WO2024006287A2 - Antiviral compounds useful against sars-cov-2 - Google Patents
Antiviral compounds useful against sars-cov-2 Download PDFInfo
- Publication number
- WO2024006287A2 WO2024006287A2 PCT/US2023/026356 US2023026356W WO2024006287A2 WO 2024006287 A2 WO2024006287 A2 WO 2024006287A2 US 2023026356 W US2023026356 W US 2023026356W WO 2024006287 A2 WO2024006287 A2 WO 2024006287A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- ring
- independently
- substituted
- pharmaceutically acceptable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
- C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
- C07D487/04—Ortho-condensed systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/4985—Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
- C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D311/04—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
- C07D311/06—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2
- C07D311/08—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring
- C07D311/16—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring substituted in position 7
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
- C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
- C07D405/04—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D519/00—Heterocyclic compounds containing more than one system of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring system not provided for in groups C07D453/00 or C07D455/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/16—Purine radicals
- C07H19/20—Purine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
Definitions
- the present technology provides a compound of Formula I: pharmaceutically acceptable salt and/or solvate thereof, wherein Ring A isC 6 -C 10 aryl or 5 to 10 membered heteroaryl; R 1 is selected from H, optionally substituted C 1 -C 6 alkyl, -CH 2 CCH, or optionally substituted 2 to 15 membered heteroalkyl; each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl; each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl; n2 is 0, 1, 2, 3, 4, or 5; and n3 is 0, 1, 2, 3, or 4; with the proviso that the compound is not: (S)-3-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-(4- ethyl-3-methylpiperazin-1-yl)-2H-
- the present technology provides a compound of Formula II: pharmaceutically acceptable salt and/or solvate thereof, wherein Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl; R 1 is selected from H, optionally substituted C 1 -C 6 alkyl, -CH 2 CCH, or optionally substituted 2 to 15 membered heteroalkyl; each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl; each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl; n2 is 0, 1, 2, 3, 4, or 5; and n3 is 0, 1, 2, 3, or 4; with the proviso that the compound is not: 2-(4,6-dimethylpyrazolo[l,5-a]pyrazin-2-yl)-7-(4- ethylpiperazin-l-yl)-9-methyl-4H-pyrido
- the present technology provides a compound of Formula III: pharmaceutically acceptable salt and/or solvate thereof, wherein Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl; Ring B is 5 to 10 membered heteroaryl; each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl; each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl; Ring C is a 5-membered heteroaryl; n2 is 0, 1, 2, 3, 4, or 5; n3 is 0, 1, 2, 3, or 4; zl, z3, and z4 are each independently 0, 1, 2, 3 or 4; z2 is independently at each occurrence 1 or 2; and z5 is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
- the present technology provides a compound selected from the group consisting of:
- the present technology provides a compound of Formula IV: pharmaceutically acceptable salt and/or solvate thereof, wherein Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl; Ring B is 5 to 10 each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl; each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl;
- Ring C is a 5-membered heteroaryl
- n2 is 0, 1, 2, 3, 4, or 5
- n3 is 0, 1, 2, 3 or 4
- zl, z3, and z4 are each independently 0, 1, 2, 3, or 4
- z2 is independently at each occurrence 1 or 2
- z5 is 1,
- the present technology provides a compound having the following chemical structure:
- the present technology provides a compound having the following chemical structure:
- the present technology provides a pharmaceutical composition
- a pharmaceutical composition comprising a compound as disclosed herein, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable excipient.
- the present technology provides a method of treating a disorder or disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound as disclosed herein, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, or a therapeutically effective amount of a pharmaceutical composition as disclosed herein, wherein the disorder or disease is spinal muscular atrophy (SMA).
- SMA spinal muscular atrophy
- the present technology provides a method of treating a disorder or disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound as disclosed herein, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, or a therapeutically effective amount of a pharmaceutical composition as disclosed herein, wherein the disorder or disease is a viral disorder or disease.
- FIG. 1 shows risdiplam’s dual binding sites in exon 7 of SMN2 pre-mRNA.
- One of the risdiplam analogues, SMN-C5 binds to site 1 by stabilizing a bulged A (exon 7 +54) between the 5’-splice site and U1 snRNA and subsequently enhances the U1 snRNP recruitment (17).
- T pseudouridine.
- Terminal stem-loop (TLS2) is an inhibitory ci.s-acting regulatory element for exon 7 splicing (exonic splicing silencer).
- TLS2 Terminal stem-loop
- FIGS. 2A-2B show the structures of risdiplam and its active analogues, SMN-C2 and SMN-C5.
- FIG. 2B shows the fluorescence polarization (FP) of SMN-C2 (0.5 ⁇ M) and RNA and DNA sequences (50 ⁇ M) of various lengths.
- FIGS. 3A-3C shows isothermal calorimetry (ITC).
- FIG. 3A shows raw differential power (DP)
- FIG. 3B shows integrated data for SMN-C2 (250 ⁇ M) and DNA Seq6 (25 ⁇ M) in a buffer that contains 30 mM 2-(A-morpholino)ethanesulfonic acid (MES, pH 6.1), 5% DMSO, and 100 mM NaCl.
- MES 2-(A-morpholino)ethanesulfonic acid
- DMSO 5% DMSO
- the figures are the representation of three independent experiments.
- FIG. 4 shows GaMD simulations revealed spontaneous binding of compound 1 to RNA Seq6 and representative conformation of compound 1-bound RNA Seq6 in the folded state.
- Black compound 1
- Light grey RNA Seq6
- dashed line polar interaction.
- FIGS. 5A-5B show 1 H NMR titration of compound 1 (lOO ⁇ M) with DNA Seq4 at various concentrations, from top to bottom: 0 mol% (no DNA), 2.5 mol% DNA, 5 mol% DNA, 10 mol% DNA, 20 mol% DNA, and a control spectrum of DNA (20 ⁇ M) without compound 1.
- FIG. 5B shows the numbering of compound 1 and the relative saturation-transfer difference (STD) at different position of compound 1 in a mixture of DNA (0.5 ⁇ M) and compound 1 (10 ⁇ M) solution. STD was not detected (N.D.) in the whole piperazine ring.
- FIG. 6 shows various RNA or DNA secondary structures that harbour the SMN- C2 putative binding site (highlighted in red).
- FIGS. 7A-7D show the gene assembly of the SARS-CoV-2 (RefSeq NC 045512).
- ORFlb is continuously synthesized after ORFla when PFS occurs.
- Nsps are produced by viral protease cleavage from ppla and pplab.
- Nspl leader protein
- nsp3 and 5 proteases
- nspl2 RdRp
- nspl3 helicase
- nspl4 3'-to-5' exonuclease
- nspl5 endo-RNase
- nspl 6 2'-O-ribose methyltransferase.
- FIG. 7C shows the RNA structure of SL5 and nearby regions.
- FIG. 7D shows the deconvolution of the RNA-binding site within SL5. C30 selectively binds to the RNA structure containing the bulged G in SL5.
- FIGS. 8A-8B show structures of SMN-C2 and the optimization of ring E for SL5 binding. The dissociation constants were listed in the table.
- FIG. 8B shows titration of fluorescence polarization for SARS-CoV-2 RNA SL5 and SMN-C2, C29, and C30.
- FIGS. 9A-9B shows the dose-response curves in the in vitro fluorescence polarization (FP) binding assay.
- FIG. 10 shows the fluorescence polarization (FP) assay dose-response curves for sequences with Ka values in Table 1, plotted using GraphPad Prism 8.
- FIG. 11 shows the fluorescence polarization (FP) assay dose-response curves for compounds with Ka values in Table 2, plotted using GraphPad Prism 8.
- FIG. 12 shows the fluorescence polarization (FP) assay dose-response curves for sequences with Ka values in Scheme 2, plotted using GraphPad Prism 8.
- FIG. 13 shows the fluorescence polarization assay dose-response curves for sequences in Table S2, plotted using GraphPad Prism 8.
- FIG. 14 shows the fluorescence polarization assay dose-response curves for compounds in Table S4, plotted using GraphPad Prism 8.
- FIG. 15 shows cell-based SMN2 splicing assay with minigenes that harbor different mutations in the GA-rich sequence. The minigene-transfected 293T cells were treated with different concentrations of SMN-C2 for 24 h. The EC 50 was calculated using the disappearance of the Aexon 7 band. The figure is a representative of three biological replicates.
- FIG. 16 shows ITC raw data for SMN-C2 (300 ⁇ M) and dsDNA (43 ⁇ M, annealed Seq6 and its reverse complememt) in a buffer that contains 30 mM 2-(N- morpholino)ethanesulfonic acid (MES, pH 6.1), 5% DMSO, and 100 mM NaCl.
- MES 2-(N- morpholino)ethanesulfonic acid
- DMSO 5% DMSO
- FIGS. 17A-17B show size-exclusion chromatography with a Superdex 75 column for DNAs Seq4 (50 ⁇ M), Seq4_RC (50 ⁇ M), and the dsDNA made by annealing equal molar of the DNAs Seq4 and Seq4_RC.
- FIG. 17A shows size-exclusion chromatography with a Superdex 75 column for DNAs Seq4 (50 ⁇ M), Seq4_RC (50 ⁇ M), and the dsDNA made by annealing equal molar of the DNAs Seq4 and Seq4_RC.
- FIG. 17A shows size-exclusion chromatography with a Superdex 75 column for DNAs Seq4 (50 ⁇ M), Seq4_RC (50 ⁇ M), and the dsDNA made by annealing equal molar of the DNAs Seq4 and Seq4_RC.
- the figures are the representation of three independent experiments.
- FIG. 18B shows size-exclusion chromatography with a Superdex 30 column for random 22nt
- FIG. 18E shows size-exclusion chromatography with a Superdex 30 column for a 1 : 1 annealed mixture of Seql9 and Seql9_RC. All DNA samples were prepared in 1 x phosphate buffered saline (PBS) at 100 ⁇ M.
- PBS phosphate buffered saline
- FIG. 19 shows size-exclusion chromatography with a Superdex 75 column for RNA Seql l.
- FIGS. 20A-20B show the “Intermediate” conformational states of RNA-compound 1 obtained from the GaMD simulations.
- FIG. 20B shows the “Unbound/Unfolded” conformational states of RNA-compound 1 obtained from the GaMD simulations.
- FIGS. 21A-21B show the “Bound/Unfolded” conformational states of DNA Seq6 during binding of compound 1 obtained from the GaMD simulations.
- FIG. 2 IB shows the “Intermediate” conformational states of DNA Seq6 during binding of compound 1 obtained from the GaMD simulations.
- FIGS. 22A-22C show SPR kinetic evaluation results of (FIG. 22A) SMN-C2, (FIG. 22B) SMN-C3, and (FIG. 22C) SMN-C5 with RNA Seq4.
- FIGS. 23 A-23D shows circular dichroism of (FIG. 23 A) RNA Seq6 and (FIG. 23B) reverse complement of RNA Seq6 (RNA Seq6 RC) in the presence or absence of SMN-C2 (262.5 ⁇ M); (FIG. 23C) DNA Seq6 and (FIG. 23D) reverse complement of DNA Seq4 (DNA Seq4 RC) in the presence or absence of compound 1 (60 ⁇ M).
- RNAs and DNAs were prepared at 175 ⁇ M, 40 ⁇ M respectively in 30 mM HEPES (pH 7.3) and 100 mM NaCl.
- HEPES 4-(2- hydroxy ethyl)- 1 -piperazineethanesulfonic acid.
- FIGS. 24A-24B show the ultraviolet-visible spectroscopy of (FIG. 24A) SMN-C2 (262.5 ⁇ M) and RNA Seq6 (175 ⁇ M); (FIG. 24B) compound 1 (60 ⁇ M) and DNA Seq6 (40 ⁇ M) in 30 mM HEPES (pH 7.3) and 100 mM NaCl.
- FIG. 25 shows full gel images for FIG. 15.
- references to a certain element such as hydrogen or H is meant to include all isotopes of that element.
- an R group is defined to include hydrogen or H, it also includes deuterium and tritium.
- Compounds comprising radioisotopes such as tritium, C 14 , P 32 and S 35 are thus within the scope of the present technology. Procedures for inserting such labels into the compounds of the present technology will be readily apparent to those skilled in the art based on the disclosure herein.
- substituted refers to an organic group as defined below (e.g., an alkyl group) in which one or more bonds to a hydrogen atom contained therein are replaced by a bond to non-hydrogen or non-carbon atoms.
