WO2023197014A2 - Combination therapy comprising pd-l1 knockout nk cell and anti-pdl1 antibodies - Google Patents
Combination therapy comprising pd-l1 knockout nk cell and anti-pdl1 antibodies Download PDFInfo
- Publication number
- WO2023197014A2 WO2023197014A2 PCT/US2023/065594 US2023065594W WO2023197014A2 WO 2023197014 A2 WO2023197014 A2 WO 2023197014A2 US 2023065594 W US2023065594 W US 2023065594W WO 2023197014 A2 WO2023197014 A2 WO 2023197014A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- engineered
- cells
- car
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/15—Natural-killer [NK] cells; Natural-killer T [NKT] cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2827—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
- A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
- A61K38/208—IL-12
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
- A61K38/2086—IL-13 to IL-16
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/416—Antigens related to auto-immune diseases; Preparations to induce self-tolerance
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0646—Natural killers cells [NK], NKT cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2321—Interleukin-21 (IL-21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/25—Tumour necrosing factors [TNF]
Definitions
- NK cell therapy is a growing and gaining acceptance as an effective method to treat cancer and potentially other diseases.
- the hurdles in the past that stifled development and success of NK cell therapy were the lack of a way to produce high doses of viable and healthy NK cells with high cytotoxicity toward tumors, and good persistence to have therapeutic efficacy. What is needed are new cancer therapies that can improve NK cell cytotoxicity and prolong NK cell persistence.
- NK cells secrete IFN-gamma when activated by a malignant or virally compromised cells, which then induces tumor cells to express PD-L1 that has immune suppressive effects.
- This immune suppression can be circumvented by applying an antibody against PD-L1 that then can be bound by CD16 (Fc-gamma receptor) on NK cells to engage antibody dependent cell cytotoxicity to kill tumor cells.
- CD16 Fc-gamma receptor
- the combinatorial application of NK cells and an anti-PD-Ll mAb can have significantly higher efficacy over NK cells alone or an anti-PD-Ll by itself.
- PD-L1 -expressing tumors can also be targeted with CAR-NK or CAR-T cells targeted against PD-L1.
- PM21-NK cells lack PD-1 or PD-L1 on their surface but when exposed to certain tumor spheroids or cytokines (for example, IL- 15, IL- 18, or IL- 12) that are frequently present in the tumor microenvironment, they induce PD-L1.
- PD-L1 on NK cell surface can be coated with anti-PD-Ll antibodies and trigger fratricide, where NK cells kill each other. This can lead to depletion of NK cells and have a negative impact on efficacy.
- This disclosure describes the use of PD-L1 knockout (KO) NK cells that can be resistant to fratricide when exposed to anti-PD-Ll antibodies (e.g., Fc-competent anti-PD-Ll antibodies).
- NK cells with mutated PD-L1 to remove recognition/binding sites of anti-PD-Ll can also be used.
- an engineered NK cell wherein said engineered NK cell which is suppressed in the expression of a programmed death ligand-1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide.
- PD-L1 polypeptide comprises a mutation at a binding site of an anti-PD-Ll antibody.
- an engineered NK cell of any preceding aspect wherein the expression of the PD-L1 polypeptide is suppressed using a gene editing tool (e.g., a CRISPR/Cas endonuclease (Cas)9 system) or a nucleic acid (e.g., a siRNA or a shRNA) that targets a PD-L1 polynucleotide.
- a gene editing tool e.g., a CRISPR/Cas endonuclease (Cas)9 system
- a nucleic acid e.g., a siRNA or a shRNA
- an engineered NK cell of any preceding aspect wherein the feeder cell or engineered particle comprises an Fc domain bound to an external surface thereof.
- composition comprising the engineered NK cell of any preceding aspect.
- the pharmaceutical composition of any preceding aspect wherein the pharmaceutical composition further comprises an anti-PDLl antibody (such as for example, avelumab, pembrolizumab, nivolumab, cemiplimab, atezolizumab, dostarlimab, or durvalumab).
- the pharmaceutical composition further comprises a chimeric antigen receptor (CAR) T cell or a CAR NK cell that targets PD-L1.
- the pharmaceutical composition further comprises one or more of IL-12, IL-15, IL-18, IL-21, and 41BBL.
- the anti-PDLl antibody comprises a fragment crystallizable region (Fc region) that binds to an Fc receptor.
- the anti-PDLl antibody lacks a Fc region or comprises a Fc region having a reduced affinity to an Fc receptor relative to a reference control.
- a cancer, metastasis, or an infectious disease in a subject comprising administering to the subject a therapeutically effective amount of an engineered NK cell, wherein said engineered NK cell is suppressed in the expression of a programmed death ligand-1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide.
- PD-L1 programmed death ligand-1
- the expression of the PD-L1 polypeptide is suppressed using a gene editing tool (e.g., a CRISPR/Cas endonuclease (Cas)9 system) or a nucleic acid (e.g., a siRNA or a shRNA) that targets a PD-L1 polynucleotide.
- a gene editing tool e.g., a CRISPR/Cas endonuclease (Cas)9 system
- a nucleic acid e.g., a siRNA or a shRNA
- a cancer, metastasis, or an infectious disease of any preceding aspect wherein the engineered NK cell, wherein said engineered NK cell which is suppressed in the expression of a programmed death ligand- 1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide.
- PD-L1 polypeptide comprises a mutation at a binding site of an anti-PD-Ll antibody.
- the activation or expansion of the engineered NK cell occurs between 1 and 21 days prior to the administration of the engineered NK cell to the subject.
- the NK cell expanding composition further comprises an NK cell effector agent.
- the NK cell effector agent comprises IL-12, IL-15, IL-18, IL-21, or 41BBL, or any combination thereof.
- the method treating, decreasing, inhibiting, reducing, ameliorating, and/or preventing a cancer, metastasis, or an infectious disease of any preceding aspect further comprises administering to the subject a therapeutically effective amount of an anti-PDLl antibody (such as, for example, avelumab, pembrolizumab, nivolumab, cemiplimab, atezolizumab, dostarlimab, or durvalumab).
- the engineered NK cells can be administered between about 1 and 14 days prior to the administration of the anti-PD-Ll antibody or administered concurrently with the anti-PD-Ll antibody.
- the anti-PDLl antibody is administered in the same composition as the engineered NK cells. 15.
- the engineered NK cells can be administered prior to, concurrently with, and/or following the administration of the chimeric antigen receptor (CAR) T cell or a CAR NK cell that targets PD-L1.
- the engineered NK cells can be administered between about 1 and 14 days prior to the administration of the chimeric antigen receptor (CAR) T cell or a CAR NK cell that targets PD-L1 or administered concurrently with the anti-PD- L1 antibody.
- NK cell a cancer, metastasis, or an infectious disease of any preceding aspect, further comprising contacting the engineered NK cell with one or more of IL-12, IL-15, IL-18, IL- 21, and 41BBL prior to, concurrently with, and/or following the administration of the NK cell to the subject.
- the one or more of IL-12, IL-15, and IL-18 are administered prior to, concurrently with, and/or following the administration of the engineered NK cell.
- a cancer, metastasis, or an infectious disease of any preceding aspect further comprising administering PM21 particles or EX21 exosomes to the subject.
- the PM21 particles or EX21 exosomes are administered prior to, concurrently with, and/or following the engineered NK cell.
- the PM21 particles or EX21 exosomes are administered at least 1, 2, or 3 times per week following the administration of the NK cell.
- Figure 1 shows that therapies targeting PD-1/PD-L1 pathway have transformed the cancer treatment and outcomes. The success of these treatments depends largely on PD-L1 ligand being expressed on treated tumors.
- Activated NK cells such as PM-21 NK cells secrete IFN-y upon tumor recognition, which leads to induction of PD-L1 on the surface of cancer cells.
- PD-L1 can then be targeted with currently available antibodies or for example CAR-NK or -T cells.
- a recent study showed that activated NK cells could also express PD-L1 on the surface, for example when exposed to K562 cells or certain cytokines (Cancer Discov 2019;9: 1422-37).
- PD-L1 on NK cells could be recognized and bound by antibodies or CAR constructs which could potentially lead to self-killing or so called fratricide. This would particularly occur with Fc-competent antibodies such as for example avelumab.
- Fc-competent antibodies such as for example avelumab.
- Prior studies have found the treatment with avelumab does not lead to depletion of lymphocyte including those with surface PD-L1 expression www.ncbi.nlm.nih.gov/pmc/articles/PMC6387686/.
- This disclosure provides evidence that PM21- NK cells although highly activated are PD-L1 but PD-L1 expression can be induced on these cells upon exposure to tumor spheroids or cytokines. Exposure of such cells to avelumab can lead to fratricide and potential NK depletion.
