WO2023218466A1 - Treatment of heart disease - Google Patents

Abstract

A method of inducing angiogenesis in a heart tissue is provided. The method comprising contacting the heart tissue with an effective amount of CCL24 or a nucleic acid molecule encoding same, thereby inducing angiogenesis in the heart tissue.

Description

TREATMENT OF HEART DISEASE

RELATED APPUCATION/S

This application claims the benefit of priority of Israel Patent Application No. 292957 filed on 11 May 2022, the contents of which are incorporated herein by reference in their entirety.

The Sequence Listing file, entitled 96O61.xml, created on 11 May 2023, comprising 40,960 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to a treatment of a heart disease.

Cardiovascular diseases (CVD) is the leading cause of death worldwide. CVD represents a class of disorders of the heart and blood vessels, including arrhythmias, heart failure, coronary artery disease and myocardial infarction (MI) among others. Ischemic CVDs, namely MI and stroke, account for 4 out 5 CVD deaths per year according to the World Health Organization (WHO). Though advancements in acute care of myocardial infarction (MI) have made it possible for more patients to survive heart attack, this growing population is left with permanent damage to the heart wall manifested by adverse heart wall remodeling, a drop-in quality of life, and, in many cases, death. To date, no therapy pertaining to the resolution of the resulting scar has breached the market; leaving a heretofore unmet clinical need for survivors of MI at risk for recurrent infarctions and heart failure. The irreversible nature of MI damage was thought to be the result of diminished cardiomyocyte (CM) proliferative capacity. However, the field of cardiac regeneration has arrived at the understanding that healing the heart does not hinge solely upon the recalled ability of CMs to proliferate; rather the capacity to regenerate will require the coordination of all major cardiac cell types (Skelly et al., 2018).

The immune system is well situated to facilitate the crosstalk necessary for cardiac injury repair; immune cells communicate between themselves, as well as with the cardiac fibroblasts (cFB) (Diny et al., 2016), endothelial cells and CMs (Swirski et al., 2018). During the acute inflammation phase, the production of inflammatory cytokines from intravasated immune cells, stressed CMs (Gwechenberger et al., 1999) and activated cFBs combines to further potentiate inflammatory signals (Swirski et al., 2018). While the immune cells recruited to the heart by these signals are necessary for tissue repair, it is well established that an over-inflammation reaction yields a poor outcome for scarring and cardiac function (Panizzi et al., 2010; Westman et al., 2016). Conversely, the absence of a robust immune response could also result in an instable scar and an increased likelihood for myocardial rupture (Amerogen et al., 2007). Therefore the acute inflammation phase must be transient, and appropriate in magnitude.

Undoubtedly Aardio-immunology’ is gaining steam as researchers appreciate the power of the immune system in coordinating not only healing, but a diversity of biological processes and functions at steady state conditions (Swirski et al., 2018). At gestation resident immune cells infiltrate the heart to participate in many homeostatic roles throughout life (Epelman et al., 2014). Resident cardiac macrophages (rcM(|)) for example may regulate innervation of nerves with CMs, assist in CM repolarization, and act as scouts for potential infections. With such diversity in location and function, macrophage composition even at steady state is heterogenous; and upon injury becomes more dynamic (Dick et al., 2019). Though some inflammatory macrophages can promote further tissue damage, it is well established that macrophages are necessary for the healing process. Indeed, macrophage depletion impairs scar formation in adult mouse models, and cardiac regeneration in neonatal mice (Aurora et al., 2014). Therefore, resolution of the cardiac macrophage subcategories and their function remains an important goal. Recent works have demonstrated that circulating monocytes express CCR2+ (Epelman et al., 2014), and after intravasation into the myocardium begin to express pro-inflammatory cytokines encouraging cardiac disease. However, the embryonic ally- derived rcM(|) population, characterized by TIMD+LYVE1+, have a cardio-protective role more analogous to neonatal macrophages with abilities to promote CM proliferation and angiogenesis, despite representing a small part of the macrophage pool in the first days after MI injury (Dick et al., 2019). The mechanism for how this rcM(|) population exerts its beneficial effect had not been explored in clinical aspects.

CCL24 has been well studied in the context of asthma and allergic reactions, and is apotent chemokine of eosinophils through the putative receptor CCR3 (Forssmann et al., 1997). Elevated levels of CCL24 have been observed in some infections where they potentiate a Th2 inflammation response, and in some chronic inflammatory diseases such as scleroderma (Mor et al., 2019) and nonalcoholic steatohepatitis. Though CCL24 appears to be a potent mediator of inflammation, high CCL24 expression in cancers may have an angiogenic effect (Jin et al., 2016) and it has been recently demonstrated that CCL24 exogenous expression has an effect on CM proliferation in rat neonatal cardiac cells in vitro (Wang et al., 2019).

Additional background art includes:

WO2017/072772 SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of inducing angiogenesis in a heart tissue, the method comprising contacting the heart tissue with an effective amount of CCL24 or a nucleic acid molecule encoding same, thereby inducing angiogenesis in the heart tissue.

According to an aspect of some embodiments of the present invention there is provided a method of treating a heart disease in a subject in need thereof, the method comprising administering to the subject in an acute manner a therapeutically effective amount of CCL24 or a nucleic acid molecule encoding same, which induces angiogenesis in a heart tissue, thereby treating the heart disease.

According to an aspect of some embodiments of the present invention there is provided a composition comprising a therapeutically effective amount of CCL24 or a nucleic acid molecule encoding same for use in treating a heart disease in a subject in need thereof, wherein the treating is acute treatment.

According to some embodiments of the invention, the contacting is in an acute manner.

According to some embodiments of the invention, the acute is at time of cardiac inflammation.

According to some embodiments of the invention, the acute is up to 96 hours following initiation of symptoms of the heart disease.

According to some embodiments of the invention, the effective amount results in improvement of a heart function as determined by ejection fraction, stroke volume, fractional shortening and/or scar area.

According to some embodiments of the invention, the effective amount and acute treatment cause a reduction in scar area.

According to some embodiments of the invention, the heart tissue is an adult tissue.

According to some embodiments of the invention, the subject is an adult.

According to some embodiments of the invention, the method is performed ex-vivo.

According to some embodiments of the invention, the method is performed in-vivo.

According to some embodiments of the invention, the administering is by local administration.

According to some embodiments of the invention, the composition is formulated for local administration.

According to some embodiments of the invention, the local administration comprises intramyocardial injection. According to some embodiments of the invention, the heart tissue comprises adult cardiomyocytes or juvenile cardiomyocytes.

According to some embodiments of the invention, the heart disease is an ischemic heart disease or a heart failure.

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIGs. 1A-E show that Agrin induces CCL24 expression specific to resident cardiac macrophages. (A) UMAP representation of 15,028 Agrin and 4,633 PBS CD45+ cells analyzed, which identified 20 clusters (left, n=5, macrophages, M(|); monocytes, mono; granulocytes, GRN; dendritic cells, DC), and UMAP showing the contribution of Ag/PBS samples (right). (B) UMAP expression plot shows differential expression of CCL24 in LYVE1/TIMD4+ M(|) clusters 1 and 4 in PBS (left) versus agrin (right) treated hearts. (C) QPCR of CCL24 in agrin vs PBS treated hearts at 6hr, 12hr, Id, 2d, 7d, 14d timepoints demonstrates elevation in CCL24 levels between 12hr and 2d after MI with agrin treatment (values normalized to SHAM, n=3 mice per condition per timepoint, multiple t-tests with Benjamini, Krieger and Yekutieli correction). (D) CCL24 ELISA in agrin vs PBS treated hearts at 6hr, 12hr, Id, 7d, 14d timepoints shows a trend in higher CCL24 levels with agrin treatment at 1 day post MI (dpmi; values normalized to SHAM, n=3 mice per condition per timepoint n=3 mice per condition per timepoint, multiple t-tests with Benjamini, Krieger and Yekutieli correction). (E) smFISH in agrin treated hearts 1 dpmi shows Ccl24 probe colocalizes with CD45+/LYVE1+ immune cells in the infarct zone (representative image, n=4 mice). FIGs. 2A-F show that CCL24 administration post- MI facilitates cardiac regeneration by various functional parameters. (A-C) Echocardiographic measurements demonstrate recovery in ejection fraction, longitudinal fractional shortening and stroke volume in ICR adult female mice treated with CCL24 versus PBS. Echos analyzed 2 days pre-MI, then 2, 14 and 35 dpmi (2-way ANOVA followed by Dunnett’s test; p-values reported are CCL24 vs PBS). To the right, the graph shows the delta EF/FS/SV values, respectively, between baseline and 35 dpmi measurements per mouse (1-way ANOVA with Dunnett’ s test, ****p-value<0.0001). (D) After 35 dpmi endpoint, CCL24 injected mice had a reduced heart weight/body weight ratio versus PBS controls (Brown- Forsythe and Welch 1-way ANOVA with Dunnett’s test, p=0.0419) (E) Representative images of Masson Trichrome (MT) staining of PBS (top) and CCL24 (bottom) treated hearts 35 dpmi. (F) Scar area is reduced in CCL24 vs PBS injected hearts 35 dpmi as determined by area of MT staining in the section containing the largest scar. (Brown-Forsythe and Welch 1-way ANOVA with Dunnett’s Test). In all figures: n=18 PBS, 24 CCL24, 8 SHAM.

FIGs. 3A-0 show that CCL24 administration has pro-regenerative effects on major cardiac cell types. (A) Representative image of in vitro P7 ICR cardiac culture (B) have more %ki67+ cardiomyocytes with Agrin (100 ng/ml) and CCL24 (10 ng/ml) addition (one-way ANOVA, Tukey’s correction, 3 biological replicates, scale bar=50 pm). (C) Representative images of HUVEC tubule formation assays with serum (FBS), no serum (EBM) and no serum with CCL24 (EBM with 100 ng/mL CCL24) and the corresponding quantitation (D-H) for nodes, junctions, meshes, total length and mean mesh size across 5, 10, 50, 100 ng/ml CCL24 concentrations (Brown-Forsythe and Welch 1-way ANOVA with Dunnett’s test, 3 biological repeats, scale bar=500 pm), (i) Representative images of the infarct area and (J) and respective quantitation of CD31+ and EMCN+ blood vessels in the infarct 7 dpmi treated with PBS (left) and CCL24 (right) (n=5 PBS, 6 CCL24; T-test with Welch’s correction). (K) Quantitation of %ki67+ cFBS in vitro after 1 passage in the presences of CCL24 at concentrations of 0, 5, 10, 25, 50, 100 ng/ml; and (L) samples are binned based on no CCL24 addition (0 ng/ml), mid-CCL24 application (5- 10 ng/ml), and high-CCL24 application (>25 ng/ml). P-value is reported (Brown-Forsythe and Welch 1-way ANOVA with Dunnett’ s test, 2 biological repeats). (M) Representative images of in vitro cultured cFBs after 1 passage in the presence of 0 (above) or 100 ng/ml (below) CCL24 application. Insets (yellow box) show smooth muscle actinin (aSMA) and vimentin channels independently to reveal aSMA-/VIM+ cFBs (yellow arrows) scale bar=500 pm Quantitation follows in (N) demonstrating the % aSMA+/VIM+ cFBs over CCL24 at concentrations of 0, 5, 10, 25, 100 ng/ml (Brown-Forsythe and Welch 1-way ANOVA with Dunnett’s test, 3 biological repeats). (O) PBS and CCL24 treated hearts 7 dpmi labeled for periostin (POSTN) and aSMA, scale bar=500 pm FIGs. 4A-I shows that CCL24 application reduces expression of CCL2, CCL3 and IL17. For Figures 4A-H: ELISA measures cytokine levels from heart lysate extracted from infarcted hearts after 6hrs, 1 day, 4 days, and 14 dpmi with PBS or CCL24 application as compared to noninjured controls (n=3 per sample, nested 1-way ANOVA with Benjamini, Krieger and Yekutiel correction). At 6 hrs post-MI (A) CCL2, (C) CCL3, and (E) IL17 levels increase more in PBS as compared to CCL24 treated infarcted hearts. (B, D, F) No reduced cytokine levels upon CCL24 treatment may be observed in later timepoints, (G) or in IL4 (H) or TNFa. (I) FACS of SiglecF+/Ly6G+ eosinophil population from infarcted hearts 7 dpmi reveals no difference in eosinophil infiltration between PBS and CCL24 conditions, only increased infiltration between CCL24 and SHAM treated controls (n=l l PBS, 14 CCL24, 7 SHAM; p-adj reported, 1-way ANOVA).

