WO2022266414A1 - Compounds and methods for reducing ifnar1 expression - Google Patents
Compounds and methods for reducing ifnar1 expression Download PDFInfo
- Publication number
- WO2022266414A1 WO2022266414A1 PCT/US2022/033935 US2022033935W WO2022266414A1 WO 2022266414 A1 WO2022266414 A1 WO 2022266414A1 US 2022033935 W US2022033935 W US 2022033935W WO 2022266414 A1 WO2022266414 A1 WO 2022266414A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- certain embodiments
- modified oligonucleotide
- modified
- nucleobase
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7156—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interferons [IFN]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3525—MOE, methoxyethoxy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
Definitions
- oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of IFNAR1 RNA in a cell or animal, and in certain instances reducing the amount of IFNAR1 protein in a cell or animal.
- Such oligomeric compounds, methods, and pharmaceutical compositions are useful to treat neurological diseases or conditions associated with neuroinflammation, including Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injui , neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- Aicardi-Goutieres Syndrome is a progressive inflammatory encephalopathy associated with several neuropathological manifestations, including seizures, difficulty feeding, dystonia, spasticity, delayed motor development, delayed language development, and delayed social skill development.
- Imaging of AGS patients reveals white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephaly; patients also have elevated levels of interferon alpha (IFNa) and lymphocytosis in cerebrospinal fluid.
- IFNa interferon alpha
- AGS has been associated with mutations in one of ten genes: TREX1 (DNA exonuclease), RNASEH2A, B or C (subunits of RNASEH2), SAMHD1 (dNTP hydrolase), ADAR1 (RNA editing enzyme), MDA5 (dsRNA sensor), USP18 (negative regulator of type I IFN signaling), LSM11 and RNU7-1 (components of the replication-dependent histone pre-mRNA-processing complex). Mutations in any one of these genes lead to aberrant activation of the antiviral response and high levels of IFNa (Adang, et al., 2020, J. Child Neurol., 35, 7016; Rodero, et al., 2016, J. Esp. Med., 213, 2527-2538).
- Interferon Alpha and Beta Receptor Subunit 1 (IFNARl) is one of two components of the interferon alpha receptor, involved in type I interferon signaling.
- Type I interferon signaling is elevated in AGS patients and is believed to be a key mediator of neuropathology.
- Elevated levels of type I interferon signaling are also associated with diseases or conditions such as neuroinflammation associated with stroke, brain injury, Alzheimer’s disease, neuropsychiatric systemic lupus erythematosus, neuromyelitis optica, post-operative delirium and cognitive decline, cranial radiation- induced cognitive decline, viral infection-induced cognitive decline, and ataxia telangectasia (Wlodarczyk, et al., 2021, Glia 69, 943-953; Santer, et al., 2009, J. Immunol. 182,1192-1201; Zeng, et al meaning 2019, Arthritis Res. Ther.
- diseases or conditions such as neuroinflammation associated with stroke, brain injury, Alzheimer’s disease, neuropsychiatric systemic lupus erythematosus, neuromyelitis optica, post-operative delirium and cognitive decline, cranial radiation- induced cognitive decline, viral infection-induced cognitive decline, and ataxia telangec
- Type I interferon signaling induces expression of hundreds of genes, including Interferon Induced Protein with Tetratricopeptide Repeats 1 (Ifitl), Interferon Induced Protein with Tetratricopeptide Repeats 3 (Ifit 3), and Interferon Regulatory Factor 7 (Irf7) (Li, et al., 2018, J. Biol. Chem. 292, P5845-P5859).
- Crossing a mouse model of Alzheimer’s disease with an IFNAR1 knockout mouse suppressed type I interferon signaling resulted in a glial cell anti-inflammatory response, and reduced neuroinflammation (Minter, M.R., et al., 2016, Acta Neuropathologica Commim. 4:72).
- Oligomeric compounds, methods, and pharmaceutical compositions of certain embodiments described herein are useful for reducing or inhibiting IFNAR1 expression in a cell or animal.
- IFNAR1 RNA or protein levels can be reduced in a cell or animal.
- the subject has Aicardi-Goutieres Syndrome.
- the subject has a disease or disorder associated with a mutation in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR1, MDA5, USP18, LSM11, orRNU7-l.
- the disease or disorder is AGS, stroke, epilepsy, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica or ataxia telangectasia.
- 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety.
- a 2’-deoxynucleoside is a 2 ' -(i-D-dcoxy nucleoside and comprises a 2’ ⁇ -D-deoxyribosyl sugar moiety, which has the b-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
- a 2 ‘ -dco.xy nucleoside may comprise a modified nucleobase or may comprise anRNA nucleobase (uracil).
- 2’-MOE means a I’-CXCIBbOCIU group in place of the 2’-OH group of a furanosyl sugar moiety.
- a “2’-MOE sugar moiety” or a “2’-0-methoxyethyl sugar moiety” means a sugar moiety with a 2’- 0(CH 2 ) 2 0CH 3 group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the b-D-ribosyl configuration. “MOE” means O-methoxyethyl.
- 2’-MOE nucleoside means a nucleoside comprising a 2’-MOE sugar moiety.
- 5-methylcytosine means a cytosine modified with a methyl group attached to the 5 position.
- a 5-methylcytosine is a modified nucleobase.
- “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
- amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
- the symptom or hallmark is one or more of seizures, difficulty feeding, dy stonia, spasticity, delayed motor development, delayed language development, delayed social skill development, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephaly.
- the hallmark is the level of IFNa or lymphocytosis in cerebrospinal fluid in the subject.
- population means a plurality of molecules of identical molecular formula.
- chirally enriched in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
- the molecules are modified oligonucleotides.
- the molecules are oligomeric compounds comprising modified oligonucleotides.
- the chiral center is at the phosphorous atom of a phosphorothioate intemucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate intemucleoside linkage.
- chirally controlled in reference to an intemucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
- antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
- cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
- Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and/or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.
- conjugate group means a group of atoms that is directly attached to an oligonucleotide.
- Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
- conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
- conjugate moiety means a covalently bound group of atoms that modifies one or more properties of a molecule compared to the identical molecule lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
- deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a (i-D-2 ' -dco. ⁇ ribosyl sugar moiety.
- a deoxy region is the gap of a gapmer.
- intemucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
- modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
- linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented betw een those that are linked).
- motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
- modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
- non-bicyclic modified sugar moiety means a modified sugar moiely that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
- nucleobase means an unmodified nucleobase or a modified nucleobase.
- a nucleobase is a heterocyclic moiety.
- an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
- a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase.
- a “5-methyl cytosine” is a modified nucleobase.
- a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
- nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
- nucleoside means a compound or fragment of a compound comprising a nucleobase and a sugar moiety.
- the nucleobase and sugar moiety are each, independently, unmodified or modified.
- oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
- An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
- a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
- oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
- unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
- oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
- unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
- pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension and lozenges for the oral ingestion by a subject.
