WO2024064888A2 - Microorganismes modifiés présentant une expression et une sécrétion de protéines améliorées - Google Patents

Microorganismes modifiés présentant une expression et une sécrétion de protéines améliorées Download PDF

Info

Publication number
WO2024064888A2
WO2024064888A2 PCT/US2023/074893 US2023074893W WO2024064888A2 WO 2024064888 A2 WO2024064888 A2 WO 2024064888A2 US 2023074893 W US2023074893 W US 2023074893W WO 2024064888 A2 WO2024064888 A2 WO 2024064888A2
Authority
WO
WIPO (PCT)
Prior art keywords
yeast cell
engineered
protein
cell
ncsu
Prior art date
Application number
PCT/US2023/074893
Other languages
English (en)
Other versions
WO2024064888A3 (fr
Inventor
Nathan CROOK
Deniz DURMUSOGLU
Ibrahim AL'ABRI
Daniel Haller
Original Assignee
North Carolina State University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by North Carolina State University filed Critical North Carolina State University
Publication of WO2024064888A2 publication Critical patent/WO2024064888A2/fr
Publication of WO2024064888A3 publication Critical patent/WO2024064888A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces

Definitions

  • NCSU-2022-177-02 NCSU-41009.601 ENGINEERED MICROORGANISMS WITH ENHANCED PROTEIN EXPRESSION AND SECRETION CROSS REFERENCE TO RELTED APPLICATIONS [001]
  • This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63/376,912 filed September 23, 2022, which is incorporated herein by reference in its entirety and for all purposes.
  • GOVERNMENT FUNDING [002] This invention was made with government support under grant number CBET1934284 awarded by the National Science Foundation. The government has certain rights in the invention.
  • the present disclosure provides materials and methods related to the production of peptides and polypeptides from engineered microorganisms.
  • the present disclosure provides compositions and methods for producing a genetically modified microorganism (e.g., yeast cell) with enhanced protein expression and/or secretion.
  • a genetically modified microorganism e.g., yeast cell
  • Engineered probiotics provide unique strategies for disease prevention and treatment.
  • Engineered probiotics are microorganisms that are genetically engineered to stably deliver biotherapeutics, detect disease markers, or perform beneficial functions in the gut environment.
  • Probiotics can be genetically engineered to convert nutrients available in the gut environment to therapeutics or supplements that are not readily available for the host. Additionally, they can be engineered to eliminate metabolic waste or toxins.
  • probiotics have been engineered to NCSU-2022-177-02 NCSU-41009.601 target pathogens such as Clostridioides difficile, treat metabolic diseases such as Phenylketonuria or deliver biotherapeutics such as interleukin-10 to treat inflammatory bowel disease.
  • engineered probiotics can sense and respond to their environment, improving targeting and dosage of therapeutics.
  • Engineered probiotics can potentially be used as a drug delivery platform for many current therapies, target new diseases or treat infections in the gut environment. While all engineered probiotics that are currently in clinical trials are bacterial probiotics, yeast probiotics are currently investigated as a candidate for other applications. However, one challenge in the development of engineered probiotics for use in human patients is control over dosage. If expression of a therapeutic is constitutive (i.e., “always on”) dosage of the therapeutic becomes difficult to control. Additionally, biosynthesis of a therapeutic molecule is often energy- and nutrient-intensive, potentially decreasing the fitness of the engineered probiotic within the gut microbiota, thereby reducing colonization. Therefore, it would be advantageous to control the timing and level of expression of a therapeutic product in S.
  • Embodiments of the present disclosure include an engineered yeast cell comprising (i) at least one genetic modification that produces a functional phosphoglucomutase (PGM2) protein; and (ii) at least one exogenous polynucleotide operably linked to a pGAL1 promoter.
  • expression of a target polypeptide or protein encoded by the exogenous polynucleotide is increased compared to a yeast cell lacking the genetic modification.
  • the genetic modification comprises a mutation in the gene encoding PGM2.
  • the at least one genetic modification comprises a point mutation at position 1276, 1277, and/or 1278 in the gene encoding PGM2 (see SEQ ID NO: 1).
  • the point mutation is: (i) T1276A, T1276C, or T1276G; (ii) G1277C or G1277T; or (iii) A1278T, A1278C, or A1278G.
  • the yeast cell is selected from the group consisting of S. boulardii, S. cerevisiae, P. pastoris, Y. lipolytica, C. albicans, K.
  • genetic modification enables the yeast cell to utilize galactose as a carbon source.
  • the genetic modification enhances colonization in a NCSU-2022-177-02 NCSU-41009.601 host.
  • the genetic modification enhances colonization in a host in the presence of galactose.
  • the genetic modification activates the pGAL1 promoter.
  • expression of the target polypeptide or protein encoded by the exogenous polynucleotide is increased compared to a yeast cell lacking the genetic modification.
  • the engineered yeast cell further comprises at least one gene knockout.
  • expression and/or secretion of the target polypeptide or protein is increased at least 1.2-fold compared to a yeast cell lacking the at least one gene knockout.
  • the genetic knockout comprises a knockout of YPS1 (Accession No. P32329), PRB1 (Accession No. P09232), PEP4 (Accession No. P07267), and/or APE1 (Accession No. P14904).
  • the genetic knockout comprises a knockout of PRB1 and PEP4.
  • the genetic knockout comprises a knockout of YPS1, PRB1, PEP4, and APE1.
  • the engineered yeast cell comprises a target polypeptide or protein that is at least one of an anti-cancer agent, an immune regulator, an anti-pathogenic agent, and/or a metabolic regulator.
  • the target polypeptide or protein is at least one of a DARPin, a lectin, a monoclonal antibody, a F(ab’)2 fragment, a Fab’/Fab fragment, a diabody, a scFv, a nanobody, and/or an affibody.
  • the exogenous polynucleotide comprises a secretion signal upstream of the target polypeptide or protein.
  • the yeast cell is from an S. boulardii strain.
  • the yeast cell is from an S. boulardiifZWG, XYWGOS "55+00#' :S XTRK KRHTJORKSYX% the yeast cell is from an S.
  • Embodiments of the present disclosure also include a composition comprising any of the engineered yeast cells described herein. In some embodiments, the composition is lyophilized.
  • Embodiments of the present disclosure also include a method of treating and/or preventing a disease or condition in a subject. In accordance with these embodiments, the method includes administering any of the compositions described herein to the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 15 cells/kg body weight of the subject. In some embodiments, the composition is administered orally or rectally.
  • Embodiments of the present disclosure also include a method of growing a yeast cell in media comprising galactose.
  • the method includes making at least one genetic modification to the yeast cell such that the yeast cell is capable of producing a functional phosphoglucomutase (PGM2) protein.
  • the yeast cell is a Saccharomyces boulardii cell.
  • the at least one genetic modification enables the yeast cell to utilize galactose as a carbon source.
  • the method further comprises inducing expression of an exogenous polypeptide or protein via activation of a pGAL1 promoter.
  • the exogenous polypeptide or protein is at least one of an anti-cancer agent, an immune regulator, an anti-pathogenic agent, and/or a metabolic regulator.
  • Embodiments of the present disclosure also include a method of enhancing colonization of a yeast cell in a host.
  • the method includes administering a composition comprising an engineered yeast cell that comprises at least one genetic modification that produces a functional phosphoglucomutase (PGM2) protein.
  • the yeast cell is a Saccharomyces boulardii cell.
  • the genetic modification enables the yeast cell to utilize galactose as a carbon source.
  • the engineered yeast cell further comprises at least one exogenous polynucleotide operably linked to a pGAL1 promoter.
  • the composition comprises galactose.
  • the engineered Saccharomyces boulardii cell exhibits enhanced colonization in a host as compared to a wild type Saccharomyces boulardii cell.
  • the composition comprises galactose and wherein the engineered Saccharomyces boulardii cell exhibits enhanced colonization in a host as compared to a wild type Saccharomyces boulardii cell or compared to the engineered Saccharomyces boulardii cell administered without galactose.
  • OD600 measurements were collected every 10 minutes in BioTek Synergy H1 Plate Reader.
  • FIGS.2A-2E Representative graphical data demonstrating Dose-response curves of inducible systems expressing yeGFP.
  • Each reporter construct is on a high-copy (2 ⁇ ) plasmid with a URA3 selective marker.
  • the repressors are expressed from a low-copy (CEN) plasmid with a HIS3 marker.
  • FIGS. 3A-3F Dose-response curves of inducible systems expressing CaFbfp under aerobic and anaerobic conditions.
  • Systems with highest fold induction pLAC (a), pXYL (b), U82 ⁇ * "I##
  • ⁇ KWK IZQYZWKJ OS GY ,0k OS 4B RKJOG QGIPOSM KOYNKW ZWGIOQ TW ZWGIOQ GSJ NOXYOJOSK supplemented with glucose (2%) (except for pGAL1) or raffinose (for pGAL1) and range of xylose, IPTG and galactose concentrations, respectively under aerobic or anaerobic (5%H2, 5%CO2, 90% N2) conditions for 24 hours.
  • FIGS. 4A-4C Inducible promoter-mediated surface display in probiotic yeast Sb – enabling high-throughput screening of protein-protein interactions.
  • FIGS. 5A-5B Orthogonality of the inducible promoters in Sb. (a) Evaluating the cross reactivity among the five inducible promoters driving yeGFP expression when exposed to various inducers.
  • FIGS. 6A-6C Modulation Sb colonization profile and residence time in the mouse gut via addition of inducing sugars.
  • FIGS. 7A-7D In situ protein expression in the mammalian gut. SbGal+ provides controlled gene expression in the mouse gut. NanoLuciferase expressed via pGAL1 was used to evaluate the functionality and efficiency of SbGal+ in vivo.
  • FIGS. 8A-8C Development and validation of genetic logic gates for precision- controlled protein expression in the gut. pTET and pGAL1 were utilized due to their tight regulation between 'on' and 'off' states, to establish an AND gate for precise protein expression.
  • mice were given an antibiotic cocktail (ampicillin (0.5 mg/mL), gentamicin (0.5 mg/mL), metronidazole (0.5 mg/mL), neomycin (0.5 mg/mL), vancomycin (0.25 mg/mL), sucralose (4 mg/mL)) throughout the experiment.
  • Galactose (2 mg/mL) was administered in water starting from Day 0.10 ⁇ 8 CFUs SbGal++pGalTet-NLuc strains were given to the mice for 2 days. On Day 0, galactose and aTc administration began ad libitum in water. Fecal samples were collected daily and plated on YPD media containing antibiotics. On Day 2, mice were sacrificed and tissue samples were collected.
  • FIGS. 9A-9C In vitro development of reporter inducible strain in yeast synthetic media and chow mice diet.
  • Sb strain expressing yeGFP under the control of galactose inducible promoter (pGal) was tested in yeast complete synthetic media without uracil (CSM-U) and chow mice diet (Chow) with and without galactose.
  • CSM-U galactose inducible promoter
  • Chow chow mice diet
  • FIGS. 10A-10B In vitro development of genetic logic gates in Sb.
  • Sb strain expressing yeGFP under the control of galactose - anhydrotetracycline inducible promoter (pGal- Tet) was tested in yeast complete synthetic media without uracil and histidine (CSM-U-H) and NCSU-2022-177-02 NCSU-41009.601 chow mice diet (Chow) with and without galactose.
  • nucleic acid molecule refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA.
  • the term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, NCSU-2022-177-02 NCSU-41009.601 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methyl
  • oligonucleotide refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than about 300 residues long (e.g., between 15 and 100), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example, a 24- residue oligonucleotide is referred to as a “24-mer.” Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides.
  • peptide and polypeptide generally refer to polymer compounds of two or more amino acids joined through the main chain by peptide amide bonds (--C(O)NH--).
  • peptide typically refers to short amino acid polymers (e.g., chains having fewer than 25 amino acids), whereas the term “polypeptide” typically refers to longer amino acid polymers (e.g., chains having more than 25 amino acids).
  • isolated polynucleotide generally refers to a polynucleotide (e.g., of genomic, cDNA, or synthetic origin, or a combination thereof) that, by virtue of its origin, the isolated polynucleotide is not associated with all or a portion of a polynucleotide with which the “isolated polynucleotide” is found in nature; is operably linked to a polynucleotide that it is not linked to in nature; or does not occur in nature as part of a larger sequence.
  • a polynucleotide e.g., of genomic, cDNA, or synthetic origin, or a combination thereof
  • sequence identity generally refers to the degree two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have the same sequential composition of monomer subunits.
  • sequence similarity refers to the degree with which two polymer NCSU-2022-177-02 NCSU-41009.601 sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have similar polymer sequences.
  • similar amino acids are those that share the same biophysical characteristics and can be grouped into the families, e.g., acidic (e.g., aspartate, glutamate), basic (e.g., lysine, arginine, histidine), non-polar (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) and uncharged polar (e.g., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine).
  • acidic e.g., aspartate, glutamate
  • basic e.g., lysine, arginine, histidine
  • non-polar e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • uncharged polar e.g.
  • the “percent sequence identity” is calculated by: (1) comparing two optimally aligned sequences over a window of comparison (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), (2) determining the number of positions containing identical (or similar) monomers (e.g., same amino acids occurs in both sequences, similar amino acid occurs in both sequences) to yield the number of matched positions, (3) dividing the number of matched positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), and (4) multiplying the result by 100 to yield the percent sequence identity or percent sequence similarity.
  • a window of comparison e.g., the length of the longer sequence, the length of the shorter sequence, a specified window
  • peptides A and B are both 20 amino acids in length and have identical amino acids at all but 1 position, then peptide A and peptide B have 95% sequence identity. If the amino acids at the non-identical position shared the same biophysical characteristics (e.g., both were acidic), then peptide A and peptide B would have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 out of 15 amino acids in peptide D are identical to those of a portion of peptide C, then peptides C and D have 70% sequence identity, but peptide D has 93.3% sequence identity to an optimal comparison window of peptide C.
  • expression vector is a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription. Such additional segments may include promoter and terminator sequences, and optionally one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, NCSU-2022-177-02 NCSU-41009.601 that provide for the expression of a coding sequence in a host cell.
  • polyadenylation signals are control sequences.
  • secretory signal sequence is a DNA sequence that encodes a polypeptide (a “secretory peptide” that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.
  • promoter is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, LTZSJ OS YNK .e STS&ITJOSM WKMOTSX TL MKSKX' [041]
  • operably linked when referring to DNA segments, indicates that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.
  • a coding sequence is “under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then trans-RNA spliced and translated into the protein encoded by the coding sequence.
  • heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell. Preferably, the heterologous DNA includes a gene foreign to the cell. 2.
  • Saccharomyces boulardii is a leading probiotic candidate for delivery of biotherapeutics to the mammalian gut. As the only eukaryotic probiotic chassis, S.
  • boulardii is suitable for applications that are not attainable by probiotic bacteria.
  • Sb has been established as an easy to engineer probiotic yeast that can be used for production of small molecules and elimination of pathogens. While Sb is a promising probiotic, precise control of gene expression in the species has not been achieved; such control can play a crucial role in maintaining the fitness and survival of the strain during colonization.
  • Developing inducible gene expression systems that can be tuned via the addition of ligands could play an essential role for production and delivery of biotherapeutics.
  • 5 ligand-responsive gene expression systems were developed for S. boulardii.
  • embodiments of the present disclosure include an engineered yeast cell comprising (i) at least one genetic modification that produces a functional phosphoglucomutase (PGM2) protein; and (ii) at least one exogenous polynucleotide operably linked to a pGAL1 promoter.
  • expression of a target polypeptide or protein encoded by the exogenous polynucleotide is increased compared to a yeast cell lacking the genetic modification.
  • the genetic modification comprises a mutation in the gene encoding PGM2.
  • the at least one genetic modification comprises a point mutation at position 1276, 1277, and/or 1278 in the gene encoding PGM2.
  • the point mutation is: (i) T1276A, T1276C, or T1276G; (ii) G1277C or G1277T; or (iii) A1278T, A1278C, or A1278G.
  • one or more of these point mutations produces a functional phosphoglucomutase (PGM2) protein such that glucose can be effectively utilized by the engineered yeast cell.
  • PGM2 phosphoglucomutase
  • the yeast cell includes, but is not limited to, S. boulardii, S. cerevisiae, P. pastoris, Y. lipolytica, C. albicans, K.
  • Other strains of yeast cells can also be used as would be recognized by one of ordinary skill in the art based on the present disclosure.
  • genetic modification enables the engineered yeast cell to utilize galactose as a carbon source. In some embodiments, the genetic modification enhances colonization in a host. In some embodiments, the genetic modification enhances colonization in a host in the presence of galactose. [049] In some embodiments, the genetic modification activates the pGAL1 promoter. In some embodiments, expression of the target polypeptide or protein encoded by the exogenous polynucleotide that is operably linked to the pGAL promoter is increased compared to a yeast cell lacking the genetic modification. [050] In some embodiments, the engineered yeast cell further comprises at least one gene knockout.
  • expression and/or secretion of the target polypeptide or protein is increased at least 1.2-fold compared to a yeast cell lacking the at least one gene knockout.
  • the engineered yeast cells of the present disclosure include at least one genetic modification in a gene involved in the protein secretion pathway.
  • the genetic medication results in the reduction of the activity and/or expression of the gene(s) involved in the protein secretion pathway.
  • the genetic modification is a gene knockout or a loss-of-function mutation.
  • the genetic modification can be in any one of the following genes: APE1, YPS1, PRB1, PEP4, PAH1, DER1, HRD1, OCH1, MNN9, VPS5, VPS17, TDA3, GOS1, and ROX1.
  • expression of a target polypeptide or protein is increased compared to a yeast cell lacking at least one genetic modification in one or more of these genes.
  • the genetic knockout comprises a knockout of YPS1 (Accession No. P32329), PRB1 (Accession No. P09232), PEP4 (Accession No. P07267), and/or APE1 (Accession No. P14904).
  • the genetic knockout comprises a knockout of PRB1 and PEP4. In some embodiments, the genetic knockout comprises a knockout of YPS1, PRB1, PEP4, and APE1.
  • the engineered yeast cell comprises a target polypeptide or protein that is at least one of an anti-cancer agent, an immune regulator, an anti-pathogenic agent, and/or a metabolic regulator. In some embodiments, the target polypeptide or protein is at least one of a DARPin, a lectin, a monoclonal antibody, a F(ab’) 2 fragment, a Fab’/Fab fragment, a diabody, a scFv, a nanobody, and/or an affibody.
  • the exogenous polynucleotide comprises other features that facilitate protein expression and/or secretion in the engineered yeast cell.
  • the exogenous polypeptide can include a promoter upstream of the target polypeptide or protein in order to facilitate its expression.
  • the exogenous polynucleotide can include a secretion signal upstream of the target polypeptide or protein in order to facilitate its secretion from the engineered yeast cell.
  • the secretion signal comprises an alpha mating factor secretion signal.
  • the target polypeptide or protein is expressed and secreted from the engineered yeast cell. In some embodiments, the target polypeptide or protein is expressed on the surface of the engineered yeast cell.
  • the exogenous polynucleotide comprises a secretion signal upstream of the target polypeptide or protein.
  • the engineered yeast cells of the present disclosure comprising at least one of the genetic modifications described herein exhibit increased expression, secretion, and/or cell surface display of the target polypeptide or protein.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.1- fold compared to a yeast cell lacking the genetic modification.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.2- fold compared to a yeast cell lacking the genetic modification.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.3- fold compared to a yeast cell lacking the genetic modification.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.4- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.5- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.6- fold compared to a yeast cell lacking the genetic modification.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.7- NCSU-2022-177-02 NCSU-41009.601 fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.8- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 1.9- fold compared to a yeast cell lacking the genetic modification.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 2.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 3.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 4.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 5.0- fold compared to a yeast cell lacking the genetic modification.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 6.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 7.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 8.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 9.0- fold compared to a yeast cell lacking the genetic modification.
  • expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 10.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 15.0- fold compared to a yeast cell lacking the genetic modification. In some embodiments, expression, secretion, and/or cell surface display of the target polypeptide or protein is increased at least 20.0- fold compared to a yeast cell lacking the genetic modification. [054] In accordance with the above embodiments, the present disclosure also includes a composition comprising any of the engineered yeast cells described herein. In some embodiments, the composition is formulated as a food product or a medicament.
  • the composition is lyophilized. In some embodiments, the composition is in wet form. In some NCSU-2022-177-02 NCSU-41009.601 embodiments, the composition is in frozen form.
  • yeast cells can be formulated as a lyophilized composition (e.g., including a cryoprotectant) and can be readily reconstituted, which is an advantage over many other microorganisms (e.g., bacteria and fungi).
  • the compositions of the present disclosure are particularly suited for lyophilization and formulation as an LBP and/or therapeutic composition for administration to a subject.
  • the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 15 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 14 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 13 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 12 cells/kg body weight of the subject.
  • the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 11 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 10 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 6 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 7 cells/kg body weight of the subject.
  • the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 8 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 9 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 10 cells/kg body weight of the subject. In some embodiments, the engineered yeast cells are present in the composition at a dose from about 1x10 10 cells/kg body weight to about 1x10 15 cells/kg body weight of the subject.
  • the engineered yeast cells are present in the composition at a dose from about 1x10 8 cells/kg body weight to about 1x10 12 cells/kg body weight of the subject. NCSU-2022-177-02 NCSU-41009.601 [056]
  • the composition comprising the engineered yeast cells of the present disclosure further comprises at least one pharmaceutically acceptable excipient or carrier.
  • a pharmaceutically acceptable excipient and/or carrier or diagnostically acceptable excipient and/or carrier includes but is not limited to, sterile distilled water, saline, phosphate buffered solutions, amino acid-based buffers, or bicarbonate buffered solutions. An excipient selected and the amount of excipient used will depend upon the mode of administration.
  • An effective amount for a particular subject/patient may vary depending on factors such as the condition being treated, the overall health of the patient, the route and dose of administration, and the severity of side effects.
  • Guidance for methods of treatment and diagnosis is available (see, e.g., Maynard, et al. (1996) A Handbook of SOPs for Good Clinical Practice, Interpharm Press, Boca Raton, Fla.; Dent (2001) Good Laboratory and Good Clinical Practice, Urch Publ., London, UK).
  • a therapeutically effective amount can be initially determined from animal models.
  • a therapeutically effective dose can also be determined from human data which are known to exhibit similar pharmacological activities, such as other adjuvants.
  • the applied dose can be adjusted based on the relative bioavailability and potency of the administered engineered yeast cells and the corresponding proteins or peptides expressed by the engineered yeast cells. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled person in the art.
  • the compositions described herein may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into compositions for pharmaceutical use. Methods of formulating pharmaceutical compositions are known in the art (see, e.g., “Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA).
  • compositions are subjected to tabletting, lyophilizing, direct compression, conventional mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping, or spray drying to form tablets, granulates, nanoparticles, nanocapsules, microcapsules, microtablets, pellets, or powders, which may be enterically coated or uncoated. Appropriate formulation depends on the route of administration.
  • compositions described herein may be formulated into pharmaceutical compositions in any suitable dosage form (e.g., liquids, capsules, sachet, hard capsules, soft capsules, tablets, enteric coated tablets, suspension powders, granules, or matrix sustained release NCSU-2022-177-02 NCSU-41009.601 formations for oral administration) and for any suitable type of administration (e.g., oral, inhalable, topical, injectable, immediate-release, pulsatile-release, delayed-release, or sustained release).
  • suitable dosage form e.g., liquids, capsules, sachet, hard capsules, soft capsules, tablets, enteric coated tablets, suspension powders, granules, or matrix sustained release NCSU-2022-177-02 NCSU-41009.601 formations for oral administration
  • suitable type of administration e.g., oral, inhalable, topical, injectable, immediate-release, pulsatile-release, delayed-release, or sustained release.
  • compositions may be formulated into pharmaceutical compositions comprising one or more pharmaceutically acceptable carriers, thickeners, diluents, buffers, buffering agents, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or agents.
  • the pharmaceutical composition may include, but is not limited to, the addition of calcium bicarbonate, sodium bicarbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and surfactants, including, for example, polysorbate 20.
  • Embodiments of the present disclosure also include a method of treating and/or preventing a disease or condition in a subject by administering any of the engineered yeast cells or compositions comprising the engineered yeast cells described herein.
  • the methods include administering any of the compositions described herein to the subject.
  • the composition is administered orally, rectally, parenterally, intramuscularly, intraperitoneally, intravenously, intracerebroventricularly, intracisternally, subcutaneously, via injection or infusion, via inhalation, spray, nasal, vaginal, rectal, sublingual, or topical administration.
  • the composition is administered orally or rectally.
  • the engineered yeast cells are present in the composition at a dose from about 1x10 5 cells/kg body weight to about 1x10 15 cells/kg body weight of the subject. In some embodiments, the composition is administered orally or rectally.
  • Embodiments of the present disclosure also include a method of growing a yeast cell in media comprising galactose. In accordance with these embodiments, the method includes making at least one genetic modification to the yeast cell such that the yeast cell is capable of producing a functional phosphoglucomutase (PGM2) protein.
  • PGM2 phosphoglucomutase
  • the yeast cell is a Saccharomyces boulardii cell.
  • the at least one genetic modification enables the yeast cell to utilize galactose as a carbon source.
  • the method further comprises inducing expression of an exogenous polypeptide or protein via activation of a pGAL1 promoter.
  • the exogenous polypeptide or protein is at least one of an anti-cancer agent, an immune regulator, an anti-pathogenic agent, and/or a metabolic regulator. NCSU-2022-177-02 NCSU-41009.601 [060]
  • Embodiments of the present disclosure also include a method of enhancing colonization of a yeast cell in a host.
  • the method includes administering a composition comprising an engineered yeast cell that comprises at least one genetic modification that produces a functional phosphoglucomutase (PGM2) protein.
  • the yeast cell is a Saccharomyces boulardii cell.
  • the genetic modification enables the yeast cell to utilize galactose as a carbon source.
  • the engineered yeast cell further comprises at least one exogenous polynucleotide operably linked to a pGAL1 promoter.
  • the composition comprises galactose.
  • the engineered Saccharomyces boulardii cell exhibits enhanced colonization in a host as compared to a wild type Saccharomyces boulardii cell.
  • the composition comprises galactose and wherein the engineered Saccharomyces boulardii cell exhibits enhanced colonization in a host as compared to a wild type Saccharomyces boulardii cell or compared to the engineered Saccharomyces boulardii cell administered without galactose.
  • E. coli cells were grown in lysogeny broth (LB) (5g/L yeast extract, 10 g/L tryptone, 10g/L NaCl) at 37 °C supplemented with ampicillin (100 ⁇ g/mL), kanamycin (50 ⁇ g/mL) or chloramphenicol (34 ⁇ g/mL). Saccharomyces boulardii ATCC-MYA796-)'#"-%&(" ⁇ GX ZXKJ YT ITSXYWZIY BH8GQj% GSJ BH8GQj ⁇ GX ZXKJ LTW XZHXKVZKSY inducible promoter characterization, yeast surface display, and logic gate experiments.
  • LB lysogeny broth
  • yeast extract 10 g/L tryptone, 10g/L NaCl
  • ampicillin 100 ⁇ g/mL
  • kanamycin 50 ⁇ g/mL
  • chloramphenicol 34 ⁇ g
  • Sc BY4741 was used as a control for certain experiments.
  • Yeast cultures for genome editing were grown in yeast extract-peptone-dextrose (YPD) medium (50 g/L YPD Broth (Sigma-Aldrich)).
  • yeast cultures were grown in synthetic complete media containing 0.67% (w/v) Yeast Nitrogen Base Without Amino Acids (Sigma-Aldrich), 1.92 g/L Yeast Synthetic Media Dropout Mix (uracil, histidine, or both), and glucose (2% (w/v) as a carbon source unless otherwise indicated. All S. boulardii strains were grown at 37 °C and all S. cerevisiae strains were grown at 30 °C.
  • Plasmid ISA1041 provided guide RNA and Cas9 nuclease to carry the edit.
  • a synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #1000000061).
  • Expression vectors for yeGFP, mKate, and CaFBFP consisted of two connectors, an inducible or constitutive promoter, the fluorescent protein coding sequence, the tENO1 terminator, the URA3 yeast marker, the 2micron yeast origin, and Amp/ColE1 as an E. coli marker and origin.
  • expression vectors for cognate repressor proteins included two connectors, the constitutive promoter pFBA1, the repressor protein coding sequence, the tENO2 terminator, the HIS3 yeast marker, the CEN yeast origin, and Amp/ColE1 as an E. coli marker and origin. All yeast parts were included in the MoClo-YKT kit except for the following parts, which were ordered as gBlocks with appropriate restriction sites and overhangs: pTET, pLAC, pXYL, pFBA1, tetR, lacI, xylR, CaFBFP, and mKate.
  • Expression vectors were assembled according to Deuber lab YTK protocols via Golden Gate cloning, with the Golden Gate reaction mixture containing 0.5 ⁇ L of 40 nM of each DNA part (20 fmol), 0.5 ⁇ L T7 ligase (EB), 1.0 ⁇ L T4 Ligase Buffer (NEB), and 0.5 ⁇ L BsaI (10,000 U/mL, NEB), with water to bring the final volume to 10 ⁇ L. Assembly was performed on a thermocycler using the following program: 30 cycles of digestion ( 37 °C for 2 min) and ligation (16 °C for 5 min), followed by a final digestion (60 °C for 10 min) and heat inactivation (80 °C for 10 min) .
  • Gibson Assembly was used to assemble both the inducible promoter-fluorescent protein transcriptional unit and constitutive promoter-cognate repressor transcriptional unit into the same backbone, separated by a connector.
  • three fragments were amplified, consisting of the two transcriptional units and yeast backbone with E. coli marker and origin, with ⁇ 20 bp homology between fragments.
  • the Gibson Assembly mixture consisted of the following: 100 ng backbone fragment, additional insert fragments in 2:1 molar ratio to backbone fragment, 10 ⁇ L HiFi 2X Master Mix (NEB), and water up to 20 ⁇ L.
  • AGA2-sfGFP plasmid was constructed via Gibson assembly.
  • pYD1 plasmid was gift from the Wittrup Lab (Addgene #xxxxx) and TRP1 marker on pYD1 was swapped with HIS3 marker from MoClo-YTK via 2-part Gibson cloning, resulting in pYD1-HIS3.
  • sfGFP was ordered as gene fragment and was inserted into MCS on pYD1-HIS3 via 2-part Gibson cloning.
  • pGAL1-AGA1-URA3 integration cassette was constructed via Golden Gate assembly.
  • AGA1 was amplified from Sb genome.
  • pGAL1 (YTK030), amplified AGA1 and tENO1 (YTK051) were inserted in ISA086 via Golden gate cloning.
  • the nourseothricin resistance gene natR was amplified and assembled into an integration cassette to form ISA186 by Golden Gate assembly as described above.
  • Integration cassettes for logic gate constructs were constructed via Golden Gate assembly of the following parts: The integration cassette backbone, the logic gate, and any necessary transcriptional units for repressor proteins. All parts were ordered as gBlocks with appropriate restriction sites and overhangs for Golden Gate assembly except for the backbone and the pFBA1-tetR-tENO2 transcriptional unit, which was amplified from an expression vector.
  • constitutive promoters pPXR1 and pVMA6 were used for repressor proteins LacI and XylR, respectively.
  • Yeast Competent Cells and Transformations A yeast competent cell preparation and transformation protocol from Gietz et. Al was used. To prepare competent cells, yeast colonies were inoculated into 1 mL YPD and incubated in a shaking incubator overnight at 37 °C, 250 rpm. This culture was diluted into fresh 25 ml YPD (with OD600 " 0.25) and grown to OD 0.8-1.0.
  • the cell pellet was then gently resuspended in 50 ⁇ L boiled salmon sperm DNA (2 mg/ml), and transformation reagents were added in the following order: 2 ⁇ g DNA repair template if applicable, 1 ⁇ g of any yeast plasmids (either for expression or for gRNA and Cas12a expression), 36 ⁇ L lithium acetate (1.0 M), and 260 ⁇ L PEG3350 (50%, Fisher Scientific).
  • double-stranded salmon sperm DNA (Invitrogen, 15632011) at 10 mg/ml was diluted to 2 mg/mL and incubated at 95 °C for 5 min to denature the DNA.
  • the transformation mix was gently vortexed for less than 5 seconds at low speed before being heat shocked at 42 °C for one hour.
  • the transformation reactions were NCSU-2022-177-02 NCSU-41009.601 then centrifuged for 3 minutes at 3,000 x g, and the supernatant was removed and discarded.
  • the cells were resuspended in 1 mL YPD by gentle pipetting, and recovered for 1 hour at 37 °C (or 30 °C for S. cerevisiae). In the case of genome editing reactions, this recovery period was extended to a total of 3 hours. Finally, the cell suspension was centrifuged for 1 minute at 3,000 x g and the pellet was resuspended in 100 ⁇ L.
  • Yeast Genome Editing For yeast genome editing, the protocol above was followed, with the DNA transformed including 1 ⁇ g of a Cas12a-encoding plasmid ISA166, 1 ⁇ g of a guide RNA plasmid, and 2 ⁇ g of a linear DNA repair template with 350-900 bp of homology to the target site in the genome on each side. Repair templates included the URA3 gene to aid in selection of positive transformants through plating on growth media lacking uracil.
  • S. boulardii Colony PCR Yeast genome edits were confirmed using Phire Plant Direct PCR Master Mix from Thermo Fisher.
  • the protocol for performing PCR amplification directly from yeast colonies is described by the manufacturer. Briefly, 10 ⁇ L of master mix was combined with 1 ⁇ L of each primer and water up to 20 ⁇ L. Using a pipette tip, a small part of a yeast colony was picked and resuspended in the PCR reaction. If PCR fails, then use modified protocol. Resuspend small colony in 8 ⁇ L of 20 mM NaOH and incubate reaction at 98 °C for 10 minutes then add 10 ⁇ L of master mix was combined with 1 ⁇ L of each primer to the lysed cells. The PCR reaction then proceeded according to the supplier’s specifications. Primers were designed to bind outside the linear repair template’s homology arms.
  • Antibiotic cocktail (ampicillin (0.5 mg/mL), gentamicin (0.5 mg/mL), metronidazole (0.5 mg/mL), neomycin (0.5 mg/mL), vancomycin (0.25 mg/mL)), sucralose (4 mg/mL) and galactose (20 mg/mL) were administered ad libitum in filter sterilized drinking water during the experiment and refreshed daily.
  • Antibiotic NCSU-2022-177-02 NCSU-41009.601 administration was started 3 days prior to Sb gavage. Mice were gavaged with 10 ⁇ 8 CFU Sb (SbPGM2::NatR or Sb::NatR) every day for 3 days. Fecal samples were collected every 24 h from day 1 to day 9.
  • mice were sacrificed and intestinal contents (small intestine, cecum, colon) were collected.
  • R ⁇ centrifuge tubes and then weighed again to determine fecal mass.
  • Fecal matter was then resuspended in 1 mL PBS per 10 mg feces.
  • Fecal suspensions were plated on YPD media ITSYGOSOSM .) hM(R ⁇ STZWXKTYNWOIOS GSJ )'+.
  • nucleotide sequence of phosphoglucomutase (PGM2) from Saccharomyces boulardii is provided below: [079] ATGTCATTTCAAATTGAAACGGTTCCCACCAAACCATATGAAGACCAAA AGCCTGGTACCTCTGGTTTGCGTAAGAAGACAAAGGTGTTTAAAGACGAACCTAACT ACACAGAAAATTTCATTCAATCGATCATGGAAGCTATTCCAGAGGGTTCTAAAGGTG CCACTCTTGTTGTCGGTGGTGATGGGCGTTACTACAATGATGTCATTCTTCATAAGAT TGCCGCTATCGGTGCTGCCAACGGTATTAAAAAGTTAGTTATTGGTCAGCATGGTCT
  • Example 1 [082] Experiments were conducted to investigate the performance of ligand-responsive gene expression systems that were previously investigated in S. cerevisiae in S. boulardii, and JKRTSXYWGYK YNKOW ZYOQOY ⁇ LTW XK[KWGQ GUUQOIGYOTSX OS KSMOSKKWKJ UWTHOTYOIX' BH8GQj% G MGQGIYTXK& competent strain of S. boulardii, was constructed and activation of the pGAL1 galactose-inducible promoter was demonstrated.
  • Dose-response behavior for this promoter was analyzed, in addition to four other inducible promoters (xylose, lactose or IPTG (Isopropyl ß-D-1- NCSU-2022-177-02 NCSU-41009.601 thiogalactopyranoside), copper, and anhydrotetracycline), establishing the first set of ligand- responsive expression systems in probiotic yeast. Results indicated that all 5 inducible systems demonstrated different gene activation ranges, and with non-toxic inducers that are largely absent from the human diet. The behavior of these promoters was investigated under anaerobic conditions similar to those found in the gut.
  • the lactose disaccharide As one of the monosaccharides comprising the lactose disaccharide, it is generally non-toxic to humans, except in the case of galactosemia, a rare genetic disorder that prevents galactose metabolism.
  • Liu et al demonstrated that the PGM2 gene in S. boulardii MYA- 796 harbors a point mutation that introduces a premature stop codon, leading to a truncated phosphoglucomutase enzyme and a very slow growth rate of S. boulardii on galactose. Liu et al demonstrated that when S. boulardii’s PGM2 gene is reverted to the sequence found in S.
  • a plasmid was constructed with production of yeast-enhanced green fluorescent protein (yeGFP) under the control of the pGAL1 UWTRTYKW GSJ YWGSXLTWRKJ YNOX UQGXROJ YT HTYN ⁇ OQJ&Y ⁇ UK GSJ BH8GQj XYWGOSX' 7QZTWKXIKSIK TL ⁇ K87@ ⁇ GX RKGXZWKJ ZXOSM LQT ⁇ I ⁇ YTRKYW ⁇ ' 3TYN ⁇ OQJ&Y ⁇ UK GSJ BH8GQj XYWGOSX K]NOHOYKJ induction of yeGFP fluorescence in the presence of galactose, demonstrating that although wild- type S.
  • yeGFP yeast-enhanced green fluorescent protein
  • boulardii does not seem to efficiently metabolize galactose (FIG. 1B), it can still allow galactose-inducible gene expression (FIG.1L)
  • the inefficiency of galactose metabolism presents a problem with pGAL1-based gene expression in the wild-type strain, as another metabolizable carbon source must be provided.
  • Glucose inhibits pGAL1 induction, so glucose NCSU-2022-177-02 NCSU-41009.601 cannot be used as a carbon source for wild-type S. boulardii when gene expression is desired.
  • the copper-inducible pCUP1 promoter (from MoClo Yeast Toolkit (YTK)) was used, as well as three engineered minimal promoters previously described: pTET (inducible by anhydrotetracycline (aTc)), pLAC (inducible by IPTG), and pXYL (inducible by xylose). All three of these promoters consist of two repressor-binding operator sequences, separated by spacers, placed upstream of a minimal ADH2 transcriptional start site.
  • YTK MoClo Yeast Toolkit
  • the yeGFP was placed under the control of each inducible promoter and transformed the resulting yeast expression vectors to the BH8GQj XYWGOS TL S. boulardii.
  • plasmids encoding the corresponding repressor proteins tetR, lacI, and xylR, respectively
  • tetR, lacI, and xylR were also introduced.
  • each of the five strains were subinoculated into synthetic media with various concentrations of their respective inducers and grew for 20 hours before measuring fluorescence using the flow cytometer.
  • Glucose was used as the carbon source for all strains except the pGAL1-yeGFP strain, in which raffinose was used as a carbon source.
  • the pCUP1-yeGFP strain was grown in copper sulfate-free media to reduce nonspecific induction. All five systems showed increasing fluorescence with increasing inducer concentration, demonstrating ligand-responsive gene expression in S. boulardii (FIG. 2).
  • the pCUP1 promoter exhibited the highest fluorescence level at low inducer concentration, matching previous reports that it is a “leaky” promoter.
  • Example 3 [086] Inducible systems enable tunable gene expression in an anaerobic environment. Engineering programmable gene expression in S.
  • boulardii in vivo would enable it to deliver NCSU-2022-177-02 NCSU-41009.601 nutrients or therapeutics to the gut environment in a tunable fashion, expanding its utility as a “living medicine.” Due to their high fold-induction and high expression levels, experiments focused on the performance of pXYL, pLAC, and pGAL under gut-like conditions. Because the large intestine (where S. boulardii primarily resides) is characterized by very low oxygen concentrations, the performance of the selected inducible systems under was analyzed anaerobic conditions.
  • CaFBFP Candida albicans-adapted flavin-based fluorescent protein
  • Flavin-based fluorescent proteins do not require oxygen to fold.
  • Production of CaFBFP was placed under the control of each inducible promoter in the library, transformed these UQGXROJX YT BH8GQj GQTSM ⁇ OYN ITWWKXUTSJOSM WKUWKXXTW UQGXROJX GX SKIKXXGW ⁇ % GSJ IZQYO[GYKJ YNK resulting strains under aerobic and anaerobic conditions.
  • Example 4 Inducible systems enable ligand-responsive surface display in S. boulardii. Having demonstrated inducible gene expression in S. boulardii under anaerobic conditions, experiments NCSU-2022-177-02 NCSU-41009.601 were conducted to investigate several possible applications for these inducible systems. As a case study, surface display was selected. Surface display of proteins on the cell surface of commensal bacteria has enabled enhanced colonization of the gut and localization of the bacteria to specific therapeutic sites. Therefore, enabling surface display in S. boulardii will add to its programmability as a therapeutic. In S.
  • surface display is enabled by fusing the protein of interest to Aga2. Upon expression of the fusion protein, it localizes to the cell wall surface through disulfide bonds between Aga1 and Aga2, resulting in display of the protein of interest.
  • the cell surface anchor protein Aga1 was expressed in the genome using inducible pGAL1, and an Aga2-GFP fusion protein was expressed under inducible control of pGAL1 on a low-copy plasmid. GFP was selected as the protein of interest for surface display.
  • inducible expression is preferable to constitutive expression as it enables the cell population to grow to the requisite size before initiating surface display.
  • Example 5 Inducible systems enable orthogonal gene expression. Engineered microbes can sometimes be programmed to make use of multiple inducible promoters each responding to different inducer molecules. Experiments were conducted to investigate whether any inducible promoters in the library responded to inducer molecules from other systems, as such “crosstalk” could present a barrier to engineering more complex circuit behavior. To check for crosstalk, yeast cultures harboring each inducible system were grown in cultures containing high concentrations of each of the five inducer molecules, as well as a no-inducer control.
  • Flow cytometry was used to check for fluorescence in each culture. It was found that two inducible systems, the pGAL1 and pLAC system, exhibited significant crosstalk, with galactose inducing a 7.4-fold increase in pLAC expression and IPTG producing a 2-fold increase in pGAL1 expression (FIG. 5A). This lack of orthogonality most likely arises from the chemical similarity between the two inducer molecules.
  • the pCUP1 promoter appears to exhibit 2-fold activation from IPTG and galactose as well, and aTc induces a small increase ( ⁇ 1.5-fold) in the pLAC and pXYL systems.
  • the pGAL1 system exhibited the highest fold-change (23-fold) in expression following induction with the intended ligand, while pCUP1 had the lowest (5.5-fold).
  • This data suggests that although the five inducible systems are not fully orthogonal, several sets of two systems exist with minimal crosstalk between NCSU-2022-177-02 NCSU-41009.601 them, such as pCUP1 and pXYL, pLAC and pXYL, pTET and pCUP1, pXYL and pGAL1, and pGAL and pTET, with this final pair exhibiting the least amount of off-target repression or induction.
  • Example 6 Galactose metabolism increases and prolongs gut colonization by Sb. Gut mucus is decorated with glycans that serve as a primary carbon source for many intestinal microbes. These glycans are primarily composed of galactose, N-acetylglucosamine, N-acetylgalactosamine, fucose, and sialic acid.
  • mice consumed the noncaloric sweetener sucralose in their water (S), but one of these groups of mice also consumed galactose (S+G).
  • Sb noncaloric sweetener sucralose in their water
  • S+G galactose
  • Example 7 Inducible systems enable responsive in vivo protein production in mouse models. Recombinant proteins can be synthesized in situ in the mammalian gut using engineered probiotics. This cellular mechanism enables delivery of therapeutic and/or diagnostic proteins to the disease location providing sustainable treatment or tracking of the disease.
  • GAL1 promoter In order to test whether GAL1 promoter can be used and induced to produce recombinant proteins in the mouse gut, constructed a SbGal+ strain with a plasmid encoding for nanoluciferase (NLuc) protein under the control of GAL1 promoter (SbGal+-NLuc).
  • SbGal+-NLuc strain was functional and able to produce nanoluciferase when cultured in media (CSM-U) supplemented with galactose.
  • CSM-U media
  • the detection of nanoluciferase produced by SbGal+-NLuc in supernatant samples was at its optimum 5 minutes after assay development.
  • the SbGal+ strain expressing yeGFP was cultured under the control of pGAL1 in media prepared from chow diet pellets with or without addition of galactose to test whether the diet would inhibit and/or achieve pGAL1.
  • mice were given different SbGal+ strains or exposed to different sugar induction in water for 2 days (Day 0- Day 1).
  • the first set of mice were given SbGal+ strain with the noncaloric sweetener sucralose in their water (control group, background luminescence).
  • the second set of mice were given SbGal+-NLuc with the noncaloric sweetener sucralose in their water (no induction control group).
  • mice were given SbGal+-NLuc with the noncaloric sweetener sucralose and galactose as inducer in their water.
  • Daily feces were collected for CFU enumeration and nanoluciferase activity detection via luminescent readout.
  • intestinal tissues were collected for CFU enumeration, nanoluciferase activity detection and imaging. All luminescence values were normalized by CFU. Feces obtained from mice given SbGal+-NLuc and consumed galactose had higher luminescence values compared to the control groups, indicating higher NLuc presence in the feces.
  • mice given SbGal+- NLuc but no galactose consumption were able to synthesize NLuc in the gastrointestinal tract, mostly in the cecum.
  • Bioluminescence imaging of the tissue samples confirmed that the hotspots for NLuc production upon galactose induction were in small intestine and cecum followed by colon.
  • Example 8 [094] Inducible systems enable in vivo logical operations in the mouse gut. Using logic gates in engineered probiotics allows for precise control over protein synthesis in the gut. This can lead to more effective and targeted treatments for a variety of conditions, with fewer side effects compared to systemic drug administration.
  • a transcriptional AND gate was constructed in which both galactose and aTc are necessary for activation of transcription, by cloning two Tet operators (separated by a T-rich spacer) upstream of the pGAL1 promoter, which contains an operator for the Gal4p activator protein.
  • TetR repressor is bound to the Tet operator sites, preventing readthrough, while in the absence of galactose, the Gal4p activator is absent, preventing transcription. Only when both inducers are present should transcription of downstream genes occur.
  • Nanoluciferase (NanoLuc) was selected as the reporter for AND gate behavior.
  • mice Only when aTc NCSU-2022-177-02 NCSU-41009.601 was present in the chow diet media, yeGFP was produced.4 groups of antibiotic-treated mice were MO[KS JOLLKWKSY BH8GQj&U82 ⁇ C6C&> ⁇ ZI GSJ K]UTXKJ YT OSJZIYOTS ITSJOYOTSX OS ⁇ GYKW LTW + JG ⁇ X "5G ⁇ )& 5G ⁇ *#' 7OWXY XKY TL ROIK ⁇ KWK MO[KS BH8GQj&U82 ⁇ C6C&> ⁇ ZI XYWGOS ⁇ OYN YNK STSIGQTWOI X ⁇ KKYKSKW XZIWGQTXK OS YNKOW ⁇ GYKW "8GQ a GCI &#' BKITSJ XKY TL ROIK ⁇ KWK MO[KS BH8GQj&U82 ⁇ C6
  • Single inducer groups exhibited some level of AND-gate activation due to availability of galactose in the diet and/or in the mucus or strength of galactose operation sidetracking Tet repression (as observed in the in vitro testing), however the maximum activation was possible when both inducers present in vivo.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des matériaux et des procédés associés à la production de peptides et de polypeptides à partir de micro-organismes modifiés. En particulier, la présente invention concerne des compositions et des procédés de production d'un micro-organisme génétiquement modifié (par exemple, une cellule de levure) présentant une expression et/ou une sécrétion de protéines améliorées.
PCT/US2023/074893 2022-09-23 2023-09-22 Microorganismes modifiés présentant une expression et une sécrétion de protéines améliorées WO2024064888A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263376912P 2022-09-23 2022-09-23
US63/376,912 2022-09-23

