WO2023122099A2 - Édition de gènes basée sur crispr pour préserver l'épissage et l'expression d'isoformes de foxp3 1 et 2 - Google Patents

Édition de gènes basée sur crispr pour préserver l'épissage et l'expression d'isoformes de foxp3 1 et 2 Download PDF

Info

Publication number
WO2023122099A2
WO2023122099A2 PCT/US2022/053529 US2022053529W WO2023122099A2 WO 2023122099 A2 WO2023122099 A2 WO 2023122099A2 US 2022053529 W US2022053529 W US 2022053529W WO 2023122099 A2 WO2023122099 A2 WO 2023122099A2
Authority
WO
WIPO (PCT)
Prior art keywords
foxp3
cells
gene
homology
isoform
Prior art date
Application number
PCT/US2022/053529
Other languages
English (en)
Other versions
WO2023122099A3 (fr
Inventor
Rosa Bacchetta
Maria Grazia Roncarolo
Matthew H. PORTEUS
Esmond LEE
Simon BORNA
Original Assignee
The Board Of Trustees Of The Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Board Of Trustees Of The Leland Stanford Junior University filed Critical The Board Of Trustees Of The Leland Stanford Junior University
Publication of WO2023122099A2 publication Critical patent/WO2023122099A2/fr
Publication of WO2023122099A3 publication Critical patent/WO2023122099A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464452—Transcription factors, e.g. SOX or c-MYC
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • FOXP3 is an essential transcription factor for the development of functional regulatory T cells (Tregs), responsible for maintaining immune tolerance and for T cell homeostasis.
  • Tregs functional regulatory T cells
  • IPEX Enteropathy X-linked syndrome
  • IPEX syndrome is a devastating autoimmune disease caused by mutations in the FOXP3 gene, which is a master transcription factor for the development of a normal immune system (Bacchetta et al., 2016).
  • IPEX can be lethal, typically manifesting in the first 12 months with early onset, neonatal Type 1 Diabetes, severe watery diarrhea, failure to thrive and extensive dermatitis.
  • IPEX presents exclusively in males, but is otherwise indiscriminate across race, ethnicity, and geographical distribution. About 330 patients have been reported worldwide so far. Untreated, most affected children die within the first 1 -2 years of life.
  • IPEX is a rare disease, but a better understanding of the pathogenesis has increased diagnosis, also exposing later onset atypical forms of the disease.
  • IPEX While in its severe form IPEX is rare, atypical and chronic forms of IPEX have increasingly been described (Barzaghi F JACI 2018, Narula M. JACI 2022). Thus, with more patients surviving the acute disease phase or presenting with chronic atypical forms, there is an urgent challenge is to develop a long-term treatment and cure for all IPEX patients. As a monogenic disease, IPEX is an excellent candidate for gene therapy, where restoration of FOXP3 in a patient's own cells could be a one-time cure with very limited toxicity.
  • FOXP3 genes that require tight endogenous regulation and are differentially expressed in different cell types, namely Tregs and effector T cells (Teff).
  • Tregs and effector T cells Tregs and effector T cells (Teff).
  • the additional feature of FOXP3 protein is that it is expressed in two main isoforms, a full length (FL) and a Exon 2 deleted (A2) isoform, both functionally relevant.
  • Methods and compositions are provided for CRISPR-based FOXP3 gene correction approach that uses homology directed repair to insert FOXP3 cDNA at exon 3 of the endogenous gene locus, preserving the endogenous splicing occurring at exon 2 and therefore permitting expression of FOXP3 isoforms, including the Full Length (FL) and Exon 2 deleted (A2) isoform. In nature, both are expressed constitutively by Tregs and each has important distinct functions. IPEX patients frequently have mutations that affect both isoforms. Gene editing with CRISPR/Cas9 enables delivery of the therapeutic gene to its locus under the control of endogenous regulatory elements.
  • a CRISPR system is provided to target the FOXP3 gene downstream of the alternatively spliced exon 2.
  • This system inserts a donor template with FOXP3 cDNA consisting of a sequence encoding exons 3-1 1 (SEQ ID NO:1 ) into the FOXP3 gene locus at exon 3, allowing expression of both isoforms.
  • the FOXP3 coding sequence lacks sequences encoding exons 1 and 2.
  • the donor template may also contain the truncated nerve growth factor receptor (tNGFR) placed under an IRES or constitutive promoter. This surface marker has been used clinically for selection and tracking of genetically engineered cells, which may be referred to herein as isoform 1 and 2 cells.
  • a method for restoring functional regulatory T cell activity to an individual in need thereof e.g. an individual suffering from immune dysregulation polyendocrinopathy enteropathy X-linked (IPEX) syndrome.
  • the gene edited hematopoietic cells comprise a site-directed gene correction of the FOXP3 gene at exon 3.
  • the cells are autologous to a recipient, for example where the cells are isolated from a patient sample, gene corrected ex vivo, and reintroduced to the recipient.
  • the cells are allogeneic to the recipient.
  • the recipient suffers from IPEX.
  • the hematopoietic cells are hematopoietic stem or progenitor cells (HSPC), e.g. CD34 + human hematopoietic stem cells, lymphoid progenitor cells, etc.', which may be isolated from peripheral blood, cord blood, bone marrow, etc. as known in the art.
  • HSPC hematopoietic stem or progenitor cells
  • the hematopoietic cells are T cells, which may be isolated from patient samples, for example by selection for positive expression of CD4, CD25, etc. or may be differentiated from HSPC.
  • the T cells are CD4 + Teff cells.
  • the T cells are CD4 + Treg.
  • the cells produced by this method may be referred to herein as isoform 1 and 2 hematopoietic edFOXP3 cells, e.g. isoform 1 and 2 HSPC edF0XP3 and isoform 1 and 2 CD4 edFOXP3 T cells, etc.
  • FOXP3 engineered human hematopoietic cells are produced by gene editing of hematopoietic cells ex vivo by CRISPR/Cas effector gene editing.
  • the gene editing method may comprise introducing into the targeted cell the components: sgRNA, e.g. SEQ ID NO:2 complexed to a Cas protein as an RNP system; and a FOXP3 homology donor vector.
  • the FOXP3 homology donor vector comprises a coding sequence for FOXP3, exons 3- 1 1 .
  • the coding sequence may be a cDNA, or may comprise one or more introns.
  • the coding sequence can be modified, or diverged, to incorporate synonymous mutations at the nucleotide level according to the redundant codon usage system, to prevent premature recombination while still encoding for a wild-type protein.
  • the FOXP3 sequence encodes exons of a functional, wild-type FOXP3 protein, although for research purposes a mutated form may be encoded.
  • the FOXP3 coding sequence is generally not linked to a promoter in the vector, and is expressed in the cell by the native FOXP3 promoter.
  • the FOXP3 coding sequence may be operably linked to a polyadenylation sequence, including without limitation BGH polyadenylation signal.
  • the homology vector optionally comprises a marker sequence, including without limitation a tNGFR operably linked to an IRES, or a promoter, e.g. the phosphoglycerate kinase 1 (PGK) promoter.
  • the homology donor vector further comprises a 5’ and a 3' arm with homology to the FOXP3 locus (chromosomal site); where the homology arms may be centered on the cut site of the sgRNA.
  • the recombinant FOXP3 homology donor vector comprises the nucleotide sequence coding for the amino acid sequence (SEQ ID NO:1 ).
  • the amino acid sequence will have at least 90% sequence identity to SEQ ID NO:1 , or a sequence having at least about 80-100% sequence identity thereto, for example at about 95% sequence identity, including any percent identity within this range, such as 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, wherein the recombinant FOXP3 homology donor vector is capable of gene correcting a mutated FOXP3 sequence in a hematopoietic cell of interest.
  • nucleotide sequences can code for this amino acid sequence.
  • Exemplary nucleotide sequences are provided in SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, which correspond to the nucleotide sequence of the initial construct with PGK; the IRES construct, and an optimized IRES construct.
  • Exemplary homology arms of the construct are provided in SEQ ID NO:3 and SEQ ID NO:4, respectively.
  • Useful homology arms may have a sequence of SEQ ID NO:3 and SEQ ID NO:4, or a sequence having at least about 80-100% sequence identity thereto, for example at about 95% sequence identity, including any percent identity within this range, such as 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto
  • the sgRNA comprises 2'-O-methyl 3'phosphorothioate (MS) chemical modifications at the terminal nucleotides.
  • the Gas protein is Cas9 protein.
  • the sgRNA comprises the sequence set forth in SEQ ID NO:2.
  • a method of producing isoform 1 and 2 CD4 edFOXP3 T cells comprising: a) obtaining a biological cell sample comprising one of HSPC, lymphoid progenitor cells, or CD4 + T lymphocytes from a subject; b) gene editing the cells with CRISPR/Cas9 and FOXP3 homology donor vectors described herein; and c) culturing the cells under conditions suitable for expression of the FOXP3, wherein CD4 + T lymphocytes are edited into isoform 1 and 2 CD4 edFOXP3 T cells (both Teff and Tregs).
  • the cells targeted for gene editing are HSPC or lymphoid progenitor cells
  • the cells may be differentiated into CD4 + T cells.
  • HSPC are transplanted to a recipient and differentiated into Treg and Teff isoform 1 and 2 CD4 edFOXP3 T cells in vivo.