FIGs. 5A-G show that CCL24 supports angiogenic and lymphatic improvement post-MI. (A) Representative images of angiogenic behaviors in vitro cardiac cultures after 12 days by CD31 staining reveal a (B) longer and (C) more branched endothelial cell network with 100 ng/mL CCL24 application as compared to PBS controls (20x images, n=12 technical replicates; T-test with Welch’s correction). (D) Representative images of LYVE1+ lymphatic vessels (red) in the infarct of PBS or CCL24 treated hearts 4 dpmi (inset scale bar 100 um), (E) and the respective quantitation of lymphatic vessels in the infarct and border zone (n= 2 PBS, 7 CCL24; T-test). (F) EdU pulse from days 4-7 dpmi labels endothelial cells in vessels in the infarct zone (IZ), border zone (BZ), but not the remote zone (RZ); after 14 dpmi more vessels contain EdU+ cells in the IZ of CCL24 treated hearts vs PBS controls (n=5 biological repeats per sample, multiple T-tests with Benjamini, Krieger and Yekutiel correction). (G) Representative image of CCL24 treated infarcted heart 14 dpmi after 4-7 day EdU+ demonstrates EdU+ incorporation into vessels in the IZ, BZ, but not RZ (scale bar 1000 um, inset scale bar 50 um).

FIGs. 6A-J show proteomic analysis that indicates a cardioprotective role for CCL24. (A) Representative images of Masson Trichrome (MT) staining of PBS (top) and CCL24 (bottom) treated hearts 4 dpmi. (B) Scar area is reduced in CCL24 vs PBS injected hearts 4 dpmi as determined by area of MT staining in the section containing the largest scar (n= 4 PBS, 5 CCL24, 2 SHAM; Brown-Forsythe and Welch’s 1-way ANOVA with Dunnett’s Test). (C) Neither scar area nor (D) SMA+ vessel number at 1 dpmi are significantly different between PBS and CCL24 treated hearts (n= 3 per sample, T-test). (E) Proteomic analysis downstream of mass spectrometry compares infarcted hearts 3 dpmi with PBS or CCL24 treatment against uninjured controls. Graph represents the number and direction of differentially expressed proteins (DEPs) across 3 comparisons, PBS vs CCL24 treatment, PBS vs uninjured controls, and CCL24 vs uninjured controls (for all proteomic figures: n= 4 biological replicates per sample). (F) Venn diagram representation shows DEPs specific or common to PBS or CCL24 treatment vs uninjured controls. (G) Heatmap generated from the proteomics analysis reveals 3 clusters: 1- DEPs common to injury, 2- DEPs with increased expression upon CCL24 treatment, 3- DEPS with decreased expression upon CCL24 treatment (n=4, p<0.05). (H) Volcano plot of DEPs between CCL24 and PBS (grey lines represent cutoffs, FO1.5, -log(padj) >1.30). (I) Functional enrichment analysis for DEPS only in PBS controls or (J) CCL24 treated mice (FO1.5, p<0.05, Wikipathway/KEGG/Reactome/GO) .

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to treatment of heart diseases.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

Whilst searching for mechanisms by which the immune system coordinates a regenerative response in myocardial infarction (MI), the present inventors uncovered pro-regenerative rcM(|) populations that express Ccl24, a chemokine well known to attract eosinophils but understudied in the heart. The present inventors have uncovered a pleiotropic role for this chemokine in the heart: angiogenesis and lymphatic inducer; and immune modulator. Hence the present invention is based, in some embodiments thereof, on acute administration of CCL24 to mediate these properties in the treatment of heart diseases.

As shown in the Examples section which follows, QPCR and ELISA demonstrated an increase in Ccl24 levels in the heart 12-48 hours after MI in agrin treated hearts; and smFISH experiments validate the expression of Ccl24 in the rcM(|) population at this timepoint. Injection of CCL24 peptide (0.25 g in 30 pl volume, 27-119aa) into the myocardium directly after MI facilitates cardiac regeneration by echocardiographic functional parameters including ejection fraction, stroke volume, and fractional shortening. CCL24 treated hearts also have a significant reduction in scar size. Exogenous CCL24 application to P7 primary cardiac cells in vitro directly stimulates cardiomyocyte (CM) proliferation, and application to human umbilical cord endothelial cell culture stimulates tubule formation. Immunofluorescence (IF) staining of blood vessel markers endomucin and CD31 in heart sections treated with CCL24 or PBS controls corroborates the strong angiogenic effect of CCL24. By IF staining both in vitro and in vivo, the present inventors verified that CCL24 does not potentiate the fibroblast injury response. The present inventors further showed that CCL24 application attenuates expression of CCL2, CCL3 and IL17, but not other cytokines such as U_4 or TNFa at 6hrs post-MI in heart lysate. Canonically, CCL24 functions as a potent eosinophil attractant, however FACS analysis did not show evidence of increased eosinophil infiltration into the myocardium as compared to PBS controls; implicating a non-canonical mechanism as the mode of action for CCL24 effects in the heart. Further investigation of the vascular effects of CCL24 administration showed that CCL24 addition to cardiac cultures promotes proxies of angiogenesis by CD31 staining. In vivo CCL24 application promotes the lymphatic network in addition to the vascular network. CCL24 treatment increases incorporation of proliferative endothelial cells in vascular vessels, corroborating the dynamic nature of these vessels and the role of CCL24 in enhancing vascular remodeling. These results were further corroborated by proteomic analysis which further showed a protective effect of CCL24 in response to oxidative stress.

Taken together, the present inventors have demonstrated that CCL24 can act as an immunotherapy to coordinate cardiomyocyte, angiogenic and fibrotic responses to MI injury, resulting in an improved outcome in adult murine MI models.

Thus, according to an aspect of the invention, there is provided a method of inducing angiogenesis in a heart tissue, the method comprising contacting the heart tissue with an effective amount of CCL24 or a nucleic acid molecule encoding same, thereby inducing angiogenesis in the heart tissue.

According to some embodiments of the invention the contacting is performed ex vivo. According to some embodiments of the invention the contacting is performed in vivo. According to an alternative or an additional aspect, there is provided a method of treating a heart disease in a subject in need thereof, the method comprising administering to the subject in an acute manner a therapeutically effective amount of CCL24 or a nucleic acid molecule encoding same, which induces angiogenesis in a heart tissue, thereby treating the heart disease.

According to an alternative or an additional aspect, there is provided composition comprising a therapeutically effective amount of CCL24 or a nucleic acid molecule encoding same for use in treating a heart disease in a subject in need thereof, wherein said treating is acute treatment.

As used herein “CCL24” refers to the Chemokine (C-C motif) ligand 24 (CCL24) also known as myeloid progenitor inhibitory factor 2 (MPIF-2) or eosinophil chemotactic protein 2 (eotaxin-2). It is a protein that in humans is encoded by the CCL24 gene. The gene symbol is CCL24. An exemplary protein product is provided in NM_002991. The term relates to the CCL24 protein but also to the DNA or RNA encoding same. Thus, also envisaged herein are functional variants of CCL24 which are at least 80 %, 81 %, 82 %, 83 %, 84 %, 85 %, 86 %, 87 %, 88 %, 89 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 % identical to the amino acid sequence set forth in SEQ ID NO: 26 or 27, as long as they retain their ability to induce angiogenesis in a heart tissue.

According to a specific embodiment, the heart tissue comprises endothelial cells or precursors thereof to form blood vessels.

As used herein, “identity” or “sequence identity” refers to global identity,

an identity over the entire amino acid or nucleic acid sequences disclosed herein and not over portions thereof.

Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, and MUSCLE. The homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including an amino acid substitution, as further described hereinbelow.

A functional variant of a polypeptide may be also a fragment of the original polypeptide. The term "fragment", when used in reference to a reference polypeptide (e.g., SEQ ID NO: 26 or 27), refers to a polypeptide in which amino acid residues are deleted as compared to the reference polypeptide itself, but where the remaining amino acid sequence is usually identical to the corresponding positions in the reference polypeptide. Such deletions can occur at the amino - terminus or carboxy-terminus, anywhere in between of the reference polypeptide, or alternatively both. Fragments typically are at least 3, 5, 6, 8 or 10 amino acids long, at least 14 amino acids long, at least 20, 30, 40 or 50 amino acids long, at least 75 amino acids long. According to a specific embodiment, the length of the fragment or variant does not exceed 92 amino acids (e.g., without the signal peptide).

According to a specific embodiment the amino acid sequence of the CCL24 consists or comprises amino acid sequence 27-119 of SEQ ID NO: 26 or 27.

The term "functional variant" may alternatively or additionally include conservatively substituted variants or mutations (including insertion or substitutions) which do not decrease the activity of CCL24 in mediating angiogenesis of a heart tissue.

As used herein “decrease” refers to at least about 5 %, 10 %, 20 %, 30 % or more reduction in CCL24 activity as compared to that of a CCL24 comprising the native sequence (e.g., SEQ ID NO26 or 27).

The term "conservatively substituted variant" refers to a peptide comprising an amino acid residue sequence that differs from a reference peptide by one or more conservative amino acid substitution, and maintains some or all of the activity of the reference peptide as described herein. A "conservative amino acid substitution" is a substitution of an amino acid residue with a functionally similar residue. Examples of conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another; the substitution of one charged or polar (hydrophilic) residue for another, such as between arginine and lysine, between glutamine and asparagine, between threonine and serine; the substitution of one basic residue such as lysine or arginine for another; or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another; or the substitution of one aromatic residue, such as phenylalanine, tyrosine, or tryptophan for another. The phrase "conservatively substituted variant" also includes peptides wherein a residue is replaced with a chemically derivatized residue, provided that the resulting peptide maintains some or all of the activity of the reference peptide as described herein.

Thus, according to a specific embodiment, the functional variant is a peptide fragment of the CCL24 polypeptide (e.g., positions 27 to 119 of SEQ ID NO: 26 or 27).

Also envisaged herein are functional variants which are homologs, orthologs and synthetic versions of CCL24.

Thus, contemplated herein are amino acid sequences which are at least 95 % identical to SEQ ID NO: 26 or 27 (Genebank Accession No. NM_002991.3 or Genebank Accession No. AAB51135, respectively).

Also contemplated herein are chimeric versions of CCL24 which have an improved halflife in the serum compared to the CCL24 portion per se.

Without wishing to be bound by any particular theory of operation, a heterologous amino acid sequence such as an immunoglobulin region can increase serum-half life or bioavailability of a fusion polypeptide and the precise polypeptide sequences of the Fc portion can be selected to maximize serum-half life and/or bioavailability. In addition, Fc regions from different IgG subclasses (e.g., IgGl, IgG2, IgG3, and IgG4) exhibit different immunological activities, and therefore the IgG Fc region can be selected based on a desired immunological activity. For example, the Fc region of IgGl can activate complement, while the Fc region of IgG4 has reduced complement activity.