- a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
- pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
- a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
- a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
- stereonorandom or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration.
- the stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
- the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
- the stereorandom chiral center is not racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety.
- the stereorandom chiral center is at the phosphorous atom of a stereorandom phosphorothioate or mesyl phosphoroamidate intemucleoside linkage.
- sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
- unmodified sugar moiety means a 2’-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2 ' -H(H) deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
- Unmodified sugar moieties have one hydrogen at each of the U, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
- modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
- symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
- a symptom is apparent to a subject or to a medical professional examining or testing said subject.
- a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
- a hallmark is apparent on a brain MRI scan.
- target nucleic acid and “target RNA” mean a nucleic acid that an oligomeric compound is designed to affect.
- Target RNA means an RNA transcript and includes pre-mRNA and mRNA unless otherwise specified.
- target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
- terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
- antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
- antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
- gapmer means a modified oligonucleotide comprising an internal region positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage.
- the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
- the internal region is a deoxy region.
- the positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5 ’-end of the internal region.
- each nucleoside of the gap is a 2 ‘ -[l-D-deoxy nucleoside.
- MOE gapmer indicates a gapmer having a gap comprising 2’ ⁇ -D-deoxynucleosides and wings comprising 2 ’-MOE nucleosides.
- a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
- hybridization means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
- RNAi agent means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics.
- RNAi agents may comprise conjugate groups and/or terminal groups.
- an RNAi agent modulates the amount and/or activity, of a target nucleic acid.
- the term RNAi agent excludes antisense agents that act through RNase H.
- RNase H agent means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNase H agents are single- stranded.
- RNase H agents are double-stranded.
- RNase H compounds may comprise conjugate groups and/or terminal groups.
- an RNase H agent modulates the amount and/or activity of a target nucleic acid.
- the term RNase H agent excludes antisense agents that act principally through RISC/Ago2.
- treating means improving a subject’s disease or condition by administering an oligomeric compound described herein.
- Rearing a subject improves a symptom relative to the same symptom in the absence of the treatment.
- treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
- terapéuticaally effective amount means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.
- Embodiment 1 A modified oligonucleotide according to the following chemical structure:
- Embodiment 2 The modified oligonucleotide of embodiment 1, which is the sodium salt or the potassium salt.
- Embodiment 4 A modified oligonucleotide according to the following chemical structure:
- Embodiment 5 The modified oligonucleotide of embodiment 4, which is the sodium salt or the potassium Embodiment 6.
- Embodiment 7 A modified oligonucleotide according to the following chemical structure:
- Embodiment 8 The modified oligonucleotide of embodiment 7, which is the sodium salt or the potassium salt.
- Embodiment 9 A modified oligonucleotide according to the following chemical structure:
- Embodiment 10 A modified oligonucleotide according to the following chemical structure:
- Embodiment 11 The modified oligonucleotide of embodiment 10, which is the sodium salt or the potassium salt.
- Embodiment 12 A modified oligonucleotide according to the following chemical structure:
- Embodiment 13 A modified oligonucleotide according to the following chemical structure:
- Embodiment 14 The modified oligonucleotide of embodiment 13, which is the sodium salt or the potassium salt.
- Embodiment 15 A modified oligonucleotide according to the following chemical structure:
- Embodiment 18 A modified oligonucleotide according to the following chemical structure: Embodiment 19.
- An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO 10), wherein:
- A an adenine nucleobase
- mC a 5 -methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2 ' -(l-D-dcoxvribos ⁇ l sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2 ' -(i-D-dco. ⁇ vribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Embodiment 21 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T e oG eo T e oT e oT eo Td s Ad s m Cd s Ad s Td s Td s Tds TdsT ds T eo T es m C es m C e (SEQ ID NO 12), wherein:
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2 ' -(i-D-dco. ⁇ vribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Embodiment 22 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: Te S T e oTeoAeoTe S m Cds m CdsAd S A ds T ds T ds A ds Td S m Cds m CdsAeoTeo m Ces m C es m Ce (SEQ ID NO 9), wherein:
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2 ' -(i-D-dcoxvribos ⁇ l sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Embodiment 23 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: Te S T ⁇ Teo m CeoA eo TeoA ds T ds T ds T ds G ds T ds T ds A ds m C ds T ds Teo m Ce S m C es Te (SEQ ID NO 13), wherein:
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2 ' -(i-D-dco. ⁇ vnbosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T C3 T co ni C co Gco" 1 Cco" 1 CcoTdsA c
- A an adenine nucleobase
- mC a 5-methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2’-p-D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Embodiment 25 A population of modified oligonucleotides of any of embodiments 1-18 or a population of oligomeric compounds of any of embodiments 19-24, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
- Embodiment 26 A pharmaceutical composition comprising a modified oligonucleotide of any of embodiments 1-18, an oligomeric compound of any of embodiments 19-24, or a population of modified oligonucleotides or population of oligomeric compounds of embodiment 25, and a pharmaceutically acceptable diluent.
- Embodiment 27 The pharmaceutical composition of embodiment 26, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.
- Embodiment 28 The pharmaceutical composition of embodiment 27, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population, and artificial cerebrospinal fluid or phosphate-buffered saline.
- Embodiment 29 A method comprising administering to a subject a modified oligonucleotide of any of embodiments 1-18, an oligomeric compound of any of embodiments 19-24, a population of modified oligonucleotides or population of oligomeric compounds of embodiment 25, or a pharmaceutical composition of any of embodiments 26-28.
- Embodiment 30 A method of treating a disease associated with type I interferon signaling, comprising administering to a subject having a disease associated with type I interferon signaling a therapeutically effective amount of a modified oligonucleotide of any of embodiments 1-18, an oligomeric compound of any of embodiments 19-24, a population of modified oligonucleotides or population of oligomeric compounds of embodiment 25, or a pharmaceutical composition of any of embodiments 26-28; thereby treating the disease associated with type I interferon signaling.
- Embodiment 31 The method of embodiment 30, wherein the disease associated with type I interferon signaling is Aicardi-Goutieres Syndrome, stroke, Neuropsychiatric Systemic Lupus Erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.
- the disease associated with type I interferon signaling is Aicardi-Goutieres Syndrome, stroke, Neuropsychiatric Systemic Lupus Erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.
- Embodiment 32 The method of embodiment 30 or embodiment 31, wherein the disease is associated with an elevated level of interferon-alpha.
- Embodiment 33 The method of any of embodiments 30-32, wherein administering the modified oligonucleotide, the oligomeric compound, the population of modified oligonucleotides or population of oligomeric compounds, or the pharmaceutical composition of reduces seizures, dystonia, spasticity, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, or microencephaly in the subject; improves feeding, motor development, language development, or social skill development in the subject; or reduces interferon alpha or lymphocytosis in the cerebrospinal fluid of the subject.
