nucleotide, and is used in assays for comparison with a test nucleic acid, to determine if the test nucleic acid includes the methylated nucleotide.

“Detecting” is used herein to identify the existence, presence, or fact of something. General methods of detecting are known to the skilled artisan and may be supplemented with the protocols and reagents disclosed herein. For example, included herein are methods of detecting a nucleic acid molecule in sample. Detection can include a physical readout, such as fluorescence output. The term “hybridization” is defined as forming base pairs between complementary regions of two strands of DNA, RNA, or between DNA and RNA, thereby forming a duplex molecule, for example. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (such as the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions for attaining particular degrees of stringency are discussed in Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, N.Y. (chapters 9 and 11).

An “isolated” biological component (such as a nucleic acid molecule) has been substantially separated, produced apart from, or purified away from other biological components. Nucleic acid molecules which have been “isolated” include nucleic acids molecules purified by standard purification methods, as well as those chemically synthesized. Isolated does not require absolute purity, and can include nucleic acid molecules that are at least 50% isolated, such as at least 75%, 80%, 90%, 95%, 98%, 99% or even 100% isolated.

A “nucleic acid” is a deoxyribonucleotide or ribonucleotide polymer, which can include analogues of natural nucleotides that hybridize to nucleic acid molecules in a manner similar to naturally occurring nucleotides. In a particular example, a nucleic acid molecule is a single stranded (ss) DNA or RNA molecule, such as a probe or primer. In another particular example, a nucleic acid molecule is a double stranded (ds) nucleic acid, such as a target nucleic acid. Examples of modified nucleic acids are those with altered backbones, such as peptide nucleic acids (PNA).

The major nucleotides of DNA are deoxyadenosine 5 '-triphosphate (dATP or A), deoxy guanosine 5 '-triphosphate (dGTP or G), deoxy cytidine 5 '-triphosphate (dCTP or C) and deoxythymidine 5 '-triphosphate (dTTP or T). The major nucleotides of RNA are adenosine 5 '-triphosphate (ATP or A), guanosine 5 '-triphosphate (GTP or G), cytidine 5 '-triphosphate (CTP or C) and uridine 5 '-triphosphate (UTP or U).

Nucleotides include those nucleotides containing modified bases, modified sugar moieties and modified phosphate backbones, as known in the art.

Examples of modified base moieties which can be used to modify nucleotides at any position on its structure include, but are not limited to: 5 -fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N-6- isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3 -methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5 '-methoxy carboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 5- methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2- carboxypropyl)uracil, and 2,6-diaminopurine.

Examples of modified sugar moieties which may be used to modify nucleotides at any position on its structure include, but are not limited to: arabinose, 2-fluoroarabinose, xylose, and hexose, or a modified component of the phosphate backbone, such as phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, or a formacetal or analog thereof.

The term “complementary binding” as used herein occurs when the base of one nucleic acid molecule forms a hydrogen bond to the base of another nucleic acid molecule. Normally, the base adenine (A) is complementary to thymidine (T) and uracil (U), while cytosine (C) is complementary to guanine (G). For example, the sequence 5'-ATCG-3' of one ssDNA molecule can bond to 3'-TAGC-5' of another ssDNA to form a dsDNA. In this example, the sequence 5'-ATCG-3' is the reverse complement of 3'-TAGC-5'. Nucleic acid molecules can be complementary to each other even without complete hydrogen-bonding of all bases of each molecule. For example, hybridization with a complementary nucleic acid sequence can occur under conditions of differing stringency in which a complement will bind at some but not all nucleotide positions.

A “polymorphism” is a variation in a gene sequence. The polymorphisms can be those variations (DNA sequence differences, e.g., substitutions, deletions, or insertions) which are generally found between individuals or different ethnic groups and geographic locations which, while having a different sequence, produce functionally equivalent gene products. Typically, the term can also refer to variants in the sequence which can lead to gene products that are not functionally equivalent. Polymorphisms also encompass variations which can be classified as alleles and/or mutations which can produce gene products which may have an altered function. Polymorphisms also encompass variations which can be classified as alleles and/or mutations which either produce no gene product or an inactive gene product or an active gene product produced at an abnormal rate or in an inappropriate tissue or in response to an inappropriate stimulus. Alleles are the alternate forms that occur at the polymorphism.

Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule or protein that is linked to the variation.

The identity/similarity between two or more nucleic acid sequences is expressed in terms of the identity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are.

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5: 151-3, 1989; Corpet et al., Nuc. Acids Res. 16: 10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biotechnology (NCBI, National Library of Medicine, Building 38 A, Room 8N805, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. Additional information can be found at the NCBI web site. BLASTN is used to compare nucleic acid sequences. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.

Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (1166=1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer. In another example, a target sequence containing a 20-nucleotide region that aligns with 20 consecutive nucleotides from an identified sequence as follows contains a region that shares 75 percent sequence identity to that identified sequence (that is, 15=20*100=75). One indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions, as described above.

A “sample,” such as a biological sample, is a sample obtained from a subject. As used herein, biological samples include all clinical samples useful for detection of a methylated nucleotide, including, but not limited to, cells, tissues, and bodily fluids, such as: blood; derivatives and fractions of blood, such as serum; urine; sputum; or CVS samples. In a particular example, a sample includes blood obtained from a human subject, such as whole blood or serum.

A “test nucleic acid molecule” refers to a nucleic acid molecule whose detection, quantitation, qualitative detection, characterization, or a combination thereof, is intended. For example, the test nucleic acid molecule can be a defined region or particular portion of a nucleic acid molecule, for example a portion of a genome (such as a gene or a region of DNA or RNA containing a gene or portion thereof of interest). The nucleic acid molecule need not be in a purified form. Various other nucleic acid molecules can also be present with the test nucleic acid molecule. For example, the test nucleic acid molecule can be a specific nucleic acid molecule (which can include RNA or DNA), for which the detection of a particular polymorphism is intended. In some examples, a test nucleic acid includes a viral nucleic acid molecule, or a bacterial nucleic acid molecule. Purification or isolation of the test nucleic acid molecule, if needed, can be conducted by methods known to those in the art, such as by using a commercially available purification kit or the like.

By “contacting” is meant placement in direct physical association, for example solid, liquid or gaseous forms. Contacting includes, for example, direct physical association of fully- and partially-solvated mole As used herein, the term "CRISPRs" or "Clustered Regularly Interspaced Short “Palindromic Repeats" refers to an acronym for DNA loci that contain multiple, short, direct repetitions of base sequences. Each repetition contains a series of bases followed by 30 or so base pairs known as "spacer" sequence. The spacers are short segments of DNA from a virus and may serve as a 'memory' of past exposures to facilitate an adaptive defense against future invasions, (Doudna et al. Genome editing. The new frontier of genome engineering with CRISPR-Cas9" Science 346(6213): 1258096 (2014)).

As used herein, the term "Cas" or "CRISPR-associated (cos)" refers to genes often associated with CRISPR repeat-spacer arrays.

As used herein, the term "Cas9" refers to a nuclease from type II CRISPR systems, an enzyme specialized for generating double-strand breaks in DNA, with two active cutting sites (the HNH and RuvC domains), one for each strand of the double helix. tracrRNA and spacer RNA. may be combined into a "single-guide RNA" (sgRNA) molecule that, mixed with Cas9, could find and cleave DNA targets through Watson-Crick pairing between the guide sequence within the sgRNA and the target DNA sequence, (Jinek et al. A programmable dual-RNA- guided DNA endonuclease in adaptive bacterial immunity" Science 337(6096):816-821 (2012)).