Thus, a particular Fc region can be selected for a particular application based on the desired immunological activities manifested by each region. In some particular embodiments, the Fc region can be the Fc region of human IgGl, IgG2, IgG3 or IgG4. As such, the chemokine- immuno globulin fusion polypeptide find utility in enhancing immunity, suppressing autoimmunity, suppressing inflammation, and/or inhibiting growth/metastasis of proliferative disorder cells. The present application further provides isolated polynucleotide which encode the chemokine-immunoglobulin fusion polypeptide disclosed herein and expression vectors capable of expressing the chemokine-immunoglobulin fusion polypeptide in vivo.

According to specific embodiments, the heterologous sequence can be attached to the chemokine (i.e., CCL24) directly or via a linker that may be derived from naturally-occurring proteins or is an empirical linker as described, for example, in Chichili et al., (2013), Protein Sci. 22(2): 153-167, Chen et al., (2013), Adv Drug Deliv Rev. 65(10): 1357-1369. In some embodiments, the linker may be designed using linker designing databases and computer programs such as those describedin Chen et al., (2013), Adv Drug Deliv Rev. 65(10): 1357-1369 and Crasto et al (2000), Protein Eng. 13(5):309-312, the entire contents of which are hereby incorporated by reference.

In some embodiments, the chemokine-immunoglobulin fusion polypeptides of the present application, as well as the chemokine per se or variants thereof, are conjugated to a non-protein polymer to form protein-polymer conjugates. Unless specifically indicated to the contrary, the term "non-protein polymer" is defined as a molecule formed by covalent linkage of two or more monomers, wherein none of the monomers is contained in the group contains amino acids. Serum soluble non-protein polymers, such as polyethylene glycol, and tissue or fat soluble polymers, such as polycaprolactone, can be used for delivery, release, and/or retention of polypeptides. In some embodiments, the protein-polymer conjugate is a pegylated chemokine-immunglobulin fusion polypeptide, chemokine or a variant thereof.

As mentioned, the CCL24 may also be provided in the form of a nucleic acid sequence encoding the CCL24 or a functional variant of same.

Synthetic or in vztro-translated mRNA is engineered to mimic naturally occurring mRNA (Jirikowski et al., 1992 Science 255, 996-998. doi: 10.1126/science.1546298; Conry et al., 1995 Hum. Vaccines Immunother. 14, 839-846. doi: 10.1080/21645515.2017.1412896). According to some embodiments of the invention, it comprises a single- stranded open reading frame flanked by untranslated regions, and has a 5' cap for translation, and a 3' poly(A) tail for stability (Conry et al., 1995, supra; Whisenand et al., 2017 Considerations for the Design and cGMP Manufacturing of mRNA Therapeutics. San Diego, CA: TriLink BioTechnologies; Shin et al., 2018 Adv. Ther. 1: 1800065. doi: 10.1002/adtp.201800065). Exogenous mRNA is translated into protein in the cytoplasm, and degrades within the cytoplasm typically within minutes to hours, posing no risk of integration into the genome. Development and manufacturing of RNA therapeutics is relatively simple and a more cost-effective process comparing to that for recombinant proteins or small molecules. In addition, RNA sequences can be easily modified allowing for personalization of RNA therapy. US20190241633 teaches compositions and methods for formulating CCL24 RNA for therapy.

Damase et al. Front. Bioeng. Biotechnol., 18 March 2021 www(dot)doi(dot)org/10(dot)3389/fbioe(dot)2021(dot)628137 teaches methods and formulations for mRNA delivery.

U.S. Patent Nos. 9,889,202 and 11,090,264 teach systems and methods for RNA delivery for expression of therapeutic proteins, each of which is incorporated herein by reference.

Hence, contemplated herein are polynucleotides (DNA or RNA or combinations of same) encoding CD24 or functional variants thereof. The term CCL24 is aimed at including the protein of CCL24 as well as nucleic acid sequences (e.g., DNA, RNA) encoding same.

The polynucleotide sequence may comprise synthetic modifications and/or codon usage which increase their pharmacokinetics.

According to a specific embodiment, the CCL24 is in a soluble form.

According to a specific embodiment, the CCL24 is in an insoluble form.

According to a specific embodiment, the CCL24 is comprised in a delivery vehicle (e.g., liposome).

As used herein “angiogenesis” refers to the formation of new blood vessels. This process involves the migration, growth, and differentiation of endothelial cells which line the inside wall of blood vessels. Methods of determining angiogenesis can include in vitro and in vivo methods. For instance, an in vitro assay can be a tubule formation assay such as described in the Examples section and an in vivo assay is describedin Figures 31 and 3 J. Other in vivo and in vitro assays are described in details in Staton et al. Int J Exp Pathol. 2009 Jun; 90(3): 195-221.

According to a specific embodiment, the heart tissue is a post-natal tissue.

According to a specific embodiment, the heart tissue is a juvenile tissue.

According to a specific embodiment, the heart tissue is an adult tissue.

The age is defined by regulatory agencies definitions e.g., FDA.

The term “treating” refers to inhibiting, preventing or arresting the development of a pathology (i.e., heart disease, disorder or condition, e.g., ischemic heart disease) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology. As used herein, the term “preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.

As used herein, the term “subject” includes mammals, preferably human beings at any age (e.g., infant, child, juvenile, adult) that suffer from the pathology. Preferably, this term encompasses individuals who are at risk to develop the pathology. According to some embodiments, the subject is not a prenatal or neonatal subject. According to an embodiment, the subject can be above 13, 18, 25, 50, 60 or 65 years of age.

According to a specific embodiment, the heart disease is an ischemic heart disease.

An ischemic heart disease refers to a lack of oxygen flow to the heart or portion thereof, resulting in myocardial ischemic damage. As used herein, the phrase myocardial ischemic damage includes damage caused by reduced blood flow to the myocardium Non-limiting examples of causes of an ischemic heart disease and myocardial ischemic damage include: decreased aortic diastolic pressure, increased intraventricular pressure and myocardial contraction, coronary artery stenosis (e.g., coronary ligation, fixed coronary stenosis, acute plaque change (e.g., rupture, hemorrhage), coronary artery thrombosis, vasoconstriction), aortic valve stenosis and regurgitation, and increased right atrial pressure. Non-limiting examples of adverse effects of myocardial ischemia and myocardial ischemic damage include myocyte damage (e.g., myocyte cell loss, myocyte hypertrophy, myocyte cellular hyperplasia), angina (e.g., stable angina, variant angina, unstable angina, sudden cardiac death), myocardial infarction, and congestive heart failure. Damage due to myocardial ischemia may be acute or chronic, and consequences may include scar formation, cardiac remodeling, cardiac hypertrophy, wall thinning, dilatation, and associated functional changes. The existence and etiology of acute or chronic myocardial damage and/or myocardial ischemia may be diagnosed using any of a variety of methods and techniques well known in the art including, e.g., non-invasive imaging (e.g., MRI, echocardiography), angiography, stress testing, assays for cardiac-specific proteins such as cardiac troponin, and evaluation of clinical symptoms. These methods and techniques as well as other appropriate techniques may be used to determine which subjects are suitable candidates for the treatment methods described herein.

According to a specific embodiment, the ischemic heart disease in the present invention includes, for example, coronary arteriosclerosis, acute myocardial infarction (AMI), myocardial infarction (MI), old MI, angina pectoris (AP) including stable angina, unstable angina, and effort angina, ischemic cardiomyopathy, heart failure, chronic heart failure, and other disease which causes necrosis of heart muscle that results from prolonged ischemia. As necrosis of heart muscle progresses, the damaged myocardial tissue is replaced with fibrous tissue, thickness of the myocardial wall in the infarct zone gets thinner, and the cardiac inner cavity dilates, therefore cardiac function such as contractility deteriorates and results in heart failure.

Coronary arteriosclerosis is characterized by arteriosclerosis in the coronary artery that supplies nutrients to the heart. Angina pectoris is characterized by attacks of chest pain caused by impaired blood flow in the coronary artery. Myocardial infarction is characterized by myocardial necrosis caused by impaired blood flow in the coronary artery and by fatal complications coming therewith such as arrhythmia, cardiac failure, cardiac rupture, and pump failure. Impaired blood flow to the heart, a vital organ, is an essential characteristic of these ischemic heart diseases.

"Post-infarction myocardial remodeling" refers to a series of changes such as the hypertrophy of myocardial cells at non-infarction sites, increase in interstitial tissue (extracellular matrix), and the dilation of cardiac lumens, which occur in compensation for reduced cardiac function caused by thickening at infarction sites after myocardial infarction. Since long-term prognosis after myocardial infarction is correlated with the degree of left ventricular dysfunction, the suppression of myocardial remodeling is important for maintaining and conserving the function of the left ventricle.

According to some embodiments of the invention, the ischemic heart disease is selected from the group consisting of acute myocardial infarction (AMI), myocardial infarction (MI) and Chronic heart failure (CHF).

According to some embodiments of the invention, the ischemic heart disease is myocardial infarction (MI).

As mentioned, the CCL24 or variant thereof is contacted with the heart tissue in an acute manner (i.e., as opposed to a chronic manner).

Namely, the tissue is treated only one or several times with the CCL24 or variant thereof.

In such a modality, treatment is done before fibrosis has commenced (scar formation).

The heart tissue comprises cardiomyocytes.

As used herein “a cardiomyocyte” or “cardiomyocytes” (abbreviated as, CM, CMs), also known as myocardiocytes or cardiac myocytes, are the muscle cells (myocytes) that make up the cardiac muscle. The term refers to cardiomyocytes of any species including mammalian, e.g., human at any stage of development. According to a specific embodiment, the cardiomyocyte is a neonatal CM (e.g., for human up 6 months after birth). According to a specific embodiment, the cardiomyocyte is an adult cardiomyocyte (e.g., for human at least 16-18 years after birth). The CCL24 or variants thereof of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism

Herein the term "active ingredient" refers to the agent (e.g., CCL24 or variants thereof) accountable for the biological effect.

Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

According to a specific embodiment, “acute” is at time of cardiac inflammation. This can be determined by imaging (e.g., MRI) or using molecular markers for inflammation such as CRP (an inflammation indicator).

According to some embodiments of the invention, the acute administration or contacting is up to 96 hours (e.g., up to 72 hours, 48 hours or 24 hours) following initiation of symptoms of said heart disease, e.g., myocardial infarction.

According to some embodiments of the invention, the effective amount results in improvement of a heart function as determined by ejection fraction, stroke volume, fractional shortening and/or ventricular wall thickness.

According to some embodiments of the invention, the effective amount and acute treatment prevent fibrosis.

According to some embodiments of the invention, the therapeutically effective amount comprises a single administration.

According to some embodiments of the invention, the therapeutically effective amount comprises a repeated administration.

According to some embodiments of the invention, the repeated administration comprises at least 2 administrations. According to some embodiments of the invention, a first administration of the at least 2 administrations is immediately after onset of symptoms of the heart disease and a second administration of the two administrations is within 96 hours from the diagnosis.

According to some embodiments of the invention, a first administration of the at least 2 administrations is immediately after symptoms onset or diagnosis of the ischemic heart disease and a second administration of the two administrations is within 48-96 hours from symptoms onset or diagnosis.

According to some embodiments of the invention the effective amount results in improvement of a heart function as determined by ejection fraction, stroke volume, fractional shortening and/or ventricular wall thickness.

According to some embodiments of the invention the said effective amount and acute treatment prevent fibrosis.

Techniques for formulation and administration of drugs may be found in “Remington’ s Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, intravenous, intraperitoneal, intranasal, or intraocular injections.

Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient. For example by direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery. Also contemplated is administration of the composition directly to the myocardium e.g., either during open heart surgery or guided by imaging e.g., ultrasound.

According to a specific embodiment, the administration of CCL24 or variants thereof is by intramyocardial administration.

