WO2023166292A1 - Cho (chinese hamster ovary) cells for bioproduction with akr1 knock-out or suppression - Google Patents

Cho (chinese hamster ovary) cells for bioproduction with akr1 knock-out or suppression Download PDF

Info

Publication number
WO2023166292A1
WO2023166292A1 PCT/GB2023/050469 GB2023050469W WO2023166292A1 WO 2023166292 A1 WO2023166292 A1 WO 2023166292A1 GB 2023050469 W GB2023050469 W GB 2023050469W WO 2023166292 A1 WO2023166292 A1 WO 2023166292A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cho cell
akr1
cas protein
family
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2023/050469
Other languages
French (fr)
Inventor
Alan Dickson
Mark Stockdale
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Manchester
Revvity Discovery Ltd
Original Assignee
University of Manchester
Horizon Discovery Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Manchester, Horizon Discovery Ltd filed Critical University of Manchester
Publication of WO2023166292A1 publication Critical patent/WO2023166292A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70Enzymes
    • C12N2501/71Oxidoreductases (EC 1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2511/00Cells for large scale production
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)

Definitions

  • the present disclosure relates to the field of modified Chinese Hamster Ovary (CHO) cells.
  • CHO cells provide an important expression system for manufacturing biopharmaceuticals, and use of them is common in the biopharmaceutical industry.
  • One challenge with using CHO cells for bioproduction is that when one grows these cells in large bioreactors, e.g., on the order of thousand liter bioreactors, the CHO cells are presented with stressors that are capable of activating apoptotic pathways.
  • the stressors include, but are not limited to, hypoxia, high osmolality, mechanical stress, and nutrient starvation, and they have been described as reducing culture productivity and leading to the generation of undesirable levels of cellular debris.
  • the present disclosure is directed to modified CHO cells, methods for making these modified CHO cells, and use of these modified CHO cells. Among the uses are the bioproduction of desirable products.
  • the present disclosure provides a CHO cell modified to knock-out or reduce expression of each of: a gene from the AKR1 family; BAX; and BAK.
  • the present disclosure is directed to a CHO cell that is modified to be a triple knock-out, wherein the following three genes are knocked out: AKR1B1, BAX, and BAK.
  • the present disclosure provides a triple knock-out that brings together an anti- apop to tic component (BAX/BAK KO (knock-out)) with a modification of carbohydrate metabolism (AKR1B1 KO) in favor of production of a product.
  • this triple knock-out may be an unexpected synergy that in part is due to the extension of viability of cultures due to the BAX/BAK KO, including but not limited to the effect of the reduction of cell debris during primary recovery and/or allowing cell cultures to progress for longer and therefore potentially improve productivity indirectly, as well as increased productivity due to the AKR1B1 KO.
  • the present disclosure is directed to a CHO cell that is modified to have reduced expression of each of the following three genes: a gene from the AKR1 family, BAX, and BAK.
  • the present disclosure is directed to a CHO cell that is modified to have knock-out of a gene from the AKR1 family and have reduced expression of each BAX and BAK.
  • the present disclosure is directed to a CHO cell that is modified to have knock-out of BAK and have reduced expression of each of a gene from the AKR1 family and BAX.
  • the present disclosure is directed to a CHO cell that is modified to have knock-out of BAX and reduced expression of a gene from the AKR1 family and BAK.
  • the present disclosure is directed to a CHO cell that is modified to have knock-out of a gene from the AKR1 family and BAX and have reduced expression of BAK.
  • the present disclosure is directed to a CHO cell that is modified to have knock-out of a gene from the AKR1 family and BAK and have reduced expression of BAX.
  • the present disclosure is directed to a CHO cell that is modified to have knock-out of BAK and BAX and reduced expression of a gene from the AKR1 family.
  • the present disclosure provides a CHO cell modified to: (i) knock-in or increase expression of CDC42; and (ii) knock-out or reduce expression of at least two of the following genes: a gene from the AKR1 family, BAX, and BAK.
  • the present disclosure provides a method for generating a modified CHO cell of the present disclosure, said method comprising one or more gene selection and manipulation methodologies selected from the group consisting of CRISPR/Cas systems, Zinc Finger nucleases, TALEN, and RNA interference, base-editing technology, transposon technology, and the use of Adeno- associated viruses.
  • the present disclosure provides use of a modified CHO cell of other embodiments of the present disclosure for expression of monoclonal antibodies or Fc-fusion, bi-specific, tri-specific or any other therapeutic or other proteins, development of biopharmaceuticals and difficult to express proteins as well as other non-protein biotherapeutics, such as viral vectors, and bioproduction manufacturing methods using perfusion systems, such as continuous manufacturing and intensified fed-batch.
  • the present disclosure provides a bioproduction method of producing a product utilizing a modified CHO cell of any of the embodiments of the present disclosure.
  • Figure 1 shows the culture longevity of the single knock-out, double knockout, triple knock-out and the wild-type control parental cell line (denoted as control in the figure) in an Ambr250 bioreactor run.
  • Figure 2 depicts a comparison of the maximum viable cell density in single knock-out, double knock-out, triple knock-out, and the wild-type parental control (denoted as control in the figure) cell lines in an Ambr250 bioreactor run. All data are normalized to the control parental cell line.
  • Figure 3 shows Trastuzumab production in single knock-out, double knockout, triple knock-out and wild-type control parental (denoted as control in the figure) cell lines in an Ambr250 bioreactor run.
  • the present disclosure shows the surprising synergistic effects of the combinatorial knock-out of AKR1B1, BAK and BAX genes on viable cell density and titer when compared to the wild-type parental, single knock-out cell line and, double knock-out cell line therefore increasing the CHO cells performance.
  • the term “AKR1” refers to a protein produced by the aldo-keto reductase family 1 of genes.
  • the AKR1 genes form one of sixteen AKR families of genes, and they encode aldose reductase enzymes that catalyze redox transformations that may be involved in biosynthesis, intermediary metabolism, and detoxification.
  • AKR1B1 aldo-keto reductase family 1, member Bl, which is also referred to as AR; ADR; ALR2; and ALDR1).
  • AKR1A1 AKR1B10, AKR1B15, AKR1C1, AKR1C2, AKR1C3, AKR1C4, AKR1D1, and AKR1E2.
  • Table 1A provides the NCBI identifications of the mRNA and protein sequences for the human AKR1 genes, including known isoforms and variants. The NCBI database is publicly accessible at https://www.ncbi.nlm.nih.gov and incorporated by reference herein. [0033] Table 1A
  • Table IB provides the NCBI identifications of the mRNA and protein sequences for the Chinese Hamster AKR1 genes, including known isoforms and variants.
  • the NCBI database is publicly accessible at https://www.ncbi.nlm.nih.gov and incorporated by reference herein.
  • BAK also known as BAK1; CDN1; BCL2L7; and BAK-LIKE, refers to a protein that typically localizes to mitochondria and induces apoptosis, and is encoded by the BAK gene (also known as the BAK1 gene).
  • mRNA sequence for human BAK is available at the U.S. National Institute of Health’s NBCI database as NM_001188.4, which codes for NP_001179.1.
  • mRNA sequence for Cricetulus griseus BAK1 is available at the U.S. National Institute of Health’s NBCI database as NM_001246795, which codes for NP_001233724.1.
  • the afore-referenced nucleotide and protein sequences from the NCBI database are incorporated by reference.
  • BAX also known as BCL2L4 and bcl-2-like protein 4 refers to an apoptosis regulator and is encoded by the BAX gene. It belongs to the Bcl-2 protein family and is capable of forming a heterodimer with BCL2. The degree of association and the reaction of BAX with BCL2 may determine in part, the survival of a cell when in the presence of an apoptotic stimulus.
  • BAX has as at least eight known isoforms.
  • the RNA sequences that code for BAX are available at the U.S. National Institute of Health’s NBCI database as NM_001291428.2 (isoform 1), which codes for NP_001278357.1; NM_001291429.2 (isoform gamma), which codes for NP_001278358.1; NM_001291430.2 (isoform lambda), which codes for NP_001278359.1; NM_001291431.2 (isoform zeta), which codes for NP_001278360.1; NM_004324.4 (isoform beta), which codes for NP_004315.1; NM_138761.4 (isoform alpha), which codes for NP_620116.1; NM_138763.4 (isoform delta), which codes for NP_620118.1; and NM_138764.5 (isoform sigma), which codes for NP_620119.2.
  • Cas protein refers to a polypeptide encoded by a Cas (CRISPR- associated) gene.
  • a Cas protein may be a “Cas endonuclease” or “Cas effector protein,” that when in complex with a suitable polynucleotide component is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific polynucleotide target sequence or editing a polynucleotide sequence.
  • a Cas endonuclease described herein comprises one or more nuclease domains.
  • the endonucleases of the disclosure may include those having one or more RuvC nuclease domains.
  • Cas protein also includes functional fragments or functional variants of a native Cas protein, or a protein that shares at least 50%, between 50% and 55%, at least 55%, between 55% and 60%, at least 60%, between 60% and 65%, at least 65%, between 65% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 85%, at least 85%, between 85% and 90%, at least 90%, between 90% and 95%, at least 95%, between 95% and 96%, at least 96%, between 96% and 97%, at least 97%, between 97% and 98%, at least 98%, between 98% and 99%, at least 99%, between 99% and 100%, or 100% sequence identity with at least 50, between 50 and 100, at least 100, between 100 and 150, at least 150, between 150 and 200, at least 200, between 200 and 250, at least 250, between 250 and 300, at least 300, between 300 and 350, at least 350, between 350 and 400, at least
  • Cas proteins include but are not limited to: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csxl2), CaslO, CaslOd, Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl2f, Casl2h, Casl2i, Casl2j (Cas(
  • CDC42 is a protein that is also known as cell division cycle 42, CDC42Hs, G25K, and TKS, and is involved in regulation of the cell cycle. CDC42 may influence a variety of signaling events and cellular processes in a variety of organisms from yeast to mammals. CDC42 has at least two known isoforms (one of which has two variants), the RNA sequences that code for CDC42 are available at the U.S.
  • NBCI database as NM_001039802.2 (cell division control protein 42 homolog isoform 1 precursor, variant 1), which codes for NP_001034891.1; NM_001791.4 (cell division control protein 42 homolog isoform 1 precursor, variant 2), which codes for NP_001782.1; and NM_044472.3 (cell division control protein 42 homolog isoform 2), which codes for NP_426359.1.
  • the mRNA sequence for Cricetulus griseus CDC42 is available at the U.S. National Institute of Health’s NBCI database as NM_ XM_007644222.4, which codes for XP_007642412.1.
  • the afore-referenced nucleotide and protein sequences from the NCBI database are incorporated by reference.
  • CHO cells are Chinese Hamster Ovary Cells. Examples of CHO cells include but are not limited to DUXB11, DG44 and CHO-K1, CHO-K1 GS -/-, CHO-K1SP, CHO— S, CHO-K1SV, CHO-M, and CHO-DG44. CHO cells are commercially available and may, for example, be purchased from Horizon Discovery, Cambridge, United Kingdom.
  • complementarity refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by either traditional Watson-Crick base-pairing or other non-traditional types of base pairs.
  • a percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively).
  • Perfect complementarity means that all of the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • substantially complementary refers to a degree of complementarity that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%, over a region of, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more consecutive nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
  • double- stranded siRNA refers to siRNA in which there are separate antisense strands and sense strands.
  • Each strand of a double- stranded siRNA may be 18-36 nucleotides long or 18-30 nucleotides long or 19-25 nucleotides long, or 22-24 nucleotides long.
  • Double-stranded siRNA may have blunt ends or overhangs at the 5' and/or 3' ends of either strand or both strands that are for example, one to six nucleotides in length.
  • expression refers to the process by which a polynucleotide is transcribed from a DNA template (such as into an mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins.
  • Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • a “gRNA” is a guide RNA.
  • a gRNA comprises, consists essentially of, or consists of a CRISPR RNA (crRNA) and in some embodiments, it may also comprise a trans-activating CRISPR RNA (tracrRNA). It may be created synthetically or enzymatically, and it may be in the form of a contiguous strand of nucleotides in which case it is a “sgRNA” or in some embodiments, formed by the hybridization of regions of a crRNA and a tracrRNA that are not covalently linked together to form a contiguous chain of nucleotides.
  • each gRNA may independently be encoded by a plasmid, lentivirus, or AAV (adeno associated virus), a retrovirus, an adenovirus, a coronavirus, a Sendai virus or other vector.
  • a gRNA may comprise, consist essentially of, or consist of modified nucleotides, unmodified nucleotides or combinations thereof.
  • the gRNA introduces specificity into CRISPR/Cas systems. The specificity is dictated in part by base pairing between a target DNA and the sequence of a region of the gRNA that may be referred to as the spacer region or targeting region of for example 18-36 nucleotides. This spacer region may, for example, be at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to a target site of DNA or identical to a target site of DNA.
