WO2023215764A2 - Pathological remodeling of distal lung matrix in end-stage cystic fibrosis patients - Google Patents
Pathological remodeling of distal lung matrix in end-stage cystic fibrosis patients Download PDFInfo
- Publication number
- WO2023215764A2 WO2023215764A2 PCT/US2023/066517 US2023066517W WO2023215764A2 WO 2023215764 A2 WO2023215764 A2 WO 2023215764A2 US 2023066517 W US2023066517 W US 2023066517W WO 2023215764 A2 WO2023215764 A2 WO 2023215764A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- matrix
- lung
- cystic fibrosis
- tissue
- analysis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/0068—General culture methods using substrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/27—Lung cells, respiratory tract cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/90—Substrates of biological origin, e.g. extracellular matrix, decellularised tissue
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2535/00—Supports or coatings for cell culture characterised by topography
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2537/00—Supports and/or coatings for cell culture characterised by physical or chemical treatment
- C12N2537/10—Cross-linking
Definitions
- Cystic fibrosis is a genetic disease caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Cystic fibrosis (CF) is characterized by a pathologic cascade of impaired ion transfer, dysregulation of airway surface liquid and mucus, inability to clear infection, chronic inflammation, and ultimately end-stage lung disease necessitating transplantation. As disease severity increases, structural remodeling of the airways (i.e., bronchiectasis) presents as a hallmark feature that is routinely observed on chest radiography and evaluated with established scoring systems.
- CFTR cystic fibrosis transmembrane conductance regulator
- a first aspect provides a biological tissue model configured for in vitro applications, the biological tissue model comprising: a substrate including a plurality of isolated, soluble matrikines; wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue.
- Embodiments of the tissue model include the following, alone or in any combination.
- the plurality of isolated, soluble matrikines may be incorporated into the substrate as a scaffold.
- the plurality of isolated, soluble matrikines may be incorporated into the substrate as a hydrogel.
- the biological tissue model is disease-specific.
- the biological tissue model may be a cystic fibrosis biological tissue model.
- the substrate may be capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native disease-specific biological tissue.
- the substrate may be capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
- a second aspect provides a method of preparing a biological tissue model configured for in vitro applications, the method comprising: isolating a plurality of soluble matrikines from an extracellular matrix; incorporating the plurality of soluble matrikines into a substrate; and recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue with the substrate.
- Embodiments of the method include the following, alone or in any combination.
- the biological tissue model is that disclosed above, including any of the embodiments alone or in any combination.
- Incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a scaffold.
- Incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a hydrogel.
- the method may further comprise processing the isolated, soluble matrikines by crosslinking the isolated, soluble matrikines with each other for incorporation into the substrate.
- the method may further comprise processing the isolated, soluble matrikines by coating a surface of a scaffold for incorporation into the substrate.
- Isolating the plurality of soluble matrikines includes treating a native biological tissue with a CHAPS -based detergent.
- Isolating the plurality of soluble matrikines includes treating a native biological tissue with a Benzonase-based enzyme.
- the biological tissue model is a cystic fibrosis biological tissue model.
- the method wherein recapitulating one or more of a microstructure, molecular composition, and biomechanical property includes recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native disease-specific biological tissue.
- the method wherein recapitulating one or more of a microstructure, molecular composition, and biomechanical property includes recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
- Figure 1A shows aspects of the experimental overview, according to exemplary embodiments of the disclosed subject matter.
- Figure IB shows aspects of the matrix extracted from human cystic fibrosis lung featuring native disease-specific composition and/or mechanics, according to exemplary embodiments of the disclosed subject matter.
- Figures 2A and 2B show aspects of an in vitro cystic fibrosis lung model system, according to exemplary embodiments of the disclosed subject matter.
- Figures 3A and 3B show a comparison of CF and normal lung ECM biomaterials, according to exemplary embodiments of the disclosed subject matter.
- Figures 4A-4D show comparisons of CF and control lung ECM biomaterials composition and ultrastructure, according to exemplary embodiments of the disclosed subject matter.
- Figures 5A and 5B show a comparison of CF and control lung ECM biomaterial key structural constituents, according to exemplary embodiments of the disclosed subject matter.
- Figure 6 shows the composition of CF ECM biomaterials by matrisome category, according to exemplary embodiments of the disclosed subject matter.
- Figure 7 shows quantification of cystic fibrosis and control lung ECM biomaterial cytokine profiles, according to exemplary embodiments of the disclosed subject matter.
- Figures 8A-8C show a global analysis of cystic fibrosis lung matrisome, according to exemplary embodiments of the disclosed subject matter.
- Figures 9A-9D show characterization of the core matrix structure and composition in cystic fibrosis and control lung, according to exemplary embodiments of the disclosed subject matter.
- Figures 10A-10D show an analysis of matrix-associated proteins in cystic fibrosis and control lung, according to exemplary embodiments of the disclosed subject matter.
- Figure 11 shows confirmation of WTC11 and CF iPSC differentiation into macrophages with flow cytometry, according to exemplary embodiments of the disclosed subject matter.
- Figure 12 shows an experimental design for macrophage studies, according to exemplary embodiments of the disclosed subject matter.
- Figure 13 shows aspects of cystic fibrosis and WTC11 macrophage and extracellular matrix co-culture system, according to exemplary embodiments of the disclosed subject matter.
- Figures 14A-C show aspects of WTC11 and cystic fibrosis macrophage cytokine expression in response to CF and control lung extracellular matrix, according to exemplary embodiments of the disclosed subject matter.
- Figures 15A-B show aspects of macrophage cytokine expression in response to CF extracellular matrix, according to exemplary embodiments of the disclosed subject matter.
- Figure 16 shows histological imaging of CF and control lungs, according to exemplary embodiments of the disclosed subject matter.
- Figure 17 shows multi-modal imaging of CF and control lungs, according to exemplary embodiments of the disclosed subject matter.
- Figure 18 shows stereotypical alterations to the airways seen in cystic fibrosis patient tissue versus control lung, according to exemplary embodiments of the disclosed subject matter.
- Figure 19 shows heat maps showing differences in lung matrix proteins in cystic fibrosis and control lung tissue, according to exemplary embodiments of the disclosed subject matter.
- Figure 20 shows aspects of molecular function pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figure 21 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figure 22 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figure 23 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figure 24 shows aspects of preparation of matrix extract from whole patient tissue through detergent and enzyme decellularization, according to exemplary embodiments of the disclosed subject matter.
- Figure 25 shows violin plots showing relative abundance of matrix proteins in cystic fibrosis and control matrix extracts, according to exemplary embodiments of the disclosed subject matter.
- Figure 26 shows aspects of molecular function pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figure 27 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figure 28 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figure 29 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
- Figures 30A-C shows GO networks identified by filtering for upregulated peptides and downregulated peptides, according to exemplary embodiments of the disclosed subject matter.
- Figures 31 A-B show aspects of collagen expression in cystic fibrosis and control lung matrix, according to exemplary embodiments of the disclosed subject matter.
- cystic fibrosis although well-characterized in the proximal airways, are understudied in the distal lung. In particular, characterization of the cystic fibrosis lung ‘matrisome’ (matrix proteome) has not been previously described, and could help identify biomarkers and inform therapeutic strategies.
- Lung matrix structure and composition facilitate gas exchange by providing mechanical integrity to withstand dynamic changes in pressure during breathing, elasticity to ventilate the distal alveoli, and biochemical cues to guide cell behavior and respond to injury.
- Key structural and biological matrix constituents in the lung include collagens and laminins, which comprise the basement membrane, and elastin which provides the lungs with elastic recoil enabling ventilation.
- coordinated matrix remodeling governs lung tissue repair to restore function of an injured area.
- the matrix and its reparative woundhealing functions are compromised in a disease-specific manner. Because matrix structure and composition are intrinsically linked to cell, tissue, and organ-level function, we aimed to identify significantly altered matrix components and dysregulated pathways in CF.
- Matrikines are peptides liberated by partial proteolysis of extracellular matrix macromolecules, which are able to regulate cell activities. They are messenger peptides capable of regulating cell activities by interacting with their specific receptors and can activate certain genes involved in the process of extracellular matrix renewal and cell proliferation. Among these peptides, some of them may modulate proliferation, migration, protease production, or apoptosis, which suggest that they can play a significant role in the control of disease progression. Without limitation, matrikines nay be derived from elastin, connective tissue glycoproteins, or collagens.
- Matrix and matrikines are isolated from patient tissue and feature native tissue biomolecular profiles, including core matrix proteins, growth factors, and cytokines. Although described primarily herein for the study of cystic fibrosis lung disease, the platform can be easily extended to include other diseases and organs. In cystic fibrosis, matrix and matrikine profiles can vary from patient-to- patient. Therefore, these materials enable patient-specific disease models for identification of therapeutic targets, validation of therapeutic efficacy, and studies of disease.
- Dysregulation of matrix organization and aberrant wound healing pathways are associated with loss of matrix protein diversity and obliteration of distal lung tissue structure in end-stage cystic fibrosis. While many therapeutics aim to functionally restore defective cystic fibrosis transmembrane conductance regulator (CFTR), drugs that target dysregulated matrix pathways may serve as adjunct interventions to support lung recovery.
- CFTR cystic fibrosis transmembrane conductance regulator
- Figure 1 A shows a schematic overview of the experimental procedure. Cystic fibrosis and control lung tissues were procured to extract and analyze the distal lung matrix structure and composition through proteomic profiling, multimodal imaging (e.g. histology, immunostaining, electron microscopy) and gene ontology.
- proteomic profiling e.g. histology, immunostaining, electron microscopy
- gene ontology e.g. histology, immunostaining, electron microscopy
- Figure IB shows aspects of the matrix extracted from human cystic fibrosis lung featuring native disease-specific composition and/or mechanics.
- Isolated lung ECM is obtained through decellularization and can be used to prepare (i) soluble matrikine cocktails, (ii) decellularized scaffolds, and (iii) hydrogels for various cell culture substrate applications.
- a hydrogel is a biphasic material, a mixture of porous, permeable solids and at least 10% by weight or volume of interstitial fluid comprising mainly water.
- the porous permeable solid is a water-insoluble three-dimensional network of natural or synthetic polymers and a fluid, having absorbed a large amount of water or biological fluids. The structure is maintained due to chemical or physical cross-linking of individual polymer chains.
- Hydrogels also possess a degree of flexibility very similar to natural tissue die to their significant water content, allowing for in vitro study of proteins within a hydrogel.
- Hydrogels may be prepared using a variety of polymeric materials, which can be divided broadly into two categories according to their origin: natural or synthetic polymers.
- Natural polymers for hydrogel preparation include hyaluronic acid, chitosan, heparin, alginate, gelatin and fibrin
- Common synthetic polymers include polyvinyl alcohol, polyethylene glycol, sodium polyacrylate, acrylate polymers and copolymers thereof.
- Figures 2A and 2B show aspects of an in vitro cystic fibrosis lung model system showing that the CF model recapitulates cell-cell-matrix crosstalk.
- Figure 2A shows schematically that isolated lung ECM biomaterials (soluble matrikines, scaffolds, hydrogels) may be prepared for incorporation as a disease-specific substrate with multiple cell types (cell types #1 and #2) such as bronchial epithelium, mesenchymal stromal cells, fibroblasts, macrophages, and other cell types.
- 2B shows example readouts and outputs from the in vitro cystic fibrosis model system.
- Figures 3 A and 3B show a comparison of CF and normal lung ECM biomaterials using microscopy by Hematoxylin and eosin (H&E) staining of airways and parenchyma from native lung tissue (Fig. 3A) and decellularized extracellular matrix biomaterials (Fig. 3B).
- CF lung parenchyma displays proteinaceous fluid filled airways and thrombosis compared to healthy parenchyma with clear airway and alveolar space.
- CF airway cross section reveals epithelial cell hyperplasia, thickened basement membrane, and abnormal airway mucus compared to healthy control with phenotypically normal basement membrane and pseudostratified airway epithelium.
- CF ECM biomaterial retains features of native CF lung including parenchymal derangement and basement membrane thickening compared to healthy ECM biomaterial.
- Figures 4A and 4B show a comparison of CF and control lung ECM biomaterials composition and ultrastructure.
- CF and control lung ECM biomaterials were compared with (Fig. 4A) histology including hematoxylin and eosin (H&E), Masson’s tri chrome (blue, collagens), elastic van Gieson (EVG) (black, elastin), and (Fig. 4B) electron microscopy including scanning electron microscopy (SEM), and transmission electron microscopy (TEM).
- Figures 4C and 4D show additional structural comparisons of cystic fibrosis and control lung tissue.
- Figures 5 A and 5B show a comparison of CF and control lung ECM biomaterial key structural constituents.
- Collagen IV, elastin, fibronectin, and laminin were visualized with immunofluorescent imaging (Fig. 5A) and quantified with LC-MS/MS relative abundance (Fig. 5B).
- Figure 6 shows the composition of CF ECM biomaterials by matrisome category. Collagens, glycoproteins, proteoglycans, ECM-affiliated proteins, ECM-regulator proteins, and secreted factors were quantified using LC-MS/MS.
- Figure 7 shows quantification of cystic fibrosis and control lung ECM biomaterial cytokine profiles. Cytokine levels were measured in CF and control lung ECM.
- the cytokines included EGF, epidermal growth factor; FGF-2, fibroblast growth factor-2; 1L-12P40, interleukin 12B; MDC, C-C motif chemokine ligand 22; IL-13, interleukin- 13; G-CSF, colony stimulating factor 3; Flt-3L, fms related receptor tyrosine kinase 3; GM-CSF, granulocyte-macrophage colony stimulating factor; IL-IRA, interleukin-1 receptor agonist; IL-la, interleukin- 1 alpha; IL-9, interleukin-9; IFN-a2, interferon alpha-2; GRO alpha, C-X-C motif chemokine ligand 1; MCP-3, chemokine ligand 7; IL-4, interle
- the matrisome includes a group of proteins encoded by genes for core ECM proteins (collagens, proteoglycans, and ECM glycoproteins) and ECM-associated proteins (proteins structurally resembling ECM proteins, ECM remodeling enzymes, and secreted factors).
- core ECM proteins collagens, proteoglycans, and ECM glycoproteins
- ECM-associated proteins proteins structurally resembling ECM proteins, ECM remodeling enzymes, and secreted factors.
- the “core matri some” comprises ⁇ 300 proteins, encoded by an ensemble of over 1000 genes.
- ECM-modifying enzymes ECM-binding growth factors
- other ECM-associated proteins are large numbers of ECM-associated proteins. These different categories of ECM and ECM- associated proteins cooperate to assemble and remodel extracellular matrices and bind to cells through ECM receptors.
- the matrisome can be elucidated by proteomic techniques used in mapping the genome of organisms.
- proteomic techniques used in mapping the genome of organisms.
- dysregulation of matrix pathways and alterations to distal lung matrix structure and composition accompany the well-described hallmarks of CF, including chronic infection, inflammation, structural changes to the airways, and progressive decline in lung function. Changes to the matrix were visualized at multiple scales by histology and electron microscopy.
- LC-MS/MS liquid chromatography mass spectrometry
- LC-MS/MS liquid chromatography mass spectrometry
- Ultrastructural abnormalities in CF distal lung matrix The lung matrix is a complex, well-organized, 3D structure that supports lung function by providing a large surface area for gas exchange and allowing for lung breathing.
- histological staining was performed on lung specimens from all patients to visualize overall tissue histomorphology (H&E), and the distribution of collagen (Masson’s tri chrome, blue), and elastin (elastic van Gieson, black) ( Figures 16 and 17).
- Figure 16 shows histological imaging of CF and control lungs with H&E, tri chrome, and elastin van Gieson (EVG) for samples from all patients and controls.
- Figure 17 shows multi-modal imaging of CF and control lungs, including high magnification histology (H&E, tri chrome, EVG), scanning electron microscopy (SEM), and immunofluorescent staining for elastin. Histological staining of airway sections confirmed stereotypical airway morphology, including elevated levels of glycoproteins and mucins (Alcian blue, blue) in CF ( Figure 18). Compared to control lung, CF specimens displayed expected septal thickening, fragmented fibers, and proteinaceous fluid-filled airways and alveoli with varying degrees of severity.
- H&E high magnification histology
- SEM scanning electron microscopy
- Lung parenchymal ultrastructure and alveolar architecture were grossly abnormal in CF with airway and alveolar obstruction and collapse, as evidenced by scanning electron microscopy (SEM) imaging, indicative of parenchymal destruction.
- SEM scanning electron microscopy
- Visual assessment of the epithelium, endothelium, and alveolar basement membrane by transmission electron microscopy (TEM) revealed basement membrane disruption and alveolar collapse ( Figures 4B and 4C).
- Figure 19 shows heat maps showing differences in lung matrix proteins in cystic fibrosis and control lung tissue detected using LC-MS/MS of whole patient tissue. Detected peptides were filtered using The Matrisome Project database to specifically identify differential expression of: (A) collagens, (B) glycoproteins, (C) matrix-affiliates, (D) matrix-regulators, and (E) secreted factors.
- Figure 20 shows aspects of molecular function pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung.
- GO gene ontology
- Figure 21 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung.
- GO gene ontology
- Figure 22 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung.
- GO gene ontology
- Figure 23 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung.
- GO gene ontology
- Figure 24 shows aspects of the preparation of matrix extract from whole patient tissue through detergent and enzyme decellularization that results in nearly complete removal of genetic material shown with (A) absence of DAPI signal on histology, and (B) >95% reduction in DNA content detected with PicoGreen DNA assay.
- Figure 25 shows violin plots showing relative abundance of matrix proteins in cystic fibrosis and control matrix extracts, including (A) collagens, (B) proteoglycans, (C) glycoproteins, (D) matrix-affiliates, (E) matrix-regulators and (F) secreted factors.
- Detected proteins are categorized according to The Matrisone Project database.
- Figures 8A-8C show aspects of a global analysis of the cystic fibrosis lung matrisome.
- Fig. 8A shows a Principal component analysis (PCA) of CF and control lung matrix. The shape of marker indicates patient mutations: circle, AF508/AF508; triangle, AF508/G542X; hexagon, AF508/unknown.
- Fig. 8B is a Volcano plot of differentially expressed matrisome components.
- Fig. 8C shows a gene ontology (GO) analysis of pathways significantly altered in CF.
- BP biological processes
- CC cellular components
- MF molecular factors.
- Figures 9A-9D show characterization of the core matrix structure and composition in cystic fibrosis and control lung. Expression of core matrisome components, including collagens (Fig. 9A), glycoproteins (Fig. 9B), and (C) proteoglycans (Fig. 9C), using LC-MS/MS is shown. Fig. 9D shows expression of basement membrane constituents and elastin using immunofluorescence.
- Figures 10A-10D show an analysis of matrix-associated proteins in cystic fibrosis and control lung, including matrix-affiliated (Fig. 10A), matrix-regulators (Fig. 10A), and secreted factors (Fig. 10C) in CF and control lung matrisomes.
- Fig. 10D shows representative immunostaining of differentially expressed proteins in each category. Arrows indicate positive cytoplasmic galectin staining. Asterisks indicate positive nuclear NFKB.
- Macrophages are specialized white blood cells involved in the detection, phagocytosis and destruction of bacteria and other harmful organisms. In addition, they can also present antigens to T cells and initiate inflammation by releasing molecules (known as cytokines) that activate other cells.
- Figure 11 shows confirmation of WTC11 and CF iPSC differentiation into macrophages with flow cytometry. Flow cytometry confirmed expression of CDl lb and CD14 in iPSC-derived CF and WTC11 macrophages.
- Figure 12 shows an experimental design for macrophage studies.
- CF and WTC11 iPSC- macrophages were co-cultured in basal conditions and with CF and control lung ECM.
- Primary readouts include cytokine expression, RNA sequencing, and gene ontology.
- Figure 13 shows aspects of cystic fibrosis and WTC11 macrophage and extracellular matrix co-culture system. Bright field images of WTC11 and CF macrophages exposed to CF and control lung ECM in vitro are shown.
- Figures 14A-C show aspects of WTC11 and cystic fibrosis macrophage cytokine expression in response to CF and control lung extracellular matrix.
- Fig. 14A shows WTC11 and CF macrophage cytokine expression at baseline.
- Fig. 14B shows WTC11 and CF macrophage cytokine expression in response to CF lung extracellular matrix.
- Fig. 14C shows WTC11 and CF macrophage cytokine expression in response to control lung extracellular matrix.
- MCP-1 monocyte chemoattractant protein-1; IL-8, interleukin 8; IL-18, interleukin 18. *p ⁇ 0.05; **p ⁇ 0.01.
- Figures 15A-B show aspects of macrophage cytokine expression in response to CF extracellular matrix.
- Fig. 15A shows WTC11 macrophages exposed to CF extracellular matrix cytokine expression fold change over basal WTC11 macrophages.
- Fig. 15B shows CF macrophages exposed to CF extracellular matrix cytokine expression fold change over basal CF macrophages.
- Figure 18 shows stereotypical alterations to the airways seen in cystic fibrosis patient tissue versus control lung shown with H&E and Alcian blue (Representative images are from CF patient #1, CF patient #9, and control #3).
- Figure 26 shows aspects of molecular function pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung.
- GO gene ontology
- Figure 27 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung.
- GO gene ontology
- Figure 28 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung.
- GO gene ontology
- Figure 29 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung.
- GO gene ontology
- Figures 30A-C shows GO networks identified by filtering for upregulated peptides (log2(FC)>l) and downregulated peptides (log2(FC) ⁇ -1).
- Fig. 30A shows molecular function networks
- Fig. 30B shows cellular component networks
- Fig. 30C shows biological process networks.
- perlecan HSPG2, proteoglycan found in the basement membrane
- Figures 31 A-B show aspects of collagen expression in cystic fibrosis and control lung matrix
- Fig. 31A shows a table of collagen expression. Green highlight indicates significance (p ⁇ .05).
- Fig. 3 IB shows a heat map of differential expression of collagens demonstrating hierarchical clustering of patients and genes.
- HRG Histidine rich 241 glycoprotein
- PDGF-B platelet derived growth factor subunit B
- NS fibulin-1
- NS type 3 collagen
- Lung extracellular matrix serves as the major structural component of the lung and provides large surface area for gas exchange in the form of the alveolar basement membrane.
- CF structural remodeling of the airways and elevated levels of proteolytic enzymes and matrix breakdown products in airway fluid are recognized indicators of worsening disease.
- the lung matrix serves as a structural scaffold that provides macro- and micro-scale features to support lung function, including ventilation and oxygenation.
- elastin confers the lung with appropriate compliance and enables dynamic movement during breathing
- basement membrane proteins provide a well-organized, thin membrane across which gas exchange occurs. Disruption to matrix proteins that enable ventilation and oxygenation has a deleterious effect on lung function.
- Our findings indicate that matrix constituents involved in lung elasticity (i.e., elastin) and basement membrane integrity (i.e., collagen IV, laminin) are pathologically altered in CF.
- Elastin was degraded in end-stage CF, as evidenced by LC-MS/MS and immunofluorescence. We also observed a loss of lysyl oxidase 2 (LOXL2), which functions as an elastin crosslinker to stabilize the matrix.
- LXL2 lysyl oxidase 2
- Basement membrane constituents including several isoforms of collagen IV and laminin which were visualized with immunofluorescence and quantified with LC-MS/MS, were degraded in end-stage CF, consistent with dysregulation of the basement membrane and alveolar structure observed on SEM and TEM.
- Disruption to the basement membrane is a feature of many acute and chronic lung pathologies (e g., emphysema, COPD, acute respiratory distress syndrome (ARDS)), contributing to functional impairment of the lung by compromising the integrity of the blood-gas barrier. This pattern of destruction may be mediated by an imbalance between proteases and protease inhibitors, and has been shown to correlate with mortality in other respiratory conditions. Loss of basement membrane integrity in CF may contribute to cytokine release that triggers paracrine-mediated inflammation, as well as edema and alveolar fluid retention, leading to impaired gas exchange.
- IL-16 and TGF-p were both significantly increased in CF lung tissue and response to TGF-P was an identified GO term, indicative of the inflammatory process that contributes to aberrant wound healing and can signal epithelial-mesenchymal transition (EMT), a common pathway implicated in many lung diseases.
- EMT epithelial-mesenchymal transition
- Dysregulated EMT has deleterious effects on lung cell phenotype and function by: (i) impairing epithelial barrier function and innate defense mechanisms, (ii) enabling migration of activated stromal cells throughout the lung matrix, and (iii) promoting stromal cell hyperplasia while compromising pseudostratified airway epithelium.
- Described herein are: (i) Matrix extracted from human cystic fibrosis lung featuring native disease-specific composition and/or mechanics; (ii) Matrikines extracted from human cystic fibrosis lung featuring native tissue biomolecular profiles; and (iii) A method for extracting human cystic fibrosis lung matrix and/or matrikines from diseased and normal tissues.
- the matrix or matrikines can be used to condition or culture cells or to utilize as a therapeutic delivery vehicle.
- An in vitro cystic fibrosis lung model system that incorporates the CF matrix or matrikines or other disease-specific human tissue components and factors, including cells, matrix, matrikines, mucus, sputum, bronchoalveolar lavage fluid, serum, plasma, extracellular vesicles, micro-organisms, and/or other soluble factors is proposed.
- This model system can be used to study cystic fibrosis or other lung diseases ex vivo.
- the model system can be used to culture or co-culture cells in vitro, including epithelium, endothelium, stromal, or immune lineages, to model disease-specific mechanisms, e.g., cell-cell or cell-matrix interactions, or other crosstalk in vitro.
- the model system couldbeusedto identify therapeutic targets, develop therapeutics or drugs, test therapeutics or drugs, or evaluate the efficacy of gene or cell therapy to treat cystic fibrosis.
- the model system could be used to study various CFTR mutations, CFTR signaling, or to evaluate CFTR-targeting therapeutics, including modulators and correctors.
- CFTR modulator drugs such as Trikafta have revolutionized the cycle-of-care for CF patients and led to dramatic improvements in functional lung parameters.
- the ability of these CFTR-targeting medications to indirectly prevent matrix degradation, recover dysregulated matrix pathways, or repair degraded lung matrix should be evaluated.
- Drivers of matrix destruction identified in this study could act as therapeutic targets or biomarkers to monitor disease progression.
- Drugs targeting dysregulated matrix pathways may serve as adjunct interventions to CFTR modulators to support repair of damaged tissue and recovery of lung function in CF patients.
- pathology e.g., fibrosis
- H&E hematoxylin and eosin
- EMG elastic van Gieson’s
- pentachrome and Alcian blue
- Lung samples were de-paraffinized, submerged in boiling citrate buffer (pH 6.0) or EDTA buffer (pH 8.0) for antigen retrieval for 20 minutes, and blocked with 10% normal donkey serum in phosphate-buffered saline for 2 hours at room temperature.
- Primary antibodies were added and incubated for 12 hours at 4°C, or 4 hours at 25°C. Secondary antibody was diluted 1 :500 and incubated for 1 hour at 25°C. Sections were mounted in mounting medium (Vectashield Mounting Medium; Vector Laboratories) with DAPI, cover-slipped, and imaged with a Leica DMi8 fluorescence microscope.
- Lung specimens were fixed with 2.5% glutaraldehyde, 4% paraformaldehyde, and 0.02% picric acid in 0.1 M sodium cacodylate buffer (pH 7.2). Samples were then post-fixed with 1% OsO4 in Soreson’s buffer for 1 hour, dehydrated, and embedded in Lx-112 (Ladd Research Industries). Sections (60 nm) were prepared using an ultramicrotome (PowerTome PT XL; RMC), stained with uranyl acetate and lead citrate and examined with a transmission electron microscope (JEM- 1200 EXII; JEOL).
- Lung matrix was extracted via detergent and enzyme decellularization. Human lung tissue was rinsed in phosphate-buffered saline. Lungs were sliced into 2 -mm sheets and washed with sterile water for 30 minutes to remove residual blood and debris. Tissue slices were then subject to four 2-hour wash cycles with CHAPS detergent (8mM CHAPS, IM NaCl, and 25mM EDTA) followed by rinses with dH2O and 2X PBS.
- CHAPS detergent 8mM CHAPS, IM NaCl, and 25mM EDTA
- tissue sheets were rinsed in benzonase precondition buffer (50mM tris-HCl, 0.1 mg/mL bovine serum albumin (BSA), ImM MgC12) and then subject to enzyme decellularization by washing with benzonase (90 U/mL; Sigma-Aldrich) in benzonase precondition buffer. Tissue was then rinsed with PBS, snap frozen in liquid nitrogen, pulverized into a fine powder using mortar and pestle, and dehydrated using a lyophilizer.