  • the biological cell sample can be any sample comprising targeted hematopoietic cells, e.g. peripheral blood, bone marrow, etc. Isolation of HSPC may utilize mobilized peripheral blood, as known in the art (see, for example, Karpova et al. (1019) F1000Res.; 8: F1000 Faculty Rev-2125).
  • the method further comprises isolating the targeted cells, e.g. HSPC, lymphoid progenitor cells, CD4 + T lymphocytes, etc. from the biological sample.
  • the method further comprises substantially purifying the cells after gene editing.
  • the gene edited cells are substantially purified by positive selection for a cell surface marker encoded by the homology donor vector.
  • the cell surface marker is a truncated nerve growth factor receptor (tNGFR)
  • the gene edited cells can be substantially purified by positive selection for the tNGFR cell surface marker using for example and without limitation, immunomagnetic separation or flow cytometry.
  • the method further comprises culturing the hematopoietic cells during and after the gene editing process. In certain embodiments, the method further comprises culturing isoform 1 and 2 CD4 edFOXP3 T cells. In some embodiments, the method further comprises adding IL-2 to a culture of CD4 edFOXP3 T cells to expand the number of isoform 1 and 2 CD4 edFOXP3 T cells in the culture.
  • gene edited hematopoietic cells produced by the methods described herein are provided, for example a population of isolated isoform 1 and 2 HSPC edF0XP3 ; isoform 1 and 2 CD4 edFOXP3 T cells; etc.
  • a composition comprising FOXP3 gene edited cells produced by the methods described herein are provided for use in treatment of an inflammatory condition.
  • a composition of the FOXP3 gene edited cells is substantially purified free of other cells.
  • the composition further comprises a pharmaceutically acceptable excipient.
  • a composition comprising the FOXP3 gene edited cells for use in treatment of IPEX syndrome is provided.
  • a method of treating an inflammatory condition in a subject comprising administering a therapeutically effective amount of a composition comprising FOXP3 gene edited cells produced by the methods described herein to the subject.
  • the composition is generally administered in an amount sufficient to reduce inflammation in the subject.
  • a method of adoptive cellular immunotherapy for treating an inflammatory condition comprising: a) obtaining a biological cell sample comprising one of HSPC, lymphoid progenitor cells, or CD4 + T lymphocytes from a subject; b) gene editing the cells with CRISPR/Cas9 and FOXP3 homology donor vectors described herein; c) administering a therapeutically effective amount of the cells to the subject.
  • the cells targeted for gene editing are HSPC or lymphoid progenitor cells
  • the cells may be differentiated into isoform 1 and 2 CD4 edFOXP3 T cells.
  • HSPC are transplanted to a recipient and differentiated into isoform 1 and 2 CD4 edFOXP3 T cells in vivo.
  • the biological cell sample can be any sample comprising targeted hematopoietic cells, e.g. peripheral blood, cord blood, bone marrow, etc.
  • the method further comprises isolating the targeted cells, e.g. HSPC, lymphoid progenitor cells, CD4 + T lymphocytes, etc. from the biological sample.
  • the methods described herein can be used to treat inflammatory conditions, including for example, without limitation, Treg deficiency, autoimmune disorders, allergies, graft-versus-host disease, and transplant rejection.
  • the Treg deficiency/autoimmune disorder is IPEX syndrome.
  • a method of treating immune dysregulation polyendocrinopathy enteropathy X-linked (IPEX) syndrome comprising administering a therapeutically effective amount of a composition comprising autologous isoform 1 and 2 HSPC edF0XP3 or isoform 1 and 2 CD4 edFOXP3 T cells to the subject, as described herein.
  • FOXP3 gene edited cells produced by the methods described herein may be administered by any suitable mode of administration.
  • the cells are administered intravenously or intra-arterially.
  • the cells are administered locally at a site of inflammation.
  • the cells are administered locally at a site of a tissue or organ transplant.
  • Method of transplantation for hematopoietic stem cells may use myeloablative or non-myeloablative conditioning, including antibody-mediated conditioning, e.g. as disclosed in US Patent nos.10,882,915; 10,1 11 ,966; 10,406,179; US Patent publications 20200369767; 20200129557; and 20180214524, each herein specifically incorporated by reference.
  • FIG. 1 showing CRISPR/Cas9 mediated in-frame insertion strategy of FOXP3 3-11 cDNA at exon 3 of the genomic FOXP3 gene with expected splicing choices (blue arrows).
  • FIG. 2 showing Western blot of FOXP3 expression in edited Tregs.
  • Lane 1 and 2 are positive controls from unedited Tregs, while lane 3 is a negative control from Tregs with FOXP3 knocked out.
  • Lane 4 shows expression of both isoforms (FL and A2) in purified edited FOXP3 3 ' 11 Tregs.
  • FIG. 3 Western blot of CD4+ T effector cells edited with 3-1 1 construct and purified for NGFR+, showed expression of both full length and A2 isoforms after restimulation (line 4).
  • Line 1 , 2, 3, 5 and 6 show control Teff cells nucleofected without Cas9, nucleofected without Cas9 and treated with AAV6 only, FOXP3 knock out with NGFR Knock in (NGFR KO) in Teff cells, A2 or FL FOXP3 edited Teff cells, respectively.
  • FIG. 4 Colony Forming Unit assay showing physiological differentiation in vitro of the different blood cells derived from edited HSPCs (below).
  • FIG. 5 Representative FACS plots showing FOXP3 staining in gated CD3+CD4+ Treg cells.
  • Treg were edited with 3-1 1 (with PGK-NGFR) or “ PGK-NGFR Knock in - FOXP3 knock out” construct (KIKO), or nucleofected in the absence of CRISPR/Cas9 (Nucl only) and/or treated with AAV6 virus (AAV6 only). While Nucl and AAV6 were gated as NGFR-, KIKO and E3-1 1 cells were gated as NGFR+.
  • the Y axes show staining with an antibody clone 150D, which recognizes the isoforms of FOXP3 containing exon 2.
  • the X axes show staining with an antibody clone 250D, which recognizes all FOXP3 isoforms.
  • FIG. 6 Schematic of a construct where PGK is exchanged for IRES.
  • FIG. 7. Edited Treg cells from two healthy donors.
  • FACS plots show FOXP3 staining in gated CD3+CD4+ Treg. 3-1 1 and 3-1 1 IRES Treg cells were gated as NGFR+.
  • the Y axes show staining with an antibody clone 150D, which recognizes the isoforms of FOXP3 containing exon 2.
  • the X axes show staining with an antibody clone 250D, which recognizes all FOXP3 isoforms.
  • FIG. 8 Quantification of FOXP3 MFI in 4 Treg donors edited with 3-11 and 3-1 1 IRES construct.
  • Two antibodies were used to quantify FOXP3 expression, clone 250D (left), which recognizes all FOXP3 isoforms, and clone 150D (right), which recognizes the isoforms of FOXP3 containing exon 2.
  • FOXP3 MFI values were normalized to Treg edited with 3-1 1 construct.
  • FOXP3 expression is increased of 50% when Treg cells are edited with the 3-11 IRES construct.
  • FIG. 9 Nucleotide sequence of a targeting construct (SEQ ID NO:5) including a PGK promoter.
  • FIG. 10 Nucleotide sequence of a targeting construct (SEQ ID NO:6) including an IRES element in place of a PGK promoter.
  • FIG. 1 Nucleotide sequence of a targeting construct (SEQ ID NO:7) including an opimitized IRES element in place of a PGK promoter.
  • the present disclosure provides genetically modified cells and methods of producing such cells. Also provided are methods of editing the genome of such cells.
  • the genetically modified cells of the disclosure are genetically modified such that their genome includes an integrated heterologous FOXP3 coding nucleic acid at one or more positions within the genome, operably linked to the native FOXP3 promoter present in the genome.
  • the newly integrated FOXP3 sequence replaces a mutated sequence present in the genome with a wildtype sequence.
  • a cell includes a plurality of such cells and reference to “the regulatory T cell-like cells” includes reference to one or more regulatory T cell-like cells and equivalents thereof, e.g. CD4 edFOXP3 cells, Teff cells, Treg-like cells, or engineered Tregs, known to those skilled in the art, and so forth.
  • the regulatory T cell-like cells includes reference to one or more regulatory T cell-like cells and equivalents thereof, e.g. CD4 edFOXP3 cells, Teff cells, Treg-like cells, or engineered Tregs, known to those skilled in the art, and so forth.
  • a CRISPR/Cas protein (also referred to herein as a CRISPR/Cas endonuclease) interacts with (binds to) a corresponding guide RNA to form a ribonucleoprotein (RNP) complex (referred to herein as a CRISPR/Cas complex) that is targeted to a particular site (a target sequence) in a target genome via base pairing between the guide RNA and a target sequence within the target genome.
  • RNP ribonucleoprotein
  • a guide RNA includes (i) a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target DNA and (ii) a protein-binding region that includes a double stranded RNA (dsRNA) duplex and bind to a corresponding CRISPR/Cas protein.
  • the guide RNA can be readily modified in order to target any desired sequence within a target genome (by modifying the guide sequence). Suitable guide RNA sequences are provided.
  • a wild type CRISPR/Cas protein (e.g., a Cas9 protein) normally has nuclease activity that cleaves a target nucleic acid (e.g., a double stranded DNA (dsDNA)) at a target site defined by the region of complementarity between the guide sequence of the guide RNA and the target nucleic acid.