As used herein, the term "catalytically active Cas9" refers to an unmodified Cas9 nuclease comprising full nuclease activity.

The term "nickase" as used herein, refers to a nuclease that cleaves only a single DNA strand, either due to its natural function or because it has been engineered to cleave only a single DNA strand. Cas9 nickase variants that have either the RuvC or the HNH domain mutated provide control over which DNA strand is cleaved and which remains intact. (Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity" Science 337(6096):816-821 (2012) and Cong et ai. Multiplex genome engineering using CRISPR/Cas systems" Science 339(6121): 8J 9-823 (2013)).

The term, "trans-activating crRNA", "tracrRNA" as used herein, refers to a small trans- encoded RNA. For example, CRISPRCas (clustered, regularly interspaced short palindromic repeats/CRISPR-associated proteins) constitutes an RNA-mediated defense system, which protects against viruses and plasmids. This defensive pathway has three steps. First a copy of the invading nucleic acid is integrated into the CRISPR locus. Next, CRISPR RNAs (crRNAs) are transcribed from this CRISPR locus. The crRNAs are then incorporated into effector complexes, where the crRNA guides the complex to the invading nucleic acid and the Cas proteins degrade this nucleic acid. There are several pathways of CRISPR activation, one of which requires a tracrRNA, which plays a role in the maturation of crRNA. TracrRNA is complementary to the repeat sequence of the pre-crRNA, forming an RNA duplex. This is cleaved by RNase III, an RNA-specific ribonuclease, to form a crRNA/tracrRNA hybrid. This hybrid acts as a guide for the endonuclease Cas9, which cleaves the invading nucleic acid.

The term "protospacer adjacent motif (or PAM) as used herein, refers to a DNA sequence that may be required for a Cas9/sgRNA to form an R-loop to interrogate a specific DNA sequence through Watson-Crick pairing of its guide RNA with the genome. The PAM specificity may be a function of the DNA-binding specificity of the Cas9 protein (e.g., a "protospacer adjacent motif recognition domain" at the C-terminus of Cas9).

The terms "protospacer adjacent motif recognition domain", "PAM Interacting Domain" or "PID" as used herein, refers to a Cas9 amino acid sequence that comprises a binding site to a DNA target PAM sequence.

The term "binding site" as used herein, refers to any molecular arrangement having a specific tertiary and/or quaternary structure that undergoes a physical attachment or close association with a binding component. For example, the molecular arrangement may comprise a sequence of amino acids. Alternatively, the molecular arrangement may comprise a sequence a nucleic acids. Furthermore, the molecular arrangement may comprise a lipid bilayer or other biological material . As used herein, the term "sgRNA" refers to single guide RNA used in conjunction with CRISPR associated systems (Cas). sgRNAs are a fusion of crRNA and tracrRNA and contain nucleotides of sequence complementary to the desired target site. Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity" Science 337(6096): 816- 821 (2012) Watson-Crick pairing of the sgRNA with the target site permits R-loop formation, which in conjunction with a functional PAM permits DNA cleavage or in the case of nuclease- deficient Cas9 allows binds to the DNA at that locus.

As used herein, the term "orthogonal" refers to targets that are non-overlapping, uncorrelated, or independent. For example, if two orthogonal Cas9 isoforms were utilized, they would employ orthogonal sgRNAs that only program one of the Cas9 isoforms for DNA recognition and cleavage. (Esvelt et al., "Orthogonal Cas9 proteins for RNA-guided gene regulation and editing" Nat Methods 10(11): 1116-1121 (2013)).

The term "truncated" as used herein, when used in reference to either a polynucleotide sequence or an amino acid sequence means that at least a portion of the wild type sequence may be absent. In some cases, truncated guide sequences within the sgRNA or crRNA may improve the editing precision of Cas9. (Fu, et al. "Improving CRISPR-Cas nuclease specificity using truncated guide RNAs" Nat Biotechnol. 2014 Mar;32(3):279-284 (2014)).

The term "base pairs" as used herein, refer to specific nucleobases (also termed nitrogenous bases), that are the building blocks of nucleotide sequences that form a primary structure of both DNA and RNA. Double-stranded DNA may be characterized by specific hydrogen bonding patterns. Base pairs may include, but are not limited to, guanine-cytosine and adenine-thymine base pairs.

The term "specific genomic target" as used herein, refers to any pre-determined nucleotide sequence capable of binding to a Cas9 protein contemplated herein. The target may include, but may be not limited to, a nucleotide sequence complementary to a programmable DNA binding domain or an orthogonal Cas9 protein programmed with its own guide RNA, a nucleotide sequence complementary to a single guide R A, a protospacer adjacent motif recognition sequence, an on-target binding sequence and an off-target binding sequence.

The term "on-target binding sequence" as used herein, refers to a subsequence of a specific genomic target that may be completely complementary to a programmable DNA binding domain and/or a single guide RNA sequence.

The term "off-target binding sequence" as used herein, refers to a subsequence of a specific genomic target that may be partially complementary to a programmable DNA binding domain and/or a single guide RNA sequence.

The term "fails to bind" as used herein, refers to any nucleotide-nucleotide interaction or a nucleotide-amino acid interaction that exhibits partial complementarity, but has insufficient complementarity for recognition to trigger the cleavage of the target site by the Cas9 nuclease. Such binding failure may result in weak or partial binding of two molecules such that an expected biological function (e.g., nuclease activity) fails.

The term "cleavage" as used herein, may be defined as the generation of a break in the DNA. This could be either a single-stranded break or a double-stranded break depending on the type of nuclease that may be employed.

As used herein, the term "edit" "editing" or "edited" refers to a method of altering a nucleic acid sequence of a polynucleotide (e.g., for example, a wild type naturally occurring nucleic acid sequence or a mutated naturally occurring sequence) by selective deletion of a specific genomic target or the specific inclusion of new sequence through the use of an exogenously supplied DNA template. Such a specific genomic target includes, but may be not limited to, a chromosomal region, mitochondrial DNA, a gene, a promoter, an open reading frame or any nucleic acid sequence.

Methods of Modifying Myostatin Gene in Birds, as well as Vectors and Transgenic Avians Thereof

Poultry is one of the most important meat sources in a human’s diet and increased meat yield can bring a huge economic benefit to the poultry industry. To enhance meat yield, genetic selection for a bigger chicken has been applied traditionally and resulted in great success with bigger body weight and higher feed efficiency (Hunton 2006). Among genetic factors that contribute to muscle growth, myostatin (MSTN), also known as growth differentiation factor 8, is one of the most well-known and prominent genes that can be targeted to increase muscle growth. MSTN is mainly expressed in skeletal muscle and negatively regulates the growth of muscle (McPherron 1997). This inhibitory effect on muscle growth has been further confirmed by n MSTN mutation resulting in increased muscle mass (Lee 2020, herein incorporated by reference in its entirety for its teaching concerning MSTN gene mutations).