- Substituted groups also include groups in which one or more bonds to a carbon(s) or hydrogen(s) atom are replaced by one or more bonds, including double or triple bonds, to a heteroatom.
- a substituted group is substituted with one or more substituents, unless otherwise specified.
- a substituted group is substituted with 1, 2, 3, 4, 5, or 6 substituents.
- substituent groups include: halogens (i.e., F, Cl, Br, and I); hydroxyls; alkoxy, alkenoxy, aryloxy, aralkyloxy, heterocyclyl, heterocyclylalkyl, heterocyclyloxy, and heterocyclylalkoxy groups; carbonyls (oxo); carboxylates; esters; urethanes; oximes; hydroxylamines; alkoxyamines; aralkoxyamines; thiols; sulfides; sulfoxides; sulfones; sulfonyls; pentafluorosulfanyl (i.e., SFs), sulfonamides; amines; N-oxides; hydrazines; hydrazides; hydrazones; azides; amides; ureas; amidines; guanidines; enamines; imides; isocyanates; isothio
- Substituted ring groups such as substituted cycloalkyl, aryl, heterocyclyl and heteroaryl groups also include rings and ring systems in which a bond to a hydrogen atom is replaced with a bond to a carbon atom. Therefore, substituted cycloalkyl, aryl, heterocyclyl and heteroaryl groups may also be substituted with substituted or unsubstituted alkyl, alkenyl, and alkynyl groups as defined below.
- Alkyl groups include straight chain and branched chain alkyl groups having from 1 to 12 carbon atoms, and typically from 1 to 10 carbons or, in some embodiments, from 1 to 8, 1 to 6, or 1 to 4 carbon atoms. Alkyl groups may be substituted or unsubstituted. Examples of straight chain alkyl groups include groups such as methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups.
- branched alkyl groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, tert-butyl, neopentyl, isopentyl, and 2,2- dimethylpropyl groups.
- Representative substituted alkyl groups may be substituted one or more times with substituents such as those listed above, and include without limitation haloalkyl (e.g., trifluoromethyl), hydroxyalkyl, thioalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, alkoxyalkyl, carboxyalkyl, and the like.
- Heteroalkyl groups include straight chain and branched chain alkyl groups except that at least one carbon atom is replaced by a heteroatom e.g., oxygen, nitrogen, or sulfur). Heteroalkyl groups typically include from 1 to 15 carbons or, in some embodiments, from 1 to 10, from 1 to 8, 1 to 6, or 1 to 4 carbon atoms. Heteroalkyl groups typically contain 1, 2, 3, 4, or 5 heteroatoms, e.g., 1, 2, 3, 4, or 5 oxygen atoms. Heteroalkyl groups may be substituted or unsubstituted. Examples of straight chain heteroalkyl groups include derivatives of polyethylene glycol.
- Cycloalkyl groups include mono-, bi- or tricyclic alkyl groups having from 3 to 12 carbon atoms in the ring(s), or, in some embodiments, 3 to 10, 3 to 8, or 3 to 4, 5, or 6 carbon atoms. Cycloalkyl groups may be substituted or unsubstituted. Exemplary monocyclic cycloalkyl groups include, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl groups.
- the cycloalkyl group has 3 to 8 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 5, 3 to 6, or 3 to 7.
- Bi- and tricyclic ring systems include both bridged cycloalkyl groups and fused rings, such as, but not limited to, bicyclo[2.1.1]hexane, adamantyl, decalinyl, and the like.
- Substituted cycloalkyl groups may be substituted one or more times with, non-hydrogen and non-carbon groups as defined above.
- substituted cycloalkyl groups also include rings that are substituted with straight or branched chain alkyl groups as defined above.
- Representative substituted cycloalkyl groups may be mono-substituted or substituted more than once, such as, but not limited to, 2,2-, 2,3-, 2,4- 2,5- or 2,6-disubstituted cyclohexyl groups, which may be substituted with substituents such as those listed above.
- Cycloalkylalkyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a cycloalkyl group as defined above. Cycloalkylalkyl groups may be substituted or unsubstituted. In some embodiments, cycloalkylalkyl groups have from 4 to 16 carbon atoms, 4 to 12 carbon atoms, and typically 4 to 10 carbon atoms. Substituted cycloalkylalkyl groups may be substituted at the alkyl, the cycloalkyl or both the alkyl and cycloalkyl portions of the group. Representative substituted cycloalkylalkyl groups may be mono-substituted or substituted more than once, such as, but not limited to, mono-, di- or tri-substituted with substituents such as those listed above.
- Alkenyl groups include straight and branched chain alkyl groups as defined above, except that at least one double bond exists between two carbon atoms. Alkenyl groups may be substituted or unsubstituted. Alkenyl groups have from 2 to 12 carbon atoms, and typically from 2 to 10 carbons or, in some embodiments, from 2 to 8, 2 to 6, or 2 to 4 carbon atoms. In some embodiments, the alkenyl group has one, two, or three carbon-carbon double bonds.
- Representative substituted alkenyl groups may be mono-substituted or substituted more than once, such as, but not limited to, mono-, di- or tri-substituted with substituents such as those listed above.
- Cycloalkenyl groups include cycloalkyl groups as defined above, having at least one double bond between two carbon atoms. Cycloalkenyl groups may be substituted or unsubstituted. In some embodiments the cycloalkenyl group may have one, two or three double bonds but does not include aromatic compounds. Cycloalkenyl groups have from 4 to 14 carbon atoms, or, in some embodiments, 5 to 14 carbon atoms, 5 to 10 carbon atoms, or even 5, 6, 7, or 8 carbon atoms. Examples of cycloalkenyl groups include cyclohexenyl, cyclopentenyl, cyclohexadienyl, cyclobutadienyl, and cyclopentadienyl.
- Cycloalkenylalkyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of the alkyl group is replaced with a bond to a cycloalkenyl group as defined above. Cycloalkenylalkyl groups may be substituted or unsubstituted. Substituted cycloalkenylalkyl groups may be substituted at the alkyl, the cycloalkenyl or both the alkyl and cycloalkenyl portions of the group. Representative substituted cycloalkenylalkyl groups may be substituted one or more times with substituents such as those listed above.
- Alkynyl groups include straight and branched chain alkyl groups as defined above, except that at least one triple bond exists between two carbon atoms. Alkynyl groups may be substituted or unsubstituted. Alkynyl groups have from 2 to 12 carbon atoms, and typically from 2 to 10 carbons or, in some embodiments, from 2 to 8, 2 to 6, or 2 to 4 carbon atoms. In some embodiments, the alkynyl group has one, two, or three carbon-carbon triple bonds. Examples include, but are not limited to -
- substituted alkynyl groups may be mono- substituted or substituted more than once, such as, but not limited to, mono-, di- or tri -substituted with substituents such as those listed above.
- Aryl groups are cyclic aromatic hydrocarbons that do not contain heteroatoms.
- Aryl groups herein include monocyclic, bicyclic and tricyclic ring systems.
- Aryl groups may be substituted or unsubstituted.
- aryl groups include, but are not limited to, phenyl, azulenyl, heptalenyl, biphenyl, fluorenyl, phenanthrenyl, anthracenyl, indenyl, indanyl, pentalenyl, and naphthyl groups.
- aryl groups contain 6-14 carbons, and in others from 6 to 12 or even 6-10 carbon atoms in the ring portions of the groups.
- the aryl groups are phenyl or naphthyl.
- aryl groups includes groups containing fused rings, such as fused aromatic-aliphatic ring systems (e.g., indanyl, tetrahydronaphthyl, and the like).
- Representative substituted aryl groups may be mono-substituted (e.g., tolyl) or substituted more than once.
- monosubstituted aryl groups include, but are not limited to, 2-, 3- , 4-, 5-, or 6-substituted phenyl or naphthyl groups, which may be substituted with substituents such as those listed above.
- Aralkyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to an aryl group as defined above.
- Aralkyl groups may be substituted or unsubstituted.
- aralkyl groups contain 7 to 16 carbon atoms, 7 to 14 carbon atoms, or 7 to 10 carbon atoms. Substituted aralkyl groups may be substituted at the alkyl, the aryl or both the alkyl and aryl portions of the group.
- Representative aralkyl groups include but are not limited to benzyl and phenethyl groups and fused (cycloalkylaryl)alkyl groups such as 4-indanylethyl.
- Representative substituted aralkyl groups may be substituted one or more times with substituents such as those listed above.
- Heterocyclyl groups include aromatic (also referred to as heteroaryl) and nonaromatic ring compounds containing 3 or more ring members, of which one or more is a heteroatom such as, but not limited to, N, O, and S. Heterocyclyl groups may be substituted or unsubstituted. In some embodiments, the heterocyclyl group contains 1, 2, 3 or 4 heteroatoms. In some embodiments, heterocyclyl groups include mono-, bi- and tricyclic rings having 3 to 16 ring members, whereas other such groups have 3 to 6, 3 to 10, 3 to 12, or 3 to 14 ring members.
- Heterocyclyl groups encompass aromatic, partially unsaturated and saturated ring systems, such as, for example, imidazolyl, imidazolinyl and imidazolidinyl groups.
- the phrase “heterocyclyl group” includes fused ring species including those comprising fused aromatic and non-aromatic groups, such as, for example, benzotriazolyl, 2,3-dihydrobenzo[l,4]dioxinyl, and benzo[l,3]dioxolyl.
- the phrase also includes bridged polycyclic ring systems containing a heteroatom such as, but not limited to, quinuclidyl.
- heterocyclyl groups that have other groups, such as alkyl, oxo or halo groups, bonded to one of the ring members, referred to as “substituted heterocyclyl groups”.
- Heterocyclyl groups include, but are not limited to, aziridinyl, azetidinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, thiazolidinyl, tetrahydrothiophenyl, tetrahydrofuranyl, dioxolyl, furanyl, thiophenyl, pyrrolyl, pyrrolinyl, imidazolyl, imidazolinyl, pyrazolyl, pyrazolinyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, thiazolinyl, isothiazolyl, thiadiazolyl, o
- substituted heterocyclyl groups may be mono-substituted or substituted more than once, such as, but not limited to, pyridyl or morpholinyl groups, which are 2-, 3-, 4-, 5-, or 6-substituted, or disubstituted with various substituents such as those listed above.
- Heteroaryl groups are aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, O, and S. Heteroaryl groups may be substituted or unsubstituted.
- Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiophenyl, benzothiophenyl, furanyl, benzofuranyl, indolyl, azaindolyl (pyrrolopyridinyl), indazolyl, benzimidazolyl, imidazopyridinyl (azabenzimidazolyl), pyrazolopyridinyl, triazolopyridinyl, benzotri azolyl, benzoxazolyl, benzothiazolyl, benzothiadi azolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthyl, purin
- Heteroaryl groups include fused ring compounds in which all rings are aromatic such as indolyl groups and include fused ring compounds in which only one of the rings is aromatic, such as 2,3-dihydro indolyl groups.
- Representative substituted heteroaryl groups may be substituted one or more times with various substituents such as those listed above.
- Heterocyclylalkyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a heterocyclyl group as defined above. Heterocyclylalkyl groups may be substituted or unsubstituted. Substituted heterocyclylalkyl groups may be substituted at the alkyl, the heterocyclyl or both the alkyl and heterocyclyl portions of the group.
- heterocyclyl alkyl groups include, but are not limited to, morpholin-4-yl-ethyl, furan-2-yl-methyl, imidazol-4-yl-methyl, pyri din-3 -yl-methyl, tetrahydrofuran-2-yl-ethyl, and indol-2-yl-propyl.
- Representative substituted heterocyclylalkyl groups may be substituted one or more times with substituents such as those listed above.
- Heteroaralkyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a heteroaryl group as defined above. Heteroaralkyl groups may be substituted or unsubstituted.
- Substituted heteroaralkyl groups may be substituted at the alkyl, the heteroaryl or both the alkyl and heteroaryl portions of the group.
- Representative substituted heteroaralkyl groups may be substituted one or more times with substituents such as those listed above.
- Groups described herein having two or more points of attachment i.e., divalent, trivalent, or polyvalent
- divalent alkyl groups are alkylene groups
- divalent aryl groups are arylene groups
- divalent heteroaryl groups are divalent heteroarylene groups
- Substituted groups having a single point of attachment to the compound of the present technology are not referred to using the “ene” designation.
- chloroethyl is not referred to herein as chloroethylene.