- Use of PD-L1 KO NK cells can provide a solution for developing treatments that target PD-L1 with
- Figure 2A shows PD-L1 induction on NK cells measured following stimulation by K562 (black triangles), CSTX2, IL-21 and 41BBL expressing cells (red inverted triangles), or PM21- particles (green squares) in the presence of IL-2 and compared to culturing in IL2 alone as a control (black circles).
- PD-L1 expression was measured prior to stimulation and on days 1, 4, 7, 10, 12, and 14 of culture by flow cytometry gated on viable NK (CD3-, CD56+) cells.
- N 2 donors.
- Figure 5 A shows that NK cells were PM21 -particle expanded from T cell-depleted PBMCs and cultured for 14 days.
- NK cell cytotoxicity against spheroids of A549 cells stably expressing PD-L1 (A549-PD-L1) was determined by kinetic live-cell imaging assay.
- Co-incubation of PM21-NK cells with Fc-competent anti-PD-Ll (avelumab, Selleckchem. Cat#:A2015) red triangles
- Fc-competent anti-PD-Ll alone had no cytotoxicity.
- N 1 donor in quadruplicate.
- Figure 5B shows that PM21-NK cell cytotoxicity against PD-L1 expressing A549 cells at 72 hours was significantly greater in the presence of Fc-competent anti-PD-Ll (avelumab, Selleckchem. Cat#: A2015) (red triangles) compared to PM21-NK cells alone (black circles) (1 : 1 NK:PD-L1 A549 ratio).
- N 1 donor in quadruplicate.
- FIGS 7A-7C show that NK cells were PM21 -particle expanded from T cell-depleted PBMCs and PD-L1 was knocked-out (KO) using CRISPR/Cas9.
- PD-L1 KO PM21-NK cells blue inverted triangles
- WT PM21-NK cells black
- PD-L1 KO PM21-NK cells blue
- WT PM21-NK cells black
- PD-L1 KO PM21-NK cells blue
- Figure 8 shows ex vivo NK cell expansion and PD-L1 knockout.
- Figure 9 shows PD-L1 expression on PD-L1 knockout NK cells.
- Figure 11 shows PM21- NK cells do not express PD-L1, but tumor exposure induced PD- L1 expression.
- Figures 12A and 12B shows that ADCC-competent anti-PD-Ll led to enhanced killing of PD-L1+ tumor cells.
- Figures 13 A and 13B show that in vivo PM21-NK/anti-PD-Ll resulted in decreased tumor control and NK cell survival compared to PM21-NK cells alone.
- Figure 14 shows that PD-L1 knockout prevented PM21-NK cell fratricide in vitro.
- Figures 15A and 15B show that in vivo PD-L1 PM21-NK cell/anti-PD-Ll resulted in no change in tumor control or NK cell survival compared to PM21-NK cells alone.
- Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed.
- compositions and methods include the recited elements, but not excluding others.
- Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like.
- Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions of this invention. Embodiments defined by each of these transition terms are within the scope of this invention.
- administering to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like.
- parenteral e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques
- Constant administration means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time.
- Systemic administration refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject’s body (e.g., greater than 50% of the body), for example through entrance into the circulatory or lymph systems.
- local administration refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount.
- locally administered agents are easily detectable in the local vicinity of the point of administration, but are undetectable or detectable at negligible amounts in distal parts of the subject’s body.
- Administration includes selfadministration and the administration by another.
- the compositions disclosed herein are administered parenterally, intravenously, intraperitoneally, or subcutaneously, or through arterial infusion, venous infusion, or artificial catheter mediated infusion.
- beneficial agent and “active agent” are used interchangeably herein to refer to a chemical compound or composition that has a beneficial biological effect.
- beneficial biological effects include both therapeutic effects, i.e., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, i.e., prevention of a disorder or other undesirable physiological condition.
- the terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like.
- Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom, Thus, a gene encodes a protein if transcription and translation of mRNA.
- linker refers at least a bivalent moiety with a site of attachment for a polypeptide and a site of attachment for another polypeptide.
- a polypeptide can be attached to the linker at its N-terminus, its C-terminus or via a functional group on one of the side chains.
- the linker is sufficient to separate the two polypeptides by at least one atom and in some embodiments by more than one atom.
- gene refers to the coding sequence or control sequence, or fragments thereof.
- a gene may include any combination of coding sequence and control sequence, or fragments thereof.
- a “gene” as referred to herein may be all or part of a native gene.
- a polynucleotide sequence as referred to herein may be used interchangeably with the term “gene”, or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof.
- gene or “gene sequence” includes, for example, control sequences upstream of the coding sequence (for example, the ribosome binding site).
- nucleic acid means a polymer composed of nucleotides, e.g. deoxyribonucleotides (DNA) or ribonucleotides (RNA).
- ribonucleic acid and RNA as used herein mean a polymer composed of ribonucleotides.
- deoxyribonucleic acid and DNA as used herein mean a polymer composed of deoxyribonucleotides. (Used together with “polynucleotide” and “polypeptide”.)
- nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
- the phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
- peptide polypeptide
- protein protein
- polynucleotide refers to a single or double stranded polymer composed of nucleotide monomers.
- “Pharmaceutically acceptable” component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained.
- the term When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration. 53.
- “Pharmaceutically acceptable carrier” (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and/or human pharmaceutical or therapeutic use.
- carrier or “pharmaceutically acceptable carrier” can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil/water or water/oil emulsion) and/or various types of wetting agents.
- carrier encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations.
- a carrier for use in a composition will depend upon the intended route of administration for the composition.
- the preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, ed. University of the Sciences in Philadelphia, Lippincott, Williams & Wilkins, Philadelphia, PA, 2005.
- physiologically acceptable carriers include saline, glycerol, DMSO, buffers such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICSTM (BASF; Florham Park, NJ).
- buffers such as phosphate buffer
- sequence identity indicates a quantitative measure of the degree of identity between two sequences of substantially equal length.
- the percent identity of two sequences, whether nucleic acid or amino acid sequences is the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100.
- An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be applied to amino acid sequences by using the scoring matrix developed by Dayhoff, Atlas of Protein Sequences and Structure, M. O. Dayhoff ed., 5 suppl.
- substitutions are conservative amino acid substitutions: limited to exchanges within members of group 1 : glycine, alanine, valine, leucine, and Isoleucine; group 2: serine, cysteine, threonine, and methionine; group 3 : proline; group 4: phenylalanine, tyrosine, and tryptophan; group 5: aspartate, glutamate, asparagine, and glutamine.
- nucleic acid and amino acid sequence identity are known in the art. Typically, such techniques include determining the nucleotide sequence of the mRNA for a gene and/or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this fashion. In general, identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity.
- CARs chimeric antigen receptors
- chimeric antigen receptors may refer to artificial T- cell receptors, chimeric T-cell receptors, or chimeric immunoreceptors, for example, and encompass engineered receptors that graft an artificial specificity onto a particular immune effector cell (e.g., a T cell or an NK cell).
- CARs comprise an intracellular domain, a transmembrane domain, and an extracellular domain comprising a tumor associated antigen binding region.
- CDR refers to the “complementarity determining regions” of the antibody which consist of the antigen binding loops as defined by Kabat E.A. et al., (1991) Sequences of proteins of immunological interest. NUT Publication 91-3242.
- An “increase” can refer to any change that results in a greater amount of a symptom, disease, composition, condition or activity.
- An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant.
- a “decrease” can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity.
- a substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance.
- a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed.
- a decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount.
- the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.
- the “fragments,” whether attached to other sequences or not, can include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the fragment is not significantly altered or impaired compared to the nonmodified peptide or protein. These modifications can provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the fragment must possess a bioactive property, such as inhibitory effect on NK cells.
- “Inhibit,” “inhibiting,” and “inhibition” mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.
- Inhibitors of expression or of activity are used to refer to inhibitory molecules, respectively, identified using in vitro and in vivo assays for expression or activity of a described target protein, e.g., ligands, antagonists, and their homologs and mimetics. Inhibitors are agents that, e.g., inhibit expression or bind to, partially or totally block stimulation or protease activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity of the described target protein, e.g., antagonists.
- a control sample untreated with inhibitors
- Inhibition of a described target protein is achieved when the activity value relative to the control is about 80%, optionally 50% or 25, 10%, 5% or 1%.
- prevent or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.
- the term “subject” refers to any individual who is the target of administration or treatment.
- the subject can be a vertebrate, for example, a mammal.
- the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline.
- the subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole.
- the subject can be a human or veterinary patient.
- patient refers to a subject under the treatment of a clinician, e.g., physician.
- the term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.
- treatment refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder.
- This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder.
- Treatment include the administration of a composition with the intent or purpose of partially or completely preventing, delaying, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing, mitigating, and/or reducing the intensity or frequency of one or more a diseases or conditions, a symptom of a disease or condition, or an underlying cause of a disease or condition. Treatments according to the invention may be applied preventively, prophylactically, pallatively or remedially.
- Prophylactic treatments are administered to a subject prior to onset (e.g., before obvious signs of cancer), during early onset (e.g., upon initial signs and symptoms of cancer), or after an established development of cancer. Prophylactic administration can occur for day(s) to years prior to the manifestation of symptoms of a disease or an infection. 69.
- various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.
- an engineered NK cell that is suppressed in the expression of a programmed death ligand-1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide.
- PD-L1 programmed death ligand-1
- an engineered NK cell that is suppressed in the expression of a PD- L1 polypeptide.
- the expression of PD-L1 can be suppressed using any means, including, for example, by a deletion of a PD-L1 gene or a fragment thereof (e.g., one or more exons of a PD-L1 gene), or by a siRNA or a shRNA that targets a PD-L1 polynucleotide.
- an engineered NK cell comprising a mutated PD-L1 polypeptide.
- mutation refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue.
- PD-L1 refers herein to a polypeptide that, in humans, is encoded by the CD274 gene.
- the PD-L1 polypeptide is that identified in one or more publicly available databases as follows: HGNC: 17635 NCBI, Entrez Gene: 29126, Ensembl: ENSG00000120217, OMIM®: 605402, UniProtKB/Swiss-Prot: Q9NZQ7.
- the PD-Ll polypeptide comprises the sequence of SEQ ID NO: 1, or a polypeptide sequence having at or greater than about 80%, about 85%, about 90%, about 95%, or about 98% homology with SEQ ID NO: 1, or a polypeptide comprising a portion of SEQ ID NO: 1.
- the PD-L1 polypeptide of SEQ ID NO: 1 may represent an immature or pre-processed form of mature PD-L1, and accordingly, included herein are mature or processed portions of the PD-L1 polypeptide in SEQ ID NO: 1.
- expression means generation of mRNAby transcription from nucleic acids such as genes, polynucleotides, and oligonucleotides, or generation of a protein or a polypeptide by transcription from mRNA.
- suppression of expression refers to a decrease of a transcription product or a translation product in a significant amount as compared with the case of no suppression.
- the suppression of the expression of a PD-L1 polypeptide herein shows, for example, a decrease of a transcription product or a translation product in an amount of about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, or about 99% or more in comparison to the amount of transcription product or the translation product in an NK cell (e.g., a primary NK cell, a naive NK cell, a NK cell line, a non-expanded NK, or expanded NK) compared with no suppression of PD-L1.
- an NK cell e.g., a primary NK cell, a naive NK cell, a NK cell line, a non-expanded NK, or expanded NK
- the expression of the PD-L1 polypeptide is suppressed using a gene editing tool (e.g., CRISPR/Cas endonuclease (Cas)9 system) or a nucleic acid (e.g., siRNA, shRNA) that targets a PD-L1 polynucleotide.
- a gene editing tool e.g., CRISPR/Cas endonuclease (Cas)9 system
- a nucleic acid e.g., siRNA, shRNA
- the expression of PD-L1 is suppressed using a method comprising introducing into the NK cell a CRISPR/Cas endonuclease (Cas)9 system with a CRISPR/Cas guide RNA, wherein the guide RNA targets the PD-L1 gene or a fragment thereof.
- a CRISPR/Cas endonuclease (Cas)9 system with a CRISPR/Cas guide RNA, wherein the guide RNA targets the PD-L1 gene or a fragment thereof.
- CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA- processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
- tracr trans-activating CRISPR
- tracr-mate sequence encompassing a “direct repeat” and a tracrRNA- processed partial direct repeat in the context of an endogenous CRISPR system
- guide sequence also referred to as a “spacer” in the context of an endogenous CRISPR system
- one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system.
- CRISPR systems are known in the art. See, e.g., U.S. Pat. No. 8,697,359, incorporated by reference herein in its entirety.
- guide RNA refers to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence.
- guide sequence refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the term “guide” or “spacer”.
- the gRNA described herein for targeting a PD-L1 polynucleotide comprises a sequence at least about 60% (for example, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%) identity to ATTTACTGTCACGGTTCCCA (SEQ ID NO: 2) or a fragment thereof.
- the gRNA comprises a sequence set forth in SEQ ID NO: 2.
- gRNA sequence of ATTTACTGTCACGGTTCCCA (SEQ ID NO: 2) is targeting the CD274 gene at locus chr9:+5457079-5457099.
- the NK cell described herein is a primary NK cell or a NK cell line. In some embodiments, the NK cell described herein is an expanded NK cell or a non-expanded NK cell. In some embodiments, the NK cell expanding composition comprises a feeder cell, an engineered PM particle, or an exosome. In some embodiments, the engineered NK cell disclosed herein is an expanded or activated NK cell. In some embodiments, the NK cell is expanded by contacting a naive NK cell with an NK cell expanding composition.
- an engineered NK cell wherein said engineered NK cell is suppressed in the expression of a programmed death ligand-1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide, wherein the NK cell is an expanded NK cell expanded by contacting a naive NK cell with an NK cell expanding composition (including, for example, feeder cells expressing membrane bound IL-21 (FC21), plasma membrane (PM) particles prepared from FC21 (PM21), or exosomes (EX) prepared from FC21 (EX21)).
- a programmed death ligand-1 PD-L1
- a mutated PD-L1 polypeptide wherein the NK cell is an expanded NK cell expanded by contacting a naive NK cell with an NK cell expanding composition (including, for example, feeder cells expressing membrane bound IL-21 (FC21), plasma membrane (PM) particles prepared from FC21 (PM21), or exosomes (EX) prepared from FC21 (EX21)).
- the membrane bound IL-21 expressing FC21 cells, PM21 particles, and EX21 exosomes can further comprise additional one or more NK cell effector agents, such as one or more activating agents, stimulatory peptides, cytokines, and/or adhesion molecules including, but not limited to 41BBL, IL-2, IL-12, IL-15, IL-18, MICA, LFA-1, 2B4, BCM/SLAMF2, CCR7 (for example, PM21 particle, EX21 exosome, or FC cell expressing 41BBL and membrane bound interleukin-21).
- at least one NK cell effector agent is IL-15 or IL- 21.
- the NK cell effector agents can be selected from IL-12, IL-15, and IL-18.
- the NK cell effector agent comprises IL-21 and/or 41BBL.
- activated NK cell refers to the NK cells that show upregulation of activating receptors (e.g., CD16, NKG2D, NKp30, and/or DNAM-1) and increases in cytotoxic function (e.g., increase in production of IFN-y, TNF, and/or granzymes).
- activating receptors e.g., CD16, NKG2D, NKp30, and/or DNAM-1
- increases in cytotoxic function e.g., increase in production of IFN-y, TNF, and/or granzymes.
- a pharmaceutical composition comprising the engineered NK cell of any preceding aspect.
- the engineered NK cell is suppressed in the expression of a programmed death ligand- 1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide.
- the pharmaceutical composition further comprises a chimeric antigen receptor (CAR) T cell or a CAR NK cell that targets PD-L1.
- the pharmaceutical composition further comprises an anti-PDLl antibody.
- the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
- the anti-PDLl antibody disclosed herein comprises a fragment crystallizable region (Fc region) that binds to an Fc receptor (e.g., CD16). Such bindings of the Fc region to the Fc receptor may trigger effector functions of the immune system (e.g., ADCC).
- Fc region fragment crystallizable region
- the anti-PDLl antibody lacks a Fc region or comprises a Fc region having a reduced affinity to an Fc receptor (e.g., CD16) relative to a reference control.
- the anti- PDL1 antibody comprises one or more mutations on the Fc region that reduce the binding affinity of the Fc region to the Fc receptor.
- anti-PD-Ll antibody refers to an antibody composition that binds to PD-L1 and reduces or inhibits the interaction between the bound PD-L1 and PD-1.
- the anti-PD-Ll antibody is a monoclonal antibody that is specific for PD-L1 and that reduces or inhibits the interaction between the bound PD-L1 and PD-1.
- Non-limiting examples of PD-L1 inhibitors are atezolizumab, avelumab and durvalumab.
- the atezolizumab is TECENTRIQ® or a bioequivalent.
- the atezolizumab has the Unique Ingredient Identifier (UNII) of the U.S.
- the atezolizumab is that described in U.S. Pat. No. 8217149, which is incorporated by reference in its entirety.
- the avelumab is BAVENCIO® or a bioequivalent.
- the avelumab has the Unique Ingredient Identifier (UNII) of the U.S. Food and Drug Administration of KXG2PJ551I.