As a member of the transforming growth factor- (TGF-P) superfamily, the MSTN gene is translated into a precursor protein (prepro-MSTN) and prepro-MSTN consists of three parts, N-terminal signal peptide, MSTN propeptide, and C-terminal mature MSTN domain (McFarlane 2005). The prepro-MSTN undergo three proteolytic processes to give rise to functional mature MSTN. Initially, pro-MSTN is generated by removal of signal peptide from prepro-MSTN and forms a homodimer. Subsequently, furin, a calcium-dependent serine protease, cleaves the proteolytic processing site (RXXR) between propeptide and mature MSTN (Lee 2001). After the cleavage of pro-MSTN, mature MSTN is non-covalently bound to propeptide, resulting in the formation of a latent MSTN complex (Lee 2001). For mature MSTN to be biologically active, propeptide needs to be cleaved by the bone morphogenetic protein- 1/tolloid family of metalloproteinases and release mature MSTN from the latent MSTN complex. The active dimer of mature MSTN binds to activin receptor type 2B (ACVR2B) and activates type-1 activin receptor serine kinases, ALK4 and ALK5. Subsequently, Smad 2 and 3 are phosphorylated and translocated to the nucleus to initiate changes in downstream gene transcription, which eventually inhibit muscle differentiation and growth (Trendelenburg 2009). To inhibit the anti-myogenic function of MSTN, the entire MSTN gene (Lv 2016) or mature domain encoding region (Bi 2016; He 2018) can be disrupted by genetic mutations using CRISPR/Cas9, a powerful genome editing tool.

Disclosed herein is a transgenic avian comprising an artificial heterozygous or homozygous disruption in its myostatin gene (MSTN , wherein said disruption results in an artificial suppression of myostatin; and further wherein resulting offspring of the transgenic avian also comprise the disruption. Importantly, germline mosaic founder avian lines were generated without using primordial germ cell (PGC)-mediated procedures, which was the method previously used in the prior art. The transgenic avians disclosed herein were created by injecting a modified viral vector containing the CRISPR/Cas9 system directly into avian blastoderms (Examples 1 and 2).

The CRIPSR/Cas system for genome editing contains two distinct components: a guide RNA (gRNA) and an endonuclease, e.g. Cas9. The gRNA is typically a 20- nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA/Cas9 complex is recruited to the target sequence by basepairing between the gRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break.

The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both domains are active, the Cas9 causes double strand breaks in the genomic DNA. A significant advantage of CRISPR/Cas is that the high efficiency of this system coupled with the ability to easily create synthetic gRNAs enables multiple genes to be targeted simultaneously. Apparent flexibility in the base-pairing interactions between the gRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cut by Cas9.

To create the transgenic avian line disclosed herein, gRNAs were first designed. The sequences for the MSTN gene was obtained from NCBI for duck (XM_005011412), and potential variations were examined by sequencing of MSTN cDNA of several Pekin ducks. One of skill in the art is apprised how to select and design gRNAs. This can be done, for example, by using a publicly available on-line bioinformatics program. An example of a gRNA which can be used includes, but is not limited to, SEQ ID NO: 1 (GACTGTGCAATGCTTGTACGTGG), or a nucleic acid with 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to SEQ ID NO: 1.

The next step in creating the transgenic avian disclosed herein is the construction of a viral vector which comprises the CRISPR/Cas9. There are many available CRISPR/Cas9 systems available, and one of skill in the art can readily determine which is appropriate, and obtain it commercially.

Regarding the viral vector, one of skill in the art can determine which is suitable for creating the transgenic avians described herein. Such vectors are commonly used in gene transfer and gene therapy applications. Different viral vector systems have their own unique advantages and disadvantages. Examples of suitable vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, alphavirus vectors, herpes simplex viral vectors, retroviral vectors, or lentiviral vectors. In a specific embodiment, an adenovirus can be used.

One very important aspect of the present invention is that an avian promoter is used in creating the viral vector. An example of such as promoter is the 7SK promoter, which can be found in quail (Ahn 2017, herein incorporated by reference in its entirety for its teaching concerning the 7SK promoter and its use in a vector). For example, in an adenovirus vector, the human U6 promoter can be replaced with the 7SK promoter. The desired gRNA sequences can then be inserted (Lee 2019; Lee 2020). (Example 2 and Ahn 2017). The selected gRNA in avian-optimized Cas9 expression cassette can then be integrated into the appropriate vector. Recombinant viral vectors can then be produced using methods known to those of skill in the art (Lee 2019; Lee 2020, both included by reference in their entirety for their teachings concerning viral vector production).

The engineered viral vector can then be injected directly into a blastoderm (Lee 2019; Lee 2020; Shin 2014; Ahn 2015). In birds, an oocyte is transported into the oviduct after ovulation, and fertilized in the initial section of the oviduct into which the oocyte is transported, the infundibulum, within 15 minutes after ovulation; the egg is laid within about 24 hours. After fertilization, the 1-cell zygote rapidly proliferates up to ~60,000 cells at the time of egg laying. As a result of rapid cell proliferation of the zygote in the oviduct, it is difficult to access the zygote in vivo at the 1-cell stage for genome editing. In addition, it is challenging to surgically remove, genetically modify, and surgically transplant the zygote attached to the fragile yolk into the oviduct of the recipient. For these reasons, using PGCs is not ideal. The method of producing transgenic avians disclosed herein allows for direct injection of the adenoviral CRISPR/Cas9 vector into the blastoderm (Lee 2019, herein incorporated by reference in its entirety for its teaching concerning direct delivery of CRISPR/Cas9 into blastoderm). Examples 1 and 2 provide details regarding how CRISPR/Cas9 can be introduced into the blastoderm. This method provides a rapid way to generate knockout birds by avoiding the need for PGC culture and genome modification in vitro before injection into the embryo.

Once the blastoderm has been transformed, the first generation of birds (Gl) can be hatched, grown, and bred. For example, a heterozygous female can be identified (MSTN+/-) and can be bred with a wild-type male. Offspring from this breeding pair can be genotyped and are expected to have a 50:50 ratio for MSTN+/-: MSTN+/+ at generation 2 (G2).This combination can be bred, and the G3 offspring are expected to have three different genotypes (MSTN+/+, +/-, -/-) which are then used for examining body, muscle and fat weights, and feed efficiency. Therefore, a transgenic avian line comprising an artificial heterozygous or homozygous disruption in its myostatin gene (MSTN).

The transgenic avian disclosed herein can have any genetic modification which leads to a reduction in myostatin activity. For example, the modification can lead to a disruption in MSTN expression. Modification may be accomplished by the introduction (insertion), substitution (replacement) or removal (deletion) of one or more nucleotides in the MSTN gene, or within a regulatory region thereof. There are a variety of means known to those of skill in the art for modifying genes, including the CRISPR/Cas9 system. The modification can be derived from imprecise non-homologous end joining (NHEJ)-mediated repair that can produce insertion and/or deletion mutations of variable length at the site of the double strand break created by the Cas9 molecule. The insertion, deletion, or substation can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more bases in length.

The transgenic avian of claim 3, wherein said deletions comprise one or more base pair insertions in MSTN.

The transgenic avian can be any type of avian. Examples include, but are not limited to, duck, chicken, turkey, quail, pheasant, geese, pigeon, ostrich, emu, guinea fowl, or partridge.

The transgenic avian disclosed herein can have any attribute associated with lack of myostatin production. This can mean, for example, increased skeletal muscle growth. When skeletal muscle growth is increased, it can be increased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%,

40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%,

56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%,

72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%,

88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% or more in a transgenic avian with a modified MSTN gene as compared to a control without a modified MSTN gene. In a specific example, the transgenic avian has about 20%-30% increased skeletal muscle growth. In a more specific example, the transgenic avian has about 25% increased skeletal muscle growth.