  • a target nucleic acid e.g., a double stranded DNA (dsDNA)
  • dsDNA double stranded DNA
  • CRISPR/Cas protein includes wild type CRISPR/Cas proteins, and also variant CRISPR/Cas proteins, e.g., CRISPR/Cas proteins with one or more mutations in a catalytic domain rendering the protein a nickase.
  • a heterologous nucleic acid is integrated into the genome of a cell, which for the purposes of the present disclosure is typically a human hematopoietic cell.
  • the heterologous nucleic acid can be any desired length, but will comprise a FOXP3 coding sequence.
  • the term “heterologous” is a relative term. In some cases, the heterologous nucleic acid is heterologous to the genome because the exact sequence is present nowhere in the genome except for where the nucleic acid has integrated, although a highly similar sequence is usually present.
  • a nucleic acid that is integrated into the genome at one or more positions includes a CRISPR/Cas target sequence.
  • two or more nucleic acids are integrated into two or more different positions within the same locus (e.g., flanking a nucleotide sequence encoding a protein and/or an RNA, or a transcription control element). For example, both isoforms of FOXP3 may be integrated.
  • locus refers to a position (which position can be particular base pair location, or can be a range of from one base pair to another) within a genome of interest.
  • a locus can be a particular base pair position.
  • a locus can be a range of base pair positions, e.g., the position in the genome that codes a particular protein or RNA that is transcribed (as an illustrative example, the FOXP3 locus is a protein-coding locus that is transcribed and encodes the FOXP3 protein).
  • the term protein-coding locus or RNA-coding locus generally includes the transcriptional control sequences that influence transcription of the locus.
  • the term “protein-coding locus” not only refers to the nucleotide sequences that have an open reading frame (ORF) and directly encode the protein, but also the promoter, the 5’ UTR, the 3’ UTR, etc.
  • a target DNA e.g., genomic DNA
  • a CRISP/Cas protein e.g., Cas9
  • target site e.g., genomic DNA
  • CRISPR/Cas target site or “CRISPR/Cas target sequence” are used interchangeably herein to refer to a nucleic acid sequence present in a target DNA (e.g., genomic DNA of a cell) to which a CRISPR/Cas guide RNA can bind, allowing cleavage of the target DNA by the CRISPR/Cas endonuclease.
  • a target sequence can be any desired length and, in some cases, can depend upon the type of CRISPR/Cas guide RNA and CRISPR/Cas protein that will be used to target the target sequence.
  • a feature that renders the target sequence functional is that it is adjacent to a protospacer adjacent motif (PAM), also referred to as a “PAM sequence.”
  • PAM protospacer adjacent motif
  • the CRISPR/Cas target sequence is adjacent to a PAM.
  • the PAM can be present at that position in the genome prior to the integration (e.g., the nucleic acid can be integrated such that the CRISPR/Cas target sequence is inserted next to the PAM that was already present in the genome.
  • the PAM is not present at the desired position in the genome, and the PAM is instead present on the nucleic acid to be integrated.
  • a heterologous nucleic acid would therefore include the CRISPR/Cas target sequence adjacent to a PAM sequence, and both the CRISPR/Cas target sequence and the PAM would be integrated into the genome.
  • a wild type CRISPR/Cas protein e.g., Cas9 protein
  • Cas9 protein normally has nuclease activity that cleaves a target nucleic acid (e.g., a double stranded DNA (dsDNA)) at a target site defined by the region of complementarity between the guide sequence of the guide RNA and the target nucleic acid.
  • site-specific targeting to the target nucleic acid occurs at locations determined by both (i) base-pairing complementarity between the guide nucleic acid and the target nucleic acid; and (ii) a short motif referred to as the “protospacer adjacent motif” (PAM) in the target nucleic acid.
  • PAM protospacer adjacent motif
  • a Cas9 protein binds to (in some cases cleaves) a dsDNA target nucleic acid
  • the PAM sequence that is recognized (bound) by the Cas9 polypeptide is present on the non-complementary strand (the strand that does not hybridize with the targeting segment of the guide nucleic acid) of the target DNA.
  • CRISRPR/Cas e.g., Cas9 proteins from different species can have different PAM sequence requirements.
  • a nucleic acid that binds to a class 2 CRISPR/Cas endonuclease e.g., a Cas9 protein; a type V or type VI CRISPR/Cas protein; a Cpf 1 protein; etc.
  • a guide RNA or “CRISPR/Cas guide nucleic acid” or “CRISPR/Cas guide RNA.”
  • a guide RNA provides target specificity to the complex (the RNP complex) by including a targeting segment, which includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence that is complementary to a sequence of a target nucleic acid.
  • “Tolerogenic” means capable of suppressing or down-modulating an adaptive or innate immunological response.
  • biological sample encompasses a clinical sample.
  • the types of “biological samples” include, but are not limited to: tissue obtained by surgical resection, tissue obtained by biopsy, cells in culture, cell supernatants, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum, fine needle aspirate, lymph node aspirate, cystic aspirate, a paracentesis sample, a thoracentesis sample, and the like.
  • the terms “obtained” or “obtaining” as used herein can also include the physical extraction or isolation of a biological sample (e.g., comprising HSPC, lymphoid progenitors, CD4 + T lymphocytes) from a subject.
  • a biological sample comprising hematopoietic cells can be isolated from a subject (and thus “obtained”) by the same person or same entity that subsequently isolates HSPC, CD4 + T lymphocytes, etc. from the sample and produces CD4 ed Fox p3 T cells (gene edited with CRISPR/Cas9 and FOXP3 homology donor vectors) from the original unmodified cells in the sample.
  • the step of obtaining does not comprise the step of isolating a biological sample.
  • the step of obtaining comprises the step of isolating a biological sample (e.g., a pre-treatment biological sample, a post-treatment biological sample, etc.).
  • a biological sample e.g., a pre-treatment biological sample, a post-treatment biological sample, etc.
  • Methods and protocols for isolating various biological samples e.g., a blood sample, a biopsy sample, an aspirate, etc. will be known to one of ordinary skill in the art and any convenient method may be used to isolate a biological sample.
  • substantially purified generally refers to isolation of a component of a sample (e.g., cell or substance), such that the component comprises the majority percent of the sample in which it resides.
  • a substantially purified component comprises at least 70%, preferably at least 80%-85%, more preferably at least 90-99% of the sample.
  • treatment used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect.
  • the effect can be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease.
  • treatment encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease and/or symptom(s) from occurring in a subject who may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease and/or symptom(s), i.e., arresting their development; or (c) relieving the disease symptom(s), i.e., causing regression of the disease and/or symptom(s).
  • Those in need of treatment include those already inflicted as well as those in which prevention is desired (e.g., those with increased susceptibility to an autoimmune disease, etc.)
  • a therapeutic treatment is one in which the subject is inflicted prior to administration and a prophylactic treatment is one in which the subject is not inflicted prior to administration.
  • the subject has an increased likelihood of becoming inflicted or is suspected of being inflicted prior to treatment.
  • the subject is suspected of having an increased likelihood of becoming inflicted.
  • “Pharmaceutically acceptable excipient or carrier” refers to an excipient that may optionally be included in the compositions of the invention and that causes no significant adverse toxicological effects to the patient.
  • “Pharmaceutically acceptable salt” includes, but is not limited to, amino acid salts, salts prepared with inorganic acids, such as chloride, sulfate, phosphate, diphosphate, bromide, and nitrate salts, or salts prepared from the corresponding inorganic acid form of any of the preceding, e.g., hydrochloride, etc., or salts prepared with an organic acid, such as malate, maleate, fumarate, tartrate, succinate, ethylsuccinate, citrate, acetate, lactate, methanesulfonate, benzoate, ascorbate, para-toluenesulfonate, palmoate, salicylate and stearate, as well as estolate, gluceptate and lactobionate salts.
  • salts containing pharmaceutically acceptable cations include, but are not limited to, sodium, potassium, calcium, aluminum, lithium, and ammonium (including substituted ammonium).
  • An "effective amount" of a composition comprising HSPC edF0XP3 or CD4 edFOXP3 T cells is an amount sufficient to safely effect beneficial or desired results, such as an amount that suppresses activation and proliferation of effector T cells and increases immune tolerance.
  • An effective amount can be administered in one or more administrations, applications, or dosages.