- the avelumab is that described in U.S. Pat. App. Pub. No. 2014321917, which is incorporated by reference in its entirety.
- the durvalumab is IMFINZI® or a bioequivalent.
- the durvalumab has the Unique Ingredient Identifier (UNII) of the U.S. Food and Drug Administration of 28X28X9OKV.
- the durvalumab is that described in U.S. Pat. No. 8779108, which is incorporated by reference in its entirety.
- the anti-PDLl antibody used herein comprises one or more of avelumab, pembrolizumab, nivolumab, cemiplimab, atezolizumab, dostarlimab, or durvalumab.
- compositions according to the disclosure include compositions comprising Fc-bound feeder cells (FCs), compositions comprising Fc-bound engineered plasma membrane (PM) particles, and compositions comprising Fc-bound engineered exosomes.
- Fc-bound engineered PM particles include PM nanoparticles derived from Fc-bound feeder cells.
- Fc bound engineered exosomes include exosomes or other extracellular vesicles derived from Fc-bound feeder cells, as also described in further detail below. Alternatively, exosomes may be derived from other sources such as platelets and megakaryocytes.
- Fc-bound shall be understood as referring to the coupling of an Fc domain in an inverted orientation (i.e., the amino terminal end facing intracellularly) to the external surface of a feeder cell or engineered particle via a transmembrane peptide. This can be achieved using the Fc fusion peptides disclosed herein.
- a feeder cell composition comprising at least one Fc-bound feeder cell, i.e., a feeder cell comprising an Fc domain bound to an external surface of the feeder cell, as described in further detail below.
- a feeder cell can be genetically modified to express an Fc domain bound to an external surface of the feeder cell, i.e., to express an Fc fusion peptide as described further below.
- Another aspect of the disclosure provides an NK cell expanding composition free of feeder cells, comprising at least one Fc-bound engineered particle, i.e., an engineered particle comprising an Fc domain bound in inverted orientation to an external surface of the feeder cell.
- the feeder cells can be engineered to express a ligand that can be tagged with a humanized antibody.
- the at least one Fc-bound feeder cell optionally comprises at least one cell NK cell effector agent.
- an Fc-bound feeder cell comprises one cell NK cell effector which is IL- 15 or IL-21.
- Fc-bound feeder cells can comprise at least two or more different NK cell effector agents.
- Fc-bound engineered PM particles optionally comprise at least one cell NK cell effector agent.
- an Fc-bound engineered particle comprises one cell NK cell effector which is IL-15 or IL-21.
- Fc-bound engineered PM particles can comprise at least two or more different NK cell effector agents.
- the second NK cell effector agent can for example be 41BBL.
- NK cell effector agents can be selected from 41BBL, IL-15, IL-2, IL-12, IL-18, IL-21, MICA, UBLP, 2B4, LFA-1, a Notch ligand, ligands for NKp46, or BCM1/SLAMF2, TLR ligands, and NKG2D ligands, or a cytokine.
- at least one additional NK cell effector agent is IL- 15 or IL-21.
- the NK cell effector agents can be selected from IL-12, IL-15, and IL-18.
- the engineered feeder cells, engineered plasma membrane particles, engineered exosomes and uses thereof for expanding NK cells are those described in U. S. Patent Nos. 9,623,082, 11,260,076, and 10,300,089 and U.S. Publication Nos. 2019/0309070, 2020/0061115, and 2020/0237822, which are incorporated by reference in their entireties.
- NK cell feeder cells for use in the methods disclosed herein, and for use in making the PM particles and exosomes disclosed herein, can be either irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or nonirradiated autologous or allogeneic PBMCs, RPMI8866, HFWT, 721.221 or K562 cells as well as EBV-LCLs, other non-HLA or low-HLA expressing cell lines or patient derived primary tumors which can be used as a tumor vaccine.
- PBMCs peripheral blood mononuclear cells
- RPMI8866 HFWT
- 721.221 or K562 cells RPMI8866, HFWT, 721.221 or K562 cells
- EBV-LCLs other non-HLA or low-HLA expressing cell lines or patient derived primary tumors which can be used as a tumor vaccine.
- Fc-bound feeder cells can be prepared by transfecting or transducing feeder cells with any Fc fusion peptide as described herein, using standard transduction or transfection techniques well known in the art.
- cDNA vectors for Fc fusion peptides disclosed herein can be ligated into an expression plasmid, which allows expression in bacterial (E. coh), insect, or mammalian cells.
- the cDNA vector can be FLAG- or HIS-tagged.
- Suitable transfection methods include nucleofection (or electroporation), calcium phosphate-mediated transfection, cationic polymer transfection (e.g., DEAE-dextran or polyethylenimine), viral transduction, virosome transfection, virion transfection, liposome transfection, cationic liposome transfection, immunoliposome transfection, nonliposomal lipid transfection, dendrimer transfection, heat shock transfection, magnetofection, lipofection, gene gun delivery, impalefection, sonoporation, optical transfection, and proprietary agent-enhanced uptake of nucleic acids.
- nucleofection or electroporation
- calcium phosphate-mediated transfection e.g., calcium phosphate-mediated transfection
- cationic polymer transfection e.g., DEAE-dextran or polyethylenimine
- viral transduction virosome transfection, virion transfection, liposome transfection, cationic liposome transfection, immunolipo
- molecules can be introduced into a cell by microinjection.
- molecules can be injected into the cytoplasm or nuclei of the cells of interest.
- the amount of each molecule introduced into the cell can vary, but those skilled in the art are familiar with means for determining the appropriate amount.
- an Fc fusion peptide and one or more membrane bound NK cell effector agents can be introduced to a feeder cell at the same time.
- feeder cells once having been transfected or transduced with an Fc fusion peptide can be further transfected with membrane bound NK cell effector agents such as IL-15 and/or IL-21 and/or 41BBL and/or infected as an EBV-LCL and/or other NK cell effector agent(s).
- feeder cells can be simultaneously transfected or transduced with an Fc fusion peptide and membrane bound NK cell effector agents such as IL- 15 and/or IL-21 and/or 41 BBL and/or EBV-LCL and/or other NK cell effector agent(s).
- NK cell effector agents such as IL- 15 and/or IL-21 and/or 41 BBL and/or EBV-LCL and/or other NK cell effector agent(s).
- feeder cells previously transfected or transduced and expressing membrane bound NK cell effector agents such as IL-15 and/or IL-21 and/or 41BBL and/or infected as an EBV-LCL and/or other NK cell effector agent(s)
- Fc fusion peptide e.g., IL-15 and/or IL-21 and/or 41BBL and/or infected as an EBV-LCL and/or other NK cell effector agent(s)
- the cell is maintained under conditions appropriate for cell growth and/or maintenance. Suitable cell culture conditions are well known in the art and are described, for example, in Santiago et al., Proc. Natl. Acad. Sci. USA, 2008, 105:5809-5814; Moehle et al. Proc. Natl. Acad. Sci. USA, 2007, 104:3055-3060; Urnov et al., Nature, 2005, 435:646-651; and Lombardo et al., Nat. Biotechnol., 2007, 25: 1298-1306.
- Routine optimization may be used, in all cases, to determine the best techniques for a particular cell type.
- Fc-bound feeder cells can be used in cell culture to stimulate NK cells directly, or can be used to prepare PM particles or exosomes derived from the feeder cells.
- Fc-bound engineered PM particles include Fc-bound PM particles, which can be prepared from Fc-bound NK cell feeder cells using well known methods. PM particles are vesicles made from the plasma membrane of a cell or artificially made (e.g., liposomes). A PM particle can contain a lipid bilayer or simply a single layer of lipids. A PM particle can be prepared in single lamellar, multi- lamellar, or inverted form. PM particles can be prepared from Fc-bound feeder cells as described herein, using known plasma membrane preparation protocols or protocols for preparing liposomes such as those described in U.S. Pat. No. 9,623,082, the entire disclosure of which is herein incorporated by reference. In certain aspects, PM particles as disclosed herein range in average diameter from about 10 to about 1000 nm. In certain aspects, PM particles as disclosed herein range in average diameter from about 170 to about 300 nm.
- Fc-bound exosomes as disclosed herein can be prepared from exosome-secreting cells, which can be prepared from Fc-bound NK cell feeder cells using well known methods, wherein the exosome is an extracellular product of exosome-secreting cells, as described in United States Pat. App. Pub. No. 20170333479, the entire disclosure of which is herein incorporated by reference.
- Exosomes comprise lipids and proteins and the identity of the proteins found in a particular exosome is dependent on the cell(s) that produced them.
- Exosomes disclosed herein comprise an Fc fusion peptide as disclosed herein (i.e., are Fc-bound), and optionally one or more stimulatory peptides (NK cell effector agents) present in the exosome membrane.