- Embodiment 34 A method of reducing expression of IFNAR1 in a cell, comprising contacting the cell with a modified oligonucleotide of any of embodiments 1-18, an oligomeric compound of any of embodiments 19-24, a population of modified oligonucleotides or population of oligomeric compounds of embodiment 25, or a pharmaceutical composition of any of embodiments 26-28.
- Embodiment 35 The method of embodiment 34, wherein the cell is a neuron or a glial cell, optionally wherein the cell is an astrocyte or microglial cell.
- Embodiment 36 The method of any of embodiments 29-33, wherein the subject is human.
- Embodiment 37 The method of embodiment 34 or embodiment 35, wherein the cell is a human cell.
- Embodiment 38 Use of a modified oligonucleotide of any of embodiments 1-18, an oligomeric compound of any of embodiments 19-24, a population of modified oligonucleotides or population of oligomeric compounds of embodiment 25, or a pharmaceutical composition of any of embodiments 26-28 for treating a disease associated with type I interferon signaling.
- Embodiment 39 Use of a modified oligonucleotide of any of embodiments 1-18, an oligomeric compound of any of embodiments 19-24, a population of modified oligonucleotides or population of oligomeric compounds of embodiment 25, or a pharmaceutical composition of any of embodiments 26-28 in the manufacture of a medicament for treating a disease associated with type I interferon signaling.
- Embodiment 40 The use of embodiment 38 or embodiment 39, wherein the disease is associated with an elevated level of interferon alpha.
- Embodiment 41 The use of any of embodiments 38-40, wherein the disease associated with type I interferon signaling is Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.
- the disease associated with type I interferon signaling is Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.
- Compound No. 1489477 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5’ to 3’) of CTTTTTCTGCTCTTATACGC (SEQ ID NO 11), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2 ' -(i-D-dcoxy nucleosides, wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester intemucleoside linkages, the intemucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl
- Compound No. 1489477 is represented by the following chemical notation: m C es T eo T eo T eo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (SEQ ID NO 11), wherein:
- A an adenine nucleobase
- mC a 5 -methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2’-p-D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Compound No. 1489477 is represented by the following chemical structure:
- an oligomeric compound comprises the sodium salt or the potassium salt of the modified oligonucleotide represented by Structure 1.
- the sodium salt of Compound No. 1489477 is represented by the following chemical structure:
- Compound No. 1489494 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5’ to 3’) of CTGTTTT AC ATTTTTTTTCC (SEQ ID NO 12), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2’ ⁇ -D-deoxynucleosides, wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester intemucleoside linkages, the intemucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine
- Compound No. 1489494 is represented by the following chemical notation: m C es T eo G eo T eo T eo T eo T ds A ds m C ds A ds T ds T ds T Cis T ds T ds T ds T eo T es m C es m C e (SEQ ID NO 12), wherein:
- A an adenine nucleobase
- mC a 5 -methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2’-p-D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Compound No. 1489494 is represented by the following chemical structure:
- an oligomeric compound comprises the sodium salt or the potassium salt of the modified oligonucleotide represented by Structure 3.
- the sodium salt of Compound No. 1489494 is represented by the following chemical structure:
- Compound No. 1489525 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5’ to 3’) of TTTATCCAATTATCCATCCC (SEQ ID NO 9), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2’ ⁇ -D-deoxynucleosides, wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages, the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2’-p-D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Compound No. 1489525 is represented by the following chemical structure:
- an oligomeric compound comprises the sodium salt or the potassium salt of the modified oligonucleotide represented by Structure 5.
- the sodium salt of Compound No. 1489525 is represented by the following chemical structure:
- Compound No. 1492069 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5’ to 3’) of TCGCCTAATTTTTCTCTCAC (SEQ ID NO 10), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ' -[i-D-dco. ⁇ y nucleosides, wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages, the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl
- Compound No. 1492069 is represented by the following chemical notation: T es m C eo G eo m C eo m C es T ds A ds A dS T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO 10), wherein:
- A an adenine nucleobase
- mC a 5 -methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2’ ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Compound No. 1492069 is represented by the following chemical structure:
- an oligomeric compound comprises the sodium salt or the potassium salt of the modified oligonucleotide represented by Structure 7.
- the sodium salt of Compound No. 1492069 is represented by the following chemical structure:
- Compound No. 1492082 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5’ to 3’) of TTTCATATTTGTTACTTCCT (SEQ ID NO 13), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2 ‘ -[l-D-dcoxy nucleosides.
- intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester intemucleoside linkages
- the intemucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
- each cytosine is a 5-methyl cytosine.
- Compound No. 1492082 is represented by the following chemical notation: T es T eo T eo m C eo A eo T eo A dS T dS T dS T dS G ds T CiS T dS A dS m C dS T dS T eo m C es m C es T e (SEQ ID NO 13), wherein:
- A an adenine nucleobase
- mC a 5 -methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2’ ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Compound No. 1492082 is represented by the following chemical structure:
- an oligomeric compound comprises the sodium salt or the potassium salt of the modified oligonucleotide represented by Structure 9.
- the sodium salt of Compound No. 1492082 is represented by the following chemical structure:
- Compound No. 1492131 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5 ’ to 3 ’) of TTCGCCTAATTTTTCTCTCA (SEQ ID NO 14), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2 ‘ -[l-D-dco. ⁇ y nucleosides.
- intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester intemucleoside linkages
- the intemucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
- each cytosine is a 5-methyl cytosine.
- Compound No. 1492131 is represented by the following chemical notation: T es T eo m C eo G eo m C eo m C eo T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (SEQ ID NO 14), wherein:
- A an adenine nucleobase
- mC a 5 -methyl cytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- e a 2’-MOE sugar moiety
- d a 2’ ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage
- o a phosphodiester intemucleoside linkage.
- Compound No. 1492131 is represented by the following chemical structure:
- an oligomeric compound comprises the sodium salt or the potassium salt of the modified oligonucleotide represented by Structure 11.
- the sodium salt of Compound No. 1492131 is represented by the following chemical structure:
- oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
- Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
- Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage.
- Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
- modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
- Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 3’, 4’, and/or 5’ positions.
- Examples of 2’ -substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to 2'-0(CH 2 ) 2 0CH 3 (“MOE” or “O-methoxyethyl”).
- modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
- a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring b-D-deoxyribosyl configuration.
- modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
- a 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
- 2’-modified sugar moieties described herein are in the b-D-ribosyl isomeric configuration unless otherwise specified.
- modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. Examples of modified nucleobases include 5-methylcytosine.
- nucleosides of modified oligonucleotides may be linked together using one or more modified intemucleoside linkages.
- the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom.
- Modified intemucleoside linkages compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
- intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
- intemucleoside linkages having a chiral center include but are not limited to phosphorothioates.
- Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate or other linkages containing chiral centers in particular stereochemical configurations.
- populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
- modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration.
