WO2023280685A1 - Sars-cov-2 specific aptamer - Google Patents
Sars-cov-2 specific aptamer Download PDFInfo
- Publication number
- WO2023280685A1 WO2023280685A1 PCT/EP2022/068154 EP2022068154W WO2023280685A1 WO 2023280685 A1 WO2023280685 A1 WO 2023280685A1 EP 2022068154 W EP2022068154 W EP 2022068154W WO 2023280685 A1 WO2023280685 A1 WO 2023280685A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rbd
- aptamer
- rna
- rna aptamer
- cov
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
Definitions
- the present invention relates generally to medicine and the use of aptamers.
- the present invention specifically relates to novel aptamers that bind to the Spike protein of SARS-CoV-2.
- SARS-CoV-2 Severe Acute Respiratory Syndrome Coronavirus 2 pandemic in 2020-2021 has launched a global quest to find new molecular tools for the detection and treatment of the disease.
- SARS-CoV-2 Severe Acute Respiratory Syndrome Coronavirus 2 pandemic in 2020-2021 has launched a global quest to find new molecular tools for the detection and treatment of the disease.
- the challenge to find an effective cure remains due to the limited access to SARS-CoV-2 vaccines, particularly in developing countries, and the emergence of new viral strains that can evade immune responses and potentially compromise the efficacy of current vaccines.
- SARS-CoV-2 expresses a surface spike (S) glycoprotein, which is composed of two domains (SI and S2) and forms a trimeric structure capable of interacting with human cells.
- SI and S2 the receptor binding domain located on the SI subunit of the spike protein binds with high affinity to human angiotensin-converting enzyme-2 (ACE2) and in conjunction with the associated transmembrane protease, serine 2 (TMPRSS2) facilitate viral uptake.
- ACE2 angiotensin-converting enzyme-2
- TMPRSS2 transmembrane protease
- Efforts to neutralize viral activity and replication have therefore mainly focused on inhibiting the Spike-ACE2 interaction.
- Antibodies have been developed and are currently used for SARS-CoV-2 detection and some, primarily those targeting RBD, show promise as therapeutic candidates due to their potent neutralizing effect.
- the high costs of antibody production, the use of animals and their poor stability at ambient temperatures remain a disadvantage.
- Ab immunogenicity and the risk of antibody-dependent enhancement (ADE) of infection associated with Fc-containing Abs limit their therapeutic potential.
- VHH antibodies or nanobodies raised to the spike protein may overcome some of these drawbacks but are more prone to immunological response.
- interesting alternatives such as de novo proteins based on the host ACE2 receptor and other synthetic molecules have been investigated and may, if potential immunogenicity and stability problems are solved, help develop affordable and efficient detection methods and drugs.
- Nucleic acid-based aptamers have gained increased attention as alternatives to antibodies due to their ease of production, low immunogencity, high thermal and chemical stability and smaller size, but still with comparable target binding and specificity.
- Aptamers are short single-stranded oligonucleotides, developed through an in vitro selection process termed SELEX (Systematic Evolution of Ligands by Exponential enrichment), that bind with high affinity and selectivity to cognate targets.
- SELEX Systematic Evolution of Ligands by Exponential enrichment
- the present invention relates to novel aptamers targeting the RBD on the spike protein of SARS-CoV-2 and hereby, to prevent binding to the ACE2 and efficiently neutralise SARS-CoV-2.
- These aptamers are RNA aptamers and have different sequences compared to other aptamers targeting the spike protein of SARS-CoV- 2.
- an object of the present invention relates to the provision of aptamers for preventing binding to ACE2.
- RNA aptamer which prevents binding of the RBD and/or spike protein to ACE2, comprising a sequence having at least 80% sequence identity, such as at least 90% sequence identity to SEQ ID NO: 1.
- Another aspect of the present invention relates to a multimeric RNA aptamer comprising at least two RNA aptamers as described herein.
- An even further aspect of the present invention relates to an RNA aptamer as described herein and/or a multimeric RNA aptamer as described herein and/or a composition as described herein and/or a pharmaceutical composition as described herein for use as a medicament.
- Still a further aspect of the present invention relates to an RNA aptamer as described herein and/or a multimeric RNA aptamer as described herein for use in preventing, alleviating and/or treating infection with SARS-CoV-2 or variants thereof.
- a further aspect of the present invention relates to in vitro use of an RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein in a detection assay for detecting and/or quantifying SARS-CoV-2 or variants thereof.
- Still another aspect of the present invention is to provide a detection device, adapted for detecting SARS-CoV-2 or variants thereof, comprising at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein.
- An even further aspect of the present invention is to provide a kit of parts for detecting or quantifying SARS-CoV-2 or variants thereof comprising - at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein;
- a detection device arranged for capturing said RNA aptamer and/or said multimeric RNA aptamer
- kits of parts for detecting or quantifying SARS-CoV-2 or variants thereof.
- Figure 1 shows selection of an RNA aptamer binding to RBD.
- Figure 2 shows RBD-PB6 binding to RBD and inhibiting its interaction with ACE2.
- RBD-PB6 is diluted in 1/2 dilution steps starting from 500 nM (thin lines indicate fitting model).
- D) Fitted data shows the signal decay at increasing amounts of aptamer, that was used to determine IC50 values.
- Figure 3 shows RBD-PB6 recognising spike protein in a tag-independent manner.
- FIG. 4 shows Flow-Induced Dispersion Analysis (FIDA) determining complex formation and size.
- FIDA experiments showing the increase in hydrodynamic radius in solution upon binding of the RBD to the fluorescently labelled RBD-PB6 (black line indicates fitting 1: 1 model used). The experiment was performed in triplicates (A, B and C, respectively) yielding an average KD of ⁇ 129 nM.
- Figure 5 shows RBD-PB6 truncated constructs. NUPACK analysis of secondary structures of each truncated aptamer version.
- FIG. 6 shows BLI competition screening experiment of the different truncated versions of RBD-PB6. Competition experiments between RBD and ACE2 was performed using 50 nM RBD-ctag and 1000 nM of each truncated aptamer.
- Figure 7 shows VLP neutralization experiments with SARS-CoV-1 and SARS-CoV- 2.
- A) Flow cytometry analysis of the fluorescence signal for SARS-CoV-2 and B) SARS-CoV-1 transduction.
- FIG 8 shows that RBD-PB6 does not block infection by MERS-pseudotyped VLPs in cell culture.
- VLP neutralization control experiment with MERS pseudotyped virus and RBD-PB6 (circle), RBD-PB6-Ta (square) and RBD-3 (negative control, triangle).
- Figure 9 shows that multivalency enhances aptamer binding and viral neutralization efficiency.
- A) Histogram shows fluorescence intensity originating from multiple binding events of RBD-PB6 aptamers on trimeric spike.
- B) FIDA binding experiments show superior affinity of trimeric and dimeric aptamers for spike protein. Picomolar affinities for the multimerized aptamers were assessed by BLI.
- Figure 10 shows screening for the optimal spacer length for RBD-PB6 multimerization.
- Figure 11 shows time course experiments of aptamer degradation in serum- containing medium.
- Monomer, dimer and trimer aptamer incubated in DMEM+10% FCS at 37°C at different time points showed half-life values of 51 h, 48 h and 132 h, respectively.
- Figure 12 shows RBD-PB6 binds to the new variants of SARS-CoV-2 spike protein.
- Figure 13 shows RBD-PB6 for detection of SARS-CoV-2 in a lateral flow assay.
- A) demonstrates a method of detecting SARS-CoV-2 in a sample.
- B) demonstrates the functioning of a lateral flow strip.
- C) shows lateral flow strips after incubation with different viral titers (LFA-1: 10*6 particles/mL; LFA-2: 10*5 particles/mL; LFA-3: 10*4 particles/mL; LFA-4: 10*3 particles/mL) of SARS-CoV-2 virus (B.1.1.7 variant).
- D) shows quantification of the absorbance signal from the test line (averaged to the control line) at different viral concentrations.
- Figure 14 shows an ELISA assay using a sandwich format with a capture antibody and RBD-PB6 aptamer for detection of purified trimeric spike protein. LoD ⁇ 20 pM for Spike protein.
- Figure 15 shows pharmacokinetic studies with RBD-PB6 trimer with and without PEGylation demonstrating an approx. 10-fold increase in the circulation time of the pegylated trimeric aptamer compared to the non pegylated after IV injection in mice.
- the aptamer modified at the 3 ' end with a PEG20 shows slower clearance.
- Figure 16 shows lateral flow assay (LFA) studies with live SARS-CoV-2 virus using lateral flow strips.
- A) shows optical read-out at different viral titers for the alpha (UK), delta and omicron variants.
- B) illustrates images of the LFA at different viral titers.
- aptamer refers to oligonucleotides that resembles antibodies in their ability to act as ligands and bind to analytes.
- Aptamers may in general e.g. comprise natural DNA nucleotides, natural RNA nucleotides, modified DNA nucleotides, modified RNA nucleotides, or a combination thereof.
- RNA aptamers are used which may comprise one or more modifications.
- modifications are artificial nucleotides or artificial bonds selected from the group consisting of 2'-F- pyrimidine, 2'-NH2-pyrimidine, 2'-0-Me, LNA (locked nucleic acid), 4'-S, TNA (threose nucleic acid), FANA (fluoroarabinonucleotide) and HNA (1,5- anhydrohexitol nucleic acid).
- aptamers compared to antibodies are designed to easily be sequenced and amplified after isolation.
- multimeric aptamer refers to two or more aptamers connected forming a row of aptamers capable of binding RBD.
- the individual aptamers may in one embodiment be linked via a linker. Alternatively the individual aptamers are connected directly without a linker.
- sequence of the individual aptamers in the multimeric aptamer may be identical or may be different. In one embodiment, the sequence of the aptamers in the multimeric aptamer is identical. In a further embodiment, the sequence of the aptamers is similar but may comprise a different degree of artificial nucleotides.
- linker refers to a molecule that joins two aptamers, either covalently, or through ionic, van der Waals or hydrogen bonds.
- the linker is covalently binding to two aptamers.
- connection linker refers to a linker, which connects groups of aptamers such as groups comprising three aptamers.
- the three aptamers are connected by a linker of a certain length forming a trimer. This trimer is then connected to another trimer by a connection linker.
- the connection linker may be longer, shorter or of similar length as the linker, preferably the connection linker is longer.
- sequence identity refers to the sequence identity between genes or proteins at the nucleotide, base or amino acid level, respectively. Specifically, a DNA and a RNA sequence are considered identical if the transcript of the DNA sequence can be transcribed to the identical RNA sequence.
- sequence identity is a measure of identity between proteins at the amino acid level and a measure of identity between nucleic acids at nucleotide level.
- the protein sequence identity may be determined by comparing the amino acid sequence in a given position in each sequence when the sequences are aligned.
- the nucleic acid sequence identity may be determined by comparing the nucleotide sequence in a given position in each sequence when the sequences are aligned.
- the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence).
- the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
- the two sequences are of different length and gaps are seen as different positions.
- One may manually align the sequences and count the number of identical amino acids.
- alignment of two sequences for the determination of percent identity may be accomplished using a mathematical algorithm.
- Such an algorithm is incorporated into the NBLAST and XB1_AST programs of (Altschul et al. 1990).
- Gapped BLAST may be utilized.
- PSI-Blast may be used to perform an iterated search, which detects distant relationships between molecules.
- the default parameters of the respective programs may be used. See http://www.ncbi.nlm.nih.gov.
- sequence identity may be calculated after the sequences have been aligned e.g. by the BLAST program in the EMBL database (www.ncbi.nlm.gov/cgi-bin/BLAST).
- the default settings with respect to e.g. "scoring matrix" and "gap penalty" may be used for alignment.
- the BLASTN and PSI BLAST default settings may be advantageous.
- the percent identity between two sequences may be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
- An embodiment of the present invention thus relates to sequences of the present invention that has some degree of sequence variation. Substitution
- substitution refers to the replacement of one nucleotide in the RNA aptamer with a different nucleotide.
- nucleotides/artificial nucleotides refers to the natural nucleotides being adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U) and artificial nucleotides, which are natural nucleotides that have been chemically modified in order to obtain other characteristics such as better stability.
- artificial bonds refers to bonds between nucleotides, which are not naturally occurring but which arises due to the presence of artificial nucleotides, and potential additional bonds that these would give rise to.
- KD refers to the equilibrium dissociation constant between the aptamer and the RBD/Spike protein. It is inversely related to affinity. The value relates to the concentration of aptamer needed by a lower value i.e. lower concentration is equal to a higher affinity of the antibody.
- IC50 refers to half maximal inhibitory concentration. This is a measure of the potency of a substance in inhibiting a specific biological or biochemical function. It is a quantitative measure that indicates how much of the particular compound is needed to inhibit a given biological process or biological component by 50%, when measured in vivo or in vitro.
- spike protein refers to a glycoprotein that protrudes from the envelope of e.g. coronavirus.
- the spike protein facilitates entry of the virion into a host cell by binding to a receptor on the surface of a host cell. This is followed by fusion of the viral and host cell membranes.
- wild-type SARS-CoV-2 spike protein is considered to have the sequence according to SEQ ID NO: 13.
- RBD refers to a short immunogenic fragment from a virus that binds to a specific endogenous receptor sequence to gain entry into host cells.
- wild-type SARS-CoV-2 RBD domain relates to SEQ ID NO: 25, which is amino acids 319-532 of SEQ ID NO: 13.
- modification refers to the addition of compound, which is not an oligonucleotide to the aptamer and/or multimeric aptamer in order to modify the biological characteristics/abilities of the aptamer and/or multimeric aptamer such as better pharmacokinetics and/or biodistribution.
- the compounds used for the modification may be any compound as known to the persons skilled in the art such as PEG, albumin, palmitoyl and/or cholesterol.
- PEG is PEG20 or PEG40.
- Vector refers to a DNA molecule used as a vehicle to transfer recombinant genetic material into a host cell.
- the four major types of vectors are plasmids, bacteriophages and other viruses, cosmids, and artifical chromosomes.
- the vector itself is generally a DNA sequence that consists of an insert (a heterologous nucleic acid sequence, transgene) and a larger sequence that serves as the "backbone" of the vector.
- the purpose of a vector, which transfers genetic information to the host is typically to isolate, multiply, or express the insert in the target cell.
- Vectors called expression vectors are specifically adapted for the expression of the heterologous sequences in the target cell, and generally have a promoter sequence that drives expression of the heterologous sequences.
- Simpler vectors called transcription vectors are only capable of being transcribed but not translated: they can be replicated in a target cell but not expressed, unlike expression vectors. Transcription vectors are used to amplify the inserted heterologous sequences.
- composition refers to a composition suspended in a suitable amount of a pharmaceutical acceptable diluent or excipient.
- the term “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, and more particularly in humans.
- adjuvant refers to a compound or mixture that enhances the immune response to an antigen.
- An adjuvant can serve as a tissue depot that slowly releases the antigen and as a lymphoid system activator, which non-specifically enhances the immune response.
- a primary challenge with an antigen alone, in the absence of an adjuvant will fail to elicit a humoral or cellular immune response.
- Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
- the adjuvant is pharmaceutically acceptable.
- excipient refers to a diluent, adjuvant, carrier, or vehicle with which the composition of the invention is administered.
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E. W. Martin.
- SARS-CoV-2 variant refers to other SARS-CoV- 2 viruses that has arisen from the wild-type SARS-CoV-2 by one or more mutations or modifications of the wild-type genome. Examples of such present variants are B.1.1.7, B.1.351, Bl.1.248, B.1.617 and BA.l.
- the variants may include mutations but is not limited to mutations such as K417N, E484K, N501Y, where the numbering is according to the Kabat system based on the wild-type sequence of SARS-CoV-2 Spike protein (Uniprot code: P0DTC2-1).
- the term "administered” refers to any of the routes by which the RNA aptamer, multimeric RNA aptamer, composition and/or pharmaceutical composition may be delivered to the subject in need hereof.
- RNA aptamer, multimeric RNA aptamer, composition and/or pharmaceutical composition may be administered by pulmonary, parenteral, gastrointestinal or systemic delivery.
- Systemic delivery means that the entire body is affected as the RNA aptamer, multimeric RNA aptamer, composition and/or pharmaceutical composition is administered to the circulatory system.
- the gastrointestinal delivery includes oral and rectal administration providing a system-wide effect. A system-wide effect is also obtained by the parenteral delivery, which includes all but enteral delivery.
- pulmonary delivery local/regional delivery to the lung and respiratory tract can be achieved. Such a delivery will often be performed using an inhaler, nebulizer or direct intranasal delivery.
- RNA aptamer multimeric RNA aptamer, composition and/or pharmaceutical composition
- injection which can be intraperitoneal, intravenous, intramuscular, subcutaneous and intradermal.
- subject comprises humans of all ages, other primates (e.g., cynomolgus monkeys, rhesus monkeys); mammals in general, including commercially relevant mammals, such as cattle, pigs, horses, sheep, goats, mink, ferrets, hamsters, cats and dogs, as well as birds. Preferred subjects are humans.
- Capture antibodies refers to antibodies used in the detection device or the kit, which binds to a region of the SARS-CoV-2 virus or variants hereof, not overlapping with the binding site of the aptamer.
- Lateral flow strip refers to a device used for a lateral flow immunochromatographic assay or rapid test for detection of the presence of a target substance in a liquid sample without the need for specialized and costly equipment as commonly known in the art.
- the lateral flow strip uses capillary flow to move the liquid in the strip.
- Capturing molecules such as capturing antibodies
- the term “capturing molecules”, refers to molecules used in the detection device or the kit for capturing a control component in order to verify the correctness of the assay performed on the detection device or by using the kit.
- the term “Capturing antibodies”, refers to antibodies used in the detection device or the kit for capturing a control component in order to verify the correctness of the assay performed on the detection device or by using the kit.
- the capturing molecules are selected from the group consisting of proteins, oligonucleotides, small molecules and antibodies.
- the oligonucleotide and/or small molecule binds to an aptamer as described herein or an antibody.
- the capturing molecule does not interfere with the binding of the aptamer to SARS- CoV2 virus or Spike protein.
- Control component is used interchangeably with control substance and positive control.
- Capturing moiety refers to a moiety, which may be present on the RNA aptamer and/or the multimeric RNA aptamer for the RNA aptamer and/or multimeric RNA aptamer to be captured by the detection device when in use.
- Catching moiety refers to a moiety, which may be present on a detection device to be able to capture the RNA aptamer and/or the multimeric RNA aptamer. In one embodiment, the catching moiety may interact with a capturing moiety when in use.
- the herein disclosed novel aptamers target RBD on the spike protein and prevents binding of the RBD/spike protein to ACE2 as demonstrated in examples 2-3.
- These novel aptamers not only target the RBD but also demonstrates neutralization of virus-like particles expressing SARS-CoV-2 and variants hereof as illustrated in example 4.
- the examples furthermore demonstrate that the originally identified aptamer RBD-PB6 may be truncated to a certain extent without affecting the binding and neutralization ability.
- the invention relates to an RNA aptamer comprising a sequence having at least 90% sequence identity to SEQ ID NO: 1.
- the invention relates to an RNA aptamer, which prevents binding of the RBD and/or spike protein to ACE2, comprising a sequence having at least 80% sequence identity, such as at least 90% sequence identity to SEQ ID NO: 1.
- the RNA aptamer comprises a sequence having at least 90% sequence identity to SEQ ID NO: 2.
- the RNA aptamer has at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2, such as at least 98% sequence identity, like at least 99% sequence identity, such as at least 100% sequence identity.
- the RNA aptamer consists of or comprises a sequence selected from the group of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12.
- the RNA aptamer consists of or comprises a sequence selected from the group of SEQ ID NO: 2 or SEQ ID NO: 3.
- the RNA aptamer consists of or comprises a sequence according to SEQ ID NO: 2 or SEQ ID NO: 3.
- RNA aptamer as described by the present invention comprising at the most 10 substitutions compared to SEQ ID NO: 1, SEQ ID NO:
- SEQ ID NO: 3 SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12, such as at the most 9 substitutions, at the most 8 substitutions, at the most 7 substitutions, at the most 6 substitutions, at the most 5 substitutions, at the most 4 substitutions, at the most 3 substitutions, at the most 2 substitutions or at the most 1 substitutions.
- the RNA aptamer according to the present invention has a length, which is at the most 120 nucleotides, such as at the most 110 nucleotides, like at the most 100 nucleotides, such as at the most 90 nucleotides.
- the invention relates to an RNA aptamer comprising a sequence having at least 70% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 such as at least 80% sequence identity.
- the RNA aptamer comprises a sequence having at least 90% sequence identity to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12.
- the RNA aptamer comprises a sequence having at least 90% sequence identity to SEQ ID NO: 3.
- the RNA aptamer has at least 95% sequence identity to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12, such as at least 98% sequence identity, like at least 99% sequence identity, such as at least 100% sequence identity.
- the RNA aptamer may be produced by using naturally nucleotides. However, in order to modify the aptamer e.g. improving the stability, the nucleotides may be completely or partially replaced by artificial nucleotides.
- the RNA aptamer comprises one or more artificial nucleotides and/or artificial bonds, such as selected from the group consisting of 2'-F-pyrimidine, 2'- NH2-pyrimidine, 2'-0-Me, LNA (locked nucleic acid), 4'-S, TNA (threose nucleic acid), FANA (fluoroarabinonucleotide) and HNA (1,5-anhydrohexitol nucleic acid), preferably 2'-F-pyrimidine.
- all pyrimidines in the RNA aptamer according to the present invention comprises 2'- fluoro modifications.
- the 2'-fluoro modifications are resistant to nuclease degradation, which provides serum stability, greatly facilitates sample handling and increases shelf life.
- the RNA aptamer according to the present invention consists of artificial nucleotides and/or artificial bonds or comprising at least 50%, such as at least 60%, like at least 70%, such as at least 80%, like at least 90% artificial nucleotides and/or artificial bonds.
- the RNA aptamer has a KD value to RBD below 500 nM, such as below 400 nM, like below 300 nM, such as below 200 nM, like below 100 nM, such as below 75 nM, like below 50 nM, such as below 20 nM.
- the RNA aptamer has a k a to RBD above lxlO 4 M _1 s _1 , such as above 5xl0 4 M _1 s _1 , like above lxlO 5 M _1 s _1 , such as above 5xl0 5 M _1 s _1 , like above 8xl0 5 M _1 s _1 .
- the RNA aptamer has a kd to RBD below lxlO -2 s ⁇ ⁇ such as below lxlO -3 s -1 , like below 5x10 3 s -1 , such as below 2xl0 ⁇ 4 s -1 .
- the KD value, k a and kd were measured using biolayer interferometry binding assays (BLI).
- BLI biolayer interferometry binding assays
- the BLI was performed in an Octet RED96 equipment (ForteBio) and analyzed using either the instrument ' s software or Prism (GraphPad Prism 5.0) software. In general, orbital shake speed of 700 or 1000 rpm were used for BLI experiments. Binding sensorgrams were aligned to dissociation and following subtraction of the reference well/sample, and globally fit to a 1: 1 binding model.
- the RNA aptamer has an IC50 for neutralizing infection with live SARS-CoV-2 virus, below 100 mM, such as below 80 mM, like below 60 mM, such as 40 mM, like below 20 mM, such as below 10 mM, like below 5 mM.
- the IC50 was measured for live SARS-CoV-2 virus as described in the materials and method section. Aptamers in serial dilutions were mixed with SARS-CoV-2 (Freiburg isolate, FR-4286) at a final titer of 100 TCID50/well. Incubation was performed for 1.5 hr at room temperature. Controls without either virus or aptamer were included as control. The virus:aptamer mixtures were added to Vero E6 TMPRSS2 cells and incubated for 12h in a humidified CO2 incubator at 37°C, 5% CO2, before washing off the cells and re-incubated for 60h. The cells were fixed with 5% formalin and staining with crystal violet solution. The plates were read using a light microscope (Leica DMil) with camera (Leica MC170 HD) at 4x magnification, and cytopathic effect (CPE) scored.
- the RNA aptamer may be modified to obtain better pharmacokinetics and biodistribution.
- the RNA aptamer comprises a modification.
- the modification is a PEG, albumin, palmitoyl or cholesterol.
- said modification is palmitoyl.
- said modification is PEG.
- the novel RNA aptamers may be connected into a multimeric RNA aptamer, which improves the binding to the spike protein as well as the neutralization efficacy as demonstrated by example 5.
- the present invention relates to a multimeric RNA aptamer comprising at least two RNA aptamers as described herein.
- the number of RNA aptamers in the multimeric RNA aptamer may vary from two RNA aptamers to several aptamers depending on the purpose of the multimeric RNA aptamer.
- the multimeric RNA aptamer comprises or consists of 2-150 RNA aptamers, such as 2-125 RNA aptamers, like 3-100 RNA aptamers, such as 3-75 RNA aptamers, like 3-50 RNA aptamers, such as 3-25 RNA aptamers, like 3-12 RNA aptamers.
- the multimeric RNA aptamer is a dimer or a trimer.
- the multimeric RNA aptamer has a KD value to RBD below 500 pM, such as below 400 pM, like below 300 pM, such as below 200 pM, like below 100 pM, such as below 75 pM, like below 50 pM, such as below 40 pM.
- the multimeric RNA aptamer has a k a to RBD above lxlO 4 M _1 s _1 , such as above 5xl0 4 M _1 s _1 , like above lxlO 5 M _1 s _1 , such as above 5xl0 5 M _1 s _1 , like above 8xl0 5 M _1 s _1 .
- the multimeric RNA aptamer has a kd to RBD below lxlO -2 s 1 , such as below 5xl0 ⁇ 3 s 1 , like below lxlO 3 s 1 , such as below 5xl0 ⁇ 4 s 1 , like below lxlO 4 s 1 , such as below 5xl0 ⁇ 5 s 1 .
- the KD value, k a and kd were measured using biolayer interferometry binding assays (BLI).
- the BLI was performed in an Octet RED96 equipment (ForteBio) and analyzed using either the instrument ' s software or Prism (GraphPad Prism 5.0) software. In general, orbital shake speed of 700 or 1000 rpm were used for BLI experiments. Binding sensorgrams were aligned to dissociation and following subtraction of the reference well/sample, and globally fit to a 1: 1 binding model.
- the RNA aptamer shows high neutralizing effect when targeting live SARS-CoV-2 virus and thus, may be used in as low an amount as possible.
- the multimeric RNA aptamer has an IC50 for neutralizing infection with live SARS-CoV-2 virus, below 1 mM, such as below 800 nM, like below 600 nM, such as below 400 nM, like below 200 nM, such as below 100 nM, like below 50 nM.
- the IC50 was measured for live SARS-CoV-2 virus as described in the materials and method section. Aptamers in serial dilutions were mixed with ARS-CoV-2 (Freiburg isolate, FR-4286) at a final titer of 100 TCID50/well. Incubation was performed for 1.5 hr at room temperature. Controls without either virus or aptamer were included as control. The virus:aptamer mixtures were added to Vero E6 TMPRSS2 cells and incubated for 12h in a humidified CO2 incubator at 37°C, 5% CO2, before washing off the cells and re-incubated for 60h. The cells were fixed with 5% formalin and staining with crystal violet solution. The plates were read using a light microscope (Leica DMil) with camera (Leica MC170 HD) at 4x magnification, and cytopathic effect (CPE) scored.
- the connection between the RNA aptamers in the multimeric RNA aptamer may either be a direct linkage between the RNA aptamers or they may be connected via a linker.
- the at least two RNA aptamers are separated by a linker.
- the linker may be composed of nucleotides or be a chemical linker.
- the chemical linker may comprise or consist of PEG molecules, polyalkanes (n-alkane or Cn), polypeptides and other oligomeric and polymeric systems either linear (polyethylene, polypropylene) or branched (PAMAM, bis- MPA).
- the linker is a mixture between nucleotides and molecules such as PEG.
- the multimeric RNA aptamer comprises different linkers between the RNA aptamers i.e. a multimeric RNA aptamer may comprise both chemical linkers as well as nucleotide linkers.
- said linker is a nucleotide linker.
- said nucleotide linker has a length in the range 1-30 nucleotides, such as 1-25 nucleotides, like 1-20 nucleotides, such as 2-15 nucleotides, like 3- 10 nucleotides.
- said linker is an adenosine linker.
- said linker comprises or consists of 3-23 adenosines, such as 3-11 adenosines, like 5-9 adenosines such as 8 adenosines.
- the linkers in the multimeric RNA aptamer need not be of similar size i.e. the linkers may be of different length.
- the different length may be obtained by using different components e.g. nucleotides or chemical molecules for the linker or by including a different number of components for the linkers.
- the distance between the RNA aptamers in the multimeric RNA aptamer can be varied.
- said multimeric RNA aptamer comprises more than two RNA aptamers and said RNA aptamers are separated by linkers with a different number of nucleotides.
- the spike protein is present on the SARS-CoV-2 as a trimer, which trimers are distributed over the entire surface of the virus particle.
- the distance between the spike proteins in the trimer and the trimers distributed on the surface of the virus is different.
- said multimeric RNA aptamer comprises at least two groups of trimers being separated with a connection linker.
- said connection linker comprises more nucleotides than said linker separating said RNA aptamers in said trimer.
- connection linker
- 10-200 nucleotides such as 15-175 nucleotides, like 20- 150 nucleotides, such as 25-135 nucleotides, like 30-120 nucleotides; comprises 5-250 PEG molecules, such as 10-225 PEG molecules, like 15-200 PEG molecules, such as 20-175 PEG molecules, like 25-150 PEG molecules; and/or has a length of 1-200 nm, such as 2-175 nm, like 3-150 nm, such as 4-125 nm, like 5-100 nm.
- the length of the linker in nm is a measurement of the linker from one RNA aptamer to the next RNA aptamer taking into account the average nucleobase distance in single- and double-stranded regions as well as potential secondary structures.
- RNA aptamers according to the present invention may be expressed by one or more vectors.
- a further aspect of the present invention relates to a vector comprising, inserted therein, a nucleic acid sequence transcribing a RNA aptamer as described herein.
- the vector is a plasmid, circular single-stranded DNA or circular double-stranded DNA.
- a multimeric RNA aptamer may be produced using rolling circle amplification (RCA).
- RCA rolling circle amplification
- the vectors may be expressing the RNA aptamers in a cell.
- a host cell expressing the RNA aptamer as described herein, and/or a host cell comprising a vector as described herein.
- the host cell is E. Coli.
- RNA aptamers may also be synthetically/chemically produced.
- RNA aptamer according to the invention may be in a composition, such as a pharmaceutical composition.
- the invention relates to a composition comprising at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein.
- the present invention relates to a pharmaceutical composition comprising a composition as described herein and a pharmaceutically acceptable excipient.
- composition and/or pharmaceutical composition comprises one or more stabilizing agents and/or one or more buffering agents.
- RNA aptamer may be used as a medicament.
- a further aspect of the present invention relates to an RNA aptamer according to the invention and/or a multimeric RNA aptamer according to the invention and/or a composition according to the invention and/or a pharmaceutical composition according to the invention for use as a medicament.
- RNA aptamer as described herein may be used for targeting SARS-CoV-2 infections or infections with variants of SARS-CoV-2.
- an even further aspect relates to an RNA aptamer according to the present invention and/or a multimeric RNA aptamer according to the present invention and/or a composition according to the present invention and/or a pharmaceutical composition according to the present invention for use in preventing, alleviating and/or treating infection with SARS-CoV-2 or variants thereof.
- the infection is in a mammal, preferable a human.
- the RNA aptamer may be administered by different routes.
- said RNA aptamer and/or said multimeric RNA aptamer and/or said composition and/or said pharmaceutical composition is administered by pulmonary, parenteral, gastrointestinal or systemic delivery.
- said RNA aptamer and/or said multimeric RNA aptamer and/or said composition and/or said pharmaceutical composition is administered by nasal or oral delivery.
- the RNA aptamer and/or said multimeric RNA aptamer and/or said composition and/or said pharmaceutical composition is administered by injection such as intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection or intradermal injection.
- RNA aptamer according to the present invention also targets variants of the wild-type SARS-CoV-2.
- the RNA aptamer and/or a multimeric RNA aptamer and/or a composition and/or a pharmaceutical composition for use may thus advantageously be used for targeting variants as well.
- the SARS-CoV-2 variant is selected from the group consisting of B.1.1.7, B.1.351, Bl.1.248 and B.1.617, and variants comprising one or more modifications selected from the group consisting of K417N, K417T, L452R, T478K, E484K and N501Y, such as a variant comprising K417N and E484K, like a variant comprising K417N and N501Y, such as a variant comprising E484K and N501Y, like a variant comprising K417N, E484K and N501Y, like a variant comprising K417T, E484K and N501Y, such as a variant comprising L452R and T478K, like a variant comprising K417T and E484K, such as a variant comprising K417T and N501Y, like a variant comprising E484K and N501Y.
- the SARS-CoV-2 variant is selected from the group consisting of B.1.1.7, B.1.351, Bl.1.248, B.1.617 and BA.l and B.1.617, and variants comprising one or more modifications selected from the group consisting Of K417N, K417T, N440K, L452R, S477N, T478K, E484K, E484A, Q493R, G496S, Q498R, N501Y and Y505H, such as a variant comprising K417N and E484K, like a variant comprising K417N and N501Y, such as a variant comprising E484K and N501Y, like a variant comprising K417N, E484K and N501Y, like a variant comprising K417T, E484K and N501Y, such as a variant comprising L452R and T478K, like a variant comprising K417T and E484K, such as a variant comprising
- RNA aptamer as described by the present invention may also be used for the detection of SARS-CoV-2 and variants hereof.
- a further aspect of the present invention relates to in vitro use of an RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein in a detection assay for detecting and/or quantifying SARS-CoV-2 or variants thereof.
- the detection assay may be in the form of a detection device.
- the present invention relates to a detection device, adapted for detecting SARS-CoV-2 or variants thereof, comprising at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein.
- the detection device is an ELISA assay as commonly known to persons skilled in the art.
- capture antibodies which binds to a region of the SARS-CoV-2 virus not overlapping with the binding site of the aptamer, are arranged for capturing the SARS-CoV-2 virus.
- the capture antibody may bind to the S2 domain of the spike protein.
- the antibody may bind to the RBD domain.
- the RNA aptamer and/or the multimeric RNA aptamer is then added after a sample potentially comprising SARS-CoV-2 virus has been incubated with the capture antibody. In case, SARS- CoV-2 virus is present a sandwich complex will form.
- the formation of sandwich complexes may be identified by techniques as commonly known to persons skilled in the art.
- the RNA aptamer is modified with a marker for identification of sandwich complexes.
- a biotinylated oligonycleotide partly complementary to the aptamer could be attached to the RNA aptamer and visualized using HRP-streptavidin.
- the capture antibody is immobilized on a solid support such as a surface or a bead.
- said RNA aptamer and/or said multimeric RNA aptamer is coupled to a solid support, such as surface or a bead.
- the detection device is a lateral flow strip.
- the lateral flow strip advantageously, comprises a control line and a test line as known in the field.
- the test line identifies the presence of SARS-CoV-2 or variants hereof.
- the test line is incubated with RNA aptamers or multimeric RNA aptamers.
- the test line comprises a catching moiety for being able to capture the RNA aptamer and/or the multimeric RNA aptamer.
- the control line may include a compound, such as a capturing molecule, like a capturing antibody, for binding to a control substance present in the lateral flow strip in mobilized form, in order to verify correct flow in the lateral flow strip.
- the detection device further comprises capture antibodies functioning as positive controls.
- the binding to the control line and test line may be visualized as commonly known to the persons skilled in the art such as by gold nanoparticles.
- the gold nanoparticles may be bound to the capture antibodies.
- the detection device further comprises gold nanoparticle labelled capture antibodies.
- aptamers as described herein may be labelled with gold nanoparticles.
- the gold-nanoparticle labelled aptamers may be combined with capture antibodies or aptamers as described herein, being adapted for being captured at and/or binding to the test line.
- aptamers as described herein are labelled with gold nanoparticles.
- the detection assay may be in the form of a kit of parts.
- the present invention relates to a kit of parts for detecting and/or quantifying SARS-CoV-2 or variants thereof comprising
- RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein;
- a detection device arranged for capturing said RNA aptamer and/or said multimeric RNA aptamer
- kits of parts for detecting or quantifying SARS-CoV-2 or variants thereof.
- the detection device arranged for capturing the RNA aptamer and/or the multimeric RNA aptamer may, in one embodiment, be a solid support, such as surface or a bead. In a further embodiment, the detection device may be a lateral flow strip. In an even further embodiment, the detection device further comprises capture antibodies functioning as positive controls. Hereby the correct flow in the lateral flow strip can be verified.
- the detection device may comprise a catching moiety for being able to capture the RNA aptamer and/or the multimeric RNA aptamer.
- the catching moiety may interact with a capturing moiety on the RNA aptamer and/or multimeric RNA aptamer in order for the RNA aptamer and/or multimeric RNA aptamer to be bound to the detection device.
- said at least one aptamer and/or said at least one multimeric RNA aptamer comprises a capturing moiety.
- said capturing moiety is biotin. If the capturing moiety is biotin, the catching moiety may advantageously be streptavidin.
- the detection device may be used for detection of SARS-CoV-2 or variants hereof.
- the present invention relates to the use of a detection device according to the present invention for detection of SARS-CoV-2 or variants hereof in a sample.
- the sample may be any sample where SARS-CoV-2 would be present if a subject has been infected such as in the nose, saliva, urine, faeces or blood .
- the sample is a nose swab, nasopharyngeal swab, a saliva sample, a urine sample, a fecal sample, a plasma sample, a serum sample or a blood sample.
- oligonucleotides including primers and single-stranded (ssDNA) library, were synthesized by Integrated DNA Technologies (IDT, Belgium).
- IDTT Integrated DNA Technologies
- 2'F-RNA aptamers to RBD, the library design previously described (Kenan et al., 1999) was used, however with a 36 nt random region (here termed KK-N36 library).
- KKfw36 forward primer
- KK-N36 library a first annealing step of the Forward primer (KKfw36; SEQ ID NO:21) and the KK-N36 library at 75°C for 15 min and slowly cooling to room temperature (RT).
- Annealed primers were extended by Klenow polymerase (KlenoFragment, exo, ThermoScientific, Lithuania). Purification of the dsDNA products was performed with 6% non-denaturing polyacrylamide gel. The initial RNA library was transcribed in a reaction containing dsDNA template (1.7 nmol at 0.7 mM final concentration, ca.
- His-tagged SARS-CoV-2 RBD spike purified protein (AA 319-532; Creative biolabs; SEQ ID NO: 25). Beads were prepared as described by the manufacturer; in the initial selection cycle, 5 pg of SARS-CoV-2 RBD Spike protein His-tagged and of control His-tagged protein (Ctr-His, 2Rbl7c Nanobody (Vaneycken et al., 2011) His-tagged) [SEQ ID NO: 26] were incubated with DynabeadsTM His-Tag Isolation and Pulldown (Invitrogen), using manufacturer ' s recommended loading capacity according to the molecular weight of protein, for 30 min at 25°C with shaking (800 rpm) in 10 mM phosphate buffer pH 7.4, 300 mM NaCI and 0.01% Tween20.
- washing buffer 10 mM phosphate buffer pH 7.5, 3 mM MgCh and 150 mM NaCI supplemented with O.lmg/mL BSA
- Beads were re-suspended in selection buffer (WB supplemented with 0.1 mg/mL salmon sperm DNA (Invitrogen, USA) and 0.1 mg/mL BSA).
- Selection buffer WB supplemented with 0.1 mg/mL salmon sperm DNA (Invitrogen, USA) and 0.1 mg/mL BSA).
- Library was re-folded in WB prior to incubation with the beads as follows: (1) 90°C for 2 min; (2) 65°C for 5 min; and (3) 37°C and left at RT.
- dsDNA transcription templates for the next selection cycle were generated by polymerase chain reaction (PCR) using the KKfw36 and KKrv36 primers and Phusion High-fidelity DNA Polymerase (Thermo Scientific, Lithuania), followed by BamHi digestion (ThermoSicentific, Lithuania) and dsDNA purification with GeneJET PCR purification kit (ThermoScientific, Lithuania). 2'-F-Y-RNA for subsequent cycles was produced by transcription as detailed above and purified on 8% denaturing polyacrylamide gels.
- the amount of 2'-F-Y RNA was kept constant at 150 pmol (cycles 2-8) while the amount of RBD- protein was decreased during selection from 5 pg (cycle 2), 2 pg (cycle 3), 1 pg (cycle 4) and 0.5 pg (cycles 5-8).
- the protein amount used for counterselection was kept constant at 2 pg from selection cycle 2.
- Incubation time with the counterselection beads was kept at 45 min in all selection cycles, while incubation with target beads was decreased to 15 min in the last selection cycles (from cycle 4). Longer washing steps were performed over the selection in order to increase stringency. From selection cycle 6, an additional counterselection step was introduced after the first counterselection by incubating the non-bound sequences with empty beads for 15 min.
- protein modified beads were prepared as described above using 0.5 pg of control His-tagged protein (2Rbl7c Nanobody) and/or RBD-His or the trimeric stabilised Spike protein his-tagged. Incubation with 20 pmol of 2'-F-Y- RNA libraries or single clones was performed to a final volume of 100 uL of binding buffer for 30 min at RT and shaking at 700 rpm. Three washing steps in WB were performed (0.3 ml_, 1 min) and beads were finally re-suspended in 12 pL of deionized water for reverse transcription as described above. One microliter of the generated cDNA was diluted in 74 pL of water for analysis via qPCR.
- PCR master mix containing lx LightCycler 480 SYBR Green I master mix (Roche, Germany) and 500 nM of KKrv36 and KKfw36 primers [SEQ ID NOs: 21-22].
- Thermal conditions were optimized to 7 min at 95°C followed by 40 cycles of 10 s at 95°C, 20 s at 60°C and 30 s at 72°C. Thermal cycling was performed in a LightCycler 480 (Roche, Germany). Each sample was run in technical triplicates. DeltaCt values were defined as the control protein minus target protein Ct values.
- Proteins were expressed as previously described (Peterhoff et al., 2021) in Expi293 cells (Thermo Fisher Scientific) in different scales using the commercial ExpiFectamineTM system and subjected to affinity purification.
- RBD-PB6 aptamer, truncated and multimerized versions were produced by in vitro transcription as described for the library preparation in the selection of 2 ' -fluoro aptamers section.
- RBD-PB6 aptamer template was generated by PCR amplification using the corresponding template [SEQ ID NO: 20] with KKfw36 and KKrv36 primers [SEQ ID NO: 21 and 22].
- the double-stranded templates, formed by two complementary sequences, of the truncated [SEQ ID NO: 14 and 15] and dimer [SEQ ID NO: 16 and 17] and trimer [SEQ ID NO: 18 and 19] versions of RBD-PB6 aptamer were produced by annealing of the two complementary DNA strands.
- Biolayer interferometry (BLI) binding experiments were performed in an Octet RED96 equipment (ForteBio) and analyzed using either the instrument ' s software or Prism (GraphPad Prism 5.0) software. Binding sensorgrams were aligned to dissociation and following subtraction of the reference well/sample, and globally fit to a 1: 1 binding model. For these binding kinetic experiments, 96 well plates (black, flat bottom, Greiner) were used. In general, orbital shake speed of 700 or 1000 rpm were used for BLI experiments.
- aptamer binding assays For aptamer binding assays, different His-tagged spike protein constructs were diluted in binding buffer (10 mM phosphate buffer pH 7.5, 150 mM NaCI and 3 mM MgCb with 0.1% BSA and 0.05% TWEEN-20) at 2.5 pg/mL concentration and immobilized onto a Ni-NTA-coated biosensors (OCTET Ni-NTA (NTA) Biosensors, Sartorius).
- binding buffer 10 mM phosphate buffer pH 7.5, 150 mM NaCI and 3 mM MgCb with 0.1% BSA and 0.05% TWEEN-20
- the binding kinetics were recorded as follows: eight aptamer-loaded sensors were dipped in 1/3 serial dilutions of Spike protein (stabilized trimeric protein with a C-tag provided by ExpreS2ion Biotechnologies, Denmark) for 400 seconds during the association step. For the multimerized aptamers (dimer and trimer), the highest concentration started at 16 nM whereas for the monomeric RBD-PB6 Ta, the highest concentration was 150 nM. Then, the sensors were moved to only buffer for 1200 seconds (dissociation step). Regeneration was achieved by doing 3 cycles of consecutive steps, first dipping into phosphoric acid (500 mM) and then into binding buffer during 5 s each.
- aptamer-loaded sensors were dipped again in freshly prepared serial dilutions of Spike protein for another binding measurement (including association and dissociation steps).
- Fc tagged ACE2 protein ((19-740) expressed in CHO, The Native Antigen Company, UK) at 2.5 pg/mL concentration in binding buffer was captured on a protein G-coated sensor (OCTET ProteinG (ProG) Biosensors, Sartorius) for 300 seconds or until 0.5 nm response was reached.
- RBD [SEQ ID NO:25], RBD SA variant (AcroBiosystems, USA; cat no: SPD-C52Hp), SI British variant (SinoBiological, China, cat no: 40591-V08H12) and Spike (ExpreS2ion Biotechnologies, Denmark, cat no: S2-46A-001) proteins were used as ligands at fixed concentrations of 50, 25 nM or 0.5 nM, respectively.
- the different aptamer constructs (full-length, truncated and multimerized versions) were previously folded as described above and incubated at different concentrations with these proteins for 20 min at RT.
- the octet protocol consisted in dipping the ACE2-loaded sensors first in binding buffer for 60 s (baseline), then in different solutions of RBD or Spike protein plus aptamer for 150 s or 600 s, respectively (association) and finally in binding buffer again (dissociation) for 150 s or 600 s (for RBD or Spike, respectively). Regeneration was achieved by doing 3 cycles of consecutive steps, first dipping into 10 mM Glycine pH 1.4 and then into binding buffer during 5 s each. The process, including the ACE2 loading, was repeated at different aptamer concentrations.
- FIDA Flow Induced Dispersion Analysis
- Indicator samples were prepared with 25 nM AF488-labeled PB6, RBD-PB6, RBD-PB6-Ta dimer or trimer premixed with either dilution series of RBD (0-2.5 uM) or spike trimer (ExpreS2ion Biotechnologies, Denmark, code no: Stab-Spike-Fd Lot #: PB- 0411) (0-80 nM) in assay buffer (PBS with 3mM MgCh and 0.1% BSA). Analyte samples contained RBD/Spike trimer dilution series only. All samples were analysed using the following procedure.
- the capillary was flushed with assay buffer at 3500 mbar for 120 s and then at 1500 mbar for 20 s. Indicator samples were subsequently applied at 50 mbar for 10 s followed by analyte samples at 400 mbar for 180 s.
- the Taylorgrams were interpreted using the FIDA software suite, version 2.04 (Fida Biosystems ApS, Copenhagen, Denmark) with a Taylorgram fraction setting of 75 %.
- Biotinylation and fluorescence labeling of aptamers was performed by 3'-end ribose oxidation using sodium-metaperiodate followed by reaction with Alexa Fluor 488- or EZ-link Biotin-LC-Hydrazide using the standard protocol of the provider (Thermo Fisher Scientific). Cy5-hydrazide was obtained from Lumiprobe.
- Solutions containing the spike protein and aptamers were prepared in imaging buffer consisting of 100 mM NaCI, 3 mM MgCh and 10 mM phosphate buffer (pH 7.4).
- the PEG passivated sample chamber was first incubated with a solution of 1% w/v Tween-20 for ten minutes (Chandrados et al., 2014), then with a solution of 0.1 mg/ml_ streptavidin linker protein (Invitrogen) for seven minutes to immobilize single biotinylated spike proteins. After each step, the sample chamber was flushed with surface passivating buffer consisting of 0.2 % w/v Tween-20 and 0.5% w/v BSA in imaging buffer.
- the sample chamber was incubated with 100 pM of spike protein for 10 min and free protein was washed away with surface passivating buffer. Finally, 1 nM of Cy5 labelled aptamer was added just before measurements.
- the solution containing the aptamer also included an oxygen scavenging system (17 U/mL glucose oxidase, 4.5 mg/ml_ glucose, and 260 U/mL catalase) to prevent photobleaching as well as 2 mM of the triplet quenching reagent Trolox (Sigma Aldrich) to minimize photoblinking.
- an oxygen scavenging system 17 U/mL glucose oxidase, 4.5 mg/ml_ glucose, and 260 U/mL catalase
- Fluorescence movies 10 minutes long were taken with frames of 100 ms using excitation with a 640 nm laser totally internally reflected at the glass-water interface where the spike proteins were immobilized.
- the laser power was set to ⁇ 8.5 mW to minimize photobleaching.
- VLPs oseudotvoed virion like particles
- VLPs pseudotyped with spike protein of MERS-CoV, SARS-CoV-1 and SARS-CoV-2 were used to assess aptamer specificity.
- HEK293T cells were seeded at density of 50.000 cells/cm 2 .
- VLPs were incubated with an aptamer of interest for 90 min at RT prior to transduction.
- SARS-CoV-2 Westphalode
- FR-4286 was propagated in VeroE6 expressing cells expressing human TMPRSS2 (VeroE6-hTMPRSS2) with a multiplicity of infection (MOI) of 0.05.
- Supernatant containing new virus progeny was harvested 72h post infection, and concentrated on lOOkDa Amicon ultrafiltration columns (Merck) by centrifugation for 30 minutes at 4000 g.
- Virus titer was determined by TCID50% assay and calculated by Reed-Muench method.
- Aptamer were prepared in serial dilutions in DMEM (Gibco) + 2% FCS (Sigma-Aldrich) + 1% Pen/Strep (Gibco) + L-Glutamine (Sigma-Aldrich)+ 3 mM MgCh were mixed with SARS-CoV-2 at a final titer of 100 TCID50/well, and incubated at RT for 1.5hr. A "no aptamer” and a "no virus” (uninfected) control samples were included.
- the virus:aptamer mixtures were added to 2 x 10 4 Vero E6 TMPRSS2 cells seeded in flat-bottom 96-well plates, and incubated for 12h in a humidified CO2 incubator at 37 °C, 5% CO2, before washing off the cells and re-incubated for 60h.
- the cells were fixed with 5% formalin (Sigma-Aldrich) and staining with crystal violet solution (Sigma- Aldrich).
- the plates were read using a light microscope (Leica DMil) with camera (Leica MC170 HD) at 4x magnification, and cytopathic effect (CPE) scored.
- biotin-complementary oligo Biotin-TEG (tetraethyleneglycol)-CCCGACACCCGCGGATC; SEQ ID NO: 28).
- the biotinylated aptamer RBD- PB-6_ext was diluted in PB with 0.5% BSA and 0.05% tween-20 and mixed with 5 mI_ gold conjugated detection antibody (antibody 40150-D006; RRID Number: AB_2827985, SinoBiological, China) to a final aptamer concentration of 300 nM.
- 40 nm gold nanoparticles Bioporto CAT NO: NGIB18-3 was conjugated to the antibody following the manufacturer ' s protocol.
- Recombinant omnicron SI (SinoBiological, cat no: 40591-V08H41) was prepared as live SARS-CoV-2 samples.
- the strip (gRAD OneDetection Strip, Bioporto), which comprises a biotin-binding protein at the test line and an anti-rabbit/anti-mouse/anti-goat capturing molecule at the control line, was dipped into a final 100 pL solution.
- the aptamer-virus-gold conjugated antibody complex will flow through the test, and control lines due to capillary force. After 10-15 minutes, the test line is revealed and a color change can be observed in the presence of analyte.
- Colorimetric signal was measured in a plate reader at 450 nm. Limit of detection (LoD) was defined as background + 3*sd (standard deviations).
- PEGylation of aptamers was performed by 3'-end ribose oxidation using sodium- metaperiodate followed by reaction with PEG20-Hydrazide (Creative PEGworks) using the standard protocol of the provider.
- mice were kept in groups of 4-5 mice per cage.
- RBD-PB6 aptamer and variants were administered through I.V. tail vein (n > 3 for each injection).
- Blood samples were drawn from the tail of each animal at different time points over 24 h using Microvette 300 tubes (Sarstedt). The blood serum was collected by centrifugation of the tubes for 5 min at 10,000 g. One pL of serum was mixed with 9 mI PBS and 1 pL of the mixture was used for reverse transcription to generate the cDNA using the primer alrev and Superscript III (Invitrogen, USA) following the manufacturer protocol. Afterwards, the samples were quantified by qPCR. To that end, 3 pL of the generated cDNA were diluted in 12 pL of water for analysis via qPCR.
- the aim of the present study is to select and identify new aptamers targeting the receptor-binding domain of SARS-CoV-2 spike protein that recognizes the ACE2 receptor.
- RNA library For the aptamer selection, we targeted the receptor binding domain (RBD) of SARS-CoV-2 spike protein that recognizes the ACE2 receptor.
- RBD receptor binding domain
- RNA bound to the beads was subjected to reverse transcription (RT) and PCR amplification.
- a counterselection step was introduced in all cycles to avoid unspecific binders using a control His-tagged protein, and an additional counterselection step with empty Ni-NTA beads was included from the sixth selection cycle.
- Iterative cycles of selection reducing the amount of protein and RNA, as well as the incubation time, yielded enrichment of different clones in the library.
- Sequencing data show that several clones (RBD-PB-0, -1 and -5) dominated the library pool in earlier selection cycles, representing up to 50-60% of the total amount of sequences.
- selection cycle 6 the frequency of earlier enriched sequences drastically decreased, leading to the enrichment of two other predominant clones.
- RBD-PB6 and RBD-PB7 displayed a prominent amplification in the last selection cycles and were strongly enriched, representing more than 90% of the library in cycle 8.
- the aptamer RBD-PB6 was identified as a candidate for targeting RBD and the trimer spike protein.
- Example 3 RBD-PB6 binds with high affinity to SARS-CoV-2 spike protein and blocks its interaction with ACE2
- the aim of the present invention was to study the binding of the aptamer RBD- PB6 and truncated versions hereof to SARS-CoV-2.
- RBD-PB6 The binding of RBD-PB6 to different SARS-CoV-2 spike constructs was assayed by Biolayer interferometry (BLI) and Flow Induced Dispersion Analysis (FIDA) (Fig 2).
- BLI Biolayer interferometry
- FIDA Flow Induced Dispersion Analysis
- Fig 2 To determine the binding affinity of RBD-PB6 to spike protein by BLI, we immobilised His-tagged RBD (SEQ ID NO: 25), spike-Sl (amino acids Vall6- Arg685 of SEQ ID NO: 13), full-length spike (SEQ ID NO: 13) or trimeric spike proteins on Ni-NTA functionalized sensors and tested with increasing concentrations of RBD-PB6.
- RNA aptamer that binds with high affinity and selectivity to both the RBD alone and the whole spike protein of SARS- CoV-2. Binding affinities were characterized by both surface and solution biophysical techniques. The experimentally determined size of the individual species assessed by FIDA matches the theoretical values. The relatively small increment in size observed upon aptamer binding suggests that RBD-PB6 establishes multiple interactions with spike protein in agreement with a tightly assembled complex.
- RBD-PB6 blocked the interaction between SARS-CoV-2 spike protein and host receptor ACE2 and prevented viral entry in cells, suggesting that the RBD-PB6 and ACE2 binding sites on spike overlap.
- RBD-PB6 binds to a binding site on RBD overlapping with the binding site for ACE2.
- Truncation of the RBD-PB6 to some extent could be performed without the loss of binding affinity. However, further truncation lead to loss of binding affinity.
- RBD-PB6 To study the ability of RBD-PB6 to neutralise viral-like particles pseudotyped with spike protein from SARS-CoV-2, SARS-CoV-1 and MERS.
- VLPs viral-like particles
- the target cells (HEK293 cells transfected with plasmids expressing human ACE2 and TMPRSS2) were incubated for 36-48h with SARS-CoV-2 VLPs and varying amounts of RBD-PB6, RBD-PB6-Ta and a control aptamer. Subsequently, cells were washed and cultured for 3 days. Fluorescence microscopy shows that increasing concentrations of the aptamer considerably reduce the EGFP signal, indicating that RBD-PB6 efficiently blocks viral uptake (data not shown). The fluorescent signal was quantified by flow cytometry, which yielded IC50 values of 200 nM and 140 nM for RBD-PB6 and RBD-PB6-Ta, respectively (Figure 7A).
- RBD-PB6-Ta neutralized VLPs expressing the G614D spike variant, associated with increased viral infectivity (Korber et al., 2020), slightly more efficiently than the wt strain, with an IC50 value of 110 nM ( Figure 7A, grey curve).
- the data demonstrates the aptamers RBD-PB6 and RBD-PB6-Ta are highly specific towards SARS-CoV-2.
- the RNA aptamer is specific to SARS-CoV-2 and does not bind SARS-CoV-1 and MERS coronavirus.
- aptamers RBD-PB6 and RBD-PB6-Ta are able to neutralize VLPs expressing both SARS-CoV-2 wt spike protein as well as the G614D spike variant.
- the SARS-CoV-2 spike protein adopts a trimeric structure in the viral envelope and we therefore investigated if multimerization of RBD-PB6 could further enhance binding trimeric spike protein.
- RNA aptamers bearing 2 ' -fluoro modifications at the pyrimidines are known to be more stable than unmodified RNA and DNA aptamers.
- Visualization of the degradation by PAGE gel revealed that the aptamer constructs remained largely intact for up to 24h in media supplemented with FCS ( Figure 11) with a half-life of ⁇ 50h, and up to 4 days in phosphate buffer. This contrasts non-modified RNA aptamers that are degraded in serum within minutes (data not shown). Together with the infectivity inhibition studies, these results indicate that the aptamers used here are functional for extended times in serum.
- the dimeric aptamer showed an about 10 times lower effect with IC50 values of 387 nM whereas the monomeric aptamer, RBD-PB6 Ta, further declined the neutralizing activity about 10 times to an IC50 of ⁇ 1.5-5 mM.
- Multimerization of the aptamer to dimeric and trimeric forms resulted in an approximately 10-fold and 100-fold stronger binding affinity, respectively, mirrored by increased inhibitory effect on SARS-CoV-2 infection, with IC50 values in the low nanomolar range.
- Example 6 RBD-PB6 binds with high affinity to the B.1.1.7 and B.1.351 variants of SARS-CoV-2 spike protein
- SARS-CoV-2 virus has emerged and are circulating globally. These variants carry mutations in the spike protein associated with increased transmission, thus leading to an increase in COVID-19 cases. In addition, some of these variants contain mutations that could hamper immune detection and weaken antibody-based therapies and vaccine efficiency.
- RBD-PB6 and RBD-PB6-Ta also inhibit binding between RBD-B.1.315 and ACE2 with IC50 values of 577 and 556 nM, respectively.
- RBD-PB6 showed high affinity towards spike proteins from the new viral lineages B.1.1.7 and B.1.351, illustrating that the mutations present in the spike proteins of these variants do not affect RBD-PB6 binding. Thus, these data demonstrates that the current and most prevalent mutations on the spike protein do not affect recognition by RBD-PB6.
- Example 7 RBD-PB6 detection of SARS-CoV-2 in a lateral flow strip assay
- FIG. 13A demonstrates a potential method for detection of SARS-CoV-2 using aptamers according to the present invention.
- a biotinylated aptamer 1 is mixed with gold nanoparticles(NPs)-antibodies 3 in a vial 5 prior to adding a sample 7 potentially comprising SARS-CoV-2. After incubation, the mixture 9 is added to a lateral flow strip 11 e.g. by arranging the lateral flow strip 11 in the mixture 9.
- the mixture flows downstream 13 the lateral flow strip 11 and after a certain period the result can be read on the lateral flow strip 11 at the test line 15 and control line 17.
- Figure 13B shows a lateral flow strip 11 with the area for sample loading 19 comprising SARS-CoV-2 21, gold NPs-antibodies 3 and biotinylated aptamer 1.
- biotinylated aptamer 1 and the gold NPs-antibodies 3 are bound to SARS- CoV-2 21 prior to loading the mixture 9 onto the lateral flow strip 11.
- the biotinylated aptamers 1 will be captured at the test line 15 by a biotin binding protein and gold NPs-antibodies 3 will be captured at the control line 17 by a capturing antibody 23. If SARS-CoV-2 is present in the mixture these will be bound together with the aptamers at the test line 15 and can then be identified by the gold-labelled NPs- antibodies 3.
- control line 17 the capturing antibody 23 will bind to the gold NPs- antibodies 3 no matter whether SARS-CoV-2 21 is present or not.
- the control line 17 is used to indicate whether the flow on the lateral flow strip 11 has been satisfactory and the release from the sample loading section sufficient.
- Figure 13C shows the use of lateral flow strips, the principle of which was described above ( Figures 13A+B).
- Figures 13A+B Four different viral titers from low pM to low fM concentration were incubated on four strips (LFA-1: 10*6 particles/mL; LFA-2: 10*5 particles/mL; LFA-3: 10*4 particles/mL; LFA-4: 10*3 particles/mL).
- Figure 13C shows that the aptamer-based LFA allows detection of low amounts of live SARS-CoV-2 virus (B.1.1.7 variant) as demonstrated by a visible test line 15.
- the control line 17 is shown on all of the four lateral flow strips showing the reliability of the test.
- Figure 13D shows the optical readout of the lateral flow strips where the absorbance signal was quantified from the test line (averaged to the control line) at the different viral concentrations. A reliable optical readout is demonstrated down to 1.5*10 5 virus/mL (i.e. particles/mL).
- kits comprising a lateral flow strip and aptamers according to the present invention would allow testing of samples to identify presence of SARS-CoV-2 in a simple and efficient manner, which would also detect emerging variants of the SARS-CoV-2.
- Example 8 RBD-PB6 detection of SARS-CoV-2 using ELISA
- An enzyme-linked immunosorbent sandwich assay was designed using capture antibodies - either binding to the S2 domain or to a non-overlapping epitope for the aptamer in the SI domain- in combination with the RBD-PB6 aptamer.
- the aptamer was modified with an oligonucleotide extension in the 3 to allow its hybridization with a complementary biotinylated oligonucleotide that binds to the streptavidin-HRP conjugate.
- the sandwich complex In presence of Spike protein, the sandwich complex is formed and by addition of the TMB substrate, a colorimetric response dependent on the Spike protein concentration is used as read-out. As shown in Fig 14, the signal intensity follows a sigmoidal dependent curve at different Spike protein concentrations, with a limit of detection (LoD) lower than 20 pM of Spike protein.
- LiD limit of detection
- I.V. intravenous injections in mice were performed and blood samples were drawn over 24h.
- trimeric aptamer functionalized with PEG20 clearly shows longer circulation times than the unmodified trimeric RBD-PB6 Ta aptamer.
- the aptamer modified at the 3 ' end with a PEG20 shows slower clearance. Similar results were obtained when using PEG40 or palmitoyl groups (data not shown).
- RBD-PB6 aptamer was found to bind strongly (more intense band in the test line, almost no gold-Ab complex is observed in the control line; data not shown) to recombinant omicron SI his tagged protein at a low nanomolar concentration (7 nM of SI omicron protein).
- the sandwich detection platform based on the RBD-PB6 aptamer (biotinylated) and a complementary antibody (antibody 40150-D006; RRID Number: AB_2827985, SinoBiological, China) was implemented in a lateral flow assay (LFA) to compare its detection sensitivity to Omicron (BA.l) versus the alpha (B.1.1.7) and delta (B.1.617 ) variants.
- LFA lateral flow assay
- Figure 16 shows that the aptamer-based LFA allows detection of low amounts of live SARS-CoV-2 virus (omicron variant) with a reliable optical readout down to 7.5E+04 pfu/mL ( Figure 2A). Compared to other variants, the aptamer loses sensitivity against the omicron variant (Limit of detection (LoD): Alpha: ca. 1.5E+03 pfu/mL; Delta: ca. 6.0E+03 pfu/mL). An illustration of the LFAs at different titers are shown in Figure 2B. The control line 17 is visible for all of the LFAs, while the intensity of the test line 15 depends on the titer.
- Limit of detection Limit of detection (LoD): Alpha: ca. 1.5E+03 pfu/mL; Delta: ca. 6.0E+03 pfu/mL).
- RBD-PB6 aptamer can be used for detecting new SARS-CoV-2 variants such as Omicron (BA.l).
- the LoDs observed in the LFA experiments are above the average amount of virus found in nasopharyngeal swabs (1.6E+04 viral load/test; i.e. around 1.1E+05 viral load/mL),thus indicating that RBD-PB6 aptamer can be potentially employed in the described LFA platform for detection of currently circulating SARS-CoV-2 variants.
- Kenan DJ, Keene JD. In Vitro Selection of Aptamers from RNA Libraries. In: Haynes SR f editor. RNA-Protein Interaction Protocols. Totowa, NJ: Humana Press; 1999. p. 217-31.
- RBD-PB6a-Sl SEQ ID NO: 1 RBD-PB6a-Sl SEQ ID NO: 2 RBD-PB6-Ta SEQ ID NO: 3 RBD-PB6 SEQ ID NO: 4 RBD-PB6a-s2 SEQ ID NO: 5 RBD-PB6a-s3 SEQ ID NO: 6 RBD-PB6-Tb SEQ ID NO: 7 RBD-PB6-TC SEQ ID NO: 8 RBD-PB6-Td SEQ ID NO: 9 RBD-PB6-Tinv (used interchangeably with RBD-PB6-Ta_inv) SEQ ID NO: 10 RBD-PB6a-extl SEQ ID NO: 11 RBD-PB6a-ext2 SEQ ID NO: 12 RBD-PB6a-ext3 SEQ ID NO: 13 Spike protein wt SARS-CoV-2 SEQ ID NO: 14 RBD-PB6a template SEQ ID NO: 15 RBD-PB6a_C template (complementary strand) SEQ ID NO
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to an RNA aptamer comprising a sequence having at least 80% sequence identity to SEQ ID NO: 1 for targeting RBD of the spike protein of SARS-CoV-2 virus as well as multimeric RNA aptamers. The invention furthermore relates to the RNA aptamer and/or multimeric RNA aptamers for use in preventing, alleviating and/or treating infection with SARS-CoV-2 or variants thereof. In addition, an in vitro use of the RNA aptamer and/or multimeric RNA aptamer in a detection assay is described along with a detection device and a kit of parts for detecting or quantifying SARS-CoV-2 or variants thereof comprising at least one RNA aptamer and/or at least one multimeric RNA aptamer; and a detection device arranged for capturing said RNA aptamer and/or said multimeric RNA aptamer.
Description
SARS-COV-2 SPECIFIC APTAMER
Technical field of the invention
The present invention relates generally to medicine and the use of aptamers. The present invention specifically relates to novel aptamers that bind to the Spike protein of SARS-CoV-2.
Background of the invention
The Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) pandemic in 2020-2021 has launched a global quest to find new molecular tools for the detection and treatment of the disease. Despite the exceptional efforts worldwide for contingency and unprecedented technological progress in vaccine development, the challenge to find an effective cure remains due to the limited access to SARS-CoV-2 vaccines, particularly in developing countries, and the emergence of new viral strains that can evade immune responses and potentially compromise the efficacy of current vaccines.
Like other coronaviruses, SARS-CoV-2 expresses a surface spike (S) glycoprotein, which is composed of two domains (SI and S2) and forms a trimeric structure capable of interacting with human cells. In particular, the receptor binding domain (RBD) located on the SI subunit of the spike protein binds with high affinity to human angiotensin-converting enzyme-2 (ACE2) and in conjunction with the associated transmembrane protease, serine 2 (TMPRSS2) facilitate viral uptake. Efforts to neutralize viral activity and replication have therefore mainly focused on inhibiting the Spike-ACE2 interaction. Antibodies (Abs) have been developed and are currently used for SARS-CoV-2 detection and some, primarily those targeting RBD, show promise as therapeutic candidates due to their potent neutralizing effect. However, the high costs of antibody production, the use of animals and their poor stability at ambient temperatures remain a disadvantage. Moreover, Ab immunogenicity and the risk of antibody-dependent enhancement (ADE) of infection associated with Fc-containing Abs limit their therapeutic potential.
VHH antibodies or nanobodies raised to the spike protein may overcome some of these drawbacks but are more prone to immunological response. Interesting alternatives such as de novo proteins based on the host ACE2 receptor and other synthetic molecules have been investigated and may, if potential immunogenicity and stability problems are solved, help develop affordable and efficient detection methods and drugs.
Nucleic acid-based aptamers have gained increased attention as alternatives to antibodies due to their ease of production, low immunogencity, high thermal and chemical stability and smaller size, but still with comparable target binding and specificity. Aptamers are short single-stranded oligonucleotides, developed through an in vitro selection process termed SELEX (Systematic Evolution of Ligands by Exponential enrichment), that bind with high affinity and selectivity to cognate targets. During the last decades, a wide variety of aptamers binding to diverse biologically relevant targets, including viruses, have been identified. However, selection of aptamers targeting spike protein has proven difficult. An explanation for this may be that highly glycosylated proteins such as SARS-CoV-2 spike are challenging to target with nucleic acid-based binders. Indeed, to date there are only two reports on DNA aptamers targeting SARS-CoV-2 spike where the authors report leading aptamers with affinities in the nanomolar range (Song et al., 2020, Schmitz et al., 2020). However, none of these studies demonstrates efficient neutralisation of the SARS-CoV-2.
Hence, improved aptamers targeting SARS-CoV-2 and preventing binding to the ACE2 would be advantageous, and in particular a more efficient and/or stable neutralisation of SARS-CoV-2 would be advantageous.
Summary of the invention
The present invention relates to novel aptamers targeting the RBD on the spike protein of SARS-CoV-2 and hereby, to prevent binding to the ACE2 and efficiently neutralise SARS-CoV-2. These aptamers are RNA aptamers and have different sequences compared to other aptamers targeting the spike protein of SARS-CoV- 2.
Thus, an object of the present invention relates to the provision of aptamers for preventing binding to ACE2. In particular, it is an object of the present invention to provide aptamers capable of an efficient and stable neutralisation of SARS-CoV- 2.
Thus, one aspect of the invention relates to an RNA aptamer, which prevents binding of the RBD and/or spike protein to ACE2, comprising a sequence having at least 80% sequence identity, such as at least 90% sequence identity to SEQ ID NO: 1.
Another aspect of the present invention relates to a multimeric RNA aptamer comprising at least two RNA aptamers as described herein.
An even further aspect of the present invention relates to an RNA aptamer as described herein and/or a multimeric RNA aptamer as described herein and/or a composition as described herein and/or a pharmaceutical composition as described herein for use as a medicament.
Still a further aspect of the present invention relates to an RNA aptamer as described herein and/or a multimeric RNA aptamer as described herein for use in preventing, alleviating and/or treating infection with SARS-CoV-2 or variants thereof.
A further aspect of the present invention relates to in vitro use of an RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein in a detection assay for detecting and/or quantifying SARS-CoV-2 or variants thereof.
Still another aspect of the present invention is to provide a detection device, adapted for detecting SARS-CoV-2 or variants thereof, comprising at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein.
An even further aspect of the present invention is to provide a kit of parts for detecting or quantifying SARS-CoV-2 or variants thereof comprising
- at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein;
- a detection device arranged for capturing said RNA aptamer and/or said multimeric RNA aptamer;
- optionally, one or more reagents;
- optionally, instructions for using the kit of parts for detecting or quantifying SARS-CoV-2 or variants thereof.
Brief description of the figures
Figure 1 shows selection of an RNA aptamer binding to RBD. A) qPCR binding assay of 5 selected clones to RBD and spike protein functionalized magnetic beads. DeltaCt values are calculated by subtracting the cycle threshold (Ct) obtained from the pull down assays using beads functionalized with either RBD or the full spike protein to control protein beads (Ct(target)-Ct(control)). B) Secondary structure prediction of RBD-PB6 aptamer using NUPACK.
Figure 2 shows RBD-PB6 binding to RBD and inhibiting its interaction with ACE2.
A) Biolayer interferometry (BLI) of RBD-PB6 (in solution) binding to RBD (immobilized). RBD-PB6 is diluted in 1/2 dilution steps starting from 500 nM (thin lines indicate fitting model). B) Flow Induced Dispersion Analysis (FIDA) experiments showing the increase in hydrodynamic radius in solution upon binding of the RBD to the fluorescently labelled RBD-PB6 (black line indicates fitting model). C) Characteristic wavelength shifts recorded in the competition assays. ACE2 is previously immobilized on the sensor surface. Then, the sensor is dipped on a solution of RBD pre-incubated with increasing concentrations of RBD-PB6 (binding phase) and subsequently dipped on buffer for washing (dissociation phase). D) Fitted data shows the signal decay at increasing amounts of aptamer, that was used to determine IC50 values.
Figure 3 shows RBD-PB6 recognising spike protein in a tag-independent manner. A) BLI response of RBD-PB6 and RBD-PB6 Ta immobilized on the surface and incubated with different spike protein constructs: RBD-His (90 nM, black), Sl-His (75 nM), spike ctag (150 nM), spike trimer-His (50 nM), nanobody (negative control, 250 nM). B) BLI response of a previously reported DNA aptamer (CoV-2-
RBD-1C) (Song et al., 2020) immobilized on the surface and incubated with different spike protein constructs: RBD-His (125 nM, black), Sl-His (80 nM), spike ctag (150 nM), spike trimer-His (50 nM), nanobody (negative control, 200 nM).
Figure 4 shows Flow-Induced Dispersion Analysis (FIDA) determining complex formation and size. FIDA experiments showing the increase in hydrodynamic radius in solution upon binding of the RBD to the fluorescently labelled RBD-PB6 (black line indicates fitting 1: 1 model used). The experiment was performed in triplicates (A, B and C, respectively) yielding an average KD of ~129 nM.
Figure 5 shows RBD-PB6 truncated constructs. NUPACK analysis of secondary structures of each truncated aptamer version.
Figure 6 shows BLI competition screening experiment of the different truncated versions of RBD-PB6. Competition experiments between RBD and ACE2 was performed using 50 nM RBD-ctag and 1000 nM of each truncated aptamer.
Figure 7 shows VLP neutralization experiments with SARS-CoV-1 and SARS-CoV- 2. A) Flow cytometry analysis of the fluorescence signal for SARS-CoV-2 and B) SARS-CoV-1 transduction.
Figure 8 shows that RBD-PB6 does not block infection by MERS-pseudotyped VLPs in cell culture. VLP neutralization control experiment with MERS pseudotyped virus and RBD-PB6 (circle), RBD-PB6-Ta (square) and RBD-3 (negative control, triangle).
Figure 9 shows that multivalency enhances aptamer binding and viral neutralization efficiency. A) Histogram shows fluorescence intensity originating from multiple binding events of RBD-PB6 aptamers on trimeric spike. B) FIDA binding experiments show superior affinity of trimeric and dimeric aptamers for spike protein. Picomolar affinities for the multimerized aptamers were assessed by BLI. C) Neutralization plaque assay with SARS-CoV-2 virus on VeroE6 cells.
Figure 10 shows screening for the optimal spacer length for RBD-PB6 multimerization. A) BLI competition experiments showing the percentage of
binding inhibition between ACE2 and spike protein (trimer at 7.5 nM) with the different dimeric constructs at 100 nM. The numbering corresponds to the number of adenosines spacing each of the aptamer domains. B) Schematic representation of the dimeric scaffolding used for these screening experiments.
Figure 11 shows time course experiments of aptamer degradation in serum- containing medium. Monomer, dimer and trimer aptamer incubated in DMEM+10% FCS at 37°C at different time points showed half-life values of 51 h, 48 h and 132 h, respectively.
Figure 12 shows RBD-PB6 binds to the new variants of SARS-CoV-2 spike protein. BLI competition experiment between ACE2 and the B.1.351 RBD variant with increasing concentrations of RBD-PB6 and RBD-PB6-Ta.
Figure 13 shows RBD-PB6 for detection of SARS-CoV-2 in a lateral flow assay. A) demonstrates a method of detecting SARS-CoV-2 in a sample. B) demonstrates the functioning of a lateral flow strip. C) shows lateral flow strips after incubation with different viral titers (LFA-1: 10*6 particles/mL; LFA-2: 10*5 particles/mL; LFA-3: 10*4 particles/mL; LFA-4: 10*3 particles/mL) of SARS-CoV-2 virus (B.1.1.7 variant). D) shows quantification of the absorbance signal from the test line (averaged to the control line) at different viral concentrations.
Figure 14 shows an ELISA assay using a sandwich format with a capture antibody and RBD-PB6 aptamer for detection of purified trimeric spike protein. LoD < 20 pM for Spike protein.
Figure 15 shows pharmacokinetic studies with RBD-PB6 trimer with and without PEGylation demonstrating an approx. 10-fold increase in the circulation time of the pegylated trimeric aptamer compared to the non pegylated after IV injection in mice. The aptamer modified at the 3 'end with a PEG20 shows slower clearance.
Figure 16 shows lateral flow assay (LFA) studies with live SARS-CoV-2 virus using lateral flow strips. A) shows optical read-out at different viral titers for the alpha
(UK), delta and omicron variants. B) illustrates images of the LFA at different viral titers. The present invention will now be described in more detail in the following.
Detailed description of the invention
Definitions
Prior to discussing the present invention in further details, the following terms and conventions will first be defined:
Aptamer
In the present context, the term "aptamer", refers to oligonucleotides that resembles antibodies in their ability to act as ligands and bind to analytes. Aptamers may in general e.g. comprise natural DNA nucleotides, natural RNA nucleotides, modified DNA nucleotides, modified RNA nucleotides, or a combination thereof. In the present invention, RNA aptamers are used which may comprise one or more modifications. Examples of modifications are artificial nucleotides or artificial bonds selected from the group consisting of 2'-F- pyrimidine, 2'-NH2-pyrimidine, 2'-0-Me, LNA (locked nucleic acid), 4'-S, TNA (threose nucleic acid), FANA (fluoroarabinonucleotide) and HNA (1,5- anhydrohexitol nucleic acid).
An advantage of aptamers compared to antibodies is that they may easily be sequenced and amplified after isolation.
Multimeric aptamer
In the present context, the term "multimeric aptamer", refers to two or more aptamers connected forming a row of aptamers capable of binding RBD. The individual aptamers may in one embodiment be linked via a linker. Alternatively the individual aptamers are connected directly without a linker.
The sequence of the individual aptamers in the multimeric aptamer may be identical or may be different. In one embodiment, the sequence of the aptamers
in the multimeric aptamer is identical. In a further embodiment, the sequence of the aptamers is similar but may comprise a different degree of artificial nucleotides.
Linker
In the present context, the term "linker", refers to a molecule that joins two aptamers, either covalently, or through ionic, van der Waals or hydrogen bonds.
In one embodiment, the linker is covalently binding to two aptamers.
Connection linker
In the present context, the term "connection linker", refers to a linker, which connects groups of aptamers such as groups comprising three aptamers. In one embodiment, the three aptamers are connected by a linker of a certain length forming a trimer. This trimer is then connected to another trimer by a connection linker. The connection linker may be longer, shorter or of similar length as the linker, preferably the connection linker is longer.
Sequence identity
In the present context, the term "sequence identity", refers to the sequence identity between genes or proteins at the nucleotide, base or amino acid level, respectively. Specifically, a DNA and a RNA sequence are considered identical if the transcript of the DNA sequence can be transcribed to the identical RNA sequence.
Thus, in the present context "sequence identity" is a measure of identity between proteins at the amino acid level and a measure of identity between nucleic acids at nucleotide level. The protein sequence identity may be determined by comparing the amino acid sequence in a given position in each sequence when the sequences are aligned. Similarly, the nucleic acid sequence identity may be determined by comparing the nucleotide sequence in a given position in each sequence when the sequences are aligned.
To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide
positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of positions (e.g., overlapping positions) x 100). In one embodiment, the two sequences are the same length.
In another embodiment, the two sequences are of different length and gaps are seen as different positions. One may manually align the sequences and count the number of identical amino acids. Alternatively, alignment of two sequences for the determination of percent identity may be accomplished using a mathematical algorithm. Such an algorithm is incorporated into the NBLAST and XB1_AST programs of (Altschul et al. 1990). B1_AST nucleotide searches may be performed with the NBLAST program, score = 100, wordlength = 12, to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. BLAST protein searches may be performed with the XBLAST program, score = 50, wordlength =
3 to obtain amino acid sequences homologous to a protein molecule of the invention.
To obtain gapped alignments for comparison purposes, Gapped BLAST may be utilized. Alternatively, PSI-Blast may be used to perform an iterated search, which detects distant relationships between molecules. When utilising the NBLAST, XBLAST, and Gapped BLAST programs, the default parameters of the respective programs may be used. See http://www.ncbi.nlm.nih.gov. Alternatively, sequence identity may be calculated after the sequences have been aligned e.g. by the BLAST program in the EMBL database (www.ncbi.nlm.gov/cgi-bin/BLAST). Generally, the default settings with respect to e.g. "scoring matrix" and "gap penalty" may be used for alignment. In the context of the present invention, the BLASTN and PSI BLAST default settings may be advantageous.
The percent identity between two sequences may be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted. An embodiment of the present invention thus relates to sequences of the present invention that has some degree of sequence variation.
Substitution
In the present context, the term "substitution", refers to the replacement of one nucleotide in the RNA aptamer with a different nucleotide. Nucleotides/artificial nucleotides
In the present context, the term "nucleotides/artificial nucleotides", refers to the natural nucleotides being adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U) and artificial nucleotides, which are natural nucleotides that have been chemically modified in order to obtain other characteristics such as better stability.
Artificial bonds
In the present context, the term "artificial bonds", refers to bonds between nucleotides, which are not naturally occurring but which arises due to the presence of artificial nucleotides, and potential additional bonds that these would give rise to.
KD
In the present context, the term "KD", refers to the equilibrium dissociation constant between the aptamer and the RBD/Spike protein. It is inversely related to affinity. The value relates to the concentration of aptamer needed by a lower value i.e. lower concentration is equal to a higher affinity of the antibody.
IC50 In the present context, the term "IC50", refers to half maximal inhibitory concentration. This is a measure of the potency of a substance in inhibiting a specific biological or biochemical function. It is a quantitative measure that indicates how much of the particular compound is needed to inhibit a given biological process or biological component by 50%, when measured in vivo or in vitro.
Spike protein
In the present context, the term "Spike protein", refers to a glycoprotein that protrudes from the envelope of e.g. coronavirus. The spike protein facilitates
entry of the virion into a host cell by binding to a receptor on the surface of a host cell. This is followed by fusion of the viral and host cell membranes.
In the present application, wild-type SARS-CoV-2 spike protein is considered to have the sequence according to SEQ ID NO: 13.
RBD
In the present context, the term "RBD" or "receptor-binding domain", refers to a short immunogenic fragment from a virus that binds to a specific endogenous receptor sequence to gain entry into host cells.
In the present application, wild-type SARS-CoV-2 RBD domain relates to SEQ ID NO: 25, which is amino acids 319-532 of SEQ ID NO: 13.
Modification
In the present context, the term "modification", refers to the addition of compound, which is not an oligonucleotide to the aptamer and/or multimeric aptamer in order to modify the biological characteristics/abilities of the aptamer and/or multimeric aptamer such as better pharmacokinetics and/or biodistribution.
The compounds used for the modification may be any compound as known to the persons skilled in the art such as PEG, albumin, palmitoyl and/or cholesterol. In one embodiment, PEG is PEG20 or PEG40.
Vector
In the present context, the term "Vector", refers to a DNA molecule used as a vehicle to transfer recombinant genetic material into a host cell. The four major types of vectors are plasmids, bacteriophages and other viruses, cosmids, and artifical chromosomes. The vector itself is generally a DNA sequence that consists of an insert (a heterologous nucleic acid sequence, transgene) and a larger sequence that serves as the "backbone" of the vector. The purpose of a vector, which transfers genetic information to the host, is typically to isolate, multiply, or express the insert in the target cell. Vectors called expression vectors (expression constructs) are specifically adapted for the expression of the heterologous
sequences in the target cell, and generally have a promoter sequence that drives expression of the heterologous sequences. Simpler vectors called transcription vectors are only capable of being transcribed but not translated: they can be replicated in a target cell but not expressed, unlike expression vectors. Transcription vectors are used to amplify the inserted heterologous sequences.
Pharmaceutical composition
In the present context, the term "pharmaceutical composition" refers to a composition suspended in a suitable amount of a pharmaceutical acceptable diluent or excipient.
Pharmaceutically acceptable
In the present context, the term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, and more particularly in humans.
Adjuvant
In the present context, the term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the antigen and as a lymphoid system activator, which non-specifically enhances the immune response. Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Preferably, the adjuvant is pharmaceutically acceptable.
Excipient
In the present context, the term "excipient" refers to a diluent, adjuvant, carrier, or vehicle with which the composition of the invention is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
SARS-CoV-2 variant
In the present context, the term "SARS-CoV-2 variant", refers to other SARS-CoV- 2 viruses that has arisen from the wild-type SARS-CoV-2 by one or more mutations or modifications of the wild-type genome. Examples of such present variants are B.1.1.7, B.1.351, Bl.1.248, B.1.617 and BA.l.
The variants may include mutations but is not limited to mutations such as K417N, E484K, N501Y, where the numbering is according to the Kabat system based on the wild-type sequence of SARS-CoV-2 Spike protein (Uniprot code: P0DTC2-1).
Administered
In the present context, the term "administered" refers to any of the routes by which the RNA aptamer, multimeric RNA aptamer, composition and/or pharmaceutical composition may be delivered to the subject in need hereof.
The RNA aptamer, multimeric RNA aptamer, composition and/or pharmaceutical composition may be administered by pulmonary, parenteral, gastrointestinal or systemic delivery. Systemic delivery means that the entire body is affected as the RNA aptamer, multimeric RNA aptamer, composition and/or pharmaceutical composition is administered to the circulatory system. The gastrointestinal delivery includes oral and rectal administration providing a system-wide effect. A system-wide effect is also obtained by the parenteral delivery, which includes all but enteral delivery. By pulmonary delivery, local/regional delivery to the lung and
respiratory tract can be achieved. Such a delivery will often be performed using an inhaler, nebulizer or direct intranasal delivery.
One way of administering the RNA aptamer, multimeric RNA aptamer, composition and/or pharmaceutical composition is by injection, which can be intraperitoneal, intravenous, intramuscular, subcutaneous and intradermal.
Subject
The term "subject" comprises humans of all ages, other primates (e.g., cynomolgus monkeys, rhesus monkeys); mammals in general, including commercially relevant mammals, such as cattle, pigs, horses, sheep, goats, mink, ferrets, hamsters, cats and dogs, as well as birds. Preferred subjects are humans.
Capture antibodies In the present context, the term "Capture antibodies", refers to antibodies used in the detection device or the kit, which binds to a region of the SARS-CoV-2 virus or variants hereof, not overlapping with the binding site of the aptamer.
Lateral flow strip In the present context, the term "Lateral flow strip", refers to a device used for a lateral flow immunochromatographic assay or rapid test for detection of the presence of a target substance in a liquid sample without the need for specialized and costly equipment as commonly known in the art. The lateral flow strip uses capillary flow to move the liquid in the strip.
Capturing molecules, such as capturing antibodies
In the present context, the term "capturing molecules", refers to molecules used in the detection device or the kit for capturing a control component in order to verify the correctness of the assay performed on the detection device or by using the kit. In the present context, the term "Capturing antibodies", refers to antibodies used in the detection device or the kit for capturing a control component in order to verify the correctness of the assay performed on the detection device or by using the kit.
In one embodiment, the capturing molecules are selected from the group consisting of proteins, oligonucleotides, small molecules and antibodies. In a further embodiment, the oligonucleotide and/or small molecule binds to an aptamer as described herein or an antibody. In a further embodiment, the capturing molecule does not interfere with the binding of the aptamer to SARS- CoV2 virus or Spike protein.
Control component is used interchangeably with control substance and positive control.
Capturing moiety
In the present context, the term "Capturing moiety", refers to a moiety, which may be present on the RNA aptamer and/or the multimeric RNA aptamer for the RNA aptamer and/or multimeric RNA aptamer to be captured by the detection device when in use.
Catching moiety
In the present context, the term "Catching moiety", refers to a moiety, which may be present on a detection device to be able to capture the RNA aptamer and/or the multimeric RNA aptamer. In one embodiment, the catching moiety may interact with a capturing moiety when in use.
Aptamer
As mentioned above, the herein disclosed novel aptamers target RBD on the spike protein and prevents binding of the RBD/spike protein to ACE2 as demonstrated in examples 2-3. These novel aptamers not only target the RBD but also demonstrates neutralization of virus-like particles expressing SARS-CoV-2 and variants hereof as illustrated in example 4. The examples furthermore demonstrate that the originally identified aptamer RBD-PB6 may be truncated to a certain extent without affecting the binding and neutralization ability. Thus, in one aspect, the invention relates to an RNA aptamer comprising a sequence having at least 90% sequence identity to SEQ ID NO: 1. In a further aspect, the invention relates to an RNA aptamer, which prevents binding of the RBD and/or
spike protein to ACE2, comprising a sequence having at least 80% sequence identity, such as at least 90% sequence identity to SEQ ID NO: 1.
In one embodiment, the RNA aptamer comprises a sequence having at least 90% sequence identity to SEQ ID NO: 2. In a further embodiment, the RNA aptamer has at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2, such as at least 98% sequence identity, like at least 99% sequence identity, such as at least 100% sequence identity.
The inventors have demonstrated by the examples that there is a critical limit to the possible truncations of the RNA aptamer, possibly due to the proposed secondary structure. Accordingly, in one embodiment according to the present invention, the RNA aptamer consists of or comprises a sequence selected from the group of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12. In a further embodiment, the RNA aptamer consists of or comprises a sequence selected from the group of SEQ ID NO: 2 or SEQ ID NO: 3. In a further embodiment, the RNA aptamer consists of or comprises a sequence according to SEQ ID NO: 2 or SEQ ID NO: 3.
In a further embodiment, the RNA aptamer as described by the present invention comprising at the most 10 substitutions compared to SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12, such as at the most 9 substitutions, at the most 8 substitutions, at the most 7 substitutions, at the most 6 substitutions, at the most 5 substitutions, at the most 4 substitutions, at the most 3 substitutions, at the most 2 substitutions or at the most 1 substitutions.
In yet a further embodiment, the RNA aptamer according to the present invention has a length, which is at the most 120 nucleotides, such as at the most 110 nucleotides, like at the most 100 nucleotides, such as at the most 90 nucleotides.
In a further aspect, the invention relates to an RNA aptamer comprising a sequence having at least 70% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 such as at least 80% sequence identity.
In one embodiment, the RNA aptamer comprises a sequence having at least 90% sequence identity to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12. In a further embodiment, the RNA aptamer comprises a sequence having at least 90% sequence identity to SEQ ID NO: 3. In a further embodiment, the RNA aptamer has at least 95% sequence identity to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12, such as at least 98% sequence identity, like at least 99% sequence identity, such as at least 100% sequence identity.
The RNA aptamer may be produced by using naturally nucleotides. However, in order to modify the aptamer e.g. improving the stability, the nucleotides may be completely or partially replaced by artificial nucleotides. Hence, in a further embodiment, the RNA aptamer comprises one or more artificial nucleotides and/or artificial bonds, such as selected from the group consisting of 2'-F-pyrimidine, 2'- NH2-pyrimidine, 2'-0-Me, LNA (locked nucleic acid), 4'-S, TNA (threose nucleic acid), FANA (fluoroarabinonucleotide) and HNA (1,5-anhydrohexitol nucleic acid), preferably 2'-F-pyrimidine. The replacement of the nucleotides with artificial nucleotides may be only the pyrimidines. In still another embodiment, all pyrimidines in the RNA aptamer according to the present invention comprises 2'- fluoro modifications. The 2'-fluoro modifications are resistant to nuclease degradation, which provides serum stability, greatly facilitates sample handling and increases shelf life.
In yet another embodiment, the RNA aptamer according to the present invention consists of artificial nucleotides and/or artificial bonds or comprising at least 50%, such as at least 60%, like at least 70%, such as at least 80%, like at least 90% artificial nucleotides and/or artificial bonds.
It is important that the RNA aptamer binds to the target with sufficient binding efficiency. Thus, in a further embodiment, the RNA aptamer has a KD value to RBD below 500 nM, such as below 400 nM, like below 300 nM, such as below 200 nM, like below 100 nM, such as below 75 nM, like below 50 nM, such as below 20 nM.
In a further embodiment, the RNA aptamer has a ka to RBD above lxlO4 M _1s _1, such as above 5xl04 M _1s _1, like above lxlO5 M _1s _1, such as above 5xl05 M _1s _1, like above 8xl05 M _1s _1.
In an even further embodiment, the RNA aptamer has a kd to RBD below lxlO-2 s~ ^ such as below lxlO-3 s-1, like below 5x10 3 s-1, such as below 2xl0~4 s-1.
The KD value, ka and kd were measured using biolayer interferometry binding assays (BLI). The BLI was performed in an Octet RED96 equipment (ForteBio) and analyzed using either the instrument 's software or Prism (GraphPad Prism 5.0) software. In general, orbital shake speed of 700 or 1000 rpm were used for BLI experiments. Binding sensorgrams were aligned to dissociation and following subtraction of the reference well/sample, and globally fit to a 1: 1 binding model.
For the efficacy of the RNA aptamer, it is furthermore important that the RNA aptamer shows high neutralizing effect when targeting live SARS-CoV-2 virus and thus, may be used in as low an amount as possible. Hence, in a further embodiment, the RNA aptamer has an IC50 for neutralizing infection with live SARS-CoV-2 virus, below 100 mM, such as below 80 mM, like below 60 mM, such as 40 mM, like below 20 mM, such as below 10 mM, like below 5 mM.
The IC50 was measured for live SARS-CoV-2 virus as described in the materials and method section. Aptamers in serial dilutions were mixed with SARS-CoV-2 (Freiburg isolate, FR-4286) at a final titer of 100 TCID50/well. Incubation was performed for 1.5 hr at room temperature. Controls without either virus or aptamer were included as control. The virus:aptamer mixtures were added to Vero E6 TMPRSS2 cells and incubated for 12h in a humidified CO2 incubator at 37°C, 5% CO2, before washing off the cells and re-incubated for 60h. The cells were fixed with 5% formalin and staining with crystal violet solution. The plates were read using a light microscope (Leica DMil) with camera (Leica MC170 HD) at 4x magnification, and cytopathic effect (CPE) scored.
In order to improve the ability of the RNA aptamer when used for treatment, alleviation and prevention of SARS-CoV-2 infection, the RNA aptamer may be modified to obtain better pharmacokinetics and biodistribution. Thus, in one embodiment, the RNA aptamer comprises a modification. In a further
embodiment, the modification is a PEG, albumin, palmitoyl or cholesterol. In a still further embodiment, said modification is palmitoyl. In an even further embodiment, said modification is PEG.
Multimeric RNA aptamer
As shown in the example section, the novel RNA aptamers may be connected into a multimeric RNA aptamer, which improves the binding to the spike protein as well as the neutralization efficacy as demonstrated by example 5. Thus, in a further aspect the present invention relates to a multimeric RNA aptamer comprising at least two RNA aptamers as described herein.
The number of RNA aptamers in the multimeric RNA aptamer may vary from two RNA aptamers to several aptamers depending on the purpose of the multimeric RNA aptamer. Thus, in one embodiment, the multimeric RNA aptamer comprises or consists of 2-150 RNA aptamers, such as 2-125 RNA aptamers, like 3-100 RNA aptamers, such as 3-75 RNA aptamers, like 3-50 RNA aptamers, such as 3-25 RNA aptamers, like 3-12 RNA aptamers. In a further embodiment, the multimeric RNA aptamer is a dimer or a trimer.
It is important that the RNA aptamer binds to the target with sufficient binding efficiency. Thus, in a further embodiment, the multimeric RNA aptamer has a KD value to RBD below 500 pM, such as below 400 pM, like below 300 pM, such as below 200 pM, like below 100 pM, such as below 75 pM, like below 50 pM, such as below 40 pM.
In a further embodiment, the multimeric RNA aptamer has a ka to RBD above lxlO4 M _1s _1, such as above 5xl04 M _1s _1, like above lxlO5 M _1s _1, such as above 5xl05 M _1s _1, like above 8xl05 M _1s _1.
In an even further embodiment, the multimeric RNA aptamer has a kd to RBD below lxlO-2 s 1, such as below 5xl0~3 s 1, like below lxlO 3 s 1, such as below 5xl0~4 s 1, like below lxlO 4 s 1, such as below 5xl0~5 s 1.
The KD value, ka and kd were measured using biolayer interferometry binding assays (BLI). The BLI was performed in an Octet RED96 equipment (ForteBio) and analyzed using either the instrument 's software or Prism (GraphPad Prism 5.0) software. In general, orbital shake speed of 700 or 1000 rpm were used for BLI experiments. Binding sensorgrams were aligned to dissociation and following subtraction of the reference well/sample, and globally fit to a 1: 1 binding model.
For the efficacy of the RNA aptamer, it is furthermore important that the RNA aptamer shows high neutralizing effect when targeting live SARS-CoV-2 virus and thus, may be used in as low an amount as possible. Hence, in a further embodiment, the multimeric RNA aptamer has an IC50 for neutralizing infection with live SARS-CoV-2 virus, below 1 mM, such as below 800 nM, like below 600 nM, such as below 400 nM, like below 200 nM, such as below 100 nM, like below 50 nM.
The IC50 was measured for live SARS-CoV-2 virus as described in the materials and method section. Aptamers in serial dilutions were mixed with ARS-CoV-2 (Freiburg isolate, FR-4286) at a final titer of 100 TCID50/well. Incubation was performed for 1.5 hr at room temperature. Controls without either virus or aptamer were included as control. The virus:aptamer mixtures were added to Vero E6 TMPRSS2 cells and incubated for 12h in a humidified CO2 incubator at 37°C, 5% CO2, before washing off the cells and re-incubated for 60h. The cells were fixed with 5% formalin and staining with crystal violet solution. The plates were read using a light microscope (Leica DMil) with camera (Leica MC170 HD) at 4x magnification, and cytopathic effect (CPE) scored.
The connection between the RNA aptamers in the multimeric RNA aptamer may either be a direct linkage between the RNA aptamers or they may be connected via a linker. Hence, in one embodiment, the at least two RNA aptamers are separated by a linker. The linker may be composed of nucleotides or be a chemical linker. The chemical linker may comprise or consist of PEG molecules, polyalkanes (n-alkane or Cn), polypeptides and other oligomeric and polymeric systems either linear (polyethylene, polypropylene) or branched (PAMAM, bis- MPA). In a one embodiment, the linker is a mixture between nucleotides and molecules such as PEG. In a further embodiment, the multimeric RNA aptamer
comprises different linkers between the RNA aptamers i.e. a multimeric RNA aptamer may comprise both chemical linkers as well as nucleotide linkers.
In yet another embodiment, said linker is a nucleotide linker. In an even further embodiment, said nucleotide linker has a length in the range 1-30 nucleotides, such as 1-25 nucleotides, like 1-20 nucleotides, such as 2-15 nucleotides, like 3- 10 nucleotides.
In an even further embodiment, said linker is an adenosine linker. In a still further embodiment, said linker comprises or consists of 3-23 adenosines, such as 3-11 adenosines, like 5-9 adenosines such as 8 adenosines.
If the multimeric RNA aptamer comprises more than one linker, the linkers in the multimeric RNA aptamer need not be of similar size i.e. the linkers may be of different length. The different length may be obtained by using different components e.g. nucleotides or chemical molecules for the linker or by including a different number of components for the linkers. Hereby the distance between the RNA aptamers in the multimeric RNA aptamer can be varied. Thus, in one embodiment, said multimeric RNA aptamer comprises more than two RNA aptamers and said RNA aptamers are separated by linkers with a different number of nucleotides.
The spike protein is present on the SARS-CoV-2 as a trimer, which trimers are distributed over the entire surface of the virus particle. The distance between the spike proteins in the trimer and the trimers distributed on the surface of the virus is different. Thus, in one embodiment, said multimeric RNA aptamer comprises at least two groups of trimers being separated with a connection linker. In a preferred embodiment, said connection linker comprises more nucleotides than said linker separating said RNA aptamers in said trimer.
In a further embodiment, said connection linker
- comprises 10-200 nucleotides, such as 15-175 nucleotides, like 20- 150 nucleotides, such as 25-135 nucleotides, like 30-120 nucleotides;
comprises 5-250 PEG molecules, such as 10-225 PEG molecules, like 15-200 PEG molecules, such as 20-175 PEG molecules, like 25-150 PEG molecules; and/or has a length of 1-200 nm, such as 2-175 nm, like 3-150 nm, such as 4-125 nm, like 5-100 nm.
It is to be understood that the length of the linker in nm is a measurement of the linker from one RNA aptamer to the next RNA aptamer taking into account the average nucleobase distance in single- and double-stranded regions as well as potential secondary structures.
Vector
The RNA aptamers according to the present invention may be expressed by one or more vectors. Thus, a further aspect of the present invention relates to a vector comprising, inserted therein, a nucleic acid sequence transcribing a RNA aptamer as described herein. In a further embodiment, the vector is a plasmid, circular single-stranded DNA or circular double-stranded DNA.
If for example a circular single-stranded vector is used, a multimeric RNA aptamer may be produced using rolling circle amplification (RCA).
Host cell
The vectors may be expressing the RNA aptamers in a cell. Thus, yet an aspect of the invention relates to a host cell expressing the RNA aptamer as described herein, and/or a host cell comprising a vector as described herein. In one embodiment, the host cell is E. Coli.
It is to be understood that the RNA aptamers may also be synthetically/chemically produced.
Composition
The RNA aptamer according to the invention may be in a composition, such as a pharmaceutical composition. Thus, in a further aspect, the invention relates to a composition comprising at least one RNA aptamer as described herein and/or at
least one multimeric RNA aptamer as described herein. In a still further aspect, the present invention relates to a pharmaceutical composition comprising a composition as described herein and a pharmaceutically acceptable excipient.
In an embodiment, the composition and/or pharmaceutical composition comprises one or more stabilizing agents and/or one or more buffering agents.
Medicament
The RNA aptamer may be used as a medicament. Thus, a further aspect of the present invention relates to an RNA aptamer according to the invention and/or a multimeric RNA aptamer according to the invention and/or a composition according to the invention and/or a pharmaceutical composition according to the invention for use as a medicament.
The RNA aptamer as described herein may be used for targeting SARS-CoV-2 infections or infections with variants of SARS-CoV-2. Thus, an even further aspect relates to an RNA aptamer according to the present invention and/or a multimeric RNA aptamer according to the present invention and/or a composition according to the present invention and/or a pharmaceutical composition according to the present invention for use in preventing, alleviating and/or treating infection with SARS-CoV-2 or variants thereof. In one embodiment, the infection is in a mammal, preferable a human.
The RNA aptamer may be administered by different routes. Thus, in one embodiment said RNA aptamer and/or said multimeric RNA aptamer and/or said composition and/or said pharmaceutical composition is administered by pulmonary, parenteral, gastrointestinal or systemic delivery. In a further embodiment, said RNA aptamer and/or said multimeric RNA aptamer and/or said composition and/or said pharmaceutical composition is administered by nasal or oral delivery.
In one embodiment, the RNA aptamer and/or said multimeric RNA aptamer and/or said composition and/or said pharmaceutical composition is administered by
injection such as intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection or intradermal injection.
As demonstrated by examples 4 and 6, the RNA aptamer according to the present invention also targets variants of the wild-type SARS-CoV-2. The RNA aptamer and/or a multimeric RNA aptamer and/or a composition and/or a pharmaceutical composition for use may thus advantageously be used for targeting variants as well. Thus, in one embodiment, the SARS-CoV-2 variant is selected from the group consisting of B.1.1.7, B.1.351, Bl.1.248 and B.1.617, and variants comprising one or more modifications selected from the group consisting of K417N, K417T, L452R, T478K, E484K and N501Y, such as a variant comprising K417N and E484K, like a variant comprising K417N and N501Y, such as a variant comprising E484K and N501Y, like a variant comprising K417N, E484K and N501Y, like a variant comprising K417T, E484K and N501Y, such as a variant comprising L452R and T478K, like a variant comprising K417T and E484K, such as a variant comprising K417T and N501Y, like a variant comprising E484K and N501Y.
In a further embodiment, the SARS-CoV-2 variant is selected from the group consisting of B.1.1.7, B.1.351, Bl.1.248, B.1.617 and BA.l and B.1.617, and variants comprising one or more modifications selected from the group consisting Of K417N, K417T, N440K, L452R, S477N, T478K, E484K, E484A, Q493R, G496S, Q498R, N501Y and Y505H, such as a variant comprising K417N and E484K, like a variant comprising K417N and N501Y, such as a variant comprising E484K and N501Y, like a variant comprising K417N, E484K and N501Y, like a variant comprising K417T, E484K and N501Y, such as a variant comprising L452R and T478K, like a variant comprising K417T and E484K, such as a variant comprising K417T and N501Y, like a variant comprising E484K and N501Y, such as a variant comprising K417N, N440K, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y and Y505H, like a variant comprising K417N and N440K, such as a variant comprising K417N and S477N, like a variant comprising K417N and T478K, such as a variant comprising K417N and E484A, like a variant comprising K417N and Q493R, such as a variant comprising K417N and G496S, like a variant comprising K417N and Q498R, such as a variant comprising K417N and N501Y, like a variant comprising K417N and Y505H, such as a variant comprising N440K and S477N,
like a variant comprising N440K and T478K, such as a variant comprising N440K and E484A, like a variant comprising N440K and Q493R, such as a variant comprising N440K and G496S, like a variant comprising N440K and Q498R, such as a variant comprising N440K and N501Y, like a variant comprising N440K and Y505H, such as a variant comprising S477N and T478K, like a variant comprising S477N and E484A, such as a variant comprising S477N and Q493R, like a variant comprising S477N and G496S, such as a variant comprising S477N and Q498R, like a variant comprising S477N and N501Y, such as a variant comprising S477N and Y505H, like a variant comprising T478K and E484A, such as a variant comprising T478K and Q493R, like a variant comprising T478K and G496S, such as a variant comprising T478K and Q498R, like a variant comprising T478K and N501Y, such as a variant comprising T478K and Y505H, like a variant comprising E484A and Q493R, such as a variant comprising E484A and G496S, like a variant comprising E484A and Q498R, such as a variant comprising E484A and N501Y, like a variant comprising Q493R and G496S, such as a variant comprising Q493R and Q498R, like a variant comprising Q493R and N501Y, such as a variant comprising Q493R and Y505H, like a variant comprising G496S and Q498R, such as a variant comprising G496S and N501Y, like a variant comprising G496S and Y505H, such as a variant comprising Q498R and N501Y, like a variant comprising Q498R and Y505H, such as a variant comprising N501Y and Y505H.
Detection device and kit
The RNA aptamer as described by the present invention may also be used for the detection of SARS-CoV-2 and variants hereof. Thus, a further aspect of the present invention relates to in vitro use of an RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein in a detection assay for detecting and/or quantifying SARS-CoV-2 or variants thereof.
The detection assay may be in the form of a detection device. Thus, in an even further aspect, the present invention relates to a detection device, adapted for detecting SARS-CoV-2 or variants thereof, comprising at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein.
In one embodiment, the detection device is an ELISA assay as commonly known to persons skilled in the art. In brief, capture antibodies, which binds to a region of the SARS-CoV-2 virus not overlapping with the binding site of the aptamer, are arranged for capturing the SARS-CoV-2 virus. In one embodiment, the capture antibody may bind to the S2 domain of the spike protein. In a further embodiment, the antibody may bind to the RBD domain. The RNA aptamer and/or the multimeric RNA aptamer is then added after a sample potentially comprising SARS-CoV-2 virus has been incubated with the capture antibody. In case, SARS- CoV-2 virus is present a sandwich complex will form.
The formation of sandwich complexes may be identified by techniques as commonly known to persons skilled in the art. In one embodiment, the RNA aptamer is modified with a marker for identification of sandwich complexes. As an example a biotinylated oligonycleotide partly complementary to the aptamer could be attached to the RNA aptamer and visualized using HRP-streptavidin.
In one embodiment, the capture antibody is immobilized on a solid support such as a surface or a bead.
In another embodiment, said RNA aptamer and/or said multimeric RNA aptamer is coupled to a solid support, such as surface or a bead.
In an even further embodiment, the detection device is a lateral flow strip. The lateral flow strip advantageously, comprises a control line and a test line as known in the field. The test line identifies the presence of SARS-CoV-2 or variants hereof. In one embodiment, the test line is incubated with RNA aptamers or multimeric RNA aptamers. In a further embodiment, the test line comprises a catching moiety for being able to capture the RNA aptamer and/or the multimeric RNA aptamer. The control line may include a compound, such as a capturing molecule, like a capturing antibody, for binding to a control substance present in the lateral flow strip in mobilized form, in order to verify correct flow in the lateral flow strip. Thus, in a still further embodiment, the detection device further comprises capture antibodies functioning as positive controls.
The binding to the control line and test line may be visualized as commonly known to the persons skilled in the art such as by gold nanoparticles. As an example, the gold nanoparticles may be bound to the capture antibodies. Thus, in one embodiment, the detection device further comprises gold nanoparticle labelled capture antibodies. As a further example, aptamers as described herein may be labelled with gold nanoparticles. The gold-nanoparticle labelled aptamers may be combined with capture antibodies or aptamers as described herein, being adapted for being captured at and/or binding to the test line. Thus, in another embodiment, aptamers as described herein are labelled with gold nanoparticles. Alternatively, the detection assay may be in the form of a kit of parts. Thus, in a further aspect, the present invention relates to a kit of parts for detecting and/or quantifying SARS-CoV-2 or variants thereof comprising
- at least one RNA aptamer as described herein and/or at least one multimeric RNA aptamer as described herein;
- a detection device arranged for capturing said RNA aptamer and/or said multimeric RNA aptamer;
- optionally, one or more reagents;
- optionally, instructions for using the kit of parts for detecting or quantifying SARS-CoV-2 or variants thereof.
The detection device arranged for capturing the RNA aptamer and/or the multimeric RNA aptamer may, in one embodiment, be a solid support, such as surface or a bead. In a further embodiment, the detection device may be a lateral flow strip. In an even further embodiment, the detection device further comprises capture antibodies functioning as positive controls. Hereby the correct flow in the lateral flow strip can be verified.
In a further embodiment, the detection device may comprise a catching moiety for being able to capture the RNA aptamer and/or the multimeric RNA aptamer. The catching moiety may interact with a capturing moiety on the RNA aptamer and/or multimeric RNA aptamer in order for the RNA aptamer and/or multimeric RNA aptamer to be bound to the detection device. Thus, in one embodiment, said at least one aptamer and/or said at least one multimeric RNA aptamer comprises a capturing moiety. In a further embodiment, said capturing moiety is biotin. If
the capturing moiety is biotin, the catching moiety may advantageously be streptavidin.
The detection device may be used for detection of SARS-CoV-2 or variants hereof. Hence, in one aspect the present invention relates to the use of a detection device according to the present invention for detection of SARS-CoV-2 or variants hereof in a sample.
The sample may be any sample where SARS-CoV-2 would be present if a subject has been infected such as in the nose, saliva, urine, faeces or blood . Thus, in one embodiment, the sample is a nose swab, nasopharyngeal swab, a saliva sample, a urine sample, a fecal sample, a plasma sample, a serum sample or a blood sample.
It should be noted that embodiments and features described in the context of one of the aspects of the present invention also apply to the other aspects of the invention.
All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.
The invention will now be described in further details in the following non-limiting examples.
Examples
Example 1: Materials and Methods
Selection of 2'F-RN A aptamers
All oligonucleotides, including primers and single-stranded (ssDNA) library, were synthesized by Integrated DNA Technologies (IDT, Belgium). For the selection of 2'F-RNA aptamers to RBD, the library design previously described (Kenan et al., 1999) was used, however with a 36 nt random region (here termed KK-N36 library). In order to generate a library of double-stranded DNA (dsDNA) transcription templates, we performed a first annealing step of the Forward primer (KKfw36; SEQ ID NO:21) and the KK-N36 library at 75°C for 15 min and slowly
cooling to room temperature (RT). Annealed primers were extended by Klenow polymerase (KlenoFragment, exo, ThermoScientific, Lithuania). Purification of the dsDNA products was performed with 6% non-denaturing polyacrylamide gel. The initial RNA library was transcribed in a reaction containing dsDNA template (1.7 nmol at 0.7 mM final concentration, ca. 1015 molecules) and mutant T7 RNA polymerase Y639F in transcription buffer (80 mM HEPES (pH 7.5), 25 mM MgCh, 2 mM spermidine-HCI, 2.5 mM each ATP, GTP (Jena Biosciences, Germany) and 2'- F-dCTP and 2'-F-dUTP (TriLink Biotechnologies, USA), supplemented with BSA (heat shock fraction pH 7 >98%, Sigma-Aldrich, USA), pyrophosphatase inorganic (IPP, from yeast) and dithiotheitrol (DTT) (ThermoScientific, Lithuania). Reactions were purified on an 8% denaturing polyacrylamide gel and recovered via passive elution and ethanol precipitation.
Selection was performed using His-tagged SARS-CoV-2 RBD spike purified protein (AA 319-532; Creative biolabs; SEQ ID NO: 25). Beads were prepared as described by the manufacturer; in the initial selection cycle, 5 pg of SARS-CoV-2 RBD Spike protein His-tagged and of control His-tagged protein (Ctr-His, 2Rbl7c Nanobody (Vaneycken et al., 2011) His-tagged) [SEQ ID NO: 26] were incubated with Dynabeads™ His-Tag Isolation and Pulldown (Invitrogen), using manufacturer's recommended loading capacity according to the molecular weight of protein, for 30 min at 25°C with shaking (800 rpm) in 10 mM phosphate buffer pH 7.4, 300 mM NaCI and 0.01% Tween20. Three washing steps in washing buffer (WB; 10 mM phosphate buffer pH 7.5, 3 mM MgCh and 150 mM NaCI supplemented with O.lmg/mL BSA) were performed. Beads were re-suspended in selection buffer (WB supplemented with 0.1 mg/mL salmon sperm DNA (Invitrogen, USA) and 0.1 mg/mL BSA). Library was re-folded in WB prior to incubation with the beads as follows: (1) 90°C for 2 min; (2) 65°C for 5 min; and (3) 37°C and left at RT. 1.7 nmol of the starting library was initially incubated at a final volume of 150 pL with the counterselection beads at RT for 45 min and shaking at 700 rpm. Unbound sequences were then transferred to the RBD- modified beads and incubated at the same conditions as before. After three washing steps with WB (0.5 mL, 1 min), beads were subjected to reverse transcription for cDNA generation of the bound sequences using the primer "Reverse primer" (KKrv36; SEQ ID NO: 22) and Superscript III (Invitrogen, USA). dsDNA transcription templates for the next selection cycle were generated by
polymerase chain reaction (PCR) using the KKfw36 and KKrv36 primers and Phusion High-fidelity DNA Polymerase (Thermo Scientific, Lithuania), followed by BamHi digestion (ThermoSicentific, Lithuania) and dsDNA purification with GeneJET PCR purification kit (ThermoScientific, Lithuania). 2'-F-Y-RNA for subsequent cycles was produced by transcription as detailed above and purified on 8% denaturing polyacrylamide gels. In the succeeding cycles, the amount of 2'-F-Y RNA was kept constant at 150 pmol (cycles 2-8) while the amount of RBD- protein was decreased during selection from 5 pg (cycle 2), 2 pg (cycle 3), 1 pg (cycle 4) and 0.5 pg (cycles 5-8). The protein amount used for counterselection was kept constant at 2 pg from selection cycle 2. Incubation time with the counterselection beads was kept at 45 min in all selection cycles, while incubation with target beads was decreased to 15 min in the last selection cycles (from cycle 4). Longer washing steps were performed over the selection in order to increase stringency. From selection cycle 6, an additional counterselection step was introduced after the first counterselection by incubating the non-bound sequences with empty beads for 15 min.
Next Generation sequencing
For selection cycles, 3 to 8 samples were prepared for next generation sequencing (NGS) analysis on iSeqlOO Sequencing System (Illumina). Reverse transcription of the 2'-F-Y-RNA libraries of each selection cycle was performed followed by generation of dsDNA template by PCR. After purification of the PCR product as described above, PCR with primers containing the reverse and forward primer sequences [SEQ ID NO: 21 and 22] combined with an index and adapters was performed according to the protocol of the manufacturer (Illumina). The different samples containing different indexes were mixed with equal amounts of DNA (1 pg). To separate the PCR product from the primers, purification of 3.5 pg of the mixed library was performed with the Pippin Prep instrument with a 3% agarose, 100-250bp cassette (Sage Science, USA). Library size and purity was validated on a 4% agarose gel and the concentration was measured with Qubit fluorimeter (Invitrogen). Final preparation of the library was performed as described by iSEQlOO Sequencing System guide. One hundred and fifty base pair paired end sequencing was carried out and the raw NGS data was analyzed.
Quantitative PCR assay
For qPCR quantification, protein modified beads were prepared as described above using 0.5 pg of control His-tagged protein (2Rbl7c Nanobody) and/or RBD-His or the trimeric stabilised Spike protein his-tagged. Incubation with 20 pmol of 2'-F-Y- RNA libraries or single clones was performed to a final volume of 100 uL of binding buffer for 30 min at RT and shaking at 700 rpm. Three washing steps in WB were performed (0.3 ml_, 1 min) and beads were finally re-suspended in 12 pL of deionized water for reverse transcription as described above. One microliter of the generated cDNA was diluted in 74 pL of water for analysis via qPCR. Twenty microliters of diluted sample were added to 20 pL of PCR master mix containing lx LightCycler 480 SYBR Green I master mix (Roche, Germany) and 500 nM of KKrv36 and KKfw36 primers [SEQ ID NOs: 21-22]. Thermal conditions were optimized to 7 min at 95°C followed by 40 cycles of 10 s at 95°C, 20 s at 60°C and 30 s at 72°C. Thermal cycling was performed in a LightCycler 480 (Roche, Germany). Each sample was run in technical triplicates. DeltaCt values were defined as the control protein minus target protein Ct values.
Protein expression and purification
Proteins were expressed as previously described (Peterhoff et al., 2021) in Expi293 cells (Thermo Fisher Scientific) in different scales using the commercial ExpiFectamine™ system and subjected to affinity purification.
Aptamer production and purification
RBD-PB6 aptamer, truncated and multimerized versions were produced by in vitro transcription as described for the library preparation in the selection of 2 '-fluoro aptamers section. RBD-PB6 aptamer template was generated by PCR amplification using the corresponding template [SEQ ID NO: 20] with KKfw36 and KKrv36 primers [SEQ ID NO: 21 and 22]. The double-stranded templates, formed by two complementary sequences, of the truncated [SEQ ID NO: 14 and 15] and dimer [SEQ ID NO: 16 and 17] and trimer [SEQ ID NO: 18 and 19] versions of RBD-PB6 aptamer were produced by annealing of the two complementary DNA strands.
Biolaver interferometry binding assays
Biolayer interferometry (BLI) binding experiments were performed in an Octet RED96 equipment (ForteBio) and analyzed using either the instrument 's software
or Prism (GraphPad Prism 5.0) software. Binding sensorgrams were aligned to dissociation and following subtraction of the reference well/sample, and globally fit to a 1: 1 binding model. For these binding kinetic experiments, 96 well plates (black, flat bottom, Greiner) were used. In general, orbital shake speed of 700 or 1000 rpm were used for BLI experiments.
For aptamer binding assays, different His-tagged spike protein constructs were diluted in binding buffer (10 mM phosphate buffer pH 7.5, 150 mM NaCI and 3 mM MgCb with 0.1% BSA and 0.05% TWEEN-20) at 2.5 pg/mL concentration and immobilized onto a Ni-NTA-coated biosensors (OCTET Ni-NTA (NTA) Biosensors, Sartorius). Serial dilutions of the RBD-PB6 aptamer (previously folded in 10 mM phosphate buffer pH 7.5, 150 mM NaCI and 3 mM MgCh using a ramp temperature of lmin at 90°C, 2 min at 65°C, 2 min at 37°C and finally at 25°C) in binding buffer were prepared for the binding measurements. Baseline was recorded before each binding event (including association, dissociation and regeneration steps). First, the protein -coated sensor was dipped into the aptamer solution (association step), then into a well containing only buffer (dissociation step). Finally, 3 cycles of regeneration and cleaning were performed consisting in first dipping the sensor into a glycine solution (10 mM at pH 1.4) and then into buffer for 5 s each. The process was repeated for each aptamer concentration. Biotinylated aptamers diluted in binding buffer at 40 nM concentration were loaded on streptavidin-coated sensors (OCTET Streptavidin (SA) Biosenors, Sartorius) until 0.15 nm response was reached. Baseline was recorded prior to binding measurements. The binding kinetics were recorded as follows: eight aptamer-loaded sensors were dipped in 1/3 serial dilutions of Spike protein (stabilized trimeric protein with a C-tag provided by ExpreS2ion Biotechnologies, Denmark) for 400 seconds during the association step. For the multimerized aptamers (dimer and trimer), the highest concentration started at 16 nM whereas for the monomeric RBD-PB6 Ta, the highest concentration was 150 nM. Then, the sensors were moved to only buffer for 1200 seconds (dissociation step). Regeneration was achieved by doing 3 cycles of consecutive steps, first dipping into phosphoric acid (500 mM) and then into binding buffer during 5 s each. Subsequently, the aptamer-loaded sensors were dipped again in freshly prepared serial dilutions of Spike protein for another binding measurement (including association and dissociation steps).
For the ACE2 competition assay, Fc tagged ACE2 protein ((19-740) expressed in CHO, The Native Antigen Company, UK) at 2.5 pg/mL concentration in binding buffer was captured on a protein G-coated sensor (OCTET ProteinG (ProG) Biosensors, Sartorius) for 300 seconds or until 0.5 nm response was reached. RBD [SEQ ID NO:25], RBD SA variant (AcroBiosystems, USA; cat no: SPD-C52Hp), SI British variant (SinoBiological, China, cat no: 40591-V08H12) and Spike (ExpreS2ion Biotechnologies, Denmark, cat no: S2-46A-001) proteins were used as ligands at fixed concentrations of 50, 25 nM or 0.5 nM, respectively. The different aptamer constructs (full-length, truncated and multimerized versions) were previously folded as described above and incubated at different concentrations with these proteins for 20 min at RT. The octet protocol consisted in dipping the ACE2-loaded sensors first in binding buffer for 60 s (baseline), then in different solutions of RBD or Spike protein plus aptamer for 150 s or 600 s, respectively (association) and finally in binding buffer again (dissociation) for 150 s or 600 s (for RBD or Spike, respectively). Regeneration was achieved by doing 3 cycles of consecutive steps, first dipping into 10 mM Glycine pH 1.4 and then into binding buffer during 5 s each. The process, including the ACE2 loading, was repeated at different aptamer concentrations.
Flow Induced Dispersion Analysis (FIDA)
Flow Induced Dispersion Analysis (FIDA) experiments were conducted using a FIDA 1 instrument employing light-emitting-diode (LED) induced fluorescence detection using an excitation wavelength of 480 nm and emission wavelength > 515 nm (Fida Biosystems ApS, Copenhagen, Denmark). Non-coated capillaries with inner diameter 75 pm, outer diameter 375 pm, total length 100 cm, and length to detection window 84 cm (Fida Biosystems) were applied. Indicator samples were prepared with 25 nM AF488-labeled PB6, RBD-PB6, RBD-PB6-Ta dimer or trimer premixed with either dilution series of RBD (0-2.5 uM) or spike trimer (ExpreS2ion Biotechnologies, Denmark, code no: Stab-Spike-Fd Lot #: PB- 0411) (0-80 nM) in assay buffer (PBS with 3mM MgCh and 0.1% BSA). Analyte samples contained RBD/Spike trimer dilution series only. All samples were analysed using the following procedure. Initially, the capillary was flushed with assay buffer at 3500 mbar for 120 s and then at 1500 mbar for 20 s. Indicator samples were subsequently applied at 50 mbar for 10 s followed by analyte
samples at 400 mbar for 180 s. The Taylorgrams were interpreted using the FIDA software suite, version 2.04 (Fida Biosystems ApS, Copenhagen, Denmark) with a Taylorgram fraction setting of 75 %.
Biotinilation of a ptamers / fluorescent tagging
Biotinylation and fluorescence labeling of aptamers was performed by 3'-end ribose oxidation using sodium-metaperiodate followed by reaction with Alexa Fluor 488- or EZ-link Biotin-LC-Hydrazide using the standard protocol of the provider (Thermo Fisher Scientific). Cy5-hydrazide was obtained from Lumiprobe.
TIRF single molecule fluorescence
Single-molecule TIR (total internal reflection fluorescence microscopy) measurements were recorded using a nanoimager microscope (ONI). Samples were added to a coverslide chamber consisting of a pair of quartz and glass slides assembled together by Parafilm strips. The surface of the coverslip slide were chemically modified with poly-(ethylene glycol) (PEG) and biotinylated PEG (Laysan Bio.) at a 160: 1 ratio, and with PEG, respectively, to reduce non-specific binding by aptamers and proteins (Chandrados et al., 2014).
Solutions containing the spike protein and aptamers were prepared in imaging buffer consisting of 100 mM NaCI, 3 mM MgCh and 10 mM phosphate buffer (pH 7.4). The PEG passivated sample chamber was first incubated with a solution of 1% w/v Tween-20 for ten minutes (Chandrados et al., 2014), then with a solution of 0.1 mg/ml_ streptavidin linker protein (Invitrogen) for seven minutes to immobilize single biotinylated spike proteins. After each step, the sample chamber was flushed with surface passivating buffer consisting of 0.2 % w/v Tween-20 and 0.5% w/v BSA in imaging buffer. In the next step, the sample chamber was incubated with 100 pM of spike protein for 10 min and free protein was washed away with surface passivating buffer. Finally, 1 nM of Cy5 labelled aptamer was added just before measurements. The solution containing the aptamer also included an oxygen scavenging system (17 U/mL glucose oxidase, 4.5 mg/ml_ glucose, and 260 U/mL catalase) to prevent photobleaching as well as 2 mM of the triplet quenching reagent Trolox (Sigma Aldrich) to minimize photoblinking. Fluorescence movies 10 minutes long were taken with frames of 100 ms using excitation with a 640 nm laser totally internally reflected at the glass-water
interface where the spike proteins were immobilized. The laser power was set to ~8.5 mW to minimize photobleaching.
Data was analyzed using the iSMS software (Preus et al., 2015), and custom scripts written in MATLAB (Mathworks, USA). Fluorescence spots, where signal in a frame was a minimum of 150 counts higher than the background, were identified as possible binding events. Background corrected fluorescence time- traces were determined for each spot (Preus et al., 2016); these showed both on- and off-events, which were identified using hidden Markov modelling (HMM) analysis (Figure 10). Above-background fluorescence intensity for each frame (on- events) were plotted in histograms. The data was normalized by the total number of events (both on and off events) per video to represent the average number of on events per field of view and enable comparing different data sets together.
Neutralization assay using oseudotvoed virion like particles ( VLPs )
VLPs pseudotyped with spike protein of MERS-CoV, SARS-CoV-1 and SARS-CoV-2 were used to assess aptamer specificity. For production of VLPs, HEK293T cells were seeded at density of 50.000 cells/cm2. The next day media was exchanged prior to transfection of cells with 3 plasmids for lentiviral vector packaging gag- pol, REV and EGFP reporter together with a plasmid coding for either MERS (VG40069-G-N, Sino Biological), SARS-CoV-1 (Addgene plasmid #145031), SARS- CoV-2 WT (Addgene plasmid # 145780) or SARS-CoV-2 D614G mutant (Addgene plasmid # 156421) spike protein using calcium phosphate precipitation. Fourty- eight hours post transfection, supernatant was harvested and filtered through 0.45 pm pore-sized filter and spiked with 6 mM MgCh. Harvested VLPs were incubated with an aptamer of interest for 90 min at RT prior to transduction. For transduction, HEK293T cells transfected with ACE2 (Addgene plasmid # 1786) and TMPRSS2 (Addgene plasmid # 53887) spiked with Polybrene (6 pg/ml) seeded 10,000 cells per well on a 96-well plate were added VLPs. Next day media was exchanged; 4 days post-transduction cells were analyzed for EGFP fluorescence by fluorescence microscopy (1X73 inverted microscope, Olympus equipped with DP73 camera, Olympus) and flow cytometry (Cytoflex, Beckman Coulter).
P!aaue reduction neutralization test with SARS-CoV-2 virus.
SARS-CoV-2, Freiburg isolate, FR-4286 was propagated in VeroE6 expressing cells expressing human TMPRSS2 (VeroE6-hTMPRSS2) with a multiplicity of infection (MOI) of 0.05. Supernatant containing new virus progeny was harvested 72h post infection, and concentrated on lOOkDa Amicon ultrafiltration columns (Merck) by centrifugation for 30 minutes at 4000 g. Virus titer was determined by TCID50% assay and calculated by Reed-Muench method. Aptamer were prepared in serial dilutions in DMEM (Gibco) + 2% FCS (Sigma-Aldrich) + 1% Pen/Strep (Gibco) + L-Glutamine (Sigma-Aldrich)+ 3 mM MgCh were mixed with SARS-CoV-2 at a final titer of 100 TCID50/well, and incubated at RT for 1.5hr. A "no aptamer" and a "no virus" (uninfected) control samples were included. The virus:aptamer mixtures were added to 2 x 104 Vero E6 TMPRSS2 cells seeded in flat-bottom 96-well plates, and incubated for 12h in a humidified CO2 incubator at 37 °C, 5% CO2, before washing off the cells and re-incubated for 60h. The cells were fixed with 5% formalin (Sigma-Aldrich) and staining with crystal violet solution (Sigma- Aldrich). The plates were read using a light microscope (Leica DMil) with camera (Leica MC170 HD) at 4x magnification, and cytopathic effect (CPE) scored.
Stability studies
Two mM of RBD-PB6-Ta in its monomeric, dimeric or trimeric form were incubated in DMEM (Gibco) + 10% FCS (Sigma-Aldrich) or WB at 37 °C. Samples were collected at different time points (0, 1, 3, 6, 8, 24, 32, 48, 96 and 144 h for serum stability samples and 0, 24, 48, 96 and 144 h for the samples incubated in WB). All aliquots were diluted 1:5 in milliQ water and 2:5 in loading dye and run on an 8% denaturing polyacrylamide gel. Gels were quantified using the ImageJ software (https://imagej.nih.gov/ij/) and aptamer half-life was determined using GraphPad Prism software (USA).
Lateral flow assay
Capturing aptamer RBD-PB6_ext (SEQ ID NO: 27) was refolded (90°C, lmin;
65°C, 2 min, 37°C, 1 min) prior addition of 1.5 fold of biotin-complementary oligo (Biotin-TEG (tetraethyleneglycol)-CCCGACACCCGCGGATC; SEQ ID NO: 28). For 10 minutes, the mixture was incubated at 37°C. The biotinylated aptamer RBD- PB-6_ext was diluted in PB with 0.5% BSA and 0.05% tween-20 and mixed with 5 mI_ gold conjugated detection antibody (antibody 40150-D006; RRID Number:
AB_2827985, SinoBiological, China) to a final aptamer concentration of 300 nM. For antibody gold conjugation, 40 nm gold nanoparticles (Bioporto CAT NO: NGIB18-3) was conjugated to the antibody following the manufacturer's protocol.
Next, different concentrations of live SARS-CoV-2 sample (B.1.1.7 variant [example 7], BA.l variant, alpha variant (B.1.1.7) and delta variant (B.1.617) [example 10]) were prepared in PBS. Samples were added and incubated for 10 minutes with the biotinylated capture aptamer and the gold conjugated detection antibody.
Recombinant omnicron SI (SinoBiological, cat no: 40591-V08H41) was prepared as live SARS-CoV-2 samples.
Subsequently, the strip (gRAD OneDetection Strip, Bioporto), which comprises a biotin-binding protein at the test line and an anti-rabbit/anti-mouse/anti-goat capturing molecule at the control line, was dipped into a final 100 pL solution. The aptamer-virus-gold conjugated antibody complex will flow through the test, and control lines due to capillary force. After 10-15 minutes, the test line is revealed and a color change can be observed in the presence of analyte.
ELISA assay
Twenty microlitres of antibody 40590-D001 (RRID Number: AB_2827980; SinoBiological China) or antibody 40150-D006 (RRID Number: AB_2827985, SinoBiological, China), in 2.5 pg/mL in carbonate buffer, pH 9.5 were added to each well of a microtitre plate (96 well plate, half area; Greiner; high absortion) and incubated for over night at 4°C. A washing step with PB-Tween (pH 7.4 0.2% [v/v] Tween 20, 100 pL/well) was then performed. Blocking of the plate was carried out by the addition of 100 pL PB-Tween + 5% BSA for 2h at room temperature (rt).
Following three washings with 100 pL PB-Tween; 20 pL of Spike protein (SEQ ID NO: 13) (cone range from 50 to 0.02 nM) in PB-Tween + 0.5% BSA were added to each well and then incubated for lh at rt. Subsequently, four washing steps with PB-Tween (100 pL) were carried out. Incubation with 20 pL at 250 nM aptamer pre-hybridized with a biotinylated complementary oligonucleotide was
performed for 30 min at rt, followed by a wash with PB-Tween (4x100 pl_) and followed by the addition of HRP-Streptavidin (Thermofisher, 1: 12000 dilution) and incubation for 20 min at rt in the dark.
Subsequently, a final washing step was performed (3 times with 100 mI_ PB-Tween and 1 time PB). Then, 20 mI_ of TMB (Tetramethylbenzidine) substrate were added, incubated for 20 min and finally the reaction was stopped by addition of 20 mI_ of a 2N sulfuric acid solution.
Colorimetric signal was measured in a plate reader at 450 nm. Limit of detection (LoD) was defined as background + 3*sd (standard deviations).
PEGylation and in vivo pharmacokinetic assays PEGylation of aptamers
PEGylation of aptamers was performed by 3'-end ribose oxidation using sodium- metaperiodate followed by reaction with PEG20-Hydrazide (Creative PEGworks) using the standard protocol of the provider.
Animal experiments
Studies were performed on 10-week old adult female Balb/c mice. All animals had free access to a standard rodent diet and water. During the experiments, animals were kept in groups of 4-5 mice per cage.
For PK and biodistribution experiments, 500 pmol of RBD-PB6 aptamer and variants (with or without a specific set of functionalities, i.e. PEG20, PEG40 or palmitoyl groups) were administered through I.V. tail vein (n > 3 for each injection).
Blood samples were drawn from the tail of each animal at different time points over 24 h using Microvette 300 tubes (Sarstedt). The blood serum was collected by centrifugation of the tubes for 5 min at 10,000 g. One pL of serum was mixed with 9 mI PBS and 1 pL of the mixture was used for reverse transcription to generate the cDNA using the primer alrev and Superscript III (Invitrogen, USA) following the manufacturer protocol. Afterwards, the samples were quantified by qPCR. To that end, 3 pL of the generated cDNA were diluted in 12 pL of water for analysis via qPCR. Fifteen microliters of diluted sample were added to 15 pL of
PCR master mix containing lx LightCycler 480 SYBR Green I master mix (Roche, Germany) and 500 nM of alrev (TGGCAACCTCTGTCCTG; SEQ ID NO: 23) and alfw (GGCGACATTTGTAATTCCTG; SEQ ID NO: 24) primers, and samples were divided in two wells (each 10 pL) for running technical duplicates. Thermal conditions were optimized to 7 min at 95°C followed by 40 cycles of 10 s at 95°C, 20 s at 60°C and 30 s at 72°C. Thermal cycling was performed in a LightCycler 480 (Roche, Germany).
Calibration was performed using different concentrations of RBD-PB6 aptamer that were subjected to reverse transcription and qPCR following the protocol above.
Example 2: Selection, sequencing and truncation studies of RBD-PB6
Aim
The aim of the present study is to select and identify new aptamers targeting the receptor-binding domain of SARS-CoV-2 spike protein that recognizes the ACE2 receptor.
Materials and methods See example 1.
Results
For the aptamer selection, we targeted the receptor binding domain (RBD) of SARS-CoV-2 spike protein that recognizes the ACE2 receptor. We performed eight cycles of SELEX against recombinant RBD (AA 319-532) using a 2'F-pyrimidine modified RNA library (Kenan et al., 1999) encompassing a 36 nucleotide randomized region. For the initial selection cycle, we used 1.7 nmol of the RNA library, which provided a wide sequence diversity with ~1015 unique RNA molecules. His-tagged RBD protein expressed in HEK293 cells was immobilized on Ni-NTA magnetic beads and incubated with the RNA library in each selection cycle. The RNA bound to the beads was subjected to reverse transcription (RT) and PCR amplification. A counterselection step was introduced in all cycles to avoid unspecific binders using a control His-tagged protein, and an additional counterselection step with empty Ni-NTA beads was included from the sixth selection cycle. Iterative cycles of selection reducing the amount of protein and RNA, as well as the incubation time, yielded enrichment of different clones in the
library. Sequencing data show that several clones (RBD-PB-0, -1 and -5) dominated the library pool in earlier selection cycles, representing up to 50-60% of the total amount of sequences. In selection cycle 6, the frequency of earlier enriched sequences drastically decreased, leading to the enrichment of two other predominant clones. In particular, RBD-PB6 and RBD-PB7 displayed a prominent amplification in the last selection cycles and were strongly enriched, representing more than 90% of the library in cycle 8.
The relative binding of the selected candidates was assessed by quantitative PCR (qPCR) of RNA recovered in a spike protein pull-down assay. We incubated the clonally expressed aptamers with either RBD- or full-length trimeric spike- functionalized beads. As a negative control, we used beads functionalized with an unrelated His-tagged control protein (Ctr-His). Despite the initial enrichment of RBD-PB1 and RBD-BP5 and later RBD-PB7 seen during the selection, only the most predominant sequence after the eighth selection cycle, RBD-PB6, showed robust enrichment to both RBD and trimer spike protein by qPCR (Figure 1A). Figure IB illustrates the secondary structure of RBD-PB6 (SEQ ID NO: 3) predicted by NUPACK.
Conclusion
Following eight selection cycles, the aptamer RBD-PB6 was identified as a candidate for targeting RBD and the trimer spike protein.
Example 3: RBD-PB6 binds with high affinity to SARS-CoV-2 spike protein and blocks its interaction with ACE2
Aim
The aim of the present invention was to study the binding of the aptamer RBD- PB6 and truncated versions hereof to SARS-CoV-2.
Materials and methods See example 1.
Results
The binding of RBD-PB6 to different SARS-CoV-2 spike constructs was assayed by Biolayer interferometry (BLI) and Flow Induced Dispersion Analysis (FIDA) (Fig 2).
To determine the binding affinity of RBD-PB6 to spike protein by BLI, we immobilised His-tagged RBD (SEQ ID NO: 25), spike-Sl (amino acids Vall6- Arg685 of SEQ ID NO: 13), full-length spike (SEQ ID NO: 13) or trimeric spike proteins on Ni-NTA functionalized sensors and tested with increasing concentrations of RBD-PB6. The BLI measurements showed that RBD-PB6 binds with high affinity (KD~18 nM) to the RBD (Figure 2A) and also interacts with spike-Sl, monomeric and trimeric spike in a stabilized form (Figure 3A). These data show that RBD-PB6 interacts with a surface-exposed region in the RBD and that the binding interface is accessible even in the native trimeric form of the full- length protein. Moreover, control experiments with non-His-tagged spike protein or non-related His-tagged protein showed that the RBD-PB6 interaction is specific and independent of the protein purification tag used during aptamer selection. For comparison, we performed qualitative binding BLI assays with the lead aptamer (CoV2-RBD-lC) reported by Song et al (Song et al., 2020). In our hands, the CoV2-RBD-lC aptamer does not bind specifically to spike protein and its binding to RBD-related proteins is dependent on the His-tag. In fact, the previously reported CoV2-RBD-lC aptamer shows significant unspecific binding to our His-tagged control protein suggesting that this is the main target (Figure 3B). This impedes its application for SARS-CoV-2 intervention or detection.
To test if our RBD-PB6 aptamer binds spike protein in solution, we performed titration binding experiments by FIDA, which allowed us to monitor changes in hydrodynamic radii of the aptamer-protein complexes at different concentrations and under native binding conditions. The FIDA measurement is based on the accurate quantification of the change in the apparent size (diffusivity) of a labelled indicator molecule binding to a selected analyte (Jensen et al., 2010). The apparent indicator and complex sizes are assessed using Taylor dispersion analysis in a capillary under hydrodynamic flow. The change in diffusivity upon complex formation can be used to measure the binding affinity between the analyte and the indicator (Figure 4A-C). We labelled the aptamer (indicator) with ATTO-488 fluorophore and incubated it with increasing concentrations of RBD protein (analyte). We found that RBD-PB6 binds to RBD with an estimated KD value of 129 nM which is about 10 times higher than the BLI measurement
(Figure 2B); however, such differences in the KD value between solution- and surface-binding assays are commonly seen in other studies. Based on the FIDA data we can estimate the hydrodynamic radii (Rh) of RBD protein alone to be 2.8 nm, aptamer alone to ~3.1 nm and the resulting complex to ~3.8 nm, suggesting an extended area of interaction in the complex.
To determine if the binding of RBD-PB6 to spike protein can block the interaction with host ACE2 and potentially prevent viral entry, we performed competition assays using BLI. To that end, Fc-tagged ACE2 receptor was immobilized on a protein G sensor and incubated with 50 nM RBD protein in the presence of increasing concentrations of RBD-PB6 aptamer. We found that RBD-PB6 inhibited binding of RBD to ACE2 in a concentration-dependent manner with an IC50 of ~250 nM (Figure 2C-D). This indicates that the RBD-PB6 binding site on RBD overlaps with the binding site for ACE2 and thus holds potential to neutralize SARS-CoV-2 infection.
Based on the predicted secondary structure of RBD-PB6 (Figure IB), we evaluated a range of truncated versions to increase the atom economy of the binder and to determine the motifs involved in RBD binding (Figure 5). The truncated aptamers were assayed in a BLI competition experiments with ACE2 (Figure 6). The full- length 80 nts RBD-PB6 (SEQ ID NO: 3) is predicted to form an elongated stem loop which could be shortened to 53nts (RBD-PB6-Ta; SEQ ID NO: 2) without a loss in binding affinity (IC50 value of 200 nM; Fig 2D). Further truncation of the stem loop (RBD-PB6-Tb; SEQ ID NO: 6 and RBD-PB6-Tc; SEQ ID NO: 7), shortening of the terminal hairpin loop (RBD-PB6-Td; SEQ ID NO: 8) or nucleotide inversion in the central part of the stem (RBD-PB6-Tinv; SEQ ID NO: 9) lead to complete loss in binding affinity, suggesting that these aptamer motifs/regions are essential for the recognition of SARS-CoV-2 RBD (data not shown).
Conclusion
These data demonstrates a chemically stabilized RNA aptamer that binds with high affinity and selectivity to both the RBD alone and the whole spike protein of SARS- CoV-2. Binding affinities were characterized by both surface and solution biophysical techniques. The experimentally determined size of the individual species assessed by FIDA matches the theoretical values. The relatively small increment in size
observed upon aptamer binding suggests that RBD-PB6 establishes multiple interactions with spike protein in agreement with a tightly assembled complex.
The presence of RBD-PB6 blocked the interaction between SARS-CoV-2 spike protein and host receptor ACE2 and prevented viral entry in cells, suggesting that the RBD-PB6 and ACE2 binding sites on spike overlap. RBD-PB6 binds to a binding site on RBD overlapping with the binding site for ACE2.
Truncation of the RBD-PB6 to some extent (RBD-PB6a) could be performed without the loss of binding affinity. However, further truncation lead to loss of binding affinity.
Example 4: RBD-PB6 neutralizes SARS-CoV-2 viral entry
Aim
To study the ability of RBD-PB6 to neutralise viral-like particles pseudotyped with spike protein from SARS-CoV-2, SARS-CoV-1 and MERS.
Materials and methods See example 1.
Results
Since RBD-PB6 can block the interaction between recombinant RBD and ACE2, we next performed in vitro neutralization assays using viral-like particles (VLPs). The VLPs are based on inactivated HIV pseudotyped with SARS-CoV-2 spike protein and containing an EGFP gene as a fluorescent reporter.
The target cells (HEK293 cells transfected with plasmids expressing human ACE2 and TMPRSS2) were incubated for 36-48h with SARS-CoV-2 VLPs and varying amounts of RBD-PB6, RBD-PB6-Ta and a control aptamer. Subsequently, cells were washed and cultured for 3 days. Fluorescence microscopy shows that increasing concentrations of the aptamer considerably reduce the EGFP signal, indicating that RBD-PB6 efficiently blocks viral uptake (data not shown). The fluorescent signal was quantified by flow cytometry, which yielded IC50 values of 200 nM and 140 nM for RBD-PB6 and RBD-PB6-Ta, respectively (Figure 7A).
Furthermore, RBD-PB6-Ta neutralized VLPs expressing the G614D spike variant, associated with increased viral infectivity (Korber et al., 2020), slightly more efficiently than the wt strain, with an IC50 value of 110 nM (Figure 7A, grey curve).
To investigate the broader specificity of RBD-PB6, we repeated the assay using VLPs pseudotyped with either MERS or SARS-CoV-1 spike proteins. No neutralization was observed at any of the concentrations tested against these VLPs (Figure 7B and Figure 8 for MERS). Thus, the aptamer shows high specificity towards SARS-CoV-2 with no apparent cross- reactivity for MERS and SARS-CoV-1 despite the 75% sequence similarity between RBDs from SARS-CoV-2 and SARS- CoV-1. Eight of the 14 amino acids from SARS-CoV-1 known to interact with ACE2 are conserved in SARS-CoV-2, but there are substantial differences in the binding interface (new salt bridge between Lys417 of SARS-CoV-2 S protein and Asp30 of ACE2, new hydrogen bonding networks as well as an increment in hydrophobic contacts). Hence, the binding mode of the aptamer probably involves unique contact/areas or interfaces essential for viral ACE2 recognition that are not shared in SARS-CoV-1.
Conclusion
The data demonstrates the aptamers RBD-PB6 and RBD-PB6-Ta are highly specific towards SARS-CoV-2. The RNA aptamer is specific to SARS-CoV-2 and does not bind SARS-CoV-1 and MERS coronavirus.
It is also demonstrated that the aptamers RBD-PB6 and RBD-PB6-Ta are able to neutralize VLPs expressing both SARS-CoV-2 wt spike protein as well as the G614D spike variant.
Example 5: Aptamer multimerization improves binding to spike and neutralization efficacy
Aim
To study the binding and neutralisation efficacy of aptamer multimerization.
Materials and methods See example 1.
Results
The SARS-CoV-2 spike protein adopts a trimeric structure in the viral envelope and we therefore investigated if multimerization of RBD-PB6 could further enhance binding trimeric spike protein.
We performed single molecule TIRF experiments to determine the binding stoichiometry between RBD-PB6 and trimeric spike. To that end, biotinylated spike protein in its trimeric form was immobilized on a passivated glass surface functionalized with streptavidin and incubated with RBD-PB6 aptamer labelled at the 3 '-end with Cy5.
The RBD-PB6 aptamer bound to the spike-decorated surface and all binding events, which appeared as bright spots on the detector, were recorded over time. The fluorescence time traces associated with each spot often showed multiple binding and dissociation events and several fluorescence intensities appeared in binding events. Analysis of all binding events showed the presence of distinct populations with associated fluorescence intensities matching with the simultaneous presence of one, two, three or more aptamers interacting with the immobilized spike protein (indicated with arrows in Figures 9A; the arrows represent, reading from left to right, populations associated with one, two, three or more aptamers simultaneously interacting with the spike protein). Some of these events may arise from aptamer multimerization in solution. We also saw events with higher fluorescence intensities in control experiments in the absence of the spike protein (Figure 9A). However, these higher intensity events were significantly more frequent in the presence of spike protein, indicating that two and three molecules of RBD-PB6 can simultaneously bind to trimeric spike.
To exploit the avidity in binding associated with multivalency, we multimerised RBD-PB6-Ta to dimeric and trimeric forms. To determine the optimal linker length we conducted a trimeric spike-Ace2 competition assay on the BLI platform with linkers ranging from 3 to 27 adenosines (~1.5 to 13.5 nm). Based on this approach (Figure 10), we selected dimers and trimers of RBD-PB6-Ta with ~4 nm As spacers between each aptamer. When tested for binding to trimeric spike protein using FIDA, we saw a strong enhancement of binding affinity for the
multimerized aptamers compared to the monomer, with KD values of ~0.8 and 1.4 nM for the trimer and dimer (Figure 9B), which enters a range not accurately determined by FIDA. The Rh of the dimer and the trimer aptamers (3.4 and 4.3 nm, respectively) increased considerably to 7.3 and 8.2 nm upon binding to the trimeric spike protein, which is in good agreement with the expected values.
We also tested the binding affinity for dimer and trimer versions of RBD-PB6 using BLI by immobilising the aptamers and adding trimeric spike protein in different concentrations. This showed that the binding of multimerized aptamers was strongly improved exibiting affinities in the low picomolar range (KD values of 72 pM and 39 pM for dimer and trimer; Table 1). Analysis of the kinetic rate constants showed fast association rates for all constructs with similar ka values of 8.6xl05, l.OxlO6 and 9.5xl05 M _1s 1 for the trimer, dimer and monomer, respectively. Larger differences were observed in the dissociation rate constants, which showed strong avidity effect: The dimer and especially the trimer exhibited very slow dissociation constants with R values of 2.17xl0~5 s 1 and 7.23xl0~5 s-1, respectively, compared to the monomer ( kd = 1.99xl0-4 s-1). Our data underlines the importance of avidity to enhance the molecular recognition properties of multivalent aptamers.
The enhanced affinity of multivalent aptamers was next investigated in BLI competition experiments (Table 2+3). To this end, trimeric spike protein was incubated at a fixed concentration (0.5 nM) with different amounts of aptamers and, subsequently, the interaction with ACE2 protein immobilized on the sensor surface was measured. The dimeric and trimeric aptamer constructs showed IC50 values of 0.67 and 0.35 nM, close to the limit of detection of the assay - limited by the minimum amount of spike protein required for detection - whereas the
monomeric aptamer showed an IC50 value of 47 nM, ~100-fold higher than the multimerized versions. Hence the multimerized aptamers show a clearly increased ability to block binding between trimeric spike and human ACE2. Table 2: IC50
Table 3:
RNA aptamers bearing 2 '-fluoro modifications at the pyrimidines are known to be more stable than unmodified RNA and DNA aptamers. We determined the serum stability of RBD-PB6, RBD-PB6-Ta and multimerized versions (dimer and trimer) by incubating the aptamers in either phosphate buffer or in DMEM+10% FCS at 37°C for different time periods. Visualization of the degradation by PAGE gel revealed that the aptamer constructs remained largely intact for up to 24h in media supplemented with FCS (Figure 11) with a half-life of ~50h, and up to 4 days in phosphate buffer. This contrasts non-modified RNA aptamers that are degraded in serum within minutes (data not shown). Together with the infectivity inhibition studies, these results indicate that the aptamers used here are functional for extended times in serum.
Finally, to test the ability of RBD-PB6 to neutralize infection by live SARS-CoV-2 virus, we performed plaque assays using SARS-CoV-2 infection of VeroE6 cells in the presence of monomeric, dimeric or trimeric aptamer. All three aptamer forms
showed a neutralizing effect on SARS-CoV-2 infection but with a clear enhancement for the dimer and trimer forms (Fig 9C). The trimeric aptamer showed the strongest neutralizing effect, inhibiting SARS-CoV-2 entry with an IC50 of 46 nM. The dimeric aptamer showed an about 10 times lower effect with IC50 values of 387 nM whereas the monomeric aptamer, RBD-PB6 Ta, further declined the neutralizing activity about 10 times to an IC50 of ~1.5-5 mM.
Conclusion
These data demonstrates that multivalency enhances aptamer binding and viral neutralization efficiency. Multimerization of the aptamer to dimeric and trimeric forms resulted in an approximately 10-fold and 100-fold stronger binding affinity, respectively, mirrored by increased inhibitory effect on SARS-CoV-2 infection, with IC50 values in the low nanomolar range.
It is furthermore concluded that the length of the linker influences the binding affinity and the inclusion of modified nucleotides enhances the stability of the aptamers.
Example 6: RBD-PB6 binds with high affinity to the B.1.1.7 and B.1.351 variants of SARS-CoV-2 spike protein
Aim
To study the binding affinity of RBD-PB6 to SARS-CoV-2 variants.
Materials and methods See example 1.
Results
Recently, multiple variants of SARS-CoV-2 virus have emerged and are circulating globally. These variants carry mutations in the spike protein associated with increased transmission, thus leading to an increase in COVID-19 cases. In addition, some of these variants contain mutations that could hamper immune detection and weaken antibody-based therapies and vaccine efficiency.
To evaluate how RBD-PB6 performs against emerging SARS-CoV-2 variants, we performed binding assays using recombinant RBD containing the most prevalent
mutations, in particular those found in the B.1.1.7 and B.1.351 lineages. His- tagged proteins were immobilized onto a NTA-functionalized BLI sensor and subsequently incubated with different concentrations of RBD-PB6.
BLI binding assays showed that RBD-PB6 binds strongly (KD = 38 nM) to RBD carrying the mutations found in variant B.1.351 (K417N, E484K, N501Y) (Figure 12). Moreover, the aptamer binds with strong affinity (KD = 12 nM) to the B.1.1.7 variant of the spike SI subunit, which also comprises the N501Y mutation.
BLI competition experiments further showed that RBD-PB6 and RBD-PB6-Ta also inhibit binding between RBD-B.1.315 and ACE2 with IC50 values of 577 and 556 nM, respectively.
Conclusion
RBD-PB6 showed high affinity towards spike proteins from the new viral lineages B.1.1.7 and B.1.351, illustrating that the mutations present in the spike proteins of these variants do not affect RBD-PB6 binding. Thus, these data demonstrates that the current and most prevalent mutations on the spike protein do not affect recognition by RBD-PB6.
Example 7: RBD-PB6 detection of SARS-CoV-2 in a lateral flow strip assay
Aim
To demonstrate a possible set-up of a detection device for detecting SARS-CoV-2 using aptamers according to the present invention.
Materials and methods See example 1.
Results
Figure 13A demonstrates a potential method for detection of SARS-CoV-2 using aptamers according to the present invention. A biotinylated aptamer 1 is mixed with gold nanoparticles(NPs)-antibodies 3 in a vial 5 prior to adding a sample 7 potentially comprising SARS-CoV-2. After incubation, the mixture 9 is added to a lateral flow strip 11 e.g. by arranging the lateral flow strip 11 in the mixture 9.
The mixture flows downstream 13 the lateral flow strip 11 and after a certain
period the result can be read on the lateral flow strip 11 at the test line 15 and control line 17.
Figure 13B shows a lateral flow strip 11 with the area for sample loading 19 comprising SARS-CoV-2 21, gold NPs-antibodies 3 and biotinylated aptamer 1.
The biotinylated aptamer 1 and the gold NPs-antibodies 3 are bound to SARS- CoV-2 21 prior to loading the mixture 9 onto the lateral flow strip 11.
During the flow downstream 13 of the lateral flow strip 11, the biotinylated aptamers 1 will be captured at the test line 15 by a biotin binding protein and gold NPs-antibodies 3 will be captured at the control line 17 by a capturing antibody 23. If SARS-CoV-2 is present in the mixture these will be bound together with the aptamers at the test line 15 and can then be identified by the gold-labelled NPs- antibodies 3.
At the control line 17, the capturing antibody 23 will bind to the gold NPs- antibodies 3 no matter whether SARS-CoV-2 21 is present or not. The control line 17 is used to indicate whether the flow on the lateral flow strip 11 has been satisfactory and the release from the sample loading section sufficient.
Figure 13C shows the use of lateral flow strips, the principle of which was described above (Figures 13A+B). Four different viral titers from low pM to low fM concentration were incubated on four strips (LFA-1: 10*6 particles/mL; LFA-2: 10*5 particles/mL; LFA-3: 10*4 particles/mL; LFA-4: 10*3 particles/mL). Figure 13C shows that the aptamer-based LFA allows detection of low amounts of live SARS-CoV-2 virus (B.1.1.7 variant) as demonstrated by a visible test line 15. The control line 17 is shown on all of the four lateral flow strips showing the reliability of the test.
Figure 13D shows the optical readout of the lateral flow strips where the absorbance signal was quantified from the test line (averaged to the control line) at the different viral concentrations. A reliable optical readout is demonstrated down to 1.5*105 virus/mL (i.e. particles/mL).
Conclusion
Using a kit comprising a lateral flow strip and aptamers according to the present invention would allow testing of samples to identify presence of SARS-CoV-2 in a simple and efficient manner, which would also detect emerging variants of the SARS-CoV-2.
Example 8: RBD-PB6 detection of SARS-CoV-2 using ELISA
Aim
To evaluate the use of RBD-PB6 aptamer for SARS-CoV-2 detection.
Materials and methods See example 1.
Results
An enzyme-linked immunosorbent sandwich assay (ELISA) was designed using capture antibodies - either binding to the S2 domain or to a non-overlapping epitope for the aptamer in the SI domain- in combination with the RBD-PB6 aptamer.
The aptamer was modified with an oligonucleotide extension in the 3 to allow its hybridization with a complementary biotinylated oligonucleotide that binds to the streptavidin-HRP conjugate.
In presence of Spike protein, the sandwich complex is formed and by addition of the TMB substrate, a colorimetric response dependent on the Spike protein concentration is used as read-out. As shown in Fig 14, the signal intensity follows a sigmoidal dependent curve at different Spike protein concentrations, with a limit of detection (LoD) lower than 20 pM of Spike protein.
Conclusion
These results demonstrated that the RBD-PB6 aptamer is able to detect SARS- CoV-2 with high sensitivity when using an ELISA assay.
Example 9: Pharmacokinetics of RBD-PB6 in vivo
Aim
To evaluate the pharmacokinetics of RBD-PB6 in vivo in a pegylated trimeric aptamer as well as a non-pegylated version.
Materials and methods See example 1.
Results The half-life of the trimeric RBD-PB6 Ta and a PEG20 modified version in mice was studied. To that end, intravenous (I.V.) injections in mice were performed and blood samples were drawn over 24h.
As depicted in Fig 15, trimeric aptamer functionalized with PEG20 clearly shows longer circulation times than the unmodified trimeric RBD-PB6 Ta aptamer. There is an approx. 10-fold increase in the circulation time of the pegylated trimeric aptamer compared to the non pegylated after IV injection in mice. The aptamer modified at the 3 'end with a PEG20 shows slower clearance. Similar results were obtained when using PEG40 or palmitoyl groups (data not shown).
Conclusion
These results demonstrated that aptamer functionalization with molecules known to increase circulation time (i.e. PEG polymers of different lengths, palmitoyl, etc.) shows improved pharmacokinetics and delays clearance from the bloodstream.
Example 10: Detection of further variants using RBD-PB6
Aim To evaluate of RBD-PB6 aptamer for detection of new variants, in particular Omicron variant.
Materials and methods See example 1.
Results
RBD-PB6 aptamer was found to bind strongly (more intense band in the test line, almost no gold-Ab complex is observed in the control line; data not shown) to recombinant omicron SI his tagged protein at a low nanomolar concentration (7 nM of SI omicron protein).
Subsequently, the sandwich detection platform based on the RBD-PB6 aptamer (biotinylated) and a complementary antibody (antibody 40150-D006; RRID Number: AB_2827985, SinoBiological, China) was implemented in a lateral flow assay (LFA) to compare its detection sensitivity to Omicron (BA.l) versus the alpha (B.1.1.7) and delta (B.1.617 ) variants. This experiment was performed with live SARS-CoV-2 virus.
Figure 16 shows that the aptamer-based LFA allows detection of low amounts of live SARS-CoV-2 virus (omicron variant) with a reliable optical readout down to 7.5E+04 pfu/mL (Figure 2A). Compared to other variants, the aptamer loses sensitivity against the omicron variant (Limit of detection (LoD): Alpha: ca. 1.5E+03 pfu/mL; Delta: ca. 6.0E+03 pfu/mL). An illustration of the LFAs at different titers are shown in Figure 2B. The control line 17 is visible for all of the LFAs, while the intensity of the test line 15 depends on the titer.
Conclusion These results suggest that RBD-PB6 aptamer can be used for detecting new SARS-CoV-2 variants such as Omicron (BA.l). Despite the lower sensitivity compared to previous variants (Alpha and Delta), the LoDs observed in the LFA experiments are above the average amount of virus found in nasopharyngeal swabs (1.6E+04 viral load/test; i.e. around 1.1E+05 viral load/mL),thus indicating that RBD-PB6 aptamer can be potentially employed in the described LFA platform for detection of currently circulating SARS-CoV-2 variants.
References
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 1990; 215(3): 403-410. Chandradoss SD et al. : Surface passivation for single-molecule protein studies. Journal of visualized experiments : JoVE, (2014).
Jensen H, 0stergaard J. : Flow Induced Dispersion Analysis Quantifies Noncovalent Interactions in Nanoliter Samples. Journal of the American Chemical Society. 2010; 132(12): 4070-1.
Kenan DJ, Keene JD. : In Vitro Selection of Aptamers from RNA Libraries. In: Haynes SRf editor. RNA-Protein Interaction Protocols. Totowa, NJ: Humana Press; 1999. p. 217-31.
Korber B, Fischer WM, Gnanakaran S, Yoon H, Theiler J, Abfalterer W, et al. : Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus. Cell. 2020;182(4):812-27.el9. Peterhoff D et al. : A highly specific and sensitive serological assay detects SARS- CoV-2 antibody levels in COVID-19 patients that correlate with neutralization. Infection 49, 75-82 (2021).
Preus S, Noer SL, Hildebrandt LL, Gudnason D, Birkedal V: iSMS: single-molecule FRET microscopy software. Nature methods 12, 593-594 (2015).
Preus S, Hildebrandt LL, Birkedal V: Optimal Background Estimators in Single- Molecule FRET Microscopy. Biophysical journal 111, 1278-1286 (2016). Schmitz A, Weber A, Bayin M, Breuers S, Fieberg V, Famulok M, et al.: A SARS- CoV-2 spike binding DNA aptamer that inhibits pseudovirus infection in vitro by an RBD independent mechanism. bioRxiv. 2020:2020.12.23.424171.
Song Y, Song J, Wei X, Huang M, Sun M, Zhu L, et al.: Discovery of Aptamers Targeting the Receptor- Binding Domain of the SARS-CoV-2 Spike Glycoprotein. Analytical Chemistry. 2020;92(14):9895-900. Vaneycken I, Devoogdt N, Van Gassen N, Vincke C, Xavier C, Wernery U, et al. : Preclinical screening of anti-HER2 nanobodies for molecular imaging of breast cancer. 2011;25(7):2433-46.
Sequence listing
SEQ ID NO: 1 RBD-PB6a-Sl SEQ ID NO: 2 RBD-PB6-Ta SEQ ID NO: 3 RBD-PB6 SEQ ID NO: 4 RBD-PB6a-s2 SEQ ID NO: 5 RBD-PB6a-s3 SEQ ID NO: 6 RBD-PB6-Tb SEQ ID NO: 7 RBD-PB6-TC SEQ ID NO: 8 RBD-PB6-Td SEQ ID NO: 9 RBD-PB6-Tinv (used interchangeably with RBD-PB6-Ta_inv) SEQ ID NO: 10 RBD-PB6a-extl SEQ ID NO: 11 RBD-PB6a-ext2 SEQ ID NO: 12 RBD-PB6a-ext3 SEQ ID NO: 13 Spike protein wt SARS-CoV-2 SEQ ID NO: 14 RBD-PB6a template SEQ ID NO: 15 RBD-PB6a_C template (complementary strand) SEQ ID NO: 16 RBD-PB6a dimer template SEQ ID NO: 17 RBD-PB6a dimer_C template (complementary strand) SEQ ID NO: 18 RBD-PB6a trimer template SEQ ID NO: 19 RBD-PB6a trimer_C template (complementary strand) SEQ ID NO: 20 RBD-PB6 template SEQ ID NO: 21 KKfor36 (Forward primer) SEQ ID NO: 22 KKrev36 (Reverse primer) SEQ ID NO: 23 alrev (Reverse primer) SEQ ID NO: 24 alfw (Forward primer) SEQ ID NO: 25 wt SARS-CoV-2 RBD (aa 319-532 of SEQ ID NO: 13) SEQ ID NO: 26 2Rbl7c Nanobody SEQ ID NO: 27 RBD-PB6_ext SEQ ID NO: 28 biotin-complementary oligo
Claims
1. An RNA aptamer, which prevents binding of the RBD and/or spike protein to ACE2, comprising a sequence having at least 80% sequence identity, such as at least 90% sequence identity to SEQ ID NO: 1.
2. The RNA aptamer according to claim 1, comprising a sequence having at least 90% sequence identity to SEQ ID NO: 2.
3. The RNA aptamer according to any of the claims 1-2, comprising a sequence having at least 90% sequence identity to SEQ ID NO: 3.
4. The RNA aptamer according to claim 1, wherein said sequence is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12.
5. The RNA aptamer according to any of the preceding claims, wherein said sequence is SEQ ID NO: 2 or SEQ ID NO: 3.
6. The RNA aptamer according to any of the preceding claims, wherein the RNA aptamer comprises one or more artificial nucleotides and/or artificial bonds, such as selected from the group consisting of 2'-F-pyrimidine, 2'-NH2-pyrimidine, 2'-0- Me, LNA (locked nucleic acid), 4'-S, TNA (threose nucleic acid), FANA (fluoroarabinonucleotide) and HNA (1,5-anhydrohexitol nucleic acid), preferably 2'-F-pyrimidine.
7. A multimeric RNA aptamer comprising at least two RNA aptamers as described in any one of the claims 1-6.
8. The multimeric RNA aptamer according to claim 7, comprising or consisting of 2-150 RNA aptamers, such as 2-125 RNA aptamers, like 3-100 RNA aptamers, such as 3-75 RNA aptamers, like 3-50 RNA aptamers, such as 3-25 RNA aptamers, like 3-12 RNA aptamers.
9. The multimeric RNA aptamer according to any of the claims 7-8, wherein said at least two RNA aptamers are separated by a linker.
10. The multimeric RNA aptamer according to any of the claims 7-9, wherein said linker comprises or consists of 3-23 adenosines, such as 3-11 adenosines, like 5-9 adenosines such as 8 adenosines.
11. The multimeric RNA aptamer according to any of the claims 7-10, wherein said multimeric RNA aptamer comprises at least two groups of trimers being separated with a connection linker, where optionally, said connection linker comprises more nucleotides than said linker separating said RNA aptamers in said trimer.
12. The multimeric RNA aptamer according to any of the claims 7-11, having KD value to RBD below 500 pM, such as below 400 pM, like below 300 pM, such as below 200 pM, like below 100 pM, such as below 75 pM, like below 50 pM, such as below 40 pM.
13. An RNA aptamer as described in any of the claims 1-6 and/or a multimeric RNA aptamer as described in any of the claims 7-12 for use as a medicament.
14. An RNA aptamer as described in any of the claims 1-6 and/or a multimeric RNA aptamer as described in any of the claims 7-12 for use in preventing, alleviating and/or treating infection with SARS-CoV-2 or variants thereof.
15. In vitro use of an RNA aptamer as described in any of the claims 1-6 and/or at least one multimeric RNA aptamer as described in any of the claims 7-12 in a detection assay for detecting and/or quantifying SARS-CoV-2 or variants thereof.
16. A detection device, adapted for detecting SARS-CoV-2 or variants thereof, comprising at least one RNA aptamer as described in any of the claims 1-6 and/or at least one multimeric RNA aptamer as described in any of the claims 7-12.
17. A kit of parts for detecting or quantifying SARS-CoV-2 or variants thereof comprising
at least one RNA aptamer as described in claims 1-6 and/or at least one multimeric RNA aptamer as described in claims 7-12;
- a detection device arranged for capturing said RNA aptamer and/or said multimeric RNA aptamer; - optionally, one or more reagents;
- optionally, instructions for using the kit of parts for detecting or quantifying SARS-CoV-2 or variants thereof.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21184829 | 2021-07-09 | ||
| EP21184829.6 | 2021-07-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023280685A1 true WO2023280685A1 (en) | 2023-01-12 |
Family
ID=76859527
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2022/068154 Ceased WO2023280685A1 (en) | 2021-07-09 | 2022-06-30 | Sars-cov-2 specific aptamer |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2023280685A1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR4286E (en) | 1904-10-20 | 1905-12-20 | Francois Jules Chapsal | Improvements to continuous pneumatic railway brakes |
-
2022
- 2022-06-30 WO PCT/EP2022/068154 patent/WO2023280685A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR4286E (en) | 1904-10-20 | 1905-12-20 | Francois Jules Chapsal | Improvements to continuous pneumatic railway brakes |
Non-Patent Citations (17)
| Title |
|---|
| ALTSCHUL SFGISH WMILLER WMYERS EWLIPMAN DJ: "Basic local alignment search tool", J MOL BIOL, vol. 215, no. 3, 1990, pages 403 - 410, XP002949123, DOI: 10.1006/jmbi.1990.9999 |
| AMOUZADEH TABRIZI MAHMOUD ET AL: "A photo-electrochemical aptasensor for the determination of severe acute respiratory syndrome coronavirus 2 receptor-binding domain by using graphitic carbon nitride-cadmium sulfide quantum dots nanocomposite", SENSORS AND ACTUATORS B: CHEMICAL, ELSEVIER BV, NL, vol. 345, 29 June 2021 (2021-06-29), XP086731409, ISSN: 0925-4005, [retrieved on 20210629], DOI: 10.1016/J.SNB.2021.130377 * |
| CHANDRADOSS SD ET AL.: "Surface passivation for single-molecule protein studies", JOURNAL OF VISUALIZED EXPERIMENTS : JOVE, 2014 |
| FABRIZIO CLERI ET AL: "DNA aptamers block the receptor binding domain at the spike protein of SARS-CoV-2", CHEMRXIV, 24 July 2020 (2020-07-24), pages 1 - 14, XP055761928, Retrieved from the Internet <URL:https://chemrxiv.org/articles/preprint/DNA_Aptamers_Block_the_Receptor_Binding_Domain_at_the_Spike_Protein_of_SARS-CoV-2/12696173> [retrieved on 20201221], DOI: 10.26434/chemrxiv.12696173.v1 * |
| JENSEN HOSTERGAARD J: "Flow Induced Dispersion Analysis Quantifies Noncovalent Interactions in Nanoliter Samples", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 132, no. 12, 2010, pages 4070 - 1, XP002637140, DOI: 10.1021/ja100484d |
| KENAN DJKEENE JD: "RNA-Protein Interaction Protocols", 1999, HUMANA PRESS, article "In Vitro Selection of Aptamers from RNA Libraries", pages: 217 - 31 |
| KORBER BFISCHER WMGNANAKARAN SYOON HTHEILER JABFALTERER W ET AL.: "Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus", CELL, vol. 182, no. 4, 2020, pages 812 - 27, XP055907214, DOI: 10.1016/j.cell.2020.06.043 |
| LIU XIAOHUI ET AL: "Neutralizing Aptamers Block S/RBD-ACE2 Interactions and Prevent Host Cell Infection", ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 60, no. 18, 22 March 2021 (2021-03-22), pages 10273 - 10278, XP055875601, ISSN: 1433-7851, DOI: 10.1002/anie.202100345 * |
| PETERHOFF D ET AL.: "A highly specific and sensitive serological assay detects SARS-CoV-2 antibody levels in COVID-19 patients that correlate with neutralization", INFECTION, vol. 49, 2021, pages 75 - 82, XP037355840, DOI: 10.1007/s15010-020-01503-7 |
| PREUS SHILDEBRANDT LLBIRKEDAL V: "Optimal Background Estimators in Single-Molecule FRET Microscopy", BIOPHYSICAL JOURNAL, vol. 111, 2016, pages 1278 - 1286, XP029755726, DOI: 10.1016/j.bpj.2016.07.047 |
| PREUS SNOER SLHILDEBRANDT LLGUDNASON DBIRKEDAL V: "iSMS: single-molecule FRET microscopy software", NATURE METHODS, vol. 12, 2015, pages 593 - 594 |
| SCHMITZ AWEBER ABAYIN MBREUERS SFIEBERG VFAMULOK M ET AL.: "A SARS-CoV-2 spike binding DNA aptamer that inhibits pseudovirus infection in vitro by an RBD independent mechanism", BIORXIV. 2020:2020.12.23.424171 |
| SONG YSONG JWEI XHUANG MSUN MZHU L ET AL.: "Discovery of Aptamers Targeting the Receptor-Binding Domain of the SARS-CoV-2 Spike Glycoprotein", ANALYTICAL CHEMISTRY, vol. 92, no. 14, 2020, pages 9895 - 900, XP055759814, DOI: 10.1021/acs.analchem.0c01394 |
| VALERO JULIÁN ET AL: "A serum-stable RNA aptamer specific for SARS-CoV-2 neutralizes viral entry", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 118, no. 50, 7 December 2021 (2021-12-07), XP055968781, ISSN: 0027-8424, DOI: 10.1073/pnas.2112942118 * |
| VALERO JULIÁN ET AL: "Supplementary Information for A serum-stable RNA aptamer specific for SARS-CoV-2 neutralizes viral entry", 7 December 2021 (2021-12-07), pages 1 - 15, XP055968780, Retrieved from the Internet <URL:https://www.pnas.org/doi/10.1073/pnas.2112942118#supplementary-materials> [retrieved on 20221006] * |
| VANEYCKEN IDEVOOGDT NVAN GASSEN NVINCKE CXAVIER CWERNERY U ET AL., PRECLINICAL SCREENING OF ANTI-HER2 NANOBODIES FOR MOLECULAR IMAGING OF BREAST CANCER, vol. 25, no. 7, 2011, pages 2433 - 46 |
| YANLING SONG ET AL: "Discovery of Aptamers Targeting the Receptor-Binding Domain of the SARS-CoV-2 Spike Glycoprotein", ANALYTICAL CHEMISTRY, vol. 92, no. 14, 18 June 2020 (2020-06-18), US, pages 9895 - 9900, XP055759814, ISSN: 0003-2700, DOI: 10.1021/acs.analchem.0c01394 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102349259B1 (en) | Nucleic Acid Sequencing Using Affinity Reagents | |
| Ols et al. | Multivalent antigen display on nanoparticle immunogens increases B cell clonotype diversity and neutralization breadth to pneumoviruses | |
| US9562907B2 (en) | Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method | |
| ES2617226T3 (en) | Multiplexed trials based on aptamers | |
| WO2013024763A1 (en) | Production method for nucleic acid aptamer | |
| US20220202935A1 (en) | Immunogen for Preventing or Treating Familial Frontotemporal Dementia (FTD) and/or Amyotrophic Lateral Sclerosis (ALS) | |
| US20160187342A1 (en) | DNA Aptamer Specifically Binding to EN2 (Engrailed-2) and Use Thereof | |
| EP3978510A1 (en) | Norovirus-binding peptide | |
| CN114457083B (en) | A group of single-stranded DNA nucleic acid aptamers that specifically recognize malachite green and their application | |
| WO2013056501A1 (en) | Compositions and methods for quantitative detection of microorganisms and cells | |
| WO2023280685A1 (en) | Sars-cov-2 specific aptamer | |
| WO2011146825A2 (en) | Avian influenza h5n1 specific aptamers and their use | |
| KR101513766B1 (en) | DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use | |
| JP7527848B2 (en) | Norovirus-binding peptide | |
| KR102946297B1 (en) | Method for manufacturing hotspot peptide-nucleic acids hybrid based on in vitro selection | |
| KR20190031705A (en) | DNA aptamer specifically binding to Avian influenza virus and uses thereof | |
| WO2025024292A1 (en) | Huh-antibody fusion proteins | |
| Zhong et al. | Modular DNA barcoding of nanobodies enables multiplexed in situ protein imaging and high-throughput biomolecule detection | |
| US20240218376A1 (en) | Aptamer-type multi-warhead covalent drug | |
| KR101678946B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to 25-hydroxy Vitamin D3 and Uses Thereof | |
| US11053538B2 (en) | Reagents and methods for blocking non-specific interactions with nucleic acids | |
| US20230365659A1 (en) | Sars-cov-2-binding peptide | |
| US20220213525A1 (en) | Simple method for detecting nucleic acid sequence, etc. | |
| US20250180560A1 (en) | Method for Rapid Capture, Detection and Analysis of Viruses on Surfaces | |
| CN116064553B (en) | Two DNA aptamers that specifically recognize Omicron and Delta mutants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22741244 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 22741244 Country of ref document: EP Kind code of ref document: A1 |