  • a composition comprising HSPC edF0XP3 or CD4 edFOXP3 T cells is intended an amount that, when administered as described herein, brings about a positive therapeutic response, such as improved recovery from an inflammatory condition such as, but not limited to, an autoimmune manifestation, an allergy, graft-versus-host disease, and transplant rejection. Improved recovery may include a reduction in inflammation, pain, or autoimmune-induced tissue damage, or better graft tolerance and prolonged survival of transplanted cells, tissue or organs. Additionally, a therapeutically effective dose or amount may compensate for functional (e.g., IPEX syndrome) or quantitative Treg-deficiency and reduce the need for immunosuppressive or anti-inflammatory drugs.
  • an effective unit dose may be 10 6 cells /kg, 3 x 10 6 cells /kg, 10 7 cells /kg, 10 8 cells /kg, 10 9 /kg, or more.
  • isolated is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro molecules of the same type.
  • isolated with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.
  • isolated when referring to a cell, is a cell that is separate and discrete from the whole organism with which the cell is found in nature.
  • substantially purified generally refers to isolation of a substance, e.g. a cell, compound, drug, polynucleotide, protein, polypeptide, such that the substance comprises the majority percent of the sample in which it resides.
  • a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample.
  • Techniques for purification of cells may include, for example, cells that are purified using specific antibodies coupled with magnetic beads where the antibody targets a specific membrane marker, such as tNGFR.
  • Other techniques for purifying substances of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density.
  • the terms “recipient”, “individual”, “subject”, “host”, and “patient”, are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • "Mammal” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, sheep, goats, pigs, etc.
  • the mammal is human.
  • unit dosage form refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of the agents calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle.
  • the specifications for the unit dosage forms for use in the present invention depend on the particular compound employed and the effect to be achieved, the pharmacodynamics associated with each compound in the host, and the like.
  • Recombinant as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation, is not associated with all or a portion of the polynucleotide with which it is associated in nature.
  • the term "recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
  • the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
  • transformation refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion.
  • Recombinant host cells refer to cells which can be, or have been, used as recipients for recombinant vector or other transferred DNA, and include the original progeny of the original cell which has been transfected.
  • operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
  • a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present.
  • Expression is meant to include the transcription of mRNA from a DNA or RNA template and can further include translation of a protein from an mRNA template.
  • the promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked" to the coding sequence.
  • a “vector” is capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes).
  • target cells e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes.
  • vector construct means any nucleic acid construct capable of directing the expression of a nucleic acid of interest and which can transfer nucleic acid sequences to target cells.
  • the term includes cloning and expression vehicles, as well as viral vectors.
  • variant refers to biologically active derivatives of the reference molecule that retain desired activity.
  • variant refers to molecules having a native sequence and structure with one or more additions, substitutions (generally conservative in nature) and/or deletions, relative to the native molecule, so long as the modifications do not destroy biological activity and which are "substantially homologous" to the reference molecule.
  • sequences of such variants will have a high degree of sequence homology to the reference sequence, e.g., sequence homology of more than 50%, generally more than 60%-70%, even more particularly 80%-85% or more, such as at least 90%-95% or more, when the two sequences are aligned.
  • Gene transfer or “gene delivery” refers to methods or systems for reliably inserting DNA or RNA of interest into a host cell. Such methods can result in transient expression of nonintegrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells.
  • transferred replicons e.g., episomes
  • derived from is used herein to identify the original source of a molecule but is not meant to limit the method by which the molecule is made which can be, for example, by chemical synthesis or recombinant means.
  • a polynucleotide "derived from" a designated sequence refers to a polynucleotide sequence which comprises a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence.
  • the derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide.
  • Homology-directed repair is a mechanism in cells to repair double-stranded and single stranded DNA breaks.
  • Homology-directed repair includes homologous recombination (HR) and single-strand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem. 79:181 -211 ).
  • HR homologous recombination
  • SSA single-strand annealing
  • Other forms of HDR include single-stranded annealing (SSA) and breakage-induced replication, and these require shorter sequence homology relative to HR.
  • CRISPR is used to edit pre-existing FOXP3 mutants in order to replace with a desired version/variant of FOXP3.
  • CRISPR based genome editing methods provide advantages over traditional lentiviral methods of gene addition. Advantages include but are not limited to, increased breath of the cells types that can be transformed, allows for FOXP3 expression to be controlled by the endogenous FOXP3 promoter, allows locus specific replacement with correction of many different mutation types, etc.
  • compositions, methods, and kits are provided for producing and using engineered hematopoietic cells capable of expressing FOXP3.
  • FOXP3 is a transcription factor essential for the function of natural Tregs in maintenance of immune tolerance and normal Teff function.
  • CRISPR/Cas9-mediated gene editing of FOXP3 in CD4 + T lymphocytes endows cells with Treg- like characteristics, including the ability to suppress immune responses of effector T cells and other immune cells.
  • Isoform 1 and 2 CD4 edFOXP3 Treg cells are useful for increasing immune tolerance to antigens in a subject such as alloantigens, autoantigens, and allergens.
  • pharmaceutical compositions comprising such engineered isoform 1 and 2 CD4 edFOXP3 T cells, or compositions of stem and progenitor cells that can give rise to isoform 1 and 2 CD4 edFOXP3 T cells.
  • a CRISPR/Cas9 vector comprising a CRISPR/Cas9 system cuts the endogenous FOXP3 gene at the target site of the sgRNA. After cutting, the FOXP3 homology donor vector then replaces the endogenous copy of FOXP3 with the desired version/variant of FOXP3 contained within the FOXP3 homology donor vector using homology directed repair in a hematopoietic cell, converting them into gene edited cells.
  • nucleic acids encoding the forkhead box protein 3 (FOXP3) transcription factor can be inserted into the FOXP3 homology donor vector to create a vector capable of replacing the endogenous copy of FOXP3 with a desired version/variant following CRISPR/Cas9 cutting/editing.
  • FOXP3 forkhead box protein 3
  • the recombinant FOXP3 homology donor vector comprises: a) a 5’ homology arm; b) a polynucleotide encoding forkhead box protein 3 (FOXP3), e.g.
  • E31 1 or a variant thereof; c) a polyadenylation sequence d) an IRES (internal ribosome entry site), or a phosphoglycerate kinase 1 (PGK) promoter, wherein the PGK promoter is operably linked to the polynucleotide encoding a cell surface marker; e) a polynucleotide encoding a cell surface marker for in vitro selection and in vivo tracking of cells transduced with the vector; and f) a 3’ homology arm.
  • the cell surface marker is a truncated nerve growth factor receptor (tNGFR).
  • the ability of constructs to produce FOXP3 can be empirically determined, for example, by using a real-time RT-PCR assay of FOXP3 mRNA levels or a Western Blot assay of FOXP3 protein levels. Additionally, the ability of the CRISPR/Cas9 and FOXP3 homology donor vector to confer physiologic Teff or Treg characteristics on CD4 + T lymphocytes can be evaluated with a proliferation or a suppression assay, respectively, in vitro (see Examples).
  • FOXP3 nucleic acid and protein sequences may be derived from any source.
  • a number of endogenous FOXP3 nucleic acid and protein sequences are known. Representative sequences including various isoforms of the FOXP3 transcription factor are listed in the National Center for Biotechnology Information (NCBI) database. See, for example, NCBI entries: Accession Nos.
  • sequences or a variant thereof comprising a sequence having at least about 80-100% sequence identity thereto, including any percent identity within this range, such as 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, can be used as the basis for an exon 3-11 FOXP3 homology donor construct, wherein the expressed exon 3-11 FOXP3 retains biological activity, including transcription factor activity and the ability to convert CD4 + T lymphocytes into isoform 1 and 2 CD4 edFOXP3 T cells, including Treg and Teff cells.