Also contemplated herein is that the transgenic avian can have less fat accretion. When fat accretion is decreased, it can be decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,

26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,

42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%,

58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%,

74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%,

90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% in a transgenic avian with a modified MSTN gene as compared to a control without a modified MSTN gene. In a specific example, the transgenic avian has about 20% to 40% less fat accretion. In a more specific example, the transgenic avian has about 30% less fat accretion.

Also contemplated herein is that the transgenic avian with a shorter time to reach market age. For example, the time to market can be 1, 2, 3, 4, 5, 6, or 7 days less, or 1, 2, 3, or 4 weeks less (or more) in a transgenic avian with a modified MSTN gene as compared to a control without a modified MSTN gene. In a specific example, the transgenic avian has about 3-10 days less time to market age. In a more specific example, the transgenic avian has about 7 days less time to market age.

Using the methods described herein, the transgenic animal can have myostatin levels which are reduced by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% in a transgenic avian with a modified MSTN gene as compared to a control without a modified MSTN gene. Typically, this reduction can be 100%, so that the myostatin gene is not expressed at all, and no significant amount of myostatin is produced at all.

Disclosed herein is a vector encoding a CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises gRNAs which are specific for MSTN gene, and further wherein expression of the CRISPR/Cas9 system is under control of an avian 7SK promoter. Production of such a promoter is described above. The CRISPR/Cas9 system encoded by the vector can edit the MSTN gene thereof in a manner resulting in inactivation of myostatin. One specific example of a vector which works with the transgenic avians described herein is recombinant adenovirus type 5. Also described is a cell which has been transformed with this vector, such as blastoderm cell. Further described herein is a nucleic acid encoding this vector. Examples of such vectors which can be used with the methods disclosed herein include, but are not limited to, lentiCRISPR v2; Addgene plasmid # 52961 and Adeno Cas9; Addgene plasmid # 64072. These vectors are modified according to the methods described herein.

As described above, the transgenic avians of this invention can be made with specific methods, which are also novel. Specifically, this method comprises producing an avian with targeted mutations in MSTN gene to inactive functions of proteins , the method comprising the steps of introducing the vector described above into an avian primordial germ cell in blastoderm; utilizing the promoter within the vector which controls the CRISPR/Cas9 system, thereby expressing the CRISPR/Cas9 system, which results in alteration of the MSTN gene thereof, thereby producing avian embryos containing genome-edited germ cells; placing eggs containing embryos with genome-edited germ cells under conditions suitable for development, thereby producing chimeric avian with genome-edited germ cells in MSTN gene; and producing genome-edited offspring from breeding of chimeric avians. As described above, the vector is introduced into an avian blastoderm, which is then introduced into an avian egg, which can lead to offspring. These offspring are herein contemplated as part of the invention.

Methods of Modifying Melanophilin Gene in Birds, as well as Vectors and Transgenic Avians Thereof

The methods described above can also be applied to create transgenic avians with a modified melanophilin (MLPH) gene. The MLPH gene provides instructions for making a protein called melanophilin. This protein is found in pigment-producing cells called melanocytes, where it helps transport structures called melanosomes. These structures produce a pigment called melanin, which is the substance that gives skin, hair, and eyes their color (pigmentation). Melanophilin interacts with proteins produced from the MY05A and RAB27A genes to form a complex that transports melanosomes to the outer edges of melanocytes. From there, the melanosomes are transferred to other types of cells, where they provide the pigment needed for normal hair, skin, and eye coloring.

The methods and vectors described above can be employed with the exact same procedures described above, but with the MLPH gene being modified rather than the MSTN gene. Therefore, contemplated herein is a vector encoding a CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises gRNAs which are specific for MLPH gene, and further wherein expression of the CRISPR/Cas9 system is under control of an avian 7SK promoter. An example of a gRNA which can be used with this vector is SEQ ID NO: 2 (AGGTGTAGAAGCGGCAATCCAGG), or a nucleic acid with 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to SEQ ID NO: 2. The modified MLPH gene can result in inactivation of melanophilin. Also contemplated herein is a transgenic avian with a modified MLPH gene, produced by the methods outlined herein in regard toMSTN transgenic birds.

Stated explicitly, disclosed herein is a method of producing an avian with targeted mutations to MLPH gene to inactive functions of proteins , the method comprising the steps of: introducing the vector of claim 8 into an avian primordial germ cell in blastoderm; utilizing the promoter within the vector which controls the CRISPR/Cas9 system, thereby expressing the CRISPR/Cas9 system, which results in alteration of the MLPH gene thereof, thereby producing avian embryos containing genome-edited germ cells; placing eggs containing embryos with genome-edited germ cells under conditions suitable for development, thereby producing chimeric avian with genome-edited germ cells in MLPH gene; and producing genome-edited offspring from breeding of chimeric avians.

EXAMPLES

Example 1: Generation of genome-edited chicken and duck lines by adenovirus- mediated in vivo genome editing

Conventional avian genome editing is mediated by isolation, culture, and genome editing of primordial germ cells (PGCs), screening and propagating the genome-edited PGCs, and transplantation of the PGCs into recipient embryos. The PGC-mediated procedures, however, are technically difficult and therefore, the conventional method has previously been utilized only in chickens. Here, germline mosaic founder chicken and duck lines were generated without the PGC-mediated procedures by injecting an adenovirus containing the CRISPR/Cas9 system into avian blastoderms. Genome-edited chicken and duck offspring produced from the founders carried different insertion or deletion mutations without mutations in the potential off-target sites. The data demonstrate successful applications of the adenovirus-mediated method for production of genome-edited chicken and duck lines.

Provided herein is an example of an adenovirus-mediated genome editing method that resulted in the production of targeted gene knockout quail without PGC-mediated in vitro procedures (Lee 2019). With this method, an adenovirus containing the CRISPR/Cas9 system was injected into a quail blastoderm, resulting in germline mosaic founder quail that went on to produce genome-edited offspring. This indicates in vivo blastodermal PGCs were efficaciously induced for genome editing as a consequence of injecting the adenovirus. The adenovirus can be injected into blastoderms of any avian species to induce genome editing in the blastodermal PGCs, which develop into germline mosaic founder birds for production of genome-edited offspring. To address this, the adenovirus containing the CRISPR/Cas9 system with the gRNA targeting melanophilin (MLPH) gene, termed Adeno-MLPH, and myostatin (MSTN) gene, termed Adeno-MSTN, was injected into chicken and duck blastoderms, respectively, and confirmed genome editing in their offspring.