- benzonase precondition buffer 50mM tris-HCl, 0.1 mg/mL bovine serum albumin (BSA), ImM MgC12
- BSA bovine serum albumin
- ImM MgC12 ImM MgC12
- Lung tissue and extracted lung matrix were resuspended in sodium deoxycholate (SDC) lysis buffer (1% SDC, 10 mM TCEP, 40 mM CAA and 100 mM TrisHCl pH 8.5) and boiled for 20 min at 60°C, 1500 rpm on thermomixer (Eppendorf Thermomixer C) to denature and reduce and alkylate cysteines, followed by sonication in a water bath, cooled down to room temperature. ECM samples then underwent deglycosylation with PNGaseF (500 U/ pl) at 37° C and 1500 rpm in a thermomixer (Eppendorf Thermomixer C) as in previous protocols.
- SDC sodium deoxycholate
- lysis buffer 1% SDC, 10 mM TCEP, 40 mM CAA and 100 mM TrisHCl pH 8.5
- thermomixer Eppendorf Thermomixer C
- Protein digestion was performed by adding LysC and trypsin in a 1 :50 ratio (pg of enzyme to pg of protein) at 37°C and 1500 rpm for 2 hours and overnight in a thermomixer (Eppendorf Thermomixer C), respectively. Peptides were then acidified with 1% trifluoroacetic acid (TFA) and subjected to StageTip cleanup via styrenedivinylbenzene-reverse phase sulfonate (SDB-RPS).
- TFA trifluoroacetic acid
- Peptides were washed with 1% TFA 99% ethyl acetate followed by 0.2% TFA 5% acetonitrile (ACN) at 1000 x g, and eluted with 1% Ammonia, 50% ACN and dried at 60°C in a SpeedVac centrifuge.
- ACN acetonitrile
- the UltiMate 3000 Ultra High-Performance Liquid Chromatography (UHPLC) system (Thermo Scientific) and EASY-Spray PepMap column (Thermo Fisher Scientific, RSLC C18 50 cm x 75 m ID) coupled with Orbitrap Fusion (Thermo) were used to separate fractioned peptides with a 5-30% acetonitrile gradient in 0.1% formic acid over 120 min at a flow rate of 250 nL/min. After each gradient, the column was washed with 90% buffer B for 5 min and re-equilibrated with 98% buffer A (0.1% formic acid, 100% high performance liquid chromatography (HPLC)-grade water) for 40 min.
- HPLC high performance liquid chromatography
- Survey scans of peptide precursors were performed from 350-1200 m/z at 120K full width at half maximum (FWHM) resolution (at 200 m/z) with a 1 x 106 ion count target and a maximum injection time of 60 ms with 3 s cycles for the survey and the MS/MS scans.
- 26 m/z DIA segments were acquired from 200-2000 m/z at 60K FWHM resolution (at 200 m/z) with a 1 x 106 ion count target and a maximum injection time of 118 ms.
- High-energy collisional dissociation (HCD) fragmentation was applied with 27% collision energy and resulting fragments were detected using the rapid scan rate in the Orbitrap.
- DIA Data independent acquisition
- directDIA 2.0 Deep learning augmented spectrum-centric DIA analysis
- Spectronaut Pulsar X a mass spectrometer vendor independent software from Biognosys.
- Default settings were used for targeted analysis of DIA data in Spectronaut, except the decoy generation was set to “mutated.”
- LC-MS/MS data was filtered for proteins identified by more than one unique peptide, and global normalization was applied using the median intensity of identified peptides. Classification of identified proteins into matrisome subgroups was done using the protein lists presented by Naba et al.
- the false discovery rate (FDR) was estimated with the mProphet approach and set to 1% at the peptide precursor level and at 1% at the protein level. Results obtained from Spectronaut were further analyzed using the Spectronaut statistical package. Significance wasdetermined by unpaired t-test with a threshold for significance of p ⁇ 0.05 (permutation-based FDR correction) and
- aortic smooth muscle Marker of activated myofibroblasts in idiopathic pulmonary fibrosis expressed by airway and vascular smooth muscle cells
- cytoplasmic 2 Regulates mucus secretion and ENaC channel function
- Biglycan Structural component of ECM signaling molecule indicative of tissue stress or injury; regulates inflammation and immunity
- Clusterin Extracellular clusterin signals apoptosis; Intracellular clusterin promotes wound healing
- Collagen alpha- 1(1) chain Expressed by profibrotic airway macrophages in pulmonary fibrosis; correlated with immune infiltration
- Collagen alpha- 1 (III) chain Upregulated in response to lung injury and fibrosis
- Collagen alpha- 1 (VI) chain Plays a critical role in lung development; Loss of COL6A1 and
- Collagen alpha-2(VI) chain COL6A2 leads to chest wall contractures, scoliosis, and muscle
- Cytoplasmic dynein 2 heavy chain 1 Supports ciliaiy function and innate immune response Fibrinogen beta chain Secreted basolaterally by pulmonary epithelium
- Lumican Regulates collagen organization, epithelial cell migration, and tissue repair
- Phosphatidylinositol 3,4,5- Plays a role in insulin signaling; Implicated in many cancers trisphosphate-dependent Rac exchanger 2 protein Prolargin Anchors basement membrane to underlying connective tissue; binds proteoglycans
- Translgutaminase 2 Mediates alveolar macrophage activation and lung inflammation
- Vitronectin Glycoprotein released during inflammation regulates cell growth and mesenchymal epithelial transition
- Zinc finger protein 251 Regulates transcription, proliferation, differentiation via ERK signaling pathway
- WNT2 MMP12 regulation of epithelial cell proliferation 1.2830E-03 FGF2, LAMC1, ACVRL1, GLUL, RPTOR, WNT7A, BMP5, CXCL12, TNFSF12, EPPK1, WNT3A, TEK, WNT5A, PDGFB, LIMS2, COL4A3, VVNT2.
- WNT5A PDGFB. HDAC7
- SRPX2 organ induction 5.0163E-03 FGF2, WNT11, WNT3A, WNT5A, WNT2, WNT2B regulation of epithelial cell migration 8.5580E-03 FGF2, ITGA3, ACVRL1, GLUL, RRAS, WNT7A, CIB1, BMPER, EPPK1, TEK, WNT5A.
- COL6A2 QSOX1, PDGFA, WNT7B, ALB, COL6A3, COL7A1, ARSI, MFGE8, WNT3A, PRSS23, WNT5A, PDGFB, ESD, COL4A4, COL12A1, P3H1, COL4A3, COL18A1, COL4A1, COL4A2, COL21A1, APOB, COL4A6, COL11A1, COL26A1, COL4A5, VCPIP1, MATN3 basement membrane 1 .0005E-19 LAMC1 , LOXL2, LAMC3, COL8A1 , LAMA4, LAMB2, CCDC80, LAMA5, NIDI ,
- CSPG4, CDH1, INPPL1 contractile actin filament bundle 3.9321E-02 ABLIM3, MYH10, MYH14, TEK, PDLIM3, PGM5, SHROOM4 _ stress fiber 3.9321E-02 ABLIM3, MYH10, MYH14, TEK, PDLIM3, PGM5, SHROOM4
- ECM proteoglycans 2.3939E-18 LAMC1, BGN, COL5A3, LAMA4, LAMB2, COL6A2, LAMA5, HSPG2, COL6A3, LAMA2, COL4A4, COL4A3, COL6A6, COL4A1, COL4A2, ASPN, FMOD, COL4A6, COL4A5, HAPLN1, ACAN, MATN1, MATN3
- LAMC1 Laminin interactions 8.7459E-18 ITGA3, LAMC1.
- Non-integrin membrane-ECM interactions 4.1577E-13 FGF2, LAMC1, COLS A3, LAMC3, LAMA4, LAMB2, LAMAS, PDGF A, FLSPG2, LAMA2, PDGFB, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL11A1, COL4A5
- Collagen biosynthesis and modifying enzymes 4.2490E-13 COL5A3, COL8A1, COL6A2, COL6A3, COL7A1, COL4A4, COL12A1, P3H1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, COL4A6, COL11A1, COL26A1, COL4A5, COL6A5
- MET activates PTK2 signaling 1.0847E-05 ITGA3, LAMC1, COL5A3, LAMC3, LAMA4, LAMB2, LAMA5, LAMA2, COL11A1
- RES11A1 MET promotes cell motility 1.6763E-04 ITGA3, LAMC1. COL5A3, LAMC3, LAMA4, LAMB2, LAMAS, LAMA2, COL11A1
- NCAM signaling for neurite out-growth 6.1185E-04 COL5A3, COL6A2, COL6A3, COL4A4, COL4A3, COL6A6, COL4A1, COL4A2,
- Insulin-like Growth Factor IGF
- NADH dehydrogenase activity 1.0840E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, AIFM1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 polyubiquitin modification-dependent protein binding 1.3678E-03 PSMD4, UBQLN2, EPS15, DNAIB2, RNF31, RAD23B, TNIP2, BRCC3, NPLOC4, VCP, UBXN1, BAG6, UBQLN1
- NADH dehydrogenase (ubiquinone) activity 3.5778E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5
- NADH dehydrogenase (quinone) activity 4.5554E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 translation regulator activity, nucleic acid binding 5.2666E-03 DHFR, EIF1, PAIP2, EIF4H, ELOC, EIF5, EIF2S1, EEF1B2, EEF1D, EIF2B2, EEF1A1, COPS5, PABPC1, ELOB, EIF3M, EIF3K, EFL1, EIF4G1, EIF2D ubiquitin-like protein binding 6.4700E-03 UBE2L6, STAM2, NUP62, SERBP1, HGS, TSG101, STAM, DNAJB2, RNF31, AUP1, NSFL1C, RAD23B, FAF2, RAE1, NPLOC4, PELP1, RBCK1, UBXN1
- NAD(P)H dehydrogenase (quinone) activity 7.2266E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 ubiquitin binding 8.1477E-03 UBE2L6, STAM2, NUP62, HGS, TSG101, STAM, DNAJB2, RNF31, AUP1, NSFL1C, RAD23B, FAF2, RAE1, NPLOC4, RBCK1, UBXN1 antioxidant activity 1.0954E-02 SELENOF, HBM, GPX7, HBQ1, GPX3, EPX, SOD2, SELENOS, PXDN, HBB, PRDX4, APOM, TXNRD1, GPX8, HBG1 ubiquitin-like protein ligase binding 1.2291E-02 UBE2J1, TANK, WASHCI, UBE2L6, HGS, SCAMP
- SELENOS UBE2G2, FAF2, NPLOC4, VCP, ERLEC1, STUB1, UBXN1, BAG6, UBQLN1, CCDC47 actin polymerization or depolymerization 1.1057E-04 WAS, HCLS1, EVL, PPP1R9B, CTTN, EPS8, LIMA1, ENAH, TMOD3, BINI, ARPC5L,
- PTK2B PLEK, CAPG, KANK1, SPTA1, PSTPIP1, ARPC5, AL0X15, CAPZA1, SPTAN1, CAPZA2, ADD1, PSTPIP2, VAS P, ADD3, ABI1, SSH3, TM0D1 synaptic vesicle cytoskeletal transport 1.3866E-04 BLOC1S6, BLOC1S4, BLOC1S2, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1,
- AP3S1 synaptic vesicle transport along microtubule 1.3866E-04 BL0C1S6, BL0C1S4, BL0C1S2, BL0C1S3. SNAPIN, DTNBP1, BL0C1S5, AP3M1,
- AP3S1 anterograde synaptic vesicle transport 1.3866E-04 BLOC1S6, BLOC1S4, BLOC1S2, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1, AP3S1 ubiquitin-dependent ERAD pathway 2.0088E-04 SGTA, UBE2J1, UBXN4, UBQLN2, DNAJB2, HSP90B1, AUP1, HSPA5, SELENOS, UBE2G2, FAF2, NPLOC4, VCP, ERLEC1, STUB1, BAG6, UBQLN1, CCDC47 response to unfolded protein 2.4439E-04 VAPB, UBXN4, HSPB8, EIF2S1, DNAJB2, HSPB7, DDRGK1, HSPA5, COPS5, SELENOS, FAF2, HSPE1, ERP44, ERO1A, HSPA14, DNAJB1, VCP, HSP90AB1, ERLEC1, BAG3, HSPA8,
- RNA transport 3.2756E-04 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI, AKAP8L, TPR, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, XPOT, RTRAF, TST, KHS RP negative regulation of blood coagulation 4.4452E-04 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1. HRG
- RNA localization 4.7045E-04 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI,
- AKAP8L TPR, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, XPOT, RTRAF, TST, KHS RP macroautophagy 4.8086E-04 ATG13, VTA1, VPS37A, SPTLC2, CDC37, STAM2, HMOX1, HGS, VPS37B, UBQLN2,
- ERO1A HSPB6, HSPA14, DNAJB1, HSPA8 negative regulation of hemostasis 5.7922E-04 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1,
- RNA localization 1.3697E-03 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI, AKAP8L, TPR, HNRNPAB, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, XPOT, RTRA F, TST, KHSRP, NHP2 actin filament polymerization 2.4439E-03 WAS, HCLS1, EVL, CTTN, EPS8, TM0D3, BINI, ARPC5L, PTK2B, CAPG, KANK1, SPTA1, PSTPIP1, ARPC5, ALOX15, CAPZA1, SPTAN1, CAPZA2, ADD1, PSTPIP2, VASP, ADD3, SSH3, TM0D1 endosomal transport 3.O35OE-O3 WAS, DPY30, WASHC2A, VTA1, LAMTOR1, WASH
- VASP, ADD3, SSH3, TMOD1 cellular response to topologically incorrect protein 5.209 IE-03 VAPB, HSPB8, EIF2S1, UGGT1, DDRGK1, AUP1, HSPA5, COPS5, SELENOS, RNF126, ERO1A, HSPA14, VCP, ERLEC1, BAG3, HSPA8, STUB1, BAG6, PIK3R1 mRNA transport 5.2282E-03 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, CETN2, NUP58, QKI, AKAP8L, TPR, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, KHSRP regulation of mRNA metabolic process 5.7968E-03 TENT5C, SNRNP70, TAF15, SRSF9, C1QBP, SAP18, RBM4, VIM, SERBP1, ELAVL1, PAF1, SF1, NPM
- HRG axo-dendritic transport 2.2348E-02 BLOC1S6, BLOC1S4, BLOC1S2, ARMCX3, HSBP1, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1, AP3S1, APP, RAB27B, HSPA8 negative regulation of proteolysis 2.2486E-02 SERPINE1, SGTA, DPEP1, AHSG, LAMTOR5, IGBP1, PROS1, LPA, CAST, BINI, FETUB, ITIH6, ITIH2, AGT, GLG1, PSMF1, DNAJB2, ALAD, GAS6, SERPINF2, DDRGK1, SERPTNA10, ECM1, SERPTND 1, KNG1, PLAUR, TTTH4, APP, POR, HSP90AB1, SERPINA1, RPL23, HRG, UBXN1, BAG6 positive regulation of supramolecular fiber organization 2.2629E-02 WAS, EVL, CTTN
- VASP CLASP 1 negative regulation of actin filament depolymerization 2.2657E-02 EPS8, LIMA1, TMOD3, CAPG, SPTA1, CAPZA1, SPTAN1, CAPZA2, ADD1, ADD3, TMOD1 regulation of actin filament depolymerization 2.3014E-02 EPS8, LIMA1, TMOD3, PLEK, CAPG, SPTA1, CAPZA1, SPTAN1, CAPZA2, ADD1, ADD3, TMOD1 synaptic vesicle transport 2.5006E-02 BLOC1S6, DNM1, BLOC1S4, BLOC1S2, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1, AP3S1
- FAF2 ISLR, ITIH4, PRDX4, PLG, GHDC, ALDOC. APP, ERP44, SPTAN1, BIN2, TUBB, APOH, VCP, CNN2, 0LFM4, HSP90AB 1, ALDOA, SERPI NA1, C0MMD9, HSPA8, IMPDH2, HRG, S100A11, GUSB endoplasmic reticulum lumen 5.0884E-15 SELENOF, CSF1, F5.
- HDLBP HDLBP, APOH, MSR1, APOC3, SAA1 cytosolic ribosome 5.6261E-10 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, RPS4X, RPS12, RPL27A, ISG15, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF2D, RPL8, RPL21, RPL 38 blood microparticle 2.6250E-09 AHSG, FGA, FGB, FGG, PROS1, CPN2, ITIH2, AGT, SLC4A1, APOL1, JCHAIN, AFM, SERPINF2, ITGA2B, APOA1, F13A1, SLC2A1, KNG1, HBB, CIS, ITIH4, PLG, CP, APOA2, KRT1, GC, HSPA8, HRG, C D5L plate
- BLOC-1 complex 7.4272E-06 B LOC1S6, BLOC1S4, KXD1, BLOC1S2, BLOC1S3, SNAPIN, STX12, DTNBP1, BLOC1S5
- BLOC complex 7.7073E-06 BLOC1S6, BLOC1S4, KXD1, BLOC1S2, HPS6, BLOC1S3, SNAPIN, STX12, DTNBP1, BLOC1S5 polysome 8.5882E-06 RPS28, VIM, EIF2S1, BTF3, RPL7A, RPS6, FXR1, RPS4X, HDLBP, RPS21, VBP1, RPS26, RPL18, RPL32, EIF4G1, RPL8, RPL38 cortical cytoskeleton 1.4444E-05 IICLS1, PPP1R9B, CTTN, PDE4DIP, EPB41, ERC1, KRT19, SLC4A1, EPB42, TPM4, MAPRE1, SPTA1, NUMA1, SLC2A1, EEF1A1, SPTAN1, CAPZA2, MPP1, CALD1, CLASP 1, TM0D1 high-density lipoprotein particle 1.471 IE-05 APOC2, APOL
- U2-type spliceosomal complex 2.058 IE-05 BUD31, SNRPD1, IK, SF3A2, SNRNP70, SNRPC, RNF113A, SF3A1, HTATSF1, SNRPE, SF3A3, SF3B2, CDC5L, BCAS2, SF3B5, SNRPD2, XAB2, U2AF2, LUC7L3 small ribosomal subunit 2.5402E-05 RPS25, RPS28, MRPS35, MRPS22, MRPS9, MRPS31, RPS17, RPS6, RPS18, RPS4X, RPS12, ISG15, RPS14, RPS21, RPS26, DAP3, EIF2D endoplasmic reticulum protein-containing complex 4.2507E-05 P4HA1, MZB1, KRTCAP2, SPTLC2, SEC61G, SEC11C, PDIA6, HSP90B1, AUP1, HSPA5, SELENOS, FAF2, NPL
- BORC complex 4.5345E-03 KXD1, BORCS8, BLOC1S2, SNAPIN, BORCS6 spherical high-density lipoprotein particle 4.5345E-03 APOC2, APOA1, APOA2, APOM, APOC3 microtubule plus-end 4.8878E-03 PDE4DTP, CLTP1 , SLATN2, MAPRE1, NUMA1, CKAP5, CLASP1 , MAPRE2 pigment granule 5.0574E-03 CTSB, CALU, NCSTN, NAP1L1, SND1, CAPG, ERP29, PDIA6, HSP90B1, HSPA5, SLC2A1, DTNBP1, MYO5A, TPP1, RAB27B, HSP90AB1, HSPA8 melanosome 5.0574E-03 CTSB, CALU, NCSTN, NAP1L1, SND1, CAPG, ERP29, PDIA6, HSP90B1, HSPA5, SLC2A1, DTNBP1, M
- ESCRT complex 6.7708E-03 VPS37A, STAM2, HGS, VPS37B, TSG101, CHMP2B, STAM, CHMP1A cell cortex region 9.3O35E-O3 CLTA, EPB41, ERC1, NUMA1, MYL12B, GNAI1, CLTB, PHLDB1, CTBP2, CLASP1 cortical microtubule cytoskeleton 9.3978E-03 PDE4DTP, MAPRE1, NUMA1, CLASP1
- NDUFS8 NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 mitochondrial respiratory chain complex 1 9.5358E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7,
- NDUFV2, NDUFS4, NDUFA5 respiratory chain complex I 9.5358E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7,
- NDUFV2 NDUFS4, NDUFA5 axon cytoplasm 1.0589E-02 BLOC1S6, BLOC1S4, BLOC1S2, ARMCX3, HSBP1, BLOC1S3, SNAPIN, DTNBP1,
- U2-type precatalytic spliceosome 3.7005E-02 SNRPD1, IK, SF3A2, RNF113A, SF3A1, SNRPE, SF3A3, SF3B2, SF3B5, SNRPD2 condensed chromosome 3.7260E-02 P3H4, TP53BP1, CBX5, RCC1, PPP1R12A, PMF1, CLIP1, NUP43, ZNF207, PPP1CC,
- ESCRT-0 complex 4.1766E-02 STAM2, HGS, STAM stress fiber 4.2587E-02 TPM3, LIMA1, PDLIM4, TPM1, TPM4, PDLIM1, MYL12B, LIMCH1, CNN2, SYNPO.
- MYL9, BAG3 contractile actin filament bundle 4.2587E-02 TPM3, LIMA1, PDLTM4, TPM1 , TPM4, PDLTM1 , MYL12B, LTMCH1 , CNN2, SYNPO, MYL9, BAG3
- IGF Insulin-like Growth Factor
- SERPINA10 Binding SERPINA10, SERPIND1, MELTF, KNG1, FSTL1, PLG, L GALS1, MMP2, APP, CP, APOA2, G0L 1, SERPINA1, IGFBP2
- Nonsense Mediated Decay independent of the 8.7308E-07 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, PABPC1, E RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
- ROBO receptors 3.2410E-06 EXT. PSMD4, ENAH, RPS25, RPS28, RPLP2, RPLP1, PSMF1, ELOC, RPL17, RPL13, RPS17, NRP1, PSMC2, RPL26, SRGAP2, PSMC1, RPL7A, PSMC3, PSMD2, RPS6, PABPC1, RPS18, ELOB, PSMC4, RPS4X, RPS12, RPL27A, VASP, RPS14, RPS21, CLASP1, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
- NUP214 Cellular response to heat stress 1.2607E-05 NUP214, NUP43, NUP50, NUP62, HSPB8, NUP54, HSBP1, HSPA5, EEF1A1, TPR, DNAJC7, STB, RAE1, RPA3, SEC13, HSPA14, DNAJB1, VCP, HSP90AB1, NUP88, BAG2, BAG3, HSPA8
- EIF2AK4 GCN2
- GCN2 EIF2AK4
- Nonsense-Mediated Decay (NMD) 6.1187E-05 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, PABPC1, RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
- Nonsense Mediated Decay enhanced by the 6.1187E-05 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, PABPC1, Exon RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
- MAN1A2 Transport to the Golgi and subsequent modification 1.4799E-04 MAN1A2, F5, COPE, TUBB3, MIA2, SEC16A, GOLGB 1, SEC23IP, NAPG, ANK1, DCTN2, MIA3, FUT8, SPTA1, DYNC1I2, TFG, COG6, COG7, CAPZA1, LMAN1, SEC13, MAN2A1, SPTAN1, CAPZA2, COPZ1, SAR1B, COG4, COPA, GOLGA2, TUBB6, COG2, SERPINA1, COPB2, TUBB 1
- LAMTOR5 LAMTOR1, RPS25, RPS28, RPLP2, RPLP1, RPL17, EIF2S1, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, ATP6V1F, SEC13, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, LAMTOR3, RPL8, RPL21, RPL38
- Intra-Golgi and retrograde Golgi-to-ER traffic 3.7548E-04 MAN1A2, GOLGA5, TRIP11, PLIN3, COPE, TUBB3, TMF1, NAPG, CYTH4, TGOLN2, DCTN2, KIF2A, GALNT2, GCC2, DYNC1I2, COG6, COG7, CAPZA1, KLC2, MAN2A1, KLC1, CAPZA2, COPZ1, PAFAH1B3, VAMP3, STX16, COG4, COPA, TUBB6, COG2, SNAP29, ARFRP1, RAB3GAP1, COPB2, TUBB1
- Clathrin-mediated endocytosis 1.5007E-03 LDLR, CLTA, CTTN, SH3GL1, BINI, STAM2, DAB2, DNM1, HGS, UBQLN2, HIP1, TGOLN2, FNBP1L, EPS15, TRIP10, STAM, COPS8, PACSIN3, COPS5, ARPC5, COPS6, CLTB, VAMP3, SNX18, COPS4, HSPA8, UBQLN1
- BRAF and RAFI fusions 3.7979E-03 FGA, FGB, FGG, PAPSS1, MPRIP, FAM114A2, AKAP9, SND1, LMNA, QKI, ITGA2B, APBB1IP, FXR1, AGTRAP, TLN1, AGK
- Intra-Golgi traffic 2.0847E-02 MAN1A2, GOLGA5, TRIP11, NAPG, CYTH4, COG6.
- Oncogenic MAPK signaling 2.7686E-02 FGA, FGB, FGG, PAPSS1, MPRIP, FAM1 14A2, PPP1 CC, AKAP9, SND1 , LMNA, QKI, ITGA2B, APBB 1IP, FXR1, AGTRAP, TLN1, AGK
- NUP214 Host Interactions of HIV factors 3.3854E-02 NUP214, PSMD4, RCC1, NUP43, NUP50, NUP62, NUP54, PSMF1, ELOC, RANBP1, NPM1, PSMC2, SKP1, PSMC1, PSMC3, PSMD2, TPR, ELOB, RAE1, PSMC4, SEC13, NUP88
- a biological tissue model configured for in vitro applications, the biological tissue model comprising: a substrate including a plurality of isolated, soluble matrikines; wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue.
- the biological tissue model of claim 6, wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
- a method of preparing a biological tissue model configured for in vitro applications comprising: isolating a plurality of soluble matrikines from an extracellular matrix; incorporating the plurality of soluble matrikines into a substrate; and recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue with the substrate.
- incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a scaffold.
- incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a hydrogel.
- processing the isolated, soluble matrikines by crosslinking the isolated, soluble matrikines with each other for incorporation into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a hydrogel.
- the biological tissue model is a cystic fibrosis biological tissue model.
- recapitulating one or more of a microstructure, molecular composition, and biomechanical property includes recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
A biological tissue model for in vitro applications comprising a substrate including a plurality of isolated, soluble matrikines, wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue. Preparing the biological tissue model includes isolating a plurality of soluble matrikines from an extracellular matrix; incorporating the plurality of soluble matrikines into a substrate; and recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue with the substrate.
Description
TITLE
PATHOLOGICAL REMODELING OF DISTAL LUNG MATRIX IN END-STAGE CYSTIC FIBROSIS PATIENTS
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional application no. 63/337990 filed on May 3, 2022, the contents of which are incorporated by reference herein.
GOVERNMENT SUPPORT CLAUSE
[0002] This invention was made with government support under EB027062 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND
[0003] Cystic fibrosis (CF) is a genetic disease caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Cystic fibrosis (CF) is characterized by a pathologic cascade of impaired ion transfer, dysregulation of airway surface liquid and mucus, inability to clear infection, chronic inflammation, and ultimately end-stage lung disease necessitating transplantation. As disease severity increases, structural remodeling of the airways (i.e., bronchiectasis) presents as a hallmark feature that is routinely observed on chest radiography and evaluated with established scoring systems. Though these structural alterations to the airways are well-characterized, changes to the distal lung, including structure and composition of the parenchymal extracellular matrix (matrix), are understudied. Despite the recognized importance of the matrix in lung function as well as its involvement in many chronic respiratory diseases, a comprehensive characterization of the CF lung matrix has not been previously reported.
SUMMARY
[0004] A first aspect provides a biological tissue model configured for in vitro applications, the biological tissue model comprising: a substrate including a plurality of isolated, soluble matrikines; wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue.
[0005] Embodiments of the tissue model include the following, alone or in any combination.
[0006] The plurality of isolated, soluble matrikines may be incorporated into the substrate as a scaffold.
[0007] The plurality of isolated, soluble matrikines may be incorporated into the substrate as a hydrogel.
[0008] The biological tissue model is disease-specific.
[0009] The biological tissue model may be a cystic fibrosis biological tissue model.
[0010] The substrate may be capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native disease-specific biological tissue. [0011] The substrate may be capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
[0012] A second aspect provides a method of preparing a biological tissue model configured for in vitro applications, the method comprising: isolating a plurality of soluble matrikines from an extracellular matrix; incorporating the plurality of soluble matrikines into a substrate; and recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue with the substrate.
[0013] Embodiments of the method include the following, alone or in any combination.
[0014] The biological tissue model is that disclosed above, including any of the embodiments alone or in any combination.
[0015] Incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a scaffold.
[0016] Incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a hydrogel.
[0017] The method may further comprise processing the isolated, soluble matrikines by crosslinking the isolated, soluble matrikines with each other for incorporation into the substrate.
[0018] The method may further comprise processing the isolated, soluble matrikines by coating a surface of a scaffold for incorporation into the substrate.
[0019] Isolating the plurality of soluble matrikines includes treating a native biological tissue with a CHAPS -based detergent.