  • the hematopoietic cells can optionally be purified before or after gene editing by any method known in the art, including, but not limited to, density gradient centrifugation (e.g., Ficoll Hypaque, percoll, iodoxanol and sodium metrizoate), immunoselection (positive selection or negative selection for surface markers) with immunomagnetic beads or immunoaffinity columns, or fluorescence-activated cell sorting (FACS).
  • density gradient centrifugation e.g., Ficoll Hypaque, percoll, iodoxanol and sodium metrizoate
  • immunoselection positive selection or negative selection for surface markers
  • immunomagnetic beads or immunoaffinity columns e.g., immunomagnetic beads or immunoaffinity columns
  • FACS fluorescence-activated cell sorting
  • CD4 + T lymphocytes and the CD4+ CD25hi CD127 low Treg cells or the CD4+CD25negCD127postive Teff cells, or CD34+ HSPC can be isolated from apheresis products by immunomagnetic CD4 + cell selection, cultured in the presence of IL-2 and IL-7 (in case of CD4+ T cells), then transfected or transduced with a FOXP3 homology donor vector, followed by immunoselection for the cell surface marker (e.g., truncated NGFR) expressed by the recombinant FOXP3 homology donor vector to separate gene edited cells from non-gene edited cells.
  • a FOXP3 homology donor vector e.g., truncated NGFR
  • Hematopoietic stem cells can be obtained by harvesting from bone marrow, from peripheral blood or cord blood. Bone marrow is generally aspirated from the posterior iliac crests while the donor is under either regional or general anesthesia. Additional bone marrow can be obtained from the anterior iliac crest. A dose of 1 X 10 8 and 2 X 10 8 marrow mononuclear cells per kilogram is generally considered desirable to establish engraftment in autologous and allogeneic marrow transplants, respectively. Bone marrow can be primed with granulocyte colony-stimulating factor (G-CSF; filgrastim [Neupogen]) to increase the stem cell count.
  • G-CSF granulocyte colony-stimulating factor
  • G-CSF cytokines
  • GM-CSF GM-CSF
  • the dose of G-CSF used for mobilization is 10 jxg/kg/day. In autologous donors who are heavily pretreated, however, doses of up to 40 .ng/kg/day can be given.
  • Mozobil may be used in conjunction with G-CSF to mobilize hematopoietic stem cells to peripheral blood for collection.
  • the stem cells are optionally, although not necessarily, purified.
  • Abundant reports explore various methods for purification of stem cells and subsequent engraftment, including flow cytometry; an isolex system (Klein et al. (2001 ) Bone Marrow Transplant. 28(11 ):1023-9; Prince et al. (2002) Cytotherapy 4(2):137-45); immunomagnetic separation (Prince et al. (2002) Cytotherapy 4(2):147-55; Handgretinger et al. (2002) Bone Marrow Transplant. 29(9):731 -6; Chou et al. (2005) Breast Cancer. 12(3) :178-88); and the like.
  • Each of these references is herein specifically incorporated by reference, particularly with respect to procedures, cell compositions and doses for hematopoietic stem cell transplantation.
  • the cells which are employed may be fresh, frozen, or have been subject to prior culture. They may be fetal, neonate, adult, etc. Hematopoietic stem cells may be obtained from fetal liver, bone marrow, cord blood, blood, particularly G-CSF or GM-CSF mobilized peripheral blood, or any other conventional source. Cells for engraftment are optionally isolated from other cells, where the manner in which the stem cells are separated from other cells of the hematopoietic or other lineage is not critical to this invention. If desired, a substantially homogeneous population of stem or progenitor cells may be obtained by selective isolation of cells free of markers associated with differentiated cells, while displaying epitopic characteristics associated with the stem cells.
  • the ability of the resulting engineered Teff or isoform 1 and 2 Treg CD4 edFOXP3 cells to respond to activation or to suppress proliferation and activation of effector T cells and other immune cells can be assayed by methods well known in the art including, for example, without limitation, performing an in vitro suppression assay or 3 H-thymidine assay that measures suppression of T cell proliferation by isoform 1 and 2 CD4 edFOXP3 T cells, or a flow cytometrybased suppression assay that measures suppression of proliferation and cytokine production in subpopulations of T cells and other immune cells (see, e.g., Thornton et al. (1998) J. Exp. Med. 1998.
  • Methods are provided for restoring a multilineage T cell compartment in individuals with mutated FOXP3, including, for example, IPEX.
  • the methods described herein are also useful for treating various immune conditions and disorders benefitting from increased immunological tolerance, such as inflammatory conditions including for example, without limitation, Treg deficiency, autoimmune disorders, allergies, graft-versus-host disease, and organ or tissue transplantation.
  • polyclonal isoform 1 and 2 CD4 edFOXP3 T cells which may be derived in vivo from transplanted isoform 1 and 2 HSPC edF0XP3 , comprising a plurality of different T cell receptors, are used for immunosuppression and promoting immune tolerance generally.
  • CD4 edFOXP3 T cells comprising a T cell receptor specific for an antigen of interest are used to dampen adaptive antigen-specific immune responses to the antigen of interest selectively.
  • the infusion of gene edited cells is a relatively simple process that is performed at the bedside.
  • the gene edited cells are infused through a central vein over a period of several hours.
  • Autologous products are frequently cryopreserved; if so they are thawed at the bedside and infused rapidly over a period of several minutes.
  • the dose of HSC is at least about 10 5 CD34 + cells/kg body weight, at least about 0.5 x 10 6 , at least about 10 6 , and up to about 2.5 x 10 6 , 5 x 10 6 , 7.5 x 10 6 , 10 7 CD34 + cells/kg body weight.
  • CD34 + cells For positive selection of CD34 + cells, commercial instruments can be employed to remove the desired cells, using solid-phase, anti-CD34 monoclonal antibodies. With negative selection, monoclonal antibodies can be used to remove undesired cells, leaving stem cells in the graft.
  • Treg deficiency and autoimmune and other inflammatory conditions that may be treated with engineered isoform 1 and 2 HSPC or CD4 edFOXP3 T cells by the methods described herein include, but are not limited to, immune dysregulation polyendocrinopathy enteropathy X-linked (IPEX) syndrome.
  • IPEX immune dysregulation polyendocrinopathy enteropathy X-linked
  • Treatment of primates, more particularly humans is of interest, but other mammals may also benefit from treatment, particularly domestic animals such as equine, bovine, ovine, feline, canine, murine, lagomorpha, and the like.
  • compositions can be prepared by formulating the FOXP3 edited hematopoietic cells into dosage forms by known pharmaceutical methods.
  • a pharmaceutical composition comprising FOXP3 edited hematopoietic cells can be formulated for parenteral administration, as liquids, suspensions, emulsions, and injections (such as venous injections, drip injections, and the like).
  • the FOXP3 edited hematopoietic cells can be combined as appropriate, with pharmaceutically acceptable carriers or media, in particular, sterile water and physiological saline, vegetable oils, resolvents, bases, emulsifiers, suspending agents, surfactants, stabilizers, vehicles, antiseptics, binders, diluents, tonicity agents, soothing agents, bulking agents, disintegrants, buffering agents, coating agents, lubricants, coloring agents, solution adjuvants, or other additives.
  • pharmaceutically acceptable carriers or media in particular, sterile water and physiological saline, vegetable oils, resolvents, bases, emulsifiers, suspending agents, surfactants, stabilizers, vehicles, antiseptics, binders, diluents, tonicity agents, soothing agents, bulking agents, disintegrants, buffering agents, coating agents, lubricants, coloring agents, solution adjuvants, or other additives.
  • pharmaceutically acceptable carriers or media in particular,
  • the subject who receives the FOXP3 edited hematopoietic cells is also the subject from whom the original, unmodified cells are harvested or obtained, which provides the advantage that the donated cells are autologous.
  • FOXP3 edited hematopoietic cells can be obtained from another subject (i.e., donor), a culture of cells from a donor, or from established cell culture lines.
  • FOXP3 edited hematopoietic cells may be obtained from the same species than the subject to be treated, and more preferably of the same immunological profile as the subject.
  • Such cells can be obtained, for example, from a biological sample comprising FOXP3 edited hematopoietic cells from a close relative or matched donor, and the FOXP3 edited hematopoietic cells that are produced (i.e., gene editing with a CRISPR/Cas 9 vector and a FOXP3 homology donor vector) can be administered to a subject in need of treatment for an inflammatory condition.
  • FOXP3 edited hematopoietic cells i.e., gene editing with a CRISPR/Cas 9 vector and a FOXP3 homology donor vector
  • the FOXP3 edited hematopoietic cells that are administered to a subject are derived from autologous or allogeneic cells.
  • the patients or subjects who donate or receive the cells are typically mammalian, and usually human. However, this need not always be the case, as veterinary applications are also contemplated.
  • At least one therapeutically effective cycle of treatment with FOXP3 edited hematopoietic cells will be administered to a subject for treatment of an inflammatory condition.
  • FOXP3 edited hematopoietic cells i.e., HSPC, lymphoid progenitors or CD4 + T lymphocytes gene edited with a CRISPR/Cas9 vector and a FOXP3 homology donor vector