- the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
- the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
- modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al, JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (S'p) configuration.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
- modified oligonucleotides comprising (Rp) and/or (S'p) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
- chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
- modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
- a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
- oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
- sugar motifs include but are not limited to any of the sugar modifications discussed herein.
- modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
- the three regions of a gapmer motif (the 5’-wing, the gap, and the 3’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
- the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
- the sugar moieties within the gap are the same as one another.
- the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
- the sugar motifs of the two wings are the same as one another (symmetric gapmer).
- the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
- the wings of a gapmer comprise 1-6 nucleosides.
- each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
- at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety.
- at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
- the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2’ ⁇ -D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
- the gapmer is a deoxy gapmer.
- the nucleosides on the gap side of each wing/gap junction comprise 2’ - deoxy ribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
- each nucleoside of the gap comprises a 2’-p-D-deoxyribosyl sugar moiety.
- each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
- one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety.
- the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing],
- a 3- 10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap.
- that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2 ' -
- a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 10 linked 2’- b-D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3 ’-wing.
- a 6-10-4 MOE gapmer consists of 6 linked 2’-MOE nucleosides in the 5’-wing, 10 linked 2’- b-D-deoxynucleosides in the gap, and 4 linked 2’-MOE nucleosides in the 3’-wing.
- a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’ -wing, 10 linked 2 ' - b-D-deoxy nucleosides in the gap, and 3 linked cEt nucleosides in the 3 ’-wing.
- modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers.
- modified oligonucleotides have a sugar motif selected from 5’ to 3’: eeeeeddddddddddeeeee; wherein each “d” represents a 2’ ⁇ -D-deoxyribosyl sugar moiety , and each “e” represents a 2’- MOE sugar moiety.
- modified oligonucleotides have a sugar motif selected from 5’ to 3’: eeeeeeddddddddddeeee; wherein each “d” represents a 2’ ⁇ -D-deoxyribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety.
- modified oligonucleotides have the sugar motif from 5’ to 3’: kkkdddddddddkkk; wherein each “d” represents a 2’ ⁇ -D-deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety.
- oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
- each nucleobase is modified.
- none of the nucleobases are modified.
- each purine or each pyrimidine is modified.
- each cytosine is modified.
- some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines.
- all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
- oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
- one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
- the sugar moiety of said nucleoside is a 2’- deoxyribosyl sugar moiety.
- oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
- each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
- each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate, a (L ' r ) phosphorothioate, and a (7/p) phosphorothioate.
- the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
- some, or all of the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
- the terminal intemucleoside linkages are modified.
- the sugar motif of a modified oligonucleotide is a gapmer
- the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
- all of the phosphorothioate linkages are stereorandom.
- all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates
- the gap comprises at least one Sp, Sp, Rp motif.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
- modified oligonucleotides have an intemucleoside linkage motif of (5’ to 3’): sooosssssssssooss phosphorothioate intemucleoside linkage, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- modified oligonucleotides have an intemucleoside linkage motif of (5’ to 3’): sooooossssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
- Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
- conjugate groups orterminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
- terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
- terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
- oligonucleotides are covalently attached to one or more conjugate groups.
- conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
- conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide.
- the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide.
- the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
- a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety.
- RRMS ribose replacement modification subunit
- a cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur.
- the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
- the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
- the modified oligonucleotide is a gapmer.
- conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
- Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et ah, Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et ah, Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al. ,Ann. N.
- a phospholipid e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et ah, Tetrahedron Lett., 1995, 36, 3651-3654; Shea et ah, Nucl.
- the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, 17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cll alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkeny
- the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, C20 alkyl, C16 alky l, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl 1 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
- a conjugate group is a lipid having the following structure:
- Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
- intercalators include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, bio
- a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (,S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5- triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (,S)-(+)-pranoprofen
- Conjugate moieties are attached to oligonucleotides through conjugate linkers.
- the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
- the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
- a conjugate linker comprises pyrrolidine.
- a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
- conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate moieties to compounds, such as the oligonucleotides provided herein.
- a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with a particular site on a compound and the other is selected to react with a conjugate moiety. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
- bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alky l, alkenyl, and alkynyl.
- conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxy late (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
- conjugate linkers include but are not limited to a substituted or unsubstituted Ci-Cio alkyl, a substituted or unsubstituted C2-C10 alkenyl or a substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
- conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker- nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
- a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N- isobutyiylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
- linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
- an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
- the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
- an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
- conjugate linkers comprise no more than 10 linker-nucleosides.
- conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
- a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
- oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
- certain conjugate linkers may comprise one or more cleavable moieties.
- a cleavable moiety is a cleavable bond.
- a cleavable moiety is a group of atoms comprising at least one cleavable bond.
- a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
- a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
- a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
- a cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
- a cleavable moiety comprises or consists of one or more linker-nucleosides.
- the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
- such cleavable bonds are unmodified phosphodiester bonds.
- a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
- the cleavable moiety is 2'-deoxyadenosine.
- a conjugate group comprises a cell-targeting moiety.
- a conjugate group has the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
- n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
- conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
- cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
- each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one ty pe of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.
- a conjugate group comprises a cell-targeting conjugate moiety.
- a conjugate group has the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
- n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
- conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
- cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
- cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
- oligomeric compounds comprise one or more terminal groups.
- oligomeric compounds comprise a stabilized 5’-phosphate.
- Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates.
- terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides.
- terminal groups comprise one or more 2’ -linked nucleosides or sugar moieties.
- the 2 ’-linked group is an abasic sugar moiety.
- oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
- antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
- Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
- hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
- certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
- RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
- the DNA in such an RNA:DNA duplex need not be unmodified DNA.
- described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
- one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
- an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
- RISC RNA-induced silencing complex
- certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
- Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA or dsRNAi) or single- stranded (ssRNA).
- hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
- Antisense activities may be observed directly or indirectly.
- observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or animal.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
- the target nucleic acid is an endogenous RNA molecule.
- the target nucleic acid encodes a protein.
- the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
- the target RNA is a mature mRNA.
- the target nucleic acid is a pre- mRNA.
- the target region is entirely within an intron.
- the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is an IFNAR1 nucleic acid.
- an IFNARl nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No.
- contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of IFNARl RNA, and in certain embodiments reduces the amount of IFNARl protein.
- the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
- the pharmacologically relevant tissues are the brain and spinal cord.
- the target nucleic acid is expressed in a pharmacologically relevant cell.
- the pharmacologically relevant cell is a neuron or a glial cell.
- the pharmacologically relevant cell is an astrocyte or a microglial cell.
- the pharmacologically relevant cell is a vascular smooth muscle cell a vascular endothelial cell, or a pericyte.
- Certain embodiments provided herein relate to methods of inhibiting IFNAR1 expression, which can be useful for treating a disease associated with neuroinflammation, for example, a disease associated with elevated type I interferon signaling, or with over-expression of a type I interferons in a subject, by administration of an oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprising a modified oligonucleotide having a nucleobase sequence complementary to an IFNAR1 nucleic acid.