  • a nucleotide sequence encodes a molecule that contains the same nucleotides as in the nucleotide sequence that encodes it; that contains the complementary nucleotides according to Watson-Crick base pairing rules; that contains the RNA equivalent of the nucleotides that encode it; that contains the DNA equivalent of the nucleotides that encode it; that contains the RNA equivalent of the complement of the nucleotides that encode it; that contains the DNA equivalent of the complement of the nucleotides that encode it; that contains the amino acid sequence that can be generated based on the consecutive codons in the sequence; and that contains the amino acid sequence that can be generated based on the complement of the consecutive codons in the sequence.
  • hybridization and “hybridizing” refer to a process in which completely, substantially, or partially complementary nucleic acid strands come together under specified hybridization conditions to form a double-stranded structure or region in which the two constituent strands are joined by hydrogen bonds. Unless otherwise stated, the hybridization conditions are naturally occurring or lab-designed conditions. Although hydrogen bonds typically form between adenine and thymine or uracil (A and T or U) or between cytidine and guanine (C and G), other base pairs may form (see e.g., Adams et al., The Biochemistry of the Nucleic Acids, 11th ed., 1992).
  • Increased expression refers to the process by which the amount of a nucleotide sequence that translated into a functional protein is increased to some degree but for which there is no modification or change to chromosomal DNA.
  • knock-in refers to a genetic modification that causes a native gene that otherwise would not have been transcribed and/or translated to be transcribed and translated into a functional protein.
  • knock-out refers to a genetic modification that prevents a native gene from being transcribed and/or translated into a functional protein.
  • the native gene is either altered and not transcribed, altered and transcribed but not translated, or altered and transcribed into an mRNA that is translated but that cannot be used to generate the same protein that the native sequence could be used to generate.
  • modified nucleotide refers to a nucleotide having at least one modification in the chemical structure of the base, sugar and/or phosphate, including, but not limited to, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, and substitution of 5- bromo-uracil or 5-iodouracil; and 2'- modifications, including but not limited to, sugar- modified ribonucleotides in which the 2'-OH is replaced by a group such as an H, OR, R, halo, SH, SR, NH 2 , NHR, NR 2 , or CN.
  • Modified bases refer to nucleotide bases such as, for example, adenine, guanine, cytosine, thymine, uracil, xanthine, inosine, and queuosine that have been modified by the replacement or addition of one or more atoms or groups.
  • nucleotide bases such as, for example, adenine, guanine, cytosine, thymine, uracil, xanthine, inosine, and queuosine that have been modified by the replacement or addition of one or more atoms or groups.
  • Some examples of these types of modifications include, but are not limited to, alkylated, halogenated, thiolated, aminated, amidated, or acetylated bases, alone and in various combinations.
  • More specific modified bases include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N, -dimethyladenine, 2-propyladenine, 2- propylguanine, 2-aminoadenine, 1 -methylinosine, 3 -methyluridine, 5 -methylcytidine, 5 -methyluridine and other nucleotides having a modification at the 5 position, 5-(2- amino)propyluridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1- methyladenosine, 2-methyladenosine, 3 -methylcytidine, 6-methyluridine, 2- methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5- methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza- adenosine, 6-
  • Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl.
  • the sugar moieties may be, or be based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4- thioribose, and other sugars, heterocycles, or carbocycles.
  • nucleotide refers to a ribonucleotide or a deoxyribonucleotide or modified form thereof, as well as an analog thereof.
  • Nucleotides include species that comprise purines, e.g., adenine, hypoxanthine, guanine, and their derivatives and analogs, as well as pyrimidines, e.g., cytosine, uracil, thymine, and their derivatives and analogs.
  • a nucleotide comprises a cytosine, uracil, thymine, adenine, or guanine moiety.
  • nucleotide also includes those species that have a detectable label, such as for example a radioactive or fluorescent moiety, or mass label attached to the nucleotide.
  • nucleotide also includes what are known in the art as universal bases.
  • universal bases include but are not limited to 3 -nitropyrrole, 5 -nitroindole, or nebularine.
  • Nucleotide analogs are, for example, meant to include nucleotides with bases such as inosine, queuosine, xanthine, sugars such as 2'-methyl ribose, and non-natural phosphodiester internucleotide linkages such as methylphosphonates, phosphorothioates, phosphoroacetates and peptides.
  • polynucleotide refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs or combinations thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown.
  • polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • loci locus defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched poly
  • a polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • reduced expression and “reduction of expression” refer to the process by which the amount of a nucleotide sequence that translated into a functional protein is inhibited to some degree but for which there is no modification or change to chromosomal DNA.
  • reduced expression may refer to the effects on a nucleotide sequence that affect translation, such as for example interactions with the RISC complex.
  • RNP refers to a ribonucleoprotein complex comprised of guide RNA and Cas nuclease.
  • shRNA refers to short-hairpin ribonucleic acids that contain a stem and loop structure and from which the loop can be cleaved for the molecule to cause suppression or increased expression of a protein through RNA interference.
  • shRNAs typically contain a sense sequence and an antisense sequence, each of which is 18 - 40 or 20 - 30 or 22 -25 nucleotides long, a loop sequence, that may for example be 4 to 20 nucleotides long, and optionally 5' and/or 3' overhangs of for example 1 to 6 nucleotides (e.g., dTdT) or no overhangs on either or both of the 5' and/or 3' ends.
  • dTdT nucleotides
  • shRNA refers to short interfering ribonucleic acids that can cause suppression or increased expression through RNA interference.
  • each siRNA contains an antisense sequence and a sense sequence, each of which is 18 - 40 or 20 - 30 or 22 -25 nucleotides long.
  • siRNA includes both double stranded siRNA and shRNA.
  • the antisense sequence and sense sequence may be at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or 100% complementary over at least 18 base pairs, at least 20 base pairs, at least 25 base pairs or all base pairs.
  • an antisense strand and a sense strand none, either or both ends of each strand may be blunt or contain an overhang sequence of up to six nucleotides.
  • the antisense sequence may, for example, be 100% complementary to a region of a target polynucleotide such as an mRNA or at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to a region of a target polynucleotide such as an mRNA.
  • suppression and “reduction of expression” refer to the process by which the amount of a translated functional protein is inhibited to some degree but for which there is no modification or change to chromosomal DNA.
  • TALEN transcription activator-like effector nuclease
  • engineered nucleases that comprise a non-specific DNA-cleaving nuclease fused to a TALE DNA-binding domain that can target DNA sequences and be used for genome editing.
  • TALE Transcription activator-like effector nuclease
  • vector refers to a molecule or complex that transports another molecule and includes but is not limited to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it has been linked, or that has been incorporated within the vector sequence.
  • a vector can be introduced into cells and organisms to express RNA transcripts, proteins, and peptides, and may be termed an “expression vector.” Examples of vectors include, but are not limited to, plasmids, lentiviruses, alphaviruses, adenoviruses, or adeno-associated viruses.
  • the vector may be single stranded, double stranded or have at least one region that is single stranded and at least one region that is double stranded.
  • the nucleic acid may comprise, consist essentially of, or consist of RNA or DNA or a combination thereof.
  • the term “zinc finger” refers to engineered nucleases that comprise a nonspecific DNA-cleaving nuclease fused to a zinc finger DNA binding domain. Zinc fingers can target DNA sequences and be used for genome editing.
  • the term “about” generally refers to plus or minus 10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 20” may mean from 18-22. Other meanings of “about” may be apparent from the context, such as rounding off; for example “about 1” may also mean from 0.5 to 1.4.
  • nucleotide sequences are denoted in italicized lettering while proteins are denoted by unitalicized lettering.
  • a modified CHO cell is a cell that has had one more genes knocked out, one or more genes knocked in, the expression of one or more genes increased, or the expression of one more genes reduced.
  • CHO cells are available from commercial sources, and persons of ordinary skill in the art are familiar with how to culture CHO cells.
  • the CHO cell is selected from the group consisting of DUXB11, DG44 and CHO-K1.
  • the CHO cell comprises a selectable marker. Examples of selectable markers include, but are not limited to, selectable markers that allow the selection of high producing clones comprising an expression vector.
  • GS glutamine synthetase
  • DHFR dihydrofolate reductase
  • HPRT hypoxanthine-guanine phosphoribosyltransferase
  • the CHO cell that is modified as described herein is also a DHFR-/- knock-out.
  • the CHO cell that is modified as described herein is also a GS -I- knock-out.
  • the CHO cell is a double knock-out CHO cell line (DHFR-/- and GS-/-) with disrupted Dihydrofolate Reductase (DHFR) and Glutamine Synthetase (GS) genomic loci.
  • DHFR Dihydrofolate Reductase
  • GS Glutamine Synthetase
  • each of the following genes has been knocked out: a gene from the AKR1 family, e.g., AKR1B1, BAK, and BAX.
  • Knock-out may, for example, be accomplished through the use of CRISPR technologies, including but not limited to Type II technologies and Type V technologies.
  • a gene is knocked out when the DNA sequence of that gene has been modified, e.g., base edited, such that it is not transcribed or what is transcribed cannot be translated or cannot be translated into the same protein into which wild type gene is translated.
  • the CRISPR technologies may, for example, comprises a Cas enzyme such as Cas9 and a guide RNA (gRNA) that is either single stranded (sgRNA) and comprises a tracrRNA region and crRNA region, or is formed by a tracrRNA sequence and a crRNA sequence that appear on different polynucleotides.
  • Cas proteins can be used in this disclosure, including but not limited to Type II, e.g., Cas9 and Type V Cas proteins.
  • Type II e.g., Cas9
  • Type V Cas proteins examples include, but are not limited to, those disclosed elsewhere in this specification.
  • the Cas proteins may be present in the CHO cell in active or inactive form. Further, they may be introduced passively or actively by, for example, association with a virus, trypsinization, osmotic shock, microinjection, electroporation, or after transfection of cells with expression vectors, e.g., a plasmid, containing the nucleotide sequence for the Cas protein of interest.
  • expression vectors e.g., a plasmid, containing the nucleotide sequence for the Cas protein of interest.
  • the Cas protein is modified to have reduced catalytic activity or is modified to be catalytically inactive.
  • the Cas protein is a component of a base-editing system as for example, described in Komor et al. Nature, vol 533, 2016 and Koblan et al. Nature Biotechnology, vol 36, 2018; Collantes et al. The CRISPR Journal, vol 4, 2021, which are incorporated by reference in their entireties.
  • the Cas protein is part of a Cas-CLOVER system whereby a partially active or catalytically inactive Cas protein is fused to another protein or domain, for example Clo51 or Fokl.
  • the Cas-CLOVER system is described in Guilinger et al. Nature Biotechnology, vol 32, June 2014, which is incorporated by reference in its entirety.
  • the gRNA may be either a single strand of nucleotides that has at least one region that is self- complementary or two strands of nucleotides each of which has at least one region that is complementary to a region of the other strand.
  • the gRNA regardless of whether it is a single strand of nucleotides or two strands of nucleotides, there may be one or more loops.
  • Type V systems e.g., Casl2e, and Casl2f
  • a tracrRNA sequence and a crRNA sequence that may be present on the same or different polynucleotides.
  • other Type V systems such as those that use Casl2a, MAD7, Casl2h, Casl2i, and Casl2j
  • no tracrRNA sequence is present.
  • a third type of Type V system such as those that use Casl2d, there are a scoutRNA and a crRNA sequence that may be present on the same or different polynucleotides.
  • the nucleotides within the gRNA may be entirely RNA or a combination of ribonucleotides and other nucleotides such as deoxyribonucleotides.
  • Each nucleotide may be unmodified, or one or more nucleotides may be modified, e.g., with one of the following modifications: 2'-O-methyl, 2' fluoro or 2- aminopurine.
  • the crRNA sequence is 36 to 60 nucleotides long or 40 to 55 nucleotides long.
  • a Cas association region which also may be referred to as a repeat region, that may be 18 to 30 nucleotides long or 20 to 25 nucleotides long and a targeting region, which also may be referred to as a spacer region, that may be 18 to 30 nucleotides long or 20 to 25 nucleotides long.
  • the targeting region contains the targeting sequence, which is a variable sequence that may be selected based on where one wishes for the Cas protein to act.
  • the targeting region may be designed to include a region that is complementary and capable of hybridization to a pre-selected target site of interest, such as a region of a gene from the AKR1 family, BAK, or BAX.
  • the region of complementarity between the targeting region and the corresponding target site sequence may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 consecutive nucleotides in length or it may be at least 80%, at least 85%, at least 90%, or at least 95% complementary to a region of DNA over 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 consecutive nucleotides, such as a region of a gene from the AKR1 family, BAK, or BAX.