  • a therapeutically effective dose or amount of a composition comprising FOXP3 edited hematopoietic cells is intended an amount that, when administered as described herein, brings about a positive therapeutic response, such as improved recovery from an inflammatory condition benefiting from increased immunological tolerance, such as an autoimmune disorder, an allergy, graft-versus-host disease, or a tissue transplant.
  • Improved recovery may include a reduction in inflammation, pain, or autoimmune-induced tissue damage, decreased allergic response, or prolonged survival of transplanted tissue or organs. Additionally, a therapeutically effective dose or amount may compensate for Treg-deficiency (e.g., IPEX syndrome) and reduce the need for immunosuppressive or anti-inflammatory drugs.
  • Treg-deficiency e.g., IPEX syndrome
  • compositions comprising FOXP3 edited hematopoietic cells; FOXP3 edited T cells, e.g. Treg, Teff cells, and/or one or more other therapeutic agents, such as other drugs for treating immune diseases or conditions, or other medications will be administered.
  • the compositions of the present invention are typically, although not necessarily, administered via injection (subcutaneously, intravenously, intra-arterially, or intramuscularly), by infusion, or locally. Additional modes of administration are also contemplated, such as intraperitoneal, intrathecal, intralymphatic, intravascular, intralesion, transdermal, and so forth.
  • compositions comprising FOXP3 edited hematopoietic cells and other agents may be administered using the same or different routes of administration in accordance with any medically acceptable method known in the art.
  • the pharmaceutical compositions comprising FOXP3 edited hematopoietic cells are administered prophylactically, e.g., to prevent Treg deficiency, etc.
  • Such prophylactic uses will be of particular value for subjects who have a disease or a genetic predisposition to developing an inflammatory condition, such as an autoimmune disease, inflammation, or allergy.
  • FOXP3 edited hematopoietic cells may be administered to a patient with an autoimmune disease to prevent a disease flare, or in I PEX patients with mixed donor chimerism and disease relapse.
  • compositions comprising FOXP3 edited hematopoietic cells can effectively treat.
  • the actual dose and number of doses to be administered will vary depending upon the age, weight, and general condition of the subject as well as the severity of the condition being treated, the judgment of the health care professional, and conjugate being administered.
  • Therapeutically effective amounts can be determined by those skilled in the art, and will be adjusted to the particular requirements of each particular case.
  • compositions comprising FOXP3 edited hematopoietic cells, prepared as described herein (again, preferably provided as part of a pharmaceutical preparation), can be administered alone or in combination with one or more other therapeutic agents for treating an immune disease or condition.
  • Antibody conditioning may be used, or myeloablative conditioning as known in the art.
  • Individuals nay be treated with combination therapies with other medications used to treat a particular condition or disease according to a variety of dosing schedules depending on the judgment of the clinician, needs of the patient, and so forth. The specific dosing schedule will be known by those of ordinary skill in the art or can be determined experimentally using routine methods.
  • Exemplary dosing schedules include, without limitation, administration five times a day, four times a day, three times a day, twice daily, once daily, three times weekly, twice weekly, once weekly, twice monthly, once monthly, and any combination thereof.
  • Preferred compositions are those requiring dosing no more than once a day.
  • compositions comprising FOXP3 edited hematopoietic cells can be administered prior to, concurrent with, or subsequent to other agents. If provided at the same time as other agents, the FOXP3 edited hematopoietic cells can be provided in the same or in a different composition. Thus, the FOXP3 edited hematopoietic cells and one or more other agents can be presented to the individual by way of concurrent therapy.
  • concurrent therapy is intended administration to a subject such that the therapeutic effect of the combination of the substances is caused in the subject undergoing therapy.
  • concurrent therapy may be achieved by administering a dose of a pharmaceutical composition comprising FOXP3 edited hematopoietic cells and a dose of a pharmaceutical composition comprising at least one other agent, such as a drug for treating an immune disease or condition, which in combination comprise a therapeutically effective dose, according to a particular dosing regimen.
  • the FOXP3 edited hematopoietic cells and one or more other therapeutic agents can be administered in at least one therapeutic dose.
  • Administration of the separate pharmaceutical compositions can be performed simultaneously or at different times (i.e., sequentially, in either order, on the same day, or on different days), as long as the therapeutic effect of the combination of these substances is caused in the subject undergoing therapy.
  • compositions described herein may be included in a kit.
  • isoform 1 and 2 hematopoietic edFOXP3 cells i.e., gene corrected CD4 + T lymphocytes, gene corrected HSPC, etc.
  • a CRISPR/Cas9 vector and a FOXP3 homology donor vector, as described herein, for expression of FOXP3 hematopoietic cells to produce isoform 1 and 2 CD4 edFOXP3 T cells may be included in the kit.
  • untransduced hematopoietic cells are provided with the CRISPR/Cas9 RNP complex and the FOXP3 homology donor vectors separate.
  • the kit may also comprise nucleotransfection agents, agents for purification of cells (e.g., microbeads for selection of transfected cells having the NGFR surface marker), agents for maintaining or culturing cells, such as media, and optionally one or more other factors, such as cytokines (e.g., IL-2), growth factors, antibiotics, and the like.
  • kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.
  • the kit may comprise one or more containers holding the hematopoietic cells and/or CRISPR/Cas9 vector and FOXP3 homology donor vectors, and other agents.
  • Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes.
  • Containers can be formed from a variety of materials, including glass or plastic.
  • a container may have a sterile access port (for example, the container may be a vial having a stopper pierceable by a hypodermic injection needle).
  • the kit can further comprise a container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution, or dextrose solution. It can also contain other materials useful to the end-user, including other pharmaceutically acceptable formulating solutions such as buffers, diluents, filters, needles, and syringes or other delivery devices.
  • a pharmaceutically-acceptable buffer such as phosphate-buffered saline, Ringer's solution, or dextrose solution.
  • the delivery device may be pre-filled with the compositions.
  • the kit can also comprise a package insert containing written instructions for methods of treating inflammatory conditions with the cells, as described herein.
  • the package insert can be an unapproved draft package insert or can be a package insert approved by the Food and Drug Administration (FDA) or other regulatory body.
  • FDA Food and Drug Administration
  • the kit comprises a CRISPR/Cas9 vector and a FOXP3 homology donor vector comprising the components arranged as depicted in the vector map shown in FIG. 1 A.
  • the kit comprises a recombinant FOXP3 homology donor vector , comprising a coding sequence for FOXP3, usually a full-length coding sequence.
  • the coding sequence may be a cDNA, or may comprise one or more introns.
  • the coding sequence can be modified, or diverged, to incorporate synonymous mutations at the nucleotide level according to the redundant codon usage system, to prevent premature recombination while still encoding for a wild-type protein.
  • the FOXP3 sequence encodes a functional, wild-type FOXP3 protein, although for research purposes a mutated form may be encoded.
  • the FOXP3 coding sequence is generally not linked to a promoter in the vector, and is expressed in the cell by the native FOXP3 promoter.
  • the FOXP3 coding sequence may be operably linked to a polyadenylation sequence, including without limitation BGH polyadenylation signal.
  • the homology vector optionally comprises a marker sequence, including without limitation a truncated nerve growth factor receptor (tNGFR) operably linked to an IRES or a promoter, e.g. the phosphoglycerate kinase 1 (PGK) promoter.
  • the homology donor vector further comprises a 5’ and 3’ arm of homology to the chromosomal site; where the homology arms may be centered on the cut site of the sgRNA.
  • IPEX X-linked
  • FOXP3 forkhead box protein 3
  • Treg thymic- derived regulatory T cell
  • Teff CD4+ effector T
  • IPEX is an ideal candidate for a gene therapy approach whereby patient hematopoietic stem and progenitor (HSPC) cells or T cells are gene corrected ex vivo and reinfused in the patient.
  • HSPC patient hematopoietic stem and progenitor
  • CRISPR clustered regularly interspaced short palindromic repeat
  • Cas9 CRISPR-associated protein 9
  • this gene correction approach provides a more complete and long- term treatment for IPEX syndrome and circumvent the need for matched hematopoietic stem cell donors.