- diseases treatable with the oligomeric compounds, modified oligonucleotides, oligomeric duplexes, and methods provided herein include neurological diseases or conditions associated with neuroinflammation, for example, a disease associated with elevated type I interferon signaling, or with over-expression of type I interferons, selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- a disease associated with elevated type I interferon signaling or with over-expression of type I interferons, selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s
- a method comprises administering to a subject an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex, any of which having a nucleobase sequence complementary to an IFNAR1 nucleic acid.
- the subject has a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- administering the therapeutically effective amount of the oligomeric compound, or modified oligonucleotide improves a symptom or hallmark of a disease or condition associated with neuroinflammation.
- the symptom or hallmark is selected from seizures, difficulty feeding, dystonia, spasticity, delayed motor development, delayed language development, delayed social skill development, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephaly.
- administering the therapeutically effective amount of the oligomeric compound or the modified oligonucleotide reduces type I IFN signaling or lymphocytosis in cerebrospinal fluid in the subject.
- a method of inhibiting expression of IFNAR1 nucleic acid, such as RNA, in a subject having a disease associated with neuroinflammation, for example, a disease associated with elevated type I interferon signaling, or with over-expression of type I interferons comprises administering to the subject an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex, any of which having a nucleobase sequence complementary to an IFNAR1 nucleic acid, thereby inhibiting expression of IFNAR1 nucleic acid in the subject.
- administering the oligomeric compound, modified oligonucleotide, or oligomeric duplex inhibits expression of IFNAR1 in the brain or spinal cord.
- the subject has a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- a method of inhibiting expression of IFNAR1 nucleic acid in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex, any of which having a nucleobase sequence complementary to an IFNAR1 nucleic acid, thereby inhibiting expression of IFNAR1 nucleic acid in the cell.
- the cell is glial cell, for example, an astrocyte or a microglial cell.
- the cell is in a subject having a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus eiythematosus, neuroinflammation following traumatic brain injuiy, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus eiythematosus, neuroinflammation following traumatic brain injuiy, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- Certain embodiments are drawn to an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex, any of which having a nucleobase sequence complementary to an IFNAR1 nucleic acid, for use in treating a disease associated with neuroinflammation associated with neuroinflammation, for example, a disease associated with elevated type I interferon signaling, or with over-expression of IFNa.
- the disease is a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex is for use in improving a symptom or hallmark of a disease or condition associated with neuroinflammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus eiy thematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation- induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia .
- a disease or condition associated with neuroinflammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus eiy thematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation- induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica,
- the symptom or hallmark is selected from seizures, difficulty feeding, dystonia, spasticity, delayed motor development, delayed language development, delayed social skill development, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephaly.
- an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex is for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid in a subject.
- Certain embodiments are drawn to an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex, any of which comprising a modified oligonucleotide having a nucleobase sequence complementary to an IFNAR1 nucleic acid, for the manufacture or preparation of a medicament for treating a disease associated with neuroinflammation, for example, a disease associated with elevated type I interferon signaling, or with over-expression of IFNa.
- the disease is a neurological disease or condition associated with neuroinllammation selected from Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- Aicardi-Goutieres Syndrome stroke
- neuropsychiatric systemic lupus erythematosus neuroinflammation following traumatic brain injury
- neuro-autoimmune disorders Alzheimer’s disease
- post-operative delirium and cognitive decline cranial radiation-induced cognitive decline
- viral infection-induced cognitive decline neuromyelitis optica
- ataxia telangiectasia ataxia telangiectasia.
- an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex is for the manufacture or preparation of a medicament for improving symptoms or hallmarks associated with Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer’s disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.
- the symptom or hallmark is selected from seizures, difficulty feeding, dystonia, spasticity, delayed motor development, delayed language development, delayed social skill development, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephaly.
- an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex is for the manufacture or preparation of a medicament for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid in a subject.
- the oligomeric compound, modified oligonucleotide, or oligomeric duplex can be any described herein.
- compositions comprising one or more oligomeric compounds.
- the one or more oligomeric compounds each consists of a modified oligonucleotide.
- the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
- a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
- the sterile saline is pharmaceutical grade saline.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
- the sterile water is pharmaceutical grade water.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate- buffered saline (PBS).
- PBS phosphate- buffered saline
- the sterile PBS is pharmaceutical grade PBS.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid.
- the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.
- a pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and PBS. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.
- a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid.
- a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid.
- a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid.
- the artificial cerebrospinal fluid is pharmaceutical grade.
- pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients.
- excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone .
- oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
- Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
- compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
- pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
- prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
- Lipid moieties have been used in nucleic acid therapies in a variety of methods.
- the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly -cationic lipids are formed without the presence of a neutral lipid.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
- a lipid moiety' is selected to increase distribution of a pharmaceutical agent to fat tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
- compositions comprise a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions.
- Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
- certain organic solvents such as dimethylsulfoxide are used.
- compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
- compositions comprise a co-solvent system.
- co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
- co-solvent systems are used for hydrophobic compounds.
- a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
- the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
- co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
- compositions are prepared for oral administration.
- pharmaceutical compositions are prepared for buccal administration.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
- compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
- Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
- certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms.
- modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
- a dose may be in the form of a dosage unit.
- a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound.
- the free acid is in equilibrium with anionic and salt forms.
- the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
- a modified oligonucleotide or an oligomeric compound may be partially or fully de-protonated and in association with Na+ ions.
- the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose.
- a dose, or dosage unit, of 10 mg of Compound No. 1492069 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1492069.
- an oligomeric compound comprises a conjugate group
- the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
- RNA nucleoside comprising a 2’-OH sugar moiety and a thymine base
- RNA oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base
- RNA having a modified sugar 2 ’ -OH in place of one 2 ’ -H of DNA
- RNA having a modified base thymine (methylated uracil) in place of an uracil of RNA
- nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5 -position.
- Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or ( S ), as a or b such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
- Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
- Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
- tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
- the compounds described herein include variations in w hich one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element.
- compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 3 ⁇ 4 hydrogen atoms.
- Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 3 ⁇ 4, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 0 or 18 0 in place of 16 0, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
- non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
- radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
- Example 1 Design of modified oligonucleotides complementary to human IFNAR1 nucleic acid
- Modified oligonucleotides complementary to a human IFNAR1 nucleic acid were designed, as described in the tables below.
- “Start site” indicates the 5 ’ -most nucleoside to which the modified oligonucleotide is complementaiy in the target nucleic acid sequence.
- “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
- Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO 1 (GENBANK Accession No. NC 000021.9, truncated from 33321001 to 33363000), to SEQ ID NO 2 (GENBANK Accession No. NM 000629.2), or to both.
- ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
- the modified oligonucleotides in the table below are 5-10-5 MOE gapmers.
- the gapmers are 20 nucleosides in length, wherein the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d” represents a 2 ‘ -p-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sooosssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
- Each cytosine residue is a 5- methyl cytosine.
- the modified oligonucleotides in the table below are 6-10-4 MOE gapmers.
- the gapmers are 20 nucleosides in length, wherein the sugar motif for the gapmers is (from 5’ to 3’): eeeeeeddddddddddeeee; wherein each “d” represents a 2 ' -(i-D-dco. ⁇ vribos> l sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sooooossssssssoss; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
- Each cytosine residue is a 5- methyl cytosine.
- Example 2 Activity of modified oligonucleotides complementary to human IFNAR1 in transgenic mice
- Modified oligonucleotides described above were tested in a human IFNAR1 transgenic mouse model.
- Transgenic mice that express a human IFNAR1 transcript were generated.
- Exons 1-6 and ⁇ 4.9kB of upstream sequence of the human IFNAR1 gene from fosmid ABCS-41091 400N2 was subcloned into a BAC, CTD-2289N21, containing exons 7-11 of the human IFNAR1 genes and 56 kB of downstream sequence, to generate a complete IFNARl transgene.
- the engineered BAC was digested with Notl to remove the BAC backbone.
- the purified BAC fragment, containing the complete human IFNARl gene was introduced into fertilized eggs from C57BL/6 mice by pronuclear injection to produce three founder lines. Line 17505 was used in the experiments described herein.
- mice were divided into groups of 2 mice each. Each mouse received a single ICV bolus of 300 pg of modified oligonucleotide. A group of 2-4 mice received PBS as a negative control.
- mice Two weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure amount of IFNAR1 RNA using human primer probe setRTS44352 (forward sequence CTTTCAAGTTCAGTGGCTCCA, designated herein as SEQ ID NO 6; reverse sequence CGTTTTGAGGAAAGACACACTG, designated herein as SEQ ID NO 7; probe sequence
- Example 3 Potency of modified oligonucleotides complementary to human IFNAR1 RNA in transgenic mice
- mice Human IFNARl transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses indicated in tables below. A group of 4 mice received PBS as a negative control.
- mice Two weeks post treatment, mice were sacrificed, and RNA was extracted from the spinal cord, cortex, and cerebellum for quantitative real-time RTPCR analysis of RNA expression of IFNARl using primer probe set RTS44352 (described herein above). Results are presented as percent human IFNARl RNA relative to PBS control, adjusted to 18S PCR (described herein above). The half maximal effective dose (ED 50 ) of each modified oligonucleotide was calculated using GraphPad Prism 7 softw are (GraphPad Software, San Diego, CA).
- IFNAR1 RNA in comparison to the PBS control.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Endocrinology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020247001511A KR20240023602A (ko) | 2021-06-18 | 2022-06-17 | Ifnar1 발현을 감소시키기 위한 화합물 및 방법 |
| AU2022293556A AU2022293556A1 (en) | 2021-06-18 | 2022-06-17 | Compounds and methods for reducing ifnar1 expression |
| MX2023015230A MX2023015230A (es) | 2021-06-18 | 2022-06-17 | Compuestos y metodos para reducir la expresion de ifnar1. |
| BR112023026050A BR112023026050A2 (pt) | 2021-06-18 | 2022-06-17 | Compostos e métodos para reduzir expressão de ifnar1 |
| JP2023577660A JP2024523364A (ja) | 2021-06-18 | 2022-06-17 | Ifnar1発現を低減するための化合物及び方法 |
| IL309217A IL309217A (en) | 2021-06-18 | 2022-06-17 | Compounds and Methods for Reducing IFNAR1 Expression |
| EP22825886.9A EP4355759A1 (en) | 2021-06-18 | 2022-06-17 | Compounds and methods for reducing ifnar1 expression |
| CA3223192A CA3223192A1 (en) | 2021-06-18 | 2022-06-17 | Compounds and methods for reducing ifnar1 expression |
| CN202280043046.4A CN117500815A (zh) | 2021-06-18 | 2022-06-17 | 用于降低ifnar1表达的化合物和方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163212454P | 2021-06-18 | 2021-06-18 | |
| US63/212,454 | 2021-06-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022266414A1 true WO2022266414A1 (en) | 2022-12-22 |
Family
ID=84527477
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/033935 Ceased WO2022266414A1 (en) | 2021-06-18 | 2022-06-17 | Compounds and methods for reducing ifnar1 expression |
Country Status (12)
| Country | Link |
|---|---|
| US (2) | US11753644B2 (https=) |
| EP (1) | EP4355759A1 (https=) |
| JP (1) | JP2024523364A (https=) |
| KR (1) | KR20240023602A (https=) |
| CN (1) | CN117500815A (https=) |
| AU (1) | AU2022293556A1 (https=) |
| BR (1) | BR112023026050A2 (https=) |
| CA (1) | CA3223192A1 (https=) |
| IL (1) | IL309217A (https=) |
| MX (1) | MX2023015230A (https=) |
| TW (1) | TW202317765A (https=) |
| WO (1) | WO2022266414A1 (https=) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017216390A1 (en) * | 2016-06-17 | 2017-12-21 | F. Hoffmann-La Roche Ag | Nucleic acid molecules for reduction of papd5 or papd7 mrna for treating hepatitis b infection |
| WO2019157531A1 (en) * | 2018-02-12 | 2019-08-15 | Ionis Pharmaceuticals, Inc. | Modified compounds and uses thereof |
| US20200199589A1 (en) * | 2016-09-29 | 2020-06-25 | Biogen Ma Inc. | Compounds and Methods for Reducing Tau Expression |
Family Cites Families (170)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US4500707A (en) | 1980-02-29 | 1985-02-19 | University Patents, Inc. | Nucleosides useful in the preparation of polynucleotides |
| US5132418A (en) | 1980-02-29 | 1992-07-21 | University Patents, Inc. | Process for preparing polynucleotides |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4415732A (en) | 1981-03-27 | 1983-11-15 | University Patents, Inc. | Phosphoramidite compounds and processes |
| US4973679A (en) | 1981-03-27 | 1990-11-27 | University Patents, Inc. | Process for oligonucleo tide synthesis using phosphormidite intermediates |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
| DE3329892A1 (de) | 1983-08-18 | 1985-03-07 | Köster, Hubert, Prof. Dr., 2000 Hamburg | Verfahren zur herstellung von oligonucleotiden |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| USRE34036E (en) | 1984-06-06 | 1992-08-18 | National Research Development Corporation | Data transmission using a transparent tone-in band system |
| US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
| FR2567892B1 (fr) | 1984-07-19 | 1989-02-17 | Centre Nat Rech Scient | Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons |
| US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| FR2575751B1 (fr) | 1985-01-08 | 1987-04-03 | Pasteur Institut | Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5506337A (en) | 1985-03-15 | 1996-04-09 | Antivirals Inc. | Morpholino-subunit combinatorial library and method |