Results and Discussion

Injection of Adeno-MLPH into chicken blastoderms generates germline mosaic founders and genome -edited offspring. The adenovirus-mediated method was initially applied to chickens because this species is the most available, economically important, and scientifically investigated avian species. After oviposition, approximately 30 PGCs are located in the central region of the chicken blastoderm (Tsunekawa 2000) that consists of 60,000 cells (Pokhrel 2017), and the blastodermal PGCs can be genetically edited by injecting the Adeno-MLPH into the subgerminal cavity beneath the epiblast, a single-cell layer of the blastoderm (Fig. 1). The MLPH gene involved in melanosome transportation (Matesic 2001) and feather pigmentation (Lee 2019) was targeted in Rhode Island Red chickens to provide a visual phenotypic marker in the brown feathers. To produce genome-edited chickens, 17 potential germline mosaic founder birds (GO) were hatched from 100 injected eggs and then mated with wild-type (WT) chickens. Multiple genome-edited offspring (Gl) with different heterozygous deletion mutations (1, 3, 9, 13, 21, and 23 bp deletions) were hatched from seven founder chickens with the result being 41.2% of germline mosaicism of the founder birds and 2%, 2.2%, 5.3%, 6%, 7%, 9%, and 11% of germline transmission efficiencies of each of the founders (Fig. 2A). As depicted in Fig. 2B, only the homozygous mutant chickens (G2) had gray feathers that confirmed autosomal recessive inheritance of the MLPH mutation. These results were the first where the adenovirus-mediated method was used to generate genome-edited chickens without utilization of the conventional PGC-mediated method.

Injection of Adeno-MSTN into duck blastoderms generates germline mosaic founder and genome-edited offspring. The application of the adenovirus-mediated method was subsequently extended to other avian species. Although the duck is one of the major poultry species globally, in vivo genome editing in ducks has not previously been reported. The duck MSTN gene was therefore targeted, an anti-myogenic regulator (McPherron 1997), using the adenovirus-mediated method. After injection of the Adeno-MSTN into the duck blastoderm, 10 mosaic founder ducks (GO) were hatched from 91 injected eggs and subsequently mated with WT ducks. As a result, one heterozygous mutant offspring (Gl) with a 1 bp insertion mutation was produced, with there being 10% germline mosaicism of the founder lines and 2% germline transmission efficiency (Fig. 2A). This outcome is the initial reporting of the generation of a genome-edited duck line without utilization of the conventional method, providing the first genome-edited duck model for gaining insight into MSTN functions for future studies.

Off-target mutation was not identified in the genome-edited chicken and duck lines. Potential off-target mutation in the genome of the heterozygous mutant Gl chicken and duck lines were also assessed. Potential off-target sites were selected based on large homology scores with the gRNA sequence by using a NCBI tool for BLAST Genome in chicken (GCF_016699485.2) and duck (GCF 015476345.1) (Table 1). None of the potential off- target sites for MLPH and MSTN genes in the Gl chicken and duck lines, respectively, had any mutations. As a nonintegrating viral delivery system (Lee 2017), the utilization of adenovirus has an advantage in minimizing risks of off-target mutation, because transient expression of CRISPR/Cas9 system results in fewer off-target mutations than permanent expression (Ortinski 2017). In addition, the capacity of adenovirus is adequate for packaging the large CRISPR/Cas9 system (Lee 2017). Also, the large transduction efficiency and titers of adenovirus are significant advantages when a limited volume of adenovirus, approximately 2 mL, can be administered in the confined subgerminal cavity. Furthermore, because the transduction of turkey and zebra finch in vitro by adenovirus has been reported (Lee 2019; Jung 2021), the adenovirus-mediated method can be utilized to produce genome-edited birds in these avian species. Based on these advantages, adenovirus type 5 is a very efficacious vehicle for delivering the CRISPR/Cas9 system to avian blastodermal cells in vivo for inducing genome editing efficiently and conveniently in blastodermal PGCs to produce genome-edited birds of different species.

Genome editing is the most efficacious technology for gaining an understanding of gene functions, but avian species are perhaps some of the least studied animal species in terms of in vivo genome editing. The conventional PGC-mediated method alone has previously been used to induce genome editing only in chickens. The data here demonstrates successful production of genome-edited chicken and duck lines by using the adenovirus-mediated method. Without having to conduct technically difficult procedures of the conventional method, the method applied in this study can be easily utilized by other researchers for the production of genome-edited birds of various avian species.

Materials and Methods

The eggs of Rhode Island Red chickens and American Pekin ducks were purchased from Eagle Nest Poultry in Oceola, Ohio. Adenovirus was injected into the blastoderms of unincubated eggs, and all birds were maintained in The Ohio State University Poultry Facility in Columbus, Ohio. Experimental activities and animal care were approved by the Institutional Animal Care and Use Committee at The Ohio State University (Protocol 2019A00000024-R1).

Animal Care. Eggs of Rhode Island Red chicken and American Pekin duck were purchased from the Eagle Nest Poultry in Oceola, Ohio. Eggs were incubated at 37.5 °C and 60% relative humidity, and hatched birds were transferred to brooder cages and maintained with ad libitum feeding at The Ohio State University Poultry Facility in Columbus, Ohio. Experimental protocols including experimental activities and animal care were approved by the Institutional Animal Care and Use Committee at The Ohio State University (Protocol 2019A00000024-R1).

Adenovirus production and injection into the avian blastoderm. A lentiviral CRISPR/Cas9 vector purchased from Addgene (lentiCRISPR v2, Plasmid #52961) was previously optimized to avian species by replacing promoters to a quail 7SK promoter and a CBh promoter for gRNA and Cas9 protein expression (Ahn 2017), respectively. The avian optimized CRISPR/Cas9 system was transferred to an adenovirus shuttle vector purchased from Addgene (Adeno Cas9, Plasmid #64072) by replacing the internal CRISPR/Cas9 system to our avian optimized system using Xhol and Agel restriction enzymes and T4 DNA ligase (Lee 2019). Subsequently, a recombinant adenovirus type 5 was produced commercially by ViraQuest Inc. based on the adenovirus shuttle vector containing the avian optimized CRISPR/Cas9 system. The final titers of the recombinant adenovirus for targeting MLPH gene in chicken and MSTN gene in duck were 2.0 x IO¹⁰ PFU/mL and 3.0 x IO¹⁰ PFU/mL, respectively. To inject the adenovirus into the blastoderm, chicken and duck eggs were positioned reversely and laterally for 2 hr each to position the blastoderm on the lateral side of the eggs. After disinfection of the lateral side of the eggshell with 70% ethanol, a small window was made on the lateral apex of the eggshell using tweezers. Through the window, approximately 2 mL of adenovirus was injected into the subgerminal cavity of the blastoderm using a microinjector (MINJ-PD, Tritech Research) and microneedle (1-000-0500, Drummond) prepared with a micropipette puller (PC- 100, Narishige) and grinder (EG-44, Narishige). Adenovirus was precisely injected into the middle of the blastoderm under the visual assistance of a stereo microscope (SZ61, Olympus) with external gooseneck lights and the central region of the blastoderm turned pale when the adenovirus was captured in the subgerminal cavity properly.

Production of genome-edited birds from germline mosaic founder birds. After hatching 17 and 10 potential germline mosaic founders (GO) from 100 and 91 injected chicken and duck eggs, respectively, the founder birds were mated with WT birds to produce offspring (Gl). To identify mutation on the target site from the offspring, approximately 3 mL of blood was obtained from the brachial wing vein using an insulin syringe to extract genomic DNA (gDNA) from blood. The blood cells were lysed using 300 mL of lysis buffer [200 mM NaCl, 50 mM Tris-Cl, 10 mM EDTA, 1% SDS, and 0.1 mg/mL proteinase K solution (25530049, Invitrogen) at pH 8.0] at a heat block of 55 °C for 6 hr, and 300 mL of phenol-chloroform- isoamyl alcohol mixture (77617, Sigma-Aldrich) was added to the lysed blood solution. After vortexing and centrifuging at 15,000 x g for 10 min of each mixture, 240 mL of the supernatant were transferred to a new tube, mixed with 80 mL of ammonium acetate solution (A2706, Sigma-Aldrich) and 240 mL of isopropyl alcohol (3032, Mallinckrodt), inverted multiple times, and centrifuged at 15,000 x g for 10 min to make a pellet of gDNA. Then, the supernatant was removed, and the tube was centrifuged again at the same speed after addition of 300 mL of 70% ethanol to wash. After removal of the ethanol, the pellet was dried and dissolved with 50 mL of TE buffer with RNase A (10 mg/mL, Qiagen). To perform PCR using the gDNA extracted from each offspring’s blood, primer sets for MLPH gene (forward primer, 5’-GACCTGAAGTGCAAGATAGACCA-3’ (SEQ ID NO: 9); reverse primer, 5’- CTAGAAGAGCTGAATTCCCCTTC-3’ (SEQ ID NO: 10) and MSTN gene (forward primer, 5’-GCTGCACTGAATGTGAGATCA-3’(SEQ ID NO: 11); reverse primer, 5’- CGCAGTTTGCTGAGGATTTGAA-3’(SEQ ID NO: 12) were designed based on the chicken (GCF O 16699485.2) and duck (GCF 015476345.1) genome sequences available from NCBI. PCR was performed using AmpliTaq Gold DNA Polymerase (N8080241, ThermoFisher) with an initial incubation at 95 °C for 600 s, followed by 40 cycles at 95 °C for 40 s, 56 °C for 40 s, and 72 °C for 40 s, and final extension at 72 °C for 300 s. The PCR products were analyzed by an agarose gel electrophoresis system (1704466, Bio-Rad) and PCR bands at the target size were extracted using a QIAquick Gel Extraction Kit (28706, Qiagen) and sent for Sanger sequencing at The Ohio State University Comprehensive Cancer Center. By analyzing the chromatogram, heterozygous mutant chickens and ducks were identified and maintained, and heterozygous mutant chickens were further mated with other heterozygous mutant chickens to produce homozygous mutant chickens (G2).

Analysis of off-target mutation in G1 heterozygous mutant birds. Using 23 nucleotide sequences consisting of gRNA sequences and PAM motif, 5'-NGG-3’, as a template, nucleotide sequences having high homology scores, followed by PAM motif, in chicken and duck genomes were screened by the BLAST Genome tool available from NCBI (https://www.ncbi.nlm.nih.gov/genome). Primers sets for MLPH off-target 1 (forward primer, 5’-TGCCTGTTTTCTGAGGAGA-3’(SEQ ID NO: 13); reverse primer, 5’- GGTCTTGCCATGAACTTCA-3’(SEQ ID NO: 14)), MLPH off-target 2 (forward primer, 5’-CATTCTGATTCAGCAAAGCACA-3’(SEQ ID NO: 31); reverse primer, 5’- TCTGAAATGCAGCATCGGAA-3’(SEQ ID NO: 15)), MLPH off-target 3 (forward primer, 5’-AGTTGACAGGGAAGGATTTCA-3’(SEQ ID NO: 16); reverse primer, 5’- ACTTGGCTCAGCCATGAT-3’(SEQ ID NO: 17)), MSTN off-target 1 (forward primer, 5’- AGCCAGAAAGAGTATGCAAGCAA-3’(SEQ ID NO: 18); reverse primer, 5’- AGGATGTGAGAGATGTGAAGTAAGTCA-3’(SEQ ID NO: 19)), MSTN off-target 2 (forward primer, 5’-CTACACTTACTGGAGACACCACTT-3’(SEQ ID NO: 20); reverse primer, 5’-GAAGGGACCTCTGGAGATCT-3’(SEQ ID NO: 21)), and MSTN off-target 3 (forward primer, 5’-GGGAGCGTTCAGCTATAGTATTCA-3’(SEQ ID NO: 22); reverse primer, 5’-GGTTCCTACAGTCTTTCCACCAA-3’(SEQ ID NO: 23)) were designed based on the chicken and duck genome sequences. PCR was performed following the same PCR conditions with adjustment of the annealing temperature according to the melting temperature of primers. After agarose gel electrophoresis, extraction of PCR bands, and Sanger sequencing, off-target mutation was analyzed.

Example 2: Process for Creating MSTN Heterozygous Ducks

1. Selection of three gRNAs: The sequences for the MSTN gene was obtained from NCBI for duck (XM 005011412), and potential variations were examined by actual sequencing of MSTN cDNA of several Pekin ducks. The gRNAs with the largest on-target scores among all potential gRNAs were selected by searching for the NGG PAM sequence followed by a 20-base pair target sequence for S. pyogenes Cas9 (SpCas9) using a publicly available online bioinformatics program (Kim 2021; Lee 2019).

2. Construction of adenoviral vector containing CRISPR/Cas9: A commercially available CRISPR/Cas9 system was modified to use in the avian species by replacing the human U6 promoter with a quail 7SK promoter and transferred to an adenovirus shuttle vector for adenoviral production after selection of gRNA (Lee 2019; Lee 2020). To insert the selected gRNA, each of a pair of oligos (1 nM per each oligo) for the targeting sequence were annealed with the targeting vector by T4 PNK (#M0201, NEB) (Ahn 2017). The final constructed targeting vector which contains targeting guide sequences were confirmed by Sanger sequencing at The Ohio State University DNA Sequencing Core Facility.

3. Recombinant adenovirus production: The selected gRNA in avian-optimized Cas9 expression cassette was integrated into the adenoviral shuttle vector. Recombinant adenovirus were produced using procedures that we have previously described (Lee 2019; Lee 2020).

4. Injection of Adenovirus into blastoderm: For injection of the CRISPR/Cas9 adenovirus, microneedles were prepared and attached to a microinjector as described (Lee 2019; Lee 2020; Shin 2014; Ahn 2015). Two pL (0.5-1 x 108 PFU) of recombinant adenovirus were injected into the central area of the blastoderm by visualization using a stereomicroscope (SZ61, Olympus). The eggs were rotated automatically in the incubator.

5. GO hatching, growing, and breeding: A total of 10 potential GO germ-line chimeric birds were produced, maintained, and bred in the Department of Animal Sciences Poultry Facility in Columbus, Ohio. When the chimeric birds develop to sexually maturity, they were mated with wild-type ducks in separate cages and eggs were collected and hatched.

6. G1 hatching, growing, and breeding: At 2 weeks of age, wing feathers were collected, and genomic DNA were extracted for genotyping (20-40 offspring) by sequencing the target area of MSTN gene. One female G1 MSTN+/- duck was identified. 7. Propagating G1 MSTN+/- ducks: The female G1 MSTN+/- was bred with wild-type male duck. Offspring from this breeding pair are genotyped and expected for 50:50 ratio for MSTN+/-: MSTN+/+ at generation 2 (G2).

8. Breeding of MSTN heterozygous ducks: The G3 offspring with three different genotypes (MSTN+/+, +/-, -/-) are used for examining body, muscle and fat weights, and feed efficiency.

REFERENCES

1. B. Schusser, et al., Immunoglobulin knockout chickens via efficient homologous recombination in primordial germ cells. Proc. Natl. Acad. Sci. U. S. A. 110, 20170-20175 (2013).

2. T. S. Park, H. J. Lee, K. H. Kim, J.-S. Kim, J. Y. Han, Targeted gene knockout in chickens mediated by TALENs. Proc. Natl. Acad. Sci. U. S. A. Ill, 12716-12721 (2014).