- Exosomes can be produced for example from cell lines engineered for improved formation or release of exosomes. Such cell lines include, but are not limited to, Fc-bound cell lines as described above in Section 1(a).
- Non-limiting cell lines are Fc-bound K562-mbl5-41BBL and Fc-bound K562.
- exosomes as disclosed herein range in average diameter from about 30 to about 100 nm, or to about 160 nm. In one aspect, exosomes average about 60-80 nm in diameter.
- exosomes can be more readily adapted to uses where a smaller size is preferable.
- exosomes may be preferred in applications requiring diffusion through physiological barriers, enhanced biodistribution through tissue compartments, or intravenous injections.
- the NK cell expanding composition disclosed herein is combined with a cell medium solution comprising at least one soluble media component such as a cytokine, IL- 2, IL-12, IL-15, IL-18, IL-21, NAM, ascorbate or any combination thereof.
- a cell medium solution comprising at least one soluble media component such as a cytokine, IL- 2, IL-12, IL-15, IL-18, IL-21, NAM, ascorbate or any combination thereof.
- NK cell expanding compositions used herein and the methods for NK cell expansion described herein are those described in U.S. Pat. Pub. No. 20200237822, the entire disclosure of which is herein incorporated by reference.
- NK cells must lack any expression of PD-L1 on their surface or have a mutated PD-L1 that has a mutation at the binding site of the anti-PD-Ll antibody to prevent fratricide (self-killing).
- the avelumab-binding epitope region on PD-L1 is mainly constituted by the C strand, C' strand, F strand, G strand and CC' loop of PD-L1.
- the binding involves hydrogen bond interactions between residues (Y52, S54, G55 of HCDR2 and G102 and V104 of HCDR3) of the scFv and residues (Y56, E58, N63, V76, R113 and SI 17) of hPD-Ll (Accession No in PDB: 5GRJ).
- the present disclosure seeks to treat cancers and improve the efficacy of NK cell therapy only or in combination with anti-PD-Ll inhibitors. Accordingly, disclosed herein is a method of treating, decreasing, inhibiting, reducing, ameliorating, and/or preventing a cancer, metastasis, or an infectious disease in a subject comprising administering to the subject a therapeutically effective amount of the engineered NK cell disclosed herein or the pharmaceutical composition disclosed herein.
- a method of treating, decreasing, inhibiting, reducing, ameliorating, and/or preventing a cancer, metastasis, or an infectious disease in a subject comprising administering to the subject a therapeutically effective amount of a composition comprising an engineered NK cell, wherein said engineered NK cell is suppressed in the expression of a programmed death ligand-1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide.
- the composition further comprises an anti-PD-Ll antibody and/or a chimeric antigen receptor (CAR) T cell or a CAR NK cell that targets PD-L1.
- CAR chimeric antigen receptor
- the expression of the PD-L1 polypeptide is suppressed using a gene editing tool (e.g., CRISPR/Cas endonuclease (Cas)9 system) or a nucleic acid (e.g., an siRNA or an shRNA) that targets a PD-L1 polynucleotide.
- a gene editing tool e.g., CRISPR/Cas endonuclease (Cas)9 system
- a nucleic acid e.g., an siRNA or an shRNA
- the engineered NK cell described herein is a primary NK cell or a NK cell line. In some embodiments, the engineered NK cell described herein is an expanded NK cell or a non-expanded NK cell. In some embodiments, the NK cell expanding composition comprises a feeder cell, an engineered PM particle, or an exosome. In some embodiments, the NK cell expanding composition further comprises an NK cell effector agent.
- the engineered NK cell disclosed herein is an expanded or activated NK cell.
- the NK cell is expanded by contacting a naive NK cell with an NK cell expanding composition.
- the activation and/or expansion of NK cell occurs in vitro, ex vivo, or in vivo.
- the expanding composition comprises a feeder cell, an engineered PM particle, or an exosome.
- the activation or expansion of NK cell can occur between about 1 and about 21 days (e.g., between about 1 and about 7, between about 1 and about 14, between about 7 and about 14, between about 1 and about 10, or between about 5 and 14 days) prior to the administration of NK cell to the subject.
- the activation or expansion ofNK cell occurs about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days prior to the administration of NK cell to the subject.
- Stimulation with membrane bound IL-21 was found to stimulate continuous propagation of NK cells over countless generations allowing for continuous expansion of engineered NK cells provided that the culture is periodically replenished with fresh stimulatory cells.
- Engineered NK cells that are infused into the patient may stop dividing due to the lack of continued stimulation by the feeders.
- NK cell activating agents and stimulatory peptides include, but are not limited to, 41BBL, IL-2, IL-12, IL-15, IL-21, IL-18, MICA, LFA-1, 2B4, BCM/SLAMF2, CCR7 and/or other homing receptors.
- cytokines include, but are not limited to, IL-2, IL- 12, IL-21, and IL-18.
- adhesion molecules include, but are not limited to LFA-1, MICA, BCM/SLAMF2.
- FC plasma membrane particle Feeder cells
- PM particle PM particle
- EX exosomes
- the membrane bound IL-21 expressing FC21 cells, PM21 particles, and EX21 exosomes can further comprise additional one or more activating agents, stimulatory peptides, cytokines, and/or adhesion molecules including, but not limited to 41BBL, IL-2, IL-12, IL-18, MICA, LFA-1, 2B4, BCM/SLAMF2, CCR7 (for example, PM21 particle, EX21 exosome, or FC cell expressing 41BBL and membrane bound interleukin-21).
- NK cells such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- the engineered NK cell is suppressed in the expression of a programmed death ligand- 1 (PD-L1) polypeptide or comprises a mutated PD-L1 polypeptide.
- PD-L1 programmed death ligand- 1
- the plasma membrane particle or exosome used in the disclosed methods can be purified from NK cell stimulating feeder cells.
- NK cell stimulating feeder cells for use in the claimed methods and for use in making the plasma membrane particles (for example PM21 particles) and exosomes (for example FC21 exosomes) disclosed herein can be either irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or nonirradiated autologous or PBMCs, RPMI8866, NK-92, NK-92MI, NK-YTS, NK, NKL, KIL, KIL C.2, NK 3.3, NK-YS, HFWT, K562 cells, NK cells transfected with membrane bound IL- 15 and 41BBL (such as, for example, NK-92, NK-92MI, NK-YTS, NK, NKL, KIL, KIL C.2, NK 3.3, NK-YS, HFWT, and/or K
- the NK cell feeder cells can be NK-92, NK-92MI, NK- YTS, NK, NKL, KIL, KIL C.2, NK 3.3, NK-YS, HFWT, and/or K562 cells transfected with membrane bound IL-21 and 41BBL or NK-92, NK-92MI, NK-YTS, NK, NKL, KIL, KIL C.2, NK 3.3, NK-YS, HFWT, and/or K562 cells transfected with membrane bound IL-15 and 41BBL.
- the activation and/or expansion of the engineered NK cells disclosed herein can occur ex vivo prior to administration of the NK cells (such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide), or in vitro concurrently with or following administration of the engineered NK cells (such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide).
- the engineered NK cells can be expanded and/or activated ex vivo prior to administration by contacting the engineered NK cells (such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) with PM particles (e.g., PM21 particles), exosomes (e.g., EX21 exosomes), or feeder cells for between 1 and 28 days prior and more preferably 1 and 21 days prior to administration of the engineered NK cells.
- PM particles e.g., PM21 particles
- exosomes e.g., EX21 exosomes
- feeder cells for between 1 and 28 days prior and more preferably 1 and 21 days prior to administration of the engineered NK cells.
- the engineered NK cells (such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) can be contacted with PM particles (e.g., PM21 particles), exosomes (e.g., EX21 exosomes), or feeder cells for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days prior to administration of the engineered NK cells (such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide).
- PM particles e.g., PM21 particles
- exosomes e.g., EX21 exosomes
- feeder cells for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days prior to administration of the engineered NK cells (such as,
- the benefit of the activation and/or expansion of the NK cells does not stop with the administration of the NK cells (such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) to the subject.
- NK cells such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- NK cells can occur in vivo through direct administration of PM particles (e.g., PM21 particles) and/or exosomes (e.g., EX21 exosomes) to the subject.
- PM particles e.g., PM21 particles
- exosomes e.g., EX21 exosomes
- NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- an anti-PDLl antibody wherein said method further comprises the administration of PM particles (e.g., PM21 particles) and/or exosomes (e.g., EX21 exosomes) directly to the subject.
- PM particles e.g., PM21 particles
- exosomes e.g., EX21 exosomes
- PM particles e.g., PM21 particles
- exosomes e.g., EX21 exosomes
- NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- PM particles e.g., PM21 particles
- exosomes e.g., EX21 exosomes
- NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide.
- engineered NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- engineered NK cells can occur through exposure of the engineered NK cells (such as, for example, such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) to one or more of IL-12, IL-15, IL-21 and/or IL-18.
- This exposure can occur prior to administration of the engineered NK cells (such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) to the subject, concurrently with, and/or after administration of the engineered NK cells to the subj ect.
- the one or more of IL-12, IL-15, IL-21, and/or IL-18 can be administered to the engineered NK cells (such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) during the ex vivo culture of the NK cells.
- IL-12, IL-15, IL-21, and IL-18 can also be obtained via administration of IL-15, IL- 12, IL-21, and IL- 18 directly to the subject prior to, concurrently with, and even continuing after the administration of the engineered NK cells (such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) to the subject.
- the engineered NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- an anti-PDLl antibody further comprising administering to the subject one or more of IL-12, IL-15, IL-21, and/or IL-18 wherein the one or more of IL-12, IL-15, IL-21, and/or IL-18 is administered prior to, concurrently with, and/or following administration of the engineered NK cells (such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) to the subject.
- the engineered NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- PD-L1 is not necessarily present in all cancers and needs to be present for anti-PDLl therapy to be effective.
- PDL1 needs to be induced which is accomplished in the present methods through the administration of memory-like NK cells, or PM21, or FC21 NK cells, or any types of NK cell derived from various sources or activation methods which express high amounts of IFN-y in response to sensing a tumor and thereby induce PD-L1 expression on the tumor.
- the engineered NK cells (such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) can be administered concurrently with the anti-PDLl antibody.
- the engineered NK cells can be administered between 1 and 21 days and more preferably 1 and 14 days prior to administration of the anti-PDLl antibody.
- NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- an anti-PDLl antibody wherein the NK cells are administered 1, 2, 3, 4, 5, 6, 7, 8 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 prior to administration of the anti-PD-Ll antibody.
- the engineered NK cells can be administered concurrently with chimeric antigen receptor (CAR) T cells or CAR NK cells that target PD-L1.
- CAR chimeric antigen receptor
- the engineered NK cells can be administered between 1 and 21 days and more preferably 1 and 14 days prior to administration of the CAR T cells/CAR NK cells.
- NK cells such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide
- CAR T cells/CAR NK cells wherein the NK cells are administered 1, 2, 3, 4, 5, 6, 7, 8 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 prior to administration of the CAR T cells/CAR NK cells.
- the engineered NK cells (such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) and chimeric antigen receptor (CAR) T cell or a CAR NK cell that target PD-L1 are administered concurrently.
- CAR chimeric antigen receptor
- the source of NK cells can be critical to the efficacy of the therapy as rejection of transferred NK cells would thwart the therapeutic process. Accordingly, it is contemplated herein that the engineered NK cells (such as, for example, such as, for example, engineered NK cell that is suppressed in the expression of PD-L1 or comprises a mutated PD-L1 polypeptide) were derived from an autologous, haploidentical, or allogeneic donor source of NK cells.
- the NK cells may also be derived umbilical cord blood, placental blood, or from various types of stem cells, or from NK cell like cell lines such as NK92.
- the disclosed compositions and methods can be used to treat any disease where uncontrolled cellular proliferation occurs such as cancers.
- a representative but non-limiting list of cancers that the disclosed compositions can be used to treat is the following: lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin’s Disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of head and neck, kidney cancer, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma/glioblastoma, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx, and lung, colon cancer, cervical cancer, cervical carcinoma, breast cancer, and epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, large bowel cancer, hem
- Compounds and methods disclosed herein may also be used for the treatment of precancer conditions such as cervical and anal dysplasias, other dysplasias, severe dysplasias, hyperplasias, atypical hyperplasias, and neoplasias.
- the disclosed methods of inhibiting, reducing, and/or preventing cancer metastasis and/or recurrence can comprise the administration of any anti-cancer agent known in the art including, but not limited to Abemaciclib, Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Afatinib Dimaleate, Afinitor (Everolimus), Akynzeo (Netupitant and Palonosetron Hydrochloride), Aldara (Imiquimod), Aldesleukin, Alecensa (Alectinib), Alectinib, Alemtuzumab
- chemotherapeutics that are PD1/PDL1 blockade inhibitors (such as, for example, lambrolizumab, nivolumab, pembrolizumab, pidilizumab, BMS-936559, Atezolizumab, Durvalumab, or Avelumab). It is also intended herein that the disclosed uses of the disclosed compositions and/or an engineered NK cell population for inhibiting, reducing, and/or preventing cancer metastasis and/or recurrence can comprise use in combination the use of any anti-cancer agent known in the art including, but not limited to those agents listed above.
- the engineered NK cells and uses of the cells all as disclosed herein are for treating an infectious disease caused by a viral infection, wherein the viral infection comprises an infection of Herpes Simplex virus- 1, Herpes Simplex virus-2, Varicella-Zoster virus, Epstein- Barr virus, Cytomegalovirus, Human Herpes virus-6, Variola virus, Vesicular stomatitis virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus, Rhinovirus, Coronavirus, Influenza virus A, Influenza virus B, Measles virus, Polyomavirus, Human Papillomavirus, Respiratory syncytial virus, Adenovirus, Coxsackie virus, Dengue virus, Mumps virus, Poliovirus, Rabies virus, Rous sarcoma virus, Reovirus, Yellow fever virus, Zika virus, Ebola virus, Marburg virus, Lassa fever virus, Eastern
- the additional therapeutic agent can be an antiviral agent selected from but not limited to a 5-substituted 2- deoxyuridine analog, a nucleoside analogs, a (nonnucleoside) pyrophosphate analog, a nucleoside reverse transcriptase (RT) inhibitors (NRTI), a nonnucleoside reverse transcriptase inhibitor (NNRTI), a protease inhibitor (PI), and integrase inhibitor, an entry inhibitor, and acyclic guanosine analog, an acyclic nucleoside phosphonate (ANP) analog, a hepatitis C virus (HCV) NS5 A and NS5B inhibitor, and influenza virus inhibitor, an immunostimulator, an interferon, an oligonucleotide, and an antimitotic inhibitor.
- a nucleoside analogs a (nonnucleoside) pyrophosphate analog
- RT nucleoside reverse transcriptase
- NRTI non
- Non-limiting examples of antiviral agents are acyclovir, famciclovir, valacyclovir, penciclovir, ganciclovir, ritonavir, lopinavir, saquinavir, and the like; cimetidine; ranitidine; captopril; metformin; bupropion; fexofenadine; oxcarbazepine; leveteracetam; tramadol; or any of their isomers tautomers, analogs, polymorphs, solvates, derivatives, or pharmaceutically acceptable salts.
- the engineered NK cells and uses of the cells all as disclosed herein are for treating infectious disease caused by a bacterial infection, wherein the bacterial infection comprises an infection of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium bovis strain BCG, BCG substrains, Mycobacterium avium, Mycobacterium intracellular, Mycobacterium africanum, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium avium subspecies paratuberculosis, Nocardia asteroides, other Nocardia species, Legionella pneumophila, other Legionella species, Acetinobacter baumanii, Salmonella typhi, Salmonella enterica, other Salmonella species, Shigella boydii, Shigella dysenteriae, Shigella sonnei, Shigella flexneri, other Shigella species, Yersinia pestis, Pasteurella haemolytica
- the engineered NK cells and uses of the cells all as disclosed herein are for treating infectious disease caused by a fungal infection, wherein the fungal infection comprises an infection of Candida albicans, Cryptococcus neoformans, Histoplama capsulatum, Aspergillus fumigatus, Coccidiodes immitis, Paracoccidiodes brasiliensis, Blastomyces dermitidis, Pneumocystis carinii, Penicillium marneffi, or Alternaria alternate.
- the fungal infection comprises an infection of Candida albicans, Cryptococcus neoformans, Histoplama capsulatum, Aspergillus fumigatus, Coccidiodes immitis, Paracoccidiodes brasiliensis, Blastomyces dermitidis, Pneumocystis carinii, Penicillium marneffi, or Alternaria alternate.
- the engineered NK cells and uses of the cells all as disclosed herein are for treating infectious disease caused by a parasitic infection, wherein the parasitic infection comprises an infection of Toxoplasma gondii, Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, other Plasmodium species, Entamoeba histolytica, Naegleria fowleri, Rhinosporidium seeberi, Giardia lamblia, Enterobius vermicularis, Enterobius gregorii, Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Cryptosporidium spp., Trypanosoma brucei, Trypanosoma cruzi, Leishmania major, other Leishmania species, Diphyllobothrium latum, Hymenolepis nana, Hymenolepis diminuta, Echinococcus granulosus, Echinococcus granulos
- the additional therapeutic agent can be an antibiotic agent selected from but not limited to penicillin, tetracycline, cephalosporin, lincomycin, a macrolide, a sulfonamide, a glycopeptide, an aminoglycosides, and a carbapenem.
- antibiotic agent selected from but not limited to penicillin, tetracycline, cephalosporin, lincomycin, a macrolide, a sulfonamide, a glycopeptide, an aminoglycosides, and a carbapenem.
- antibacterial agents are amoxicillin, doxycycline, cephalexin, ciprofloxacin, clindamycin, metronidazole, azithromycin, sulfamethoxazole and trimethoprim, clavulanate, and levofloxacin.
- the engineered NK cells administered or used in the method or uses of any preceding aspect are formulated in a pharmaceutically acceptable carrier and a pharmaceutically acceptable excipient.
- compositions can be practiced prior to or following the onset of the cancer, metastatic condition, or infection, to treat, prevent, inhibit, and/or reduce the muscular disease.
- the disclosed methods of treating cancer utilize anti-PDLl antibodies in combination with PM21, EX21, or FC21 XM engineered NK cells and/or PM21 particles and/or EX21 exosomes.
- anti-cancer therapies comprising PM21, EX21, orFC21 XM engineered NK cells and an anti-PDLl antibody.
- anti-cancer therapies comprising PM21, EX21, or FC21 XM engineered NK cells and an anti-PD-Ll antibody further comprising PM21 particles and/or EX21 exosomes.
- anti-cancer therapies comprising PM21 particles and/or EX21 exosomes and an anti-PD-Ll antibody. Additionally, any of the above disclosed anti-cancer therapies can comprise one or more of IL-12, IL-15, and IL-18.
- the disclosed therapies can be provided in a kit comprising one or more anti-PDLl antibodies and one or more engineered NK cells.
- the therapy containing kit may also comprise one or more PM21 particles, EX21 exosomes, and/or FC21 feeder cells; and/or one or more of IL-12, IL-15, and IL-18.
- the anti-cancer therapies and methods of treating a cancer disclosed herein comprise the use of an anti-PD-Ll antibody. It is understood and herein contemplated that the disclosed methods and therapies can comprise and/or utilize any known anti-PD-Ll antibody, and in particular, any previously shown to have a therapeutic effect including, but not limited to atezolizumab by Genentech.
- antibodies is used herein in a broad sense and includes both polyclonal and monoclonal antibodies. In addition to intact immunoglobulin molecules, also included in the term “antibodies” are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or fragments thereof, as long as they are chosen for their ability to interact with PDL1 such that PDL1 is inhibited from interacting with PD1.
- the antibodies can be tested for their desired activity using the in vitro assays described herein, or by analogous methods, after which their in vivo therapeutic and/or prophylactic activities are tested according to known clinical testing methods.
- IgA human immunoglobulins
- IgD immunoglobulins
- IgE immunoglobulins
- IgG immunoglobulins
- the term “monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules.
- the monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity.
- the disclosed monoclonal antibodies can be made using any procedure which produces mono clonal antibodies.
- disclosed monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975).
- a hybridoma method a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
- the lymphocytes may be immunized in vitro.
- In vitro methods are also suitable for preparing monovalent antibodies.
- Digestion of antibodies to produce fragments thereof, particularly, Fab fragments can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566.
- Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.
- antibody or fragments thereof encompasses chimeric antibodies and hybrid antibodies, with dual or multiple antigen or epitope specificities, and fragments, such as F(ab’)2, Fab’, Fab, Fv, sFv, and the like, including hybrid fragments.
- fragments of the antibodies that retain the ability to bind their specific antigens are provided.
- fragments of antibodies which maintain PDL1 binding activity are included within the meaning of the term “antibody or fragment thereof.”
- Such antibodies and fragments can be made by techniques known in the art and can be screened for specificity and activity according to the methods set forth in the Examples and in general methods for producing antibodies and screening antibodies for specificity and activity (See Harlow and Lane. Antibodies, A Laboratory Manual. Cold Spring Harbor Publications, New York, (1988)).
- antibody or fragments thereof conjugates of antibody fragments and antigen binding proteins (single chain antibodies).
- the fragments can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove/add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc.
- the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen. Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide.
- antibody can also refer to a human antibody and/or a humanized antibody.
- Many non-human antibodies e.g., those derived from mice, rats, or rabbits
- are naturally antigenic in humans and thus can give rise to undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in the methods serves to lessen the chance that an antibody administered to a human will evoke an undesirable immune response.
- the disclosed human antibodies can be prepared using any technique.
- the disclosed human antibodies can also be obtained from transgenic animals.
- transgenic, mutant mice that are capable of producing a full repertoire of human antibodies, in response to immunization, have been described (see, e.g., Jakobovits et al., Proc. Natl. Acad. Set. USA, 90:2551-255 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993)).
- the homozygous deletion of the antibody heavy chain joining region (1(H)) gene in these chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production, and the successful transfer of the human germ-line antibody gene array into such germ-line mutant mice results in the production of human antibodies upon antigen challenge.
- Antibodies having the desired activity are selected using Env-CD4-co-receptor complexes as described herein.
- Antibody humanization techniques generally involve the use of recombinant DNA technology to manipulate the DNA sequence encoding one or more polypeptide chains of an antibody molecule.
- a humanized form of a non-human antibody is a chimeric antibody or antibody chain (or a fragment thereof, such as an sFv, Fv, Fab, Fab’, F(ab’)2, or other antigen-binding portion of an antibody) which contains a portion of an antigen binding site from a non-human (donor) antibody integrated into the framework of a human (recipient) antibody.
- a humanized antibody residues from one or more complementarity determining regions (CDRs) of a recipient (human) antibody molecule are replaced by residues from one or more CDRs of a donor (non-human) antibody molecule that is known to have desired antigen binding characteristics (e.g., a certain level of specificity and affinity for the target antigen).
- CDRs complementarity determining regions
- donor non-human antibody molecule that is known to have desired antigen binding characteristics
- Fv framework (FR) residues of the human antibody are replaced by corresponding non-human residues.
- Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- Humanized antibodies generally contain at least a portion of an antibody constant region (Fc), typically that of a human antibody (Jones et al., Nature, 321 :522-525 (1986), Reichmann et al., Nature, 332:323-327 (1988), and Presta, Curr. Opin. Struct. Biol., 2:593-596 (1992)).
- Fc antibody constant region
- humanized antibodies can be generated according to the methods of Winter and co-workers (Jones et al., Nature, 321 :522-525 (1986), Riechmann et al., Nature, 332:323-327 (1988), Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
- Methods that can be used to produce humanized antibodies are also described in U.S. Patent No. 4,816,567 (Cabilly et al.), U.S. Patent No.
- nucleic acid approaches for antibody delivery also exist.
- the broadly neutralizing anti-PDLl antibodies and antibody fragments can also be administered to patients or subjects as a nucleic acid preparation (e.g., DNA or RNA) that encodes the antibody or antibody fragment, such that the patient's or subject's own cells take up the nucleic acid and produce and secrete the encoded antibody or antibody fragment.
- the delivery of the nucleic acid can be by any means, as disclosed herein, for example.
- compositions can also be administered in vivo in a pharmaceutically acceptable carrier.
- pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
- the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
- compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, including topical intranasal administration or administration by inhalant.
- topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector.
- Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
- compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
- Parenteral administration of the composition is generally characterized by injection.
- Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
- the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol.
- Vehicles such as "stealth” and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)). a) Pharmaceutically Acceptable Carriers
- compositions including antibodies, can be used therapeutically in combination with a pharmaceutically acceptable carrier.
- Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
- an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic.
- the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution.
- the pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5.
- Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered.
- compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
- compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like. 149.
- the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection.
- the disclosed antibodies can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally.
- Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable..
- compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
- inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
- organic acids such as formic acid, acetic acid, propionic acid, glyco
- Effective dosages and schedules for administering the compositions may be determined empirically, and making such determinations is within the skill in the art.
- the dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms of the disorder are effected.
- the dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like.
- the dosage will vary with the age, condition, sex and extent of the disease in the patient, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art.
- the dosage can be adjusted by the individual physician in the event of any counterindications.
- Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.
- Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
- guidance in selecting appropriate doses for antibodies can be found in the literature on therapeutic uses of antibodies, e.g., Handbook of Monoclonal Antibodies, Ferrone et al., eds., Noges Publications, Park Ridge, N.J., (1985) ch. 22 and pp. 303-357; Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., eds., Raven Press, New York (1977) pp. 365-389.
- a typical daily dosage of the antibody used alone might range from about 1 pg/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above.
- a composition such as an antibody
- the efficacy of the therapeutic antibody can be assessed in various ways well known to the skilled practitioner. For instance, one of ordinary skill in the art will understand that a composition, such as an antibody, disclosed herein is efficacious in treating or inhibiting a cancer in a subject by observing that the composition reduces tumor size or the rate of metastasis.
- NK cell therapy is a growing and gaining acceptance as an effective method to treat cancer and potentially other diseases.
- the hurdles in the past that stifled development and success of NK cell therapy were the lack of a way to produce high doses of viable and healthy NK cells with high cytotoxicity toward tumors, and good persistence to have therapeutic efficacy.
- the present invention proposes the combined use of adoptive NK cells modified to remove expression of PD-L1 on their surface together with an anti-PD-Ll antibody to bind PD-L1 expressing tumors and engage ADCC by NK cells.
- NK cells secrete IFNy when activated by a malignant or virally compromised cell which then induces tumor cells to express PD-L1.
- the expression of PD-L1 on tumors is part of an immune-suppressive mechanism to evade the immune system, but the disclosed herein exploits this mechanism for treatment. With the relatively tumor specific expression of PD-L1, tumors can then be targeted by an anti-PDLl antibody. Thus, this normally immune suppressive mechanism can be exploited to better engage NK cells by ADCC through binding of the Fc region on the PD-L1 antibody to CD16 on NK cells.
- PD-L1 on tumors can be also targeted with use of CAR-NK or CAR-T cells.
- NK cells must lack any expression of PD-L1 on their surface to prevent fratricide (self-killing).
- This study found that PM21-NK cells don't express PD-L1 but can induce its expression after activation with cytokines or exposure to SKOV-3 ovarian cancer spheroids.
- NK cells may express PD-L1 which, in combination with Fc-competent antibodies, can lead to their fratricide.
- NK cells with downregulated or knocked- out expression of PD-L,1 such as PD-L1 KO PM21-NK cells are better cells for use in combination with anti-PD-Ll antibodies.
- NK cell self-killing can occur diminishing the efficacy of the treatment.
- the coadministration of adoptive PD-L1 KO NK cells and a CD16 binding anti-PDLl mAB allows for induction of PDL1 on tumor cells and ADCC engagement by NK cells without self-killing.
- PD-L1 targeting PD-L1 KO NK cells should kill tumors better without self-killing.
- Immunotherapeutic strategies such as checkpoint blockade of PD-1/PD-L1 have shown success in the treatment of cancer and have become a focal point of immunotherapy in oncology. Recent studies have highlighted the importance of Natural Killer (NK) cells in the success of these immunotherapies and adoptive NK cellular therapy is being explored to enhance response to these immunotherapeutic treatments.
- Antibodies targeting PD-L1 are mostly Fc silent but some, such as Avelumab, can engage FcyR (CD16) receptor on NK cells resulting in killing cancer cells via antibody-dependent cellular cytotoxicity (ADCC).
- ADCC antibody-dependent cellular cytotoxicity
- PM21 -particle expanded NK (PM21-NK) cells are an optimal NK cell product to consider for this combination strategy as these NK cells lack PD- L1 but can induce PD-L1 on tumors cells.
- PD-L1 can be induced on NK cells. This could potentially lead to fratricide of NK cells in the presence of Fc-competent, PD-L1 targeting antibodies and mitigate their cytotoxic response.
- This study determined if PD-L1 can be induced on PM21-NK cells and what effect PD-L1 engagement had on their activity and potential for fratricide in both WT and PD-L1 knockout PM21-NK cells.
- PM21-NK cells were found to express no to very low levels of PD-L1 after exposure to various cancer cell line monolayers or K562 co-culture. Exposure to SKOV-3 spheroids or to a cytokine combination of IL 12, IL 15, and IL 18 led to a significant induction in PD-L1 in WT PM21-NK cells that was not seen in PD-L1 knockout cells. The effect of this induction in vitro and in vivo will be presented and the potential for fratricide is being explored in both the context of WT PM21-NK cells and PD-L1 knockout cells. This study will examine the utility of PD-L1 knockout PM21-NK cells as a cell product for therapeutic use in combination with PD-L1 targeting antibodies.
- Figure 9 shows knockout of PD-L1 by electroporating PM21-NK cells with a CRISPR/Cas9 RNP complex with gRNA targeting PD-L1.
- PD-L1 expression measured after cytokine exposure.
- Anti-PD-Ll antibodies ADCC-competent anti-PD-LL Avelumab; SelleckChem. Non-ADCC-competent anti-PD-LL UltraLEAF anti-PD-Ll; Biolegend.
- SKOV-3-GFPLuc-bearing NSG mice were treated with PM21-NK cells (5xl0 6 cells i.p. injection day 0, with or without ADCC-competent anti-PD-Ll treatment (10 mg/kg day 0, 5, 9). Compared to NK cell alone, combination with anti-PD-Ll treatment resulted in decreased tumor control (A: luminescence on day 7 posttreatment) and lower NK cells survival (B: recovery from the i.p. cavity on day 13). ( Figure 13.)
- NK cell fratricide was determined after incubation with non-competent or ADCC- competent anti-PD-Ll .
- PD-L1 KO PM21-NK cells (red) had significantly more viable NK cells after incubation with ADCC-competent anti-PD-Ll compared to WT (blue).
- N 3 donor in triplicate.
- Figure 14. 171.
- SKOV-3-GFPLuc-bearing NSG mice were treated with PDL1 KO PM21-NK cells (5xl0 6 cells i.p. injection day 0) with or without ADCC-competent anti-PD-Ll treatment (10 mg/kg day 0, 5, 9).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Endocrinology (AREA)
- Mycology (AREA)
- General Engineering & Computer Science (AREA)
- Developmental Biology & Embryology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
Claims
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/855,147 US20250249097A1 (en) | 2022-04-08 | 2023-04-10 | Combination therapy comprising pd-l1 knockout nk cell and anti-pdl1 antibodies |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263329078P | 2022-04-08 | 2022-04-08 | |
| US63/329,078 | 2022-04-08 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023197014A2 true WO2023197014A2 (en) | 2023-10-12 |
| WO2023197014A3 WO2023197014A3 (en) | 2023-11-23 |
Family
ID=88243877
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/065594 Ceased WO2023197014A2 (en) | 2022-04-08 | 2023-04-10 | Combination therapy comprising pd-l1 knockout nk cell and anti-pdl1 antibodies |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20250249097A1 (en) |
| WO (1) | WO2023197014A2 (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040241854A1 (en) * | 2002-08-05 | 2004-12-02 | Davidson Beverly L. | siRNA-mediated gene silencing |
| WO2016134284A1 (en) * | 2015-02-19 | 2016-08-25 | University Of Florida Research Foundation, Inc. | Chimeric antigen receptors and uses thereof |
-
2023
- 2023-04-10 WO PCT/US2023/065594 patent/WO2023197014A2/en not_active Ceased
- 2023-04-10 US US18/855,147 patent/US20250249097A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2023197014A3 (en) | 2023-11-23 |
| US20250249097A1 (en) | 2025-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7622031B2 (en) | Trans-cyclooctene bioorthogonal agents and uses in cancer and immunotherapy | |
| US20240010976A1 (en) | Methods and compositions for stimulating gamma delta t cells | |
| JP7551110B2 (en) | Cell population-mediated delivery of checkpoint inhibitors for cancer immunotherapy | |
| CA3112212A1 (en) | Covalent adaptor synnotch and chimeric antigen receptors (cars) for programmable antigen-targeting | |
| IL285039B1 (en) | Preparations and methods for stimulating natural killer cells | |
| US20220143179A1 (en) | Drug delivery for combination of epigenetic modulation and immune checkpoint blockade | |
| US20230226211A1 (en) | Cd25-targeted il-2 for increasing cd4 t cell formation and treatment of infections | |
| US20240226168A1 (en) | Engineered nk cells and uses thereof | |
| US20250249097A1 (en) | Combination therapy comprising pd-l1 knockout nk cell and anti-pdl1 antibodies | |
| WO2021188473A1 (en) | Delta opioid receptor antagonists reprogram immunosuppressive microenvironment to boost immunotherapy | |
| US20260008844A1 (en) | Use of anti-marco antibody with a checkpoint blockade antibody for the treatment of cancer | |
| AU2024228613A1 (en) | Transforming growth factor-beta superfamily-imprinted natural killer cells for cancer immunotherapy | |
| US20230190804A1 (en) | Compositions and methods for augmenting chimeric antigen receptor (car) t cell therapies | |
| HK40127948A (en) | Covalent adaptor synnotch and chimeric antigen receptors (cars) for programmable antigen-targeting | |
| EP4355777A1 (en) | Cells expressing vista antigen-binding molecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23785704 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18855147 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23785704 Country of ref document: EP Kind code of ref document: A2 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18855147 Country of ref document: US |