  • HDR homology directed repair
  • F0XP3 E3-11 gene editing construct that enables the expression of both F0XP3 isoforms.
  • the regulatory regions of FOXP3 comprise a specific promoter and 3 conserved FOXP3- specific regulatory elements (CNS1 -3).
  • CNS1 plays a role in peripheral Treg induction, as shown in CNS1 deficient mice who displayed unaltered thymic Treg differentiation but a decrease in Tregs in gut associated lymphoid tissues as well as mesenteric lymph nodes.
  • CNS3 is a pioneer element containing a c-Rel transcription factor binding site.
  • C-Rel binds to CNS3 downstream of TCR activation, facilitating Foxp3 expression and Treg differentiation.
  • CNS3 deficient mice had 5-fold less Foxp3+ CD4 single-positive thymic Tregs.
  • CNS2 contains a CpG island that is exclusively demethylated in mature Tregs, an event that maintains constant Foxp3 expression. Consequently, CNS2 deficient Treg cells lose Foxp3 expression over time.
  • CRISPR/Cas9 mediated FOXP3 gene editing in HSPC. While lentiviral (LV) approaches lead to semi-random insertion of variable copies of the LV template per cell, gene editing with CRISPR/Cas9 allows genetic manipulation at specific loci. To maintain FOXP3 gene expression under the control of the endogenous promoter and CNS regulatory elements, a strategy was developed for FOXP3 gene correction utilizing CRISPR/Cas9 and AAV6 virus for homologous template delivery, containing full length FOXP3 cDNA, that can restore FOXP3 expression independent of the patient mutations, which are located throughout the gene.
  • LV lentiviral
  • that construct contained a truncated NGFR surface marker gene under a constitutive promoter, PGK, which marks edited cells, enabling their purification and monitoring.
  • PGK constitutive promoter
  • This strategy allows the inserted FOXP3 sequence to be under the control of the regulatory elements at the FOXP3 locus.
  • FOXP3 gene edited Tregs from IPEX patients showed restoration of FOXP3 expression and suppressive capacity, up to the lower level of normal.
  • Tregs derived from these edited HSPCs were fewer in number and showed reduced FOXP3 expression compared to wild type controls. This result suggests that a better level of FOXP3 expression may be necessary for optimal Treg commitment. The presence of only full-length isoform may not be sufficient to fully support Treg development or stability.
  • the induction and stability of FOXP3 expression may be affected by the site of the construct insertion or the loss of introns and 3’ UTR sequences.
  • the donor template was inserted after exon 1 , and thus CNS3 was moved downstream of the inserted gene cassette. The shift of the CNS3 may spatially interfere with assembly of transcriptional complexes associated with induction of FOXP3 expression during Treg development.
  • mouse Foxp3 is only expressed as the full-length isoform in Tregs and unlike in humans, mouse Teff cells do not express the gene. This underscores differences in FOXP3 and T cell biology in mice and humans. While many studies have been done on the role of Foxp3 in the immune system in mice, there may be subtleties in function of the gene not captured by mouse models. Hence, an appropriate gene editing strategy aimed at preserving FOXP3 gene regulation and splicing together with the humanized mouse model may be a unique opportunity to clarify the need for both isoforms in IPEX syndrome patients.
  • FOXP3A2 One of the isoforms, FOXP3A2, lacks one of two FOXP3 encoded nuclear export signals (NES), is highly expressed and appears to be the dominant isoform in both activated Teff and Treg.
  • FOXP3A2 also lacks the binding sites to interact with transcriptional regulators STAT3 or ROR family members, RORyt and RORcc. Zhou et al. demonstrated that loss of RORyT binding leads to increased expression of IL17A, a key cytokine driving TH17 polarization, suggesting a FOXP3 isoform specific role in determining Treg/TH17 fate lineages.
  • FOXP3A2 but not FOXPFL, induces transcription of GARP (glycoprotein A repetitions predominant), which plays a key role in suppressive activities of Treg cells.
  • GARP glycoprotein A repetitions predominant
  • FOXP3FL+ FOXP3A2 led to a significant reduction in IL-22 production and a visible, although not statistically significant, reduction of IL-17A, suggesting complementary activities of both isoforms are required to reduce expression of IL- 17A and IL-22.
  • FOXP3 Gene Editing with preserved Isoform splicing A CRISPR system was designed to target the FOXP3 gene downstream of the alternatively spliced exon. Similar to our previously published FOXP3 FL construct, our new FOXP3 construct contains NGFR reporter gene, which enable tracking and purification of edited cells (FIG. 1 ). This refined system inserts a FOXP3 cDNA encoding exons 3-1 1 (FOXP3 3-11 ) into the FOXP3 gene locus at exon 3 permitting expression of both isoforms. This approach will enable endogenous regulation of FOXP3 gene expression from the inserted cDNA.
  • Treg cell specific demethylated region (TSDR), which is demethylated only in Treg and represent the most strict and precise method for enumeration of T reg cell number form given sample.
  • TSDR Treg cell specific demethylated region
  • T cells from the spleens of engrafted mice into Treg (CD4 + CD25 + CD127 l0 ), Teff 1 (CD4 + CD25 l0 CD127 l0 ) and Teff 2 (CD4 + CD25 l0 CD127 int/hi ) populations we showed that when derived from control HSPCs, as expected, the Teff 1 and Teff 2 populations had low TSDR demethylation and the majority of sorted Tregs had TSDR demethylation. However, sorted Treg cells derived from FOXP3 3 ' 11 HSPC edited HSPCS were missing an epigenetic mark of TSDR demethylation.
  • the E3-1 1 construct was modified to (1 ) remove the strong PGK promoter, where the NGFR marker is tied to FOXP3 transcription via an IRES.
  • CRISPR-mediated editing is optimal for preserving endogenous regulation, and at the same time can preserve the natural splicing, resulting in expression of the two main FOXP3 isoforms and that guarantees appropriate function of Treg and Teff cells and therefore has the best curative potential for IPEX.
  • the donor template also contains the truncated nerve growth factor receptor (tNGFR).
  • tNGFR truncated nerve growth factor receptor
  • This surface marker has been used clinically for selection and tracking of genetically engineered cells.
  • This surface marker can be inserted downstream of the FOXP3 3-1 1 construct under a constitutive promoter (i.e. PGK), and be expressed independently from the upstream FOXP3 gene in all the edited cells.
  • tNGFR can be inserted together with an Internal Ribosome Entry Sites (IRES) that will allow expression in all the F0XP3 expressing cells only.
  • IRS Internal Ribosome Entry Sites
  • the coding sequences of the constructs are inserted by CRISPR/Cas9-mediated doublestrand break followed by homologous recombination.
  • the sgRNA used to target exon 3 has the sequence: (SEQ ID NO:2) ATCCACCGTTGAGAGCTGGG.
  • the nucleotide sequence marked E3-11 in Figure 1 corresponds to a nucleotide sequence encoding the amino acid sequence (SEQ ID NO:1) corresponding to exon 3 to 11 amino acid sequence of human FOXP3.
  • Such an amino acid sequence can be coded by different nucleotide sequences, for example as shown in the construct in any of Figures 9, 10 and 11 .
  • the left homology arm (LHA) in these constructs has the sequence (SEQ ID NO:3) GGGCTGAGGCCAGCTCTGCAACTTATTAGCTGTTTGATCTTTAAAAAGTTACTCGATCTCC ATGAGCCTCAGTTTCCATACGTGTAAAAGGGGGATGATCATAGCATCTACCATGTGGGCTT GCAGTGCAGAGTATTTGAATTAGACACAGAACAGTGAGGATCAGGATGGCCTCTCACCCA CCTGCCTTTCTGCCCAGCTGCCCACACTGCCCCTAGTCATGGTGGCACCCTCCGGGGCA CGGCTGGGCCCCTTGCCCCACTTACAGGCACTCCTCCAGGACAGGCCACATTTCATGCAC CAGGTATGGACGGTGAATGGGCAGGGAGGAGGGAGCAGGTGGGAGAACTGTGGGGAGG GGCCCCGAGTCAGGCTGAACCACAGCCCACATGTGCCCCCCCCAG
  • the right homology arm (RHA) in these constructs has the sequence (SEQ ID NO:4) AGCTCTCCaCAGTGGATGCCCACGCCCGGACCCCTGTGCTGCAGGTGCACCCCCTGGAG AGCCCAGCCATGATCAGCCTCACACCACCCACCACCGCCACTGGGGTCTTCTCCCTCAAG GCCCGGCCTGGCCTCCCACCTGGTAACACCTCAGCCCGTACCCCATGGCTTCACAGAAC CCCCAAGTCCCCAGATCCTTGGCTGTGAGCAGTGTAGGCTATTCTGAATTGCAGTACTCTG GGGGTCAAAGGTGTCAGGTCTCAGAGGCTTGGAAACTCCACCCTCCAAAAAACGTCAGGT GCAGAACCTTAAAGATGCAGAATGTCAAAATCACAAAACCACAGAGCTTTACAAAGCTAGT CAAAATGTCAGCACCTGCGAATGGCCGTCTTTAAGCTTCT
  • SEQ ID NO:5 Shown in FIGS. 9, 10 and 11 are SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, which correspond to the nucleotide sequence of the initial construct with PGK; the IRES construct, and an optimized IRES construct.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des compositions et des procédés se rapportant à des cellules hématopoïétiques à édition du gène FOXP3, comprenant des cellules souches et progénitrices hématopoïétiques, des cellules progénitrices lymphoïdes et des lymphocytes T CD4+. L'approche de correction du gène FOXP3 basée sur CRISPR utilise une réparation dirigée par homologie pour insérer l'ADNc de FOXP3 au niveau de l'exon 3 du locus de gène endogène, préservant l'épissage endogène se produisant au niveau de l'exon 2 et permettant ainsi l'expression d'isoformes de FOXP3, y compris l'isoforme de pleine longueur (FL) et l'isoforme à délétion de l'exon 2 (Δ2). Les cellules à édition du gène sont utiles dans la thérapie cellulaire pour restaurer des fonctions immunitaires normales et favoriser la tolérance immunitaire.
PCT/US2022/053529 2021-12-21 2022-12-20 Édition de gènes basée sur crispr pour préserver l'épissage et l'expression d'isoformes de foxp3 1 et 2 WO2023122099A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163292354P 2021-12-21 2021-12-21
US63/292,354 2021-12-21