- Alkoxy groups are hydroxyl groups (-OH) in which the bond to the hydrogen atom is replaced by a bond to a carbon atom of a substituted or unsubstituted alkyl group as defined above. Alkoxy groups may be substituted or unsubstituted. Examples of linear alkoxy groups include but are not limited to methoxy, ethoxy, propoxy, butoxy, pentoxy, hexoxy, and the like. Examples of branched alkoxy groups include but are not limited to isopropoxy, secbutoxy, tert-butoxy, isopentoxy, isohexoxy, and the like.
- cycloalkoxy groups include but are not limited to cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, and the like.
- Representative substituted alkoxy groups may be substituted one or more times with substituents such as those listed above.
- alkanoyl and alkanoyloxy can refer, respectively, to -C(O)-alkyl groups and -O-C(O)-alkyl groups, each containing 2-5 carbon atoms.
- aryloyl and aryloyloxy refer to -C(O)-aryl groups and -O-C(O)-aryl groups.
- aryloxy and arylalkoxy refer to, respectively, a substituted or unsubstituted aryl group bonded to an oxygen atom and a substituted or unsubstituted aralkyl group bonded to the oxygen atom at the alkyl. Examples include but are not limited to phenoxy, naphthyloxy, and benzyloxy. Representative substituted aryloxy and arylalkoxy groups may be substituted one or more times with substituents such as those listed above.
- carboxylate refers to a -C00H group.
- esteer refers to -COOR 70 and -C(O)O-G groups.
- R 70 is a substituted or unsubstituted alkyl, cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heterocyclylalkyl or heterocyclyl group as defined herein.
- G is a carboxylate protecting group. Carboxylate protecting groups are well known to one of ordinary skill in the art.
- amide includes C- and N-amide groups, i.e., -C(O)NR 71 R 72 , and -NR 71 C(O)R 72 groups, respectively.
- R 71 and R 72 are independently hydrogen, or a substituted or unsubstituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, heterocyclylalkyl or heterocyclyl group as defined herein.
- Amido groups therefore include but are not limited to carbamoyl groups (-C(O)NH 2 ) and formamide groups (-NHC(O)H).
- the amide is -NR 71 C(O)-(CI-5 alkyl) and the group is termed “carbonylamino,” and in others the amide is -NHC(O)-alkyl and the group is termed “alkanoylamino.”
- nitrile or “cyano” as used herein refers to the -CN group.
- Urethane groups include N- and O-urethane groups, i.e., -NR 73 C(O)OR 74 and -OC(O)NR 73 R 74 groups, respectively.
- R 73 and R 74 are independently a substituted or unsubstituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, heterocyclylalkyl, or heterocyclyl group as defined herein.
- R 73 may also be H.
- amine refers to -NR 75 R 76 groups, wherein R 75 and R 76 are independently hydrogen, or a substituted or unsubstituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, heterocyclylalkyl or heterocyclyl group as defined herein.
- the amine is alkylamino, dialkylamino, arylamino, or alkylarylamino.
- the amine is NH 2 , methylamino, dimethylamino, ethylamino, diethylamino, propylamino, isopropylamino, phenylamino, or benzylamino.
- sulfonamido includes S- and N-sulfonamide groups, i.e., -SO 2 NR 78 R 79 and -NR 78 SO 2 R 79 groups, respectively.
- R 78 and R 79 are independently hydrogen, or a substituted or unsubstituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, heterocyclylalkyl, or heterocyclyl group as defined herein.
- Sulfonamido groups therefore include but are not limited to sulfamoyl groups (-SO 2 NH 2 ).
- the sulfonamido is -NHSO 2 -alkyl and is referred to as the “alkylsulfonylamino” group.
- thiol refers to -SH groups
- sulfides include -SR 80 groups
- sulfoxides include -S(O)R 81 groups
- sulfones include -SO 2 R 82 groups
- sulfonyls include -SO 2 OR 83 .
- R 80 , R 81 , R 82 , and R 83 are each independently a substituted or unsubstituted alkyl, cycloalkyl, alkenyl, alkynyl, aryl aralkyl, heterocyclyl or heterocyclylalkyl group as defined herein.
- the sulfide is an alkylthio group, -S-alkyl.
- urea refers to -NR 84 -C(O)-NR 85 R 86 groups.
- R 84 , R 85 , and R 86 groups are independently hydrogen, or a substituted or unsubstituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, heterocyclyl, or heterocyclylalkyl group as defined herein.
- amidine refers to -C(NR 87 )NR 88 R 89 and -NR 87 C(NR 88 )R 89 , wherein R 87 , R 88 , and R 89 are each independently hydrogen, or a substituted or unsubstituted alkyl, cycloalkyl, alkenyl, alkynyl, aryl aralkyl, heterocyclyl or heterocyclylalkyl group as defined herein.
- guanidine refers to -NR 90 C(NR 91 )NR 92 R 93 , wherein R 90 , R 91 , R 92 and R 93 are each independently hydrogen, or a substituted or unsubstituted alkyl, cycloalkyl, alkenyl, alkynyl, aryl aralkyl, heterocyclyl or heterocyclylalkyl group as defined herein.
- halogen refers to bromine, chlorine, fluorine, or iodine. In some embodiments, the halogen is fluorine. In other embodiments, the halogen is chlorine or bromine.
- hydroxyl as used herein can refer to -OH or its ionized form, -O .
- a “hydroxyalkyl” group is a hydroxyl-substituted alkyl group, such as HO-CH 2 -.
- imide refers to -C(O)NR 98 C(O)R 99 , wherein R 98 and R 99 are each independently hydrogen, or a substituted or unsubstituted alkyl, cycloalkyl, alkenyl, alkynyl, aryl aralkyl, heterocyclyl or heterocyclylalkyl group as defined herein.
- the term “imine” refers to -CR 100 (NR 101 ) and -N(CR 100 R 101 ) groups, wherein R 100 and R 101 are each independently hydrogen or a substituted or unsubstituted alkyl, cycloalkyl, alkenyl, alkynyl, aryl aralkyl, heterocyclyl or heterocyclylalkyl group as defined herein, with the proviso that R 100 and R 101 are not both simultaneously hydrogen.
- nitro refers to an -NO 2 group.
- trifluoromethyl refers to -CF 3 .
- trifluoromethoxy refers to -OCF 3 .
- azido refers to -N 3 .
- trialkyl ammonium refers to a -N(alkyl) 3 group.
- a trialkylammonium group is positively charged and thus typically has an associated anion, such as halogen anion.
- isocyano refers to -NC.
- isothiocyano refers to -NCS.
- pentafluorosulfanyl refers to -SF 5 .
- a range includes each individual member.
- a group having 1-3 atoms refers to groups having 1, 2, or 3 atoms.
- a group having 1-5 atoms refers to groups having 1, 2, 3, 4, or 5 atoms, and so forth.
- Pharmaceutically acceptable salts of compounds described herein are within the scope of the present technology and include acid or base addition salts which retain the desired pharmacological activity and is not biologically undesirable (e.g., the salt is not unduly toxic, allergenic, or irritating, and is bioavailable).
- pharmaceutically acceptable salts can be formed with inorganic acids (such as hydrochloric acid, hydroboric acid, nitric acid, sulfuric acid, and phosphoric acid), organic acids (e.g.
- alginate formic acid, acetic acid, benzoic acid, gluconic acid, fumaric acid, oxalic acid, tartaric acid, lactic acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, naphthalene sulfonic acid, and p-toluenesulfonic acid) or acidic amino acids (such as aspartic acid and glutamic acid).
- an acidic group such as for example, a carboxylic acid group
- it can form salts with metals, such as alkali and earth alkali metals (e.g.
- salts can be prepared in situ during isolation and purification of the compounds or by separately reacting the purified compound in its free base or free acid form with a suitable acid or base, respectively, and isolating the salt thus formed.
- Tautomers refers to isomeric forms of a compound that are in equilibrium with each other. The presence and concentrations of the isomeric forms will depend on the environment the compound is found in and may be different depending upon, for example, whether the compound is a solid or is in an organic or aqueous solution. For example, in aqueous solution, quinazolinones may exhibit the following isomeric forms, which are referred to as tautomers of each other:
- guanidines may exhibit the following isomeric forms in protic organic solution, also referred to as tautomers of each other:
- Stereoisomers of compounds include all chiral, diastereomeric, and racemic forms of a structure, unless the specific stereochemistry is expressly indicated.
- compounds used in the present technology include enriched or resolved optical isomers at any or all asymmetric atoms as are apparent from the depictions.
- racemic and diastereomeric mixtures, as well as the individual optical isomers can be isolated or synthesized so as to be substantially free of their enantiomeric or diastereomeric partners, and these stereoisomers are all within the scope of the present technology.
- the compounds of the present technology may exist as solvates, especially hydrates. Hydrates may form during manufacture of the compounds or compositions comprising the compounds, or hydrates may form over time due to the hygroscopic nature of the compounds.
- Compounds of the present technology may exist as organic solvates as well, including DMF, ether, and alcohol solvates among others. The identification and preparation of any particular solvate is within the skill of the ordinary artisan of synthetic organic or medicinal chemistry.
- the present technology provides a compound of Formula I: pharmaceutically acceptable salt and/or solvate thereof, wherein Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl; R 1 is selected from H, optionally substituted C 1 -C 6 alkyl, -CH 2 CCH, or optionally substituted 2 to 15 membered heteroalkyl; each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl; each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl; n2 is 0, 1, 2, 3, 4, or 5; and n3 is 0, 1, 2, 3, or 4; with the proviso that the compound is not: (S)-3-(6,8-dimethylimidazo[l,2-a]pyrazin-2-yl)-7-(4- ethyl-3-methylpiperazin-l-yl)-2H
- the present technology provides a compound of Formula II: pharmaceutically acceptable salt and/or solvate thereof, wherein Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl; R 1 is selected from H, optionally substituted C 1 -C 6 alkyl, -CH 2 CCH, or optionally substituted 2 to 15 membered heteroalkyl; each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl; each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl; n2 is 0, 1, 2, 3, 4, or 5; and n3 is 0, 1, 2, 3, or 4; with the proviso that the compound is not: 2-(4,6-dimethylpyrazolo[l,5-a]pyrazin-2-yl)-7-(4- ethylpiperazin-l-yl)-9-methyl-4H-pyrido
- Ring A is substituted or unsubstituted phenyl, naphthyl, quinolyl, imidazopyrazinyl, or imidazopyridinyl.
- Ring A is phenyl, naphthyl, quinolyl, imidazopyrazinyl, or imidazopyridinyl each optionally substituted with 1 to 3 -F, -Cl, - Br, -CH 3 , -CH 2 CH 3 , -CF 3 , -OCH 3 , -OCH 2 CH 3 , or -OCF 3 .
- each R 1 is independently H, -CH 3 , or -CH 2 CH 3 .
- each R 1 is wherein nla and nib are independently selected from 1, 2, 3, 4, or 5.
- each R 2 is independently hydrogen, -CH 3 , or -CH 2 CH 3 . In embodiments, each R 2 is independently halogen, -CH 3 , or -CH 2 CH 3 .
- each R 3 is independently -F, -Cl, -Br, -CH 3 , or -CH 2 CH 3 . In embodiments, each R 3 is independently -O(CH 2 ) 2 NHC(O)O-t-butyl or -O(CH 2 ) 2 NHC(O)OH.
- n2 is 0 or 1. In embodiments, n3 is 0 or 1.
- the present technology provides a compound selected from the [0102] In embodiments, the present technology provides a compound selected from the
- the present technology provides a compound of Formula III: pharmaceutically acceptable salt and/or solvate thereof, wherein Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl; Ring B is 5 to 10 each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl; each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl;
- Ring C is a 5-membered heteroaryl
- n2 is 0, 1, 2, 3, 4, or 5
- n3 is 0, 1, 2, 3, or 4
- zl, z3, and z4 are each independently 0, 1, 2, 3, or 4
- z2 is independently at each occurrence 1 or 2
- z5 is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
- z5 is 3, 4, 5, 6, 7, or 8.
- z5 is 3.
- the compound has the chemical structure of Formula Illa: (Illa) or a pharmaceutically acceptable salt and/or solvate thereof.
- the compound has the chemical structure of Formula Illb : (Illb) or a pharmaceutically acceptable salt and/or solvate thereof.
- the compound has the chemical structure of Formula IIIc: pharmaceutically acceptable salt and/or solvate thereof.
- Ring B is selected from coumarin and pyridopyrimidone.
- the compound has the chemical structure of Formula Illa’ : pharmaceutically acceptable salt and/or solvate thereof.
- the compound has the chemical structure of Formula Illb’ : pharmaceutically acceptable salt and/or solvate thereof.
- the compound has the chemical structure of Formula IIIc’: or a pharmaceutically acceptable salt and/or solvate thereof.
- Ring C is 1,2,3-triazinyl.
- Ring A is substituted or unsubstituted phenyl, naphthyl, quinolyl, imidazopyrazinyl, or imidazopyridinyl.
- Ring A is phenyl, naphthyl, quinolyl, imidazopyrazinyl, or imidazopyridinyl each optionally substituted with 1 to 3 -F, -Cl, - Br, -CH 3 , -CH 2 CH 3 , -CF 3 , -OCH 3 , -OCH 2 CH 3 , or -OCF 3
- each R 2 is independently hydrogen, -CH 3 , or -CH 2 CH 3 . In embodiments, each R 2 is independently halogen, -CH 3 , or -CH 2 CH 3
- each R 3 is independently -F, -Cl, -Br, -CH 3 , or -CH 2 CH 3 . In embodiments, each R 3 is independently -O(CH 2 ) 2 NHC(O)O-t-butyl or -O(CH 2 ) 2 NHC(O)OH.
- n2 is 0 or 1.
- n3 is 0 or 1.
- z5 is 3, 4, 5, 6, 7, or 8.
- z5 is 3.
- the present technology provides a compound selected from the group consisting of:
- the present technology provides a compound of Formula IV:
- Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl
- Ring B is each R 2 is independently halogen or optionally substituted C 1 -C 6 alkyl
- each R 3 is independently selected from halogen, optionally substituted C 1 -C 6 alkyl, or optionally substituted 2 to 6 membered heteroalkyl;
- Ring C is a 5-membered heteroaryl
- n2 is 0, 1, 2, 3, 4, or 5
- n3 is 0, 1, 2, 3 or 4
- zl, z3, and z4 are each independently 0, 1, 2, 3, or 4
- z2 is independently at each occurrence 1 or 2
- z5 is 1,
- the compound has the chemical structure of Formula IVa: pharmaceutically acceptable salt and/or solvate thereof.
- the compound has the chemical structure of Formula IVb: pharmaceutically acceptable salt and/or solvate thereof.
- Ring B is selected from coumarin and pyridopyrimidone.
- the compound has the chemical structure of Formula IVa’ : pharmaceutically acceptable salt and/or solvate thereof.
- the compound has the chemical structure of Formula pharmaceutically acceptable salt and/or solvate thereof.
- Ring C is 1,2,3-triazinyl
- Ring A is substituted or unsubstituted phenyl, naphthyl, quinolyl, imidazopyrazinyl, or imidazopyridinyl.
- each R 2 is independently hydrogen, -CH 3 , or -CH 2 CH 3 .
- each R 3 is independently -F, -Cl, -Br, CH 3 , or CH 2 CH 3 .
- each R 3 is independently -O(CH 2 ) 2 NHC(O)O-t-butyl or - O(CH 2 ) 2 NHC(O)OH.
- Ring A is phenyl, naphthyl, quinolyl, imidazopyrazinyl, or imidazopyridinyl each optionally substituted with 1 to 3 -F, -Cl, -Br, -CH 3 , -CH 2 CH 3 , -CF3, - OCH 3 , -OCH 2 CH 3 , or -OCF 3 .
- n2 is 0. In some embodiments, n2 is 1. In some embodiments, n3 is 0. In some embodiments, n3 is 1.
- z5 is 3, 4, 5, 6, 7, or 8. In some embodiments, z5 is 3. [0135] In another aspect the present technology provides a compound having the following chemical structure:
- a composition that includes any one of the herein- described embodiments of compounds of Formula I, Formula II, Formula III, Formula Illa, Formula Illb, Formula IIIc, Formula Illa’, Formula Illb’, Formula IIIc’, Formula IV, Formula IVa, Formula IVb, Formula IVa’, or Formula IVb’ and also includes a pharmaceutically acceptable carrier.
- a compound of the present technology is part of a pharmaceutical composition, the pharmaceutical composition including an effective amount of the compound of any one of the aspects and embodiments of compounds of Formula I and a pharmaceutically acceptable carrier.
- the present technology provides a pharmaceutical composition comprising a compound as disclosed herein, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable excipient.
- the present technology provides a method of treating a disorder or disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound as disclosed herein, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, or a therapeutically effective amount of a pharmaceutical composition as disclosed herein, wherein the disorder or disease is spinal muscular atrophy (SMA).
- SMA spinal muscular atrophy
- the present technology provides a method of treating a disorder or disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound as disclosed herein, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, or a therapeutically effective amount of a pharmaceutical composition as disclosed herein, wherein the disorder or disease is a viral disorder or disease.
- Effective amount refers to the amount of a compound or composition required to produce a desired effect.
- One example of an effective amount includes amounts or dosages that yield acceptable toxicity and bioavailability levels for therapeutic (pharmaceutical) use including, but not limited to, the treatment of a bacterial infection.
- a “subject” or “patient” is a mammal, such as a cat, dog, rodent or primate. Typically the subject is a human, and, preferably, a human suffering from or suspected of suffering from pain.
- the term “subject” and “patient” can be used interchangeably.
- compositions and medicaments comprising any of the compounds disclosed herein (e.g., compounds of Formula I) and a pharmaceutically acceptable carrier or one or more excipients or fillers.
- the compositions may be used in the methods and treatments described herein.
- Such compositions and medicaments include a therapeutically effective amount of any compound as described herein, including but not limited to a compound of Formula I.
- the pharmaceutical composition may be packaged in unit dosage form. The unit dosage form is effective in treating a bacterial infection when administered to a subject in need thereof.
- compositions and medicaments may be prepared by mixing one or more compounds of the present technology, pharmaceutically acceptable salts thereof, stereoisomers thereof, tautomers thereof, or solvates thereof, with pharmaceutically acceptable carriers, excipients, binders, diluents or the like.
- the compounds and compositions described herein may be used to prepare formulations and medicaments that prevent or treat a bacterial infection.
- Such compositions can be in the form of, for example, granules, powders, tablets, capsules, syrup, suppositories, injections, emulsions, elixirs, suspensions or solutions.
- compositions can be formulated for various routes of administration, for example, by oral, parenteral, topical, rectal, nasal, vaginal administration, or via implanted reservoir.
- Parenteral or systemic administration includes, but is not limited to, subcutaneous, intravenous, intraperitoneal, and intramuscular, injections.
- the following dosage forms are given by way of example and should not be construed as limiting the instant present technology.
- powders, suspensions, granules, tablets, pills, capsules, gelcaps, and caplets are acceptable as solid dosage forms. These can be prepared, for example, by mixing one or more compounds of the instant present technology, or pharmaceutically acceptable salts or tautomers thereof, with at least one additive such as a starch or other additive.
- Suitable additives are sucrose, lactose, cellulose sugar, mannitol, maltitol, dextran, starch, agar, alginates, chitins, chitosans, pectins, tragacanth gum, gum arabic, gelatins, collagens, casein, albumin, synthetic or semi-synthetic polymers or glycerides.
- oral dosage forms can contain other ingredients to aid in administration, such as an inactive diluent, or lubricants such as magnesium stearate, or preservatives such as paraben or sorbic acid, or anti-oxidants such as ascorbic acid, tocopherol or cysteine, a disintegrating agent, binders, thickeners, buffers, sweeteners, flavoring agents or perfuming agents. Tablets and pills may be further treated with suitable coating materials known in the art.
- suitable coating materials known in the art.
- Liquid dosage forms for oral administration may be in the form of pharmaceutically acceptable emulsions, syrups, elixirs, suspensions, and solutions, which may contain an inactive diluent, such as water.
- Pharmaceutical formulations and medicaments may be prepared as liquid suspensions or solutions using a sterile liquid, such as, but not limited to, an oil, water, an alcohol, and combinations of these.
- Pharmaceutically suitable surfactants, suspending agents, emulsifying agents may be added for oral or parenteral administration.
- suspensions may include oils.
- oils include, but are not limited to, peanut oil, sesame oil, cottonseed oil, com oil and olive oil.
- Suspension preparation may also contain esters of fatty acids such as ethyl oleate, isopropyl myristate, fatty acid glycerides and acetylated fatty acid glycerides.
- Suspension formulations may include alcohols, such as, but not limited to, ethanol, isopropyl alcohol, hexadecyl alcohol, glycerol and propylene glycol.
- Ethers such as but not limited to, poly(ethyleneglycol), petroleum hydrocarbons such as mineral oil and petrolatum; and water may also be used in suspension formulations.
- Injectable dosage forms generally include aqueous suspensions or oil suspensions which may be prepared using a suitable dispersant or wetting agent and a suspending agent.
- Injectable forms may be in solution phase or in the form of a suspension, which is prepared with a solvent or diluent.
- Acceptable solvents or vehicles include sterilized water, Ringer’s solution, or an isotonic aqueous saline solution.
- sterile oils may be employed as solvents or suspending agents.
- the oil or fatty acid is non-volatile, including natural or synthetic oils, fatty acids, mono-, di- or tri-glycerides.
- the pharmaceutical formulation and/or medicament may be a powder suitable for reconstitution with an appropriate solution as described above.
- these include, but are not limited to, freeze dried, rotary dried or spray dried powders, amorphous powders, granules, precipitates, or particulates.
- the formulations may optionally contain stabilizers, pH modifiers, surfactants, bioavailability modifiers and combinations of these.
- Compounds of the present technology may be administered to the lungs by inhalation through the nose or mouth.
- suitable pharmaceutical formulations for inhalation include solutions, sprays, dry powders, or aerosols containing any appropriate solvents and optionally other compounds such as, but not limited to, stabilizers, antimicrobial agents, antioxidants, pH modifiers, surfactants, bioavailability modifiers and combinations of these.
- the carriers and stabilizers vary with the requirements of the particular compound, but typically include nonionic surfactants (Tweens, Pluronics, or polyethylene glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars or sugar alcohols.
- Aqueous and nonaqueous (e.g., in a fluorocarbon propellant) aerosols are typically used for delivery of compounds of the present technology by inhalation.
- Dosage forms for the topical (including buccal and sublingual) or transdermal administration of compounds of the present technology include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, and patches.
- the active component may be mixed under sterile conditions with a pharmaceutically-acceptable carrier or excipient, and with any preservatives, or buffers, which may be required.
- Powders and sprays can be prepared, for example, with excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances.
- the ointments, pastes, creams and gels may also contain excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
- Absorption enhancers can also be used to increase the flux of the compounds of the present technology across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane (e.g., as part of a transdermal patch) or dispersing the compound in a polymer matrix or gel.
- excipients and carriers are generally known to those skilled in the art and are thus included in the instant present technology. Such excipients and carriers are described, for example, in “Remingtons Pharmaceutical Sciences” Mack Pub. Co., New Jersey (1991), which is incorporated herein by reference.
- the formulations of the present technology may be designed to be short-acting, fast-releasing, long-acting, and sustained-releasing as described below.
- the pharmaceutical formulations may also be formulated for controlled release or for slow release.
- compositions may also comprise, for example, micelles or liposomes, or some other encapsulated form, or may be administered in an extended release form to provide a prolonged storage and/or delivery effect. Therefore, the pharmaceutical formulations and medicaments may be compressed into pellets or cylinders and implanted intramuscularly or subcutaneously as depot injections or as implants such as stents. Such implants may employ known inert materials such as silicones and biodegradable polymers.
- Specific dosages may be adjusted depending on conditions of disease, the age, body weight, general health conditions, sex, and diet of the subject, dose intervals, administration routes, excretion rate, and combinations of drugs. Any of the above dosage forms containing effective amounts are well within the bounds of routine experimentation and therefore, well within the scope of the instant present technology.
- Those skilled in the art are readily able to determine an effective amount by simply administering a compound of the present technology to a patient in increasing amounts until, for example, culture of the bacterial infection indicates a reduction in the number of bacteria and/or the symptoms of the bacterial infection decrease (e.g., as indicated by the patient).
- the compounds of the present technology can be administered to a patient at dosage levels in the range of about 0.1 to about 1,000 mg per day.
- a dosage in the range of about 0.01 to about 100 mg per kg of body weight per day may be sufficient (e.g., a dosage in the range of about 0.01 to about 10 mg per kg of body weight per day may be sufficient).
- the specific dosage used can vary or may be adjusted as considered appropriate by those of ordinary skill in the art.
- the dosage can depend on a number of factors including the requirements of the patient, the severity of the bacterial infection and the pharmacological activity of the compound being used. The determination of optimum dosages for a particular patient is well known to those skilled in the art.
- compositions and methods of the present technology may also be demonstrated by a culture of the bacterial infection indicating a reduction in the number of bacteria subsequent to administering a compound and/or composition of the present technology and/or the symptoms of the bacterial infection decrease (e.g., as indicated by the patient).
- test subjects will exhibit a 10%, 20%, 30%, 50% or greater reduction, up to a 75-90%, or 95% or greater, reduction, in one or more symptom(s) caused by, or associated with, the disorder in the subject, compared to placebo-treated or other suitable control subjects.
- the compounds of the present technology can also be administered to a patient along with other conventional therapeutic agents that may be useful in the treatment of a bacterial infection, such as a fluoroquinolone antibiotic, an aminoglycoside antibiotic, and/or a polymyxin antibiotic.
- a compound and/or composition of the present technology may be administered along with an effective amount of a fluoroquinolone antibiotic, an effective amount of a aminoglycoside antibiotic, and/or a polymyxin antibiotic.
- the administration may include oral administration, parenteral administration, nasal administration, or topical administration.
- the administration may include subcutaneous injections, intravenous injections, intraperitoneal injections, or intramuscular injections.
- the administration may include oral administration.
- the methods of the present technology can also comprise administering, either sequentially or in combination with one or more compounds of the present technology, a conventional therapeutic agent (e.g., an antiviral drug or drug for treating COVID-19 (e.g. remdesivir)) in an amount that can potentially or synergistically be effective for the treatment of a viral disease or disorder (e.g., COVID-19).
- a conventional therapeutic agent e.g., an antiviral drug or drug for treating COVID-19 (e.g. remdesivir)
- a compound of the present technology is administered to a patient in an amount or dosage suitable for therapeutic use.
- a unit dosage comprising a compound of the present technology will vary depending on patient considerations. Such considerations include, for example, age, protocol, condition, sex, extent of disease, contraindications, concomitant therapies and the like.
- An exemplary unit dosage based on these considerations can also be adjusted or modified by a physician skilled in the art.
- a unit dosage for a patient comprising a compound of the present technology can vary from 1 x 10 -4 g/kg to 1 g/kg, preferably, 1 x 10 -3 g/kg to 1.0 g/kg. Dosage of a compound of the present technology can also vary from 0.01 mg/kg to 100 mg/kg or, preferably, from 0.1 mg/kg to 10 mg/kg.
- a compound of the present technology can also be modified, for example, by the covalent attachment of an organic moiety or conjugate to improve pharmacokinetic properties, toxicity or bioavailability (e.g., increased in vivo half-life).
- the conjugate can be a linear or branched hydrophilic polymeric group, fatty acid group or fatty acid ester group.
- a polymeric group can comprise a molecular weight that can be adjusted by one of ordinary skill in the art to improve, for example, pharmacokinetic properties, toxicity or bioavailability.
- Exemplary conjugates can include a polyalkane glycol (e.g., polyethylene glycol (PEG), polypropylene glycol (PPG)), carbohydrate polymer, amino acid polymer or polyvinyl pyrolidone and a fatty acid or fatty acid ester group, each of which can independently comprise from about eight to about seventy carbon atoms.
- a polyalkane glycol e.g., polyethylene glycol (PEG), polypropylene glycol (PPG)
- carbohydrate polymer e.g., amino acid polymer or polyvinyl pyrolidone and a fatty acid or fatty acid ester group, each of which can independently comprise from about eight to about seventy carbon atoms.
- Conjugates for use with a compound of the present technology can also serve as linkers to, for example, any suitable substituents or groups, radiolabels (marker or tags), halogens, proteins, enzymes, polypeptides, other therapeutic agents (for example, a pharmaceutical or drug), nucleosides, dyes, oligonucleotides, lipids, phospholipids and/or liposomes.
- conjugates can include polyethylene amine (PEI), polyglycine, hybrids of PEI and polyglycine, polyethylene glycol (PEG) or methoxypolyethylene glycol (mPEG).
- a conjugate can also link a compound of the present technology to, for example, a label (fluorescent or luminescent) or marker (radionuclide, radioisotope and/or isotope) to comprise a probe of the present technology.
- Conjugates for use with a compound of the present technology can, in one aspect, improve in vivo half-life.
- Other exemplary conjugates for use with a compound of the present technology as well as applications thereof and related techniques include those generally described by U.S. Patent No. 5,672,662, which is hereby incorporated by reference herein.
- Example 1 Recognition of single-stranded nucleic acids by small-molecule splicing modulators
- SMA Spinal muscular atrophy
- nusinersen is an antisense oligonucleotide (ASO), which acts by direct binding to the SMN2 pre-mRNA with Watson-Crick base-pairing.
- ASO antisense oligonucleotide
- the binding site for nusinersen (intron 7 +10 to +27 in SMN2) was identified as an intronic splicing silencer (ISS) (9). Blocking this ISS by nusinersen promotes inclusion of exon 7 (10).
- risdiplam is a first-in-class small-molecule splicing modifier that increases the production of full-length SMN2 mRNA upon oral administration in the SMA mouse model (11, 12) and in humans (13). It was demonstrated that analogues of risdiplam bind directly to exon 7 of the SMN2 pre-mRNA at two separate locations: binding site 1 is located at the 5’ splice site (14, 15) and binding site 2 is a GA-rich sequence located ⁇ 24 nts upstream of the 5’ splice site (FIG. 1).
- TSL terminal stem-loop
- SMN-C5 (FIG. 2A) was found to stabilize the formation of a ternary complex of the 5’ splice site of the SMN2 exon 7 and the U1 small nuclear ribonucleoprotein (snRNP) via binding to a bulged A (17) (FIG. 1).
- snRNP small nuclear ribonucleoprotein
- binding site 2 we previously demonstrated that a 15-nt synthetic singlestranded (ss) RNA that contains the GA-rich sequence selectively binds to SMN-C2 (14). Binding site 2 was also identified as part of the exonic splicing enhancer (ESE) 2 (15, 17).
- ESE exonic splicing enhancer
- the biological consequences for risdiplam analogue binding to binding site 2 include alterations in binding of trans-acting splicing regulatory proteins.
- Treatment with a risdiplam analogue, SMN- C3 (12) enhanced binding between a 500-nt pre-mRNA sequence containing the GA-rich sequences and a splicing regulatory protein, far upstream element-binding protein 1 (FUBP1) (14).
- FUBP1 far upstream element-binding protein 1
- SMN-C5 In surface plasmon resonance (SPR) assays, the presence of SMN-C5 prevents the binding of hnRNP G with ESE2 (15). Reverse-genetic studies showed that deletion of the entire ESE2 sequence in a cell-based minigene system reduces the effectiveness of SMN-C5 at restoring proper splicing of SMN2 (15). The effective concentration at 50% potency ( EC 50 ) of SMN-C5 significantly increases in AESE2 minigene compared to the wildtype sequences, and SMN-C5 failed to induce the complete inclusion of exon7 even at a high concentration (10 ⁇ M) (15).
- SPR surface plasmon resonance
- SMN-C5 can still weakly modulate splicing of the SMN2, indicating that the GA-rich sequence is not strictly required for drug action (15). These findings indicated that the GA-rich sequence plays a role in enhancing the drug potency.
- the GA-rich sequence is also found in some other risdiplam-sensitive genes (e.g., STRN3 (15, 18)).
- nuclease-free water Invitrogen #AM9932
- concentration of the oligonucleotides at ⁇ 0.1 mM was calibrated with the A260 value measured by a NanoDrop ND-1000 (Thermo, Waltham, MA, USA) and the predicted extinction coefficient (http://www.oligoevaluator.com) using Lamber-Beer’s Law.
- the risdiplam analogues (1 mM in DMSO) were diluted in 2X assay buffer (40 mM HEPES, 200 mM NaCl for RNA; 40 mM HEPES, 200 mM NaCl, 1 mM MgCl 2 for DNA) to make a 1 ⁇ M 2X working solution.
- 2X assay buffer 40 mM HEPES, 200 mM NaCl for RNA; 40 mM HEPES, 200 mM NaCl, 1 mM MgCl 2 for DNA
- a 1 :2 dilution series (8 points) of each oligonucleotide was prepared in 20-30 ⁇ L water to desired concentrations (i.e., 1-128 ⁇ M).
- 20-30 ⁇ L 2X working solution containing the 2X assay buffer and the small-molecule ligand was added to each oligonucleotide sample in 1 : 1 (v/v) and mixed by pipetting for 4 times.
- 20 ⁇ L of the above IX working solution was transferred into a 384-well, black, F-bottom microplates (Greiner Bio-One) in duplicates or triplicates. The plate was equilibrated at room temperature for 5 min before being read using a microplate reader (SYNERGY Hl, BioTek;
- Excitation/Emission 360/460 nm) at 25 °C.
- SMN-C5 a competitive binding assay was employed to measure an apparent K d .
- SMN-C5 was 1 :2 serial diluted for 10 concentration points starting at 750 ⁇ M in DMSO.
- a mixture of SMN-C2 (0.5 ⁇ M) and DNA Seq6 (25 ⁇ M) in IX assay buffer was prepared and incubated at room temperature for 10 minutes.
- 3 ⁇ L of SMN-C5 solution at each concentration was added to a 42 ⁇ L SMN-C2/DNA Seq6 mixture and incubated at room temperature for 10 minutes.
- the mixture was then transferred into a microplate (20 ⁇ L each well) in duplicates for fluorescence polarization readout.
- the experimental data were analyzed using Prism 8 software (Graphpad Software, San Diego, CA, USA).
- the dissociation constant K d was calculated with 95 % confidence interval after nonlinear curve fitting (Sigmoidal, 4 parameters).
- GaMD works by adding a harmonic boost potential to smooth the potential energy surface and reduce system energy barriers. GaMD provides unconstrained enhanced sampling without the requirement of pre-defined collective variables. Moreover, because the boost potential exhibits a Gaussian distribution, biomolecular free energy profiles can be properly recovered through cumulant expansion to the second order (29). GaMD has been demonstrated to accelerate biomolecular simulations by orders of magnitude, especially for ligand binding to proteins (30, 31). Here, we have applied GaMD to explore the binding of the risdiplam analogue to the putative target nucleic acids with GA-rich sequence. The simulation structures of nucleic acids were built using NAB in the AmberTools package (32).
- the nucleotide sequence was used to construct the Arnott B-Right handed DNA and RNA duplexes.
- One of the strands from each duplex was extracted to generate the starting nucleic acid structure (Seq6) of DNA and RNA.
- a ligand molecule of compound 1 was placed randomly at >15 A away from the nucleic acid.
- Each simulation system was then prepared using the solution builder plug-in with the CHARMM-GUI web server (33). Each system was solvated in 0. IM NaCl solution at 298.15 K.
- the AMBER force field, BSC 1 was used for DNA, OL3 for the RNA, GAFF2 for ligand and TIP3P for water in the system.
- the system was further equilibrated for 125 ps at 298.15 K using constant number, pressure and temperature (NPT) ensemble with the same restraints as in the NVT run. Then cMD without any constrains was performed to further relax the system for 1 ns at 1 atm pressure and 298.15 K temperature.
- NPT constant number, pressure and temperature
- the simulations proceeded with GaMD (see method details in SI), which was implemented in the GPU version of AMBER18 (34).
- a short cMD run of 2 ns was performed to collect potential statistics (including the maximum, minimum, average and standard deviation (SD)).
- SD standard deviation
- One boost potential is applied to the dihedral energetic term and another to the total potential energetic term.
- the average and SD of the system potential energies were calculated every 200,000 steps (400 ps) for both systems.
- the upper limit of the boost potential SD, ⁇ 0 was set to 6.0 kcal/mol for both the dihedral and the total potential energetic terms for DNA-ligand binding system. While the ⁇ 0 was set to 3.0 kcal/mol and 6.0 kcal/mol for the total and dihedral potential energetic terms in the RNA-ligand binding system, respectively.
- the boost potential was applied to the total and dihedral potential energies of the system.
- Table 5 The GaMD production simulations are summarized in Table 5. In all simulations, the hydrogen-heavy atom bonds were constrained using the SHAKE algorithm and the simulation time step was set to 2.0 fs.
- the particle mesh Ewald (PME) method was employed to compute the long-range electrostatic interactions and a cutoff value of 9.0 A was applied to treat the non-bonded atomic interactions.
- the temperature was controlled using the Langevin thermostat with a collision frequency of 1.0 ps -1 .
- NMR spectra were acquired on a Bruker 600 MHz Avance III HD spectrometer equipped with a TCI cryoprobe, and a Varian INOVA 600 MHz spectrometer equipped with a cryogenic HCN probe.
- a 1 mL Eppendorf tube was added 4 ⁇ L or 40 ⁇ L (for 10 ⁇ M or 100 ⁇ M final concentration) 500 ⁇ M compound 1 solution, followed by 20 ⁇ L 10x PBS pH 5.0 buffer, 10 ⁇ L D 2 O, 2 ⁇ L DMSO-d6 and H 2 O. The solution was then heated at 60 °C for 1 min before 1 mM DNA Seq4 solution was added to form a 200 ⁇ L small molecule-DNA solution.
- the amount of the DNA Seq4 solution and H 2 O were varied to form solutions of different ratios of DNA Seq4: compound 1.
- the series of solutions with 2.5 mol%, 5 mol%, 10 mol%, 20 mol%, 50 mol%, 100 mol%, 200 mol%, 400 mol%, 1000 mol%, 2000 mol%, 5000 mol% and 8200 mol% DNA Seq4 were then transferred to 3 mm NMR tubes for analysis.
- the 1 H NMR spectra were acquired at 40 °C with wetlD or excitation- sculpture (ES) to suppress the water signals.
- the STD experiment was performed with selective saturation at 5.80 ppm with a selective bandwidth of 125 Hz, 2 s mixing time, 16k scans.
- SMN-C2 a risdiplam analogue, SMN-C2 (FIG. 2A), binds to a 15-nt GA-rich sequence in SMN2 exon 7 (14). SMN-C2 was observed to bind to GA-rich DNAs similarly to RNAs (FIG. 2B). Because DNA oligonucleotides are more readily accessible than RNA (the unit price for synthetic RNA is more than 10 times of DNA), we extensively used synthetic DNA sequences to probe small-molecule-nucleic acid interactions throughout this study, and RNA sequences were used to validate important findings. Here, we first investigated the minimum length of sequence required for SMN-C2 binding.
- SMN-C2 ring B/C
- FP fluorescence polarization
- Table 1 Binding affinities'' of SMN-C2 and ssDNAs* or ssRNAs, which harbour a 9-nucleotide GA-rich sequence.
- RNA Seql8 represents the duplex formed between the 5’ splice site of SMN2 exon 7 and U1 snRNA, and was previously used in NMR studies for binding site 1 (17). Comparing the two risdiplam putative binding sites side-by-side, the binding affinity (K d ) of SMN-C2-RNA Seq6 (binding site 2) is 3.4-fold stronger than that observed with RNA Seql8 (Table 1).
- GaMD simulations suggested a mechanism for small-molecule nucleic acid binding
- RNA Seq6 Three low-energy conformational states of the RNA-ligand system were also identified for RNA Seq6, including the “Unbound/Unfolded” (FIG. S20b), “Intermediate” (FIG. S10A) and “Bound/Folded” states (FIG.4).
- Bound/Folded state a similar binding mode of compound 1 was observed in RNA as in the DNA with subtle differences.
- DNA the coumarin core (ring B/C) of compound 1 intercalated between the 2 nd and 4 th bases of the first GAAG motif (FIG. 4)
- the intercalation occurred between the 2 nd and 4 th bases of the second GAAG motif.
- aromatic signals of compound 1 (6.6-8.5 ppm) are below the detection limit when 20 mol% of the DNA Seq4 is present, whereas the aliphatic signals are still observed (1.3-4.1 ppm, FIG. 5 A).
- the peak width at half maximum plus the J coupling constant (FWHM + J) of the doublet for 3-CH 3 of compound 1 ( ⁇ 1.4 ppm) only increases from 10.4 Hz at 0 mol% DNA to 13.5 Hz at 20 mol% DNA (FIG. 5 A).
- the new risdiplam analogues with a bicyclic ring D1/D2 both showed high binding affinity to the GA-rich sequence DNA Seq6 when the ring DI is unchanged from SMN-C2 (compounds 10 and 11, Table 2).
- TSL1 stem-loop structure
- RNA secondary or tertiary structures 43-45. These structures can be simple internal bulges that contain 2-6 unpaired nucleotides (e.g., ref (46)) or complex riboswitches that contain a small-molecule binding cavity, which cannot be discerned from primary sequences (e.g., ref (47)).
- ref (46) 2-6 unpaired nucleotides
- ref (47) complex riboswitches that contain a small-molecule binding cavity, which cannot be discerned from primary sequences
- ref (47) complex riboswitches that contain a small-molecule binding cavity, which cannot be discerned from primary sequences
- N A, U, G, or C
- GAAG tetraloop is a naturally occurring variation of the GNRA tetraloop (38, 52).
- a closing base pair e.g., G-C
- G-C a closing base pair
- RNA Seq6 simulation revealed that the piperazine ring in the compound interacted with the RNA aptamer via a polar bond between N4 of compound 1 and N3 of the 2G nucleobase (FIG. 4). This is consistent with the finding that the GA-rich RNA was more sensitive to N4 alkylation in the SMN-C2 scaffold than that observed with DNA.
- a bulky Boc group reduced the binding affinity for RNA Seq6 by 3 -fold (Table 1, RNA Seq6 vs Table 2, entry 6). It was also shown in simulation results that the double loop-like ligand-binding pocket was confined by 2G and 5G in DNA Seq6 (FIG. 4).
- the dissociation constants (K d ) for the binding of the small molecules to either the GA-rich sequence in this study or to the 5’ splice site-Ul snRNP complex in the previous report (17) are in micromolar range, orders of magnitude higher than the EC 50 values of some of the active splicing modifiers in cell-based splicing assay (e.g., Table 2, entries 1-4).
- K d dissociation constants
- risdiplam analogues are not required to remain bound to the mRNA once exon 7 splicing is complete. Therefore, the effective dose of risdiplam analogues in cells can be much smaller than the K d .
- An example of this type of behavior was demonstrated by a recently optimized proteolysis targeting chimaera (PROTAC), namely ARD-266, which selectively targets and degrades androgen receptor (55).
- PROTAC proteolysis targeting chimaera
- ARD-266 which selectively targets and degrades androgen receptor
- the K d between ARD-266 and von Hippel-Lindau (VHL) E3 ligase is at micromolar (55).
- ARD-266 causes 50 % reduction of the androgen receptor protein level at less than 1 nM in VCaP cells, in other words, EC 50 ⁇ 0.1% K d (55).
- SMN-C2 in general, binds with higher affinity to ssDNA sequences relative to ssRNA (Table 1). In cells, most of the DNA is doubly stranded in the genome. However, ssDNAs transiently form during DNA replication. Therefore, there is a concern that the DNA-binding ability may associate with genotoxicity (11). Although one of the strongest GA-rich sequence ligands, SMN-C5, is negative in the Ames test (11), further studies are required to correlate genotoxicity and DNA-binding.
- the GA- rich sequence is crucial in maintaining the drugs’ potency for regulating splicing, binding to the GA-rich alone is not sufficient to induce SMN2 exon 7 inclusion. It is, therefore, possible that the GA-rich sequence serves as an auxiliary binding site and facilitates ligand binding to the 5’ splice site, i.e., a small-molecule delivery relay.
- risdiplam analogue SMN-C3 only significantly affects splicing in 13 genes, while branaplam affects the splicing of 36 genes (15).
- the forkhead box Ml (FoxMl) gene is one of the 13 risdiplam-sensitive genes but lacks a GA-rich sequence (18).
- the SMN2 gene is ⁇ 10 times more sensitive to a risdiplam analogue, RG-7800 (8), consistent with the hypothesis that the GA-rich sequence enhances the drug potency.
- a risdiplam analogue TEC-1
- TEC-1 another risdiplam analogue
- TEC-1 another risdiplam analogue
- the FoxMl gene splicing becomes even less sensitive to TEC-1 than risdiplam. This result underscored the possibility that sequence recognition of the risdiplam analogue can be changed by modification of the ring B/C.
- Example 3 Bifunctional Compounds [0289] Experimental procedure for the preparation of C47: Aldehyde 1’ (0.1 g, 0.724 mmol) in DMF (2 mL) was added chloro compound (0.19 g, 0.724 mmol) and potassium carbonate (0.1 g, 0.724 mmol). The reaction mixture is stirred at 50 °C for overnight. Added water to the reaction mixture, extracted with diethyl ether. The organic phase was washed with brine solution, dried (Na2SO4) and concentrated in vacuo. The compound 2’ is pure enough for the next step (Colorless oil, 0.15 g, 85 %).
- Fluoro Compound 7 (0.05 g, 0.137 mmol) in DMF was added C s2 CO 3 and Propargyl-PEG-4-Br and the reaction mixture is heated at 130 °C for 20 min under microwave irradiation. Yellow solids were formed, added ice water, filtered, and washed again with water and dried.
- the compound 8’ is purified using 5% MeOH/DCM system, Yellow solid, 0.047 g, 72%. Alkyne (1.25 mg, 0.002 mmol) in DMSO was added azide (1.0 mg, 0.002 mmol) and formed the clear solution.
- Step 1 Compounds 1’ (285 mg, 1 mmol) and 2’ (120 mg, 1.1 mmol) were dissolved in CH 3 CN in a sealed tube, the mixture was heated at 120 °C for 30min. Precipitate was filtered and the solid was washed with CH 3 CN to give the pure product as a yellow solid (100 mg).
- Step 2 Compounds 3’ (45 mg, 0.15 mmol) and 4’ (45 mg, 0.15 mmol) were dissolved in DMF and K 2 CO 3 was added. The mixture was heated at 100 °C for 3h. DMF was removed under vacuum.
- Step 3 Compound 5’ (32 mg, 0.06 mmol) and piperazine (15 mg, 0.18 mmol) were dissolved in DMSO. The mixture was heated at 120 °C for 2h. DMSO was removed under vacuum. The residue was purified by falsh column with 0-15% MeOH in DCM to give 16 mg product.
- Step 4 Compounds 6’ (6 mg, 0.01 mmol) and 7’ (5 mg, 0.01 mmol) were dissolved in DMSO and sodium ascorbate (2 mg, 0.01 mmol), THPTA (4 mg, 0.01 mmol), CuSO4 (2 mg, 0.01mmol) were added. The mixture was stirred under nitrogen at room temperature overnight. DMSO was removed under vacuum. The residue was purified by column with 0-20% MeOH in DCM. The yellow product was further purified by HPLC to give 1 mg pure product.
- Example 4 Efficacy Data [0300]
- a SARS-CoV-2 cell model Details about the cell model include: a tetracycline-inducible SARS-CoV-2 minigene HEK293 cell-line (ThermoFisher, 293 Flp-InTM T-RExTM system) was constructed.
- the minigene system contains the full 5’ and 3’ UTRs as well as part of nsp1 in the 5’-end of the viral coding sequence.
- the minigene system can, therefore, be used as a model system for the RNA-targeting approaches.
- the primers for the viral gene quantification are listed below: q-hGluc-F: ACCACGGATCTCGATGCTGA; q-hGlucR: TTCATCTTGGGCGTGCACTT. [0302]
- the RT-qPCR experiment showed that C47, can reduce the RNA level in a dose- dependent manner. In the presence of 25 ⁇ M C47, the viral minigene mRNA level reduced ⁇ 50% (FIG.9B).
- SARS-CoV-2 - C2NH preferentially binds to the SARS-CoV-2 start codon [0303] Coronavirus gene assembly and polyproteins.
- SARS-CoV-2 belongs to the betacoronavirus genus, and is an enveloped ssRNA(+) virus, with a genome length of about 29,903 nucleotides (nts, RefSeq NC_045512) 2 .
- the viral genome is 5' capped and 3' polyadenylated, so that it is recognized and treated as an mRNA by the host cell ribosome.
- ORFs open reading frames from 5’ to 3’ (FIG.7A).
- the 5’-terminal two-thirds of the genome have two long ORFs, ORF1a and ORF1ab that are translated into two replicase- associated polyprotein (pp) precursors, pp1a and pp1ab.
- Pp1a is the N-terminal fraction of pp1ab and has an in-fame stop codon at 13,481 nt. Correct translation of C-terminal pp1ab requires a programmed-1 ribosomal frameshift (or programmed frameshift, PFS) that shifts the ORF by -1 nucleotide via a “slippery sequence” to avoid the ORF1a stop codon 3 .
- Pp1a and pp1ab are cleaved by viral proteases into 16 nonstructural proteins (nsps), some of which have essential viral functions. For example, nsp12 in pp1ab is required for viral replication, being an RNA- dependent RNA polymerase (RdRp).
- Nsp12 and other nsps in pp1ab collectively form the replication transcription complex (RTC) 4 .
- the RTC then promotes replication of the viral genome ssRNA (+), forming a double-stranded (ds) RNA located in ER membrane invaginations. This dsRNA then serves as a template for transcription of further copies of the RNA genome by RTC-mediated transcription from the 5’- to 3’-end. mRNA transcription for each coronavirus structural protein is accomplished through a "discontinuous” mechanism.
- the RTC binds to the 5’-untranslated region (UTR) leader transcriptional regulatory sequences (TRS-L), and then “hops” onto the body TRS (TRS-B, FIG.7A) sequence.
- UTR 5’-untranslated region
- TRS-L leader transcriptional regulatory sequences
- TRS-Bs are located at the 5’-end of each structural gene for transcription.
- the roles of conserved RNA sequences in viral protein translation Several conserved sequences have been uncovered in beta coronaviruses 5,6 . In the proposed study, we will only focus on the essential sequences that have a well-defined function, including the start codon and PFS regulatory sequence. To evaluate the mutation propensity of these two sequences in the SARS-CoV-2 genome, we aligned 3,559 viral sequences uploaded at PubMed (www.ncbi.gov). Our analysis showed that only 1 sequence record has a mutation at the 3’ of the start codon in the region of interest (265-273 nt, Fig 2A).
- the ribosomal 40S subunit then "scans" in a 5' to 3' direction along the 5'-UTR to locate an AUG start codon (266 nt, Fig 2A) using the initiator tRNA to start translation elongation 7 . If the viral RNA is cleaved at the start codon region, the transcripts will not be translated. [0305]
- the mechanism of PFS. PFS is essential for translation of C-terminal pp1ab, which contains almost all components of the RTC. PFS is governed by a highly conserved RNA sequence found in all coronavirus species.
- This PFS RNA regulatory element contains a slippery sequence (U_UUA_AAC motif) followed by an RNA pseudoknot structure (Fig 2B) 3 .
- a slippery sequence U_UUA_AAC motif
- tRNAs in the ribosomal P- and A-sites re-bind to the -1 reading frame, and the ribosome starts to translate within the new reading frame.
- translation halts at a stop codon (13,481-13,483 nt) within the pseudoknot scaffold. It has been demonstrated that the viral RNA sequence alone (the RNA sequence in Fig 2B) can recapitulate the PSF activity without a viral protein cofactor in SARS-CoV 8 .
- RNA-binding drugs are a validated pharmacological modality as antivirals.
- RNA viruses use RNA sequences and structures to hijack host cell functions or promote viral life cycle progression, such as the transactivation response (TAR) hairpin, internal ribosomal entry site (IRES), and Rev responsive element (RRE) in HIV-1 9 .
- the HIV-1 trans-activator protein (Tat) binds to TAR to enhance the transcription of the viral genome.
- Peptoid inhibitors targeting the TAR-Tat interaction have been shown to inhibit HIV-1 replication in vitro and in vivo 10 .
- HCV hepatitis C viral
- OAS-RNase L pathway Oligoadenylate synthetase (OAS)-RNase L pathway.
- OAS-RNase L pathway is activated by double-stranded (ds) RNA, which is produced in RNA virus life cycle.
- ds double-stranded
- OAS synthesizes a signaling molecule, 2',5'- linked oligoadenylates (2-5A), that activate RNase L by dimerization.
- RNase L then cleaves single-stranded (ss) RNA leading to degradation of viral genomes, arrest of protein synthesis, and apoptosis.
- Coronavirus can inactivate this pathway by destroying the signaling molecule, 2-5A.
- ns2 is a 2',5'-phosphodiesterase (PDE) that cleaves 2- 5A, thereby preventing RNase L activation 16 .
- PDE 2',5'-phosphodiesterase
- MERS also uses PDE activity of a viral gene, ns4b, to enzymatically degrade 2-5A 17 .
- the specific gene that degrades 2-5A has not been fully validated in SARS-CoV-2.
- the expression of RNase L is not inhibited by SARS-CoV-2 in Calu-3 and A549 cell-lines 18 .
- RNase L dimerizer i.e. activator
- K d 18 ⁇ M to RNase L monomer
- RIBOTAC fragment in RIBOTAC
- C2NH (FIG.8A) is a dealkylated analog of a known RNA-binding molecule, SMN-C2 21 , and a close analog of risdiplam (FIG.8A), an FDA-approved RNA-binding molecule for an unrelated disease, spinal muscular atrophy (SMA, approved on 8/7/2020).
- SMA spinal muscular atrophy
- the major drug effect of risdiplam is to increase the level of a splice variant of survival of motor neuron (SMN) 2, which should not adversely impact human.
- SMA spinal muscular atrophy
- Example 7 [0311] Minigene SMN2 Splicing Assays in 293T cells [0312] These in vitro findings were validated in SARS-CoV-25’ UTR expressing 293T cells. In this cell model, the SARS-CoV-25’ UTR sequence was fused to a CMV promoter- controlled Gaussia luciferase expression cassette. Consistent with the RNase L degradation assay result, the maximum potency of C64 (i.e., RNA reduction level) was significantly better than C65. The activities of C47 and C48 in this cell model are similar, between those of C64 and C65.
- Gaussia luciferase minigenes for SMN2 exon 7 skipping were transfected into 293T cells following the Lipofectamine 2000 protocol (Thermo) in a 6-well plate. After 6 h of incubation, cells were disassociated with 0.5 mL TrypLE (Gibco, # 12605036) for 5 min. The trypsinization was stopped by adding 1.5 mL of full growth medium (DMEM + 10% FBS) to the wells. The cell number was counted using Countess II Automated Cell Counter (Thermo, # AMQAX1000) and were diluted in low serum medium (DMEM + 3% FBS).
- the cells were seeded into a 24-well plate (0.2 million per well) in 0.35 mL medium and incubate for 2 h at 37 °C. The cells were then treated with SMN-C2 or nusinersen at various concentrations. In the wells containing nusinersen, 1 ⁇ L Endo-Porter delivery reagent (GeneTools, Philomath, OR, USA; ordered through Fisher Scientific, # NC1501848) was added and mixed by gently swirling the plate. The cells were incubated for another 24 h at 37 °C before being harvested by aspirating the medium and adding 300 ⁇ L RLT buffer (RNeasy mini kit) in each well.
- RLT buffer RNeasy mini kit
- RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany #74104) according to the manufacturer’s manual.
- the RNA was reversely transcribed using M-MLV reverse transcriptase (Promega, # M1701) and a poly(dT) primer.
- the spliced products were amplified by PCR using the primer set, pCI-FW: 5’ GGCTAGAGTACTTAATACGACTCAC, and GLuc- RV: 5’-CAGCGATGCAGATCAGG-GC.
- the PAGE is performed with 8 % TBE gels (180 V, 30 min).
- the gels were stained with 0.003 % SYBR Safe DNA Gel Stain (Thermo, # S33102) in 0.5 ⁇ TBE buffer for 10 min (for full gel images for FIG.3).
- the transfected cells were transferred into a 384-well plate (Greiner #784075) at 15,000 cells per well in 27 ⁇ L medium.
- the compounds were 1:2 serial diluted for 10 concentration points starting at 1 ⁇ M (final concentration) and added into the wells in triplicates (3 ⁇ L). The plate was incubated for 48 h at 37 °C with 5% CO 2 after the addition of the compounds.
- the Gaussia luciferase reading agent was prepared by diluting coelenterazine Gaussia luciferase substrate (Thermo #1862575) at 1:500 ratio into the Gaussia luciferase buffer containing 50 mM Tris-Cl pH 7.5, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, and 0.2% BSA in M-PER Mammalian Protein Extraction Reagent (Thermo #78501).15 ⁇ L of the Gaussia luciferase reading reagent was added to each well and incubated for 5 min at room temperature followed by luminescence measurements (Cytation 5, BioTek).
- the minigene reporter plasmid was constructed by inserting the below sequence between T7 promoter and SV40 poly(A) sequences in pCI vector: CTAGCCTCGAGATGGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATC ATACTGGCTATTATATGGTAAGTAATCACTCAGCATCTTTTCCTGACAATTTTTTTGT AGTTATGTGACTTTGTTTTGTAAATTTATAAAATACTACTTGCTTCTCTCTTTATATT ACTAAAAAAAATACAACTGTCTGAGGCTTAAATTACTCTTGCAT TGTCCCTAAGTATAATTTTAGTTAATTTTAAAAAGCTTTCATGCTATTGTTAGATTAT TTTGATTATACACTTTTGAATTGATTGATTATGTTTTAATCTCT GATTTGAAATTGATTGTAGGGAAT
- the SARS- CoV-2 virus was engineered to include a Nano Luciferase (NLuc) reporter by fusing NLuc onto ORF7 of the SARS-CoV-2 genome45.
- NLuc Nano Luciferase
- a human lung epithelial carcinoma cell line A549 expressing high level of ACE2 was applied as the host cell.
- the cells were infected with the SARS-CoV-2-NLuc virus at a multiplicity of infection (MOI) of 2.0 at 1 h before the treatment with RIBOTACs C64 for 3 d. C64 showed > 95% inhibition at 20 ⁇ M. At the same concentration, no major toxicity is observed in A549 cells.
- MOI multiplicity of infection
- Example 8 Isothermal Titration Calorimetry (ITC) Assay
- ITC Isothermal calorimetric titrations were carried out on a Malvern Analytical MicroCal PEAQ-ITC at 25 °C.
- the DNA (see above for the calibration procedure) and the SMN-C2 water solutions containing the desired amount of the materials were freeze-dried overnight (Labconco FreeZone 4.5 Liter Benchtop Freeze Dry System) and then re-suspended in appropriate volume of buffer containing 5 % DMSO, 100 mM NaCl and 30 mM MES buffer at pH 6.0 (e.g., 350 ⁇ L for DNA Seq6, 80 ⁇ L for SMN-C2).
- Each ITC titration had an initial injection of 0.4 ⁇ L followed by 18 injections of SMN-C2 (e.g., 250 ⁇ M for DNA Seq6 titration) of 2 ⁇ L for 4 s at 150 s intervals into the DNA (e.g. Seq6 at 25 ⁇ M) in sample cell.
- the analysis was performed using the instrument’s MicroCal PEAQ-ITC Analysis Software (Malvern Analytical).
- the ITC data was fit using the One Set of Sites mode to calculate the dissociate constant (Kd), binding stoichiometry, and the changes in enthalpy and Gibbs free energy.
- Kd dissociate constant
- DP differential power
- the running buffer composed of 10 mM HEPES, 100 mM NaCl, 0.05% Tween 20 (w/v), 5 mM EDTA, 0.1% (v/v) DMSO at pH 6.8 was prepared freshly, filtered through the 0.22 ⁇ m PVDF membrane prior to use.5’-biotinylated RNA Seq4 was purchased from GenScript and dissolved in nuclease-free water to a concentration of 100 ⁇ M.
- the sensor chip was firstly conditioned with 3 consecutive 1 min injections of high salt solution (50 mM NaOH, 1M NaCl) at a flow rate of 10 ⁇ L/min.
- biotinylated RNA was diluted 1000 ⁇ in running buffer (100 nM) and applied over the streptavidin sensor chip surface at a flow rate of 10 ⁇ L/min to achieve immobilization level of about 800 RU.
- alkyne-PEG-biotin 50 ⁇ M in running buffer
- the kinetics analysis was performed following the BiaControl Software Wizard Kinetics protocol.
- the small molecules (HCl salt form, 10 mM in water) were diluted in the running buffer to six concentrations (0, 0.1, 1, 5, 10, 20 ⁇ M for SMN-C2; 0, 1, 5, 10, 20, 40 ⁇ M for SMN-C5; 0, 1, 10, 20, 40, 80 ⁇ M for SMN-C3) and titrated over the immobilized RNA Seq4 (contact time: 1 min, flow rate: 30 ⁇ L/min).
- the data analysis was performed using the instrument BiaEvaluation Software. All monitored resonance signals were subtracted with signals from a non-binding reference channel. Kinetic values (Kd, ka, kd) were calculated using the BiaEvaluation Software Binding Affinity protocol with 1:1 fitting.
- GaMD is an enhanced sampling approach wherein a harmonic boost potential is added to smooth the potential energy surface and reduce energy barriers(1). GaMD provides efficient unconstrained enhanced sampling without the need for predefined collective variables. A brief summary of the method is described here. Consider a system with N atoms at positions r When the system potential V( ) is lower than a reference energy E, the modified potential V*(r ) of the system is calculated as: where k is the harmonic force constant. The parameters E and k can be determined by applying three principles of enhanced sampling.
- the reference energy should fall in range as follows: where V max and V min are the system maximum and minimum potential energies. To ensure that Eq. (3) is valid, k has to satisfy: Let us define The standard deviation of ⁇ V needs to be small enough (i.e., narrow distribution) to ensure precise reweighting using cumulant expansion to the second order: where V avg and ⁇ v are the average and standard deviation of ⁇ V with as a user-specified upper limit (e.g.10 k B T ) for accurate reweighting.
- E is set to the lower bound can be calculated as: [0328]
- the threshold energy E is set to its upper bound is set to: [0329] If is calculated between 0 and 1. Otherwise, is calculated using Eq. (4).
- the original GaMD method provides schemes to add only the total potential boost ⁇ V p , only dihedral potential boost or the dual potential boost (both ⁇ V p and ⁇ V p ).
- Dual-boost GaMD provides higher acceleration than the other two types of simulations.
- the simulation parameters comprise of the threshold energy E for applying boost potential and effective harmonic force constants, k 0 P and k 0 D and for total and dihedral potential boost.
- Energetic Reweighting of GaMD Simulations [0332] The GaMD simulations can be reweighted to calculate the original potential mean force (PMF) free energy profiles. The probability distribution along a reaction coordinate is written as P*(A ) .
- p*(A ) can be reweighted to recover the canonical ensemble distribution p(A ) , as: where M is the number of bins, is the ensemble-averaged Boltzmann factor of ⁇ V(r ) for simulation frames found in the j th bin.
- the ensemble-averaged reweighting factor can be approximated using cumulant expansion: where first two cumulants are given by [0333]
- the boost potential derived from GaMD simulations usually follows near- Gaussian distribution. Cumulant expansion to the second order thus provides a good approximation for computing the reweighting factor(1, 2).
- Reagents and solvents were purchased from commercial sources (Fisher, Sigma- Aldrich and Combi-Blocks) and used as received. Reactions were tracked by TLC (Silica gel 60 F 254 , Merck) and Waters ACQUITY UPLC-MS system (ACQUITY UPLC H Class Plus in tandem with Qda Mass Detector).
- Step 1 Synthesis of Coumarin intermediate: A mixture of substituted phenyl acetic acid (1 eq), substituted 2-hydroxylbenzaldehyde (1 eq), triethylamine and acetic anhydride (1 : 5) was heated to 100 °C for 1 h in a Biotage Initiator + microwave reactor. TLC and LC-MS showed completion of reaction. The mixture was cooled to room temperature, poured into 10 mL ice water and extracted with ethyl acetate. Organic layer was washed with brine, dried with anhydrous sodium sulphate and removed under vacuum.
- Step 2 Synthesis of final product: To a solution of Coumarin intermediate (1 eq) and 1-methylpiperazine (2 eq) in DMSO was added K 2 CO 3 (3 eq). The reaction mixture was heated to 120 °C and stirred for 2 h. TLC and LC-MS showed completion of reaction. The mixture was cooled to room temperature, poured into ice water and extracted with ethyl acetate. Organic layer was washed with brine, dried with anhydrous sodium sulphate and removed under vacuum.
- the cells will be plated onto the Transwell inserts (0.33 cm 2 /0.4 ⁇ M pore size, Coster #3470) at an air-liquid interface (ALI) for 4 weeks.
- the airway epithelium will be incubated with the RIBOTACs at 24 h before, concurrent, or 24 h after apical infection of SARS-CoV-2, to evaluate the specific timing of the inhibitory effect in viral replication.
- SARS- CoV-2 isolated USA-WA1/2020
- HAE-ALI HAE-ALI
- Viruses will be inoculated by incubation of the diluted virus in 100 ⁇ l of D-PBS at an MOI of 0.2 (high), 0.02 (medium), and 0.002 (low) in the apical chamber.
- References cited in Example 1 1. Lunn, M.R. and Wang, C.H. (2008) Spinal muscular atrophy. Lancet, 371, 2120–33. 2. Lorson, C.L., Rindt, H. and Shababi, M. (2010) Spinal muscular atrophy: mechanisms and therapeutic strategies. Hum. Mol. Genet., 19, R111-8. 3. D’Amico, A., Mercuri, E., Tiziano, F.D. and Bertini, E. (2011) Spinal muscular atrophy. Orphanet J.
- SMN2 splicing modifiers improve motor function and longevity in mice with spinal muscular atrophy. Science, 345, 688–93. 13. Sturm, S., Günther, A., Jaber, B., Jordan, P., Al Kotbi,N ., Parkar, N., Cleary, Y., Frances, N., Bergauer, T., Heinig, K., et al. (2019) A phase 1 healthy male volunteer single escalating dose study of the pharmacokinetics and pharmacodynamics of risdiplam (RG7916, RO7034067), a SMN2 splicing modifier. Br. J. Clin. Pharmacol., 85, 181–193. 14.
- Singh, R.N., Ottesen, E.W. and Singh, N.N. (2020) The First Orally Deliverable Small Molecule for the Treatment of Spinal Muscular Atrophy. Neurosci. Insights, 15. 19. Brodersen, D.E., Clemons, W.M., Carter, A.P., Morgan-Warren, R.J., Wimberly, B.T. and Ramakrishnan, V. (2000) The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B, on the 30S ribosomal subunit. Cell, 103, 1143–1154. 20.
- each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc.
- all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above.
- a range includes each individual member.
- Ring A is C 6 -C 10 aryl or 5 to 10 membered heteroaryl;
- R 1 is selected from H, C 1 -C 6 alkyl, -CH 2 CCH, or 2 to 15 membered heteroalkyl;
- each R 2 is independently halogen or C 1 -C 6 alkyl;
- each R 3 is independently selected from halogen, C 1 -C 6 alkyl, or 2 to 6 membered heteroalkyl;
- n2 is 0, 1, 2, 3, 4, or 5; and n3 is 0, 1, 2, 3, or 4; with the proviso that the compound is not (S)-3-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-(4-ethyl-3-methylpiperazin-1-yl)-2H- chromen-2-one (C2); (S)-3-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl
- Ring A isC 6 -C 10 aryl or 5 to 10 membered heteroaryl;
- R 1 is selected from H, C 1 -C 6 alkyl, -CH 2 CCH, or 2 to 15 membered heteroalkyl;
- each R 2 is independently halogen or C 1 -C 6 alkyl;
- each R 3 is independently selected from halogen, C 1 -C 6 alkyl, or 2 to 6 membered heteroalkyl;
- n2 is 0, 1, 2, 3, 4, or 5; and n3 is 0, 1, 2, 3, or 4; with the proviso that the compound is not 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-9-methyl-4H- pyrido[1,2-a]pyrimidin-4-one (C3); or 2-(8-fluoro-2-methylimidazo[1,
- a pharmaceutical composition comprising the compound of any one of Paragraphs A-AD, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable excipient.
- AF A method of treating a disorder or disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the compound of any one of Paragraphs A-AD, or the stereoisomer or the tautomer thereof, or the pharmaceutically acceptable salt thereof, or a therapeutically effective amount of the pharmaceutical composition of Paragraph AE, wherein the disorder or disease is a viral disorder or disease.
- the method of Paragraph AF wherein the disease is COVID-19. AH.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
Description
Claims
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/877,434 US20250368651A1 (en) | 2022-06-27 | 2023-06-27 | Antiviral compounds useful against sars-cov-2 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263355874P | 2022-06-27 | 2022-06-27 | |
| US63/355,874 | 2022-06-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2024006287A2 true WO2024006287A2 (en) | 2024-01-04 |
| WO2024006287A3 WO2024006287A3 (en) | 2024-02-15 |
Family
ID=89381291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/026356 Ceased WO2024006287A2 (en) | 2022-06-27 | 2023-06-27 | Antiviral compounds useful against sars-cov-2 |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20250368651A1 (en) |
| WO (1) | WO2024006287A2 (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012170546A1 (en) * | 2011-06-06 | 2012-12-13 | University Of Iowa Research Foundation | Methods of inhibiting muscle atrophy |
| WO2015095449A1 (en) * | 2013-12-19 | 2015-06-25 | Ptc Therapeutics, Inc. | Methods for modulating the amount rna transcripts |
| WO2016073947A1 (en) * | 2014-11-07 | 2016-05-12 | Kineta, Inc. | Anti-viral compounds, pharmaceutical compositions, and methods of use thereof |
| WO2019057821A1 (en) * | 2017-09-20 | 2019-03-28 | Lead Discovery Center Gmbh | Coumarin derivatives, processes for their preparation and uses thereof for the treatment of cancer |
-
2023
- 2023-06-27 WO PCT/US2023/026356 patent/WO2024006287A2/en not_active Ceased
- 2023-06-27 US US18/877,434 patent/US20250368651A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024006287A3 (en) | 2024-02-15 |
| US20250368651A1 (en) | 2025-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Johns et al. | The use of oxadiazole and triazole substituted naphthyridines as HIV-1 integrase inhibitors. Part 1: Establishing the pharmacophore | |
| AU2019321464B2 (en) | Substituted indoles and methods of use thereof | |
| EP1675861B1 (en) | Pyrimidothiophene compounds | |
| US9604988B2 (en) | Agent for treating or inhibiting recurrence of acute myeloid leukemia | |
| JP5926727B2 (en) | Substituted imidazo [1,2-b] pyridazine | |
| KR101096948B1 (en) | MG Kinesin Inhibitor | |
| EP3917934A2 (en) | Compounds and uses thereof | |
| EP3917526A1 (en) | Compounds and uses thereof | |
| EP3917529A1 (en) | Compounds and uses thereof | |
| CA3020541A1 (en) | Bet protein degraders | |
| KR20210151823A (en) | Compositions and methods for correcting abnormal splicing | |
| US20100120762A1 (en) | Triazine derivatives as inhibitors of phosphodiesterases | |
| JP5820080B2 (en) | Tricyclic PI3K and / or mTOR inhibitors | |
| KR20210135507A (en) | Methods and compositions for controlling splicing | |
| JP2020514361A (en) | 9,10,11,12-Tetrahydro-8H- [1,4] diazepino [5 ', 6': 4,5] thieno [3,2-F] quinolin-8-one compounds and uses thereof | |
| Velthuisen et al. | Pyridopyrimidinone inhibitors of HIV-1 RNase H | |
| WO2021231778A1 (en) | Coronavirus protease degraders and uses thereof | |
| US9261497B2 (en) | Method of treating cancer with modulators of SCFSkp2 | |
| US11453640B2 (en) | Small molecules for disrupting the super elongation complex and inhibiting transcription elongation for cancer therapy | |
| EP3683214A1 (en) | Brd4 inhibitor | |
| US20070259911A1 (en) | Novel Compounds and Use of Tetrahydropyridothiophenes | |
| US20250368651A1 (en) | Antiviral compounds useful against sars-cov-2 | |
| WO2014036395A1 (en) | SMALL MOLECULES TARGETING REPEAT r(CGG) SEQUENCES | |
| CN115197206B (en) | Tetrahydro-γ-carboline compounds substituted at the 3-position of indole, pharmaceutical compositions and uses thereof | |
| US12233047B2 (en) | Pharmaceutical combination and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23832248 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18877434 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23832248 Country of ref document: EP Kind code of ref document: A2 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18877434 Country of ref document: US |



























































































































