3. I. Oishi, K. Yoshii, D. Miyahara, H. Kagami, T. Tagami, Targeted mutagenesis in chicken using CRISPR/Cas9 system. Sci. Rep. 6, 23980 (2016).

4. J. N. Kim, et al., Detection and characterization of primordial germ cells in pheasant (Phasianus colchicus) embryos. Theriogenology 63, 1038-1049 (2005).

5. T. S. Park, M. A. Kim, J. M. Lim, J. Y. Han, Production of quail (Coturnix japonica) germline chimeras derived from in vitro-cultured gonadal primordial germ cells. Mol. Reprod. Dev. 75, 274-281 (2008).

6. A. J. Wade, N. A. French, G. W. Ireland, The potential for archiving and reconstituting valuable strains of turkey (Meleagris gallopavo) using primordial germ cells. Poult. Sci. 93, 799-809 (2014).

7. Y.-C. Chen, et al., In vitro culture and characterization of duck primordial germ cells. Poult. Sci. 98, 1820-1832 (2019).

8. K. M. Jung, et al., Identification and characterization of primordial germ cells in a vocal learning Neoaves species, the zebra finch. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 33, 13825-13836 (2019).

9. J. Lee, J. Ma, K. Lee, Direct delivery of adenoviral CRISPR/Cas9 vector into the blastoderm for generation of targeted gene knockout in quail. Proc. Natl. Acad. Sci. U. S. A. 116, 13288-13292 (2019).

10. N. Tsunekawa, M. Naito, Y. Sakai, T. Nishida, T. Noce, Isolation of chicken vasa homolog gene and tracing the origin of primordial germ cells. Development 127, 2741- 2750 (2000). 11. N. Pokhrel, E. Ben-Tai Cohen, O. Genin, D. Sela-Donenfeld, Y. Cinnamon, Cellular and morphological characterization of blastoderms from freshly laid broiler eggs. Poult. Set. 96, 4399-4408 (2017).

12. L. E. Matesic, et al., Mutations in Mlph, encoding a member of the Rab effector family, cause the melanosome transport defects observed in leaden mice. Proc. Natl. Acad. Sci. U. S. A. 98, 10238-10243 (2001).

13. A. C. McPherron, A. M. Lawler, S. J. Lee, Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83-90 (1997).

14. C. S. Lee, et al., Adenovirus-mediated gene delivery: Potential applications for gene and cell-based therapies in the new era of personalized medicine. Genes Dis. 4, 43-63 (2017).

15. P. I. Ortinski, B. O’Donovan, X. Dong, B. Kantor, Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Mol. Ther. - Methods Clin. Dev. 5, 153-164 (2017).

16. K. M. Jung, Y. M. Kim, J. L. Kim, J. Y. Han, Efficient gene transfer into zebra finch germline-competent stem cells using an adenoviral vector system. Sci. Rep. 11, 14746 (2021).

17. J. Ahn, et al., Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system. Poult. Sci. 96, 1445-1450 (2017).

18. Shin S, Choi YM, Han JY, Lee K. Inhibition of lipolysis in the novel transgenic quail model overexpressing G0/G1 switch gene 2 in the adipose tissue during feed restriction. PLoS One. 2014 Jun 25;9(6):el00905.

19. Lee J, Kim DH, Lee K. Muscle Hyperplasia in Japanese Quail by Single Amino Acid Deletion in MSTN Propeptide. Int J Mol Sci. 2020 Feb 22;21(4): 1504.

20. Lee J, Kim DH, Brower AM, Schlachter I, Lee K. Research Note: Improved feed efficiency in quail with targeted genome editing in the myostatin gene. Poult Sci. 2021 Aug;100(8): 101257.

21. Hunton, P. 100 Years of poultry genetics. Worlds Poult. Sci. J. 2006, 62, 417-428.

22. Bi, Y.; Hua, Z.; Liu, X.; Hua, W.; Ren, H.; Xiao, H.; Zhang, L.; Li, L.; Wang, Z.; Laible, G.; et al. Isozygous and selectable marker-free MSTN knockout cloned pigs generated by the combined use of CRISPR/Cas9 and Cre/LoxP. Sci. Rep. 2016, 6, 31729 23. He, Z.; Zhang, T.; Jiang, L.; Zhou, M.; Wu, D.; Mei, J.; Cheng, Y. Use of CRISPR/Cas9 technology efficiently targeted goat myostatin through zygotes microinjection resulting in double-muscled phenotype in goats. Biosci. Rep. 2018, 38

24. Lv, Q.; Yuan, L.; Deng, J.; Chen, M.; Wang, Y.; Zeng, J.; Li, Z.; Lai, L. E_cient Generation of Myostatin Gene Mutated Rabbit by CRISPR/Cas9. Sci. Rep. 2016, 6, 25029.

25. McFarlane, C.; Langley, B.; Thomas, M.; Hennebry, A.; Plummer, E.; Nicholas, G.; McMahon, C.; Sharma, M.; Kambadur, R. Proteolytic processing of myostatin is autoregulated during myogenesis. Dev. Biol. 2005, 283,

26. Lee, S.J.; McPherron, A.C. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. USA 2001, 98, 9306-9311.

TABLES

Table 1. Potential off-target sites of MLPH in the chicken genome and MSTNm' the duck genome.

Chicken Chromosome Locus Score Sequence PAM Direction

AGGTGTAGAAGCGGCAATCC

MLPH 7 4,803,647 46.1 AGG +

(SEQ ID NO: 36) CATGGTAGAAGTGGCAATCC

Off-target 1 Z 31 ,734,515 30.2 AGG

(SEQ ID NO: 37)

AGGTTAAGAAGCGGCATTCC

Ott-target 2 1 7,592,337 26.3 CGG

(SEQ ID NO: 3)

TTTCGAAGAAGCAGCAATCC

Ott-target 3 3 105,764,773 26.3 TGG +

(SEQ ID NO: 4)

Duck Chromosome Locus Score Sequence PAM Direction

GACTGTGCAATGCTTGTACG

MSTN 7 35,554,025 46.1 TGG

(SEQ ID NO: 5)

ATATCTGCAATGCTTGTAGG

Ott-target 1 3 104,643,583 28.2 AGG

(SEQ ID NO: 6) TCAACTGCACTGCTTGTACG

Off-target 2 1 139,164,908 28.2 TGG

(SEQ ID NO: 7)

AGAAAATATATGCTTGTACG

Ott-target 3 5 13,753,811 28.2 TGG

(SEQ ID NO: 8)

Matched nucleotides of the off-target sequences to the target gene sequences are underlined. SEQUENCES

SEQ ID NO: 1 (Pekin Duck origin)