Publications (2)

Publication Number Publication Date
WO2023122099A2 true WO2023122099A2 (fr) 2023-06-29
WO2023122099A3 WO2023122099A3 (fr) 2023-08-03

Family

ID=86903508

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/053529 WO2023122099A2 (fr) 2021-12-21 2022-12-20 Édition de gènes basée sur crispr pour préserver l'épissage et l'expression d'isoformes de foxp3 1 et 2

Country Status (1)

Country Link
WO (1) WO2023122099A2 (fr)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019210078A1 (fr) * 2018-04-27 2019-10-31 Seattle Children's Hospital (dba Seattle Children's Research Institute) Expression de foxp3 humain dans des lymphocytes t à édition génique
CA3141159A1 (fr) * 2019-05-21 2020-11-26 Sangamo Therapeutics, Inc. Expression transgenique controlee dans des lymphocytes t regulateurs
EP4103591A4 (fr) * 2020-02-13 2024-09-04 Univ Leland Stanford Junior Lymphocytes t modifiés par un gène foxp3 à base de crispr et précurseurs de cellules souches hématopoïétiques permettant de traiter des patients atteints de syndrome ipex

Also Published As

Publication number Publication date
WO2023122099A3 (fr) 2023-08-03

Similar Documents

Publication Publication Date Title
US20240117352A1 (en) Expression of foxp3 in edited cd34+ cells
US20230081343A1 (en) Crispr-based foxp3 gene engineered t cells and hematopoietic stem cell precursors to treat ipex syndrome patients
JP7198823B2 (ja) 全身においてタンパク質を発現させるためのプラットフォームとしての遺伝子工学操作された造血幹細胞
JP7321934B2 (ja) 幹細胞移植のための非遺伝毒性移植前処置レジメン
US20210253652A1 (en) Expression of human foxp3 in gene edited t cells
US9592259B2 (en) APC-mediated tolerance induction for therapy of multiple sclerosis
US20220323503A1 (en) Methods and compositions for reconstituting microglia
WO2016011381A1 (fr) Diminution de l'expression et/ou de la fonction de cxcr4 pour améliorer la prise de greffe de cellules souches hématopoïétiques
JP2024506758A (ja) 改変された幹細胞組成物およびその使用方法
CN113939319A (zh) 靶向cd19的基因工程化t细胞针对b细胞恶性肿瘤的同种异体细胞疗法
JP2020517720A (ja) ネガティブ選択により誘導されるｃｄ３４＋幹細胞を含む治療用製剤
US20230192808A1 (en) Hla engineering methods and compositions for treatment of autoimmunity
WO2023122099A2 (fr) Édition de gènes basée sur crispr pour préserver l'épissage et l'expression d'isoformes de foxp3 1 et 2
EP4419114A1 (fr) Compositions de cellules souches modifiées et leurs procédés d'utilisation
US20230220059A1 (en) Genetically engineered t cells expressing bcma-specific chimeric antigen receptors and uses thereof in cancer therapy
JP2020517289A (ja) Ｈｌａ遺伝子のｒｎａガイドゲノム編集を使用して関節リウマチを処置する方法
EP4104850A1 (fr) Optimisation d'un récepteur antigénique chimérique
BR112019014406A2 (pt) métodos de tratar esclerose múltipla usando células t autólogas
EP4130263A1 (fr) Composé et procédé pour le ciblage spécifique du gène hax1
US20240066067A1 (en) In utero transplantation of factor viii-expressing cells for treatment of hemophilia
WO2020179931A1 (fr) Technique d'édition génique à haut débit
Candotti Gene therapy for immunodeficiency
WO2024173594A1 (fr) Compositions de cellules souches modifiées et procédés d'utilisation
CN117545489A (zh) 修饰的干细胞组合物及其使用方法
WO2019050841A1 (fr) Composition de cellules souches hématopoïétiques

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22912392

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE