WO2024026922A1 - Method for simplifying design, synthesis and assembly of chloroplast genome of chlamydomonas reinhardtii, and use thereof - Google Patents

Abstract

Provided are a method for simplifying the design, synthesis and assembly of a chloroplast genome of chlamydomonas reinhardtii, and use thereof. The method comprises: simplifying the design, total chemical synthesis, assembly, functional verification and use of the chloroplast genome of the chlamydomonas reinhardtii. On the basis of a natural organelle chloroplast genome of the chlamydomonas reinhardtii, a chloroplast genome of the chlamydomonas reinhardtii is re-designed and manually constructed. By means of deleting redundant genetic information, changing genetic elements or metabolic pathways or adding brand-new genetic elements or metabolic pathways, and the like, the genome is comprehensively modified; furthermore, design defects and sequence defects of the chloroplast genome of the chlamydomonas reinhardtii are repaired to achieve precise matching between the chemical synthesis and the design sequence, and verify and evaluate the design principle of the chloroplast genome of the chlamydomonas reinhardtii. On this basis, customized construction of chloroplasts is achieved, thereby providing brand-new chassis cells and optimized platform carriers for the research and production in fields such as medicine, energy, environment, and agriculture.

Description

A method and application to simplify the design, synthesis and assembly of Chlamydomonas reinhardtii chloroplast genome Technical field

The present invention relates to the fields of biotechnology and synthetic biology, and in particular to a method and application for simplifying the design, synthesis and assembly of Chlamydomonas reinhardtii chloroplast genome.

Background technique

Chlamydomonas reinhardtii is a unicellular eukaryotic dinoflagellate. It is a model organism for studying various life activities (such as photosynthesis, flagellum assembly, phototaxis and circadian rhythm, etc.). It has many common characteristics with yeast cells. It is known as "photosynthetic yeast". Chlamydomonas neoformans has three genetic systems: nuclear genome, chloroplast genome and mitochondrial genome. It is one of the few model species in which all three genetic systems can be easily and effectively transformed. Because Chlamydomonas reinhardtii has the characteristics of simple culture conditions, short growth cycle, high photosynthetic efficiency and clear genetic background, Chlamydomonas reinhardtii is considered to be a genetically modified bioreactor with broad application prospects.

Synthetic biology is the targeted design, transformation and even resynthesis of organisms based on engineering design concepts. The "writing" of genomic information will trigger the third biotechnology revolution marked by genome design and chemical synthesis, break the boundaries between non-living matter and life, and start the process of "designing life, recreating life and reshaping life" , promoting the extension of life science from understanding life to creating life, is expected to produce revolutionary developments in the fields of human health, environment, energy, agriculture and other fields [Cello J, Paul A V, Wimmer E. Chemical Synthesis of Poliovirus cDNA: Generation of Infectious Virus in the Absence of Natural Template[J].Science,297(5583):1016-8]. Chloroplast genomes provide unique opportunities for the field of synthetic biology. The chloroplast genome forms its own genetic system in a relatively small separate space. It mainly encodes some proteins closely related to photosynthesis and some ribosomal proteins. The size ranges between 150-205Kb. The chloroplast genomes of many taxa have been completed. Sequencing, and in plants and algae, chloroplast genetic transformation and expression technology is very mature [Smith H O, Hutchison C A, Pfannkoch C, et al. Generating a synthetic genome by whole genome assembly:? X174 bacteriophage from synthetic oligonucleotides[J].Proceedings of the National Academy of Sciences,2003,100(26):15440-15445.]. Therefore, these natural smaller controllable genomes are ideal materials for genetic engineering in the fields of food, energy, medicine and other biological products, and are an ideal target for synthetic biology [Chan LY, Kosuri S, Endy D. Refactoring bacteriophage T7.Mol Syst Biol.2005;1:2005.0018.].

In the process of exploring the evolution and evolution of life, the smallest genome has always been the goal pursued by researchers. Moderate streamlining of biological genomes can optimize cellular metabolic pathways, improve substrate and energy utilization efficiency, and greatly improve the possibility of predicting and controlling cellular physiological properties. There are about 20% repetitive DNA sequences in the genome of Chlamydomonas reinhardtii. There have been only sporadic reports on whether and what biological functions these sequences have. For example, some studies have pointed out that deleting the repeated segments between petA and petD will not affect the normal biological function of the gene, but the structure of the transcribed mRNA will be different; deleting the repeated segments near the atpB and psaB genes will affect photosynthesis. However, currently, no researchers have started from the entire chloroplast genome to globally transform these repeated segments and explore the functions of the repeated segments. Therefore, the existing technology still needs to be improved.

Contents of the invention

In view of the shortcomings of the above-mentioned existing technologies, the present invention provides a method and application for simplifying the design, synthesis and assembly of Chlamydomonas reinhardtii chloroplast genome, aiming to streamline the Chlamydomonas reinhardtii chloroplast genome by deleting unnecessary genes and deleting redundant repetitive segments. , providing new chassis cells and optimized platform carriers for research and production in medicine, energy, environment, agriculture, etc.

The technical solution of the present invention is as follows:

A method for simplifying the design and synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome, wherein the method includes simplifying the rational design, synthetic assembly, functional verification and application of the Chlamydomonas reinhardtii chloroplast genome; wherein the rational design of the genome includes deleting Chlamydomonas reinhardtii Short repetitive fragments in the chloroplast genome are inserted into NotI and AscI restriction endonuclease sites, resistance selection markers are inserted, and PCR watermark tags are added.

The described method for simplifying the design and synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome, wherein the rational design of the genome includes deleting 59 short repetitive fragments in the Chlamydomonas reinhardtii chloroplast genome and inserting 7 NotI and 4 AscI restriction endonuclease sites. point, insert aadA, aphVIII and cat resistance selection markers, and add 28 pairs of PCR watermark tags.

In the method for designing and synthesizing the simplified Chlamydomonas reinhardtii chloroplast genome, the full length of the designed simplified Chlamydomonas reinhardtii chloroplast genome is 186,890 bp.

The method for designing and synthesizing the simplified Chlamydomonas reinhardtii chloroplast genome, wherein the simplified Chlamydomonas reinhardtii chloroplast genome is divided into 65 primary fragments for synthesis, and each primary fragment has an ApaI restriction enzyme at both ends. At the cutting site, there are 80bp homology arms between the two fragments.

The method for simplifying the design, synthesis and assembly of the chloroplast genome of Chlamydomonas reinhardtii, wherein all the first-level fragments are synthesized by chemical methods.

The method for simplifying the design and synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome, wherein the simplified synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome includes the following steps:

6.1 Divide the simplified Chlamydomonas reinhardtii chloroplast genome into 65 primary fragments for synthesis;

6.2 Use yeast to assemble the synthesized 65 primary fragments into 14 secondary fragments;

6.3 Assemble 14 secondary fragments into three third-level fragment plasmids;

6.4 Transfer the third-level fragment plasmid into different yeast strains, and use the characteristics of yeast hybrid spores to merge the third-level fragment plasmid into one yeast strain;

6.5 Use endonuclease I-SceI to induce homologous recombination in vivo to obtain the simplified Chlamydomonas reinhardtii chloroplast genome.

The method for simplifying the design, synthesis and assembly of the Chlamydomonas reinhardtii chloroplast genome, wherein the functional verification of the simplified Chlamydomonas reinhardtii chloroplast genome includes the following steps:

7.1 Transfer the simplified Chlamydomonas reinhardtii chloroplast genome into E. coli for propagation, and extract plasmid DNA;

7.2 Use a gene gun to transform the plasmid DNA into Chlamydomonas reinhardtii chloroplasts;

7.3 The transformed Chlamydomonas reinhardtii cells are screened on a culture plate containing spectinomycin to select green single clones;

7.4 Use pre-designed watermark tags to detect the green single clone, and select positive transformants whose chloroplast genome has been replaced by the simplified Chlamydomonas reinhardtii chloroplast genome;

7.5 Detect the biological activity of the positive transformants.

In the method for simplifying the design, synthesis and assembly of the chloroplast genome of Chlamydomonas reinhardtii, the gene gun usage parameters are: gold powder particle diameter 1.0 μm, membrane rupture 1100 psi, bombardment distance 9 cm, and DNA concentration 1 μg/μL.

An application of a simplified Chlamydomonas reinhardtii chloroplast genome, wherein the simplified Chlamydomonas reinhardtii chloroplast genome is applied to cell engineering or metabolic engineering, wherein the simplified Chlamydomonas reinhardtii chloroplast genome is simplified according to any one of the above The Chlamydomonas reinhardtii chloroplast genome was prepared by design and synthetic assembly.

The application of the simplified Chlamydomonas reinhardtii chloroplast genome, wherein the β-carotenoid metabolism pathway application module is integrated into the simplified Chlamydomonas reinhardtii chloroplast genome to perform biosynthesis of the target product.

Beneficial effects: The present invention provides a method and application for simplifying the design, synthesis and assembly of the chloroplast genome of Chlamydomonas reinhardtii. The method includes simplifying the rational design, synthesis, assembly, functional verification and application of the Chlamydomonas reinhardtii chloroplast genome. The present invention designs a simplified Chlamydomonas reinhardtii chloroplast genome by deleting short repetitive fragments in the Chlamydomonas reinhardtii chloroplast genome, inserting NotI and AscI restriction endonuclease sites, inserting resistance screening markers, and adding PCR watermark tags. The present invention selects the Chlamydomonas reinhardtii chloroplast genome as the research object. Based on the natural organelle chloroplast genome of Chlamydomonas reinhardtii, it redesigns and artificially constructs the chloroplast genome of Chlamydomonas reinhardtii, and changes and adds new genetic elements or metabolism by removing redundant sequences. Pathways, etc. achieve a comprehensive transformation of the genome, repair the design defects and sequence defects of the Chlamydomonas reinhardtii chloroplast genome, achieve accurate matching of chemical synthesis and design sequences, and verify and evaluate the design principles of the Chlamydomonas reinhardtii chloroplast genome. This invention is the first to explore the functions of short dispersed repeat sequences in the entire chloroplast genome, and starts from the entire chloroplast genome to globally transform these repeat fragments and explore the functions of these repeat fragments, in order to elucidate the origin, biological significance and evolution of these repeat fragments. It provides the basis for its role in the process; it is the first attempt to streamline the Chlamydomonas reinhardtii chloroplast genome by deleting non-essential genes and redundant repetitive segments; it is the first attempt to assemble metabolic pathways in the chloroplast genome. The method provided by the invention can realize the customized construction of chloroplasts, and provide new chassis cells and optimized platform carriers for research and production in medicine, energy, environment, agriculture, etc.

Description of the drawings

Figure 1 is a simplified map of the chloroplast genome of Chlamydomonas reinhardtii provided by an embodiment of the present invention.

Figure 2 is a comparison chart of SDRs content in the original genome and the simplified Chlamydomonas reinhardtii chloroplast genome provided by the embodiment of the present invention.

Figure 3 is a schematic diagram of the simplified Chlamydomonas reinhardtii chloroplast genome sequence results of PCR verification of yeast assembly provided by the embodiment of the present invention.

Figure 4 is a schematic diagram of the enzyme cutting site results at the deletion position of transgenic Chlamydomonas provided by the embodiment of the present invention.

Figure 5 is a schematic diagram of the watermark PCR tag detection results provided by the embodiment of the present invention.

Figure 6 is a growth curve diagram of transformant Chlamydomonas reinhardtii and wild-type Chlamydomonas provided by the embodiment of the present invention.

Figure 7 is a graph showing β-carotenoid content in wild-type and transformed Chlamydomonas provided by the embodiment of the present invention.

Detailed ways

The present invention provides a method and application for simplifying the design, synthesis and assembly of the chloroplast genome of Chlamydomonas reinhardtii. In order to make the purpose, technical solution and effect of the present invention clearer and clearer, the present invention is further described in detail below. It should be understood that the specific embodiments described here are only used to explain the present invention and are not intended to limit the present invention.

Embodiments of the present invention provide a method for simplifying the design and synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome. The method includes simplifying the rational design, synthetic assembly, functional verification and application of the Chlamydomonas reinhardtii chloroplast genome.

The chloroplast genome of Chlamydomonas reinhardtii is representative, and its genome structure is similar to that of Chlorella, Arabidopsis, Brachypodium, and rice. Studying its synthetic assembly strategy will be useful for understanding the artificial modification of chloroplast genomes in other species. Better reference value. Moreover, the Chlamydomonas reinhardtii chloroplast genome has its own unique characteristics, containing about 20% of its own repetitive DNA sequences. Most intergenic regions are composed of multiple types of short dispersed repeats (SDRs), which may have structural or evolutionary significance, which will provide new evidence for the study of chloroplast gene function and evolution. Therefore, the embodiment of the present invention selects the Chlamydomonas reinhardtii chloroplast genome as the research object. Starting from the entire chloroplast genome, the function of short dispersed repeat sequences is explored within the entire chloroplast genome for the first time, and these repeat fragments are globally transformed to explore the functions of these repeat fragments. Provide a basis for elucidating the origin, biological significance and role of these repeated segments in evolution

Embodiments of the present invention are based on the natural organelle chloroplast genome of Chlamydomonas reinhardtii, redesign and artificially construct a simplified version of the chloroplast genome of Chlamydomonas reinhardtii, and achieve genome modification by removing redundant sequences, changing and adding new genetic elements or metabolic pathways, etc. Comprehensive transformation and repair of design defects and sequence defects in the chloroplast genome of Chlamydomonas reinhardtii. Using the method of synthetic biology, the simplified Chlamydomonas reinhardtii chloroplast genome fragment designed by full chemical synthesis was used to achieve full chemical de novo synthesis and assembly of the simplified version of the chloroplast genome in a yeast-bacteria system. Then, the fully chemically synthesized simplified version of the chloroplast genome was transformed into Chlamydomonas cells, and a variety of technical means were used to replace the original chloroplast genome to achieve the biological functions of the fully chemically synthesized and simplified Chlamydomonas reinhardtii chloroplast genome.

In some embodiments, the genome design includes deleting short repetitive fragments in the chloroplast genome of Chlamydomonas reinhardtii, inserting NotI and AscI restriction endonuclease sites, inserting resistance selection markers, and adding PCR watermark tags.

In some specific embodiments, the genome design includes deleting 59 short repeats (SDRs) in the Chlamydomonas reinhardtii chloroplast genome, with a total base number of 32,485 bp; inserting 11 special enzyme cutting sites, including 7 NotI and 4 AscI restriction endonuclease sites; insert 3 resistance selection markers, including aadA, aphVIII and cat resistance selection markers; add 28 pairs of PCR watermark tags. The final designed simplified chloroplast genome length of Chlamydomonas reinhardtii is 186,890 bp.

Specifically, the embodiments of the present invention are improved based on the wild-type Chlamydomonas reinhardtii chloroplast genome (NC_005353.1).

First, delete the repeated fragments in the middle of the wild-type Chlamydomonas reinhardtii chloroplast genome: use the bioinformatics software vmatch to calculate the position of the repeated fragments in the wild-type Chlamydomonas reinhardtii chloroplast genome. The parameter settings are as follows:

Vmatch-d-absolute-l 20 Cre.CP.MT.genomes.fasta>result

A total of 32485 bp of bases were deleted.

Second, 11 special restriction sites were inserted, including 7 NotI (GCGGCCGC) restriction sites and 4 AscI (GGCGCGCC) restriction sites.

Third, insert three resistance selection marker expression boxes, including aadA, aphVIII, and cat.

Fourth, add 28 pairs of PCR watermark tags.

Finally, the size of the simplified Chlamydomonas reinhardtii chloroplast genome designed and synthesized was 186,890 bp, and the map is shown in Figure 1. During the design process, a total of 32,485 bp of bases were deleted and 6,099 bp of bases were added. After the design was completed, the simplified chloroplast genome of Chlamydomonas reinhardtii basically did not contain short repetitive fragments.

Embodiments of the present invention are based on the natural chloroplast genome of Chlamydomonas reinhardtii, rationally designed and artificially constructed a simplified version of the chloroplast genome of Chlamydomonas reinhardtii, and achieve a comprehensive genome by removing redundant sequences, changing or adding new genetic elements or metabolic pathways, etc. Transformation. We also repaired the design defects and sequence defects of the chloroplast genome of Chlamydomonas reinhardtii to achieve accurate matching of chemical synthesis and design sequences, verify and evaluate the design principles of the chloroplast genome of Chlamydomonas reinhardtii, and realize customized construction of chloroplasts on this basis. The embodiment of the present invention is the first attempt to streamline the chloroplast genome of Chlamydomonas reinhardtii by deleting unnecessary genes, deleting useless repetitive fragments, and providing new chassis cells and optimized platform vectors for research and production in medicine, energy, environment, agriculture, etc. .

In some embodiments, the simplified Chlamydomonas reinhardtii chloroplast genome is divided into 65 primary fragments for synthesis. Each primary fragment has ApaI restriction enzyme sites at both ends, and there are 80 bp between the two fragments. of homology arms. The primary fragments are all synthesized by chemical methods.

At present, the cost-effective length of synthetic bases is about 3kb, so the designed chloroplast genome fragments are handed over to a biosynthetic company. Each primary fragment is about 2.8k in length, and the first and last fragments contain homologous fragments of the yeast E. coli shuttle plasmid. About 80 bp, and the remaining fragments contain 80 bp of upstream and downstream homologous fragments.

In some embodiments, the synthetic assembly of the simplified Chlamydomonas reinhardtii chloroplast genome includes the following steps:

S10. Divide the simplified Chlamydomonas reinhardtii chloroplast genome into 65 primary fragments for synthesis;

S20. Use yeast to assemble the synthesized 65 primary fragments into 14 secondary fragments;

S30. Assemble 14 secondary fragments into three third-level fragment plasmids;

S40. Transfer the third-level fragment plasmid into different yeast strains, and use the characteristics of yeast hybrid spores to merge the third-level fragment plasmid into one yeast strain;

S50. Use endonuclease I-SceI to induce homologous recombination in vivo to obtain the simplified Chlamydomonas reinhardtii chloroplast genome.

The embodiment of the present invention utilizes the efficient homologous recombination function of yeast to assemble the above-constructed simplified primary fragment of the Chlamydomonas reinhardtii chloroplast genome in yeast. Using the homology arms reserved on each fragment, 65 primary fragments were assembled into 14 secondary fragments in yeast to obtain 14 secondary fragment plasmids. Each secondary fragment plasmid contains about 5 primary fragments. fragment. After that, the second-level fragment plasmid is assembled into a large third-level fragment plasmid, and every five or so second-level fragment plasmids are assembled into a third-level fragment plasmid. 14 secondary fragment plasmids were assembled to obtain 3 third-level fragment plasmids. Through yeast hybridization, three third-level fragment plasmids were introduced into a yeast, inducing the expression of reserved restriction enzymes, so that the three third-level fragment plasmids were assembled in the yeast, and a simplified Chlamydomonas reinhardtii chloroplast genome was successfully constructed.

In some embodiments, the functional verification of the simplified Chlamydomonas reinhardtii chloroplast genome includes the following steps:

S100. Transfer the simplified Chlamydomonas reinhardtii chloroplast genome into E. coli for propagation, and extract plasmid DNA;

S200. Use a gene gun to transform the plasmid DNA into Chlamydomonas reinhardtii chloroplasts;

S300. The transformed Chlamydomonas reinhardtii cells are screened on a culture plate containing spectinomycin to select green single clones;

S400. Use pre-designed watermark tags to detect the green single clone, and select positive transformants whose chloroplast genome has been replaced by the simplified Chlamydomonas reinhardtii chloroplast genome;

S500. Detect the biological activity of the positive transformant.

In some specific embodiments, the gene gun usage parameters are: gold powder particle diameter 1.0 μm, membrane rupture 1100 psi, bombardment distance 9 cm, and DNA concentration 1 μg/μL.

In some specific embodiments, the screening plate medium contains 150 μg/mL of spectinomycin.

In some specific embodiments, testing the biological activity of the positive transformant includes the growth status of Chlamydomonas containing a simplified chloroplast genome, the photosynthetic efficiency of chloroplasts, the transcription pattern of chloroplast genes, and gene expression.

In the embodiment of the present invention, a gene gun is used to inject the above plasmid DNA into Chlamydomonas chloroplasts, and positive clones are screened through resistance plates. The screening plate medium contains 150 μg/mL spectinomycin. If the algal cells can grow monoclonal colonies on the screening plate, it means that the simplified chloroplast genome has been transferred to the chloroplast. Then use the designed watermark tag to detect whether the Chlamydomonas chloroplast genome in the monoclonal algal colony has been completely replaced with the artificially designed and synthesized simplified Chlamydomonas reinhardtii chloroplast genome sequence, and select positive transformants that have all been replaced. Afterwards, the biological activities of the positive transformants were detected, including the photosynthetic efficiency of chloroplasts containing simplified chloroplast genomes, the transcription pattern of chloroplast genes, and gene expression.

Embodiments of the present invention also provide an application of a simplified Chlamydomonas reinhardtii chloroplast genome, and the simplified Chlamydomonas reinhardtii chloroplast genome prepared according to the above method is applied to cell engineering or metabolic engineering.

In some embodiments, application modules such as the β-carotenoid metabolism pathway are integrated into the simplified Chlamydomonas reinhardtii chloroplast genome to perform biosynthesis of target products (such as β-carotenoids, etc.). Specifically, the simplified Chlamydomonas reinhardtii chloroplast genome is applied to the introduction of the β-carotenoid metabolic pathway to increase the carotenoid content in Chlamydomonas reinhardtii.

Specifically, the reserved sites can be used to introduce metabolic pathways into the simplified Chlamydomonas reinhardtii chloroplast genome through yeast. Insert the installed β-carotenoid synthesis pathway gene fragment into the primary fragment F5 synthesized in the embodiment of the present invention. There is a BamHI enzyme cleavage site in the primary fragment F5. The β-carotenoid synthesis pathway gene fragment is designed during design. BamHI restriction sites are also inserted at both ends, and the β-carotenoid synthesis pathway gene fragment can be inserted into the primary fragment F5 using the restriction ligation method to form a new F5 sequence. Then according to the assembly method described, an improved simplified Chlamydomonas reinhardtii chloroplast genome containing a β-carotenoid synthesis pathway can be obtained.

One purpose of rationally designing and synthesizing the chloroplast genome of Chlamydomonas reinhardtii is to provide new chassis organelles and designed metabolic pathways for medicine, energy and other fields. Therefore, in the embodiment of the present invention, beta carotenoids are used as an example. During the chloroplast assembly process, a The metabolic pathway of β-carotenoids is assembled into the designed chloroplast genome, and this is used as an example to achieve customized construction of chloroplasts.

The following is a further explanation of the method and application of the present invention for simplifying the design, synthesis and assembly of the chloroplast genome of Chlamydomonas reinhardtii through specific examples:

Unless otherwise specified, the materials, reagents, etc. used in the embodiments of the present invention can be purchased through commercial channels; unless otherwise specified, the methods, processes, etc. used in the embodiments of the present invention are all conventional techniques in the art or those skilled in the art. Reasonable settings can be made based on common sense or conventional technology.

Example 1 Simplified design of Chlamydomonas reinhardtii chloroplast genome

Download the wild-type Chlamydomonas reinhardtii chloroplast genome sequence (NC_005353.1) from NCBI, with a size of 205,503 bp. It was designed based on the wild-type chloroplast genome sequence, including deleting short repetitive fragments in the chloroplast genome of Chlamydomonas reinhardtii, inserting NotI and AscI restriction endonuclease sites, inserting aadA, aphVIII and cat resistance selection markers, and adding PCR watermark label.

1. Deletion of repeated fragments in the chloroplast genome of Chlamydomonas reinhardtii

Use the bioinformatics software vmatch to calculate the position of repeated fragments in the chloroplast genome of Chlamydomonas reinhardtii. The parameter settings are as follows:

Vmatch-d-absolute-l 20 Cre.CP.MT.genomes.fasta>result

The specific deleted position information is shown in Table 1. A total of 32,485 bases were deleted.

Table 1 Positional information table of deletions in the chloroplast genome of Chlamydomonas reinhardtii

2. Insert special enzyme cutting site

A total of 11 special enzyme cutting sites were inserted, including 7 NotI (GCGGCCGC) enzyme cutting sites, and the insertion locations were genome (3159-3166; 8978-8985; 15735-15742; 17522-17529; 19146-19153; 23461-23468 ;179059-179066) and 4 AscI (GGCGCGCC) restriction sites, and the insertion position is the genome (1728-1735; 18726-18733; 20178-20185; 24451-24458).

3. Insert the resistance screening marker expression box

Insert 3 resistance selection marker expression cassettes, including aadA, aphVIII, and cat. Among them, the nucleotide sequence of aadA is shown in SEQ.ID NO.1, and the nucleotide sequence of aphVIII is shown in SEQ.ID NO.2. , the nucleotide sequence of cat is shown in SEQ.ID NO.3.

4. Add PCR watermark label

Add 28 pairs of PCR watermark tags.

Finally, the size of the simplified Chlamydomonas reinhardtii chloroplast genome designed and synthesized was 186,890 bp, and the map is shown in Figure 1. During the design process, a total of 32,485 bp of bases were deleted and 6,099 bp of bases were added. After the design was completed, the simplified chloroplast genome of Chlamydomonas reinhardtii basically did not contain short repetitive fragments. The comparison results are shown in Figure 2, which shows the genome sequence results of approximately 30 kb.

Example 2 Simplifying the synthetic assembly of Chlamydomonas reinhardtii chloroplast genome

1. Chemical synthesis of primary fragments

The designed 186,890 bp simplified Chlamydomonas reinhardtii chloroplast genome sequence is divided into 65 primary fragments for synthesis. Each fragment is 2880 bp long and has ApaI restriction enzyme sites at both ends. It can be obtained by direct enzyme digestion to synthesize the plasmid. The fragments used for assembly have 80 bp homology arms between the two fragments. All primary fragments were synthesized by commercial companies, and their sequences were confirmed by sequencing and enzyme digestion.

2. Secondary fragment plasmid assembly

In view of the large number of primary fragments in the synthesized simplified Chlamydomonas reinhardtii chloroplast genome, in order to ensure assembly efficiency, yeast was used to first assemble 65 primary fragments into 14 secondary fragment plasmids, each of which was approximately 14 kb.

14 secondary fragment plasmids were assembled in the BY4741 background strain (commercial strain, purchased from Huinuo Biomedical Technology Co., Ltd., product number: A226). Each secondary fragment plasmid includes 4-5 primary fragments of the chloroplast genome, 1 A yeast bacterial shuttle plasmid skeleton, in which pRS416 (commercial plasmid, purchased from ACD, Cat. No.: 518681-C2) is used as the vector of the secondary fragment plasmid, and the URA3 gene provides an auxotrophic screening marker. The specific assembly process is as follows:

(1) Fragment preparation: Obtain the synthetic primary fragment through enzyme digestion, obtain the yeast bacterial shuttle plasmid skeleton through PCR amplification, and recover the enzyme digestion product and PCR amplification product for later use;

(2) Transformation: Co-transform the above recovered products into BY4741 yeast cells, and use SC-URA plates to screen positive clones;

(3) Identification: Randomly select single clones for yeast colony PCR preliminary screening and genome re-screening, and finally verify with all junction primers.

All 14 secondary fragment plasmids were assembled according to the above method steps.

3. Assembly of third-level fragment plasmids

(1) Assembly of third-level fragment plasmid 1

The third-level fragment plasmid 1 was assembled in the BY4741 background strain (commercial strain, purchased from Huinuo Biomedical Technology Co., Ltd., product number: A226), with a total of 7 fragments, including 4 chloroplast genome fragments of the above-mentioned second-level fragment plasmid, 1 BAC fragment, URA3 selection gene and A10-F46 bridge fragment. Among them, BAC serves as the vector of third-level fragment plasmid 1, the URA3 gene provides an auxotrophic screening marker, and the A10-F46 bridging fragment is used to insert an I-SceI restriction site between fragment A10 and fragment A10. The specific assembly process is as follows:

1) Fragment preparation: Obtain the synthetic fragments A1-5, A6-10, F46-50 and F50-53 through enzyme digestion, and obtain the BAC fragment, URA3 screening gene and A10-F46 bridge fragment through PCR amplification. Enzyme digestion products and PCR amplification products are recovered for later use. The BAC fragment is derived from plasmid pBeloBAC11 (commercial plasmid, purchased from Protein Biotechnology (Beijing) Co., Ltd., product number: pBeloBAC11), and the amplification primers used are as shown in SEQ ID NO.4-SEQ ID NO.9:

SEQ ID NO.4:1-BAC-1F

ggcaacgtccattcctatctgtttacggattattaatgtcctcatgtattcatagcaagcacatgtcggccgcctcggcctc

SEQ ID NO.5:1-BAC-1R

cctcagtcacttattatcactagcgctcgccgcagccgtgtaaccgagcatagcgagcgaactggcgaggaagcaaagaa

SEQ ID NO.6:1-BAC-2F

gatatcgggggttagttcgtcatcattgatgagggttgattatcacagtttattactctgaattggctatccgcgtgt

SEQ ID NO.7:1-BAC-2R

gaatacatgaggacattaataatccgtaaacagataggaatggacgttgcctagaaagaatcggccataatggccactctgcg

SEQ ID NO.8:1-I-SecI-F

ttttttaaaacgcaagtccttttttaagatagttattattaaccattatgttgcacatactcctagggataacagggtaat

SEQ ID NO.9:1-I-SecI-R

ctaaaaaaccgtaagcaatccatgttgtggtaaattctgcaggtttttcaaaaaaacttgaaatattattaccctgttatccctagg

2) Transformation: Co-transform the above recovered products into BY4741 yeast cells, and use SC-URA plates to screen positive clones.

3) Identification: Randomly select single clones for preliminary yeast colony PCR screening and genome re-screening, and finally verify them with all junction primers.

(2) Assembly of third-level fragment plasmid 2

The third-level fragment plasmid 2 was assembled in the BY4742 background strain (commercial strain, purchased from Beijing Xinghua Yueyang Biotechnology Co., Ltd., Cat. No. NRR01120), with a total of 7 fragments, including 6 chloroplast genome fragments of the above-mentioned second-level fragment plasmid. and pRS415 (commercial plasmid, purchased from Protein Biotechnology (Beijing) Co., Ltd., product number: pRS415) vector fragment. The process is similar to the assembly of tertiary fragment plasmid 1, except that SC-LEU plates are used to screen positive clones. After verification of all junction primers, the third-level fragment plasmid 2 was successfully assembled in BY4742 cells. The amplification primers used are as shown in SEQ ID NO.10-SEQ ID NO.11:

SEQ ID NO.10:2-RS415-F

cgacctctttgcatatctgaatcttacaaagaaattcctacaggagaagttagtatttcttagggataacagggtaatcaattcgccctatagtgagt

SEQ ID NO.11:2-RS415-R

gtctctggtaagatttttgttttattaccaagaaaagataataatacaaaccatatatatattaccctgttatccctacaccgcggtggagctccag

(3) Assembly of third-level fragment plasmid 3

The third-level fragment plasmid 3 was assembled in the BY4741 background strain, with a total of 8 fragments, including 7 chloroplast genome synthesis fragments of the above-mentioned second-level fragment plasmid and pRS411 (commercial plasmid, purchased from Prutin Biotechnology (Beijing) Co., Ltd., Catalog number: BioVectorNumber:87474) vector fragment, the process is similar to the assembly of third-level fragment plasmid 1, except that SC-MET plate is used to screen positive clones. After verification of all junction primers, the third-level fragment plasmid was successfully assembled in BY4741 cells. The amplification primers used are as shown in SEQ ID NO.12-SEQ ID NO.13:

SEQ ID NO.12:3-RS411-F

tagtcaattattaagttcaaaaaatttagttaaatctttaaagcaagcatcgattaatagtagggataacagggtaatcaccgcggtggagctccag

SEQ ID NO.13:3-RS411-R

atattccgctattagtgttacaagttttattaactttgtttaaagattttaaaaaaaccgattaccctgttatccctacaattcgccctatagtgagt

4. Three third-level fragment plasmids are hybridized into a yeast cell using yeast.

After obtaining three yeast strains of third-level fragment plasmids, two rounds of hybridization processes are needed to merge them into one yeast strain. The specific process is as follows:

The Met gene in the yeast strain containing the third-level fragment plasmid 2 was deleted using the principle of homologous exchange, and the Met gene on the genome was replaced with the kanMX fragment. The upstream and downstream sequences of the kanMX fragment and the replacement position are shown in SEQ ID NO.14. Use pFA6-kanMX4 (commercial plasmid, purchased from Shanghai Yaji Biotechnology Co., Ltd., Cat. No.: YC-14391RJ) as a template to perform PCR amplification to obtain kanMX. The primer sequences are as shown in SEQ ID NO.15-SEQ ID NO.16:

SEQ ID NO.15:Met17F：

gatatcttcggatgcaagggttcgaatcccttagctctcagacatggaggcccagaatac;

SEQ ID NO.16:Met17R:

aagtaggtttatacataattttacaactcattacgcacaccagtatagcgaccagcattc.

Transform 25 μl of PCR product into the third-level fragment plasmid (BY4742 background), screen with SC-LEU+G418; copy the transformed plate onto the G418 plate, select single clones that can grow on both plates, and perform PCR verification , verify that the correct strain is used as the third-level fragment plasmid 2 for subsequent experiments.

The above yeast strains containing third-level fragment plasmid 2 and third-level fragment plasmid 3 were hybridized and screened by SC-LEU-MET plate to contain twice the amount of third-level fragment plasmid 2 (LEU2) and third-level fragment plasmid 3 (MET17). Yeast strains. Diploid yeast strains (#1, #2) were randomly selected from the SC-LEU-MET plate and subjected to sporulation and sporulation processes to obtain haploid yeast.

Copy the YPD plate onto SC-LEU, SC-MET and SC-URA plates respectively. SC-LEU and SC-MET are used to screen haploid yeasts containing both third-level fragment plasmid 2 and third-level fragment plasmid 3. The SC-URA plate is used to ensure that the resulting haploid will not grow on the SC-URA plate for subsequent hybridization of the three tertiary fragment plasmids. Finally, a haploid yeast containing both third-level fragment plasmid 2 and third-level fragment plasmid 3 was obtained.

The mating type of the haploid yeasts obtained through the above screening is unknown. In order to subsequently hybridize with the third-level fragment plasmid 1, a haploid yeast strain with mating type alpha needs to be selected. The mating types of SZU-JDY19 (Accession Number: CCTCC M 20221034) and SZU-JDY20 (Accession Number: CCTCC M 20221033) are a and alpha respectively. The haploid strains that hybridize with them can only be successfully hybridized into diploids. Grow on SD plates. Hybridize the above YPD sporulation plates with SZU-JDY19 and SZU-JDY20 respectively, and then copy them to the SD plate. After hybridization with SZU-JDY19, it can grow on the SD plate, but after hybridization with SZU-JDY20, it cannot grow on the SD plate. growth, indicating that its mating type is alpha, and the target strain was successfully screened through this method.

The yeast screened above were hybridized with the yeast containing the third-level fragment plasmid 1, and the yeast containing the three third-level fragment plasmids were screened on the SC-LEU-MET-URA plate, and single clones were selected from the plate for subsequent follow-up. experiment.

5. Simplifying the assembly of Chlamydomonas reinhardtii chloroplast genome

Two of the three third-level fragment plasmids each have a homologous fragment. Both third-level fragment plasmid 1 and third-level fragment plasmid 2 contain fragment A10. Third-level fragment plasmid 2 and third-level fragment plasmid 3 both contain fragment F23. Both first-level fragment plasmid 3 and third-level fragment plasmid 1 contain fragment F46, and both contain an I-SceI cleavage site at one end of the homologous fragment. I-SceI is an endonuclease encoded by the mitochondrial intron of Saccharomyces cerevisiae. It can specifically recognize a sequence of approximately 18 bp and generate a double-stranded break at the recognition site to activate homologous recombination repair in yeast cells. mechanism. By inducing the expression of I-SceI in yeast cells, the third- level fragment plasmids 1, 2, and 3 were linearized, and with the help of the homologous recombination repair system of yeast cells, the complete BAC vector of the third-level fragment plasmid 1 was realized. Assembly of the chloroplast genome.

Transform the SZU-ZLP012 plasmid (deposit number: CCTCC M 20221031) (containing I-SceI endonuclease and HIS3 auxotrophic screening marker gene) into the yeast obtained in the previous step that also contains 3 third-level fragment plasmids, using SC-URA-LEU-MET-HIS plate screening yielded yeast containing three third-level fragment plasmids and the SZU-ZLP012 plasmid. Select single clones and streak them onto SC-URA-HIS+galactose plates, and use galactose to induce the expression of I-SceI. Single clones were selected for primary yeast colony PCR screening and full junction PCR re-screening, and finally the correct strain containing the simplified chloroplast genome of Chlamydomonas reinhardtii was obtained (deposit number: CCTCC M 20221032). The PCR detection results are shown in Figure 3, in which the simplified plasmid junction PCR test results: A1-5; A6-10; F1-5; F6-10; F11-13; F14-18; F19-23; F24-27; F28-32; F33-37; F38-40; F41- 45; F46-50; F51-53.

Example 3 Simplified transformation of Chlamydomonas reinhardtii chloroplast genome

The simplified Chlamydomonas reinhardtii chloroplast genome verified to be correct in the above Example 2 was transferred into E. coli, the genome was amplified using E. coli, and then the plasmid was extracted to obtain a high-concentration plasmid that can be used for chloroplast transformation.

The method for transforming Chlamydomonas reinhardtii with this plasmid is as follows:

First, Chlamydomonas neoformans CC-125 was cultured in TAP culture medium to the logarithmic phase. The cell number was about 1 to 2 × 10 ⁶ cells/mL. It was collected by centrifugation at room temperature (20-25°C); it was recombined with TAP liquid culture medium. Suspension, adjust the cell concentration to 2 × 10 ⁸ cells/mL; absorb 300 μL of suspension and apply it to TAP solid plate culture medium, and culture it in a 22°C light incubator (light condition is 90 μE/m ² /s) for 1-2 days. Form a cell layer.

Afterwards, the Chlamydomonas cells were bombarded with a gene gun (Bio-Rad) under sterile conditions. To use the Böhler desktop gene gun PDS-1000/He, the specific steps are as follows:

Take 50 μL gold powder suspension (60 μg/mL), add 5 μg (1 μg/μl) of the above synthesized circular plasmid, 50 μL 2MCaCl ₂ , 20 μL 0.1M spermidine, and mix by shaking with a turbine oscillator for 1-3 minutes; centrifuge at 8000 rpm. 10 seconds, discard the supernatant; wash with absolute ethanol, shake, centrifuge at 8000 rpm for 10 seconds, discard the supernatant, 5 times in total; finally resuspend the pellet with 60 μL of absolute ethanol.

Take 10 μL for each bombardment, and the bombardment parameters are as follows: vacuum degree 25 inches-Hg, bombardment distance 9cm, bombard 3 times each time, recover and culture in a 22°C light incubator for 12 hours, and then transfer to a screening plate to continue culturing (22°C, 90 μE/ m ² /s) for 1-2 weeks until green single clones grow out.

The above-mentioned screening plate medium contains 150 μg/mL spectinomycin. If the algal cells can grow monoclonal colonies on the screening plate, it means that the simplified Chlamydomonas reinhardtii chloroplast genome has been transferred into the chloroplast.

Example 4 Screening of Transformants

To confirm that the algal colony obtained in Example 3 is Chlamydomonas into which the target gene has been transferred, first perform continuous subculture for 15-20 generations, and then conduct molecular detection and functional verification.

(1) Detection of resistance screening fragments: Use the total DNA of transgenic Chlamydomonas as a template, design a pair of primers according to the aadA, aphVIII, and cat gene sequences, and amplify aadA, aphVIII, and cat gene fragments through PCR, which shows that containing aadA, aphVIII, and cat gene fragments The simplified chloroplast genome of aphVIII and cat genes of Chlamydomonas reinhardtii has been transferred to the chloroplast of Chlamydomonas reinhardtii.

(2) Detection of the position of the deleted repetitive fragment: Use the total DNA of transgenic Chlamydomonas as a template, design PCR primers according to the upstream and downstream sequences of the deleted position in the synthetic sequence, amplify the product, and send it to a sequencing company for sequencing. The sequencing results show that the deletion position of the transgenic Chlamydomonas is the inserted enzyme cutting site, and that of the wild-type algae is the original repeated fragment, proving that the synthesized fragment replaces the original chloroplast genome as expected. The results are shown in Figure 4 (with deletions) Dropping the first segment of the repeated segment and inserting NotI as an example).

(3) Watermark PCR detection: Using the total DNA of transgenic Chlamydomonas as the template and the watermark PCR tag as the primer, the transgenic Chlamydomonas can amplify the gene band, but the wild-type Chlamydomonas cannot amplify the band at all. The results are as follows: As shown in Figure 5.

Through the above identification, it was confirmed that the construction of the simplified Chlamydomonas reinhardtii chloroplast genome transgenic Chlamydomonas reinhardtii was completed. The designed and synthesized sequence replaced the original genome sequence as expected. The simplified genome plasmid was named SZUsyncre1.0 (Accession Number: CCTCC M 20221032).

Example 5 Functional verification of transformants

In order to verify the activity of the transformants obtained in Example 4 above, the present invention detected the growth status of transgenic Chlamydomonas. Shake the algae liquid thoroughly in the ultra-clean workbench, take 1ml of the algae liquid sample from the culture bottle and place it in a 1.5ml centrifuge tube. Use a quartz cuvette to measure the absorbance value at the wavelength of 750nm on the spectrophotometer. Each time you take a sample for measurement , use a pipette to fully flush the algae liquid in the centrifuge tube, quickly transfer it to a quartz cuvette, and wait for the absorbance value to stabilize and then read quickly to avoid the algae sinking that will affect the reading. Take 3 samples for each sample Biological replicates. Draw the growth curve of Chlamydomonas reinhardtii with time as the abscissa and OD 750 as the ordinate. The results are shown in Figure 6, which shows that the growth status of transgenic Chlamydomonas is basically the same as that of wild-type Chlamydomonas, indicating that the transferred designed fragments can perform normal biological functions and maintain the normal growth needs of Chlamydomonas.

Example 6 Synthesis of carotene using simplified Chlamydomonas reinhardtii chloroplast genome

One purpose of rationally designing and synthesizing the Chlamydomonas reinhardtii chloroplast genome is to provide new chassis organelles and designed metabolic pathways for medicine, energy and other fields. Therefore, the present invention is based on the method described in Examples 1-5, taking β-carotenoids as an example, and during the chloroplast assembly process, a metabolic pathway of β-carotenoids is designed and assembled into the designed chloroplast genome. Specific implementation methods As stated below:

Source of β-carotenoid synthesis pathway genes: According to literature reports, the three genes crtE, crtB and crtI come from Pantoeaananatis [Zhu, F., Lu, L., Fu, S., Zhong, X. et al., Targeted engineering and scale up of lycopene overproduction in Escherichia coli.Process Biochem.2014,50,341–346.], the idi gene comes from E.coli [Zhu, F., Zhong, X., Hu, M., Lu, L.et al.,In vitro reconstitution of mevalonate pathway and targeted engineering of farnesene overproduction in Escherichia coli.Biotechnol.Bioeng.2014,111,1396–1405.], the crtY gene comes from Pantoea agglomerans [Schnurr, G., Schmidt, A., Sandmann, G.,Mapping of a carotenogenic gene cluster from Erwinia herbicola and functional identification of six genes.FEMS Microbiol.Lett.1991,78,157-161.], the functions of the five genes have been verified in the literature.

1. Design of β-carotenoid synthesis pathway

According to the reported chloroplast transcriptome data, the multi-gene co-expression sequence existing in the Chlamydomonas reinhardtii chloroplast genome itself was selected, and the original gene ORF was replaced with the β-carotenoid synthesis pathway gene ORF, leaving the remaining sequences unchanged, and then cut into 4 segments. The fragment of about 3kb was sent to a biological company for synthesis. The sequence is shown in SEQ ID NO.17.

2. Assembly of β-carotenoid synthesis pathway

The fragments were assembled in the BY4741 background strain, including 4 β-carotenoid synthesis pathway gene fragments and a yeast bacterial shuttle plasmid backbone. pRS416 was used as the vector for the excerpted fragment plasmid, and the URA3 gene provided an auxotrophic screening marker. The specific assembly process is as follows :

(1) Fragment preparation: Obtain the synthetic fragment through enzyme digestion, obtain the yeast bacterial shuttle plasmid skeleton through PCR amplification, and recover the enzyme digestion product and PCR amplification product for later use;

(2) Transformation: Co-transform the above recovered products into BY4741 yeast cells, and use SC-URA plates to screen positive clones;

(3) Identification: Randomly select single clones for yeast colony PCR preliminary screening and genome re-screening, and finally verify with all junction primers.

3. Integration of β-carotenoid synthesis pathway and simplified chloroplast genome

Insert the installed β-carotenoid synthesis pathway gene fragment into the fragment F5 synthesized in Example 2. There is a BamHI restriction site in fragment F5, and the β-carotenoid synthesis pathway gene fragment is also designed at both ends. The BamHI enzyme cleavage site is inserted, and the β-carotenoid synthesis pathway gene fragment can be inserted into fragment F5 using the enzyme cleavage method to form a new F5 sequence. Then, according to the assembly method of Example 3, a β-carotenoid synthesis pathway gene fragment is obtained. Design of a synthetic pathway for carrots from the synthesized Chlamydomonas reinhardtii chloroplast genome.

4. The method for transforming Chlamydomonas reinhardtii with the designed and synthesized Chlamydomonas reinhardtii chloroplast genome containing the β-carotenoid synthesis pathway and the screening and detection method are as described in Example 3 and Example 4.

5. Detection of β-carotenoids in transformants

(1) Cultivation of transformed Chlamydomonas: sterilize 100 mL of LATP liquid medium, add corresponding antibiotics (spectinomycin 100 μg/mL); add 1 mL of transformed Chlamydomonas grown to the logarithmic phase, in a 22°C light incubator (light conditions are 90 μE /m ² /s) to the logarithmic phase; centrifuge at 4°C and 4000 rpm for 8 minutes to collect the algae; wash the algae once with an appropriate amount of ddH ₂ O to remove excess culture medium; freeze-dry overnight.

(2) Extraction of transformed Chlamydomonas pigment: weigh the freeze-dried algae (about 25 mg), add 500 μL acetone to a 2.0 mL centrifuge tube and vortex; 55°C water bath for 15 min, vortex every 5 minutes; 4°C, Centrifuge at 12000g for 5 minutes, take the supernatant into a new 2.0 mL centrifuge tube; repeat once, add 500 μL acetone to the precipitate and extract again, try to extract the pigment completely; vacuum vortex dry, add 300 μL methanol:isopropyl alcohol (8: 2) Dissolve quantitatively, filter with 0.2μm filter membrane (organic) into a 1.5mL brown centrifuge tube, and mark it.

(3) HPLC detection: Add 50 μL of sample to the sample bottle containing the inner insert tube, and perform liquid chromatography detection.

High performance liquid chromatography: Agilent Technologies, Agilent, USA

Column: 5μ, 150×3.0mm, Phenomenex Inc., Aschaffenburg, Germany

Mobile phase A: ddH ₂ O

Mobile phase B: methanol:isopropyl alcohol (8:2)

Flow rate: 0.6mL/min

Analysis time: 18min

Gradient elution:

0min: 15%A, 85%B

0-10min: 100%A, 0%B

10-12min: 100%A, 0%B

12-18min: 15%A, 85%B

Use a UV detector to measure the absorption peak area at the maximum absorption values of 280nm, 400nm, 440nm, 450nm, and 475nm, and then calculate the yield according to the standard curve.

Beta carotenoids in transformed Chlamydomonas can be detected by the above technical means. The results show (see Figure 7) that compared with wild-type Chlamydomonas, the β-carotenoid content in transformed Chlamydomonas is significantly increased, indicating that the designed and synthesized β-carotenoid pathway works normally, and this assembly strategy can be applied to other metabolisms. Design and synthesis of pathways.

In summary, the present invention provides a method and application for simplifying the design, synthesis and assembly of the Chlamydomonas reinhardtii chloroplast genome. The method includes simplifying the rational design, synthesis, assembly, functional verification and application of the Chlamydomonas reinhardtii chloroplast genome. The present invention designs a simplified Chlamydomonas reinhardtii chloroplast genome by deleting short repetitive fragments in the Chlamydomonas reinhardtii chloroplast genome, inserting NotI and AscI restriction endonuclease sites, inserting resistance screening markers, and adding PCR watermark tags. The present invention selects the Chlamydomonas reinhardtii chloroplast genome as the research object. Based on the natural organelle chloroplast genome of Chlamydomonas reinhardtii, it redesigns and artificially constructs the chloroplast genome of Chlamydomonas reinhardtii, and changes and adds new genetic elements or metabolism by removing redundant sequences. Pathways, etc. achieve a comprehensive transformation of the genome, repair the design defects and sequence defects of the Chlamydomonas reinhardtii chloroplast genome, achieve accurate matching of chemical synthesis and design sequences, and verify and evaluate the design principles of the Chlamydomonas reinhardtii chloroplast genome. This invention is the first to explore the functions of short dispersed repeat sequences in the entire chloroplast genome, and starts from the entire chloroplast genome to globally transform these repeat fragments and explore the functions of these repeat fragments, in order to elucidate the origin, biological significance and evolution of these repeat fragments. It provides the basis for its role; it is the first attempt to streamline the Chlamydomonas reinhardtii chloroplast genome by deleting redundant sequences; it is the first attempt to assemble metabolic pathways in the chloroplast genome. The method provided by the invention can realize the customized construction of chloroplasts, and provide new chassis cells and optimized platform carriers for research and production in medicine, energy, environment, agriculture, etc.

It should be understood that the application of the present invention is not limited to the above examples. Those of ordinary skill in the art can make improvements or changes based on the above descriptions. All these improvements and changes should fall within the protection scope of the appended claims of the present invention.

Claims (10)

1. A method for simplifying the design and synthetic assembly of the chloroplast genome of Chlamydomonas reinhardtii, characterized in that the method includes simplifying the rational design, synthetic assembly, functional verification and application of the chloroplast genome of Chlamydomonas reinhardtii; wherein the rational design of the genome includes deleting the chloroplast genome of Chlamydomonas reinhardtii. Short repetitive fragments in the Chlamydomonas chloroplast genome were inserted into NotI and AscI restriction endonuclease sites, resistance selection markers were inserted, and PCR watermark tags were added.
2. The method for simplifying the design and synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome according to claim 1, characterized in that the rational design of the genome includes deleting 59 short repetitive fragments in the Chlamydomonas reinhardtii chloroplast genome and inserting 7 NotI and 4 AscI Restriction endonuclease sites, insert aadA, aphVIII and cat resistance selection markers, and add 28 pairs of PCR watermark tags.
3. The method for simplified Chlamydomonas reinhardtii chloroplast genome design and synthetic assembly according to claim 2, characterized in that the designed full length of the simplified Chlamydomonas reinhardtii chloroplast genome is 186,890 bp.
4. The simplified Chlamydomonas reinhardtii chloroplast genome design, synthesis and assembly method according to claim 1, characterized in that the simplified Chlamydomonas reinhardtii chloroplast genome is divided into 65 first-level fragments for synthesis, and each first-level fragment has two ends at each end. With ApaI restriction enzyme site, there are 80bp homology arms between the two fragments.
5. The method for simplifying the design, synthesis and assembly of Chlamydomonas reinhardtii chloroplast genome according to claim 4, characterized in that all the first-level fragments are synthesized by chemical methods.
6. The method for simplifying the design and synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome according to claim 1, characterized in that the simplified synthetic assembly of the Chlamydomonas reinhardtii chloroplast genome includes the following steps:

   6.1 Divide the simplified Chlamydomonas reinhardtii chloroplast genome into 65 primary fragments for synthesis;

   6.2 Use yeast to assemble the synthesized 65 primary fragments into 14 secondary fragments;

   6.3 Assemble 14 secondary fragments into three third-level fragment plasmids;

   6.4 Transfer the third-level fragment plasmid into different yeast strains, and use the characteristics of yeast hybrid spores to merge the third-level fragment plasmid into one yeast strain;

   6.5 Use endonuclease I-SceI to induce homologous recombination in vivo to obtain the simplified Chlamydomonas reinhardtii chloroplast genome.
7. The method for simplifying the design, synthesis and assembly of the Chlamydomonas reinhardtii chloroplast genome according to claim 1, wherein the functional verification of the simplified Chlamydomonas reinhardtii chloroplast genome includes the following steps:

   7.1 Transfer the simplified Chlamydomonas reinhardtii chloroplast genome into E. coli for propagation, and extract plasmid DNA;

   7.2 Use a gene gun to transform the plasmid DNA into Chlamydomonas reinhardtii chloroplasts;

   7.3 The transformed Chlamydomonas reinhardtii cells are screened on a culture plate containing spectinomycin to select green single clones;

   7.4 Use pre-designed watermark tags to detect the green single clone, and select positive transformants whose chloroplast genome has been replaced by the simplified Chlamydomonas reinhardtii chloroplast genome;

   7.5 Detect the biological activity of the positive transformants.
8. The method for synthesizing the simplified Chlamydomonas reinhardtii chloroplast genome according to claim 7, characterized in that the gene gun usage parameters are: gold powder particle diameter 1.0 μm, membrane rupture 1100 psi, bombardment distance 9 cm, and DNA concentration 1 μg/μL.
9. An application of a simplified Chlamydomonas reinhardtii chloroplast genome, characterized in that the simplified Chlamydomonas reinhardtii chloroplast genome is applied to cell engineering or metabolic engineering, wherein the simplified Chlamydomonas reinhardtii chloroplast genome is in accordance with claims 1-8 Prepared by any of the simplified Chlamydomonas reinhardtii chloroplast genome design and synthetic assembly methods.
10. The application of the simplified Chlamydomonas reinhardtii chloroplast genome according to claim 9, characterized in that the β-carotenoid metabolic pathway application module is integrated into the simplified Chlamydomonas reinhardtii chloroplast genome to perform biosynthesis of the target product.

Images