| US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| DE3788914T2 (de) | 1986-09-08 | 1994-08-25 | Ajinomoto Kk | Verbindungen zur Spaltung von RNS an eine spezifische Position, Oligomere, verwendet bei der Herstellung dieser Verbindungen und Ausgangsprodukte für die Synthese dieser Oligomere. |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| AU598946B2 (en) | 1987-06-24 | 1990-07-05 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
| US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
| US4924624A (en) | 1987-10-22 | 1990-05-15 | Temple University-Of The Commonwealth System Of Higher Education | 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof |
| ATE151467T1 (de) | 1987-11-30 | 1997-04-15 | Univ Iowa Res Found | Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene |
| US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
| WO1989009221A1 (en) | 1988-03-25 | 1989-10-05 | University Of Virginia Alumni Patents Foundation | Oligonucleotide n-alkylphosphoramidates |
| US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
| US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
| US5194599A (en) | 1988-09-23 | 1993-03-16 | Gilead Sciences, Inc. | Hydrogen phosphonodithioate compositions |
| US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
| US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5721218A (en) | 1989-10-23 | 1998-02-24 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
| US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
| ATE269870T1 (de) | 1989-10-24 | 2004-07-15 | Isis Pharmaceuticals Inc | 2'-modifizierte oligonukleotide |
| US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
| US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
| US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
| US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5587470A (en) | 1990-01-11 | 1996-12-24 | Isis Pharmaceuticals, Inc. | 3-deazapurines |
| US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5859221A (en) | 1990-01-11 | 1999-01-12 | Isis Pharmaceuticals, Inc. | 2'-modified oligonucleotides |
| US7101993B1 (en) | 1990-01-11 | 2006-09-05 | Isis Pharmaceuticals, Inc. | Oligonucleotides containing 2′-O-modified purines |
| US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
| US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US6005087A (en) | 1995-06-06 | 1999-12-21 | Isis Pharmaceuticals, Inc. | 2'-modified oligonucleotides |
| US5457191A (en) | 1990-01-11 | 1995-10-10 | Isis Pharmaceuticals, Inc. | 3-deazapurines |
| US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
| US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
| US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
| US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
| GB9009980D0 (en) | 1990-05-03 | 1990-06-27 | Amersham Int Plc | Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| ES2116977T3 (es) | 1990-05-11 | 1998-08-01 | Microprobe Corp | Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente. |
| BR9106702A (pt) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals Inc | Analogo de oligonucleotideos e processos para modular a producao de uma proteina por um organismo e para tratar um organismo |
| US5378825A (en) | 1990-07-27 | 1995-01-03 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
| US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5386023A (en) | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
| US5223618A (en) | 1990-08-13 | 1993-06-29 | Isis Pharmaceuticals, Inc. | 4'-desmethyl nucleoside analog compounds |
| ES2083593T3 (es) | 1990-08-03 | 1996-04-16 | Sterling Winthrop Inc | Compuestos y metodos para inhibir la expresion de genes. |
| US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
| US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
| US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
| CA2092002A1 (en) | 1990-09-20 | 1992-03-21 | Mark Matteucci | Modified internucleoside linkages |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US6582908B2 (en) | 1990-12-06 | 2003-06-24 | Affymetrix, Inc. | Oligonucleotides |
| US5948903A (en) | 1991-01-11 | 1999-09-07 | Isis Pharmaceuticals, Inc. | Synthesis of 3-deazapurines |
| US5672697A (en) | 1991-02-08 | 1997-09-30 | Gilead Sciences, Inc. | Nucleoside 5'-methylene phosphonates |
| US7015315B1 (en) | 1991-12-24 | 2006-03-21 | Isis Pharmaceuticals, Inc. | Gapped oligonucleotides |
| US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
| EP0538194B1 (de) | 1991-10-17 | 1997-06-04 | Novartis AG | Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte |
| US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
| US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
| TW393513B (en) | 1991-11-26 | 2000-06-11 | Isis Pharmaceuticals Inc | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| AU3222793A (en) | 1991-11-26 | 1993-06-28 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
| FR2687679B1 (fr) | 1992-02-05 | 1994-10-28 | Centre Nat Rech Scient | Oligothionucleotides. |
| US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
| US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
| EP0577558A2 (de) | 1992-07-01 | 1994-01-05 | Ciba-Geigy Ag | Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte |
| US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
| US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
| GB9304620D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Compounds |
| GB9304618D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Chemical compounds |
| AU6449394A (en) | 1993-03-30 | 1994-10-24 | Sterling Winthrop Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| CA2159629A1 (en) | 1993-03-31 | 1994-10-13 | Sanofi | Oligonucleotides with amide linkages replacing phosphodiester linkages |
| US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
| US5801154A (en) | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
| US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
| EP0733059B1 (en) | 1993-12-09 | 2000-09-13 | Thomas Jefferson University | Compounds and methods for site-directed mutations in eukaryotic cells |
| US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
| US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
| US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| EP0807172A1 (en) | 1995-01-30 | 1997-11-19 | HYBRIDON, Inc. | Human immunodeficiency virus transcription inhibitors and methods of their use |
| US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