  • the targeting region is a region that does not hybridize with the tracrRNA and it may be downstream or upstream of the Cas association region.
  • the Cas association region is designed based on the RNA binding domain of a Cas protein with which it is intended to associate. Not all nucleotides within the Cas association need directly associate with the Cas protein.
  • the tracrRNA sequence may, for example, be 45 to 120 nucleotides long or 60 to 100 nucleotides long or 70 to 90 nucleotides long.
  • a tracrRNA sequence comprises an anti-repeat region and a distal region. In some embodiments, the anti-repeat region is 18 to 60 nucleotides long or 25 to 50 nucleotides long or 30 to 40 nucleotides long.
  • the distal region may, for example, be 18 to 60 nucleotides long or 25 to 50 nucleotides long or 30 to 40.
  • the distal region is a region that does not hybridize with the crRNA and it may e.g., be upstream of the anti-repeat region.
  • An anti-repeat region may be at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the Cas association region over at least 18 consecutive nucleotides of the Cas association region, and consequently, the Cas association region and the anti-repeat region are capable of hybridizing to form a hybridization region.
  • the gRNA is capable of retaining association with an RNA binding domain of a Cas protein. Preferably, this association is possible under both naturally occurring conditions and under laboratory conditions in which the complex is to be used.
  • the tracrRNA and crRNA are part of a contiguous strand of nucleotides, there may be a loop region between the tracrRNA and the crRNA of for example, 4 to 20 or 8 to 15 nucleotides.
  • the gRNA may comprise, consist essentially of, or consist of a distal region, an anti-repeat region, a loop, a Cas association region, and a targeting region.
  • crRNA sequences of gRNAs are listed in Table 2 below and also include crRNA sequences of gRNAs that are at least 80% similar, at least 85% similar, at least 90% similar, at least 95% similar or at least 98% similar to the sequences listed in Table 2:
  • the gRNA may be introduced into a CHO cell passively or actively, or as part of vector that encodes the gRNA sequences or sequences necessary to accomplish the knock-out of the desired genes.
  • the gRNAs may be introduced simultaneously or sequentially.
  • all of the coding sequences may be on the same polynucleotide, e.g., a vector, or two or three of the encoding sequences may be on different polynucleotides, e.g., vectors.
  • two or more vectors When two or more vectors are used, they may be introduced simultaneously or sequentially. Regardless of whether a plurality of vectors are used, the same or different effectors and/or promoters may control expression of different gRNAs. When a plurality of vectors are present, expression may be simultaneous or sequential.
  • expression of each of the following genes is reduced: AKR1, e.g., AKR1B1, BAK, and BAX.
  • Expression may be reduced by, for example, 100%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 30% for each of the genes independently.
  • Reduction of expression of the three genes may be by the same or different amounts. In some embodiments, reduction of expression does not affect the sequence of the DNA of the CHO cell.
  • each of the three genes has expression reduced by shRNA. In some embodiments, each of the three genes has expression reduced by siRNA formed from two separate strands. In some embodiments, one of the three genes has expression reduced by siRNA formed from two separate strands and the other two of the three genes has expression reduced by shRNA. In some embodiments, two of the three genes has expression reduced by siRNA formed from two separate strands and the other of the three genes has expression reduced by shRNA.
  • siRNA may be introduced sequentially or simultaneously and passively or actively by any of the technologies described above in connection with the introduction of gRNA.
  • a single vector may encode for two or three siRNAs that target different mRNA or each siRNA coding sequence may be on a separate vector.
  • the encoding regions may be under the control of a single promotor and/or repressor thereby yielding a single transcript that contains all three encoded sequences of interest and that will subsequently be processed, or each encoding region may be under a separate promotor and/or repressor that is the same or different, thereby yielding different transcripts.
  • siRNAs that target genes of interest include, but are not limited to, sequences within Table 3 below and also include siRNA sequences that contain antisense and sense sequences that are at least 80% similar, at least 85% similar, at least 90% similar, at least 95% similar or at least 98% similar to the sequences listed in Table 3: [0090] Table 3
  • AKR1B1, BAK, and BAX are described in terms of knock-out and suppression of a gene from the AKR1 family, e.g., AKR1B1, BAK, and BAX.
  • AKR1B1, BAK, and BAX are described in terms of knock-out and suppression of a gene from the AKR1 family, e.g., AKR1B1, BAK, and BAX.
  • CDC42 may knock-in or increase expression of CDC42 and knock-out or reduce expression of:
  • AKR1B1 • a gene from the AKR1 family, e.g., AKR1B1, and BAK,
  • AKR1B1 • a gene from the AKR1 family, e.g., AKR1B1, and BAX, or
  • AKR1B1, BAK, and BAX can knock-out or reduce expression of a gene from the AKR1 family, e.g., AKR1B1, BAK, and BAX and also knock-in or increase expression of CDC42.
  • gRNAs that may be used to knock in CDC42, include but are not limited to gRNAs that comprise, consist essentially of or consist of a sequence that encodes:
  • the modified CHO cells of the present disclosure can be used for the following applications: generation of biological material such as monoclonal antibodies, Fc- fusion proteins, bi-specific proteins, tri-specific proteins or any other therapeutic proteins; and development of biopharmaceuticals and difficult to express proteins and other non-protein biotherapeutics, such as viral vectors.
  • the modified CHO cells of the present disclosure can also be used in bioproduction manufacturing methods using perfusion systems, such as continuous manufacturing and intensified fed-batch.
  • a CHO K-l, parental cell line a single knock-out cell line (SKO) in which there was knock-out of only AKR1B1 ; (3) a double knock-out cell line (DKO) in which there was knock-out of BAX and BAK and (4) a triple knock-out cell line (TKO) in which there was knockout oiAKRlBl, BAX, and BAK.
  • SKO single knock-out cell line
  • DKO double knock-out cell line
  • TKO triple knock-out cell line
  • the AKR1B1 SKO resulted in an improved viability with approximately 80% viable cells present at day 14 (second from bottom line).
  • the BAX/BAK DKO and BAX/BAK/AKR1B1 TKO result in an even further improved viability in a similar way with a sustained viability of approximately 90% at day 14.
  • VCD maximum viable cell density
  • Peak VCD was measured at the highest level of Viable Cell Density achieved in a bioreactor.
  • the data show that, very surprisingly, CHO cells with the BAX/BAK/AKR1B1 TKO have the highest number of viable cells and the increase is more than the sum of the individual effect of the SKO and DKO.
  • the inventors show the production of Trastuzumab in: (1) a SKO in which there was knock-out of only AKR1B1 ; (2) a double knock-out cell line DKO in which there was knock-out of BAX and BAK and (3) a triple knock-out cell line TKO in which there was knock-out of AKR1B1, BAX, and BAK.
  • Bioproduction was determined by daily measuring the titre of produced trastuzumab over 14 days.
  • the preliminary data suggest that the AKR1 Bl SKO (bottom line) slightly impairs the titre production between day 6 and 12 compared to the parental HD-BI0P3 cell line (second from bottom line) but results in a similar titre at day 14.
  • the BAXIBAK DKO third from bottom line appears to improve bioproduction from day 10 onwards yielding a higher titre after 14 days compared to the wild-type control parental cell line (second from bottom line).
  • gRNAs Single gRNAs were cloned into a plasmid that was then transfected in CHO cells via electroporation. These sgRNAs were used for SKO and DKO.
  • Table 4 provides the target, the exon that was targeted, a DNA sequence that encodes the crRNA targeting sequence, and DNA sequences (antisense -sense pairs) that encode oligonucleotides that were used for cloning crRNA sequences into plasmids.
  • SEQ ID NO: 28 and SEQ ID NO: 31 the first four nucleotides facilitate cloning, while the remainder of the sequences are identical to crRNA targeting sequences.
  • SEQ ID NO: 34 the first five nucleotides facilitate cloning, while the remainder of the sequences are identical to crRNA targeting sequences.
  • crRNA for ribonucleoprotein (RNP) construction [00110] An RNP was created for use in triple knock-out applications. Table 5 identifies the exon that was targeted, a DNA sequence that encodes the crRNA targeting sequence, and the crRNA targeting sequence.
  • the inventors also used a T7 assay for quick check of successful editing.
  • Table 6 notes the target, PCR forward primer, and PCR reverse primer.
  • triple knock-out was generated via RNP.
  • Knock-outs of gene targets were performed sequentially using either plasmid or RNP for delivery of reagents into CHO cells. The change from plasmid to RNP was due to process improvements at that time.
  • Both the plasmid and the RNP method generate an out of frame insertion or deletion (indel) in the coding sequence of the target gene. Out of frame indels cause a frameshift to the mRNA coding sequence, which can lead to mRNA decay and a linked absence of protein expression.
  • Cells were cultured in CD FortiCHO supplemented with 4 mM L- Glutamine (cells using GS selection did not require L-glutamine supplementation) in E125 Erlenmeyer flasks. Cells were incubated at 37°C, 5% CO2, humidified atmosphere with orbital shaker set at 125 rpm. Cells were sub-cultured every 3-4 days as required.
  • gRNAs were designed using Benchling CRISPR guide RNA design. Single guides using NGG PAM sequence were selected based on scores for on-target efficiency and specificity. [00124] Single guide RNA Plasmid (GRP) Generation
  • Non-phosphorylated oligos were resuspended to 100 pM concentration in H2O. The two oligos were mixed in equal molar amounts, heated at 94°C for 5 min and gradually cooled to room temperature for 2-3 hours.
  • Annealed oligos were phosphorylated with T4 polynucleotide kinase in IX T4 DNA ligase buffer. The reaction was incubated at 37°C for 1 hour, then heat inactivated at 65 °C for 20 minutes.
  • Phosphorylated oligos were diluted in H2O. Oligos were ligated into dephosphorylated BfuAI digested vector ( no Cas 9, no selection) using T4 DNA ligase and IX T4 ligase buffer. This was set up for a molar ratio of insert: vector of 3:1. The ligation reaction was incubated at room temperature for 1 hour, then heat inactivated at 65 °C for 10 minutes.
  • [00128] 1 pl ligation reaction was used to transform 50 pl aliquot of DH5a competent cells. This was incubated on ice for 30 minutes, heat shocked at 42°C for 30 seconds and put on ice for 2 minutes. 250 pl SOC medium was added to the cells and incubated at 37°C with agitation for 1 hour. 150 pl transformed cells were plated onto LB agar plate with ampicillin selection. Plates were incubated overnight at 37°C.
  • DNA mixtures of 0.5 pg GRP plasmid and 0.5 pg Cas9 WT plasmid were combined with PBS in sterile V-bottom 96 well plates.
  • 2xl0 5 cells were centrifuged (200 ref for 5 minutes) and resuspended in 20 pl SF buffer (with associated supplement). The cells were added to the DNA mixture in the plate and then loaded into a Nucleocuvette.
  • Cells were electroporated on the Amaxa nucleofector with the program DT133. 80 pl prewamed medium was added to each Nucleocuvette and incubated at 37°C for 5 minutes. The electroporated cells were transferred to the 24- well plate prepared previously. Plates were incubated in a static 37°C, 5% CO2, humidified incubator for 48 hours. Editing efficiency was assessed by T7 endonuclease assay and/or TIDE.
  • crRNA and tracrRNA was resuspended to 100 p M in duplex buffer.
  • a 3 pM reaction of crRNA and tracrRNA was prepared and complexed by heating at 95°C for 5 minutes and cooling at room temperature.
  • Cas9 protein was diluted to 3 p M in duplex buffer and then complexed with crRNA/tracrRNA mixture to get 10 nM final concentration in OptiMEM.
  • the reaction was incubated at room temperature for 5 minutes.
  • To the RNP mixture 1.2 pl RNAiMAX and 47.3 pl OptiMEM was added and incubated for 20 minutes.
  • the reaction was added to 100 pl cells (seeded at 2xl0 5 cells/ml) in a 96 well plate. The plate was incubated in a static 37°C, 5% CO2, humidified incubator for 48 hours. Editing efficiency was assessed by T7 endonuclease assay and/or TIDE.
  • Primers were designed using Primer-BLAST against organism Cricetulus griseus.
  • the amplicon length was set between 500 and 800 bp, with the predicted cleavage site off-center, so that T7 endonuclease cleavage will yield two distinct bands.
  • Confluency of wells within 384-well plates was determined using the Solentim Cell Metric. A threshold of 15% background and 20% well confluency was set for selecting clones for expansion. Cells were expanded to static plates until they reached 6-well plates. During static culture media was FortiCHO + 4 mM L-Glut supplemented with 1 : 1000 diluted anti-clumping agent. Plates were incubated in a static incubator at 37°C, 5% CO2 humidified. Confluent 6 well plates were expanded to suspension E125 flasks. Suspension flasks were subcultured as described in cell culture.
  • Freestyle MAX reagent was added to 600 pl OptiPRO SFM medium. These were incubated for 5 minutes at room temperature. The plasmid mixture and Freestyle MAX mixture were combined and incubated for 20 minutes at room temperature. The plasmid/Freestyle MAX complex was added to 30 ml cell culture seeded at IxlO 6 cells/ml. Transfected cells were incubated for 48 hours in 37°C, 5% CO2 humidified, 125 rpm shaking incubator.
  • Transfected cells were centrifuged at 200 ref for 5 minutes and resuspended in selection media (CD FortiCHO + 50 pM MSX). Cells were placed into a T75 flask in a static incubator at 37°C, 5% CO2. At day 5, cells were counted, centrifuged as before and resuspended into fresh selection media. The viable cell density and viability was monitored every 2-3 days. Once cells were >70% viable and >lxl0 6 cells/ml they were expanded to suspension culture in E125 flasks.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present disclosure relates to modified Chinese Hamster Ovary cells. The cells may be used in bioproduction and be modified in a way that knocks out or reduces expression of: a gene from the AKR1 family, BAK, and BAX.

Description

CHO (CHINESE HAMSTER OVARY) CELLS FOR BIOPRODUCTION WITH AKR1 KNOCK-OUT OR SUPPRESSION
[001] Field
[002] The present disclosure relates to the field of modified Chinese Hamster Ovary (CHO) cells.
[003] Background
[004] CHO cells provide an important expression system for manufacturing biopharmaceuticals, and use of them is common in the biopharmaceutical industry. One challenge with using CHO cells for bioproduction is that when one grows these cells in large bioreactors, e.g., on the order of thousand liter bioreactors, the CHO cells are presented with stressors that are capable of activating apoptotic pathways. The stressors include, but are not limited to, hypoxia, high osmolality, mechanical stress, and nutrient starvation, and they have been described as reducing culture productivity and leading to the generation of undesirable levels of cellular debris.
[005] In order to try to increase the production of biopharmaceutical products, researchers have, for a number of years, experimented with the knock-down of certain genes. However, there is no known way to predict with sufficient accuracy which combination of knock-out and/or other control of expression of genes will yield modified CHO lines with sufficiently satisfactory bioproduction yields.
[006] Summary
[007] The present disclosure is directed to modified CHO cells, methods for making these modified CHO cells, and use of these modified CHO cells. Among the uses are the bioproduction of desirable products.
[008] According to a first embodiment, the present disclosure provides a CHO cell modified to knock-out or reduce expression of each of: a gene from the AKR1 family; BAX; and BAK.
[009] According to a second embodiment, the present disclosure is directed to a CHO cell that is modified to be a triple knock-out, wherein the following three genes are knocked out: AKR1B1, BAX, and BAK. In this embodiment, the present disclosure provides a triple knock-out that brings together an anti- apop to tic component (BAX/BAK KO (knock-out)) with a modification of carbohydrate metabolism (AKR1B1 KO) in favor of production of a product. Among the benefits of this triple knock-out may be an unexpected synergy that in part is due to the extension of viability of cultures due to the BAX/BAK KO, including but not limited to the effect of the reduction of cell debris during primary recovery and/or allowing cell cultures to progress for longer and therefore potentially improve productivity indirectly, as well as increased productivity due to the AKR1B1 KO.
[0010] According to a third embodiment, the present disclosure is directed to a CHO cell that is modified to have reduced expression of each of the following three genes: a gene from the AKR1 family, BAX, and BAK.
[0011] According to a fourth embodiment, the present disclosure is directed to a CHO cell that is modified to have knock-out of a gene from the AKR1 family and have reduced expression of each BAX and BAK.
[0012] According to a fifth embodiment, the present disclosure is directed to a CHO cell that is modified to have knock-out of BAK and have reduced expression of each of a gene from the AKR1 family and BAX.
[0013] According to a sixth embodiment, the present disclosure is directed to a CHO cell that is modified to have knock-out of BAX and reduced expression of a gene from the AKR1 family and BAK.
[0014] According to a seventh embodiment, the present disclosure is directed to a CHO cell that is modified to have knock-out of a gene from the AKR1 family and BAX and have reduced expression of BAK.
[0015] According to an eighth embodiment, the present disclosure is directed to a CHO cell that is modified to have knock-out of a gene from the AKR1 family and BAK and have reduced expression of BAX.
[0016] According to a ninth embodiment, the present disclosure is directed to a CHO cell that is modified to have knock-out of BAK and BAX and reduced expression of a gene from the AKR1 family. [0017] According to a tenth embodiment, the present disclosure provides a CHO cell modified to: (i) knock-in or increase expression of CDC42; and (ii) knock-out or reduce expression of at least two of the following genes: a gene from the AKR1 family, BAX, and BAK.
[0018] According to an eleventh embodiment, the present disclosure provides a method for generating a modified CHO cell of the present disclosure, said method comprising one or more gene selection and manipulation methodologies selected from the group consisting of CRISPR/Cas systems, Zinc Finger nucleases, TALEN, and RNA interference, base-editing technology, transposon technology, and the use of Adeno- associated viruses.
[0019] According to a twelfth embodiment, the present disclosure provides use of a modified CHO cell of other embodiments of the present disclosure for expression of monoclonal antibodies or Fc-fusion, bi-specific, tri-specific or any other therapeutic or other proteins, development of biopharmaceuticals and difficult to express proteins as well as other non-protein biotherapeutics, such as viral vectors, and bioproduction manufacturing methods using perfusion systems, such as continuous manufacturing and intensified fed-batch.
[0020] According to a thirteenth embodiment, the present disclosure provides a bioproduction method of producing a product utilizing a modified CHO cell of any of the embodiments of the present disclosure.
[0021] Among the benefits of various embodiments of the present disclosure are one or more of the following: (i) extended cell viability in culture, which provides advantages in primary recovery during bioproduction because of reduced filter clogging and/or lower presence of HCPs; (ii) longer cell culture times, which leads to higher productivity; and (iii) higher productivity under transient transfection and stable pool conditions.
[0022] Brief Description of the Figures
[0023] Figure 1 shows the culture longevity of the single knock-out, double knockout, triple knock-out and the wild-type control parental cell line (denoted as control in the figure) in an Ambr250 bioreactor run. [0024] Figure 2 depicts a comparison of the maximum viable cell density in single knock-out, double knock-out, triple knock-out, and the wild-type parental control (denoted as control in the figure) cell lines in an Ambr250 bioreactor run. All data are normalized to the control parental cell line.
[0025] Figure 3 shows Trastuzumab production in single knock-out, double knockout, triple knock-out and wild-type control parental (denoted as control in the figure) cell lines in an Ambr250 bioreactor run.
[0026] Detailed Description
[0027] The present disclosure shows the surprising synergistic effects of the combinatorial knock-out of AKR1B1, BAK and BAX genes on viable cell density and titer when compared to the wild-type parental, single knock-out cell line and, double knock-out cell line therefore increasing the CHO cells performance.
[0028] Reference will now be made in detail to various embodiments of the present disclosure, examples of which are illustrated in the accompanying figures. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present disclosure. However, unless otherwise indicated or implicit from context, the details are intended to be examples and should not be deemed to limit the scope of the present disclosure in any way. Additionally, features described in connection with the various or specific embodiments are not to be construed as not appropriate for use in connection with other embodiments disclosed herein unless such exclusivity is explicitly stated or implicit from context.
[0029] Headers are provided herein for the convenience of the reader and do not limit the scope of any of the embodiments disclosed herein.
Definitions
[0030] Unless otherwise stated or implicit from context, the following terms and phrases have the meanings provided below.
[0031] The term “AKR1” refers to a protein produced by the aldo-keto reductase family 1 of genes. The AKR1 genes form one of sixteen AKR families of genes, and they encode aldose reductase enzymes that catalyze redox transformations that may be involved in biosynthesis, intermediary metabolism, and detoxification. Within this family of genes is AKR1B1 (aldo-keto reductase family 1, member Bl, which is also referred to as AR; ADR; ALR2; and ALDR1). Also within the AKR1 family are AKR1A1, AKR1B10, AKR1B15, AKR1C1, AKR1C2, AKR1C3, AKR1C4, AKR1D1, and AKR1E2. [0032] Table 1A provides the NCBI identifications of the mRNA and protein sequences for the human AKR1 genes, including known isoforms and variants. The NCBI database is publicly accessible at https://www.ncbi.nlm.nih.gov and incorporated by reference herein. [0033] Table 1A
Figure imgf000006_0001
Figure imgf000007_0001
Figure imgf000008_0001
[0034] Table IB provides the NCBI identifications of the mRNA and protein sequences for the Chinese Hamster AKR1 genes, including known isoforms and variants. The NCBI database is publicly accessible at https://www.ncbi.nlm.nih.gov and incorporated by reference herein.
[0035] Table IB
Figure imgf000008_0002
[0036] The term “BAK,” also known as BAK1; CDN1; BCL2L7; and BAK-LIKE, refers to a protein that typically localizes to mitochondria and induces apoptosis, and is encoded by the BAK gene (also known as the BAK1 gene).
[0037] The mRNA sequence for human BAK is available at the U.S. National Institute of Health’s NBCI database as NM_001188.4, which codes for NP_001179.1. The mRNA sequence for Cricetulus griseus BAK1 is available at the U.S. National Institute of Health’s NBCI database as NM_001246795, which codes for NP_001233724.1. The afore-referenced nucleotide and protein sequences from the NCBI database are incorporated by reference.
[0038] The term “BAX,” also known as BCL2L4 and bcl-2-like protein 4, refers to an apoptosis regulator and is encoded by the BAX gene. It belongs to the Bcl-2 protein family and is capable of forming a heterodimer with BCL2. The degree of association and the reaction of BAX with BCL2 may determine in part, the survival of a cell when in the presence of an apoptotic stimulus.
[0039] The term BAX has as at least eight known isoforms. The RNA sequences that code for BAX are available at the U.S. National Institute of Health’s NBCI database as NM_001291428.2 (isoform 1), which codes for NP_001278357.1; NM_001291429.2 (isoform gamma), which codes for NP_001278358.1; NM_001291430.2 (isoform lambda), which codes for NP_001278359.1; NM_001291431.2 (isoform zeta), which codes for NP_001278360.1; NM_004324.4 (isoform beta), which codes for NP_004315.1; NM_138761.4 (isoform alpha), which codes for NP_620116.1; NM_138763.4 (isoform delta), which codes for NP_620118.1; and NM_138764.5 (isoform sigma), which codes for NP_620119.2. The mRNA sequence for Cricetulus griseus BAX is available at the U.S. National Institute of Health’s NBCI database as NM_001244020.1, which codes for NP_001230949.1. The afore-referenced nucleotide and protein sequences from the NCBI database are incorporated by reference.
[0040] The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR- associated) gene. A Cas protein may be a “Cas endonuclease” or “Cas effector protein,” that when in complex with a suitable polynucleotide component is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific polynucleotide target sequence or editing a polynucleotide sequence. A Cas endonuclease described herein comprises one or more nuclease domains. The endonucleases of the disclosure may include those having one or more RuvC nuclease domains. “Cas protein” also includes functional fragments or functional variants of a native Cas protein, or a protein that shares at least 50%, between 50% and 55%, at least 55%, between 55% and 60%, at least 60%, between 60% and 65%, at least 65%, between 65% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 85%, at least 85%, between 85% and 90%, at least 90%, between 90% and 95%, at least 95%, between 95% and 96%, at least 96%, between 96% and 97%, at least 97%, between 97% and 98%, at least 98%, between 98% and 99%, at least 99%, between 99% and 100%, or 100% sequence identity with at least 50, between 50 and 100, at least 100, between 100 and 150, at least 150, between 150 and 200, at least 200, between 200 and 250, at least 250, between 250 and 300, at least 300, between 300 and 350, at least 350, between 350 and 400, at least 400, between 400 and 450, at least 500, or greater than 500 if not all contiguous amino acids of a native Cas protein, and retains at least partial activity.
[0041] Examples of Cas proteins include but are not limited to: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csxl2), CaslO, CaslOd, Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl2f, Casl2h, Casl2i, Casl2j (Cas(|)), Mad7, CasX, CasY, Cas 13a, Casl4, C2cl, C2c2, C2c3, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl4, Csxl7, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, Cul966, and MAD7 and homologs or modified versions thereof. Unless otherwise stated or implicit from context, the recitation of a Cas protein includes all active and deactivated versions, as well as homologs and derivatives thereof.
[0042] The term “CDC42” is a protein that is also known as cell division cycle 42, CDC42Hs, G25K, and TKS, and is involved in regulation of the cell cycle. CDC42 may influence a variety of signaling events and cellular processes in a variety of organisms from yeast to mammals. CDC42 has at least two known isoforms (one of which has two variants), the RNA sequences that code for CDC42 are available at the U.S. National Institute of Health’s NBCI database as NM_001039802.2 (cell division control protein 42 homolog isoform 1 precursor, variant 1), which codes for NP_001034891.1; NM_001791.4 (cell division control protein 42 homolog isoform 1 precursor, variant 2), which codes for NP_001782.1; and NM_044472.3 (cell division control protein 42 homolog isoform 2), which codes for NP_426359.1. The mRNA sequence for Cricetulus griseus CDC42 is available at the U.S. National Institute of Health’s NBCI database as NM_ XM_007644222.4, which codes for XP_007642412.1. The afore-referenced nucleotide and protein sequences from the NCBI database are incorporated by reference.