According to a specific embodiment, the administration of CCL24 or variants thereof is by anterograde intracoronary administration.

As used herein “anterograde intracoronary administration” refers to injection into the blocked coronary artery with a standard catheter (with the blood flow using an autoperfusion balloon angioplasty catheter). In the case of ongoing ischemic disease, the injection is performed in the process of clinical reperfusion, injecting via the same catheter used for reperfusion. The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

According to a specific embodiment the therapeutically effective amount comprises a single administration.

Typically, such administration is immediately after diagnosis of the ischemic heart disease e.g., up to 12 hours following diagnosis and/or concomitantly with treatment e.g., angioplasty performed for reperfusion of the ischemic heart. Administration will be done "over the wire" into the affected regions of the ischemic heart using the same catheter directed at autoperfusion.

CCL24 or variants thereof may be administered one or several times following diagnosis or heart disease symptoms initiation.

Thus, according to some embodiments of the invention the therapeutically effective amount comprises a repeated administration.

According to a specific embodiment, the repeated administration comprises at least 2 administrations.

According to a specific embodiment, the first administration of the at least 2 administrations is immediately after diagnosis e.g., up to 12 hours following diagnosis and/or concomitantly with treatment (e.g., by angioplasty), as described above, of the ischemic heart disease and a second administration of the two administrations is within 96 hours from the diagnosis and/or angioplasty.

According to a specific embodiment, the first administration of the at least 2 administrations is immediately after diagnosis e.g., up to 12 hours following diagnosis of the ischemic heart disease and a second administration of the two administrations is within 48-96 hours from said diagnosis.

Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen- free water based solution, before use.

The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (e.g., CCL24 or variant thereof) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., ischemic heart disease) or prolong the survival of the subject being treated.

Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).

Dosage amount and interval may be adjusted individually to provide for example, a cardiac tissue levels of the active ingredient that are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure or diminution of the disease state are achieved.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

The agent is delivered by an appropriate means to the site of defect (e.g., as described above). The site and subject are observed and tested for regeneration of the defective myocardium to determine that an effective amount of the composition has been delivered, particularly to observe new tissue growth, and also to determine that the new tissue has the contractility necessary for it to function usefully as myocardium Tissue growth and contractility can be tested and observed by standard means, for example as described in Badylak et al, The Heart Surgery Forum, Extracellular Matrix for Myocardial Repair 6(2) E20-E26 (2003).

Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

The agents as described herein can also be immobilized to an implant (e.g., stent) where they can be slowly released therefrom

The agent as described herein can be combined with other treatment modalities. These other treatments include medication (e.g., blood pressure medication, calcium channel blockers, digitalis, anti- arrhythmic s, ACE inhibitors, anti-coagulants, immunosuppressants, pain relievers, vasodilators, etc.), treatment with Agrin (as described for instance in U.S. Patent Publication Number 2020/0306343), angioplasty, stent placement, coronary artery bypass graft, cardiac assist device (e.g., left ventricular assist device, balloon pump), pacemaker placement, heart transplantation, etc. In certain embodiments, the agent provides a bridge to recover for a subject waiting to undergo heart transplantation.

As used herein the term “about” refers to ± 10 %.

The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".

The term “consisting of’ means “including and limited to”.

The term "consisting essentially of' means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof

Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely nt, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as, various features of the invention, which are, for brevity, described in the context of a single embodime delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

MATERIALS AND METHODS

Mouse experiments and LAD ligation surgeries

Experiments were approved by the Animal Care and Use Committee at the Weizmann Institute of Science. Adult ICR female mice at least 12 weeks old were used for all myocardial infarction experiments.

Myocardial infarction was induced via ligation of the left anterior descending (LAD) coronary artery. Mice were anesthetized with isoflurane (Abbott Laboratories) and, artificially ventilated following tracheal intubation. After skin incision, lateral thoracotomy was performed at the third intercostal space by blunt dissection of the intercostal muscles. A tapered needle (C- 1) attached to a 6-0 prolene suture (Ethicon) was passed through the midventricle below the origin of the LAD coronary artery and tied to induce infarction; ischemia was indicated by light pallor of the myocardium below the ligature after suturing. Following LAD artery ligation, intramyocardial injections of agrin (1 pg/50 pl, 550-AG, R&D Biosystems) or PBS (50 pl); and CCL24 peptide (0.25 pg/30pl; 1017-MP-025/CF, R&D Systems) or PBS+0.1 %BSA (30 pl) were administered with an insulin syringe. Next the thoracic wall incisions were sutured with 6.0 non-absorbable prolene sutures, and the wound closed with skin adhesive. Mice were extubated and then warmed for several minutes until recovery. Buprenorphine was administered subcutaneously for pain relief (2 mg/kg) over 2 days. Sham-operated mice underwent the same procedure involving anesthesia, intubation and thoracotomy without LAD ligation or intramyocardial injection.

RNA sequencing and LI MAP analysis

Hearts were harvested from mice 7 days post LAD ligation MI surgery (dpmi) and agrin or PBS treatment. Importantly, all hearts were perfused with 10 mL cold PBS to remove lumenal blood and the immune cells contained therein, that had not intravasated into the heart tissue. Hearts were then washed in PBS, atria were removed, and the ventricles were minced into small pieces with a sterile blade to create more surface area for the proceeding enzymatic digestion. The pieces were moved into a digestion buffer (1.2 U/mL Dispase solution, 2 mg/mL collagenase type 2, and 1 mM CaCE in PBS) for 3 15 minute rounds of digestion at 37°C, followed by mechanical agitation by pipetting. The suspended cells were washed with PBS and then centrifuged at 200g for 20 minutes. Cells were then resuspended in 0.5 %BSA, 2 mM EDTA solution in PBS and counted for CD45 selection via Macs kit magnetic bead separation (130-052-301, CD45 microbeads, Miltenyi Biotec). The protocol for CD45 selection follows the Miltenyi handbook for MS columns .

After the CD45+ cells were selected from the heart cell lysate suspension, they were accurately counted by hemocytometer and trypan blue exclusion. Single cell suspensions were brought to optimal cell concentrations, between 800-1000 cells/pl, inPBS with 1 %BSA according to instructions. Single cell RNAseq libraries were generated using Single Cell 3' Reagent Kits v3 (lOxGenomics) according to manufacturer kit protocols and guidelines. After library generation, quality control of the libraries was performed on an Agilent Tapestation; and yield was determined by Qubit fluorometer DNA assay and by QPCR. Libraries were pooled and normalized to 4 nM before being diluted for sequencing. Pooled libraries were sequenced on an Illumina Nextseq 500 at the Life Sciences Core Facilities at the Weizmann Institute of Science.

The sequenced data were processed into expression matrices with the Cell Ranger Single Cell program supported by lOx Genomics (www(dot)10xgenomics(dot)com/). Raw scRNAseq data were demultiplexed into library specific fastq files and reads were aligned to the mml0/GRCm38 reference transcriptome. Bioinformatic analysis was performed in R using the Seurat package (Butler et al., 2018; Stuart et al., 2019). To exclude low quality cells and possible doublets in the analysis, a cutoff was applied based on number of detected genes (500-4000), detected unique molecular identifiers (UMIs, 2000-20000) and mitochondrial genes per cell (<12.5 %). Based on these cutoffs, one PBS control library was excluded from further analysis being too low quality, and analysis was continued with 3 agrin libraries versus 2 PBS libraries. Dimensional reduction was achieved by RunUMAP function used in the Seurat package, with the Uniform Manifold Approximation and Projection (UMAP) algorithm (20 PCs and 0.83 resolution). Unsupervised cluster identification was performed with the FindClusters function, also in Seurat, and cell clusters were annotated based on expression of established marker genes validated from the Immgen data site. An endothelial cell cluster as identified by high Vwr and Pecam-1 expression, and a fibroblast cluster as identified by high Ddr2 and Pdgfra expression were removed from the dataset. Differential expression analysis was performed across agrin and PBS libraries within clusters by the Seurat function FindMarkers, using gene expression detected in > 10 % of cells for at least one of the populations being compared, with an absolute log2 fold change > 0.25 as cutoff threshold (min.pct(0.1) and logfc.threshold(0.25)).

QPCR

After 10 ml cold PBS perfusion and dissection, the atria were removed from mouse hearts to enrich for the ventricles. The left and right ventricle were briefly washed in PBS before snap freezing in liquid nitrogen. After freezing, the hearts were crushed to a fine powder in a sterilized mortar and pestle always kept in liquid nitrogen. The powder was transferred to a round bottom tube with 1 ml of Qiazol lysis buffer (cat no. 79306, Qiagen) where the tissue is further homogenized by drill on ice. The samples were kept on ice until all other hearts were processed, at which point all hearts were brought to room temperature for the 15 minutes incubation as specified by the protocol. The rest of the protocol follows the Qiagen manufacturer handbook. Qiazol lysis was followed by RNA extraction using the RNeasy mini kit (cat no. 74104, Qiagen) exactly to the manufacturer’s specifications, including the optional DNA digestion step (cat no. 79254, Qiagen). RNA concentration and integrity were measured by nanodrop. RNA was used to synthesize cDNA using the High-capacity cDNA Reverse Transcription kit (with RNase inhibitor, cat no. 4374966, Thermo-Fisher) according to the manufacturers protocol. The ccl24 gene was quantified using via QPCR with the SYBR™ Green PCR Master Mix (cat no. 4309155, ThermoFisher). Primers were ordered from Sigma (F: ATTCTGTGACCATCCCCTCAT SEQ ID NO: 28; R: TGTATGTGCCTCTGAACCCAC SEQ ID NO: 29).

ELISA

As above, after 10 ml cold PBS perfusion, dissection, and atria removal, mouse hearts were briefly washed in PBS before liquid nitrogen snap freezing. After which the hearts were pulverized to a fine powder with the frozen mortar and pestle before transference to a round bottom 14 ml tube on ice. After the liquid nitrogen evaporates, 1500 pl of lysis buffer made of 0.5 %Triton-X 100, protease inhibitors, and phosphatase inhibitors at 1: 100 was added to the tube and further digested by drill. The tissue was incubated on ice for 30 minutes prior to centrifugation at 4000rpm for 5 minutes at 4°C. The supernatant was collected and moved to a fresh tube for centrifugation at 12,000rpm for 15 minutes at 4°C. For the last time, the supernatant was collected and moved to a fresh tube. Protein concentration was quantified using BCA assay purchased from Thermo Scientific (ref no: 23225) and used according to the manufacturer protocol. These samples were used in duplicate to perform the CCL24 ELISA kit (Eotaxin-2 (CCL24) Mouse SimpleStep ELISA Kit, ab206985, Abeam) used according to the manufacturer instructions. smFISH

Probes to the Ccl24 transcript were designed in collaboration with the Bioinformatics Unit in the Life Sciences Core Facilities at the Weizmann Institute of Science, and were manufactured by Stellaris. Ccl24 probes were labeled by Quasar 670 fluorescent tags. Probe position Probe SEQ on the

ID NO. Probe (5'-> 3') transcript

1 tcctggagatatgaggac 1

2 gttcaaagctggggtgca 28

3 atgttctggaggtcaggc 56

4 cggcaacgatcgtagcag 82

5 agatgcaacacgcgcagg 118

6 gggatggtcacagaatct 143

7 aggacgtgcagcaagatg 163

8 cactcggttttctggaat 195

9 ttggccaactggtagcta 215

10 ccttgggacagatgctgc 235

11 ggtgatgaagatgacccc 255

12 cagatcttatggcccttc 275

13 acagcagcttggggtcag 295

14 ttttgtatgtgcctctga 317

15 ggtttttcttggcatcca 337

16 cttggcccctttagaagg 357

17 gtctctggacagcaaact 388

18 ctcggtgctattgccacg 408

19 cagaggagaggcggctaa 428

20 cctatgtccaagttcagg 448

21 cagcctggtaaagcgtca 469

22 tggtctgtcaaaccccaa 489

23 aacttagacctcatccca 509

24 cagctcactcaggttctc 574

25 ttcactcagcacaggaga 614

To prepare hearts for smFISH staining, mice were sacrificed 1 dpmi, when the levels of Ccl24 would presumably be elevated according after agrin treatment. After 10 ml cold 4 % PFA in PBS perfusion and dissection, the hearts were fixed and stabilized in 4 % PFA, 30 % sucrose solution 4 °C for 24 hours. After fixation the hearts were embedded in OCT (LabTek) and stored at -80°C.