[0020] Isolating the plurality of soluble matrikines includes treating a native biological tissue with a Benzonase-based enzyme.
[0021] The method wherein the biological tissue model is disease-specific.
[0022] The method wherein the biological tissue model is a cystic fibrosis biological tissue model.
[0023] The method wherein recapitulating one or more of a microstructure, molecular composition, and biomechanical property includes recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native disease-specific biological tissue. [0024] The method wherein recapitulating one or more of a microstructure, molecular composition, and biomechanical property includes recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
BRIEF DESCRIPTION OF THE FIGURES
[0025] Figure 1A shows aspects of the experimental overview, according to exemplary embodiments of the disclosed subject matter.
[0026] Figure IB shows aspects of the matrix extracted from human cystic fibrosis lung featuring native disease-specific composition and/or mechanics, according to exemplary embodiments of the disclosed subject matter.
[0027] Figures 2A and 2B show aspects of an in vitro cystic fibrosis lung model system, according to exemplary embodiments of the disclosed subject matter.
[0028] Figures 3A and 3B show a comparison of CF and normal lung ECM biomaterials, according to exemplary embodiments of the disclosed subject matter.
[0029] Figures 4A-4D show comparisons of CF and control lung ECM biomaterials composition and ultrastructure, according to exemplary embodiments of the disclosed subject matter.
[0030] Figures 5A and 5B show a comparison of CF and control lung ECM biomaterial key structural constituents, according to exemplary embodiments of the disclosed subject matter.
[0031] Figure 6 shows the composition of CF ECM biomaterials by matrisome category, according to exemplary embodiments of the disclosed subject matter.
[0032] Figure 7 shows quantification of cystic fibrosis and control lung ECM biomaterial cytokine profiles, according to exemplary embodiments of the disclosed subject matter.
[0033] Figures 8A-8C show a global analysis of cystic fibrosis lung matrisome, according to exemplary embodiments of the disclosed subject matter.
[0034] Figures 9A-9D show characterization of the core matrix structure and composition in cystic fibrosis and control lung, according to exemplary embodiments of the disclosed subject matter.
[0035] Figures 10A-10D show an analysis of matrix-associated proteins in cystic fibrosis and control lung, according to exemplary embodiments of the disclosed subject matter.
[0036] Figure 11 shows confirmation of WTC11 and CF iPSC differentiation into macrophages with flow cytometry, according to exemplary embodiments of the disclosed subject matter.
[0037] Figure 12 shows an experimental design for macrophage studies, according to exemplary embodiments of the disclosed subject matter.
[0038] Figure 13 shows aspects of cystic fibrosis and WTC11 macrophage and extracellular matrix co-culture system, according to exemplary embodiments of the disclosed subject matter.
[0039] Figures 14A-C show aspects of WTC11 and cystic fibrosis macrophage cytokine expression in response to CF and control lung extracellular matrix, according to exemplary embodiments of the disclosed subject matter.
[0040] Figures 15A-B show aspects of macrophage cytokine expression in response to CF extracellular matrix, according to exemplary embodiments of the disclosed subject matter.
[0041] Figure 16 shows histological imaging of CF and control lungs, according to exemplary embodiments of the disclosed subject matter.
[0042] Figure 17 shows multi-modal imaging of CF and control lungs, according to exemplary embodiments of the disclosed subject matter.
[0043] Figure 18 shows stereotypical alterations to the airways seen in cystic fibrosis patient tissue versus control lung, according to exemplary embodiments of the disclosed subject matter.
[0044] Figure 19 shows heat maps showing differences in lung matrix proteins in cystic fibrosis and control lung tissue, according to exemplary embodiments of the disclosed subject matter.
[0045] Figure 20 shows aspects of molecular function pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0046] Figure 21 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0047] Figure 22 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0048] Figure 23 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0049] Figure 24 shows aspects of preparation of matrix extract from whole patient tissue through detergent and enzyme decellularization, according to exemplary embodiments of the disclosed subject matter.
[0050] Figure 25 shows violin plots showing relative abundance of matrix proteins in cystic fibrosis and control matrix extracts, according to exemplary embodiments of the disclosed subject matter.
[0051] Figure 26 shows aspects of molecular function pathways identified as significantly
different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0052] Figure 27 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0053] Figure 28 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0054] Figure 29 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis, according to exemplary embodiments of the disclosed subject matter.
[0055] Figures 30A-C shows GO networks identified by filtering for upregulated peptides and downregulated peptides, according to exemplary embodiments of the disclosed subject matter.
[0056] Figures 31 A-B show aspects of collagen expression in cystic fibrosis and control lung matrix, according to exemplary embodiments of the disclosed subject matter.
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0057] Reference is made in detail to select embodiments of the disclosed subject matter, examples of which are described herein. The method and corresponding steps of the disclosed subject matter are described in conjunction with the detailed description of the system.
[0058] Manifestations of cystic fibrosis, although well-characterized in the proximal airways, are understudied in the distal lung. In particular, characterization of the cystic fibrosis lung ‘matrisome’ (matrix proteome) has not been previously described, and could help identify
biomarkers and inform therapeutic strategies.
[0059] Lung matrix structure and composition facilitate gas exchange by providing mechanical integrity to withstand dynamic changes in pressure during breathing, elasticity to ventilate the distal alveoli, and biochemical cues to guide cell behavior and respond to injury. Key structural and biological matrix constituents in the lung include collagens and laminins, which comprise the basement membrane, and elastin which provides the lungs with elastic recoil enabling ventilation. In healthy patients, coordinated matrix remodeling governs lung tissue repair to restore function of an injured area. In diseased lungs, however, the matrix and its reparative woundhealing functions are compromised in a disease-specific manner. Because matrix structure and composition are intrinsically linked to cell, tissue, and organ-level function, we aimed to identify significantly altered matrix components and dysregulated pathways in CF.
[0060] We performed comprehensive, quantitative characterization of the lung matrix in cystic fibrosis, and determined that the lung matrix is pathologically altered in cystic fibrosis and that these alterations have a downstream effect on cell phenotype. This finding led to the incorporation of patient-derived matrix and matrikines in in vitro models of disease.
[0061] Matrikines are peptides liberated by partial proteolysis of extracellular matrix macromolecules, which are able to regulate cell activities. They are messenger peptides capable of regulating cell activities by interacting with their specific receptors and can activate certain genes involved in the process of extracellular matrix renewal and cell proliferation. Among these peptides, some of them may modulate proliferation, migration, protease production, or apoptosis, which suggest that they can play a significant role in the control of disease progression. Without limitation, matrikines nay be derived from elastin, connective tissue glycoproteins, or collagens.
[0062] Described herein are (i) materials (i.e., matrix and/or matrikines) that are isolated from human cystic fibrosis lung tissue. Also described is (ii) a disease model that incorporates these materials, (iii) methods for formulating (i) and (ii), and (iv) methods of use for (i) and (ii). Matrix and matrikines are isolated from patient tissue and feature native tissue biomolecular profiles, including core matrix proteins, growth factors, and cytokines. Although described primarily herein for the study of cystic fibrosis lung disease, the platform can be easily extended to include other diseases and organs. In cystic fibrosis, matrix and matrikine profiles can vary from patient-to- patient. Therefore, these materials enable patient-specific disease models for identification of therapeutic targets, validation of therapeutic efficacy, and studies of disease.
[0063] We performed liquid chromatography-mass spectrometry, gene ontology analysis, and multi-modal imaging, including histology, immunofluorescence, and electron microscopy for a
comprehensive evaluation of distal human lung extracellular matrix (matrix) structure and composition in end-stage cystic fibrosis.
[0064] Quantitative proteomic profiling identified sixty-eight (68) matrix constituents with significantly altered expression in end-stage cystic fibrosis. Over 90% of significantly different matrix peptides detected, including structural and basement membrane proteins, were expressed at lower levels in cystic fibrosis. However, the total abundance of matrix in cystic fibrosis lungs was not significantly different from control lungs, suggesting that cystic fibrosis leads to loss of diversity among lung matrix proteins rather than an absolute loss of matrix. Visualization of distal lung matrix via immunofluorescence and electron microscopy revealed pathological remodeling of distal lung tissue architecture and loss of alveolar basement membrane, consistent with significantly altered pathways identified by gene ontology analysis.
[0065] Dysregulation of matrix organization and aberrant wound healing pathways are associated with loss of matrix protein diversity and obliteration of distal lung tissue structure in end-stage cystic fibrosis. While many therapeutics aim to functionally restore defective cystic fibrosis transmembrane conductance regulator (CFTR), drugs that target dysregulated matrix pathways may serve as adjunct interventions to support lung recovery.
[0066] Previous studies identified elevated levels of proteolytic enzymes and matrix breakdown products in the bronchoalveolar lavage (BAL) fluid, sputum, and serum of CF patients, suggesting that matrix alterations mediated by protease/anti-protease imbalance may be a feature of CF. However, a comprehensive quantitative analysis of the CF lung matrisome, which includes constitutive and associated matrix proteins, remains outstanding. Understanding pathologic alterations to the lung matrix in CF may offer prognostic value and could uncover biomarkers of disease severity to inform therapeutic strategies. While gene therapies under development and currently-available cystic fibrosis transmembrane conductance regulator (CFTR) modulators aim to functionally restore CFTR expression, adjunct interventions targeting matrix remodeling could be developed to slow or reverse tissue damage and lung decline.
[0067] Figure 1 A shows a schematic overview of the experimental procedure. Cystic fibrosis and control lung tissues were procured to extract and analyze the distal lung matrix structure and composition through proteomic profiling, multimodal imaging (e.g. histology, immunostaining, electron microscopy) and gene ontology.
[0068] Figure IB shows aspects of the matrix extracted from human cystic fibrosis lung featuring native disease-specific composition and/or mechanics. Isolated lung ECM is obtained through decellularization and can be used to prepare (i) soluble matrikine cocktails, (ii)
decellularized scaffolds, and (iii) hydrogels for various cell culture substrate applications.
[0069] A hydrogel is a biphasic material, a mixture of porous, permeable solids and at least 10% by weight or volume of interstitial fluid comprising mainly water. In hydrogels the porous permeable solid is a water-insoluble three-dimensional network of natural or synthetic polymers and a fluid, having absorbed a large amount of water or biological fluids. The structure is maintained due to chemical or physical cross-linking of individual polymer chains. Hydrogels also possess a degree of flexibility very similar to natural tissue die to their significant water content, allowing for in vitro study of proteins within a hydrogel.
[0070] Hydrogels may be prepared using a variety of polymeric materials, which can be divided broadly into two categories according to their origin: natural or synthetic polymers. Natural polymers for hydrogel preparation include hyaluronic acid, chitosan, heparin, alginate, gelatin and fibrin Common synthetic polymers include polyvinyl alcohol, polyethylene glycol, sodium polyacrylate, acrylate polymers and copolymers thereof.
[0071] Figures 2A and 2B show aspects of an in vitro cystic fibrosis lung model system showing that the CF model recapitulates cell-cell-matrix crosstalk. Figure 2A shows schematically that isolated lung ECM biomaterials (soluble matrikines, scaffolds, hydrogels) may be prepared for incorporation as a disease-specific substrate with multiple cell types (cell types #1 and #2) such as bronchial epithelium, mesenchymal stromal cells, fibroblasts, macrophages, and other cell types. 2B shows example readouts and outputs from the in vitro cystic fibrosis model system.
[0072] Figures 3 A and 3B show a comparison of CF and normal lung ECM biomaterials using microscopy by Hematoxylin and eosin (H&E) staining of airways and parenchyma from native lung tissue (Fig. 3A) and decellularized extracellular matrix biomaterials (Fig. 3B). CF lung parenchyma displays proteinaceous fluid filled airways and thrombosis compared to healthy parenchyma with clear airway and alveolar space. CF airway cross section reveals epithelial cell hyperplasia, thickened basement membrane, and abnormal airway mucus compared to healthy control with phenotypically normal basement membrane and pseudostratified airway epithelium. CF ECM biomaterial retains features of native CF lung including parenchymal derangement and basement membrane thickening compared to healthy ECM biomaterial.
[0073] Figures 4A and 4B show a comparison of CF and control lung ECM biomaterials composition and ultrastructure. CF and control lung ECM biomaterials were compared with (Fig. 4A) histology including hematoxylin and eosin (H&E), Masson’s tri chrome (blue, collagens), elastic van Gieson (EVG) (black, elastin), and (Fig. 4B) electron microscopy including scanning electron microscopy (SEM), and transmission electron microscopy (TEM). Figures 4C
and 4D show additional structural comparisons of cystic fibrosis and control lung tissue. Overall tissue structure and composition of the lung parenchyma were evaluated by histology with hematoxylin and eosin (H&E), Masson’s trichrome (blue, collagens), and elastic van Gieson (EVG) (black, elastin) (Fig. 4C). Fig. 4D shows scanning electron microscopy (SEM) and transmission electron microscopy (TEM), where * = Airspace, E = elastic fibers, ATII = alveolar type II pneumocyte and arrows = lamellar bodies.
[0074] Figures 5 A and 5B show a comparison of CF and control lung ECM biomaterial key structural constituents. Collagen IV, elastin, fibronectin, and laminin were visualized with immunofluorescent imaging (Fig. 5A) and quantified with LC-MS/MS relative abundance (Fig. 5B).
[0075] Figure 6 shows the composition of CF ECM biomaterials by matrisome category. Collagens, glycoproteins, proteoglycans, ECM-affiliated proteins, ECM-regulator proteins, and secreted factors were quantified using LC-MS/MS.
[0076] Figure 7 shows quantification of cystic fibrosis and control lung ECM biomaterial cytokine profiles. Cytokine levels were measured in CF and control lung ECM. The cytokines included EGF, epidermal growth factor; FGF-2, fibroblast growth factor-2; 1L-12P40, interleukin 12B; MDC, C-C motif chemokine ligand 22; IL-13, interleukin- 13; G-CSF, colony stimulating factor 3; Flt-3L, fms related receptor tyrosine kinase 3; GM-CSF, granulocyte-macrophage colony stimulating factor; IL-IRA, interleukin-1 receptor agonist; IL-la, interleukin- 1 alpha; IL-9, interleukin-9; IFN-a2, interferon alpha-2; GRO alpha, C-X-C motif chemokine ligand 1; MCP-3, chemokine ligand 7; IL-4, interleukin-4; MCP-1, monocyte chemoattractant protein- 1; IL- 18, and interleukin 18. *p < 0.05, **p < 0.01.
[0077] The matrisome includes a group of proteins encoded by genes for core ECM proteins (collagens, proteoglycans, and ECM glycoproteins) and ECM-associated proteins (proteins structurally resembling ECM proteins, ECM remodeling enzymes, and secreted factors). In mammals the “core matri some” comprises ~300 proteins, encoded by an ensemble of over 1000 genes. In addition, there are large numbers of ECM-modifying enzymes, ECM-binding growth factors, and other ECM-associated proteins. These different categories of ECM and ECM- associated proteins cooperate to assemble and remodel extracellular matrices and bind to cells through ECM receptors. Together with receptors for ECM-bound growth factors, they provide multiple inputs into cells to control survival, proliferation, differentiation, shape, polarity, and motility of cells. The matrisome can be elucidated by proteomic techniques used in mapping the genome of organisms.
[0078] Here, we report a comprehensive, quantitative analysis of the distal lung matrix proteome (matrisome) in end-stage CF. We hypothesized that dysregulation of matrix pathways and alterations to distal lung matrix structure and composition accompany the well-described hallmarks of CF, including chronic infection, inflammation, structural changes to the airways, and progressive decline in lung function. Changes to the matrix were visualized at multiple scales by histology and electron microscopy. Towards quantitative analysis of the lung matrix, we (i) extracted matrix from CF and control lung tissues, (ii) quantified the composition of extracted matrix with liquid chromatography -mass spectrometry (LC-MS/MS), and (iii) filtered the resultant LC-MS/MS dataset to identify constituents of the lung matrisome (matrix and matrix-associated proteins). Profiles of collagens, glycoproteins, proteoglycans, secreted factors, matrix-regulating, and matrix-affiliated proteins were quantified, and differentially regulated pathways were identified through gene ontology (GO) analysis.
[0079] Significant loss of expression and structural breakdown of key matrix components, including basement membrane proteins, was observed. Pathways including ‘extracellular matrix’, ‘degradation of the extracellular matrix’, and ‘structural matrix constituents conferring tensile strength’ were significantly downregulated in CF. Correlating with loss of matrix organization and diversity, pathways involved in aberrant wound healing were upregulated inCF. Altogether, our findings suggest that pathological changes to the distal lung matrisome accompany other hallmark indicators of end-stage CF, such as stereotypical remodeling of airway structure, and may serve as therapeutic targets or biomarkers of disease state.
[0080] We investigated alterations to the distal lung matrix in end-stage CF, using tissue obtained from explanted lungs of CF patients undergoing lung transplantation. Patient mutations were determined to be AF508/AF508 (n=5), AF508/G542X (n=l), and AF508/unknown (n=2) (Supplementary Table 1). CF lung tissues were obtained from a random sample of patients with end-stage CF, and none of the samples were excluded from the study. As the lung matrix provides structural and biochemical cues to resident cells that together govern development, function, and injury response, we sought to investigate pathologic alterations to matrix structure and composition in end-stage CF, using microscopy and liquid chromatography mass spectrometry (LC-MS/MS) analysis.
[0081] Detailed methods can be found in the Experimental Methods. Briefly, lung tissue was obtained at the time of transplantation from explanted lungs from patients with end-stage CF (n=9) and uninjured regions of donor lungs declined for transplantation to serve as controls (n=3). All CF patient tissue underwent multi-modal imaging (n=9), and a subset of patient tissue samples (n=8)
underwent LC-MS/MS. For one CF patient, the right middle lobe was unavailable and instead, tissue was obtained from the lingula. CF patient mutations were determined by isolating genomic DNA and sequencing regions of the CFTR gene where common mutations are found (Supplementary Table 2). Structure and composition of the lung extracellular matrix was analyzed using histology, immunofluorescence, electron microscopy, liquid chromatography mass spectrometry (LC-MS/MS), and gene ontology (GO) analysis.
[0082] Ultrastructural abnormalities in CF distal lung matrix. The lung matrix is a complex, well-organized, 3D structure that supports lung function by providing a large surface area for gas exchange and allowing for lung breathing. For a global comparison of matrix structure and tissue morphology in CF compared to control lung, histological staining was performed on lung specimens from all patients to visualize overall tissue histomorphology (H&E), and the distribution of collagen (Masson’s tri chrome, blue), and elastin (elastic van Gieson, black) (Figures 16 and 17). Figure 16 shows histological imaging of CF and control lungs with H&E, tri chrome, and elastin van Gieson (EVG) for samples from all patients and controls.
[0083] Figure 17 shows multi-modal imaging of CF and control lungs, including high magnification histology (H&E, tri chrome, EVG), scanning electron microscopy (SEM), and immunofluorescent staining for elastin. Histological staining of airway sections confirmed stereotypical airway morphology, including elevated levels of glycoproteins and mucins (Alcian blue, blue) in CF (Figure 18). Compared to control lung, CF specimens displayed expected septal thickening, fragmented fibers, and proteinaceous fluid-filled airways and alveoli with varying degrees of severity.
[0084] Lung parenchymal ultrastructure and alveolar architecture were grossly abnormal in CF with airway and alveolar obstruction and collapse, as evidenced by scanning electron microscopy (SEM) imaging, indicative of parenchymal destruction. Visual assessment of the epithelium, endothelium, and alveolar basement membrane by transmission electron microscopy (TEM) revealed basement membrane disruption and alveolar collapse (Figures 4B and 4C).
[0085] Figure 19 shows heat maps showing differences in lung matrix proteins in cystic fibrosis and control lung tissue detected using LC-MS/MS of whole patient tissue. Detected peptides were filtered using The Matrisome Project database to specifically identify differential expression of: (A) collagens, (B) glycoproteins, (C) matrix-affiliates, (D) matrix-regulators, and (E) secreted factors.
[0086] Quantitative analysis of CF distal lung matrisome. We performed LC-MS/MS on intact distal lung tissues from CF patients and controls to identify changes to the lung proteome. Gene
ontology (GO) analysis of detected peptides revealed that the extracellular space (p = 4.0E-4) and extracellular organelles (p = 1.68E-5) were significantly altered in CF compared to control lung (Figures 20-23). Identification of significant differences in pathways involving the extracellular environment informed deeper analysis of the CF lung matrix. The matrix was then extracted by decellularization of lung tissues, which led to 95% reduction in DNA content and nearly complete removal of DAPI-stained nuclei (Figure 24), while maintaining intact matrix.
[0087] Figure 20 shows aspects of molecular function pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0088] Figure 21 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0089] Figure 22 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0090] Figure 23 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis in whole plant tissue from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0091] Figure 24 shows aspects of the preparation of matrix extract from whole patient tissue through detergent and enzyme decellularization that results in nearly complete removal of genetic material shown with (A) absence of DAPI signal on histology, and (B) >95% reduction in DNA content detected with PicoGreen DNA assay.
[0092] The full list of peptides identified using LC-MS/MS of extracted lung matrix was filtered using the open-access ‘Matrisome Project,’ which categorizes matrix proteins as: core matrisome (i.e., collagens, glycoproteins, proteoglycans), matrix-regulators, matrix-affiliated, and secreted factors. The number of matrisome proteins and their relative intensities across each of these categories were compared for CF and control lungs (Figure 25).
[0093] Figure 25 shows violin plots showing relative abundance of matrix proteins in cystic fibrosis and control matrix extracts, including (A) collagens, (B) proteoglycans, (C) glycoproteins, (D) matrix-affiliates, (E) matrix-regulators and (F) secreted factors. Detected proteins are categorized according to The Matrisone Project database.
[0094] Overall, 243 significantly different proteins were detected in the CF matrix, including 14 collagens, 18 glycoproteins, 4 proteoglycans, 10 matrix-regulators, 6 matrix- affiliated, 9
secreted factors, and 182 others (i.e., significantly altered but not considered to be matrisome constituents) (Figure 8B). All except six of the significantly altered matrix proteins were downregulated (MMP11, IL16, TGFB1, VWA5A, LGALS1 and HRG were significantly upregulated). We observed similar changes in the relative intensities of the proteins in the collagens, glycoproteins, and secreted factors categories (Figure 25), indicating similar coverage in both groups. However, there was a decreased abundance of proteoglycans in CF compared to control lung (p = 0.016), suggesting the loss of proteoglycan activity in CF. To validate the matrix extraction method, LC-MS/MS was performed on whole lung tissues, and a decrease in matrix proteins was also detected (Figure 19). Using a principal component analysis (PCA) on the extracted matrix LC-MS/MS dataset, we found that 7 out of 8 CF patients clustered together, while control patient samples did not cluster (Figure 8A). The group size was too small to draw definitive conclusions about any mutation-specific alterations to the lung matrix.
[0095] Figures 8A-8C show aspects of a global analysis of the cystic fibrosis lung matrisome. Fig. 8A shows a Principal component analysis (PCA) of CF and control lung matrix. The shape of marker indicates patient mutations: circle, AF508/AF508; triangle, AF508/G542X; hexagon, AF508/unknown. Fig. 8B is a Volcano plot of differentially expressed matrisome components. Fig. 8C shows a gene ontology (GO) analysis of pathways significantly altered in CF. BP, biological processes; CC, cellular components; MF, molecular factors.
[0096] Figures 9A-9D show characterization of the core matrix structure and composition in cystic fibrosis and control lung. Expression of core matrisome components, including collagens (Fig. 9A), glycoproteins (Fig. 9B), and (C) proteoglycans (Fig. 9C), using LC-MS/MS is shown. Fig. 9D shows expression of basement membrane constituents and elastin using immunofluorescence.
[0097] Figures 10A-10D show an analysis of matrix-associated proteins in cystic fibrosis and control lung, including matrix-affiliated (Fig. 10A), matrix-regulators (Fig. 10A), and secreted factors (Fig. 10C) in CF and control lung matrisomes. Fig. 10D shows representative immunostaining of differentially expressed proteins in each category. Arrows indicate positive cytoplasmic galectin staining. Asterisks indicate positive nuclear NFKB.
[0098] Aspects of macrophages related to CF progression and control were studied. Macrophages are specialized white blood cells involved in the detection, phagocytosis and destruction of bacteria and other harmful organisms. In addition, they can also present antigens to T cells and initiate inflammation by releasing molecules (known as cytokines) that activate other cells.
[0099] Figure 11 shows confirmation of WTC11 and CF iPSC differentiation into macrophages with flow cytometry. Flow cytometry confirmed expression of CDl lb and CD14 in iPSC-derived CF and WTC11 macrophages.
[0100] Figure 12 shows an experimental design for macrophage studies. CF and WTC11 iPSC- macrophages were co-cultured in basal conditions and with CF and control lung ECM. Primary readouts include cytokine expression, RNA sequencing, and gene ontology.
[0101] Figure 13 shows aspects of cystic fibrosis and WTC11 macrophage and extracellular matrix co-culture system. Bright field images of WTC11 and CF macrophages exposed to CF and control lung ECM in vitro are shown.
[0102] Figures 14A-C show aspects of WTC11 and cystic fibrosis macrophage cytokine expression in response to CF and control lung extracellular matrix. Fig. 14A shows WTC11 and CF macrophage cytokine expression at baseline. Fig. 14B shows WTC11 and CF macrophage cytokine expression in response to CF lung extracellular matrix. Fig. 14C shows WTC11 and CF macrophage cytokine expression in response to control lung extracellular matrix. MCP-1, monocyte chemoattractant protein-1; IL-8, interleukin 8; IL-18, interleukin 18. *p < 0.05; **p < 0.01.
[0103] Figures 15A-B show aspects of macrophage cytokine expression in response to CF extracellular matrix. Fig. 15A shows WTC11 macrophages exposed to CF extracellular matrix cytokine expression fold change over basal WTC11 macrophages. Fig. 15B shows CF macrophages exposed to CF extracellular matrix cytokine expression fold change over basal CF macrophages.
[0104] Figure 18 shows stereotypical alterations to the airways seen in cystic fibrosis patient tissue versus control lung shown with H&E and Alcian blue (Representative images are from CF patient #1, CF patient #9, and control #3).
[0105] GO analysis of the full list of significant peptides identified through LC-MS/MS revealed differences in matrix-related pathways in CF versus control lung matrix. Significantly different GO terms included: extracellular matrix (p = 3.16E-26), degradation of the extracellular matrix (p = 2.73E-7), collagen trimer (p = 1.09E-11), structural matrix constituents conferring tensile strength (p = 5.78E-11), collagen chain trimerization (p = 2.93E-10), and matrix proteoglycans (p = 5 86E 9) (Figure 8C). Additional significant GO terms related to cell-matrix interactions and cell signaling were identified, including anion binding (p = 1.19E-6), focal adhesion (p = 1.39E-6), cell-substrate junction (p = 1.97E-6), extracellular vesicle (p = 1.36E-28), and extracellular exosome (p = 3.38E-28).
[0106] After filtering for peptides with log2FC < -1, GO terms identified included: extracellular matrix structural constituent (p = 6.89E-38), collagen binding (p = 9.02E-7), glycosaminoglycan binding (p = 3.33E-6), extracellular matrix organization (p = 1.00E-18), and extracellular structure organization (p = 1.12E-18). Filtering for peptides with log2FC > 1 identified GO terms including: cadherin binding (p = 6.28E-23), unfolded protein binding (p = 3.57E-9), protein-lipid complex (p = 1.78E-12), response to topologically incorrect protein (p = 2.91E-6), response to unfolded protein (p = 2.44E-4), and negative regulation of wound healing (p = 8.16E-3). The complete lists of identified GO pathways can be found in Figures 26-30 and Supplementary Tables 3 and 4.
[0107] Figure 26 shows aspects of molecular function pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0108] Figure 27 shows aspects of cellular component pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0109] Figure 28 shows aspects of biological processes pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0110] Figure 29 shows aspects of reactome pathways identified as significantly different through gene ontology (GO) analysis in matrix extract from cystic fibrosis and control lung. (A) shows GO terms and (B) shows relevant pathways.
[0111] Figures 30A-C shows GO networks identified by filtering for upregulated peptides (log2(FC)>l) and downregulated peptides (log2(FC)< -1). Fig. 30A shows molecular function networks, Fig. 30B shows cellular component networks and Fig. 30C shows biological process networks.