[0043] The term “CHO cells” are Chinese Hamster Ovary Cells. Examples of CHO cells include but are not limited to DUXB11, DG44 and CHO-K1, CHO-K1 GS -/-, CHO-K1SP, CHO— S, CHO-K1SV, CHO-M, and CHO-DG44. CHO cells are commercially available and may, for example, be purchased from Horizon Discovery, Cambridge, United Kingdom.
[0044] The term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by either traditional Watson-Crick base-pairing or other non-traditional types of base pairs. A percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). "Perfect complementarity" means that all of the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%, over a region of, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more consecutive nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
[0045] The term “double- stranded siRNA” refers to siRNA in which there are separate antisense strands and sense strands. Each strand of a double- stranded siRNA may be 18-36 nucleotides long or 18-30 nucleotides long or 19-25 nucleotides long, or 22-24 nucleotides long. Double-stranded siRNA may have blunt ends or overhangs at the 5' and/or 3' ends of either strand or both strands that are for example, one to six nucleotides in length. [0046] The term “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into an mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
[0047] A “gRNA” is a guide RNA. A gRNA comprises, consists essentially of, or consists of a CRISPR RNA (crRNA) and in some embodiments, it may also comprise a trans-activating CRISPR RNA (tracrRNA). It may be created synthetically or enzymatically, and it may be in the form of a contiguous strand of nucleotides in which case it is a “sgRNA” or in some embodiments, formed by the hybridization of regions of a crRNA and a tracrRNA that are not covalently linked together to form a contiguous chain of nucleotides. Additionally, each gRNA (or component thereof, e.g., crRNA and tracrRNA if present) may independently be encoded by a plasmid, lentivirus, or AAV (adeno associated virus), a retrovirus, an adenovirus, a coronavirus, a Sendai virus or other vector. A gRNA may comprise, consist essentially of, or consist of modified nucleotides, unmodified nucleotides or combinations thereof. The gRNA introduces specificity into CRISPR/Cas systems. The specificity is dictated in part by base pairing between a target DNA and the sequence of a region of the gRNA that may be referred to as the spacer region or targeting region of for example 18-36 nucleotides. This spacer region may, for example, be at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to a target site of DNA or identical to a target site of DNA.
[0048] The term “encodes” refers to the ability of a nucleotide sequence or an amino acid sequence to provide information that describes the sequence of nucleotides or amino acids in another sequence or in a molecule. Thus, a nucleotide sequence encodes a molecule that contains the same nucleotides as in the nucleotide sequence that encodes it; that contains the complementary nucleotides according to Watson-Crick base pairing rules; that contains the RNA equivalent of the nucleotides that encode it; that contains the DNA equivalent of the nucleotides that encode it; that contains the RNA equivalent of the complement of the nucleotides that encode it; that contains the DNA equivalent of the complement of the nucleotides that encode it; that contains the amino acid sequence that can be generated based on the consecutive codons in the sequence; and that contains the amino acid sequence that can be generated based on the complement of the consecutive codons in the sequence.
[0049] The terms “hybridization” and “hybridizing” refer to a process in which completely, substantially, or partially complementary nucleic acid strands come together under specified hybridization conditions to form a double-stranded structure or region in which the two constituent strands are joined by hydrogen bonds. Unless otherwise stated, the hybridization conditions are naturally occurring or lab-designed conditions. Although hydrogen bonds typically form between adenine and thymine or uracil (A and T or U) or between cytidine and guanine (C and G), other base pairs may form (see e.g., Adams et al., The Biochemistry of the Nucleic Acids, 11th ed., 1992).
[0050] The term “Increased expression” refers to the process by which the amount of a nucleotide sequence that translated into a functional protein is increased to some degree but for which there is no modification or change to chromosomal DNA.
[0051] The term “knock-in” refers to a genetic modification that causes a native gene that otherwise would not have been transcribed and/or translated to be transcribed and translated into a functional protein.
[0052] The term “knock-out” refers to a genetic modification that prevents a native gene from being transcribed and/or translated into a functional protein. Thus, the native gene is either altered and not transcribed, altered and transcribed but not translated, or altered and transcribed into an mRNA that is translated but that cannot be used to generate the same protein that the native sequence could be used to generate.
[0053] The term “modified nucleotide” refers to a nucleotide having at least one modification in the chemical structure of the base, sugar and/or phosphate, including, but not limited to, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, and substitution of 5- bromo-uracil or 5-iodouracil; and 2'- modifications, including but not limited to, sugar- modified ribonucleotides in which the 2'-OH is replaced by a group such as an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN.
[0054] Modified bases refer to nucleotide bases such as, for example, adenine, guanine, cytosine, thymine, uracil, xanthine, inosine, and queuosine that have been modified by the replacement or addition of one or more atoms or groups. Some examples of these types of modifications include, but are not limited to, alkylated, halogenated, thiolated, aminated, amidated, or acetylated bases, alone and in various combinations. More specific modified bases include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N, -dimethyladenine, 2-propyladenine, 2- propylguanine, 2-aminoadenine, 1 -methylinosine, 3 -methyluridine, 5 -methylcytidine, 5 -methyluridine and other nucleotides having a modification at the 5 position, 5-(2- amino)propyluridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1- methyladenosine, 2-methyladenosine, 3 -methylcytidine, 6-methyluridine, 2- methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5- methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza- adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2-thiouridine, other thio bases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5- methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2- one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl. For example, the sugar moieties may be, or be based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4- thioribose, and other sugars, heterocycles, or carbocycles.
[0055] The term “nucleotide” refers to a ribonucleotide or a deoxyribonucleotide or modified form thereof, as well as an analog thereof. Nucleotides include species that comprise purines, e.g., adenine, hypoxanthine, guanine, and their derivatives and analogs, as well as pyrimidines, e.g., cytosine, uracil, thymine, and their derivatives and analogs. Preferably, a nucleotide comprises a cytosine, uracil, thymine, adenine, or guanine moiety. Further, the term nucleotide also includes those species that have a detectable label, such as for example a radioactive or fluorescent moiety, or mass label attached to the nucleotide. The term nucleotide also includes what are known in the art as universal bases. By way of example, universal bases include but are not limited to 3 -nitropyrrole, 5 -nitroindole, or nebularine. Nucleotide analogs are, for example, meant to include nucleotides with bases such as inosine, queuosine, xanthine, sugars such as 2'-methyl ribose, and non-natural phosphodiester internucleotide linkages such as methylphosphonates, phosphorothioates, phosphoroacetates and peptides.
[0056] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid,” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs or combinations thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
[0057] The term “reduced expression” and “reduction of expression” refer to the process by which the amount of a nucleotide sequence that translated into a functional protein is inhibited to some degree but for which there is no modification or change to chromosomal DNA. On a cellular level reduced expression may refer to the effects on a nucleotide sequence that affect translation, such as for example interactions with the RISC complex.
[0058] The term “RNP” refers to a ribonucleoprotein complex comprised of guide RNA and Cas nuclease. “shRNA” refers to short-hairpin ribonucleic acids that contain a stem and loop structure and from which the loop can be cleaved for the molecule to cause suppression or increased expression of a protein through RNA interference. Typically shRNAs contain a sense sequence and an antisense sequence, each of which is 18 - 40 or 20 - 30 or 22 -25 nucleotides long, a loop sequence, that may for example be 4 to 20 nucleotides long, and optionally 5' and/or 3' overhangs of for example 1 to 6 nucleotides (e.g., dTdT) or no overhangs on either or both of the 5' and/or 3' ends. [0059] The term “siRNA” refers to short interfering ribonucleic acids that can cause suppression or increased expression through RNA interference. Each siRNA contains an antisense sequence and a sense sequence, each of which is 18 - 40 or 20 - 30 or 22 -25 nucleotides long. Unless otherwise specified or apparent from context, the term siRNA includes both double stranded siRNA and shRNA. Within an siRNA, the antisense sequence and sense sequence may be at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or 100% complementary over at least 18 base pairs, at least 20 base pairs, at least 25 base pairs or all base pairs. When the siRNA is made of two separate strands, an antisense strand and a sense strand, none, either or both ends of each strand may be blunt or contain an overhang sequence of up to six nucleotides. Within any siRNA, between the sense and antisense sequences, there may be one or more mismatches and/or bulges, insertions and/or deletions. The antisense sequence may, for example, be 100% complementary to a region of a target polynucleotide such as an mRNA or at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to a region of a target polynucleotide such as an mRNA.
[0060] The term “suppression” and “reduction of expression” refer to the process by which the amount of a translated functional protein is inhibited to some degree but for which there is no modification or change to chromosomal DNA.
[0061] The acronym “TALEN” (transcription activator-like effector nuclease) refers to engineered nucleases that comprise a non-specific DNA-cleaving nuclease fused to a TALE DNA-binding domain that can target DNA sequences and be used for genome editing. One can engineer and use TALENs to bind to a desired DNA sequence.
[0062] The term "vector" refers to a molecule or complex that transports another molecule and includes but is not limited to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it has been linked, or that has been incorporated within the vector sequence. A vector can be introduced into cells and organisms to express RNA transcripts, proteins, and peptides, and may be termed an “expression vector.” Examples of vectors include, but are not limited to, plasmids, lentiviruses, alphaviruses, adenoviruses, or adeno-associated viruses. The vector may be single stranded, double stranded or have at least one region that is single stranded and at least one region that is double stranded. Further, the nucleic acid may comprise, consist essentially of, or consist of RNA or DNA or a combination thereof. [0063] The term “zinc finger” refers to engineered nucleases that comprise a nonspecific DNA-cleaving nuclease fused to a zinc finger DNA binding domain. Zinc fingers can target DNA sequences and be used for genome editing.
[0064] As disclosed herein, a number of ranges of values are provided. It is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the present disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the present disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present disclosure.
[0065] The term “about” generally refers to plus or minus 10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 20” may mean from 18-22. Other meanings of “about” may be apparent from the context, such as rounding off; for example “about 1” may also mean from 0.5 to 1.4.
[0066] For the purpose of the present disclosure, nucleotide sequences are denoted in italicized lettering while proteins are denoted by unitalicized lettering.
Modified CHO Cells
[0067] Various embodiments of the present disclosure are directed to modified CHO cells. A modified CHO cell is a cell that has had one more genes knocked out, one or more genes knocked in, the expression of one or more genes increased, or the expression of one more genes reduced.
[0068] CHO cells are available from commercial sources, and persons of ordinary skill in the art are familiar with how to culture CHO cells. In some embodiments, the CHO cell is selected from the group consisting of DUXB11, DG44 and CHO-K1. In some embodiments, the CHO cell comprises a selectable marker. Examples of selectable markers include, but are not limited to, selectable markers that allow the selection of high producing clones comprising an expression vector. Selectable markers known in the art include, but are not limited to glutamine synthetase (GS), G418, zeomycin, hygromycin, puromycin, dihydrofolate reductase (DHFR), and hypoxanthine-guanine phosphoribosyltransferase (HPRT). In some embodiments, the CHO cell that is modified as described herein is also a DHFR-/- knock-out. In some embodiments, the CHO cell that is modified as described herein is also a GS -I- knock-out. In some embodiments, the CHO cell is a double knock-out CHO cell line (DHFR-/- and GS-/-) with disrupted Dihydrofolate Reductase (DHFR) and Glutamine Synthetase (GS) genomic loci.