Previously established protocols by the Itzkovitz laboratory for the smFISH staining in infarcted hearts were employed (Farack and Itzkovitz 2020), the only exception was that heart tissue was fixed in 30 % formamide rather than 15 % during the relevant steps. Counterstains for the smFISH probes included DAPI (1:200 of 10 pg/mL, D9564, Sigma), Alexa Fluor 488 Phalloidin, (1:2000, A12379, Life Technologies), anti-CD45 antibody (1: 100, MCA1031G, BioRad) and anti-LYVEl antibody (1: 1000, ab218535, Abeam). Slides were imaged immediately to resolve smFISH granules under a Nikon inverted fluorescence microscope eclipse ti2 series and Ixon Ultra 88 camera at lOOx magnification. Image post-processing was done with the Nikon Nis Elements Advanced Research software.

Echocardiography

Heart function was evaluated in isoflurane- sedated mice via transthoracic echocardiography with a Vevo 3100 VisualSonics device. Echocardiography was performed to measure ejection fraction, stroke volume, fractional shortening and ventricular wall thickness. The measurements for these parameters were compared across CCL24, PBS+0.1 % BSA and SHAM treated mice at 2 days pre-MI, and 2, 14, and 35 dpmi at which point the experiment was ended.

Histology and scar analysis

After 10 ml cold PBS perfusion and dissection, mouse hearts were fixed in 4 % PFA for 48 hours and submitted for paraffin embedding and sectioning. The heart was cut transversely into 4-7 pm serial sections through the entire ventricle from apex to base with skips at 400pm intervals for full coverage of the heart. Hematoxylin and eosin (HE) staining and Masson’s trichrome (MT) staining were performed by standard protocols for resolution of the fibrotic areas. Scar size was quantified based on MT staining in the sections containing the papillary muscle using ImageJ/FUI software, followed by statistical analysis in Prism. Scar size was calculated relative to left ventricle size or by scar angle.

Immunohistochemistry

Fixed and paraffin embedded heart sections were deparaffinized by xylene incubation, and rehydrated by immersion in serial ethanol dilutions. Antigen retrieval in either EDTA or citric acid buffers was achieved by boiling in a microwave. Slides were then permeabilized in 0.5 % Triton-X 100 in PBS for 15 minutes, and blocked in a 3 % BSA, 10 % horse serum, 0.1 % Triton- X 100 blocking solution for a minimum of 1 hour at room temperature. Heart sections were then incubated in primary antibody overnight at 4 °C in a humidity chamber in 3 % BSA, 1 % horse serum, 0.1 %Triton-X 100. Primary antibodies used included: anti-endomucin (1:200, ab 106100, Abeam), anti-CD31 (1:50, ab28364, Abeam), anti-periostin (1: 100, NBP1-30042, Novus Biologicals), anti-aSMA (1:400, A2547, Sigma- Aldrich), anti-LYVEl antibody (1: 1000, ab218535, Abeam), and anti-cTnT (made in house).

After primary antibody incubation, slides were washed 3 times for 10 minutes in PBS with 0.1% Triton-X 100, and stained for up to 2 hours at room temperature with fluorescent secondary antibodies (Abeam) or WGA-647 (1:400), and DAPI for nucleus counterstain. After 5 additional PBS washes, slides were mounted with Immumount (9990412, Thermo Scientific) and viewed under a Nikon Eclipse Ti2 fluorescence microscope. Scoring of blood vessel density was performed using Adobe Photoshop software, followed by statistical analysis in Prism.

Primary Cardiac Cell Culture

Primary cardiac cells were isolated from Pl and P7 ICR mouse hearts using the neonatal dissociation kit (gentleMACS, 130-098-373, Miltenyi Biotec) according to manufacturer instructions. Cells were cultured on gelatin-coated wells (0.02 %, G1393, Sigma-Aldrich) in DMEM/F12 medium (D6421, Sigma- Aldrich) supplemented with 1 % 1-glutamine (03-020- IB, Biological Industries), 1 % Na-pyruvate (03-042- IB, Biological Industries), 1 % non-essential amino acids (01-340- IB, Biological Industries), 1 % penicillin/streptomycin/amphotericin B (03- 033- IB, Biological Industries), 5 % horse serum (04-004-1 A, Biological Industries) and 10 % FBS (04-007-1, Biological Industries) at 37 °C and 5 % CO2. Cells were allowed to adhere for 48 hours prior to treatment, at which point the medium was replaced with serum-free medium with the respective treatments for 72 hours.

For analysis of cardiomyocyte proliferation in vitro, the cells were fixed for immunostaining in 4 %PFA for 12-15 minutes. All solutions are made in PBS. Following fixation, cells were permeabilized in 0.5 % Triton X-100 for 10 minutes, washed 3 times for 5 minutes in PBS, and then blocked in 3 % BSA, 10 % horse serum, 0.1 % Triton-X 100 blocking solution for a minimum of 1 hour at room temperature. The cells were then incubated in primary antibodies at 4 °C in 3 % BSA, 0.1 % Triton X-100, 1 %HS overnight with parafilm wrapped around the plate to prevent evaporation. Primary antibodies included: anti-Ki67 (1:200, 275R, Cell Marque) for cell cycle entry and anti-cTnT (1:200, ab33589, Abeam) for cardiomyocyte identification. After 3 PBS washes, the cells were stained with fluorescent secondary antibodies (Abeam) and DAPI for nucleus counterstain for 2 hours at room temperature. After 4 additional PBS washes, the cells were left in PBS and kept in the dark for imaging on a Nikon Eclipse Ti2 fluorescence microscope. Each well was imaged in 3-4 fields randomly selected, images were scored for total cardiomyocyte nuclei (cTnT and DAPI double stain) and ki67+ cardiomyocyte nuclei (cTnT, ki67 and DAPI triple stain) in Photoshop software, followed by statistical analysis in Prism.

For the analysis of angiogenesis in cardiac culture, Pl cardiac cells isolated as described above were seeded on gelatin-coated (0.1 %; Sigma, Cat #G1393) plates. The following day cells were washed three times and fresh media was replaced. The culture was kept for twelve days, with CCE24 (100 ng/ml) or PBS dosing occurring every other day from day 6. Cells were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Cat #15710) and stained for analysis. Samples were imaged using the Nikon Eclipse Ti2 microscope. DAPI co-staining was used to exclude area of cell density differences between samples. The Angiogenesis Analyzer plug-in for ImageJ/FUI was employed to perform the angiogenesis quantification (Carpentier et al., 2020).

HUVEC Culture and Tubule Formation Assay

For both human umbilical vein endothelial cells (HUVECs) subculture and tubule formation assays, a previously well-established protocol was used (Arnaoutova et al., 2009; Baehr et al., 2020). Briefly, HUVECs (Promocell, single donor, C- 12200) were thawed and then passaged to a new plate when reaching ~75 % confluency. During subculturing, HUVECS were maintained in Promocell Endothelial Cell Growth Medium (C-22010) with the accompanying supplement mix as specified by the manufacturer (C-39215), at 37 °C and 5 % CO2. After at least 1 passage, but no more than 4, the HUVECs were plated in 6-well plates at 185,000 cells per well and seeded overnight in normal media conditions. The following day, the media was replaced to starvation conditions (EBM-2, 00190860, Lonza) for preconditioning in the respective treatments for 16 hours. After preconditioning, the HUVECs were moved to 48- well plates coated in growth factor reduced Matrigel (356231, Corning) at a concentration of 150,000 cells/mL in starvation media with treatment. HUVECS were left undisturbed for 8 hours to form tubules on the soft matrix. The cells were subsequently fixed in 4 % PFA, and imaged for tubule formation by brightfield microscopy. At least 2 fields were acquired per well for tubule formation measurement. Acquired images were analyzed by the Angiogenesis Analyzer plug-in for ImageJ/FUI (Carpentier et al., 2020) followed by statistical analysis in Prism.

Primary Cardiac Fibroblast Cell Culture and Immunofluorescence Staining

Primary cardiac fibroblast (cFB) cultures were isolated from adult mice, >12 weeks old, using the neonatal dissociation kit (130-098-373, Miltenyi Biotec) and the gentleMACS homogenizer, according to the manufacturer’s instructions. Dissociated cells were cultured in gelatin-coated (0.1 %, G1393, Sigma- Aldrich) wells with DMEM/F12 medium and supplements as written above Primary Cardiac Cell Culture), at 37°C and 5 % CO2 for 8 hours. The cells were gently washed 3 times and fresh media was replaced for an additional 40 hours. For ‘Passage 0’ cultures, cells were administrated with recombinant CCL24, dose range 5-100 ng/ml, for 48 hours, after which the cultures were fixed and stained for markers of interest (see below). For ‘Passage 1’ cultures, the cells were cultured for 4 days after isolation, then cells were passaged once. For passaging, the cFBs were placed in a 3 minute incubation of 0.25 % trypsin (2132728, Biological Industries) at 37°C, the enzymatic reaction was stopped by a 2-fold addition of full media, and cFBs were reseeded on a 96-well plate at 1.2X10⁴ cells/ well. After 24 hours, the cells were treated with recombinant CCL24 and fixed and stained as the Passage 0 cultures. For fixing, immunofluorescence staining and analysis, the cFB cells were fixed with 4 % paraformaldehyde for 15 minutes, followed by permeabilization in 0.5 % Triton X-100 for 10 minutes and blocking in 3 % BSA, 0.1 % Triton X-100 in PBS for 1 hour. The primary antibody solution was prepared in the blocking solution, and incubated overnight at 4 °C. Primary antibodies included: anti-periostin (1: 150, NBP1-30042, Novus Biologicals), anti-aSMA (1:400, A2547, Sigma- Aldrich), anti-Vimentin (1:300, ab24525, Abeam), and anti-Ki67 (1:60, ab279653, Abeam). The cultures were washed thoroughly in PBS 3 times for 10 minutes each. The appropriate secondary antibodies (Abeam or Jackson) were incubated on the samples for 1 hour followed by DAPI (5 pg/ml, D9542, Merck) staining for 10 minutes. After the 3 final PBS washes, imaging was performed on a Nikon Eclipse Ti2 fluorescence microscope. Each well was imaged in 3-4 fields randomly selected, images were scored for total cFB number (vimentin and DAPI double stain) and SMA+ cFB number (aSMA, vimentin, DAPI triple stain) orki67+ nuclei (ki67 and DAPI double stain) vs all nuclei (DAPI stain). The counting of aSMA cFB versus total cFB was done manually in Photoshop software, and the analysis of +ki67 cFB was done with a FUI macro. After scoring the rest of the statistical analysis was performed in Prism

Cytokine ELISA

The samples were prepared for the ELISA as described above. Once the samples were dissected, perfused and had the atria removed, they were snap frozen and maintained in liqN2 until transport on dry ice to the Cardiovascular Research Institute at Sheba Medical Center in Tel Aviv, Israel where the ELISA was run. The samples were run on the Q-Plex Mouse Cytokine Screen 16- plex (Quansys Biosciences, Cat #112449MS) to analyze cytokine levels. Statistical analysis was performed in Prism 9.3.1.