Publications (2)

Publication Number Publication Date
WO2024064888A2 true WO2024064888A2 (fr) 2024-03-28
WO2024064888A3 WO2024064888A3 (fr) 2024-05-02

Family

ID=90455307

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/074893 WO2024064888A2 (fr) 2022-09-23 2023-09-22 Microorganismes modifiés présentant une expression et une sécrétion de protéines améliorées

Country Status (1)

Country Link
WO (1) WO2024064888A2 (fr)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2009318173B2 (en) * 2008-11-24 2014-12-11 C5 Ligno Technologies In Lund Ab Saccharomyces strain with ability to grow on pentose sugars under anaerobic cultivation conditions
AU2016284696B2 (en) * 2015-06-25 2021-10-28 Amyris, Inc. Maltose dependent degrons, maltose-responsive promoters, stabilization constructs, and their use in production of non-catabolic compounds

Also Published As

Publication number Publication date
WO2024064888A3 (fr) 2024-05-02

Similar Documents

Publication Publication Date Title
US20200246394A1 (en) Bacteria Engineered to Reduce Hyperphenylalaninemia
US11879123B2 (en) Bacteria for the treatment of disorders
KR20170121291A (ko) 감소된 창자 염증 및/또는 강화된 창자 점막 장벽으로부터 이익을 얻는 질병을 치료하기 위해 공학처리된 박테리아
US9127284B2 (en) Modified bacteria and their uses thereof for the treatment of cancer or tumor
WO2017040719A1 (fr) Bactéries génétiquement modifiées pour traiter des troubles dans lesquels l'oxalate est nocif
US20170128499A1 (en) Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier
ES2925049T3 (es) Bacterias manipuladas para reducir la hiperfenilalaninemia
WO2016210373A2 (fr) Bactéries recombinantes modifiées pour la biosécurité, compositions pharmaceutiques, et leurs procédés d'utilisation
WO2017123592A1 (fr) Bactérie manipulée pour traiter des troubles associés aux sels biliaires
JP2018501797A (ja) 炎症性大腸疾患の診断、モニタリング、および処置のためのプロバイオティック生物
CN107530406A (zh) 用于保护肠微生物群系的与抗生素一起使用的碳青霉烯酶
WO2018031531A1 (fr) Bactéries modifiées pour imagerie non invasive et applications thérapeutiques
Van Zyl et al. In vivo bioluminescence imaging of the spatial and temporal colonization of lactobacillus plantarum 423 and enterococcus mundtii ST4SA in the intestinal tract of mice
WO2024064888A2 (fr) Microorganismes modifiés présentant une expression et une sécrétion de protéines améliorées
US20240197843A1 (en) Bacteria engineered to treat disorders in which oxalate is detrimental
JP2023511282A (ja) シュウ酸塩が有害となる障害を治療するための遺伝子改変細菌
US20230407292A1 (en) Construct for expressing monomeric streptavidin
US20220257732A1 (en) Enumeration of genetically engineered microorganisms by live cell counting techniques
Hurt et al. Genomically mined acoustic reporter genes enable real-time in vivo monitoring of tumors and tumor-homing probiotics
Cui et al. Tracing Lactobacillus plantarum within the intestinal tract of mice: green fluorescent protein‐based fluorescent tagging
JP2022512380A (ja) 高シュウ酸尿症を治療するための方法及び組成物
Zaragoza et al. Novel delivery systems for controlled release of bacterial therapeutics
Lee et al. In vivo imaging of Escherichia coli and Lactococcus lactis in murine intestines using a reporter luciferase gene
US20220290162A1 (en) Acoustic remote control of microbial immunotherapy
US20240254495A1 (en) Therapeutic Engineered Microbial Cell Systems and Methods for Treating Conditions in Which Oxalate is Detrimental

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23869227

Country of ref document: EP

Kind code of ref document: A2