[0069] In one embodiment, within the CHO cells, each of the following genes has been knocked out: a gene from the AKR1 family, e.g., AKR1B1, BAK, and BAX. Knock-out may, for example, be accomplished through the use of CRISPR technologies, including but not limited to Type II technologies and Type V technologies.
[0070] In some embodiments, a gene is knocked out when the DNA sequence of that gene has been modified, e.g., base edited, such that it is not transcribed or what is transcribed cannot be translated or cannot be translated into the same protein into which wild type gene is translated. The CRISPR technologies may, for example, comprises a Cas enzyme such as Cas9 and a guide RNA (gRNA) that is either single stranded (sgRNA) and comprises a tracrRNA region and crRNA region, or is formed by a tracrRNA sequence and a crRNA sequence that appear on different polynucleotides.
Cas proteins
[0071] Various Cas proteins can be used in this disclosure, including but not limited to Type II, e.g., Cas9 and Type V Cas proteins. Examples of specific Cas proteins that may be used in the present disclosure include, but are not limited to, those disclosed elsewhere in this specification.
[0072] The Cas proteins may be present in the CHO cell in active or inactive form. Further, they may be introduced passively or actively by, for example, association with a virus, trypsinization, osmotic shock, microinjection, electroporation, or after transfection of cells with expression vectors, e.g., a plasmid, containing the nucleotide sequence for the Cas protein of interest.
[0073] In some embodiments, the Cas protein is modified to have reduced catalytic activity or is modified to be catalytically inactive. In some embodiments, the Cas protein is a component of a base-editing system as for example, described in Komor et al. Nature, vol 533, 2016 and Koblan et al. Nature Biotechnology, vol 36, 2018; Collantes et al. The CRISPR Journal, vol 4, 2021, which are incorporated by reference in their entireties. In some embodiments, the Cas protein is part of a Cas-CLOVER system whereby a partially active or catalytically inactive Cas protein is fused to another protein or domain, for example Clo51 or Fokl. The Cas-CLOVER system is described in Guilinger et al. Nature Biotechnology, vol 32, June 2014, which is incorporated by reference in its entirety. gRNA
[0074] Different Cas proteins have different requirements for their corresponding gRNA. For example, in Type II systems (e.g., those that use Cas9), the gRNA may be either a single strand of nucleotides that has at least one region that is self- complementary or two strands of nucleotides each of which has at least one region that is complementary to a region of the other strand. Within these gRNA, regardless of whether it is a single strand of nucleotides or two strands of nucleotides, there may be one or more loops.
[0075] Certain Type V systems (e.g., Casl2e, and Casl2f) also require a tracrRNA sequence and a crRNA sequence that may be present on the same or different polynucleotides. In other Type V systems, such as those that use Casl2a, MAD7, Casl2h, Casl2i, and Casl2j, no tracrRNA sequence is present. In a third type of Type V system, such as those that use Casl2d, there are a scoutRNA and a crRNA sequence that may be present on the same or different polynucleotides.
[0076] The nucleotides within the gRNA may be entirely RNA or a combination of ribonucleotides and other nucleotides such as deoxyribonucleotides. Each nucleotide may be unmodified, or one or more nucleotides may be modified, e.g., with one of the following modifications: 2'-O-methyl, 2' fluoro or 2- aminopurine. In some embodiments over one or more ranges of one to forty or two to twenty or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, or 36 nucleotides, there are consecutively modified nucleotides or a modification pattern of every second, or every third or every fourth nucleotide being modified at its 2' position with all other nucleotides being unmodified. Additionally or alternatively, between one or more pairs or every pair of consecutive nucleotides, there may be modified or unmodified internucleotide linkages. [0077] In some embodiments, the crRNA sequence is 36 to 60 nucleotides long or 40 to 55 nucleotides long. Within the crRNA sequence are a Cas association region, which also may be referred to as a repeat region, that may be 18 to 30 nucleotides long or 20 to 25 nucleotides long and a targeting region, which also may be referred to as a spacer region, that may be 18 to 30 nucleotides long or 20 to 25 nucleotides long.
[0078] The targeting region contains the targeting sequence, which is a variable sequence that may be selected based on where one wishes for the Cas protein to act. Thus, the targeting region may be designed to include a region that is complementary and capable of hybridization to a pre-selected target site of interest, such as a region of a gene from the AKR1 family, BAK, or BAX. For example, the region of complementarity between the targeting region and the corresponding target site sequence may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 consecutive nucleotides in length or it may be at least 80%, at least 85%, at least 90%, or at least 95% complementary to a region of DNA over 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 consecutive nucleotides, such as a region of a gene from the AKR1 family, BAK, or BAX. The targeting region is a region that does not hybridize with the tracrRNA and it may be downstream or upstream of the Cas association region. The Cas association region is designed based on the RNA binding domain of a Cas protein with which it is intended to associate. Not all nucleotides within the Cas association need directly associate with the Cas protein. [0079] If a tracrRNA sequence is present, in some embodiments, the tracrRNA sequence, may, for example, be 45 to 120 nucleotides long or 60 to 100 nucleotides long or 70 to 90 nucleotides long. A tracrRNA sequence comprises an anti-repeat region and a distal region. In some embodiments, the anti-repeat region is 18 to 60 nucleotides long or 25 to 50 nucleotides long or 30 to 40 nucleotides long. The distal region may, for example, be 18 to 60 nucleotides long or 25 to 50 nucleotides long or 30 to 40. The distal region is a region that does not hybridize with the crRNA and it may e.g., be upstream of the anti-repeat region.
[0080] An anti-repeat region may be at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the Cas association region over at least 18 consecutive nucleotides of the Cas association region, and consequently, the Cas association region and the anti-repeat region are capable of hybridizing to form a hybridization region. For systems that required both a crRNA sequence and a tracrRNA sequence, when the tracrRNA and the crRNA hybridize over the hybridization region, the gRNA is capable of retaining association with an RNA binding domain of a Cas protein. Preferably, this association is possible under both naturally occurring conditions and under laboratory conditions in which the complex is to be used.
[0081] If the tracrRNA and crRNA are part of a contiguous strand of nucleotides, there may be a loop region between the tracrRNA and the crRNA of for example, 4 to 20 or 8 to 15 nucleotides. In these systems, the gRNA may comprise, consist essentially of, or consist of a distal region, an anti-repeat region, a loop, a Cas association region, and a targeting region.
[0082] Examples of crRNA sequences of gRNAs (and sequences encoded by vectors when vectors are used) are listed in Table 2 below and also include crRNA sequences of gRNAs that are at least 80% similar, at least 85% similar, at least 90% similar, at least 95% similar or at least 98% similar to the sequences listed in Table 2:
[0083] Table 2
Figure imgf000021_0001
[0084] The gRNA may be introduced into a CHO cell passively or actively, or as part of vector that encodes the gRNA sequences or sequences necessary to accomplish the knock-out of the desired genes. [0085] When a plurality of targets are to be knocked out and the gRNAs are introduced into the cell, the gRNAs may be introduced simultaneously or sequentially. Further, when the gRNAs are encoded by polynucleotides and then transcribed in the cells, all of the coding sequences may be on the same polynucleotide, e.g., a vector, or two or three of the encoding sequences may be on different polynucleotides, e.g., vectors. When two or more vectors are used, they may be introduced simultaneously or sequentially. Regardless of whether a plurality of vectors are used, the same or different effectors and/or promoters may control expression of different gRNAs. When a plurality of vectors are present, expression may be simultaneous or sequential.
Reduced expression
[0086] In some embodiments, expression of each of the following genes is reduced: AKR1, e.g., AKR1B1, BAK, and BAX. Expression may be reduced by, for example, 100%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 30% for each of the genes independently. Reduction of expression of the three genes may be by the same or different amounts. In some embodiments, reduction of expression does not affect the sequence of the DNA of the CHO cell.
[0087] In some embodiments, reduction of expression of each gene is through the use of RNAi technology, i.e., through the use of siRNA that is formed from either two separate strands or an shRNA. In some embodiments, each of the three genes has expression reduced by shRNA. In some embodiments, each of the three genes has expression reduced by siRNA formed from two separate strands. In some embodiments, one of the three genes has expression reduced by siRNA formed from two separate strands and the other two of the three genes has expression reduced by shRNA. In some embodiments, two of the three genes has expression reduced by siRNA formed from two separate strands and the other of the three genes has expression reduced by shRNA.
[0088] siRNA may be introduced sequentially or simultaneously and passively or actively by any of the technologies described above in connection with the introduction of gRNA. Similarly, when one uses vector technology, a single vector may encode for two or three siRNAs that target different mRNA or each siRNA coding sequence may be on a separate vector. Further, when on the same vector, the encoding regions may be under the control of a single promotor and/or repressor thereby yielding a single transcript that contains all three encoded sequences of interest and that will subsequently be processed, or each encoding region may be under a separate promotor and/or repressor that is the same or different, thereby yielding different transcripts.
[0089] Examples of siRNAs that target genes of interest include, but are not limited to, sequences within Table 3 below and also include siRNA sequences that contain antisense and sense sequences that are at least 80% similar, at least 85% similar, at least 90% similar, at least 95% similar or at least 98% similar to the sequences listed in Table 3: [0090] Table 3
Figure imgf000023_0001
Figure imgf000024_0001
Combinations of Knock-out and Repression Technologies
[0091] For simplicity, the embodiments described above refer to the use of exclusively knock-out technologies or exclusively repression or suppression technologies. However, combinations of these technologies can be used, and they can be used sequentially or simultaneously.
[0092] By way of non-limiting examples one can create CHO cells that:
• Knock-out a gene from the AKR1 family, knock-out BAK, and reduce expression of BAX;
• Knock-out a gene from the AKR1 family, knock-out BAX, and reduce expression of BAK;
• Knock-out a gene from the AKR1 family, and reduce expression of BAK and BAX;
• Knock-out BAK, knock-out BAX, and reduce expression of a gene from the AKR1 family;
• Knock-out BAK, and reduce expression of a gene from the AKR1 family and BAX; or
• Knock-out BAX, and reduce expression of a gene from the AKR1 family and BAK.
CDC42
[0093] The above embodiments are described in terms of knock-out and suppression of a gene from the AKR1 family, e.g., AKR1B1, BAK, and BAX. However, rather than knocking out one of these three genes or reducing expression of one of these three genes, one may knock-in or increase expression of CDC42. For example, one may knock-in or increase expression of CDC42 and knock-out or reduce expression of:
• a gene from the AKR1 family, e.g., AKR1B1, and BAK,
• a gene from the AKR1 family, e.g., AKR1B1, and BAX, or
• BAK, and BAX.
[0094] Alternatively, one can knock-out or reduce expression of a gene from the AKR1 family, e.g., AKR1B1, BAK, and BAX and also knock-in or increase expression of CDC42.
[0095] Examples of gRNA that may be used to knock in CDC42, include but are not limited to gRNAs that comprise, consist essentially of or consist of a sequence that encodes:
• CDC42 F28L variant knock-in
• crRNA Sequence: UACAACAAACAAAUUUCCAU (SEQ ID NO: 25); and
• Donor Sequence: TACAACAAACAAACTCCCATCAG (SEQ ID NO: 26). Applications
[0096] The modified CHO cells of the present disclosure can be used for the following applications: generation of biological material such as monoclonal antibodies, Fc- fusion proteins, bi-specific proteins, tri-specific proteins or any other therapeutic proteins; and development of biopharmaceuticals and difficult to express proteins and other non-protein biotherapeutics, such as viral vectors. The modified CHO cells of the present disclosure can also be used in bioproduction manufacturing methods using perfusion systems, such as continuous manufacturing and intensified fed-batch.
[0097] Examples
Example 1 : Comparison of Longevity