Eosinophil FACS

ICR mice having undergone LAD ligation surgery and subsequent PBS or CCL24 intramyocardial injection (described previously) were sacrificed 7 dpmi and a 10 mL cold perfusion was performed. The ventricles were dissected away from the atria and washed in cold PBS. The dissected tissue was dissociated by a combination of mechanical and enzymatic digestion, which included chopping and agitating for a period of 45 minutes in digestion buffer (dispase, 2 mg/mL collagenase type n, DNAse, 0.9 mM CaCE in PBS). Dissociated tissue was filtered through 70 pm into cold PBS to stop the reaction, and spun down to pellet cells in suspension (1400 rpm/5 minutes). Cells were resuspended in FACS buffer, 0.2 % EDTA (Sigma, 03690- lOOmL), 2 % FCS (Bioindustries, Sku #04-001-1 A) in PBS for staining. FC blocker TruStain FCy CD16/32, clone 93 (Biolegend, Cat #101320) was added first and allowed to incubate first for 5 minutes, followed by the FACS panel antibodies. Antibodies in this panel included: APC/Cyanine7 anti-mouse CD45, clone 30-F11 (Biolegend, Cat # 103116), FITC anti- mouse/human CDl lb, clone MI/70 (Biolegend, Cat #101205), PE anti-mouse CD170 (Siglec-F), clone S17007L (Biolegend, Cat #155506) and Alexa Fluor™ 647 anti-mouse Ly6G, clone 1A8 (Biolegend, Cat #127610). After a 30 minute incubation at 4°C, samples were rinsed with FACS buffer, filtered through 40 pm mesh and kept on ice protected from light until sorting. Just prior to sorting, a 1:50,000 working solution of DAPI was added for cell viability assessment.

Samples were run at the Kleinman Cancer Cell Sorting Facility on the Cytek™ Aurora. Unmixing and subsequent analysis was performed in FlowJo, followed by statistical analysis performed in Prism 9.3.1. EdU staining

To identify proliferating cells, 5-ethynyl-2’ -deoxyuridine (EdU, Thermo Fisher, Cat #E10187) was resolubilized in DMSO according to manufacturer’s instruction, and injected into ICR mice having undergone LAD ligation surgery and subsequent PBS or CCL24 intramyocardial injection (described previously) on days 4-7 post-MI. EdU injection was performed via intraperitoneal injection at a concentration of 50 pg/g body weight. Mice were sacrificed at 14 dpmi for immunohistochemical analysis as described previously. hnmunohistochemical staining protocols have been described previously. Exceptions for EdU staining include exclusive use of citrate antigen retrieval (Sigma, Cat #C9999), followed by typical permeabilization and blocking steps. The Click- it™ EdU Cell Proliferation Kit for Imaging, Alexa Fluor™ 555 dye (Thermo Fisher, Cat #C10339) was used according to manufacturer’s instructions. The rest of the staining protocol proceeded as already described.

Proteomics

Samples were prepared for proteomic analysis by PBS perfusion, atria removal for ventricle enrichment, followed by liqN2 snap freezing. Frozen tissue was ground to a powder by mortar and pestle the homogenized by drill bit in 50 mM Tris pH 7.4 (Sigma, T1503) with a protease and phosphotase inhibitor cocktail (1: 100). A 20 % SDS (Sigma, L3771) in 50mM Tris pH 7.4 solution was added to the protein lysate to bring the total concentration of SDS to 5 %. Samples were incubated at room temperature for 10 minutes before centrifugation for 20 minutes at 15,000rpm The supernatant was collected, the protein concentration was determined by BCA, and the samples were submitted for proteomic analysis at the de Botton Institute for Protein Profiling at the Weizmann Institute of Science.

The samples were analyzed on nanoflow liquid chromatography (nanoAcquity) coupled to high resolution, high mass accuracy mass spectrometry (Fusion Lumos), in Discovery mode, and were processed with MetaMorpheus v0.0.320. The data was searched using search engine against the SwissProt Mouse proteome database (Mouse_SP_Jan2022) appended with common lab protein contaminants and the following modifications: fixed modification of Carbamidomethylation on C, and variable modifications of Oxidation on M, Deamidation on N or Q, and protein-N-terminal acetylation. The data filtration was performed using Perseus v 1.6.2.3. Decoy hits were filtered out. Intensity values were log transformed and only proteins that had at least 50 % valid values in at least one experimental group were kept. Missing values were imputed. For convenience reasons, all values (intensities and ratios) were transformed back from their log values.

Following mass spectroscopy, 2,523 proteins were identified and quantified. Differential expression analysis was performed using ‘Limma’ package in R (www(dot)doi(dot)org/10(dot)1093/nar/gkv007). Missing values were replaced by a bounded minimum value. Differentially-expressed proteins were determined by a cutoff of p value <0.05 and at least 2 peptides detected by mass spectroscopy. Unsupervised analysis was executed to explore a pattern of gene expression by clustering the genes based on 185 proteins. These genes were determined as differential expressed proteins (DEP) in at least of the one pairwise comparisons. K- Means clustering was performed. Standardized, log 2 normalized counts were used for the clustering analysis. Clustering analysis was performed with Rstudio v3.6.1 (RStudio Team (2020). RStudio: Integrated Development for R. RStudio, PBC, Boston, MA URL www(dot)rstudio(dot)com/.)

Functional enrichment analysis was performed using g:Profiler (www(dot)biit.cs(dot)u(dot)ee/gprofiler/gost, version el08_eg55_pl 7_39cdea3, database updated on 28/12/2022) to determine most significantly relevant biological functions and pathways. g:SCS multiple testing correction method applying significance threshold of 0.05. Data sources included GO, KEGG, Reactome, WikiPathways, TRANSFAC, miRTarBase, CORUM, HP.

EXAMPLE 1

CCL24 is expressed by resident cardiac macrophages post MI

The present inventors sought to uncover a high resolution understanding of the adaptive and innate immune system changes that facilitate a regenerative response in adult mammalian models of myocardial infarction. Therefore, scRNAseq technology was employed to elucidate the immunological differences between pro-regenerative (Agrin-injected) versus pro-fibrotic (PBS injected) injuries in adult mouse MI models (Bassat et al., 2017). All MI experiments were performed in adult ICR female mice, and MI was induced by LAD ligation surgery. Preliminary experiments indicated that 7 days post-injury allowed for expansion of macrophage subpopulations, and infiltration of monocytes and adaptive immune cells (achieved via IF staining of immune markers, data not shown). Thus, mice were sacrificed 7 days post MI (dpmi) for analysis. A method was developed for gentle dissociation of the heart into a non-myocyte cell suspension for pan-immune selection by CD45+ magnetic bead MACS kit, and subsequent scRNAseq on the lOx Genomics platform Five scRNAseq libraries were generated from 1 mouse each (3Agrin/2PBS), analyzed >20,000 sequenced immune cells, and performed Uniform Manifold Approximation and Projection (UMAP) dimensionality reduction analysis to identify 20 discrete clusters; 10 macrophage (Mc|)) subpopulations, 9 distinct adaptive immune system cell types, and 1 monocyte cluster, thereby representing the full landscape of the immune response (Figure 1A). The cluster identity was validated by comparing the top ~30 cluster defining genes to all mononuclear phagocyte populations in the Immgen data repository.

The macrophage populations were mainly analyzed due to their abundance and complexity in the data set. Prior research in the cardioimmune field demonstrated that subpopulations of rcM(|)s are pro-regenerative compared to inflammatory recruited macrophages, and can be identified by LYVE1 and TIMD4 expression (Figure 1A, clusters 1 and 4). Hence cells are CD45+/LYVE+/TIMD4+ (Dicket al., 2019). Gene expression analysis revealed that these rcM(|)s exclusively express the chemokine, Ccl24 at 7 dpmi (Figure IB). It had been previously reported that macrophages express Ccl24 (Wang et al., 2019); Skelly et al., 2018), however these data demonstrate remarkably specific, albeit low, expression of Ccl24 in this rcM(|) subpopulation. To understand if Ccl24 expression might be more elevated at different times in the reparative process, the present inventors sought to capture the dynamics of Ccl24 expression in regenerative hearts across multiple timepoints during scar development and resolution. By QPCR and ELISA based methods, Ccl24 seems to peak between 12 hours and 2 dpmi and agrin application as compared to PBS controls (Figures 1C,D). To confirm the specificity of Ccl24 to the rcM(|)s during the peak of expression, single molecule fluorescence in situ hybridization (smFISH) staining was performed in frozen sections from hearts taken at 1 dpmi. In addition to the Ccl24 FISH probe, DAPI and phalloidin were counterstained to determine the scar area, and LYVE1 together with CD45 for rcM(|)s; as LYVE1 is also highly expressed in lymphatic cells, CD45 co-staining revealed rcM(|)s. A Ccl24 probe signal was evident in cells that were CD45+/LYVE1+ in the scar area of agrin treated hearts, thereby confirming the lOx scRNAseq results (Figure IE). Consonant to the knowledge that LYVE1 macrophages are only a subset of the immune cells in the tissue, as shown by many others in addition to our scRNAseq results, not every CD45+ cell expressed LYVE1. EXAMPLE 2

Direct application of CCL24 to the infarct site generates functional cardiac recovery

The present inventors then wanted to understand whether exogenous application of CCL24 would promote cardiac recovery in the injured hearts of adult mice. Direct intramyocardial injection into the ischemic site directly following permanent ligation of the left anterior descending artery was used to treat with the CCL24 peptide or PBS controls (Bassatet al., 2017). 30 pl volume with 0.25 pg of CCL24 peptide amino acids 27-119 (Ccl24 1017-MP-025/CF, R&D Systems) or 30 pl of PBS+0.1 %BSA was used for the injection. Baseline cardiac function measurements were taken 2 days prior to the LAD ligation surgery, and cardiac performance was tracked on 2 days, 14 days and 35 days post MI by echocardiography. A single injection of CCL24 to the infarct area was sufficient to improve cardiac function as soon as 14 days after the injury as measured by ejection fraction, longitudinal fractional shortening and stroke volume (Figure 2A- C). The heart weight to body weight ratio in the mice is generally considered an indication of stress. This ratio in CCL24 treated mice was not statistically different from the SHAM operated mice, but was elevated in the PBS treated group (Figure 2D). Furthermore, histological analysis of hearts taken at experimental endpoint 35 dpmi revealed a reduction in scar area in the CCL24 versus the PBS treated groups (Figure 2E-F). Taken together, these results demonstrate the utility of CCL24 peptide injection in facilitating better cardiac outcomes for mice after LAD ligation surgery.

EXAMPLE 3

CCL24 administration has pro-regenerative effects on the major cardiac cell types

Having established the efficacy of CCL24 injection in promoting a more regenerative response to MI injury, the present inventors next investigated the mechanisms by which CCL24 exerts this beneficial effect. Scientists had previously demonstrated the direct effect of CCL24 application on proliferation in neonatal rat ventricular cardiomyocytes (CMs) cultured in vitro (Wang et al., 2019). The cardiac regeneration field now understands that cardiomyocyte proliferation alone is not sufficient for cardiac regeneration. In stark contrast the present inventors have shown that the pro-regenerative role of CCL24 is primarily in promoting angiogenesis rather than inducing cardiomyocyte proliferation.

The present inventors sought to determine if CCL24 has a proliferative effect on postmitotic P7 in vitro primary cardiac culture. CCL24 peptide was applied at a 100 ng/ml concentration to P7 primary cardiac cultures from ICR mice, alongside PBS treated negative controls and Agrin treated positive controls. It was found that CCL24 application more than doubled the number of proliferating CMs as detected by ki67+ immunofluorescence staining in cTnT+ cells (Figure 3 A). No additive effect of combined Agrin and CCL24 treatment was found. Taken together these results demonstrate that CCL24 has a direct proliferative effect on mammalian CMs in cell culture conditions more closely modeling the post-mitotic nature of CMs in the adult heart (B as sat et al., 2017).