[0112] Degradation of core proteins in distal lung matrix. In total, 36 core matrisome proteins (i.e., collagens, proteoglycans, glycoproteins) of the 143 detected were significantly differentially expressed in CF matrix compared to control lung. The majority of collagens (COL4A1/2/3/6, COL5A3, COL6A2/3/5/6, COL11A1, COL21A1, COL26A1, COL12A1, and COL18Al) were significantly downregulated in CF compared to control tissue (Figure 4A). Other collagens (COL15A1, COL23A1, COL10A1, COL5A1, COL1A2) were upregulated in CF, albeit not significantly (Figures 31A-B). Other key basement membrane constituents, including multiple isoforms of laminin (LAMA2, 4, and 5) and nidogenl (NIDI) were downregulated in CF
(LAMA2, log2FC = -1.6, p = 0.025; LAMA4, log2FC = -1.2, p = 0.012; LAMA5, log2FC = -1.3, p = 0.047; NIDI, log2FC = -1.3, p = 0.030), indicative of dysregulation of basement membrane in CF lung disease and consistent with TEM and SEM findings. Elastin (ELN, log2FC = -1.6, p = 0.026) which confers lung elasticity was decreased in CF compared to control lung, a trend indicative of possible emphysema (Figure 4B). Notably, perlecan (HSPG2, proteoglycan found in the basement membrane) downregulation accompanied the loss of collagens and laminins (HSPG2, log2FC = -1.36, p = 0.021). Other collagen-interacting proteoglycans were also downregulated, such as osteoglycin (OGN, log2FC = -1.21, p = 0.014), biglycan (BGN, log2FC = -1.08, p = 0.014), and asporin (ASPN, log2FC = -2.21, p = 0.001) (Figure 4C).
[0113] Figures 31 A-B show aspects of collagen expression in cystic fibrosis and control lung matrix Fig. 31A shows a table of collagen expression. Green highlight indicates significance (p < .05). Fig. 3 IB shows a heat map of differential expression of collagens demonstrating hierarchical clustering of patients and genes.
[0100] In line with the matrisome quantification and GO analysis indicating collagen trimer and basement membrane as significantly altered pathways, immunofluore scent staining for collagen IV - a major component of the lung basement membrane - was sparse, poorly organized, and partially degraded in the alveolar septa in CF lung compared to control lung where well- organized collagen IV staining was ubiquitous in the basement membrane. Elastin, which enables cyclic movement during breathing, and laminin, which provides structural support and promotes cell adhesion to the basement membrane, appeared fragmented in CF lungs compared to controls (Figure 4D).
[0101] Dysregulation of matrix modifying proteins. Degradation of basement membrane proteins was accompanied by decreased expression of proteins that promote cell adhesion to the basement membrane (C1QTNF5/7, log2FC = -1.3/-1.4, p = 0.017/0.002; SEMA3B, log2FC = -1.6, p = 0.046). Tetranectin (CLEC3B) was found to be downregulated in CF (log2FC = -1.62, p = 0.001). However, galectin-1 (LGALS1) was overexpressed in CF, at moderate to high levels (log2FC = 1.43, p = 0.009), indicative of infection response and myeloid cell recruitment (Figure 5A). Immunostaining of tetranectin in CF samples showed sparse staining, whereas galectin staining was moderately increased in CF compared to control lung.
[0102] Matrix regulators are proteins responsible for crosslinking, degrading, and remodeling the matrix. Consistent with the breakdown of key matrix constituents, we observed significant downregulation of proteins that inhibit matrix degradation, including trypsin inhibitor (ITIH5, log2FC = -1.82, p = 0.002), serine protease inhibitor (SERPINA5, log2FC = -1.57, p = 0.013), and
tissue inhibitor of metalloproteinase 3 (TIMP3, log2FC = -2.62, p = 0.019). Similarly, lower levels ofLOXL2 (log2FC = -1.05, p = 0.019), a collagen and elastin crosslinker, correlates with observed decreases in both collagen and elastin levels in CF lung. Matrix metalloprotease (MMP) expression varied, with upregulation of MMP11 and MMP8 and downregulation ofMMP28 (Figure 10D).
[0103] Staining for MMP11 was more pronounced in CF compared to control lung. Histidine rich 241 glycoprotein (HRG) which is expressed by platelets and modulates angiogenesis, fibroblast proliferation, complement activation, coagulation, and fibrinolysis, was significantly upregulated (HRG, log2FC = 1.08, p = 0.014) and showed increased expression and more nuclear localization in CF compared to control lung. Other alterations in proteins expressed by or associated with platelets were also observed, including upregulation of platelet derived growth factor subunit B (PDGF-B, log2FC = -1.7, p = 0.028), fibulin-1 (NS), and type 3 collagen (NS). [0104] Among the secreted factors that were identified, inflammatory markers - including interleukin 16 (TL-16, log2FC = 3.9, p = 0.031) and transforming growth factor beta (TGF-0, log2FC = 2.3, p = 0.024), were all significantly increased in CF compared to control lung, whereas interleukin 17 (IL-17, log2FC = -2.2, p = 0.009) was downregulated. Several constituents of the WNT pathway were significantly downregulated in CF, and P-catenin and NF-kB demonstrated increased nuclear localization (Figure 5C). Consistent with these findings, WNT ligand biogenesis and trafficking (p = 1.05E-7) was identified as a significantly altered pathway via GO analysis (Supplementary Table 3).
[0105] Lung extracellular matrix serves as the major structural component of the lung and provides large surface area for gas exchange in the form of the alveolar basement membrane. In CF, structural remodeling of the airways and elevated levels of proteolytic enzymes and matrix breakdown products in airway fluid are recognized indicators of worsening disease. These well- described features suggest changes to the lung matrix may also be present in CF. Despite the recognized importance of the matrix in lung development, injury, and disease, a comprehensive characterization of the CF lung matrix has not been previously reported. This study addressesthis gap and provides a comprehensive and quantitative analysis of the distal lung matrix in end-stage CF.
[0106] Analysis of CF lung matrix composition and structure revealed pathological remodeling of tissue architecture, destruction of alveolar basement membranes, and significant loss of key constitutive and associated matrix proteins, including collagens, laminins, and elastin. Obliteration of distal lung parenchymal structure and loss of matrix protein diversity were identified as features of end-stage CF. Through LC-MS/MS analysis of end-stage CF samples in
comparison to control lung tissue, we determined that the majority of significantly altered matrix proteins (> 90%) were expressed at lower levels in CF compared to control lung. Interestingly, the total matrix protein abundance in CF and control lung tissue was not significantly different, suggesting that CF does not change the total amount of matrix but instead leads to loss of diversity among matrix proteins.
[0107] In previous studies, matrix-degrading enzymes including neutrophil elastase, collagenases, serine proteases, and matrix metalloproteinases have been identified in airway secretions, BAL fluid, and sputum of CF patients, with elevated levels correlating with pulmonary exacerbations and respiratory decline. Pathologically low levels of protease inhibitors including TIMPs, alphal -antitrypsin, and SLPI have also been identified in CF, and matrix breakdown products including collagen and elastin fragments were detected in BAL, serum, and urine of CF patient. Here we report a pathologically altered lung matrisome in end-stage CF, which includes destruction of key structural matrix and matrix-associated proteins. Taken with the prior evidence in the literature, these findings suggest that matrix breakdown may correlate with functional decline of the lung in CF.
[0108] The lung matrix serves as a structural scaffold that provides macro- and micro-scale features to support lung function, including ventilation and oxygenation. For example, elastin confers the lung with appropriate compliance and enables dynamic movement during breathing, and basement membrane proteins provide a well-organized, thin membrane across which gas exchange occurs. Disruption to matrix proteins that enable ventilation and oxygenation has a deleterious effect on lung function. Our findings indicate that matrix constituents involved in lung elasticity (i.e., elastin) and basement membrane integrity (i.e., collagen IV, laminin) are pathologically altered in CF.
[0109] Elastin was degraded in end-stage CF, as evidenced by LC-MS/MS and immunofluorescence. We also observed a loss of lysyl oxidase 2 (LOXL2), which functions as an elastin crosslinker to stabilize the matrix. These findings are consistent with features of emphysema, in which protease and antiprotease imbalance and immune cell recruitment lead to irreversible destruction of the lung parenchyma, loss of tissue elasticity, and impairment of proper ventilation. Evidence of tissue breakdown, similar to that in emphysematous lung, was also observed on histology in CF specimens. Similarly, prior work has suggested emphysema as a unifying feature in end-stage CF based on histopathological and radiographic analysis.
[0110] Basement membrane constituents, including several isoforms of collagen IV and laminin which were visualized with immunofluorescence and quantified with LC-MS/MS, were
degraded in end-stage CF, consistent with dysregulation of the basement membrane and alveolar structure observed on SEM and TEM. Disruption to the basement membrane is a feature of many acute and chronic lung pathologies (e g., emphysema, COPD, acute respiratory distress syndrome (ARDS)), contributing to functional impairment of the lung by compromising the integrity of the blood-gas barrier. This pattern of destruction may be mediated by an imbalance between proteases and protease inhibitors, and has been shown to correlate with mortality in other respiratory conditions. Loss of basement membrane integrity in CF may contribute to cytokine release that triggers paracrine-mediated inflammation, as well as edema and alveolar fluid retention, leading to impaired gas exchange.
[0111] Gene ontology analysis revealed several pathways involving cell-matrix interactions and cellular function, including cell-substrate junction, focal adhesion, extracellular vesicles, cellular component biogenesis and cellular localization, indicating that matrix degradation has downstream effects on cell populations in the lung. Furthermore, significantly altered matrix- associated proteins were identified via LC-MS/MS, including galectin which mediates cell-matrix interactions and proliferation, and tetranectin which binds to plasminogen and may regulate secretion and exocytosis. IL-16 and TGF-p were both significantly increased in CF lung tissue and response to TGF-P was an identified GO term, indicative of the inflammatory process that contributes to aberrant wound healing and can signal epithelial-mesenchymal transition (EMT), a common pathway implicated in many lung diseases. Proteins involved in EMT including several WNT proteins, were altered in CF compared to control lungs. Dysregulated EMT has deleterious effects on lung cell phenotype and function by: (i) impairing epithelial barrier function and innate defense mechanisms, (ii) enabling migration of activated stromal cells throughout the lung matrix, and (iii) promoting stromal cell hyperplasia while compromising pseudostratified airway epithelium.
[0112] Interestingly, in the filtered LC-MS/MS dataset for downregulated peptides (log2FC < -1), GO terms identified included several pathways involved in matrix structure and organization, such as extracellular matrix structural constituent, extracellular matrix organization, and degradation of the extracellular matrix. Additionally, several GO pathways that were identified in the downregulated dataset implicate the basement membrane specifically, including basement membrane, collagen type IV trimer, and laminin complex. In comparison, when the dataset was filtered for upregulated peptides (log2FC > 1), the identified GO pathways included cellular responses to topologically incorrect protein and unfolded protein, along with negative regulation of wound healing. These findings suggest that downregulation of matrix organizational pathways
may result in destruction of matrix and aberrant cellular response to matrix fragments (i.e., matrikynes) present in the extracellular environment.
[0113] Described herein are: (i) Matrix extracted from human cystic fibrosis lung featuring native disease-specific composition and/or mechanics; (ii) Matrikines extracted from human cystic fibrosis lung featuring native tissue biomolecular profiles; and (iii) A method for extracting human cystic fibrosis lung matrix and/or matrikines from diseased and normal tissues. The matrix or matrikines can be used to condition or culture cells or to utilize as a therapeutic delivery vehicle. An in vitro cystic fibrosis lung model system that incorporates the CF matrix or matrikines or other disease-specific human tissue components and factors, including cells, matrix, matrikines, mucus, sputum, bronchoalveolar lavage fluid, serum, plasma, extracellular vesicles, micro-organisms, and/or other soluble factors is proposed. This model system can be used to study cystic fibrosis or other lung diseases ex vivo. The model system can be used to culture or co-culture cells in vitro, including epithelium, endothelium, stromal, or immune lineages, to model disease-specific mechanisms, e.g., cell-cell or cell-matrix interactions, or other crosstalk in vitro. The model system couldbeusedto identify therapeutic targets, develop therapeutics or drugs, test therapeutics or drugs, or evaluate the efficacy of gene or cell therapy to treat cystic fibrosis. The model system could be used to study various CFTR mutations, CFTR signaling, or to evaluate CFTR-targeting therapeutics, including modulators and correctors.
[0114] Several outstanding questions remain toward better understanding of the complex changes in CF matrix. This study only evaluated end-stage CF lung samples obtained at the time of lung transplant. Future studies should assess temporal changes to the matrix in comparison with age-matched controls, and determine specific effects on cell phenotype and function. The number of samples in this study was too small to determine if mutation-specific changes to the matrix occur, and data on clinical history was not available because patient samples were obtained as de- identified surgical waste that was considered non-human subjects research. Future studies with larger patient cohorts could reveal correlations between matrix changes, clinical status, and CFTR mutation(s).
[0115] The study was focused on tissue-level changes, therefore alterations to protease levels in BAL or sputum were not analyzed. Longitudinal proteomic analysis of multiple sample types (i.e., tissue, serum, BAL fluid, urine, etc.) from individual patients may enable mechanistic understanding of disease processes involving matrix degradation. While sampling distal lung tissue via biopsy is challenging, identification of serum or BAL markers that correlate with lung matrix degradation could inform patient care, as previous studies have shown that administration
of nebulized or intravenous medication can mitigate elevated proteolytic enzyme levels in BAL fluid.
[0116] It is unclear if matrix breakdown is intrinsically driven by loss of CFTR expression or if chronic infection is the primary driver of matrix destruction. Comparison of matrix composition in other organs affected by CF (i.e., pancreas, liver) that are not undergoing an infectious process may offer insights into the relative contributions of intrinsic loss of CFTR versus chronic lung infection to matrix breakdown. For example, increased collagen deposition has been reported in liver and pancreas of CF patients, suggesting that matrix degradation in the lung may be primarily driven by chronic infection and corresponding immune response rather than loss of CFTR. Similarly, elevated protease levels correlate with bronchiectasis and tissue damage in primary ciliary dyskinesia, indicating that persistent respiratory infection triggers matrix breakdown pathways even in the presence of functioning CFTR. Nevertheless, the extent to which CFTR loss contributes to parenchymal obliteration in CF should be further evaluated. Comprehensive matrisome analyses of lung tissues from COPD and IPF have been previously reported, and when taken with our findings, suggest that changes to the lung matrix are disease- specific. Though these diseases differ in their underlying pathophysiology, cross-disease matrix comparison may unveil common pathways implicated in lung inflammation, matrix remodeling, and tissue repair, which could serve as therapeutic targets.
[0117] CFTR modulator drugs such as Trikafta have revolutionized the cycle-of-care for CF patients and led to dramatic improvements in functional lung parameters. The ability of these CFTR-targeting medications to indirectly prevent matrix degradation, recover dysregulated matrix pathways, or repair degraded lung matrix should be evaluated. Drivers of matrix destruction identified in this study could act as therapeutic targets or biomarkers to monitor disease progression. Drugs targeting dysregulated matrix pathways may serve as adjunct interventions to CFTR modulators to support repair of damaged tissue and recovery of lung function in CF patients.
EXPERIMENTAL METHODS
Human lung tissue collection
[0118] Lung tissue was obtained at the time of transplantation from the right middle lobe of patients with end-stage cystic fibrosis (CF) (w=9) and from uninjured regions of donor lungs declined for transplant serving as controls (n=3). For one CF patient, the right middle lobe was not available, and tissue was instead collected from the lingula. CF patient tissue underwent processing for multi-modal imaging (n=9, CF Patients #1 - 9) and LC-MS/MS (n=8) (CF Patients #1 - 8). For the control group, lungs with underlying pathology (e.g., fibrosis) were excluded. Explanted
human lung specimen deemed surgical waste were fully de-identified prior to sample processing and analysis. Therefore, no clinical history or patient data was available. Tissue samples were collected from the most distal region of procured lobes and were processed in parallel.
Identification of patient mutations
[0119] DNA was isolated from CF lung tissue samples using Qiagen DNeasy Blood & Tissue Kit according to manufacturer’s instructions. Exons 10, 11, 12, 23 and 24 were amplified using PCR and custom primers (Supplementary Table 2). Sanger sequencing of amplified regions was performed to identify individual patient mutations (Genewiz).
Histology
[0120] Lung specimens were fixed in cold phosphate-buffered 4% paraformaldehyde for 24 hours, embedded in paraffin, and sectioned at 5 pm thickness. Sections were stained with hematoxylin and eosin (H&E), Masson’s trichrome, elastic van Gieson’s (EVG), pentachrome, and Alcian blue (pH = 2.5) by the histology service in the Department of Molecular Pathology at Columbia University Medical Center and examined via light microscopy.
Immunohistochemistry
[0121] Lung samples were de-paraffinized, submerged in boiling citrate buffer (pH 6.0) or EDTA buffer (pH 8.0) for antigen retrieval for 20 minutes, and blocked with 10% normal donkey serum in phosphate-buffered saline for 2 hours at room temperature. Primary antibodies were added and incubated for 12 hours at 4°C, or 4 hours at 25°C. Secondary antibody was diluted 1 :500 and incubated for 1 hour at 25°C. Sections were mounted in mounting medium (Vectashield Mounting Medium; Vector Laboratories) with DAPI, cover-slipped, and imaged with a Leica DMi8 fluorescence microscope.
Transmission electron microscopy (TEM)
[0122] Lung specimens were fixed with 2.5% glutaraldehyde, 4% paraformaldehyde, and 0.02% picric acid in 0.1 M sodium cacodylate buffer (pH 7.2). Samples were then post-fixed with 1% OsO4 in Soreson’s buffer for 1 hour, dehydrated, and embedded in Lx-112 (Ladd Research Industries). Sections (60 nm) were prepared using an ultramicrotome (PowerTome PT XL; RMC), stained with uranyl acetate and lead citrate and examined with a transmission electron microscope (JEM- 1200 EXII; JEOL). Images were captured with a digital camera (ORCA-HR; Hamamatsu) and recorded with imaging software (Image Capture Engine v.602.569; AMT). TEM imaging was not available for all control lung samples. Therefore, the representative control lung TEM image was obtained from an additional lung (deceased donor with no underlying disease) that was not included in the LC-MS/MS analysis.
Scanning electron microscopy (SEM)
[0123] Lung specimens were fixed in 2.5% glutaraldehyde at room temperature for 1 hour then overnight at 4°C, rinsed in 70% ethanol, frozen, and lyophilized. Samples were imaged using a scanning electron microscope (GeminiSEM 300; Zeiss) with accelerating voltage of 5.0 kV.
Extraction of distal lung matrix
[0124] Lung matrix was extracted via detergent and enzyme decellularization. Human lung tissue was rinsed in phosphate-buffered saline. Lungs were sliced into 2 -mm sheets and washed with sterile water for 30 minutes to remove residual blood and debris. Tissue slices were then subject to four 2-hour wash cycles with CHAPS detergent (8mM CHAPS, IM NaCl, and 25mM EDTA) followed by rinses with dH2O and 2X PBS. Following this, tissue sheets were rinsed in benzonase precondition buffer (50mM tris-HCl, 0.1 mg/mL bovine serum albumin (BSA), ImM MgC12) and then subject to enzyme decellularization by washing with benzonase (90 U/mL; Sigma-Aldrich) in benzonase precondition buffer. Tissue was then rinsed with PBS, snap frozen in liquid nitrogen, pulverized into a fine powder using mortar and pestle, and dehydrated using a lyophilizer.
Preparation of distal lung matrix for LC-MS
[0125] Lung tissue and extracted lung matrix were resuspended in sodium deoxycholate (SDC) lysis buffer (1% SDC, 10 mM TCEP, 40 mM CAA and 100 mM TrisHCl pH 8.5) and boiled for 20 min at 60°C, 1500 rpm on thermomixer (Eppendorf Thermomixer C) to denature and reduce and alkylate cysteines, followed by sonication in a water bath, cooled down to room temperature. ECM samples then underwent deglycosylation with PNGaseF (500 U/ pl) at 37° C and 1500 rpm in a thermomixer (Eppendorf Thermomixer C) as in previous protocols. Protein digestion was performed by adding LysC and trypsin in a 1 :50 ratio (pg of enzyme to pg of protein) at 37°C and 1500 rpm for 2 hours and overnight in a thermomixer (Eppendorf Thermomixer C), respectively. Peptides were then acidified with 1% trifluoroacetic acid (TFA) and subjected to StageTip cleanup via styrenedivinylbenzene-reverse phase sulfonate (SDB-RPS). Peptides were washed with 1% TFA 99% ethyl acetate followed by 0.2% TFA 5% acetonitrile (ACN) at 1000 x g, and eluted with 1% Ammonia, 50% ACN and dried at 60°C in a SpeedVac centrifuge.
Liquid chromatography mass spectrometry for matrisome quantification
[0126] Peptides were resuspended in 3% acetonitrile/0.1% formic acid and injected on Thermo Scientific™ Orbitrap Fusion™ Tribrid™ mass spectrometer for peptide tandem mass spectrometry (MS/MS) analysis. The UltiMate 3000 Ultra High-Performance Liquid Chromatography (UHPLC) system (Thermo Scientific) and EASY-Spray PepMap column
(Thermo Fisher Scientific, RSLC C18 50 cm x 75 m ID) coupled with Orbitrap Fusion (Thermo) were used to separate fractioned peptides with a 5-30% acetonitrile gradient in 0.1% formic acid over 120 min at a flow rate of 250 nL/min. After each gradient, the column was washed with 90% buffer B for 5 min and re-equilibrated with 98% buffer A (0.1% formic acid, 100% high performance liquid chromatography (HPLC)-grade water) for 40 min. Survey scans of peptide precursors were performed from 350-1200 m/z at 120K full width at half maximum (FWHM) resolution (at 200 m/z) with a 1 x 106 ion count target and a maximum injection time of 60 ms with 3 s cycles for the survey and the MS/MS scans. After a survey scan, 26 m/z DIA segments were acquired from 200-2000 m/z at 60K FWHM resolution (at 200 m/z) with a 1 x 106 ion count target and a maximum injection time of 118 ms. High-energy collisional dissociation (HCD) fragmentation was applied with 27% collision energy and resulting fragments were detected using the rapid scan rate in the Orbitrap.
Data analysis
[0127] Data independent acquisition (DIA) data were analyzed with directDIA 2.0 (Deep learning augmented spectrum-centric DIA analysis) in Spectronaut Pulsar X, a mass spectrometer vendor independent software from Biognosys. Default settings were used for targeted analysis of DIA data in Spectronaut, except the decoy generation was set to “mutated.” LC-MS/MS data was filtered for proteins identified by more than one unique peptide, and global normalization was applied using the median intensity of identified peptides. Classification of identified proteins into matrisome subgroups was done using the protein lists presented by Naba et al. in the Matrisome Project to subset the dataset into: (i) core matrisome (collagens, proteoglycans, and glycoproteins), [0128] (ii) matrix-affiliated proteins, and (iii) matrix-regulator proteins, and (iv) secreted proteins.
Gene ontology term enrichment analysis
[0129] Gene ontology (GO) enrichment analysis was performed using g:Profiler. Overrepresented terms were determined using Fisher’s exact with FDR multiple test correction (Q < 0.05).
Statistical analysis
[0130] The false discovery rate (FDR) was estimated with the mProphet approach and set to 1% at the peptide precursor level and at 1% at the protein level. Results obtained from Spectronaut were further analyzed using the Spectronaut statistical package. Significance wasdetermined by unpaired t-test with a threshold for significance of p < 0.05 (permutation-based FDR correction) and |log2FC| > 1.
Table 1 | Biomolecular profile of cystic fibrosis extracellular matrix biomaterials
Protein Name Description
Actin, aortic smooth muscle Marker of activated myofibroblasts in idiopathic pulmonary fibrosis; expressed by airway and vascular smooth muscle cells
Actin, cytoplasmic 2 Regulates mucus secretion and ENaC channel function
Biglycan Structural component of ECM; signaling molecule indicative of tissue stress or injury; regulates inflammation and immunity
Clusterin Extracellular clusterin signals apoptosis; Intracellular clusterin promotes wound healing
Collagen alpha- 1(1) chain Expressed by profibrotic airway macrophages in pulmonary fibrosis; correlated with immune infiltration
Collagen alpha- 1(11) chain Marker of epithelial-mesenchymal transition; Mutatons lead to lung hypoplasia
Collagen alpha- 1 (III) chain Upregulated in response to lung injury and fibrosis
Collagen alpha- 1 (VI) chain Plays a critical role in lung development; Loss of COL6A1 and
Collagen alpha-2(VI) chain COL6A2 leads to chest wall contractures, scoliosis, and muscle
Collagen alpha-3 (VI) chain weakness; Loss of COL6A2 leads to chest wall contractures, scoliosis, and muscle weakness
Collagen alpha-2(I) chain Fibril-forming collagen; Involved in myofibroblast differentiation in lung
Cytoplasmic dynein 2 heavy chain 1 Supports ciliaiy function and innate immune response Fibrinogen beta chain Secreted basolaterally by pulmonary epithelium
Lumican Regulates collagen organization, epithelial cell migration, and tissue repair
Mimecan Interacts with TGFB and VEGF; Modultes endothelial and vascular smooth muscle integrity
Phosphatidylinositol 3,4,5- Plays a role in insulin signaling; Implicated in many cancers trisphosphate-dependent Rac exchanger 2 protein Prolargin Anchors basement membrane to underlying connective tissue; binds proteoglycans
Translgutaminase 2 Mediates alveolar macrophage activation and lung inflammation;
Regulates innate immunity
Vitronectin Glycoprotein released during inflammation; regulates cell growth and mesenchymal epithelial transition
Zinc finger protein 251 Regulates transcription, proliferation, differentiation via ERK signaling pathway
Supplementary Table 1. Summary of patient mutations.
Patient 1 AF508/AF508
Patient 2 AF508/AF508
Patient 3 AF508/AF508
Patient 4 AF508/AF508
Patient 5 AF508/AF508
Patient 6 AF508/unknown
Patient 7 AF508/G542K
Patient 8 AF508/unknown
Supplementary Table 2. Summary of primers used to detect patient mutations using PCR.