[0098] As shown in Figure 1, the inventors analyzed the longevity of: (1) a CHO K-l, parental cell line; (2) a single knock-out cell line (SKO) in which there was knock-out of only AKR1B1 ; (3) a double knock-out cell line (DKO) in which there was knock-out of BAX and BAK and (4) a triple knock-out cell line (TKO) in which there was knockout oiAKRlBl, BAX, and BAK. [0099] Cell viability (% of live cells compared to total cell number) was measured over 14 days. The results show that the viability of the wild-type control parental cell line (bottom line) starts declining from day 9 onwards to about 70% at day 14. The AKR1B1 SKO resulted in an improved viability with approximately 80% viable cells present at day 14 (second from bottom line). Interestingly, the BAX/BAK DKO and BAX/BAK/AKR1B1 TKO result in an even further improved viability in a similar way with a sustained viability of approximately 90% at day 14. These findings suggest that the combinatorial knock-out of two apoptosis targets (BAX/BAK) improves cell culture viability.
Example 2: Comparison of Cell Biomass
[00100] As shown in Figure 2, the inventors compared the maximum viable cell density (VCD) of: (1) a single knock-out cell line (SKO) in which there was knock-out of only AKR1B1 ; (2) a double knock-out cell line (DKO) in which there was knock-out of BAX and BAK and (3) a triple knock-out cell line (TKO) in which there was knockout oiAKRlBl, BAX, and BAK.
[00101] Peak VCD was measured at the highest level of Viable Cell Density achieved in a bioreactor. The data show that, very surprisingly, CHO cells with the BAX/BAK/AKR1B1 TKO have the highest number of viable cells and the increase is more than the sum of the individual effect of the SKO and DKO. These findings suggest that the combinatorial knock-out of two apoptosis targets (BAX/BAK) and a metabolic target (AKR1B1) most effectively increases the biomass of CHO cells in culture.
Example 3: Comparison of Bioproduction
[00102] As shown in Figure 3, the inventors show the production of Trastuzumab in: (1) a SKO in which there was knock-out of only AKR1B1 ; (2) a double knock-out cell line DKO in which there was knock-out of BAX and BAK and (3) a triple knock-out cell line TKO in which there was knock-out of AKR1B1, BAX, and BAK.
[00103] Bioproduction was determined by daily measuring the titre of produced trastuzumab over 14 days. The preliminary data suggest that the AKR1 Bl SKO (bottom line) slightly impairs the titre production between day 6 and 12 compared to the parental HD-BI0P3 cell line (second from bottom line) but results in a similar titre at day 14. In contrast, the BAXIBAK DKO (third from bottom line) appears to improve bioproduction from day 10 onwards yielding a higher titre after 14 days compared to the wild-type control parental cell line (second from bottom line). In line with the surprising finding that the TKO resulted in the highest biomass (example 2), the BAX/BAK/AKR1B1 TKO (top line) resulted in highest titre production from day 8 onwards yielding the highest titre at day 14. These findings suggest that the combinatorial knock-out of two apoptosis targets (BAX/BAK) and a metabolic target (AKR/BI) leads to an overall improvement of recombinant protein production.
Example 4: Method of Transfection
[00104] Transfection for examples 1 to 3 was performed according to the methodology below:
[00105] Materials and. method for AKR1 -BAX-BAK TKO
[00106] Plasmid single gRNA construct
[00107] Single gRNAs were cloned into a plasmid that was then transfected in CHO cells via electroporation. These sgRNAs were used for SKO and DKO.
Table 4 provides the target, the exon that was targeted, a DNA sequence that encodes the crRNA targeting sequence, and DNA sequences (antisense -sense pairs) that encode oligonucleotides that were used for cloning crRNA sequences into plasmids. In the sense sequences, SEQ ID NO: 28 and SEQ ID NO: 31, the first four nucleotides facilitate cloning, while the remainder of the sequences are identical to crRNA targeting sequences. In the sense sequence, SEQ ID NO: 34, the first five nucleotides facilitate cloning, while the remainder of the sequences are identical to crRNA targeting sequences. [00108] Table 4
Figure imgf000028_0001
[00109] crRNA for ribonucleoprotein (RNP) construction [00110] An RNP was created for use in triple knock-out applications. Table 5 identifies the exon that was targeted, a DNA sequence that encodes the crRNA targeting sequence, and the crRNA targeting sequence.
[00111] Table 5
Figure imgf000028_0002
[00112] T7 and TIDE Primers
[00113] The inventors also used a T7 assay for quick check of successful editing.
Table 6 notes the target, PCR forward primer, and PCR reverse primer.
[00114] Table 6
Figure imgf000028_0003
[00115] Method
[00116] Editing Overview
[00117] Single guide RNAs from Table 4 were used to perform editing. The results appear in Table 7.
[00118] Table 7
Figure imgf000029_0001
[00119] In addition to generating SKO and DKO via plasmids, triple knock-out was generated via RNP. Knock-outs of gene targets were performed sequentially using either plasmid or RNP for delivery of reagents into CHO cells. The change from plasmid to RNP was due to process improvements at that time. Both the plasmid and the RNP method generate an out of frame insertion or deletion (indel) in the coding sequence of the target gene. Out of frame indels cause a frameshift to the mRNA coding sequence, which can lead to mRNA decay and a linked absence of protein expression.
[00120] Cell Culture
[00121] Cells were cultured in CD FortiCHO supplemented with 4 mM L- Glutamine (cells using GS selection did not require L-glutamine supplementation) in E125 Erlenmeyer flasks. Cells were incubated at 37°C, 5% CO2, humidified atmosphere with orbital shaker set at 125 rpm. Cells were sub-cultured every 3-4 days as required.
[00122] Guide Design
[00123] gRNAs were designed using Benchling CRISPR guide RNA design. Single guides using NGG PAM sequence were selected based on scores for on-target efficiency and specificity. [00124] Single guide RNA Plasmid (GRP) Generation
[00125] Non-phosphorylated oligos were resuspended to 100 pM concentration in H2O. The two oligos were mixed in equal molar amounts, heated at 94°C for 5 min and gradually cooled to room temperature for 2-3 hours.
[00126] Annealed oligos were phosphorylated with T4 polynucleotide kinase in IX T4 DNA ligase buffer. The reaction was incubated at 37°C for 1 hour, then heat inactivated at 65 °C for 20 minutes.
[00127] Phosphorylated oligos were diluted in H2O. Oligos were ligated into dephosphorylated BfuAI digested vector ( no Cas 9, no selection) using T4 DNA ligase and IX T4 ligase buffer. This was set up for a molar ratio of insert: vector of 3:1. The ligation reaction was incubated at room temperature for 1 hour, then heat inactivated at 65 °C for 10 minutes.
[00128] 1 pl ligation reaction was used to transform 50 pl aliquot of DH5a competent cells. This was incubated on ice for 30 minutes, heat shocked at 42°C for 30 seconds and put on ice for 2 minutes. 250 pl SOC medium was added to the cells and incubated at 37°C with agitation for 1 hour. 150 pl transformed cells were plated onto LB agar plate with ampicillin selection. Plates were incubated overnight at 37°C.
[00129] Individual colonies were amplified by miniprep according to the manufacturer’s instructions. The guide sequence was checked by Sanger sequencing with M13-RP primer at Eurofins GATC.
[00130] GRP Transfection: SKO and TKO
[00131] 500 pl cell culture media per reaction was added to a well of 24-well plate and placed into a static 37°C, 5% CO2, humidified incubator.
[00132] DNA mixtures of 0.5 pg GRP plasmid and 0.5 pg Cas9 WT plasmid were combined with PBS in sterile V-bottom 96 well plates. 2xl05 cells were centrifuged (200 ref for 5 minutes) and resuspended in 20 pl SF buffer (with associated supplement). The cells were added to the DNA mixture in the plate and then loaded into a Nucleocuvette. Cells were electroporated on the Amaxa nucleofector with the program DT133. 80 pl prewamed medium was added to each Nucleocuvette and incubated at 37°C for 5 minutes. The electroporated cells were transferred to the 24- well plate prepared previously. Plates were incubated in a static 37°C, 5% CO2, humidified incubator for 48 hours. Editing efficiency was assessed by T7 endonuclease assay and/or TIDE.
[00133] RNP Transfection: TKQ
[00134] crRNA and tracrRNA was resuspended to 100 p M in duplex buffer. A 3 pM reaction of crRNA and tracrRNA was prepared and complexed by heating at 95°C for 5 minutes and cooling at room temperature. Cas9 protein was diluted to 3 p M in duplex buffer and then complexed with crRNA/tracrRNA mixture to get 10 nM final concentration in OptiMEM. The reaction was incubated at room temperature for 5 minutes. To the RNP mixture, 1.2 pl RNAiMAX and 47.3 pl OptiMEM was added and incubated for 20 minutes. The reaction was added to 100 pl cells (seeded at 2xl05 cells/ml) in a 96 well plate. The plate was incubated in a static 37°C, 5% CO2, humidified incubator for 48 hours. Editing efficiency was assessed by T7 endonuclease assay and/or TIDE.
[00135] Primer Design for T7/TIDE
[00136] Primers were designed using Primer-BLAST against organism Cricetulus griseus. The amplicon length was set between 500 and 800 bp, with the predicted cleavage site off-center, so that T7 endonuclease cleavage will yield two distinct bands.
[00137] DNA Extraction and PCR
[00138] 10 pl cells were removed and added to 40 pl direct lysis buffer (with proteinase K). This was incubated at 55°C for 30 minutes, then 95°C for 30 minutes.
[00139] 1.5 pl lysed cells was added to each PCR reaction containing 30.5 pl
H2O, 3 pl 25 mM MgCl2, 3 pl DMSO, 10 pl 5x GoTaq Buffer, 0.5 pl 25 mM dNTPs, 0.5 pl 100 pM forward primer, 0.5 pl 100 pM reverse primer and 0.5 pl GoTaq. PCR reaction was placed into a thermal cycler with the settings denoted in Table 8. [00140] Table 8
Figure imgf000032_0001
[00141] T7 Endonuclease Assay
[00142] After PCR amplification of an area of interest, DNA was hybridized by incubating at 94°C for 2 mins. The temperature was decreased to 85°C at 2°C/sec, then
25°C at 0.1°C/sec. Hybridized DNA was digested with T7 endonuclease in lx NEB buffer 2 at 37°C for 20 minutes. Digested DNA was analyzed on 2% agarose gel. Band intensity was determined using Multi Gauge V2.2 software. The percentage edited was calculated using the following formula: % gene modification = 100 x (l - (l- fraction cleaved)172)
[00143] TIDE Assay
[00144] After PCR amplification of an area of interest, DNA was purified using GeneJet purification kit and sent for Sanger sequencing with the primer indicated in the materials table. Sequences from CRISPR edited cells was compared to sequences from WT cells using TIDE tool (https://tide.nki.nl/). Knock-out clones were selected based upon having an out of frame insertion or deletion in each allele of the gene of interest. [00145] Single Cell Dilution
[00146] One day prior to single cell dilution, cells were subcultured at 2xl05 cells/ml in CD FortiCHO + 4 mM L-Glut. On the day of single cell dilution, cells were seeded at 0.5 cells/well in single cell dilution media (CD FortiCHO, 4 mM L- Glutamine, 2mM GlutaMAX, 1 mg/ml Albucult, IX HT supplement, 0.25 ml/L Fatty acid supplement, IX Synthetic cholesterol). Cells were seeded at 100 pl per well of 384 well plates. Plates were incubated in a static 37°C, 5% CO2, humidified incubator.
[00147] CRISPR Edited Clone Expansion
[00148] Confluency of wells within 384-well plates was determined using the Solentim Cell Metric. A threshold of 15% background and 20% well confluency was set for selecting clones for expansion. Cells were expanded to static plates until they reached 6-well plates. During static culture media was FortiCHO + 4 mM L-Glut supplemented with 1 : 1000 diluted anti-clumping agent. Plates were incubated in a static incubator at 37°C, 5% CO2 humidified. Confluent 6 well plates were expanded to suspension E125 flasks. Suspension flasks were subcultured as described in cell culture.
[00149] Cryopreservation of Cells
[00150] Cells were centrifuged (200 ref 5 minutes) and resuspended in cell culture medium with 7.5% DMSO to give IxlO7 cells/vial. 1 ml aliquots were dispensed into labelled cryovials. Vials were placed into a Mr. Frosty and stored overnight at - 80°C. Frozen cryovials were transferred to liquid nitrogen storage.
[00151] Generation of Trastuzumab Expressing Clones
[00152] Linearization of plasmid
[00153] 200 pg of Horizon Discovery plasmid was linearized using 100U PvuL
HF enzyme in lx CutSmart buffer at 37°C for 2 hours. Digested DNA was purified by adding 1/10 volume sodium acetate (3M, pH 5.5) and 2.5X volume ice-cold ethanol and incubated at -80°C overnight. The DNA was precipitated by centrifugation at 16000 ref for 30 minutes. The DNA pellet was rinsed with 70% ethanol and incubated at 4°C for 10 minutes. The DNA was precipitated by centrifugation at 16000 ref for 30 minutes, the supernatant discarded, and the pellet air-dried for 10-20 minutes. The DNA was resuspended in sterile H2O. The DNA concentration was analyzed using a NanoDrop and complete linearization confirmed by agarose gel electrophoresis. [00154] Transfection
[00155] 37.5 pg linearized plasmid was added to 600 pl OptiPRO SFM medium.
In another tube, 37.5 pl Freestyle MAX reagent was added to 600 pl OptiPRO SFM medium. These were incubated for 5 minutes at room temperature. The plasmid mixture and Freestyle MAX mixture were combined and incubated for 20 minutes at room temperature. The plasmid/Freestyle MAX complex was added to 30 ml cell culture seeded at IxlO6 cells/ml. Transfected cells were incubated for 48 hours in 37°C, 5% CO2 humidified, 125 rpm shaking incubator.
[00156] Pool selection
[00157] Transfected cells were centrifuged at 200 ref for 5 minutes and resuspended in selection media (CD FortiCHO + 50 pM MSX). Cells were placed into a T75 flask in a static incubator at 37°C, 5% CO2. At day 5, cells were counted, centrifuged as before and resuspended into fresh selection media. The viable cell density and viability was monitored every 2-3 days. Once cells were >70% viable and >lxl06 cells/ml they were expanded to suspension culture in E125 flasks.
[00158] Ambr250
[00159] Fed batch overgrow experiments were run on Ambr 250, cells were counted using Vi-Cell and titre analyzed using protein A on Octet. The following parameters were used for the Ambr run:
Figure imgf000035_0001

Claims

Claims
1. A Chinese hamster ovary (CHO) cell modified to knock-out or reduce expression of the following genes: a gene from the AKR1 family;
BAX; and
BAK.
2. The CHO cell of claim 1, wherein the gene from the AKR1 family is AKR1B1.
3. The CHO cell of claim 1, wherein there is knock-out of expression of the gene from the AKR1 family, BAK, and BAX.
4. The CHO cell of claim 3, wherein the gene from the AKR1 family is AKR1B1.
5. The CHO cell of any of claims 1 to 4 wherein the CHO cell either further comprises a Cas protein or is capable of expressing a Cas protein.
6. The CHO cell of claim 5, wherein the Cas protein is a Type II Cas protein.
7. The CHO cell of claim 6, wherein the Cas protein is Cas9.
8. The CHO cell of claim 5, wherein the Cas protein is a Type V Cas protein.
9. The CHO cell of claim 5, wherein the Cas protein is part of a base editing system.
10. The CHO cell of claim 5, wherein the Cas protein is a part of a Cas-CLOVER system.
11. The CHO cell of claim 5, wherein the CHO cell comprises or is capable of expressing a gRNA, wherein the gRNA and the Cas protein are capable of forming a gRNA-Cas protein complex, and the gRNA-Cas protein complex is capable of knocking out the gene from the AKR1 family, BAK or BAX. The CHO cell of claim 5, wherein the Cas protein is a first Cas protein, and the CHO cell further comprises or is capable of expressing a first gRNA, wherein the first gRNA and the first Cas protein form or are capable of forming a first gRNA-Cas protein complex and the first gRNA-Cas protein complex is capable of knocking out at least one of the genes selected from the group consisting of the gene from the AKR1 family, BAK, and BAX, and the CHO cell further comprises or is capable of expressing a second Cas protein and further comprises or is capable of expressing a second gRNA, wherein the second gRNA and the second Cas protein form or are capable of forming a second gRNA-Cas protein complex and the second gRNA-Cas protein complex is capable of knocking out at least one of the genes selected from the group consisting of the gene from the AKR1 family, BAK, and BAX, wherein the first gRNA-Cas protein complex and the second gRNA-Cas protein complex are capable of knocking out different genes. The CHO cell of claim 12, wherein the first Cas protein and the second Cas protein are each Cas9. The CHO cell of claim 12, wherein the CHO cell either further comprises a third Cas protein or is capable of expressing a third Cas protein and comprises or is capable of expressing a third gRNA, wherein the third gRNA and the third Cas protein form or are capable of forming a third gRNA-Cas protein complex and the third gRNA-Cas protein complex is capable of knocking out at least one of the genes selected from the group consisting of the gene from the AKR1 family, BAK, and BAX, wherein the first gRNA-Cas protein complex, the second gRNA-Cas protein complex, and the third gRNA-Cas protein complex are capable of knocking down different genes. The CHO cell of claim 14, wherein each of the first Cas protein, the second Cas protein, and the third Cas protein is Cas 9. The CHO cell of claim 11, wherein the gene from the AKR1 family is AKR1 Bl . The CHO cell of claim 12, wherein the gene from the AKR1 family is AKR1 Bl . The CHO cell of claim 14, wherein the gene from the AKR1 family is AKR1B1. The CHO cell of claim 1, wherein there is reduction of expression of at least one of the genes selected from the group consisting of the gene from the AKR1 family, BAK, and BAX. The CHO cell of claim 19, wherein there is reduction of expression of at least two of the genes selected from the group consisting of the gene from the AKR1 family, BAK, and BAX. The CHO cell of claim 20, wherein there is reduction of expression of each the genes selected from the group consisting of the gene from the AKR1 family, BAK, and BAX. The CHO cell of claim 21 further comprising an RNAi molecule or a vector encoding the RNAi molecule, wherein the RNAi molecule is capable of reduction of expression of a least one gene selected from the group consisting of the gene from the AKR1 family, BAK, and BAX by RNA interference. The CHO cell of claim 22, wherein the RNAi molecule is a double- stranded siRNA molecule or an shRNA molecule. The CHO cell of claim 21 further comprising a first RNAi molecule or a vector encoding the first RNAi molecule, wherein the first RNAi molecule is capable reduction of expression of a first gene selected from the group consisting of the gene from the AKR1 family, BAK, and BAX by RNA interference; and a second RNAi molecule or a vector encoding the second RNAi molecule, wherein the second RNAi molecule is capable of reduction of expression of a second gene selected from the group consisting of the gene from the AKR1 family, BAK, and BAX by RNA interference, wherein the first gene and the second gene are different genes. The CHO cell of claim 24, wherein the first RNAi molecule is a double- stranded siRNA molecule or an shRNA molecule; and the second RNAi molecule is a double-stranded siRNA molecule or an shRNA molecule. The CHO cell of claim 21 further comprising a first RNAi molecule or a vector encoding the first RNAi molecule, wherein the first RNAi molecule is capable reduction of expression of a first gene selected from the group consisting of the gene from the AKR1 family, BAK, and BAX by RNA interference; a second RNAi molecule or a vector encoding the second RNAi molecule, wherein the second RNAi molecule is capable of reduction of expression of a second gene selected from the group consisting of the gene from the AKR1 family, BAK, and BAX by RNA interference; and a third RNAi molecule or a vector encoding the third RNAi molecule, wherein the third RNAi molecule is capable of reduction of expression of a third gene selected from the group consisting of the gene from the AKR1 family, BAK, and BAX by RNAi interference, wherein the first gene, the second gene, and the third gene are different genes. The CHO cell of claim 26, wherein the first RNAi molecule is a double- stranded siRNA molecule or an shRNA molecule; the second RNAi molecule is a double-stranded siRNA molecule or an shRNA molecule; and the third RNAi molecule is a double-stranded siRNA molecule or an shRNA molecule. The CHO cell of any of claims 1 to 27, wherein the CHO cell is selected from the group consisting of a CH0-K1, CHO-S and CHO DG44 cell and modified versions thereof. The CHO cell of claim 28, wherein the CHO cell is a Glutamine Synthetase (GS) knock-out (GS -/-) CHO cell. A method for generating the CHO cell of any of claims 1 to 29 comprising one or more gene selection and manipulation methodologies selected from the group consisting of CRISPR/Cas technology, Zinc Finger nucleases, TALEN, baseediting technology, transposon technology, RNA interference, and the use of an Adeno-associated virus. The method according to claim 30 comprising using CRISPR/Cas technology. The method according to claim 30 comprising using RNA interference. The method according to claim 30 comprising using CRISPR/Cas technology to knock-out a first gene select from the group of the gene from the AKR1 family, BAK and BAX, and further comprising using RNA interference to reduce expression of a second gene from the AKR1 family, BAK and BAX, wherein the first gene and the second gene are different genes. The method according to claim 33 further comprising using CRISPR/Cas technology to knock-out a third gene select from the group of the gene from the AKR1 family, BAK and BAX, wherein the third gene is different from each of the first gene and the second gene. The method according to claim 33 further comprising using RNA interference to reduce the expression of a third gene select from the group of the gene from the AKR1 family, BAK and BAX, wherein the third gene is different from each of the first gene and the second gene. Use of the CHO cells of any of claims 1 to 29 to generate a biologic material. The use of claim 36, wherein the biologic material is a monoclonal antibody, or Fc-fusion, bi-specific, or tri-specific or therapeutic protein. Use of the CHO cells of any of claims 1 to 29 to develop a biopharmaceuticals or a non-protein bio therapeutics. The use of claim 38, wherein the use to develop a viral vector. A bioproduction method of producing a product comprising utilizing a CHO cell of any of claims 1 to 29 to produce the product.
PCT/GB2023/050469 2022-03-02 2023-03-02 Cho (chinese hamster ovary) cells for bioproduction with akr1 knock-out or suppression Ceased WO2023166292A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB2202894.8A GB202202894D0 (en) 2022-03-02 2022-03-02 Modified CHO cells
GB2202894.8 2022-03-02

Publications (1)

Publication Number Publication Date
WO2023166292A1 true WO2023166292A1 (en) 2023-09-07

Family

ID=81075714

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2023/050469 Ceased WO2023166292A1 (en) 2022-03-02 2023-03-02 Cho (chinese hamster ovary) cells for bioproduction with akr1 knock-out or suppression

Country Status (2)

Country Link
GB (1) GB202202894D0 (en)
WO (1) WO2023166292A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105132459B (en) * 2015-09-14 2019-01-29 武汉市星熠艾克生物医药有限责任公司 The preparation method and application of mankind's PTX3 recombinant protein
WO2021195464A2 (en) * 2020-03-26 2021-09-30 Genentech, Inc. Modified mammalian cells
WO2021262783A1 (en) * 2020-06-24 2021-12-30 Genentech, Inc. Apoptosis resistant cell lines

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105132459B (en) * 2015-09-14 2019-01-29 武汉市星熠艾克生物医药有限责任公司 The preparation method and application of mankind's PTX3 recombinant protein
WO2021195464A2 (en) * 2020-03-26 2021-09-30 Genentech, Inc. Modified mammalian cells
WO2021262783A1 (en) * 2020-06-24 2021-12-30 Genentech, Inc. Apoptosis resistant cell lines

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
"NBCI", Database accession no. NM_ XM_007644222.4
ADAMS ET AL.: "The Biochemistry of the Nucleic Ac", 1992
COLLANTES ET AL., THE CRISPR JOURNAL, vol. 4, 2021
GUILINGER ET AL., NATURE BIOTECHNOLOGY, vol. 32, June 2014 (2014-06-01)
KOBLAN ET AL., NATURE BIOTECHNOLOGY, vol. 36, 2018
KOMOR ET AL., NATURE, vol. 533, 2016
LIM S F ET AL: "RNAi suppression of Bax and Bak enhances viability in fed-batch cultures of CHO cells", METABOLIC ENGINEERING, ACADEMIC PRESS, AMSTERDAM, NL, vol. 8, no. 6, 1 November 2006 (2006-11-01), pages 509 - 522, XP024946942, ISSN: 1096-7176, [retrieved on 20061101], DOI: 10.1016/J.YMBEN.2006.05.005 *
MATTHEW N HENRY ET AL: "Attenuating apoptosis in Chinese hamster ovary cells for improved biopharmaceutical production", BIOTECHNOLOGY AND BIOENGINEERING, JOHN WILEY, HOBOKEN, USA, vol. 117, no. 4, 23 January 2020 (2020-01-23), pages 1187 - 1203, XP071033062, ISSN: 0006-3592, DOI: 10.1002/BIT.27269 *

Also Published As

Publication number Publication date
GB202202894D0 (en) 2022-04-13

Similar Documents

Publication Publication Date Title
AU2023214243B2 (en) CRISPR/CAS-related methods and compositions for treatment of beta hemoglobinopathies
US20240352465A1 (en) RNA TARGETING OF MUTATIONS VIA SUPPRESSOR tRNAs AND DEAMINASES
US20240110179A1 (en) Systems and methods for treating alpha 1-antitrypsin (a1at) deficiency
JP7632905B2 (en) Novel minimal UTR sequence
US10760081B2 (en) Compositions and methods for enhancing CRISPR activity by POLQ inhibition
EP3274453B1 (en) Crispr/cas-mediated gene conversion
EP2155911B1 (en) Micro-RNA scaffolds, non-naturally occurring micro-RNAs, and methods for optimizing non-naturally occurring micro-RNAs
KR20220119129A (en) MPS IH Treatment Methods and Compositions Based on LEAPER Technology
CN113939591A (en) Methods and compositions for editing RNA
EP2352744B1 (en) Short hairpin rnas for inhibition of gene expression
EP3957735A1 (en) Crispr/cas-related methods and compositions for treating usher syndrome and retinitis pigmentosa
US20240002862A1 (en) Regulation of gene expression by aptamer-modulated rnase p cleavage
KR20240055811A (en) Guide RNA with chemical modifications for prime editing
US12559757B2 (en) Regulation of gene expression through aptamer-modulated polyadenylation
EP4269585A1 (en) Guide rna for editing polyadenylation signal sequence of target rna
JP2025023131A (en) SiRNA sequences targeting the expression of the human genes JAK1 or JAK3 for therapeutic use
CN102021201A (en) Preparation method for myostatin knock-out pig
WO2023166292A1 (en) Cho (chinese hamster ovary) cells for bioproduction with akr1 knock-out or suppression
CN113897385A (en) DNA system for inducing toxin gene expression to selectively kill cells by using RNA interference mechanism
WO2023166297A1 (en) Cho (chinese hamster ovary) cells for bioproduction with bok knock-out or suppression
US20220251566A1 (en) Cells engineered for oligonucleotide delivery, and methods for making and using thereof
KR20220018410A (en) Self-transcribing RNA/DNA system that provides Genome editing in the cytoplasm
US12365900B2 (en) miRNA switches for RNA-triggered control of RNA interference
RU2694396C1 (en) RNA-CONDUCTOR St10 FOR USE IN THE HIGHLY SPECIFIC STREPTOCOCCUS THERMOPHILUS CRISPR / Cas9 (StCas9) NUCLEASES SYSTEM AND USE OF SAID RNA-CONDUCTOR AND StCas9 PROTEIN TO SUPPRESS HEPATITIS B VIRUS EXPRESSION IN THE HOST CELL AND FOR VIRAL DNA ELIMINATION FROM THE HOST CELL
WO2025217591A1 (en) Human-derived synthetic regulators and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23712927

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 23712927

Country of ref document: EP

Kind code of ref document: A1