It was next tested whether CCL24 application could facilitate angiogenesis in the context of cardiac repair. The present inventors tested the direct effect of the CCL24 peptide on the HUVEC tubule formation assay (Figure 3B), it was found that exogenous application of CCL24 is sufficient to induce tubule formation in a dose dependent manner (Figure 3C-H). The number of nodes, junctions and total length were all significantly affected by CCL24 application; with the number of meshes being significantly increased only at high CCL24 concentration absent a change in mean mesh size across all samples.

Having demonstrated the direct effect of CCL24 on endothelial cells in vitro, it was investigated whether in vivo application of CCL24 in the LAD ligation MI model facilitates angiogenesis in the scar area. The present inventors sacrificed ICR mice 7 dpmi for fixation, imbedding, and immunohistochemistry; and stained heart sections for endomucin (EMCN) and CD31 to reveal blood vessels, and stained for cTnT and DAPI to denote the scar area (Figure 31). Blood vessels that were either CD31+ or EMCN+/CD31+ double positive, and contained a visible lumen were scored. A dramatic increase was found in blood vessel number in CCL24 treated cells over PBS controls (Figure 3J), thereby demonstrating the potent angiogenic effect of CCL24 application following cardiac injury in vivo.

Previous works exploring the effects of chronic Ccl24 overexpression in the context of cancer, allergy, asthma and other indications have described CCL24 as a risk factor for fibrotic disease (Jin et al., 2016). To assure that the transient nature of the CCL24 treatment stimulates both cardiomyocyte proliferation and angiogenesis- but, crucially, not fibrosis, in vitro and in vivo approaches were employed to understand the cardiac fibroblast (cFB) response to exogenous CCL24 application. To determine the direct effect of CCL24 on cFB populations a proprietary technique for cFB culture was used, in which cFBs are isolated and passaged to achieve homogeneity in vitro. After this first passage, cFBs were exposed to various concentrations of CCL24, fixed in the cell culture wells and stained for the ki67 proliferation marker. Wells treated with CCL24 trended in the direction of a reduced percentage of ki67+ cFBs (Figure 3K). Based on these trends, it was observed that after 25 ng/ ml treatment there was no further effect of a more concentrated CCL24 treatment; we therefore binned CCL24 dosages into two groups- a mid- dosage between 5-10 ng/ml and a high- do sage of >25 ng/ml. A high dosage of CCL24 significantly decreased ki67 expression in cFBs compared to no CCL24 treatment controls (Figure 3L).

The present inventors also investigated myofibroblast maturation in the passage 1 cFBs by fixing, then immunostaining for alpha smooth muscle actinin (aSMA) as a cFB maturation marker, and vimentin as a pan-cFB marker. Vimentin-positive but aSMA-negative cFBs are present in both treated and untreated cultures (Figure 3M); however CCL24 application significantly reduced the percentage of aSMA-positive cells (Figure 3N). This suggested that CCL24 application does not cause cFB maturation in vitro. It will be appreciated that high SMA staining in vivo would be an indicator of matured myofibroblasts that are generally responsible for collagen deposition and fibrosis. Interestingly, observations of the CCL24 treated cFB wells revealed a pattern of aSMA- negative cells in which they appeared to cluster near each other (Figure 3M, yellow arrows). Next these in vitro findings were extended into the in vivo ML model. By IF staining, fibrosis in the scar area of the CCL24 versus PBS treated mice was visualized by the myofibroblast maturation markers periostin (POSTN) and aSMA. Hearts taken from both 1 day (data not shown) and 7 days post-MI surgery (Figure 30) were analyzed- no change in fibrosis was evident as demonstrated by POSTN staining. Consistent with the in vitro results, a modest reduction in aSMA levels was evident. These experiments indicate that transient application of CCL24 does not constitute a risk factor for increased fibrosis following injury.

EXAMPLE 4

CCL24 application effects on the immune system

Having previously established the efficacy of CCL24 administration in facilitating cardiac repair (see Example 2), the present inventors then sought to understand the effects of CCL24 on the major cardiac cell types to elucidate mechanisms by which CCL24 improves cardiac outcomes (see Example 3). Hence the effect of CCL24 was determined on cardiomyocytes (Figure 3A-B), endothelial cells (Figure 3C-J) and fibroblasts (Figure 3K-O); however, the question of immune system effects downstream of CCL24 application to the infarcted myocardium remained open. To gain an overview of immune signaling throughout the healing process, the present inventors employed a multiplexed ELISA to profile cytokine levels from the myocardium of infarcted hearts with PBS or CCL24 injection as compared to an uninjured baseline control at 6hrs, 1 day, 4 day and 14 days post-MI (Figures 4A-H). Importantly, prior to tissue processing, infarcted hearts were perfused to remove any systemic inflammation or cytokine signals in the blood. Most cytokines experienced a spike at the 6 hours, therefore this timepoint was further explored. Higher CCL2, CCL3 and IL17 levels were observed in PBS vs CCL24 treated mice at 6 hrs post-MI (Figures 4A,C,E), with no other significant changes in cytokine levels at later timepoints (Figures 4B,D,F). Other cytokine levels did not differ significantly between PBS and CCL24 treatments, including the anti-inflammatory IL4 (Figure 4G) or the pro-inflammatory TNFa (Figure 4H). The EFISA also included measurements for cytokines- IE1A, IE1B, IE2, IE3, IE5, IE6, IE10, IE12p70, IFNy, GMCSF, and RANTES and none of these significantly changed with treatment (data not shown).

Eosinophil recruitment to the infarcted heart by CCE24 transient application was tested. Hearts were divided to the following groups: PBS-treated, CCE24-treated or SHAM control mice and sacrificed 7 dpmi. After dissociation, labeling of the non-myocyte cells was determined by FACS analysis for the eosinophil population. Eosinophils were defined as SiglecF+/Ly6G+ cells gated from DAPI-/CD45+/CDl lb+. No increase in eosinophil infiltration into the PBS vs CCE24 treated myocardium was found, though CCE24 treated mice had higher eosinophil levels than SHAM controls (Figure 41). This negative result implicates a non-canonical role for CCE24 efficacy in heart repair.

EXAMPLE 5

CCL24 supports angiogenic and lymphatic improvement post-MI

Example 3 shows that application of CCL24 improves hallmarks of healing across cardiomyocyte, endothelial and fibroblast populations. The exogenously applied CCL24 had a consistent tubule formation effect in HUVEC assays in vitro (Figure 3C-H), which proves a direct effect of CCL24 on proxies of angiogenesis. These results translated to the in vivo models when intramyocardial injection of CCL24 resulted in a significantly increased blood vessel density in the scar area observable 7 dpmi by fixation and immunohistochemistry (Figure 31- J). Given the direct effect and the strength of this phenotype, the present inventors pursued the angiogenic potential of CCL24.

The HUVEC and in vivo results were corroborated using an in vitro model of cardiac culture, which was discovered would populate with endothelial cell structures resembling vessels when allowed to grow for more than 8 days. Over the longer culture period, the heterogeneous cardiac cells lose contact inhibition and form a thin 3D structure through which the endothelial cells may organize. After 6 days of culturing the present inventors treated these cultures with 100 ng/mL CCL24 or PBS controls every other day until fixation, at which point labeling endothelial cells with CD31 immunofluorescence stain (Figure 5A) revealed a longer and more branched vessel-like network with CCL24 application (Figure 5B,C). A DAPI counterstain confirmed a uniform cell density across samples. Though the vascular network is indispensable due to its roles in oxygen, nutrient and immune cell delivery, the lymphatic vasculature also plays essential roles in detoxification, immune cell trafficking and maintenance of tissue fluid balance (Oliveret al., 2020). In the acute phases of MI injury, early neovascularization is crucial for recruitment of immune cells and restoration of oxygen supply; and meanwhile lymphangiogenesis facilitates the resolution of myocardial edema (Henri et al., 2016) and also clears excess immune cells and cell debris to promote tissue healing (Klotz et al., 2015; Gancz et al., 2019). Given the emerging importance of the lymphatic network to post-MI healing, particularly during the early stages of injury, the present inventors asked whether in vivo application of CCL24 might affect the lymphatic network less than 4 dpmi. After LAD ligation surgery and subsequent CCL24 or PBS treatment, mice were sacrificed between 2-4 days for fixation, imbedding and immunohistochemistry. Heart sections were stained for LYVE1 and CD31, with DAPI and cTNT counterstains, lymphatic vessels were scored as LYVE1 and CD31 double positive structures with a visible lumen, in the scar area defined as lacking in cTNT staining (Figure 5D, CD31 not pictured to aid visualization). Even at these early timepoints, an increase in lymphatic vessels were found with CCL24 treatment compared to PBS controls (Figure 5E).

To better understand the dynamics of these vessels, 5-ethynyl-2’ -deoxyuridine (EdU) incorporation was used to label dividing cells during the healing process. After LAD ligation and CCL24 or PBS treatment, mice were given 50 pg EdU/g body weight by intraperitoneal injection daily between 4-7 dpmi. At 14 dpmi, mice were sacrificed for immunohistochemistry. EdU incorporation in the endothelial cells of the vessels was determined. Vessels were defined by CD31+ staining structures with a lumen, and as such may represent blood or lymphatic vessels. It was found that vessels in the infarct zone (IZ) were dynamic as they contained EdU+ endothelial cells (Figure 5F,G), and an increase in number of EdU+ labeled vessels was evident with CCL24 treatment (Figure 5F). Comparatively, the border zone (BZ) vessels had less EdU incorporation, with no effect for CCL24 versus PBS treatment, and did not score any remote zone (RZ) vessels with EdU incorporation.

EXAMPLE 6

Proteomic experiments at early post-MI timepoints indicate cardio-protective roles for CCL24

Having uncovered the pro-lymphatic and vasculature benefits of CCL24 treatment in timepoints as early as 2-4 dpmi, the present inventors became interested to pursue the CCL24 effects on the healing heart during the acute stages of infarct injury. Histological analysis was performed on the hearts again, but this time at just 4 dpmi (Figure 6A,B) rather than after 35 days (Figure 2E,F). This study also revealed a reduction in scar area in the CCL24 versus the PBS treated groups even at such an early timepoint. To be sure that the early reduction in scar size was not a result of smaller MI injuries, the present inventor repeated this experiment at 1 dpmi and saw no significant difference between CCL24 treatment and PBS controls (Figure 6C). The present inventors also scored for blood vessels, as identified by SMA staining for smooth muscle and a visible lumen, at the 1 dpmi timepoint and saw no significant difference either (Figure 6D). Taken together, these data suggest that differences in scar size and vessel density in the infarct between CCL24 as compared to PBS treatment resolve during the acute injury phase, and that these early benefits may set the path for improved healing in the coming weeks.