Exon Forward primer Reverse primer
Exon 10 TTTAGATCATGTCCTCTAGAAACCG CCATGTGCAAGATACAGTGTTGA
Exon 11 GTGAGCACTTGGCAACTGTTAG TGCAAGCTTCTTAAAGCATAGGT
Exon 12 AATGGACCTATGGATGATCTACAC ACACCAAGATACGGGCACAG
Exon 23 AAGGAAGTCTGCATCAGGGGT CCTGGCGATTGCTAACTTGGA
Exon 24 AAAATGTTCACAAGGGACTCCAA AGTTAGGGGTAGGTCCAGTC
Supplementary Table 3. GO analysis filtered for peptides with log2(FC) < -1
GO Term Adjusted P Relevant Genes Identified Value extracellular matrix structural constituent 6.8936E-38 TINAGL1, LAMC1, BGN, DPT, MXRA5, COL5A3, COL8A1, LAMA4, LAMB2, OGN, COL6A2, LAMA5, NIDI, HSPG2, NPNT, SRPX, COL6A3, TGFBI, THSD4, POSTN, COL7A1, MFGE8, LAMA2, ELN, ABI3BP, COL4A4, COL12A1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, ASPN, FMOD, SRPX2, COL4A6, COL11A1, COL4A5, COL6A5, HAPLN1, ACAN, MATN1, MUC5AC, MATN3 extracellular matrix structural constituent conferring 2.9150E-17 COL5A3, COL8A1, COL6A2, COL6A3, COL7A1, COL4A4, COL12A1, COL4A3, tensile strength COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, COL4A6, COL11A1, COL4A5, COL6A5 sulfur compound binding 9.0036E-08 CHST12, FGF2, GSTP1, SOD3, COL5A3, LIPH, SULT1A1, CCDC80, HPSE2, ECM2, FBLN7, POSTN, GAL3ST4, SERPINA5, CTSG, CLEC3B, GSTM3, ABI3BP, ENPP1, CFH, APOB, COL 11 Al, ELANE collagen binding 9.0150E-07 ITGA3, COL5A3, COL6A2, PDGFA, NIDI, ECM2, TGFBI, ABI3BP, PDGFB, P3H1, ASPN, MMP12 aldehyde dehydrogenase (NAD+) activity 1.9832E-06 ALDH3B1, ALDH1B1, ALDH1A1, ALDH2, ADH5, ALDH9A1, ALDH1A2 aldehyde dehydrogenase [NAD(P)+] activity 3.3226E-06 ALDH3B1, ALDH1B1, ALDH1A1, ALDH2, ADH5, ALDH9A1, ALDH1A2 glycosaminoglycan binding 3.3292E-06 FGF2, SOD3, BGN, COL5A3, LIPH, CCDC80, EPYC, ECM2, FBLN7, POSTN,
SERPINA5, CTSG, CLEC3B, ABI3BP, CFH, APOB, COL11A1, ELANE, HAPLN1, ACAN heparin binding 1.8197E-05 FGF2, SOD3, COL5A3, LIPH, CCDC80, ECM2, FBLN7, POSTN, SERPINA5, CTSG, CLEC3B, ABI3BP, CFH, APOB, COL11A1, ELANE extracellular matrix structural constituent conferring 2.7083E-05 BGN, OGN, HSPG2, ASPN, FMOD, HAPLN1, ACAN compression resistance cytokine activity 6.1357E-05 FGF2, WNT4, LEFTY2, WNT7A, BMP5, CXCL12, WNT7B, TNFSF10, BMP3, TNFSF12, WNT11, WNT3A, WNT5A, GDF10, CRLF1, WNT2, WNT2B, IL17D frizzled binding 1.0308E-04 WNT4, WNT7A, WNT7B, WNT11, WNT3A, WNT5A, WNT2, WNT2B oxidoreductase activity, acting on the aldehyde or oxo 1.0308E-04 ALDH3B1, DLAT, ALDH1B1, ALDH1A1, ALDH2, ADH5, ALDH9A1, ALDH1A2 group of donors, NAD or NADP as ac oxidoreductase activity, acting on the aldehyde or oxo 5.8036E-04 ALDH3B1, DLAT, ALDH1B1, ALDH1A1, ALDH2, ADH5, ALDH9A1, ALDH1A2 group of donors extracellular matrix binding 1.4973E-03 TINAGL1, ITGA3, BGN, NIDI, TGFBI, DMBT1, ELN, COL11A1 integrin binding 4.2052E-03 FGF2, ITGA3, LAMB2, CD 177, LAMA5, CXCL12, NPNT, ECM2, TGFBI, MFGE8,
COL4A3, DST
3 '-phosphoadenosine 5'-phosphosulfate binding 4.9876E-03 CHST12, SULT1A1, GAL3ST4, ENPP1 endopeptidase inhibitor activity 2.6902E-02 C3, TFPI, RPS6KA1, AMBP, COL6A3, COL7A1, SERPINA5, ITIH5, UBE2Z, COL4A3,
SLPI, TIMP3 peptidase inhibitor activity 3.7137E-02 C3, TFPI, RPS6KA1, AMBP, COL6A3, COL7A1, SERPINA5, ITIH5, UBE2Z, COL4A3,
SLPI, TIMP3 glyceraldehyde-3 -phosphate dehydrogenase (NAD+) 4.8492E-02 ALDH1B1, ALDH2, ALDH9A1
_ (non-phosphorylating) activity
Supplementary Table 3. GO analysis filtered for peptides with log2(FC) < -1
GO Term Adjusted P Relevant Genes Identified Value extracellular matrix organization 1.0042E-18 ITGA3, LAMC1, LOXL2, DPT, COL5A3, COL8A1, LAMB2, CCDC80, HPSE2, QSOX1, NIDI, NPNT, ECM2, TGFBI, THSD4, POSTN, ELN, WNT3A, CTSG, MMP28, ABI3BP, MMP19, COL4A4, COL12A1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, FMOD, MMP12, COL4A6, COL11A1, ELANE, COL4A5, COL6A5, ACAN extracellular structure organization 1.1219E-18 ITGA3, LAMC1, LOXL2, DPT, COL5A3, COL8A1, LAMB2, CCDC80, HPSE2, QSOX1, NIDI, NPNT, ECM2, TGFBI, THSD4, POSTN, ELN, WNT3A, CTSG, MMP28, ABI3BP, MMP19, COL4A4, COL12A1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, FMOD, MMP12, COL4A6, COL11A1, ELANE, COL4A5, COL6A5, ACAN external encapsulating structure organization 1.3984E-18 ITGA3, LAMC1. LOXL2, DPT, COL5A3, COL8A1, LAMB2, CCDC80, HPSE2, QSOX1, NIDI, NPNT, ECM2, TGFBI, THSD4, POSTN, ELN, WNT3A, CTSG, MMP28, ABI3BP, MMP19, COL4A4, COL12A1, COL4A3, COL6A6, COL18A1, COL4A1 , COL4A2, COL21A1, FMOD, MMP12, COL4A6, COL11A1, ELANE, COL4A5, COL6A5, ACAN renal sy stem development 1.621 IE-08 FGF2, ITGA3, MPST, PLXND1, WNT4, LAMB2, PECAM1, LAMA5, PDGFA, NIDI, ACE, WNT7B, BMPER, NPNT, WNT11, TEK, WNT5A, PDGFB, COL4A4, COL4A3, CRLF1, COL4A1, WNT2B, CNTRL, MME, ALDH1A2 kidney development 5.1899E-08 FGF2, ITGA3, MPST, PLXND1, WNT4, LAMB2, PECAM1, LAMA5, PDGFA, NIDI, ACE, WNT7B, BMPER, NPNT, WNT11, TEK, WNT5A, PDGFB, COL4A4, COL4A3, CRLF1, WNT2B, CNTRL, MME, ALDH1A2 collagen fibril organization 1.9608E-07 LOXL2, DPT, COL5A3, COL12A1, COL4A3, COL4A1, COL4A2, COL21A1, FMOD, COL4A6, COL11A1, COL4A5, ACAN positive regulation of cell-substrate adhesion 3.1488E-07 ITGA3, RRAS, WNT4, COL8A1, CIB1, CCDC80, NIDI, NPNT, ECM2, MYADM, TEK, ABI3BP, PDGFB, LIMS2, EPB41L5, COL26A1 cartilage development 7.2416E-06 FGF2, ACVRL1, LOXL2, BGN, WNT7A, BMP5, WNT7B, EPYC, BMP3, TGFBI, WNT11, WNT5A, WNT2B, COL11A1, ACAN, MATN1, MATN3, CNMD cellular aldehyde metabolic process 1.151 IE-05 ALDH3B1, WNT4, BMP5, ALDH1A1, PDXK, ALDH2, AKR1C1, ADH5, ALDH9A1, ESD, ALDH1A2 regulation of cell-substrate adhesion 2.1389E-05 ITGA3, ACVRL1, RRAS, WNT4, COL8A1, CIB1, CCDC80, NIDI, NPNT, ECM2,
MYADM, TEK, ABI3BP, PDGFB, LIMS2, EPB41L5, MMP12, COL26A1 nephron development 3.2046E-05 FGF2, ITGA3, WNT4, LAMB2, PECAM1, LAMA5, NIDI, WNT7B, NPNT, WNT11, TEK, PDGFB, COL4A4, COL4A3, WNT2B connective tissue development 1.0055E-04 FGF2, ACVRL1, LOXL2, BGN, WNT7A, BMP5, WNT7B, EPYC, BMP3, TGFBI, WNT11, WNT5A, PDGFB, WNT2B, COL11 Al, ACAN, MATN1, MATN3, CNMD endothelial cell proliferation 3.0255E-04 FGF2, ACVRL1, LOXL2, RPTOR, CXCL12, BMPER, TNFSF12, TEK, WNT5A, PDGFB, COL4A3, WNT2, ALDH1A2, CNMD regulation of vasculature development 3.5991E-04 C3, FGF2, ACVRL1, GLUL, RRAS, PLXND1, WNT4, RNH1, BMPER, HSPG2, CLDN5, TNFSF12, TEK, WNT5A, COL4A3, COL4A2, PIK3R6, GTF2I, CNMD sulfur compound metabolic process 3.7722E-04 CHST12, ABHD14B, DLAT, EEF1G, MPST, GSTP1, BGN, PAPSS2, SULT1A1, SQOR, B3GALT6, CLIC5, SMS, CHST14, GAL3ST4, PDK4, GSTM3, SOD1, ENPP1, GSTM5, HSPA9 response to transforming growth factor beta 1.0315E-03 ITGA3, ACVRL1, WNT4, MXRA5, LEFTY2, WNT7A, PDGFA, NPNT, CLDN5, CLEC3B, WNT5A, EPB41L5, GDF10, WNT2, COL4A2, ASPN, FMOD positive regulation of epithelial cell proliferation 1.2624E-03 FGF2, LAMC1, ACVRL1, GLUL, RPTOR, WNT7A, BMP5, CXCL12, TNFSF12, WNT3A, TEK, WNT5A, PDGFB. WNT2, MMP12 regulation of epithelial cell proliferation 1.2830E-03 FGF2, LAMC1, ACVRL1, GLUL, RPTOR, WNT7A, BMP5, CXCL12, TNFSF12, EPPK1, WNT3A, TEK, WNT5A, PDGFB, LIMS2, COL4A3, VVNT2. ALDH1A2, MMP12, CNMD
Supplementary Table 3. GO analysis filtered for peptides with log2(FC) < -1
GO Term Adjusted P Relevant Genes Identified Value regulation of angiogenesis 1.3767E-03 C3, FGF2, ACVRL1, GLUL, RRAS, PLXND1, RNH1, BMPER, HSPG2, CLDN5,
TNFSF12, TEK, WNT5A, COL4A3, COL4A2, PIK3R6, GTF2I, CNMD collagen-activated tyrosine kinase receptor signaling 1.6881E-03 COL4A3, COL4A1, COL4A2, COL4A6, COL4A5 pathway regulation of embryonic development 1.7573E-03 WNT4, LAMA4, RAB14, LAMA5, LAMA2, WNT3A, TRIP12, WNT2, WNT2B primary alcohol metabolic process 1.7800E-03 ALDH3B1, WNT4, GPD1, SULT1A1, BMP5, ALDH1B1, ALDH1A1, ALDH2, AKR1C1, ADH5, ALDH1A2 developmental induction 2.6159E-03 FGF2, WNT4, WNT11, WNT3A, WNT5A, WNT2, WNT2B epithelial cell migration 2.6606E-03 FGF2, ITGA3, ACVRL1, GLUL, LOXL2, RRAS, PLXND1, WNT7A, CIB1, BMPER.
TNFSF12, EPPK1, TEK, WNT5A, PDGFB, EPB41L5, HDAC7, SRPX2 epithelium migration 3.0805E-03 FGF2, 1TGA3, ACVRL1, GLUL, LOXL2, RRAS, PLXND1, WNT7A, GIB 1 , BMPER, TNFSF12, EPPK1, TEK, WNT5A, PDGFB, EPB41L5, HDAC7, SRPX2 positive regulation of animal organ morphogenesis 3.2034E-03 FGF2, WNT4, WNT11, WNT3A, WNT5A, WNT2, WNT2B regulation of endothelial cell proliferation 3.4674E-03 FGF2, ACVRL1, RPTOR, CXCL12, TNFSF12, TEK, WNT5A, PDGFB, COL4A3, WNT2, ALDH1A2, CNMD cellular response to transforming growth factor beta 3.6216E-03 ITGA3, ACVRL1, WNT4, LEFTY2, WNT7A, PDGFA, NPNT, CLDN5, CLEC3B, stimulus WNT5A, EPB41L5, GDF10, WNT2, COL4A2, ASPN, FMOD tissue migration 4.1054E-03 FGF2, ITGA3, ACVRL1, GLUL, LOXL2, RRAS, PLXND1, WNT7A, CIB1, BMPER, TNFSF12, EPPK1, TEK, WNT5A, PDGFB, EPB41L5, HDAC7, SRPX2 endothelial cell migration 4.3597E-03 FGF2, ACVRL1, GLUL, LOXL2, RRAS, PLXND1, WNT7A, C1B1, BMPER, TNFSF12, TEK. WNT5A, PDGFB. HDAC7, SRPX2 organ induction 5.0163E-03 FGF2, WNT11, WNT3A, WNT5A, WNT2, WNT2B regulation of epithelial cell migration 8.5580E-03 FGF2, ITGA3, ACVRL1, GLUL, RRAS, WNT7A, CIB1, BMPER, EPPK1, TEK, WNT5A. PDGFB, EPB41L5, HDAC7, SRPX2 formation of primary germ layer 8.8418E-03 ITGA3, PRKACA, COL8A1, COL7A1, WNT11, WNT3A, WNT5A, COL12A1, EPB41L5, COL4A2, COL 11 Al regulation of cell junction assembly 9.7762E-03 VPS35, ACVRL1, WNT4, ADGRL2, PRKACA, WNT7A, ACE, CLDN5, MY01C, WNT3A, TEK, WNT5A, EPB41L5, SRPX2 collagen-activated signaling pathway 1.2354E-02 COL4A3, COL4A1, COL4A2, COL4A6, COL4A5 response to toxic substance 1.2418E-02 MPST, GSTP1, SOD3, PRDX6, MAOB, ALDH1A1, ALB, ADH5, DU0X1, ABCB1, GSTM3, SOD1, CDH1, ESD, SLC6A4 lung development 1.4458E-02 FGF2, ITGA3, LAMA5. PDGFA, ACE, WNT7B, WNT11, WNT5A, WNT2, WNT2B, MME, ALDH1A2, MMP12 epithelial cell development 1.4557E-02 WNT7A, LA B2. AFDN, PECAM1, BMP5, WNT7B, CLDN5, MYADM, GSTM3, WNT5A, PDGFB, EPB41L5, COL18A1, CNMD regulation of animal organ formation 1.5729E-02 FGF2, WNT11, WNT3A, WNT5A, WNT2, WNT2B respiratory tube development 1.8390E-02 FGF2, ITGA3, LAMA5, PDGFA, ACE, WNT7B, WNT11, WNT5A, WNT2, WNT2B, MME, ALDH1A2, MMP12 gastrulation 2.0689E-02 ITGA3, PRKACA, COL8A1, MYADM, COL7A1, WNT11, WNT3A, WNT5A, COL12A1, EPB41L5, WNK1, COL4A2, COL11A1 cellular detoxification 2.4474E-02 GSTP1, SOD3, PRDX6, ALDH1A1, ALB, ADH5, DU0X1, GSTM3, SOD1, ESD detoxification 2.5450E-02 GSTP1, SOD3, PRDX6, ALDH1A1, ALB, ADH5, DU0X1, ABCB1, GSTM3, SOD1, ESD ethanol metabolic process 2.9763E-02 ALDH3B1, SULT1A1, ALDH1B1, ALDH2, ADH5 regulation of endothelial cell migration 3.6638E-02 FGF2, ACVRL1, GLUL, RRAS, WNT7A, CIB1, BMPER, TEK, WNT5A, PDGFB, HDAC7, SRPX2
Supplementary Table 3. GO analysis filtered for peptides with log2(FC) < -1
GO Term Adjusted P Relevant Genes Identified Value positive regulation of endothelial cell proliferation 4.1006E-02 FGF2, ACVRL1, RPTOR, CXCL12, TNFSF12, TEK, WNT5A, PDGFB, WNT2 kidney epithelium development 4.3882E-02 FGF2, WNT4, LAMB2, PECAM1, LAMA5, WNT7B, BMPER, NPNT, WNT11, CRLF1, WNT2B glomerular basement membrane development 4.4969E-02 LAMB2, NIDI, COL4A4, COL4A3 cellular response to toxic substance 4.5476E-02 GSTP1, SOD3, PRDX6, ALDH1A1, ALB, ADH5, DU0X1, GSTM3, SOD1, ESD endoplasmic reticulum lumen 3.0218E-20 C3, LAMC1, CHRDL1, WNT4, TSPAN15, COL5A3, WNT7A, COL8A1, LAMB2,
COL6A2, QSOX1, PDGFA, WNT7B, ALB, COL6A3, COL7A1, ARSI, MFGE8, WNT3A, PRSS23, WNT5A, PDGFB, ESD, COL4A4, COL12A1, P3H1, COL4A3, COL18A1, COL4A1, COL4A2, COL21A1, APOB, COL4A6, COL11A1, COL26A1, COL4A5, VCPIP1, MATN3 basement membrane 1 .0005E-19 LAMC1 , LOXL2, LAMC3, COL8A1 , LAMA4, LAMB2, CCDC80, LAMA5, NIDI ,
HSPG2, NPNT, TGFBI, COL7A1, LAMA2, COL4A4, COL4A3, COL18A1, COL4A1, COL4A2, COL4A6, TIMP3, COL4A5, ACAN, DST collagen trimer 1.6350E-17 COL5A3, COL8A1, EMIDI, C1QTNF5, COL6A2, C1QTNF7, COL6A3, COL7A1, COL4A4, COL12A1, FCN3, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, COL4A6, COL11A1, COL26A1, COL4A5, COL6A5 complex of collagen trimers 7.8781E-11 COL5A3, COL8A1, COL7A1, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL 11 Al, COL4A5 collagen network 5.5648E-10 COL8A1, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL4A5 network-forming collagen trimer 5.5648E-10 COL8A1, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL4A5 basement membrane collagen trimer 2.4702E-09 COL8A1, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL4A5 Golgi lumen 1.8915E-08 SOD3, BGN, WNT4, WNT7A, OGN, PDGFA, CSPG4, WNT7B, HSPG2, WNT3A,
WNT5A, PDGFB, FMOD, ACAN, MUC5AC
collagen type IV trimer 3.1312E-08 COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL4A5 vesicle lumen 1.8321E-05 C3, GSTP1, LEFTY2, NIT2, PRDX6, CYFIP1, PSMD3, QSOX1, PDGFA, PDXK, XRCC6,
ALB, LGALS3BP, LYZ, CTSG, CLEC3B, PDGFB, APOB, SLPI, ELANE, TIMP3 secretory granule lumen 6.4986E-05 C3, GSTP1, LEFTY2, NIT2, PRDX6, CYFIP1, PSMD3, QSOX1, PDGFA, PDXK, XRCC6,
ALB, LGALS3BP, LYZ, CTSG, CLEC3B, PDGFB, SLPI, ELANE, TIMP3 cytoplasmic vesicle lumen 7.5458E-05 C3, GSTP1, LEFTY2, NIT2, PRDX6, CYFIP1, PSMD3, QSOX1, PDGFA, PDXK, XRCC6,
ALB, LGALS3BP, LYZ, CTSG, CLEC3B, PDGFB, SLPI, ELANE, TIMP3 laminin- 11 complex 1.1839E-03 LAMC1, LAMB2, LAMA5 vacuolar lumen 7.1717E-03 C3, BGN, PRDX6, OGN, CSPG4, HSPG2, LYZ, CTSG, APOB, FMOD, ELANE, ACAN actin filament bundle 1.0732E-02 CRYAB, ABLIM3, MYH10, MYH14, TEK, PDLIM3, PGM5, SHROOM4 specific granule lumen 1.4765E-02 NIT2, CYFIP1, QSOX1, PDXK, LYZ, SLPI, ELANE sarcolemma 1.7850E-02 SLMAP, BGN, SGCD, CIB 1, COL6A2, COL6A3, LAMA2, SGCB, ATP1A2, PGM5 lamellipodium 3.0321E-02 NCKAP1, ABLIM3, MYH10, PLXND1, RAPH1, CIB 1, CD177, SWAP70, CYFIP1,
CSPG4, CDH1, INPPL1 contractile actin filament bundle 3.9321E-02 ABLIM3, MYH10, MYH14, TEK, PDLIM3, PGM5, SHROOM4 _ stress fiber 3.9321E-02 ABLIM3, MYH10, MYH14, TEK, PDLIM3, PGM5, SHROOM4
Supplementary Table 3. GO analysis filtered for peptides with log2(FC) < -1
GO Term Adjusted P Relevant Genes Identified Value
Extracellular matrix organization 7.4076E-22 FGF2, ITGA3, LAMC1, LOXL2, BGN, COL5A3, LAMC3, COL8A1, LAMA4, LAMB2, PECAM1, COL6A2, LAMA5, PDGF A, NIDI, HSPG2, COL6A3, COL7A1, LAMA2, ELN, CTSG, PDGFB, CDH1, MMP19, COL4A4, COL12A1, P3H1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, ASPN, FMOD, MMP12, COL4A6, COL11A1, ELANE, COL26A1, COL4A5, COL6A5, HAPLN1, ACAN, MATN1, MATN3
ECM proteoglycans 2.3939E-18 LAMC1, BGN, COL5A3, LAMA4, LAMB2, COL6A2, LAMA5, HSPG2, COL6A3, LAMA2, COL4A4, COL4A3, COL6A6, COL4A1, COL4A2, ASPN, FMOD, COL4A6, COL4A5, COL6A5, HAPLN1, ACAN, MATN1, MATN3
Laminin interactions 8.7459E-18 ITGA3, LAMC1. LAMC3, LAMA4, LAMB2, LAMAS, NIDI, HSPG2, COL7A1, LAMA2, COL4A4, COL4A3, COL 18 Al, COL4A1, COL4A2, COL4A6, COL4A5
Collagen chain trimerization 1.2887E-15 COL5A3, COL8A1, COL6A2, COL6A3, COL7A1, COL4A4, COL12A1, COL4A3,
COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, COL4A6, COL11A1, COL26A1, COL4A5, COL6A5
Degradation of the extracellular matrix 1.3278E-15 LAMC1, COL5A3, COL8A1, COL6A2, LAMAS, NIDI, HSPG2, COL6A3, COL7A1, ELN, CTSG, CDH1, MMP19, COL4A4, COL12A1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, MMP12, COL4A6, COL11A1, ELANE, COL26A1, COL4A5, COL6A5, ACAN
Collagen degradation 8.4926E-15 COL5A3, COL8A1, COL6A2, COL6A3, COL7A1, MMP19, COL4A4, COL12A1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, MMP12, COL4A6, COL11A1, ELANE, COL26A1, COL4A5, COL6A5
Non-integrin membrane-ECM interactions 4.1577E-13 FGF2, LAMC1, COLS A3, LAMC3, LAMA4, LAMB2, LAMAS, PDGF A, FLSPG2, LAMA2, PDGFB, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL11A1, COL4A5
Collagen biosynthesis and modifying enzymes 4.2490E-13 COL5A3, COL8A1, COL6A2, COL6A3, COL7A1, COL4A4, COL12A1, P3H1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, COL4A6, COL11A1, COL26A1, COL4A5, COL6A5
Collagen formation 9.9904E-12 LOXL2, COL5A3, COL8A1, COL6A2, COL6A3, COL7A1, COL4A4, COL12A1, P3H1, COL4A3, COL6A6, COL18A1, COL4A1, COL4A2, COL21A1, COL4A6, COL11A1, COL26A1, COL4A5, COL6A5
Assembly of collagen fibrils and other multimeric 1.4750E-11 LOXL2, COL5A3, COL8A1, COL6A2, COL6A3, COL7A1, COL4A4, COL12A1, COL4A3, structures COL6A6, COL18A1, COL4A1, COL4A2, COL4A6, COL11A1, COL4A5, COL6A5
Integrin cell surface interactions 4.9993E-10 ITGA3, COL5A3, COL8A1, PECAM1, COL6A2, HSPG2, COL6A3, COL7A1, CDH1, COL4A4, COL4A3, COL6A6, COL18A1, COL A1, COL4A2, COL4A6, COL4A5, COL6A5
WNT ligand biogenesis and trafficking 1.0475E-07 VPS35, WNT4, WNT7A, VPS29, WNT7B, WNT11, WNT3A, WNT5A, WNT2, WNT2B
MET activates PTK2 signaling 1.0847E-05 ITGA3, LAMC1, COL5A3, LAMC3, LAMA4, LAMB2, LAMA5, LAMA2, COL11A1
Anchoring fibril formation 1.1616E-05 COL7A1, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL4A5
NCAM1 interactions 2.0603E-05 COL5A3, COL6A2, COL6A3, COL4A4, COL4A3, COL6A6, COL4A1, COL4A2,
COL4A5, COL6A5
Signaling by PDGF 2.4623E-05 COL5A3, COL6A2, COL6A3, PDGFB, COL4A4, COL4A3, COL6A6, COL4A1, COL4A2,
COL4A5, COL6A5
Crosslinking of collagen fibrils 5.3964E-05 LOXL2, COL4A4, COL4A3, COL4A1, COL4A2, COL4A6, COL4A5
MET promotes cell motility 1.6763E-04 ITGA3, LAMC1. COL5A3, LAMC3, LAMA4, LAMB2, LAMAS, LAMA2, COL11A1
Diseases associated with glycosaminoglycan 2.1027E-04 BGN, PAPSS2, OGN, CSPG4, B3GALT6, HSPG2, CHST14, FMOD, ACAN metabolism
NCAM signaling for neurite out-growth 6.1185E-04 COL5A3, COL6A2, COL6A3, COL4A4, COL4A3, COL6A6, COL4A1, COL4A2,
COL4A5, COL6A5
Supplementary Table 3. GO analysis filtered for peptides with log2(FC) < -1
GO Term Adjusted P Relevant Genes Identified Value
Signaling by MET ITGA3, LAMC1, RAB4B, COL5A3, LAMC3, LAMA4, LAMB2, LAMA5, SH3KBP1,
9.1889E-04 LAMA2, COL11A1
Serotonin clearance from the synaptic cleft 6.5945E-03 ALDH2, MAOA, SLC6A4 Diseases of glycosylation BGN, DPMI, PAPSS2, OGN, CSPG4, B3GALT6, HSPG2, CHST14, THSD4, LFNG, 1.6138E-02 FMOD, ACAN, MUC5AC
Regulation of Insulin-like Growth Factor (IGF) C3, LAMC1, CHRDLl, IGFALS, LAMB2, QSOX1, ALB, MFGE8, CTSG, PRSS23, APOB, transport and uptake by Insulin-like Growth Fa 2.1521E-02 MATN3 Class B/2 (Secretin family receptors) 3.8154E-02 WNT4, WNT7A, WNT7B, CD55, WNT11, VIPR1, WNT3A, WNT5A, WNT2, WNT2B
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value cadherin binding 6.2814E-23 VAPB, PLIN3, LRRFIP1, GOLGA3, CTTN, LIMA1, MPRIP, SHTN1, TM0D3, SH3GL1, CAST, CDH11, EIF4H, SERBP1, VAPA, ERC1, SLC9A3R2, FNBP1L, LRRC59, KTN1, EPS15, KRT18, STK38, RANBP 1, SND1 , EIF5, CHMP2B, MAPRE1, CAPG, EEF1D, VASN, GIGYF2, SH3GLB2, HSPA5, TBC1D2, RPL7A, CDH5, PDLIM1, CKAP5, CAPZA1, ABCF3, NUDC, KLC2, CCS, SPTAN1, HDLBP, DNAJB1, SEPT IN2, ADD1, TNKS1BP1, CNN2, VASP, CALD1, 0LFM4, SCRIB, HSP90AB1, ALDOA, GOLGA2, TLN1, SH3GLB1, RPS26, TAGLN2, BAG3, ARVCF, HSPA8, DDX6, ABI1, CDH13, S100A11, CGN, CRKL unfolded protein binding 3.5658E-09 CCDC115, CDC37, NAP1L4, NPM1, UGGT1, DNAJB2, HSP90B1, PFDN1, HSPA5, SRSF10, NACA, PFDN6, NUDC, HSPE1, LMAN1, PFDN4, HSPB6, HSPA14, DNAJB1, TAPBP, HYOU1, DNAJB11, HSP 90AB1, ERLEC1, VBP1, PFDN2, HSPA8 structural constituent of cytoskeleton 1.4020E-07 TUBB3, CCDC6, EPB41, KRT5, KRT6A, VIM, KRT19, HIP1, ANK1, TPM1, EPB42, SPTA1, KRT15, ARPC5, KRT16, SPTAN1, TUBB, ADD1, KRT2, TUBB6, TLN1, SYNM, ADD3, TUBB1 actin filament binding 2.1730E-06 TPM3, HCLS1, NEXN, BLOC1S6, PPP1R9B, CTTN, LIMA1, MPRIP, SHTN1, BINI, ARPC5L, HIP1, TPM1, MARCKSL1, TPM4, CAPG, SPTA1, PSTPIP1, TPM2, ARPC5, CAPZA1, MY05A, SPTAN1, CAPZ A2, MARCKS, ADD1, PSTPIP2, SYNE2, TLN1, FMNL3, ADD3, MYL4, COROIC, TM0D1 mRNAbinding 3 2191E-05 DHFR, SNRNP70, TAF15, C1QBP, SNRPC, PAIP2, SRSF1, RBM4, SERBP1, ELAVL1, PTBP3, SF1, HNRNPC, CSTF2, ILF3, QKI, RPL26, CARHSP1, TPR, HNRNPAB, PABPC1, HNRNPM, TIAL1, FUBP1, THOC2, IGF2BP2, FXR1, FUBP3, PTBP1, HDLBP, FUS, HNRNPL, HNRNPD, RPS14, HNRNPA3, TSN, RPS26, NUDT21, DDX6, EIF4G1, KHSRP, NHP2, LUC7L3 mRNAbinding 3.2191E-05 DHFR, SNRNP70, TAF15, C1QBP, SNRPC, PAIP2, SRSF1, RBM4, SERBP1, ELAVL1, PTBP3, SF1, HNRNPC, CSTF2, ILF3, QKI, RPL26, CARHSP1, TPR, HNRNPAB, PABPC1, HNRNPM, TIAL1, FUBP1, THOC2, IGF2BP2, FXR1, FUBP3, PTBP1, HDLBP, FUS, HNRNPL, HNRNPD, RPS14, HNRNPA3, TSN, RPS26, NUDT21, DDX6, EIF4G1, KHSRP, NHP2, LUC7L3 ribonucleoprotein complex binding 4.2616E-05 SRP19, SNRPD1, C1QBP, CBX5, SRP54, EIF1, SEC61G, EIF4H, RPLP1, SERBP1, SRP72, SND1, EIF2S1, NPM1, CD2BP2, HSPA5, CKAP5, SRP68, NME1, EIF3K, EFL1, PTCD3, SPCS1, SRPRA, BAG6, CCDC47 heat shock protein binding 5.1447E-05 AHR, CDC37, NUP62, NR3C1, DNAJB2, EEF1D, APOA1, HSPA5, TPR, STIP1, DNAJC7, ST13, APOA2, HSPA14, DNAIB1, ITGAM, ITGB2, HSP90AB 1, BAG2, BAG3, HSPA8, STUB1, BAG6 chaperone binding 1.5449E-04 FGB, BINI, CDC37, TBCA, DNAJB2, ERP29, HSPA5, PFDN6, PLG, HSPE1, CP, PFDN4, HSPB6, DNAIB1, HY0U1, SUGT1, BAG2, BAG3, HSPA8, STUB1 translation regulator activity 1.0740E-03 DHFR, EIF1, PAIP2, EIF4H, ELOC, EIF5, EIF2S1, EEF1B2, EEF1D, EIF2B2, EEF1A1, COPS5, PABPC1, ELOB, IGF2BP2, FXR1, EIF3M, EIF3K, RPS14, EFL1, RPL10, EIF4G1, EIF2D
NADH dehydrogenase activity 1.0840E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, AIFM1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 polyubiquitin modification-dependent protein binding 1.3678E-03 PSMD4, UBQLN2, EPS15, DNAIB2, RNF31, RAD23B, TNIP2, BRCC3, NPLOC4, VCP, UBXN1, BAG6, UBQLN1
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value protein folding chaperone 2.1551E-03 FKBP8, DFFA, PFDN1, HSPA5, CD74, HSPA14, DNAJB1, HSP90AB1, PFDN2, HSPA8, CCDC47
NADH dehydrogenase (ubiquinone) activity 3.5778E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5
NADH dehydrogenase (quinone) activity 4.5554E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 translation regulator activity, nucleic acid binding 5.2666E-03 DHFR, EIF1, PAIP2, EIF4H, ELOC, EIF5, EIF2S1, EEF1B2, EEF1D, EIF2B2, EEF1A1, COPS5, PABPC1, ELOB, EIF3M, EIF3K, EFL1, EIF4G1, EIF2D ubiquitin-like protein binding 6.4700E-03 UBE2L6, STAM2, NUP62, SERBP1, HGS, TSG101, STAM, DNAJB2, RNF31, AUP1, NSFL1C, RAD23B, FAF2, RAE1, NPLOC4, PELP1, RBCK1, UBXN1
NAD(P)H dehydrogenase (quinone) activity 7.2266E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 ubiquitin binding 8.1477E-03 UBE2L6, STAM2, NUP62, HGS, TSG101, STAM, DNAJB2, RNF31, AUP1, NSFL1C, RAD23B, FAF2, RAE1, NPLOC4, RBCK1, UBXN1 antioxidant activity 1.0954E-02 SELENOF, HBM, GPX7, HBQ1, GPX3, EPX, SOD2, SELENOS, PXDN, HBB, PRDX4, APOM, TXNRD1, GPX8, HBG1 ubiquitin-like protein ligase binding 1.2291E-02 UBE2J1, TANK, WASHCI, UBE2L6, HGS, SCAMP3, PTK2B, TSG101, STAM, DTX3L, DNAJB2, RNF31, DDRGK1, AUP1, NGFR, HSPA5, ARIH1, UBE2L3, FAF2, ELOB, NPLOC4, TUBB, VCP, ISG15, SPA RT, HSP90AB1, BAG2, HSPA8, RPL23, STUB1, UBXN1, STAT2, BAG6, BECN1 mRNA 3'-UTR binding 1.4059E-02 TAF15, RBM4, SERBP1, ELAVL1, HNRNPC, ILF3, CARHSP1, PABPC1, TIAL1, IGF2BP2, FXR1, FUS, HNRNPD, NUDT21, KHSRP, NHP2 translation factor activity, RNA binding 1.603 IE-02 EIF1, EIF4H, ELOC, EIF5, EIF2S1, EEF1B2, EEF1D, EIF2B2, EEF1A1, COPS5, ELOB, EIF3M, EIF3K, EFL1, EIF4G1, EIF2D peroxidase activity 2.0497E-02 SELENOF, HBM, GPX7, HBQ1, GPX3, EPX, PXDN, HBB, PRDX4, GPX8, HBG1 structural constituent of muscle 2.3212E-02 NEXN, MYL3, KRT19, TPM1, TPM4, MYL1, TPM2, MYL6B, MYL9, SYNM microtubule plus-end binding 2.7888E-02 CLIP1, MAPRE1, NUMA1, STIM1, CKAP5, CLASP1, MAPRE2 protein-lipid complex binding 2.8110E-02 LDLR, APOL2, APOA1, PLTP, LPL, APOA2, MSR1, CDH13 lipoprotein particle binding 2.8110E-02 LDLR, APOL2, APOA1, PLTP, LPL, APOA2, MSR1, CDH13 oxidoreductase activity, acting on peroxide as acceptor 4.2852E-02 SELENOF, HBM, GPX7, HBQ1, GPX3, EPX, PXDN, HBB, PRDX4, GPX8, HBG1 proteasome-activating activity 4.9539E-02 PSMC2, PSMC1, PSMC3, PSMC4 protein folding 1.1462E-10 SELENOF, SGTA, SNRNP70, CDC37, TBCA, FKBP11, FKBP8, UGGT1, DFFA, DNAJB2, ERP29, PDIA6, HSP90B1, PFDN1, HSPA5, DNAJC7, ST13, GNAT1, PFDN6, PRDX4, NUDC, HSPE1, LMAN1, ER P44, PFDN4, CD74, FKBP2, ERO1 A, HSPB6, HSPA14, DNAJB1, DNAJB11, HSP90AB1, VBP1, PFDN2, BAG2, BAG3, HSPA8, TBCEL, CCDC47 blood coagulation 1.1585E-10 PF4, SERPINE1, F5, WAS, HABP2, FGA, F12, FGB, FGG, BLOC1S6, PROS1, PROC, BLOC1S4, SLC4A1, F13B, PLEK, FCER1G, GAS6, HPS6, SERPINF2, BLOC1S3, F13A1, METAP1, SERPINA10, SER PIND1, DTNBP1, KNG1, HBB, RAP2B, PLAUR, SYK, PLG, LMAN1, APOH, F10, SAA1, TLN1, SERPINA1, MYL9, KRT1, HRG
Golgi vesicle transport 1.1696E-10 GOLGA5, VAPB, TRIP11, COPE, PROS1, MIA2, SCAMP2, SEC16A, SEC23IP, NAPG,
PROC, VAPA, ANK1, SCAMP3, EPS15, KRT18, GOPC, MIA3, COMMD1, GCC2, CCDC91, TFG, COG6, COG7, MY O5A, PRKCI, AP3S1, LMAN1, SEC13, COPZ1, VAMP3, TMED1, SAR1B, VCP, TAPBP, COG4, HYOU1, F10, COPA, GOLGA2, COG2, ERGIC2, EXOCI, ARFRP1, GOLPH3, RABEP1, TRAPPC12, TRAPP C8, COPB2
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value coagulation 2.5039E-10 PF4, SERPINE1, F5, WAS, HABP2, FGA, F12, FGB, FGG, BLOC1S6, PROS1, PROC, BLOC1S4, SLC4A1, F13B, PLEK, FCER1G, GAS6, HPS6, SERPINF2, BLOC1S3, F13A1, METAP1, SERPINA10, SER PIND1, DTNBP1, KNG1, HBB, RAP2B, PLAUR, SYK, PLG, LMAN1, APOH, F10, SAA1, TLN1, SERP1NA1, MYL9, KRT1, HRG hemostasis 2.9128E-10 PF4, SERPINE1, F5, WAS, HABP2, FGA, F12, FGB, FGG, BLOC1S6, PROS1, PROC, BLOC1S4, SLC4A1, F13B, PLEK, FCER1G, GAS6, HPS6, SERPINF2, BLOC1S3, F13A1, METAP1, SERPINA10, SER PIND1, DTNBP1, KNG1, HBB, RAP2B, PLAUR, SYK, PLG, LMAN1, APOH, F10, SAA1, TLN1, SERPINA1, MYL9, KRT1, HRG cytoplasmic translation 6.1315E-10 RPS25, RPS28, RPLP2, EIF4H, RPLP1, RBM4, RPL17, DRG2, EIF5, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, EIF3M, RPS4X, EIF3K, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23 , RPL10, EIF4G1, EIF2D, RPL8, RPL21, RPL38 protein-containing complex disassembly 4.2360E-07 SMARCE1, VTA1, PPP1R9B, EPS8, LIMA1, TM0D3, SH3GL1, ARID1A, PLEK, TSG101, CHMP2B, CAPG, SET, NES, KIF2A, SPTA1, SNAPIN, PEX14, CALCOCO2, MC0LN1, CKAP5, CAPZA1, SPTAN1, GRWD1, KLC1, CAPZA2, ADD1, VCP, CHMP1A, CLASP1, SNAP29, HSPA8, RPL23, ADD3, UBQLN1, TM0D1 protein polymerization 5.7738E-07 WAS, HCLS1, EVL, FGA, FGB, FGG, CTTN, EPS8, TM0D3, PDE4DIP, CLIP1, BINI, ZNF207, ARPC5L, SLAIN2, AKAP9, PTK2B, BLOC1S2, MAPRE1, CAPG, KANK1, SPTA1, PSTPIP1, NUMA1, MZT1, CD H5, ARPC5, ALOX15, CKAP5, CAPZA1, SPTAN1, CAPZA2, ADD1, PSTPIP2, VASP, GOLGA2, CLASP1, ADD3, SSH3, TM0D1 endoplasmic reticulum to Golgi vesicle-mediated 9.1486E-07 VAPB, TRIP11, COPE, PROS1, MIA2, SEC16A, SEC23IP, PROC, VAPA, ANK1, GOPC, transport MIA3, TFG. LMAN1, SEC13, TMED1, SAR1B, VCP, HY0U1, F10, COPA, GOLGA2, ERGIC2, TRAPPC12, TRAPPC 8, COPB2 response to topologically incorrect protein 2.9118E-06 VAPB, F12, UBXN4, HSPB8, EIF2S1, UGGT1, DNAJB2, HSPB7, DDRGK1, AUP1, IISPA5, COPS5, SELENOS, RNF126, FAF2, IISPE1, ERP44, ERO1A, IISPA14, DNAJB1, VCP, HSP90AB1, ERLEC1, BA G3, HSPA8, STUB1, BAG6, PIK3R1 protein exit from endoplasmic reticulum 4.1757E-06 UBE2J1, MIA2, SEC16A, HSP90B1, AUP1, GCC2, SELENOS, UBE2G2, FAF2, SEC13, NPLOC4, SAR1B, VCP, ERLEC1, TM9SF4 fibrinolysis 7.0479E-06 SERPINE1, FGA, F12, FGB, FGG, PROS1, SERPINF2, PLG, APOH, KRT1, HRG spindle organization 7.5572E-06 MAP4, RCC1, TASOR, PDE4DIP, ZNF207, NUP62, RANBP1, DCTN2, CHMP2B, MAPRE1, SMC1A, KIF2A, NUMA1, MZT1, TACC1, TPR, GNAI1, CKAP5, RAE1, NUDC, TUBB, VCP, EML3, CHMP1A, SEP TIN1, GOLGA2, CLASP1, MAPRE2, TACC2, TUBB1 viral life cycle 1 .7636E-05 LDLR, GYPA, VAPB, VTA1 , CTSL, LAMTOR5, VPS37A, CTSB, TASOR, HTATSF1 ,
VAPA, VPS37B, ATG16L1, EPS15, TSG101, CHMP2B, GAS6, CLEC4G, ILF3, NRP1, ITGB6, TRIM26, EEA1, LRSAM1, P TX3, PABPC1, LGALS1, CD74, VCP, TRIM38, CD209, ISG15, CHMP1A, HSP90AB1, CTBP2, TRIM22, APOBEC3C, HSPA8, SPCS1,
DDX6 vesicle organization 2.0133E-05 VAPB, VTA1, BLOC1S6, LAMTOR1, VPS37A, SEC16A, TMF1, STAM2, DNM1, VAPA, HGS, VPS37B, BLOC1S4, FNBP1L, EPS15, TSG101, BLOC1S2, CHMP2B, STAM, MIA3, BLOC1S3, SNAPIN, STX12 , EEA1, TFG, DTNBP1, BLOC1S5, PRKCI, H00K3, SEC13, VAMP3, STX16, SAR1B, CHMP1A, SNAP29, STX4, GOLPH3, COROIC, CREB1 mitotic spindle organization 2.2346E-05 MAP4, RCC1, TASOR, ZNF207, NUP62, DCTN2, CHMP2B, SMC1A, KIF2A, NUMA1, MZT1, TACC1, TPR, GNAI1, CKAP5, RAE1, NUDC, VCP, EML3, CHMP1A, GOLGA2, CLASP1 , TACC2
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value response to endoplasmic reticulum stress 3.2166E-05 FCGR2B, RCN3, SGTA, VAPB, UBE2J1, UBXN4, SEC16A, UBQLN2, EIF2S1, UGGT1,
DNAJB2, ERP29, HSP90B1, DDRGK1, AUP1, HSPA5, COPS5, SELENOS, AL0X15, UBE2G2, FAF2, ERP44, ERO 1A, NPLOC4, VCP, HYOU1, AIFM1, ERLEC1, STUB1, UBXN1, EIF4G1, BAG6, UBQLN1, CCDC47, PIK3R1 negative regulation of supramolecular fiber 3.3695E-05 LDLR, WAS, EPS8, LIMA1, TM0D3, MAPRE1, CAPG, KANK1, SPTA1, PFDN1, CDH5, organization EMILIN1, PFDN6, CAPZA1, PPFIA1, PFDN4, SPTAN1, CAPZA2, ADD1, CLASP1,
VBP1, PFDN2, HSPA8, ADD3, SSH 3, TMOD1, PIK3R1 regulation of protein polymerization 6.6566E-05 HCLS1, EVL, CTTN, EPS8, TM0D3, PDE4DIP, CLIP1, BINI, ARPC5L, SLAIN2,
AKAP9, PTK2B, MAPRE1, CAPG, KANK1, SPTA1, NUMA1, CDH5, ARPC5, ALOX15, CKAP5, CAPZA1, SPTAN1, CAPZA2, A DD1, VASP, CLASP1, ADD3, SSH3, TM0D1
ERAD pathway 7.7139E-05 RCN3, SGTA, UBE2J1, UBXN4, UBQLN2, UGGT1, DNAJB2, HSP90B1, AUP1, HSPA5,
SELENOS, UBE2G2, FAF2, NPLOC4, VCP, ERLEC1, STUB1, UBXN1, BAG6, UBQLN1, CCDC47 actin polymerization or depolymerization 1.1057E-04 WAS, HCLS1, EVL, PPP1R9B, CTTN, EPS8, LIMA1, ENAH, TMOD3, BINI, ARPC5L,
PTK2B, PLEK, CAPG, KANK1, SPTA1, PSTPIP1, ARPC5, AL0X15, CAPZA1, SPTAN1, CAPZA2, ADD1, PSTPIP2, VAS P, ADD3, ABI1, SSH3, TM0D1 synaptic vesicle cytoskeletal transport 1.3866E-04 BLOC1S6, BLOC1S4, BLOC1S2, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1,
AP3S1 synaptic vesicle transport along microtubule 1.3866E-04 BL0C1S6, BL0C1S4, BL0C1S2, BL0C1S3. SNAPIN, DTNBP1, BL0C1S5, AP3M1,
AP3S1 anterograde synaptic vesicle transport 1.3866E-04 BLOC1S6, BLOC1S4, BLOC1S2, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1, AP3S1 ubiquitin-dependent ERAD pathway 2.0088E-04 SGTA, UBE2J1, UBXN4, UBQLN2, DNAJB2, HSP90B1, AUP1, HSPA5, SELENOS, UBE2G2, FAF2, NPLOC4, VCP, ERLEC1, STUB1, BAG6, UBQLN1, CCDC47 response to unfolded protein 2.4439E-04 VAPB, UBXN4, HSPB8, EIF2S1, DNAJB2, HSPB7, DDRGK1, HSPA5, COPS5, SELENOS, FAF2, HSPE1, ERP44, ERO1A, HSPA14, DNAJB1, VCP, HSP90AB1, ERLEC1, BAG3, HSPA8, STUB1, PIK3R1 regulation of actin filament organization 2.7218E-04 WAS, HCLS1, EVL, CTTN, EPS8, LIMA1, TMOD3, BINI, ARPC5L, PTK2B, TPM1, PLEK, CAPG, KANK1, ARFIP1, SPTA1, SERPINF2, NRP1, APOA1, ARPC5, AL0X15, CAPZA1, LIMCH1, PPFIA1, SPTAN1 , CAPZA2, ADD1, SYNPO, VASP, CLASP 1, ADD3, SSH3, TM0D1, PIK3R1 microtubule c toskeleton organization involved in 2.8893E-04 MAP4, RCC1, TASOR, ZNF207, NUP62, DCTN2, CHMP2B, SMC1A, KIF2A, NUMA1, mitosis MZT1, NSFL1C, TACC1, TPR, GNAI1, CKAP5, RAE1, NUDC, VCP, EML3, CHMP1A,
GOLGA2, CLASP 1, TACC2 nucleic acid transport 3.2756E-04 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI, AKAP8L, TPR, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, XPOT, RTRAF, TST, KHS RP
RNA transport 3.2756E-04 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI, AKAP8L, TPR, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, XPOT, RTRAF, TST, KHS RP negative regulation of blood coagulation 4.4452E-04 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1. HRG
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value establishment of RNA localization 4.7045E-04 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI,
AKAP8L, TPR, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, XPOT, RTRAF, TST, KHS RP macroautophagy 4.8086E-04 ATG13, VTA1, VPS37A, SPTLC2, CDC37, STAM2, HMOX1, HGS, VPS37B, UBQLN2,
ATG16L1, HSPB8, TSG101, CHMP2B, STAM, RNF31, SNAPIN, DDRGK1, AUP1, STX12, NSFL1C, LRSAM1, CALC OCO2, SNX6, MCOLN1, EXOC7, SNX18, VCP, SH3GLB1, SNAP29, EXOCI, BAG3, RAB3GAP1, TRAPPC8, UBQLN1, BECN1 chaperone-mediated protein folding 5.2177E-04 SGTA, FKBP11, DFFA, DNAJB2, HSPA5, DNAJC7, ST13, HSPE1, CD74, FKBP2,
ERO1A, HSPB6, HSPA14, DNAJB1, HSPA8 negative regulation of hemostasis 5.7922E-04 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1,
HRG regulation of intracellular transport 5.905 IE-04 ATG13, ZPR1, HCLS1, UBE2J1, NUP214, PPP1R12A, DAB2, NMT1, RBM4, PPP1CC,
FIS1, TGFB1, NUP54, ARFIP1, RNF31, GAS6, NUP58, NUMA1, SNAPIN, GCC2, AKAP8L, UBE2L3, TPR, UBE2G2, L MANI, SUPT6H, ANP32B, TCAF2, SAR1B, ITGAM, ITGB2, HSP90AB1, ERLEC1, SH3GLB 1, TM9SF4, BAG3, UBL5, PCM1, PIK3R1 regulation of actin polymerization or depolymerization 8.789 IE-04 WAS, HCLS1, EVL, CTTN, EPS8, LIMA1, TMOD3, BINI, ARPC5L, PTK2B, PLEK, CAPG, KANK1, SPTA1, ARPC5, AL0X15, CAPZA1, SPTAN1, CAPZA2, ADD1, VASP, ADD3, SSH3, TMOD1 regulation of actin filament length 9.8885E-04 WAS, HCLS1, EVL, CTTN, EPS8, LIMA1, TMOD3, BINI, ARPC5L, PTK2B, PLEK, CAPG, KANK1, SPTA1, ARPC5, AL0X15, CAPZA1, SPTAN1, CAPZA2, ADD1, VASP, ADD3, SSH3, TMOD1
'de novo' posttranslational protein folding 1.0099E-03 SELENOF, UGGT1, HSPA5, DNAJC7, STI 3. HSPE1, CD74, ER01A, HSPA14, DNAJB1, IISPA8 negative regulation of coagulation 1.2290E-03 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1, HRG regulation of RNA splicing 1.2944E-03 ZPR1, RBM12B, SNRNP70, SRSF9, C1QBP, AKAP17A, SAP18, RBM4, PTBP3, SF1, QKI, SRSF10, MBNL1, FXR1, PTBP1, FUS, HNRNPL, HNRNPH3, RPS26, HNRNPF, HSPA8, U2AF2, PIK3R1 establishment of vesicle localization 1.3173E-03 TRIP11, BLOC1S6, SEC16A, DNM1, HGS, BLOC1S4, FNBP1L, DCTN2, TSG101, BLOC1S2, STAM, BLOC1S3, SNAPIN, TFG, COPS5, DTNBP1, BLOC1S5, AP3M1, MY05A, AP3S1, SAR1B, RAB27B, S CRIB, CLASP1, SNAP29
RNA localization 1.3697E-03 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI, AKAP8L, TPR, HNRNPAB, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, XPOT, RTRA F, TST, KHSRP, NHP2 actin filament polymerization 2.4439E-03 WAS, HCLS1, EVL, CTTN, EPS8, TM0D3, BINI, ARPC5L, PTK2B, CAPG, KANK1, SPTA1, PSTPIP1, ARPC5, ALOX15, CAPZA1, SPTAN1, CAPZA2, ADD1, PSTPIP2, VASP, ADD3, SSH3, TM0D1 endosomal transport 3.O35OE-O3 WAS, DPY30, WASHC2A, VTA1, LAMTOR1, WASHCI, SPAG9, HGS, ERC1, EPS15, BLOC1S2, CHMP2B, STAM, ARFIP1, GCC2, EEA1, DCLK1, SNX6, RNF126, ACAP2, VAMP3, STX16, SNX18, VCP, H EATR5B, CHMP1A, SCRIB, ARFRP1, COROIC regulation of actin cytoskeleton organization 3.0574E-03 WAS, HCLS1, EVL, CTTN, EPS8, LIMA1, TMOD3, BINI, NOTCH2, ARPC5L, TGFB1, PTK2B, TPM1, PLEK, CAPG, KANK1, ARFIP1, SPTA1, SERPINF2, NRP1, APOA1, ARPC5, ALOX15, CAPZA1, LTMCH 1 , PPFIA1 , SPTAN1 , CAPZA2, ADD1 , SYNPO, VASP, CLASP1, HRG, ADD3, SSH3, TM0D1, ARHGAP17, PIK3R1
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value
'de novo' protein folding 3.2704E-03 SELENOF, UGGT1, HSPA5, DNAJC7, STI 3. HSPE1, CD74, ERO1A, HSPA14, DNAJB1, HSPA8 plasma lipoprotein particle clearance 3.2704E-03 LDLR, CNPY2, APOC2, SOAT1, HMOX1, APOA1, APOA2, APOM, MSR1, APOC3, KHSRP regulation of intracellular protein transport 3.3166E-03 ATG13, ZPR1, HCLS1, UBE2J1, NMT1, FIS1, TGFB1, NUP54, RNF31, GAS6, NUP58, GCC2, UBE2L3, TPR, UBE2G2, LMAN1, ANP32B, TCAF2, SAR1B, ITGAM, ITGB2, HSP90AB1, ERLEC1, SH3GLB1, TM9SF4, BAG3, UBL5, PCM1, PIK3R1 positive regulation of cytoskeleton organization 3.7351E-03 WAS, HCLS1, EVL, CTTN, PDE4DIP, CLIP1, BINI, NUP62, SLAIN2, AKAP9, PTK2B, TPM1, PLEK, MAPRE1, NES, SERPINF2, NRP1, NUMA1, APOA1, ALOX15, CKAP5, LIMCH1, SYNPO, VASP, CLASP 1, PFDN2 blood coagulation, fibrin clot formation 4.0622E-03 FGA, F12, FGB, FGG, F13A1, APOH zymogen activation 4.7030E-03 SERPINE1, FGA, F12, FGB, FGG, CTSL, LGMN, FADD, SERPINF2, MELTF, PRSS3,
APOH, CD5L regulation of amyloid fibril formation 4.8995E-03 LDLR, PFDN1, PFDN6, APP, PFDN4, VBP1, PFDN2 regulation of actin filament polymerization 5.096 IE-03 HCLS1, EVL, CTTN, EPS8, TMOD3, BINI, ARPC5L, PTK2B, CAPG, KANK1, SPTA1, ARPC5, ALOX15, CAPZA1, SPTAN1, CAPZA2, ADD1. VASP, ADD3, SSH3, TMOD1 cellular response to topologically incorrect protein 5.209 IE-03 VAPB, HSPB8, EIF2S1, UGGT1, DDRGK1, AUP1, HSPA5, COPS5, SELENOS, RNF126, ERO1A, HSPA14, VCP, ERLEC1, BAG3, HSPA8, STUB1, BAG6, PIK3R1 mRNA transport 5.2282E-03 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, CETN2, NUP58, QKI, AKAP8L, TPR, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, HNRNPA3, NUP88, KHSRP regulation of mRNA metabolic process 5.7968E-03 TENT5C, SNRNP70, TAF15, SRSF9, C1QBP, SAP18, RBM4, VIM, SERBP1, ELAVL1, PAF1, SF1, NPM1, HNRNPC, QKI, SAFB2, CARHSP1, GIGYF2, PSMC1, PSMC3, SRSF10, PABPC1, HNRNPM, MBN LI, PSMC4, SUPT6H, FXR1, PTBP1, FUS, HNRNPL, IINRNPD, NUDT21, IISPA8, KHSRP, U2AF2 protein depolymerization 6.7410E-03 PPP1R9B, EPS8, LIMA1, TMOD3, SH3GL1, PLEK, CAPG, NES, KIF2A, SPTA1, CKAP5, CAPZA1, SPTAN1, CAPZA2, ADD1, CLASP1, HSPA8, ADD3, TMOD1 endoplasmic reticulum to cytosol transport 7.0735E-03 UBE2J1, HSP90B1, AUP1, SELENOS, UBE2G2, FAF2, NPLOC4, VCP, ERLEC1 retrograde protein transport, ER to cytosol 7 7.0735E-03 UBE2J1, HSP90B1, AUP1, SELENOS, UBE2G2, FAF2, NPLOC4, VCP, ERLEC1 vesicle localization 7.5050E-03 TRIP11, BLOC1S6, SEC16A, DNM1, HGS, BLOC1S4, FNBP1L, DCTN2, TSG101, BLOC1S2, STAM, BLOC1S3, SNAPIN, TFG, COPS5, DTNBP1, BLOC1S5, AP3M1, MY05A, AP3S1, SAR1B, RAB27B, S CRIB, CLASP1, SNAP29 regulation of plasma lipoprotein particle levels 8.1643E-03 LDLR, CNPY2, APOC2, SOAT1, HM0X1, AGT, APOA1, PLTP, LPL, APOA2, APOM,
MSR1, APOC3, KHSRP negative regulation of wound healing 8.1643E-03 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, CLASP 1, KRT1, HRG high-density lipoprotein particle clearance 8.5808E-03 LDLR, APOC2, APOA1, APOA2, APOM, APOC3 nucleocytoplasmic transport 9.3034E-03 ZPR1, HCLS1, NUP214, PPP1R12A, NUP50, NUP62, AGT, RBM4, ELAVL1, PPP1CC, TGFB1, NUP54, NPM1, LMNA, GAS6, NUP58, ANP32A, AKAP8L, TPR, IPO7, SYK, THOC2, RAE1, SUPT6H, SEC13, NOP9, ANP32B, HSP90AB1, APPL2, NUP88, XPOT, BAG3, RPL23, PIK3R1 nuclear transport 9.3034E-03 ZPR1, HCLS1, NUP214, PPP1R12A, NUP50, NUP62, AGT, RBM4, ELAVL1, PPP1CC, TGFB1, NUP54, NPM1, LMNA, GAS6, NUP58, ANP32A, AKAP8L, TPR, IPO7, SYK, THOC2, RAE1, SUPT6H, SEC13, NOP9, ANP32B, HSP90AB1, APPL2, NUP88, XPOT, BAG3, RPL23, PTK3R1
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value cytoskeleton-dependent intracellular transport 9.9530E-03 BLOC1S6, BLOC1S4, FNBP1L, BLOC1S2, ARMCX3, HSBP1, BLOC1S3, SNAPIN, PEX14, RHOT2, DYNC1I2, DTNBP1, BLOC1S5, AP3M1, MY05A, AP3S1, HOOK3, APP, IFT27, TUBB, SYNE2, RAB27 B, BAG3, HSPA8, PCM1 actin filament depolymerization 1.0405E-02 PPP1R9B, EPS8, LIMA1, TMOD3, PLEK, CAPG, SPTA1, CAPZA1, SPTAN1, CAPZA2, ADD1, ADD3, TMOD1 plasminogen activation 1.2891E-02 SERPINE1, FGA, F12, FGB, FGG, SERPINF2, MELTF, APOH multivesicular body assembly 1.3462E-02 VTA1, VPS37A, STAM2, HGS, VPS37B, TSG101, CHMP2B, STAM, CHMP1A protein activation cascade 1.6479E-02 FGA, F12, FGB, FGG, F13A1, APOH negative regulation of amyloid fibril formation 1.6479E-02 LDLR, PFDN1, PFDN6, PFDN4, VBP1, PFDN2 cellular oxidant detoxification 1.7765E-02 DHFR, HBM, GPX7, HBQ1, GPX3, EPX, SOD2, SELENOS, PXDN, HBB, PRDX4, CCS, APOM, TXNRD1, GPX8, HBG1 multivesicular body organization 1.8182E-02 VTA1, VPS37A, STAM2, HGS, VPS37B, TSG101, CHMP2B, STAM, CHMP1A chaperone cofactor-dcpcndcnt protein refolding 1.8182E-02 HSPA5, DNAJC7, ST13, HSPE1, CD74, ERO1A, HSPA14, DNAJB1, HSPA8 protein import 1.9113E-02 ZPR1, HCLS1, NUP214, NUP50, NUP62, AGT, ELAVL1, TGFB1, NUP54, LMNA, NUP58, PEX14, TPR, IPO7, SYK, PEX3, SEC13, HSP90AB1, AIFM1, APPL2, NUP88, BAG3, HSPA8, RPL23, TOMM22, PIK 3R1 biological process involved in symbiotic interaction 2.0279E-02 LDLR, GYP A, PF4, VAPB, CTSL, CTSB, CARD9, KRT6A, VAPA, APOL1, EPS15, GAS6, CLEC4G, NRP1, ITGB6, TRIM26, PSMC3, PTX3, BPIFA1, THOC2, PLG, LGALS1, EXOC7, CD74, TRIM38, CD209, HDAC1, HSP90AB1, TRIM22, HSPA8, HRG spindle assembly 2.079 IE-02 RCC1, TASOR, ZNF207, CHMP2B, MAPRE1, SMC1A, KIF2A, NUMA1, MZT1, TPR, TUBB, EML3, CHMP1A, SEPTIN1, GOLGA2, CLASP1, MAPRE2, TUBB1 regulation of nucleocytoplasmic transport 2.0998E-02 ZPR1, HCLS1, NUP214, PPP1R12A, RBM4, PPP1CC, TGFB1, NUP54, GAS6, NUP58, AKAP8L, TPR, SUPT6H, ANP32B, HSP90AB1, BAG3, PIK3R1
Golgi organization 2.1261E-02 GOLGA5, TRIP11, SEC16A, PDE4DIP, GOLGB1, SEC23IP, AKAP9, GCC2, NSFL1C, COG7, LMAN1, NPLOC4, TMED1, STX16, COG4, GOLGA2, COG2, CLASP1, GOLPH3, TRAPPC12, TRAPPC8 regulation of blood coagulation 2.1525E-02 SERPINE1. FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1. HRG
axo-dendritic transport 2.2348E-02 BLOC1S6, BLOC1S4, BLOC1S2, ARMCX3, HSBP1, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1, AP3S1, APP, RAB27B, HSPA8 negative regulation of proteolysis 2.2486E-02 SERPINE1, SGTA, DPEP1, AHSG, LAMTOR5, IGBP1, PROS1, LPA, CAST, BINI, FETUB, ITIH6, ITIH2, AGT, GLG1, PSMF1, DNAJB2, ALAD, GAS6, SERPINF2, DDRGK1, SERPTNA10, ECM1, SERPTND 1, KNG1, PLAUR, TTTH4, APP, POR, HSP90AB1, SERPINA1, RPL23, HRG, UBXN1, BAG6 positive regulation of supramolecular fiber organization 2.2629E-02 WAS, EVL, CTTN, PDE4DIP, CLIP1, BINI, SLAIN2, AKAP9, PTK2B, TPM1, PLEK, MAPRE1, SERPINF2, NRP1, NUMA1, APOA1, ALOX15, CKAP5, LIMCH1, APP, SYNPO. VASP, CLASP 1 negative regulation of actin filament depolymerization 2.2657E-02 EPS8, LIMA1, TMOD3, CAPG, SPTA1, CAPZA1, SPTAN1, CAPZA2, ADD1, ADD3, TMOD1 regulation of actin filament depolymerization 2.3014E-02 EPS8, LIMA1, TMOD3, PLEK, CAPG, SPTA1, CAPZA1, SPTAN1, CAPZA2, ADD1, ADD3, TMOD1 synaptic vesicle transport 2.5006E-02 BLOC1S6, DNM1, BLOC1S4, BLOC1S2, BLOC1S3, SNAPIN, DTNBP1, BLOC1S5, AP3M1, AP3S1
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value regulation of proteasomal protein catabolic process 2.5888E-02 SGTA, ECSCR, TMF1, DAB2, UBQLN2, PSMF1, DNAJB2, ALAD, DDRGK1, COMMD1, PSMC2, PSMC1, RAD23B, ARIH1, PSMC3, ELOB, PSMC4, VCP, HSP90AB1, BAG2, STUB1, UBXN1, BAG6, UBQL N1 transport along microtubule 2.8807E-02 BLOC1S6, BLOC1S4, BLOC1S2, ARMCX3, HSBP1, BLOC1S3, SNAPIN, PEX14, RHOT2, DYNC1I2, DTNBP1, BLOC1S5, AP3M1, AP3S1, APP. IFT27, SYNE2, RAB27B, BAG3, HSPA8, PCM1 regulation of hemostasis 3.0274E-02 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1, HRG regulation of substrate adhesion-dependent cell 3.341 IE-02 FGA, FGB, FGG, C1QBP, DAB2, KANK.1, NRP1, AP0A1, MELTF, OLFM4, COROIC, spreading CRKL negative regulation of RNA splicing 3.6224E-02 SRSF9, C1QBP, SAP18, PTBP3, SRSF10, PTBP1, RPS26, U2AF2 protein maturation 4.0872E-02 SERPINE1, CPXM1, FGA, F12, FGB, FGG, CTSL, CAST, SEC11C, GLRX3, GLG1, LGMN, NCSTN, FADD, SERPINF2, SNAPIN, GALNT2, MELTF, PRDX4, CCS, PRSS3, ERO1A, APOH, CTSS, DNAJB11 , SPCS2, GLRX5, PMPCB, BAG2, SPCS1, STUB1, CD5L mitochondrial electron transport, NADH to ubiquinone 4.1983E-02 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 actin filament bundle organization 4.260 IE-02 WAS, EVL, EPS8, LIMA!, SHTN1, PTK2B, TPM1, PLEK, SERPINF2, HSP90B1, NRP1, APOA1, PDLIM1, LIMCH1, PPFIA1, MARCKS, ADD1, SYNPO, CALD1, CLASP1, PIKER 1 nucleobase-containing compound transport 4.6684E-02 CETN3, NUP214, NUP43, NUP50, NUP62, SRSF1, NUP54, NPM1, CETN2, NUP58, QKI, AKAP8L, TPR, CKAP5, THOC2, RAE1, IGF2BP2, SUPT6H, SEC13, LRRC8C, HNRNPA3, NUP88, XPOT, RTRAF, TST, KHSRP positive regulation of intracellular protein transport 4.6867E-02 ATG13, ZPR1, IICLS1, NMT1, FIS1, RNF31, GAS6, UBE2L3, TPR, ANP32B, TCAF2, SAR1B, ITGAM, ITGB2, HSP90AB1, SH3GLB 1, TM9SF4, BAG3, UBL5, PCM1, PIK3R1 endosome organization 4.7683E-02 VTA1, LAMT0R1, VPS37A, STAM2, DNM1, HGS, VPS37B, TSG101, CHMP2B, STAM, EEA1, H00K3, CHMP1A, COROIC regulation of coagulation 4.9235E-02 SERPINE1, FGA, F12, FGB, FGG, PROS1, PROC, SERPINF2, KNG1, PLG, APOH, KRT1, HRG regulation of fibrinolysis 4.9385E-02 SERPINE1, F12, SERPINF2, PLG, APOH, HRG secretory granule lumen 1.9326E-16 PF4, SERPINE1, RNASE2, F5, AHSG, FGA, FGB, FAM3C, FGG, PROS1, RETN, SPARC, PRG3, HRNR, ARHGAP45, TXNDC5, ALAD, GAS6, EPX, FTL, SERPINF2, APOA1, F13A1 , PSMC2, CTSA, ECM1 , PSMC3, EEF1 Al, PSMD2, PTX3, ARPC5, OSTF1, KNG1 , FAF2, ISLR, ITIH4, PRDX4, PLG, GHDC, ALDOC, APP, ERP44, SPTAN1, BIN2, TUBB, APOH, VCP, CNN2, 0LFM4, HSP90AB1, ALDOA, SERPI NA1, C0MMD9, HSPA8, IMPDH2, HRG, S100A11, GUSB cytoplasmic vesicle lumen 3.0649E-16 PF4, SERPINE1, RNASE2, F5, AHSG, FGA, FGB, FAM3C, FGG, PROS1, RETN, SPARC, PRG3, HRNR, ARHGAP45, TXNDC5, ALAD, GAS6, EPX, FTL, SERPINF2, APOA1, F13A1, PSMC2, CTSA, ECM1 , PSMC3, EEF1A1, PSM 2, PTX3, ARPC5, OSTF1, KNG1, FAF2, ISLR, ITIII4, PRDX4, PLG, GIIDC, ALDOC, APP, ERP44, SPTAN1, BIN2, TUBB, APOH, VCP, CNN2, 0LFM4, HSP90AB1, ALDOA, SERPI NA1, C0MMD9, HSPA8, IMPDH2, HRG, S100A11, GUSB vesicle lumen 4.1538E-16 PF4, SERPINE1, RNASE2, F5, AHSG, FGA, FGB, FAM3C, FGG, PROS1, RETN, SPARC, PRG3, HRNR, ARHGAP45, TXNDC5, ALAD, GAS6, EPX, FTL, SERPINF2, APOA1, F13A1, PSMC2, CTSA, ECM1 , PSMC3, EEF1A1, PSMD2, PTX3, ARPC5, OSTF1, KNG1,
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value
FAF2, ISLR, ITIH4, PRDX4, PLG, GHDC, ALDOC. APP, ERP44, SPTAN1, BIN2, TUBB, APOH, VCP, CNN2, 0LFM4, HSP90AB 1, ALDOA, SERPI NA1, C0MMD9, HSPA8, IMPDH2, HRG, S100A11, GUSB endoplasmic reticulum lumen 5.0884E-15 SELENOF, CSF1, F5. NUCB 1, RCN3, GPX7, P4HA1, MZB 1, FM01, P4HA2, AHSG, FGA, RCN1, RCN2, FGG, TNC, FKBP10, CKAP4, ITIH2, CALU, PROC, TGOLN2, KTN1, APOL1, TXNDC5, UGGT1, MI A3, GAS6, ERP29, PDIA6, HSP90B1, APOA1, HSPA5, SERPINA10, SERPIND1, COL10A1, MELTF, KNG1, SUMF2, PLAUR, FSTL1, LGALS1, COL15A1, APP, CP, ERP44, APOA2, ERO1A, HY0U1, F10, D NAJB11, ERLEC1, G0LM1, GPX8, SERPINA1 cell cortex 1.3323E-12 HCLS1, FGB, RAI14, CLTA, PPP1R9B, CTTN, EPS8, WASHCI, PDE4DIP, EPB41, ERC1, KRT19, GLRX3, FNBP1L, SLC4A1 , PTK2B, AKAP12, EPB42, TRTP10, TPM4, MAPRE1, C2CD2L, SPTA1, NUMA1 , SLC2A1, EEF1A1, STIM1, MYL12B, GNAI1, EXOC7, TNFAIP2, HMCN1, SPTAN1, BIN2, CL IB, PHLDB1, CAPZA2, MARCKS, SEPTIN2, MPP1, SEPTIN1, CALD1, AGTRAP, CTBP2, CLASP1, MYL9, EXO Cl, ADD3, SEPTIN4, COROIC, TM0D1, SEPTIN6 protein-lipid complex 1.7759E-12 LDLR, APOC2, LPA, BINI, APOBR, APOL1, APOA1, PLTP, SELENOS, LPL, PEX3, SAA2, APOA2, APOM, HDLBP, APOH, MSR1, APOC3, SAA1 ribosomal subunit 4.3174E-11 MRPL12, MRPL41, MRPL50, RPS25, RPS28, MRPS35, RPLP2, MRPS22, RPLP1, MRPS9, MRPS31, RPL17, RPL13, RPS17, RPL26, RPL7A, MRPL4, RPS6, RPS18, MRPL21, MRPL17, RPS4X, RPS12, R PL27A, ISG15, RPS14, RPS21, RPS26, RPL18, DAP3, RPL32, RPL23, RPL10, EIF2D, RPL8, RPL21, RPL38 plasma lipoprotein particle 1.0316E-10 LDLR, APOC2, LPA, APOBR, APOL1, APOA1, PLTP, SELENOS, LPL, SAA2, APOA2, APOM, HDLBP, APOH, MSR1, APOC3, SAA1 lipoprotein particle 1.0316E-10 LDLR, APOC2, LPA, APOBR, APOL1, APOA1, PLTP, SELENOS, LPL, SAA2, APOA2, APOM. HDLBP, APOH, MSR1, APOC3, SAA1 cytosolic ribosome 5.6261E-10 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18,
RPS4X, RPS12, RPL27A, ISG15, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF2D, RPL8, RPL21, RPL 38 blood microparticle 2.6250E-09 AHSG, FGA, FGB, FGG, PROS1, CPN2, ITIH2, AGT, SLC4A1, APOL1, JCHAIN, AFM, SERPINF2, ITGA2B, APOA1, F13A1, SLC2A1, KNG1, HBB, CIS, ITIH4, PLG, CP, APOA2, KRT1, GC, HSPA8, HRG, C D5L platelet alpha granule lumen 4.1178E-08 PF4, SERPINE1, F5, AHSG, FGA, FGB, FGG, PROS1, SPARC, GAS6, SERPINF2, F13A1, KNG1, ISLR, PLG, APP, ALDOA, SERPINA1, HRG ficolin-l-rich granule lumen 2.2155E-07 CTSB, PRG2, ALAD, PSMC2, FTH1, PSMC3, EEF1A1, PSMD2, ARPC5, OSTF1, HBB, PRDX4, ALDOC, BIN2, CTSS, VCP, HSP90AB 1, ALDOA, SERPINA1, KRT1, C0MMD9, HSPA8, IMPDH2, GUSB, CO MMD3 platelet alpha granule 3.1814E-07 PF4, SERPINE1, F5, AHSG, FGA, FGB, FGG, PROS1, SPARC, GAS6, SERPINF2, ITGA2B, F13A1, THBS2, KNG1, ISLR, PLG, APP, ALDOA, SERPINA1, HRG contractile fiber 3.3678E-07 TPM3, NEXN, MYL3, TMOD3, PDE4DIP, PPP1R12A, BINI, KRT8, PDLIM4, KRT19, GLRX3, SLC4A1, ANK1, TPM1, TPM4, SLC2A1, PDLIM1, MYL1, TPM2, MYL12B, MMP2, LMAN1, FXR1, MYL6B, SYNE2 . SYNPO, CALD1, MTMR12, ALDOA, MYL9, SYNM. BAG3, STUB 1, MYL4, COROIC, TM0D1
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value myofibril 3.9361E-07 TPM3, NEXN, MYL3, TMOD3, PDE4DIP, PPP1R12A, BINI, KRT8, PDLIM4, KRT19, GLRX3, SLC4A1, ANK1, TPM1, TPM4, SLC2A1, PDLIM1, MYL1, TPM2, MYL12B, MMP2, LMAN1, FXR1, SYNE2, SYNP O, CALD1, MTMR12, ALDOA, MYL9, SYNM, BAG3, STUB1, MYL4, CORO1C, TMOD1 ficolin-l-rich granule 9.5770E-07 LAMTOR1, CTSB, PRG2, FCER1G, ALAD, PSMC2, D0K3, FTH1, PSMC3, EEF1A1, PSMD2, ARPC5, OSTF1, HBB, PRDX4, ALDOC, BIN2, GAA, CTSS, VCP, ITGB2, HSP90AB1, ALDOA, SERPINA1, KR Tl, C0MMD9, HSPA8, IMPDH2, GUSB, C0MMD3 spliceosomal complex 9.7864E-07 BUD31, SNRPD1, IK, SF3A2, SNRNP70, AKAP17A, SNRPC, RNF113A, SF3A1, HTATSF1, SRSF1, SNRPE, SF1, HNRNPC, SF3A3, API5, SF3B2, CDC5L, PABPC1, HNRNPM, CLNS1A, BCAS2, SF3B5, S NRPD2, XAB2, HNRNPA3, HNRNPH3, HNRNPF, HSPA8, U2AF2, LUC7L3 very -low-density lipoprotein particle 4.3886E-06 APOC2, APOBR, APOL1, APOA1, SELENOS, LPL, APOA2, APOM, APOH, APOC3 triglyceride-rich plasma lipoprotein particle 4.3886E-06 APOC2, APOBR, APOL1, APOA1, SELENOS, LPL, APOA2, APOM, APOH, APOC3 sarcomere 6.7167E-06 TPM3, NEXN, MYL3, TMOD3, PPP1R12A, BINI, KRT8, PDLIM4, KRT19, GLRX3, SLC4A1, ANK1, TPM1, TPM4, SLC2A1, PDLIM1, MYL1, TPM2, MYL12B, MMP2, LMAN1, SYNE2, SYNPO, MTMR12, ALD OA, MYL9, BAG3, STUB1, MYL4, CORO1C, TM0D1
BLOC-1 complex 7.4272E-06 B LOC1S6, BLOC1S4, KXD1, BLOC1S2, BLOC1S3, SNAPIN, STX12, DTNBP1, BLOC1S5
BLOC complex 7.7073E-06 BLOC1S6, BLOC1S4, KXD1, BLOC1S2, HPS6, BLOC1S3, SNAPIN, STX12, DTNBP1, BLOC1S5 polysome 8.5882E-06 RPS28, VIM, EIF2S1, BTF3, RPL7A, RPS6, FXR1, RPS4X, HDLBP, RPS21, VBP1, RPS26, RPL18, RPL32, EIF4G1, RPL8, RPL38 cortical cytoskeleton 1.4444E-05 IICLS1, PPP1R9B, CTTN, PDE4DIP, EPB41, ERC1, KRT19, SLC4A1, EPB42, TPM4, MAPRE1, SPTA1, NUMA1, SLC2A1, EEF1A1, SPTAN1, CAPZA2, MPP1, CALD1, CLASP 1, TM0D1 high-density lipoprotein particle 1.471 IE-05 APOC2, APOL1, APOA1, PLTP, SAA2, APOA2, APOM, HDLBP, APOH, APOC3, SAA1
U2-type spliceosomal complex 2.058 IE-05 BUD31, SNRPD1, IK, SF3A2, SNRNP70, SNRPC, RNF113A, SF3A1, HTATSF1, SNRPE, SF3A3, SF3B2, CDC5L, BCAS2, SF3B5, SNRPD2, XAB2, U2AF2, LUC7L3 small ribosomal subunit 2.5402E-05 RPS25, RPS28, MRPS35, MRPS22, MRPS9, MRPS31, RPS17, RPS6, RPS18, RPS4X, RPS12, ISG15, RPS14, RPS21, RPS26, DAP3, EIF2D endoplasmic reticulum protein-containing complex 4.2507E-05 P4HA1, MZB1, KRTCAP2, SPTLC2, SEC61G, SEC11C, PDIA6, HSP90B1, AUP1, HSPA5, SELENOS, FAF2, NPLOC4, VCP, TAPBP, HY0U1 , DNAJB 11 , SPCS2, SRPRB, SPCS1, SRPRA, UBXN1 cytosolic large ribosomal subunit 6.6282E-05 RPLP2, RPLP1, RPL17, RPL13, RPL26, RPL7A, RPL27A, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38 mitochondrial protein-containing complex 1.2355E-04 MRPL12, MRPL41, NDUFV3, NMES1, MRPL50, MRPS35, MRPS22, PDK1, MRPS9, MRPS31, ATP5F1D, NDUFS8, NDUFS6, CHCHD3, ATP5PF, MRPL4, NDUFS1, T0MM6, NDUFA2, MRPL21, MRPL1 7, BCKDK, NDUFS3, TIMM13, CHCHD6, NDUFV1, NDUFS7, NDUFV2, DAP3, PMPCB, NDUFS4, NDUFA5, AGK, TOMM22 catalytic step 2 spliceosome 1.4257E-04 BUD31, SNRPD1, SF3A2, SF3A1, SRSF1, SNRPE, HNRNPC, SF3A3, SF3B2, CDC5L, PABPC1, HNRNPM, BCAS2, SNRPD2, XAB2, HNRNPA3, HNRNPF large ribosomal subunit 1.4972E-04 MRPL12, MRPL41, MRPL50, RPLP2, RPLP1, RPL17, RPL13, RPL26, RPL7A, MRPL4,
MRPL21, MRPL17, RPL27A, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value cytosolic small ribosomal subunit 4.8999E-04 RPS25, RPS28, RPS17, RPS6, RPS18, RPS4X, RPS12, ISG15, RPS14, RPS21, RPS26, EIF2D chylomicron 5.0906E-04 APOC2, APOBR, APOA1, LPL, APOA2, APOH, APOC3 chaperone complex 1.3222E- 03 CDC37, HSPB8, STIP1, DNAJB11, HSP90AB1, BAG2, BAG3, HSPA8, STUB1 endoplasmic reticulum chaperone complex 1.6038E-03 MZB1, PDIA6, HSP90B1, HSPA5, HYOU1, DNAJB11 site of polarized growth 1.7645E-03 ZPR1, HCLS1, PPP1R9B, CTTN, EPS8, TUBB3, SHTN1, PTK2B, DCTN2, FKBP15, THY1, NGFR, ARPC5, DTNBP1, MYO5A, EXOC7, APP, FXR1, KLC1, BASP1, HSP90AB1, COP A, ABI1 prefoldin complex 1.7691E-03 PFDN1, PFDN6, PFDN4, VBP1, PFDN2 muscle thin filament tropomyosin 1.9525E-03 TPM3, TPM1, TPM4, TPM2 condensed chromosome, centromeric region 2.1073E-03 TP53BP1, CBX5, PPP1R12A, PMF1, CLIP1, NUP43, ZNF207, PPP1CC, ANAPC16, DCTN2, SMC1A, SIN3A, CBX3, TPR, CKAP5, SEC13, SEPTIN2, SUGT1, CLASP1, TRAPPC12, SEPTIN6 endocytic vesicle lumen 2.4094E-03 CTSL, HGS, SPARC, HSP90B1, APOA1, HBB, HYOU1, SAA1 kinetochore 2.5150E-03 TP53BP1, CBX5, PPP1R12A, PMF1, CLIP1, NUP43, ZNF207, PPP1CC, ANAPC16, DCTN2, SMC1A, SIN3A, TPR, CKAP5, SECO, SEPTIN2, SUGT1, CLASP1, TRAPPC12, SEPTIN6 midbody 2.9390E-03 IL16, EML4, NUP62, VPS37B, PPP1CC, RAP2A, ERH, TSG101, CAPG, HSP90B1, PIN1,
HSPA5, SLC2A1, TACC1, DTNBP1, GNAI1, NUDC, EXOC7, SEPTIN2, EML3, SPART, SEPTIN 1. SH3GLB1, EXOC 1, SEPTIN6 proteasome regulatory particle, base subcomplex 3.0800E-03 PSMD4, PSMC2, PSMC1, PSMC3, PSMD2, PSMC4 growth cone 3.2430E-03 ZPR1, PPP1R9B, CTTN, EPS8, TUBB3, SHTN1, PTK2B, DCTN2, FKBP15, THY1, NGFR, ARPC5, DTNBP1, MYO5A, EXOC7, APP, FXR1, KLC1, BASP1, HSP90AB1, COP A, ABI1 nuclear pore 3.5205E-03 CETN3, NUP214, NUP43, NUP50, NUP62, NUP54, RANBP1, CETN2, NUP58, TPR, IPO7, RAE1, SEC13, NUP88, XPOT lamellipodium 4.1767E-03 EX ,, PPP1R9B, CTTN, ENAH, TUBB3, SHTN1, CAPRINI, PDLIM4, PTK2B, FGD3, CAPG, PSTPIP1, SRGAP2, ARPC5, APBB1IP, PABPC1, APP, SYNE2, VASP, SCRIB, CDC42BPB, FGD2, STX4, ABI1, C ORO1C polysomal ribosome 4.5327E-03 RPS28, BTF3, RPL7A, RPS21, RPS26, RPL18, RPL32, RPL8, RPL38
BORC complex 4.5345E-03 KXD1, BORCS8, BLOC1S2, SNAPIN, BORCS6 spherical high-density lipoprotein particle 4.5345E-03 APOC2, APOA1, APOA2, APOM, APOC3 microtubule plus-end 4.8878E-03 PDE4DTP, CLTP1 , SLATN2, MAPRE1, NUMA1, CKAP5, CLASP1 , MAPRE2 pigment granule 5.0574E-03 CTSB, CALU, NCSTN, NAP1L1, SND1, CAPG, ERP29, PDIA6, HSP90B1, HSPA5, SLC2A1, DTNBP1, MYO5A, TPP1, RAB27B, HSP90AB1, HSPA8 melanosome 5.0574E-03 CTSB, CALU, NCSTN, NAP1L1, SND1, CAPG, ERP29, PDIA6, HSP90B1, HSPA5, SLC2A1, DTNBP1, MYO5A, TPP1, RAB27B, HSP90AB1, HSPA8 low-density lipoprotein particle 5.4926E-03 LDLR, APOC2, APOBR, SELENOS, APOM, MSR1 ruffle 5.5858E-03 PPP1R9B, CTTN, EPS8, LIMA1, CLIP1, TPM1, PLEK, ARHGAP45, FGD3, CAPG, KANK1, EEF1A1, ADGRE2, MYO5A, ACAP2, JCAD, NME1, RASGRP2, APPL2, TLN1, FGD2, S100A11, COROIC
ESCRT complex 6.7708E-03 VPS37A, STAM2, HGS, VPS37B, TSG101, CHMP2B, STAM, CHMP1A cell cortex region 9.3O35E-O3 CLTA, EPB41, ERC1, NUMA1, MYL12B, GNAI1, CLTB, PHLDB1, CTBP2, CLASP1 cortical microtubule cytoskeleton 9.3978E-03 PDE4DTP, MAPRE1, NUMA1, CLASP1
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value endolysosome lumen 9.3978E-03 CTSL, CTSB, LGMN, CTSS NADH dehydrogenase complex 9.5358E-03 NDUFV3,
NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7, NDUFV2, NDUFS4, NDUFA5 mitochondrial respiratory chain complex 1 9.5358E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7,
NDUFV2, NDUFS4, NDUFA5 respiratory chain complex I 9.5358E-03 NDUFV3, NDUFS8, NDUFS6, NDUFS1, NDUFA2, NDUFS3, NDUFV1, NDUFS7,
NDUFV2, NDUFS4, NDUFA5 axon cytoplasm 1.0589E-02 BLOC1S6, BLOC1S4, BLOC1S2, ARMCX3, HSBP1, BLOC1S3, SNAPIN, DTNBP1,
BLOC1S5, AP3M1, AP3S1, RAB27B tertiary granule lumen 1.6609E-02 PRG3, FTH1, PTX3, HBB, ALDOC, PRSS3, SPTAN1, CTSS, CNN2, 0LFM4, ALDOA ruffle membrane 1.7928E-02 P PP1R9B, EPS8, TPM1, PLEK, ARHGAP45, KANK1, EEF1A1, ADGRE2, JCAD, NME1,
RASGRP2, APPL2, TLN1, FGD2, COROIC endoplasmic rcticulum-Golgi intermediate 1.8381E-02 F5, NUCB 1, CCDC115, TRIP11, GOLGB 1, SEC23IP, UGGT1, PDIA6, HSPA5, ASPSCR1, compartment LMAN1, ERP44, TMED1, TAPBP, GOLGA2, SERPINA1, ERGIC2, TRAPPC12 trans-Golgi network membrane 2.0264E-02 CLTA, IMP ADI, SCAMP2, SCAMP3, TMEM165, ARFIP1, COG6, COG7, APP, CD74, VAMP3, STX16, COG4, COG2, ARFRP1 prespliceosome 2.2700E-02 SF3A2, SNRNP70, SNRPC, SF3A1, U2AF2, LUC7L3
U2-type prespliceosome 2.2700E-02 SF3A2, SNRNP70, SNRPC, SF3A1, U2AF2, LUC7L3 pICIn-Sm protein complex 2.7142E-02 SNRPD1, SNRPE, CLNS1A, SNRPD2 actin filament bundle 2.9567E-02 TPM3, LIMA!, PDLIM4, TPM1, TPM4, PDLIM1, MYL12B, LIMCH1, MARCKS, CNN2, SYNPO, MYL9, BAG3 actomyosin 2.9567E-02 TPM3, LIMA1, PDLIM4, TPM1, TPM4, PDLIM1, MYL12B, LIMCH1, CNN2, SYNPO, CDC42BPB, MYL9, BAG3 mitotic spindle 3.0066E-02 IK, MAP4, CTTN, EPB41, EML4, NUP62, RMDN2, MAPRE1, CAPG, SMC1A, NUMA1, TPR, RMDN3, RAE1, NUDC, EML3, GOLGA2, CLASP1, PYCR3, RTRAF
U2-type precatalytic spliceosome 3.7005E-02 SNRPD1, IK, SF3A2, RNF113A, SF3A1, SNRPE, SF3A3, SF3B2, SF3B5, SNRPD2 condensed chromosome 3.7260E-02 P3H4, TP53BP1, CBX5, RCC1, PPP1R12A, PMF1, CLIP1, NUP43, ZNF207, PPP1CC,
RAD21, ANAPC16, DCTN2, SMC1A, SIN3A, CBX3, TPR, CKAP5, SEC13, SEPTIN2, CHMP1A, SUGT1, CLASP1, AD D3, TRAPPC12, SEPTIN6
ESCRT-0 complex 4.1766E-02 STAM2, HGS, STAM stress fiber 4.2587E-02 TPM3, LIMA1, PDLIM4, TPM1, TPM4, PDLIM1, MYL12B, LIMCH1, CNN2, SYNPO. MYL9, BAG3 contractile actin filament bundle 4.2587E-02 TPM3, LIMA1, PDLTM4, TPM1 , TPM4, PDLTM1 , MYL12B, LTMCH1 , CNN2, SYNPO, MYL9, BAG3
I band 4.8200E-02 NEXN, MYL3, PPP1R12A, BINI, KRT8, PDLIM4, KRT19, GLRX3, SLC4A1, SLC2A1, PDLIM1, MYL12B, SYNE2, SYNPO, ALDOA, MYL9, BAG3, STUB1
Translation 3.1093E-16 SRP19, MRPL12, MRPL41, MRPL50, RPS25, RPS28, MRPS35, SRP54, SEC61G, RPLP2, SEC11C, EIF4H, CARS1, MRPS22, RPLP1, SRP72, MRPS9, SSR3, MRPS31, TARSI, RPL17, EIF5, EIF2S1, RPL 13, EEF1B2, RPS17, EEF1D, RPL26, RPL7A, MRPL4, EIF2B2, EEF1A1, RPS6, EEF1E1, PABPC1, SSR1, RPS18, MRPL21, MRPL17, SRP68, EIF3M, PARS2, RPS4X, AIMP1, EIF3K, RPS12, RPL27A, AAR S2, RPS14, SPCS2, RPS21, SRPRB, RPS26, RPL18, DAP3, TRMT112, PTCD3, SSR2, SPCS1, RPL32, SRPRA, RPL23, RPL10, EIF4G1, MRPS25, RPL8, RPL21, RPL38
SRP-dependent cotranslational protein targeting to 3.7934E-13 SRP19, RPS25, RPS28, SRP54, SEC61 G, RPLP2, SEC1 1C, RPLP1 , SRP72, SSR3, RPL17, membrane RPL13, RPS17, RPL26, RPL7A, RPS6, SSR1, RPS18, SRP68, RPS4X, RPS12, RPL27A,
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value
RPS14, SPCS2, RPS21, SRPRB, RPS26, RPL18, SSR2, SPCS1, RPL32, SRPRA, RPL23, RPL10, RPL8, RPL21, RPL38
Regulation of Insulin-like Growth Factor (IGF) 1.8173E-09 CSF1, F5, NUCB1, AHS PGro, FteGinAs, R(ICGNF1B, PFsG)G, TNC, CKAP4, ITIH2, transport and uptake by Insulin-like Growth Factor CALU, PROC, TGOLN2, K.TN1, APOL1, MIA3, GAS6, PDIA6, HSP90B1, APOA1,
Binding SERPINA10, SERPIND1, MELTF, KNG1, FSTL1, PLG, L GALS1, MMP2, APP, CP, APOA2, G0L 1, SERPINA1, IGFBP2
Influenza Viral RNA Transcription and Replication 3.1882E-09 NUP214, RPS25, RPS28, RPLP2, NUP43, NUP50, RPLP1, NUP62, NUP54, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, TPR, POLR2J, RPS18, RAE1, SEC13, POLR2I, RPS4X, RPS12, RPL27A, RPS14, RPS21, NUP88, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Post-translational protein phosphorylation 3.4114E-09 CSF1, F5, NUCB1, AHSG, FGA, RCN1, FGG, TNC, CKAP4, HTH2, CALU, PROC, TGOLN2, KTN1, APOL1, MIA3, GAS6, PDIA6, HSP90B 1, APOA1, SERPINA10, SERPIND1, MELTF, KNG1, FSTL1, LGALS1, APP, CP, APOA2, G0LM1, SERPINA1
Influenza Infection 9.8609E-09 CLTA, NUP214, RPS25, RPS28, RPLP2, NUP43, NUP50, RPLP1, NUP62, NUP54, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, TPR, POLR2J, RPS18, RAE1, SEC13, POLR2I, RPS4X, RPS12, RPL27A, ISG15, RPS14, RPS21, NUP88, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Eukaryotic Translation Initiation 1.7761E-08 RPS25, RPS28, RPLP2, EIF4H, RPLP1, RPL17, EIF5, EIF2S1, RPL13, RPS17, RPL26, RPL7A, EIF2B2, RPS6, PABPC1, RPS18, EIF3M, RPS4X, EIF3K, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
Cap-dependent Translation Initiation 1.7761E-08 RPS25, RPS28, RPLP2, EIF4H, RPLP1, RPL17, EIF5, EIF2S1, RPL13, RPS17, RPL26, RPL7A, EIF2B2, RPS6, PABPC1, RPS18, EIF3M, RPS4X, EIF3K, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
Processing of Capped Intron-Containing Pre-mRNA 4.4100E-08 BUD31, SNRPD1, SF3A2, FIP1L1, CCAR1, SNRNP70, SRSF9, NUP214, SNRPC, NUP43, NUP50, SF3A1, NUP62, SRSF1, ELAVL1, SNRPE, NUP54, SF1, CD2BP2, HNRNPC, SRRT, CSTF2, SF3A3, SF3B2, CDC5L, TPR, SRSF10, HNRNPM, POLR2J, BCAS2, THOC2, RAE1, SEC13, POLR2I, SF3B5, PTBP1, FUS, SNRPD2, HNRNPL, HNRNPD, XAB2, HNRNPA3, NUP88, HNRNPF, NUDT21, HSPA8, U2AF2
L13a-mediated translational silencing of Ceruloplasmin 6.5189E-08 RPS25, RPS28, RPLP2, EIF4H, RPLP1, RPL17, EIF2S1, RPL13, RPS17, RPL26, RPL7A, expression RPS6, PABPC1, RPS18, EIF3M, RPS4X, EIF3K, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
GTP hydrolysis and joining of the 60S ribosomal 8.2859E-08 RPS25, RPS28, RPLP2, EIF4H, RPLP1, RPL17, EIF5, EIF2S1, RPL13, RPS17, RPL26, subunit RPL7A, RPS6, RPS 18, ETF3M, RPS4X, ETF3K, RPS 12, RPL27 A, RPS 14, RPS21 , RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
Eukaryotic Translation Elongation 9.8435E-08 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, EEF1B2, RPS17, EEF1D, RPL26, RPL7A, EEF1A1, RPS6, RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Response to elevated platelet cytosolic Ca2+ 1.6994E-07 PF4, SERPINE1, F5, AHSG, FGA, FGB, FAM3C, FGG, PROS1, CALU, SPARC, PLEK, GAS6, SERPINF2, ITGA2B, APOA1, F13A1, HSPA5, ECM1, KNG1, ISLR, ITIH4, PLG, APP, APOH, RAB27B, ALDOA, TLN1, SERPINA1, TAGLN2, STX4, HRG
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value
Platelet degranulation 2.6365E-07 PF4, SERPINE1, F5, AHSG, FGA, FGB, FAM3C, FGG, PROS1, CALU, SPARC, PLEK, GAS6, SERPINF2, ITGA2B, APOA1, F13A1, HSPA5, ECM1, KNG1, ISLR, ITIH4, PLG, APP, APOH, RAB27B, ALDOA, TLN1, SERPINA1, TAGLN2, HRG
Nonsense Mediated Decay (NMD) independent of the 8.7308E-07 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, PABPC1, E RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
Selenoamino acid metabolism 9.7247E-07 PAPSS1, RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, EEF1E1, RPS18, HNMT, RPS4X, AIMP1, RPS12, RPL27A, TXNRD1, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Peptide chain elongation 1.0106E-06 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, EEF1A1, RPS6, RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38 mRNA Splicing - Major Pathway 1.2100E-06 BUD31, SNRPD1, SF3A2, FIP1L1, CCAR1, SNRNP70, SRSF9, SNRPC, SF3A1, SRSF1, ELAVL1, SNRPE, SF1, CD2BP2, HNRNPC, SRRT, CSTF2, SF3A3, SF3B2, CDC5L, SRSF10, HNRNPM, POLR2J, BCAS2, POLR2I, SF3B5, PTBP1, FUS, SNRPD2, HNRNPL, HNRNPD, XAB2, HNRNPA3, HNRNPF, NUDT21, HSPA8, U2AF2
Eukaryotic Translation Termination 2.7104E-06 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, TRMT112, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Signaling by ROBO receptors 3.2410E-06 EXT., PSMD4, ENAH, RPS25, RPS28, RPLP2, RPLP1, PSMF1, ELOC, RPL17, RPL13, RPS17, NRP1, PSMC2, RPL26, SRGAP2, PSMC1, RPL7A, PSMC3, PSMD2, RPS6, PABPC1, RPS18, ELOB, PSMC4, RPS4X, RPS12, RPL27A, VASP, RPS14, RPS21, CLASP1, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
Formation of a pool of free 40S subunits 3.5644E-06 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, EIF3M, RPS4X, EIF3K, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38 mRNA Splicing 4.2789E-06 BUD31, SNRPD1, SF3A2, FIP1L1, CCAR1, SNRNP70, SRSF9, SNRPC, SF3A1, SRSF1, ELAVL1, SNRPE, SF1, CD2BP2, HNRNPC, SRRT, CSTF2, SF3A3, SF3B2, CDC5L, SRSF10, HNRNPM, POLR2J, BCAS2, POLR2I, SF3B5, PTBP1, FUS, SNRPD2, HNRNPL, HNRNPD, XAB2, HNRNPA3, HNRNPF, NUDT21, HSPA8, U2AF2
Regulation of expression of SLITs and ROBOs 5.0318E-06 PSMD4, RPS25, RPS28, RPLP2, RPLP1, PSMF1, ELOC, RPL17, RPL13, RPS17, PSMC2, RPL26, PSMC1, RPL7A, PSMC3, PSMD2, RPS6, PABPC1, RPS18, ELOB, PSMC4, RPS4X, RPS12, RPL27A, RPS14, RPS21 , RPS26, RPL18, RPL32, RPL23, RPL10, ETF4G1 , RPL8, RPL21, RPL38
Viral mRNA Translation 5.1885E-06 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Cellular response to heat stress 1.2607E-05 NUP214, NUP43, NUP50, NUP62, HSPB8, NUP54, HSBP1, HSPA5, EEF1A1, TPR, DNAJC7, STB, RAE1, RPA3, SEC13, HSPA14, DNAJB1, VCP, HSP90AB1, NUP88, BAG2, BAG3, HSPA8
Selenocysteine synthesis 1.3125E-05 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value
Response of EIF2AK4 (GCN2) to amino acid 1.6333E-05 RPS25, RPS28, RPLP2, RPLP1, RPL17, EIF2S1, RPL13, RPS17, RPL26, RPL7A, RPS6, deficiency RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38
Common Pathway of Fibrin Clot Formation 4.0226E-05 PF4, F5, FGA, FGB, FGG, PROS1, PROC, F13B, F13A1, SERP1ND1, F10 trans-Golgi Network Vesicle Budding 4.2217E-05 CLTA, BLOC1S6, TPD52, GOLGB1, HGS, BLOC1S4, TGOLN2, TXNDC5, ACBD3, FTL, BLOC1S3, SNAPIN, SH3D19, FTH1, DTNBP1, AP3S1, APP, CLTB, HSPA8, STX4
Nonsense-Mediated Decay (NMD) 6.1187E-05 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, PABPC1, RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
Nonsense Mediated Decay (NMD) enhanced by the 6.1187E-05 RPS25, RPS28, RPLP2, RPLP1, RPL17, RPL13, RPS17, RPL26, RPL7A, RPS6, PABPC1, Exon RPS18, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, EIF4G1, RPL8, RPL21, RPL38
ER to Golgi Anterograde Transport 6.1709E-05 F5, COPE, TUBB3, MIA2, SEC16A, GOLGB 1, SEC23IP, NAPG, ANK1, DCTN2, MIA3,
SPTA1, DYNC1I2, TFG, COG6, COG7, CAPZA1, LMAN1, SEC13, SPTAN1, CAPZA2, COPZ1, SAR1B, COG4, COPA , GOLGA2, TUBB6, COG2, SERPINA1, COPB2, TUBB 1
Formation of Fibrin Clot (Clotting Cascade) 1.1451E-04 PF4, F5, FGA, F12. FGB, FGG, C1QBP, PROS1, PROC, F13B, F13A1, SERPIND1, KNG1, F10
Transport to the Golgi and subsequent modification 1.4799E-04 MAN1A2, F5, COPE, TUBB3, MIA2, SEC16A, GOLGB 1, SEC23IP, NAPG, ANK1, DCTN2, MIA3, FUT8, SPTA1, DYNC1I2, TFG, COG6, COG7, CAPZA1, LMAN1, SEC13, MAN2A1, SPTAN1, CAPZA2, COPZ1, SAR1B, COG4, COPA, GOLGA2, TUBB6, COG2, SERPINA1, COPB2, TUBB 1
Cellular response to starvation 2.7837E-04 LAMTOR5, LAMTOR1, RPS25, RPS28, RPLP2, RPLP1, RPL17, EIF2S1, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, ATP6V1F, SEC13, RPS4X, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, LAMTOR3, RPL8, RPL21, RPL38
Regulation of HSF1 -mediated heat shock response 3.2513E-04 NUP214, NUP43, NUP50, NUP62, NUP54, HSPA5, TPR, DNAJC7, ST13, RAE1, RPA3,
SEC13, HSPA14, DNAJB 1, NUP88, BAG2, BAG3, HSPA8
Intra-Golgi and retrograde Golgi-to-ER traffic 3.7548E-04 MAN1A2, GOLGA5, TRIP11, PLIN3, COPE, TUBB3, TMF1, NAPG, CYTH4, TGOLN2, DCTN2, KIF2A, GALNT2, GCC2, DYNC1I2, COG6, COG7, CAPZA1, KLC2, MAN2A1, KLC1, CAPZA2, COPZ1, PAFAH1B3, VAMP3, STX16, COG4, COPA, TUBB6, COG2, SNAP29, ARFRP1, RAB3GAP1, COPB2, TUBB1
Interactions of Rev with host cellular proteins 1.0514E-03 NUP214, RCC1, NUP43, NUP50, NUP62, NUP54, RANBP1, NPM1, TPR, RAE1, SEC13,
NUP88
Ribosomal scanning and start codon recognition 1.1942E-03 RPS25, RPS28, ETF4H, ETF5, ETF2S1 , RPS17, RPS6, RPS18, ETF3M, RPS4X, ETF3K, RPS12, RPS14, RPS21, RPS26, EIF4G1
Translation initiation complex formation 1.1942E-03 RPS25, RPS28, EIF4H, EIF2S1, RPS17, RPS6, PABPC1, RPS18, EIF3M, RPS4X, EIF3K, RPS12, RPS14, RPS21, RPS26, EIF4G1
Clathrin-mediated endocytosis 1.5007E-03 LDLR, CLTA, CTTN, SH3GL1, BINI, STAM2, DAB2, DNM1, HGS, UBQLN2, HIP1, TGOLN2, FNBP1L, EPS15, TRIP10, STAM, COPS8, PACSIN3, COPS5, ARPC5, COPS6, CLTB, VAMP3, SNX18, COPS4, HSPA8, UBQLN1
Activation of the mRNA upon binding of the cap1.5224E-03 RPS25, RPS28, EIF4H, EIF2S1, RPS17, RPS6, PABPC1, RPS18, EIF3M, RPS4X, EIF3K, binding complex RPS12, RPS14, RPS21, RPS26, EIF4G1
Golgi Associated Vesicle Biogenesis 1.781 IE-03 BLOC1S6, TPD52, GOLGB 1, BLOC1S4, TGOLN2, TXNDC5, ACBD3, FTL, BLOC1S3, SNAPIN, SH3D19, FTH1, DTNBP1, AP3S1, HSPA8
Nuclear import of Rev protein 2.6632E-03 NUP214, RCC1 , NUP43, NUP50, NUP62, NUP54, NPM1 , TPR, RAE1 , SEC1 , NL1P88
Supplementary Table4. GO analysis filtered for peptides with log2(FC) >1
GO Term Adjusted P Relevant Genes Identified
Value
Signaling by BRAF and RAFI fusions 3.7979E-03 FGA, FGB, FGG, PAPSS1, MPRIP, FAM114A2, AKAP9, SND1, LMNA, QKI, ITGA2B, APBB1IP, FXR1, AGTRAP, TLN1, AGK
Rev -mediated nuclear export of HIV RNA 3.7992E-03 NUP214, RCC1, NUP43, NUP50, NUP62, NUP54, RANBP1, TPR, RAE1, SEC13, NUP88 COPl-mediated anterograde transport 4.2136E-03 COPE, TUBB3, GOLGB1. NAPG, ANK1, DCTN2, SPTA1, DYNC1I2, COG6. COG7, CAPZA1, SPTAN1, CAPZA2, COPZ1, COG4, COPA, G0LGA2, TUBB6, COG2, COPB2, TUBB 1 rRNA processing in tire nucleus and cytosol 7.1773E-03 RPS25, RPS28, RPLP2, RPLP1, WDR18, RPL17, HEATR1, XRN2, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, DDX21, RPS4X, PELP1, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, TRMT112, RPL32, RPL23, RPL10, NHP2, RPL8, RPL21, RPL38
Platelet activation, signaling and aggregation 7.2243E-03 PF4, SERPINE1, F5, AHSG, FGA, FGB, FAM3C, FGG, PROS1, CALU, SPARC, PLEK, FCER1G, GAS6, SERPINF2, ITGA2B, AP0A1, F13A1, HSPA5, ECM1, APBB 1IP, KNG1, GNAI1, ISLR, ITIH4, SYK, PLG, APP, RASGRP2, APOH, RAB27B, ALDOA, TLN1, SERPINA1, TAGLN2, STX4, HRG, PIK3R1
Asparagine N-linked glycosylation 1.3704E-02 MAN1A2, GFPT2, F5, COPE, TUBB3, MIA2, SEC16A, GOLGB 1, SEC23IP, NAPG, ANK1, DCTN2, UGGT1, MIA3, FUT8, SPTA1, CTSA, PSMC1, DYNC1I2, RAD23B, TFG, COG6, COG7, CAPZA1, ALG5, LMAN1. SEC13, MAN2A1, SPTAN1, CAPZA2, COPZ1, SAR1B, VCP, COG4, COPA, GOLGA2, TUBB6, COG2, SERPINA1, UBXN1, COPB2, TUBB 1
Major pathway of rRNA processing in the nucleolus 1.7423E-02 RPS25, RPS28, RPLP2, RPLP1, WDR18, RPL17, HEATR1, XRN2, RPL13, RPS17, RPL26, and cytosol RPL7A, RPS6, RPS18, DDX21, RPS4X, PELP1, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, RPL32, RPL23, RPL10, RPL8, RPL21, RPL38 rRNA processing 1.9965E-02 PS25, RPS28, RPLP2, RPLP1, WDR18, RPL17, HEATR1, XRN2, RPL13, RPS17, RPL26, RPL7A, RPS6, RPS18, DDX21, RPS4X, PELP1, RPS12, RPL27A, RPS14, RPS21, RPS26, RPL18, TRMT112, RPL32, RPL23, RPL10, NHP2, RPL8, RPL21, RPL38
Intra-Golgi traffic 2.0847E-02 MAN1A2, GOLGA5, TRIP11, NAPG, CYTH4, COG6. COG7, MAN2A1, STX16, COG4, COG2, SNAP29 snRNP Assembly 2.1884E-02 SNRPD 1, NUP214, NUP43, NUP50, NUP62, SNRPE, NUP54, TPR, CLNS1A, RAE1, SEC13, SNRPD2, NUP88
Metabolism of non-coding RNA 2.1884E-02 SNRPD1, NUP214, NUP43, NUP50, NUP62, SNRPE, NUP54, TPR, CLNS1A, RAE1, SEC13, SNRPD2, NUP88
Formation of the ternary complex, and subsequently, 2.7305E-02 RPS25, RPS28, EIF2S1, RPS17, RPS6, RPS18, EIF3M, RPS4X, EIF3K, RPS12, RPS14, the RPS21, RPS26
Oncogenic MAPK signaling 2.7686E-02 FGA, FGB, FGG, PAPSS1, MPRIP, FAM1 14A2, PPP1 CC, AKAP9, SND1 , LMNA, QKI, ITGA2B, APBB 1IP, FXR1, AGTRAP, TLN1, AGK
Host Interactions of HIV factors 3.3854E-02 NUP214, PSMD4, RCC1, NUP43, NUP50, NUP62, NUP54, PSMF1, ELOC, RANBP1, NPM1, PSMC2, SKP1, PSMC1, PSMC3, PSMD2, TPR, ELOB, RAE1, PSMC4, SEC13, NUP88
Viral Messenger RNA Synthesis 4.0217E-02 NUP214, NUP43, NUP50, NUP62, NUP54, TPR, POLR2J, RAE1, SEC13, POLR2I, NUP88
1. A biological tissue model configured for in vitro applications, the biological tissue model comprising: a substrate including a plurality of isolated, soluble matrikines; wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue.
2. The biological tissue model of claim 1, wherein the plurality of isolated, soluble matrikines are incorporated into the substrate as a scaffold.
3. The biological tissue model of any of claims 1-2, wherein the plurality of isolated, soluble matrikines are incorporated into the substrate as a hydrogel.
4. The biological tissue model of any of claims 1-3, wherein the biological tissue model is disease-specific.
5. The biological tissue model of claim 4, wherein the biological tissue model is a cystic fibrosis biological tissue model.
6. The biological tissue model of any of claims 1-5, wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native disease-specific biological tissue.
7. The biological tissue model of claim 6, wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
8. A method of preparing a biological tissue model configured for in vitro applications, the method comprising: isolating a plurality of soluble matrikines from an extracellular matrix; incorporating the plurality of soluble matrikines into a substrate; and recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue with the substrate.
9. The method of claim 8, wherein incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a scaffold.
10. The method of any of claims 8-9, wherein incorporating the plurality of soluble matrikines into the substrate includes incorporating the plurality of soluble matrikines into the substrate as a hydrogel.
11. The method of any of claims 8-10, further comprising processing the isolated, soluble matrikines by crosslinking the isolated, soluble matrikines with each other for incorporation into the substrate.
12. The method of any of claims 8-11, further comprising processing the isolated, soluble matrikines by coating a surface of a scaffold for incorporation into the substrate.
13. The method of any of claims 8-12, wherein isolating the plurality of soluble matrikines includes treating a native biological tissue with a CHAPS-based detergent.
14. The method of any of claims 8-13, wherein isolating the plurality of soluble matrikines includes treating a native biological tissue with a Benzonase-based enzyme.
15. The method of any of claims 8-14, wherein the biological tissue model is diseasespecific.
16. The method of claim 15, wherein the biological tissue model is a cystic fibrosis biological tissue model.
17. The method of any of claims 8-16, wherein recapitulating one or more of a microstructure, molecular composition, and biomechanical property includes recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native diseasespecific biological tissue.
18. The method of claim 17, wherein recapitulating one or more of a microstructure, molecular composition, and biomechanical property includes recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native cystic fibrosis biological tissue.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263337990P | 2022-05-03 | 2022-05-03 | |
| US63/337,990 | 2022-05-03 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023215764A2 true WO2023215764A2 (en) | 2023-11-09 |
| WO2023215764A3 WO2023215764A3 (en) | 2023-12-07 |
Family
ID=88647169
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/066517 Ceased WO2023215764A2 (en) | 2022-05-03 | 2023-05-02 | Pathological remodeling of distal lung matrix in end-stage cystic fibrosis patients |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2023215764A2 (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2021340630A1 (en) * | 2020-09-08 | 2023-03-16 | Xylyx Bio, Inc. | Tissue-derived matrikine compositions and methods therefor |
-
2023
- 2023-05-02 WO PCT/US2023/066517 patent/WO2023215764A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2023215764A3 (en) | 2023-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10576098B2 (en) | Compositions and methods for treating fibrotic disease | |
| Poposki et al. | Increased expression of the chemokine CCL23 in eosinophilic chronic rhinosinusitis with nasal polyps | |
| Yerra et al. | Pressure overload induces ISG15 to facilitate adverse ventricular remodeling and promote heart failure | |
| Shu et al. | IL-8 triggers neutrophil extracellular trap formation through an nicotinamide adenine dinucleotide phosphate oxidase-and mitogen-activated protein kinase pathway-dependent mechanism in uveitis | |
| Cha et al. | Compartmentalized expression of c-FLIP in lung tissues of patients with idiopathic pulmonary fibrosis | |
| Burgy et al. | Fibroblast-derived extracellular vesicles contain SFRP1 and mediate pulmonary fibrosis | |
| Thirunavukkarasu et al. | Poly (ADP-ribose) polymerase 9 mediates early protection against Mycobacterium tuberculosis infection by regulating type I IFN production | |
| Xu et al. | PM2. 5 exposure induces alveolar epithelial cell apoptosis and causes emphysema through p53/Siva-1. | |
| CN104507965A (en) | BAG3 as a serum and tissue biochemical marker | |
| JP2016211925A (en) | Method of evaluating tolerance of cancer to docetaxel or paclitaxel, method of evaluating malignant alteration of cancer, and kits used for the same in cancer | |
| Foster et al. | Proteomic analysis of human bronchoalveolar lavage fluid after subsgemental exposure | |
| Griesser et al. | Characterization of a flexible AAV-DTR/DT mouse model of acute epithelial lung injury | |
| Wu et al. | Eosinophil-derived interleukin-24 compromises epithelial integrity and aggravates airway remodeling in mouse models of allergic asthma | |
| Chen et al. | Differential Hrd1 expression and B-cell accumulation in eosinophilic and non-eosinophilic chronic rhinosinusitis with nasal polyps | |
| WO2023215764A2 (en) | Pathological remodeling of distal lung matrix in end-stage cystic fibrosis patients | |
| AU2007211846B2 (en) | A method of modulating cellular activity and agents for use therein | |
| Bailey et al. | Extracellular proteomes of M‐CSF (CSF‐1) and GM‐CSF‐dependent macrophages | |
| CN105722509A (en) | Perforin-2 activators and inhibitors as drug targets for infectious diseases and intestinal inflammation | |
| JP7823034B2 (en) | GDF3 as a biomarker and biotarget in post-ischemic cardiac remodeling | |
| Zhang et al. | CircRNA02318 Exerts Therapeutic Effects on Myocardial Ischemia-Reperfusion Injury Rats by Regulating the Nox1/Akt Through Inhibiting Drebrin | |
| CN116103235A (en) | A kind of neutrophil for promoting bone formation, composition and application thereof | |
| Wong et al. | Proteome analysis of chronically inflamed lungs in a mouse chronic asthma model | |
| Taylor et al. | Endogenous retroviral elements generate pathologic neutrophils and elastase rich exosomes in pulmonary arterial hypertension | |
| US12031976B2 (en) | Screening method for therapeutic substance for preventing or treating bronchopulmonary dysplasia (BPD) | |
| Baraniuk et al. | Differentiating osteomeatal complex disease and chronic rhinosinusitis from nonallergic rhinitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23800187 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23800187 Country of ref document: EP Kind code of ref document: A2 |