GACTGTGCAATGCTTGTACGTGG

SEQ ID NO: 2

AGGTGTAGAAGCGGCAATCCAGG

SEQ ID NO: 3

AGGTTAAGAAGCGGCATTCC

SEQ ID NO: 4

TTTCGAAGAAGCAGCAATCC

SEQ ID NO: 5

GACTGTGCAATGCTTGTACG

SEQ ID NO: 6

ATATCTGCAATGCTTGTAGG

SEQ ID NO: 7

TCAACTGCACTGCTTGTACG

SEQ ID NO: 8

AGAAAATATATGCTTGTACG

SEQ ID NO: 9

GACCTGAAGTGCAAGATAGACCA

SEQ ID NO: 10

CTAGAAGAGCTGAATTCCCCTTC

SEQ ID NO: 11

GCTGCACTGAATGTGAGATCA SEQIDNO: 12

CGCAGTTTGCTGAGGATTTGAA

SEQIDNO: 13

TGCCTGTTTTCTGAGGAGA

SEQIDNO: 14

GGTCTTGCCATGAACTTCA

SEQIDNO: 15

TCTGAAATGCAGCATCGGAA

SEQIDNO: 16

AGTTGACAGGGAAGGATTTCA

SEQIDNO: 17

ACTTGGCTCAGCCATGAT

SEQIDNO: 18

AGCCAGAAAGAGTATGCAAGCAA

SEQIDNO: 19

AGGATGTGAGAGATGTGAAGTAAGTCA

SEQIDNO: 20

CTACACTTACTGGAGACACCACTT

SEQIDNO: 21

GAAGGGACCTCTGGAGATCT

SEQIDNO: 22

GGGAGCGTTCAGCTATAGTATTCA SEQIDNO: 23

GGTTCCTACAGTCTTTCCACCAA

SEQ ID NO: 24 (Chicken MLPH gene)

CAGTGCCTGGATTGCCGCTTCTACACCTGCAAGA

SEQIDNO: 25

CAGTGCCTGGTTGCCGCTTCTACACCTGCAAGA

SEQIDNO: 26

CAGTGCCTTTGCCGCTTCTACACCTGCAAGA

SEQIDNO: 27

CAGTGCCGCTTCTACACCTGCAAGA

SEQIDNO: 28

CAGTGCCTGGAACCTGCAAGA

SEQIDNO: 29

CACACCTGCAAGA

SEQIDNO: 30

CACCTGCAAGA

SEQIDNO: 31

CATTCTGATTCAGCAAAGCACA

SEQ ID NO: 32 (Duck MSTN gene)

CTGTGCAATGCTTGTACGTGG

SEQIDNO: 33

TGCTTGTACGTGGA SEQIDNO: 34

TGCTTGTACGTGGA SEQIDNO: 35

TGCTTGTTACGTGG

SEQIDNO: 36

AGGTGTAGAAGCGGCAATCC

SEQIDNO: 37

CATGGTAGAAGTGGCAATCC

Claims

CLAIMS What is Claimed Is:

1. A transgenic avian comprising an artificial heterozygous or homozygous disruption in its myostatin gene (MSTN), wherein said disruption results in an artificial suppression of myostatin; and further wherein resulting offspring of the transgenic avian also comprise the disruption.

2. The transgenic avian of claim 1, wherein said disruption comprises a deletion of one or more nucleotides within MSTN or the regulatory region thereof.

3. The transgenic avian of claim 2, wherein deletion of one or more nucleotides of within MSTN or a regulatory region thereof is carried out using a CRISPR/Cas9 system.

4. The transgenic avian of claim 3, wherein said deletions comprise one or more base pair insertions in MSTN.

5. The transgenic avian of any one of claims 1-4, wherein said avian is a duck, chicken, turkey, quail, pheasant, geese, pigeon, ostrich, emu, guinea fowl, or partridge.

6. The transgenic avian of any one of claims 1-5, wherein the transgenic avian has 25% increased skeletal muscle growth, 30% less fat accretion, one week shorter time to reach market age, and 10% greater feed efficiency.

7. The transgenic avian of any one of claims 1-6, wherein myostatin levels are reduced by 10% or more compared to a control, wherein said control has not undergone artificial suppression of myostatin.

8. A vector encoding a CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises gRNAs which are specific for MSTN gene, and further wherein expression of the CRISPR/Cas9 system is under control of an avian 7SK promoter.

9. The vector of claim 8, wherein the CRISPR/Cas9 system edits the MSTN gene thereof in a manner resulting in inactivation of myostatin. The vector of claim 8 or 9, wherein the vector is a recombinant adenovirus type 5. A cell comprising the vector of any one of claims 8-10. A nucleic acid encoding the vector of any one of claims 8-10. A nucleic acid comprising 95% identity to SEQ ID NO: 1. A method of producing an avian with targeted mutations in MSTN gene to inactivate the function of myostatin, the method comprising the steps of: a. introducing the vector of claim 9 into an avian primordial germ cell in blastoderm; b. utilizing the promoter within the vector which controls the CRISPR/Cas9 system, thereby expressing the CRISPR/Cas9 system, which results in alteration of the MSTN gene thereof, thereby producing avian embryos containing genome-edited germ cells; c. placing eggs containing embryos with genome-edited germ cells under conditions suitable for development, thereby producing chimeric avian with genome-edited germ cells in MSTN gene; and d. Producing genome-edited offspring from breeding of chimeric avians. The method of claim 14, wherein the avian is a duck, chicken, turkey, quail, pheasant, geese, pigeon, ostrich, emu, guinea fowl, or partridge. The method of claim 14 or 15, wherein the avian with MSTN mutation which results from step d) has increased skeletal muscle growth, less fat accretion, shorter time to reach market age, and greater feed efficiency. The method of any one of claims 14-16, wherein the vector is introduced into an avian blastoderm. The method of claim 17, wherein the avian blastoderm is within an avian egg. The method of any one of claims 14-18, wherein alteration of the MSTN gene comprises a deletion or insertion in one or more nucleotides thereof. The method of claim 19, wherein offspring produced by the avian can also comprise a deletion or insertion of at least a part of MSTN gene. The method of any one of claims 14-20, wherein functions of myostatin is inactivated. A vector encoding a CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises gRNAs which are specific for MLPH gene, and further wherein expression of the CRISPR/Cas9 system is under control of an avian 7SK promoter. The vector of claim 22, wherein the CRISPR/Cas9 system edits the MLPH gene thereof in a manner resulting in inactivation of melanophilin. The vector of claim 22 or 23, wherein the vector is a recombinant adenovirus type 5. A cell comprising the vector of any one of claims 22-24. A nucleic acid encoding the vector of any one of claims 22-24. A nucleic acid comprising 95% identity to SEQ ID NO: 2. A method of producing an avian with targeted mutations in melanophilin (MLPH) gene to inactivate the function of melanophilin protein, the method comprising the steps of: a. introducing the vector of claim 23 into an avian primordial germ cell in blastoderm; b. utilizing the promoter within the vector which controls the CRISPR/Cas9 system, thereby expressing the CRISPR/Cas9 system, which results in alteration of the MLPH gene thereof, thereby producing avian embryos containing genome-edited germ cells; c. placing eggs containing embryos with genome-edited germ cells under conditions suitable for development, thereby producing chimeric avian with genome-edited germ cells mMLPH gene; and d. Producing genome-edited offspring from breeding of chimeric avians. The method of claim 28, wherein the avian is a duck, chicken, turkey, quail, pheasant, geese, pigeon, ostrich, emu, guinea fowl, or partridge. The method of any one of claims 28 or 29, wherein the vector is introduced into an avian blastoderm. The method of claim 30, wherein the avian blastoderm is within an avian egg. The method of any one of claims 28-31, wherein alteration of the MLPH gene comprises a deletion or insertion in one or more nucleotides thereof. The method of claim 28, wherein offspring produced by the avian can also comprise a deletion or insertion of at least a part of the MLPH gene. The method of any one of claims 28-33, wherein functions of melanophilin are inactivated.