The accumulation of evidence for the early healing effects of CCL24 led the present inventors to probe more deeply into the molecular pathways activated by treatment during the acute injury phase, generally defined as the first 72 hours after injury. Therefore, the present inventors performed mass spectrometry and proteomic analysis of PBS and CCL24 treated infarcted hearts as compared to uninjured controls 3 dpmi. Proteomic analysis of the differentially expressed proteins (DEPs) revealed the largest number of protein expression changes when comparing the infarcted hearts to the uninjured controls, regardless of which treatment was used (Figure 6A). Of these roughly 140 DEPs per condition, unsurprisingly most were overlapping, however 46 CCL24 treatment specific DEPs and 27 PBS specific DEPs were found when compared to uninjured controls (Figure 6F). Clustering analysis revealed 3 distinct clusters of DEPs; cluster 1 representing DEPs upregulated during infarction regardless of treatment, cluster 2 representing DEPs upregulated by CCL24 treatment but not PBS, and cluster 3 representing proteins downregulated by CCL24 treatment as compared to PBS (Figure 6G). With the exception of 3 downregulated proteins from cluster 3, most proteins from the 20 DEP signature distinguishing PBS from CCL24 treatment are represented in cluster 2 (Figure 6H). This signature includes known players in muscle contraction and myosin components such as: Myl7, Myl4, Myl6b, and Nppa. Functional enrichment analysis of PBS-specific DEPs uncovered pathways involved in apoptosis and inflammation (Figure 61). Meanwhile enrichment analysis of CCL24- specific DEPs uncovers expression of proteins associated with blood vessel maintenance, consistent with the angiogenic effects of CCL24 application. Furthermore, CCL24 treated hearts also exhibit expression of proteins involved in the response to oxidative stress. These results suggest a cardioprotective role for CCL24 treatment in response to MI injury.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

It is the intent of the Applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority documents) of this application is/are hereby incorporated herein by reference in its/their entirety.

REFERENCES

(other references are cited throughout the document)

1. Amerongen, M. J. van, Harmsen, M. C., Rooijen, N. van, Petersen, A. H. & Luyn, M. J. A. van. Macrophage Depletion Impairs Wound Healing and Increases Left Ventricular Remodeling after Myocardial Injury in Mice. Am J Pathology 170, 818-829 (2007).

2. Arnaoutova, I., George, J., Kleinman, H. K. & Benton, G. The endothelial cell tube formation assay on basement membrane turns 20: state of the science and the art. Angiogenesis 12, 267-274 (2009).

3. Aurora, A. B., Porrello, E. R., Tan, W., Mahmoud, A. I., Hill, J. A., Bassel-Duby, R., Sadek, H. A. & Olson, E. N. Macrophages are required for neonatal heart regeneration. J Clin Invest 124, 1382-1392 (2014).

4. Baehr, A., Umansky, K. B., Bassat, E., Jurisch, V., Klett, K., Bozoglu, T., Hornaschewitz, N., Solyanik, O., Kain, D., Ferraro, B., Cohen-Rabi, R., Krane, M., Cyran, C., Soehnlein, O., Laugwitz, K. L., Hinkel, R., Kupatt, C. & Tzahor, E. Agrin Promotes Coordinated Therapeutic Processes Leading to Improved Cardiac Repair in Pigs. Circulation 142, 868-881 (2020).

5. Bassat, E., Mutlak, Y. E., Genzelinakh, A., Shadrin, I. Y., Umansky, K. B., Yifa, O., Kain, D., Rajchman, D., Leach, J., Bassat, D. R., Udi, Y., Sarig, R., Sagi, I., Martin, J. F., Bursae, N., Cohen,

5. & Tzahor, E. The extracellular matrix protein agrin promotes heart regeneration in mice. Nature 547, 179-184 (2017).

6. Butler, A., Hoffman, P., Smibert, P., Papalexi, E. & Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol 36, 411— 420 (2018).

7. Carpentier, G., Berndt, S., Ferratge, S., Rasband, W., Cuendet, M., Uzan, G. & Albanese, P. Angiogenesis Analyzer for ImageJ — A comparative morphometric analysis of “Endothelial Tube Formation Assay” and “Fibrin Bead Assay.” Sci Rep-uk 10, 11568 (2020).

8. Dick, S. A., Macklin, J. A., Nejat, S., Momen, A., Clemente-Casares, X., Althagafi, M. G., Chen, J., Kantores, C., Hosseinzadeh, S., Aronoff, L., Wong, A., Zaman, R., Barbu, I., Besla, R., Lavine, K. J., Razani, B., Ginhoux, F., Husain, M., Cybulsky, M. I., Robbins, C. S. & Epelman, S. Self- renewing resident cardiac macrophages limit adverse remodeling following myocardial infarction. Nat Immunol 20, 29-39 (2019). 9. Diny, N. L., Hou, X., Barin, J. G., Chen, G., Talor, M. V., Schaub, J., Russell, S. D., Klingel,

K., Rose, N. R. & Cihakova, D. Macrophages and cardiac fibroblasts are the main producers of eotaxins and regulate eosinophil trafficking to the heart. Eur J Immunol 46, 2749-2760 (2016).

10. Epelman, S., Lavine, K. J., Beaudin, A. E., Sojka, D. K., Carrero, J. A., Calderon, B., Brija, T., Gautier, E. L., Ivanov, S., Satpathy, A. T., Schilling, J. D., Schwendener, R., Sergin, I., Razani, B., Forsberg, E. C., Yokoyama, W. M., Unanue, E. R., Colonna, M., Randolph, G. J. & Mann, D.

L. Embryonic and Adult- Derived Resident Cardiac Macrophages Are Maintained through Distinct Mechanisms at Steady State and during Inflammation. Immunity 40, 91-104 (2014).

11. Farack, L. & Itzkovitz, S. Protocol for Single-Molecule Fluorescence In Situ Hybridization for Intact Pancreatic Tissue. StarProtoc 1, 100007 (2020).

12. Forssmann, U., Uguccioni, M., Loetscher, P., Dahinden, C. A., Langen, H., Thelen, M. & Baggiolini, M. Eotaxin-2, a Novel CC Chemokine that Is Selective for the Chemokine Receptor CCR3, and Acts Like Eotaxin on Human Eosinophil and Basophil Leukocytes. J Exp Medicine 185, 2171-2176 (1997).

13. Gancz, D., Perimeter, G., and Yaniv, K. Formation and Growth of Cardiac Lymphatics during Embryonic Development, Heart Regeneration, and Disease. Cold Spring Harb. Perspect. Biol. 12, a037176. (2019).

14. Gwechenberger, M., Mendoza, M. L. H., Youker, M. K. A., Frangogiannis, P. N. G., Smith,

M. C. W., Michael, M. L. H., Entman, P. M. L. & MD. Cardiac Myocytes Produce Interleukin-6 in Culture and in Viable Border Zone of Reperfused Infarctions. Circulation 99. 546-551 (1999).

15. Henri, O., Pouehe, C., Houssari, M., Galas, L., Nicol, L., Edwards-Levy, F., Henry, J.P., Dumesnil, A., Boukhalfa, L, Banquet, S., Schapman, D., Thuillez, C., Richard, V., Mulder, P. & Brakenhielm, E. Selective Stimulation of Cardiac Lymphangiogenesis Reduces Myocardial Edema and Fibrosis Leading to Improved Cardiac Function Following Myocardial Infarction. Circulation 133, 1484-1497, discussion 1497 (2016).

16. Jin, L., Liu, W.-R., Tian, M.-X., Jiang, X.-F., Wang, H., Zhou, P.-Y., Ding, Z.-B., Peng, Y.- F., Dai, Z., Qiu, S.-J., Zhou, J., Fan, J. & Shi, Y.-H. CCL24 contributes to HCC malignancy via RhoB- VEGFA-VEGFR2 angiogenesis pathway and indicates poor prognosis. Oncotarget 8, 5135-5148 (2016). 17. Klotz, L., Norman, S., Vieira, J.M., Masters, M., Rohling, M., Dube, K.N., Bollini, S., Matsuzaki, F., Carr, C.A., and Riley, P.R. Cardiac lymphatics are heterogeneous in origin and respond to injury. Nature 522, 62-67 (2015).

18. Mor, A., Salto, M. S., Katav, A., Barashi, N., Edelshtein, V., Manetti, M., Levi, Y., George, J. & Matucci-Cerinic, M. Blockade of CCL24 with a monoclonal antibody ameliorates experimental dermal and pulmonary fibrosis. Ann Rheum Dis 78, 1260-1268 (2019).

19. Oliver, G., Kipnis, J., Randolph, J.R., & Harvey, N.L. The Lymphatic Vasculature in the 21^st Century: Novel Functional Roles in Homeostasis and Disease. Cell 182, 270-296 (2020).

20. Panizzi, P., Swirski, F. K., Figueiredo, J.-L., Waterman, P., Sosnovik, D. E., Aikawa, E., Libby, P., Pittet, M., Weissleder, R. & Nahrendorf, M. Impaired Infarct Healing in Atherosclerotic Mice With Ly-6Chi Monocytosis. J Am Coll Cardiol 55, 1629-1638 (2010).

21. Skelly, D. A., Squiers, G. T., McLellan, M. A., Bolisetty, M. T., Robson, P., Rosenthal, N. A. & Pinto, A. R. Single-Cell Transcriptional Profiling Reveals Cellular Diversity and Intercommunication in the Mouse Heart. Cell Reports 22, 600-610 (2018).

22. Stuart, T., Butler, A., Hoffman, P., Hafemeister, C., Papalexi, E., Mauck, W. M., Hao, Y., Stoeckius, M., Smibert, P. & Satija, R. Comprehensive Integration of Single-Cell Data. Cell 177, 1888-1902. e21 (2019).

23. Swirski, F. K. & Nahrendorf, M. Cardioimmunology: the immune system in cardiac homeostasis and disease. Nat Rev Immunol 18, 733-744 (2018).

24. Wang, Z., Cui, M., Shah, A. M., Ye, W., Tan, W., Min, Y.-L., Botten, G. A., Shelton, J. M., Liu, N., Bassel-Duby, R. & Olson, E. N. Mechanistic basis of neonatal heart regeneration revealed by transcriptome and histone modification profiling. Proc National Acad Sci 116, 18455-18465 (2019).

25. Westman, P. C., Lipinski, M. J., Luger, D., Waksman, R., Bonow, R. O., Wu, E. & Epstein, S. E. Inflammation as a Driver of Adverse Left Ventricular Remodeling After Acute Myocardial Infarction. J Am Coll Cardiol 67, 2050-2060 (2016).

Claims

WHAT IS CLAIMED IS:

1. A method of inducing angiogenesis in a heart tissue, the method comprising contacting the heart tissue with an effective amount of CCL24 or a nucleic acid molecule encoding same, thereby inducing angiogenesis in the heart tissue.

2. A method of treating a heart disease in a subject in need thereof, the method comprising administering to the subject in an acute manner a therapeutically effective amount of CCL24 or a nucleic acid molecule encoding same, which induces angiogenesis in a heart tissue, thereby treating the heart disease.

3. A composition comprising a therapeutically effective amount of CCL24 or a nucleic acid molecule encoding same for use in treating a heart disease in a subject in need thereof, wherein said treating is acute treatment.

4. The method of claim 1, wherein said contacting is in an acute manner.

5. The method or composition for use of any one of claims 1-4, wherein said acute is at time of cardiac inflammation.

6. The method of claim 2 or composition for use of claim 3, wherein said acute is up to 96 hours following initiation of symptoms of said heart disease.

7. The method or composition for use of any one of claims 1-6, wherein said effective amount results in improvement of a heart function as determined by ejection fraction, stroke volume, fractional shortening and/or scar area.

8. The method or composition for use of any one of claims 2-7, wherein said effective amount and acute treatment cause a reduction in scar area.

9. The method of claim 1, wherein said heart tissue is an adult tissue.

10. The method of or composition for use of any one of claims 2-3, 5-8, wherein said subject is an adult.

11. The method of any one of claims 1 and 9, being performed ex- vivo.

12. The method of any one of claims 1 and 9, being performed in-vivo.

13. The method of any one of claims 2, 5-8 and 10, wherein said administering is by local administration.

14. The composition for use of claim 3, wherein said composition is formulated for local administration.

15. The method of claim 13 or composition for use of claim 14, wherein said local administration comprises intramyocardial injection.

16. The method of any one of claims 1 and 9-12, wherein said heart tissue comprises adult cardiomyocytes or juvenile cardiomyocytes.

17. The method or composition for use of any one of claims 2-16, wherein said heart disease is an ischemic heart disease or a heart failure.