| AU1039397A (en) | 1995-11-22 | 1997-06-27 | Johns Hopkins University, The | Ligands to enhance cellular uptake of biomolecules |
| USRE44779E1 (en) | 1997-03-07 | 2014-02-25 | Santaris Pharma A/S | Bicyclonucleoside and oligonucleotide analogues |
| US6770748B2 (en) | 1997-03-07 | 2004-08-03 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogue |
| US7572582B2 (en) | 1997-09-12 | 2009-08-11 | Exiqon A/S | Oligonucleotide analogues |
| US20030228597A1 (en) | 1998-04-13 | 2003-12-11 | Cowsert Lex M. | Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation |
| US6300319B1 (en) | 1998-06-16 | 2001-10-09 | Isis Pharmaceuticals, Inc. | Targeted oligonucleotide conjugates |
| US6043352A (en) | 1998-08-07 | 2000-03-28 | Isis Pharmaceuticals, Inc. | 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides |
| EP1178999B1 (en) | 1999-05-04 | 2007-03-14 | Santaris Pharma A/S | L-ribo-lna analogues |
| US6525191B1 (en) | 1999-05-11 | 2003-02-25 | Kanda S. Ramasamy | Conformationally constrained L-nucleosides |
| US7491805B2 (en) | 2001-05-18 | 2009-02-17 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US6426220B1 (en) | 2000-10-30 | 2002-07-30 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
| US6906182B2 (en) | 2000-12-01 | 2005-06-14 | Cell Works Therapeutics, Inc. | Conjugates of glycosylated/galactosylated peptide, bifunctional linker, and nucleotidic monomers/polymers, and related compositions and method of use |
| US20030175906A1 (en) | 2001-07-03 | 2003-09-18 | Muthiah Manoharan | Nuclease resistant chimeric oligonucleotides |
| US20030158403A1 (en) | 2001-07-03 | 2003-08-21 | Isis Pharmaceuticals, Inc. | Nuclease resistant chimeric oligonucleotides |
| US8604183B2 (en) | 2002-11-05 | 2013-12-10 | Isis Pharmaceuticals, Inc. | Compositions comprising alternating 2′-modified nucleosides for use in gene modulation |
| CA2504694C (en) | 2002-11-05 | 2013-10-01 | Isis Pharmaceuticals, Inc. | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
| EP2305812A3 (en) | 2002-11-14 | 2012-06-06 | Dharmacon, Inc. | Fuctional and hyperfunctional sirna |
| US7723509B2 (en) | 2003-04-17 | 2010-05-25 | Alnylam Pharmaceuticals | IRNA agents with biocleavable tethers |
| EP1661905B9 (en) | 2003-08-28 | 2012-12-19 | IMANISHI, Takeshi | Novel artificial nucleic acids of n-o bond crosslinkage type |
| WO2005027962A1 (en) | 2003-09-18 | 2005-03-31 | Isis Pharmaceuticals, Inc. | 4’-thionucleosides and oligomeric compounds |
| EP1752536A4 (en) | 2004-05-11 | 2008-04-16 | Alphagen Co Ltd | POLYNUCLEOTIDE CAUSING RNA INTERFERENCE AND METHOD OF REGULATING GENE EXPRESSION WITH THE USE OF THE SAME |
| US20060148740A1 (en) | 2005-01-05 | 2006-07-06 | Prosensa B.V. | Mannose-6-phosphate receptor mediated gene transfer into muscle cells |
| US7569686B1 (en) | 2006-01-27 | 2009-08-04 | Isis Pharmaceuticals, Inc. | Compounds and methods for synthesis of bicyclic nucleic acid analogs |
| JP5342881B2 (ja) | 2006-01-27 | 2013-11-13 | アイシス ファーマシューティカルズ, インコーポレーテッド | 6−修飾された二環式核酸類似体 |
| US7666854B2 (en) | 2006-05-11 | 2010-02-23 | Isis Pharmaceuticals, Inc. | Bis-modified bicyclic nucleic acid analogs |
| AU2007249349B2 (en) | 2006-05-11 | 2012-03-08 | Isis Pharmaceuticals, Inc. | 5'-Modified bicyclic nucleic acid analogs |
| WO2008049085A1 (en) | 2006-10-18 | 2008-04-24 | Isis Pharmaceuticals, Inc. | Antisense compounds |
| EP2077858A4 (en) | 2006-12-06 | 2011-07-20 | Medimmune Llc | INTERFERON ALPHA-INDUCED PHARMACODYNAMIC MARKERS |
| US20100190837A1 (en) | 2007-02-15 | 2010-07-29 | Isis Pharmaceuticals, Inc. | 5'-Substituted-2-F' Modified Nucleosides and Oligomeric Compounds Prepared Therefrom |
| EP2170917B1 (en) | 2007-05-30 | 2012-06-27 | Isis Pharmaceuticals, Inc. | N-substituted-aminomethylene bridged bicyclic nucleic acid analogs |
| EP2173760B2 (en) | 2007-06-08 | 2015-11-04 | Isis Pharmaceuticals, Inc. | Carbocyclic bicyclic nucleic acid analogs |
| CA2692579C (en) | 2007-07-05 | 2016-05-03 | Isis Pharmaceuticals, Inc. | 6-disubstituted bicyclic nucleic acid analogs |
| WO2009023855A2 (en) | 2007-08-15 | 2009-02-19 | Isis Pharmaceuticals, Inc. | Tetrahydropyran nucleic acid analogs |
| US8546556B2 (en) | 2007-11-21 | 2013-10-01 | Isis Pharmaceuticals, Inc | Carbocyclic alpha-L-bicyclic nucleic acid analogs |
| WO2009082607A2 (en) | 2007-12-04 | 2009-07-02 | Alnylam Pharmaceuticals, Inc. | Targeting lipids |
| WO2009100320A2 (en) | 2008-02-07 | 2009-08-13 | Isis Pharmaceuticals, Inc. | Bicyclic cyclohexitol nucleic acid analogs |
| WO2010036698A1 (en) | 2008-09-24 | 2010-04-01 | Isis Pharmaceuticals, Inc. | Substituted alpha-l-bicyclic nucleosides |
| EP2406396A2 (en) | 2009-03-12 | 2012-01-18 | Brainco Biopharma, S.L. | A genotyping tool for improving the prognostic and clinical management of ms patients |
| EP2462153B1 (en) | 2009-08-06 | 2015-07-29 | Isis Pharmaceuticals, Inc. | Bicyclic cyclohexose nucleic acid analogs |
| US10913767B2 (en) | 2010-04-22 | 2021-02-09 | Alnylam Pharmaceuticals, Inc. | Oligonucleotides comprising acyclic and abasic nucleosides and analogs |
| CA2812046A1 (en) | 2010-09-15 | 2012-03-22 | Alnylam Pharmaceuticals, Inc. | Modified irna agents |
| WO2012068636A1 (en) | 2010-11-26 | 2012-05-31 | The University Of Melbourne | Methods and compositions comprising antagonists of type 1 interferon-mediated signalling for reducing a neuroinflammatory response in the central nervous system |
| US10017764B2 (en) | 2011-02-08 | 2018-07-10 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
| EP3453761A1 (en) | 2011-08-29 | 2019-03-13 | Ionis Pharmaceuticals, Inc. | Oligomer-conjugate complexes and their use |
| WO2013159108A2 (en) | 2012-04-20 | 2013-10-24 | Isis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
| US20150141320A1 (en) | 2012-05-16 | 2015-05-21 | Rana Therapeutics, Inc. | Compositions and methods for modulating gene expression |
| WO2014059353A2 (en) | 2012-10-11 | 2014-04-17 | Isis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleosides and uses thereof |
| US10077443B2 (en) | 2012-11-15 | 2018-09-18 | Roche Innovation Center Copenhagen A/S | Oligonucleotide conjugates |
| DK2991656T3 (da) | 2013-05-01 | 2020-03-23 | Ionis Pharmaceuticals Inc | Sammensætninger og fremgangsmåder til modulering af apolipoprotein c-iii-ekspression |
| TWI713453B (zh) | 2014-06-23 | 2020-12-21 | 美商健生生物科技公司 | 干擾素α及ω抗體拮抗劑 |
| US20200095579A1 (en) | 2017-02-22 | 2020-03-26 | Crispr Therapeutics Ag | Materials and methods for treatment of merosin-deficient cogenital muscular dystrophy (mdcmd) and other laminin, alpha 2 (lama2) gene related conditions or disorders |
| EP3713955A4 (en) | 2018-09-18 | 2022-03-09 | I-Mab Biopharma (Hangzhou) Co., Ltd. | ANTI-IFNAR1 ANTIBODIES FOR THE TREATMENT OF AUTOIMMUNE DISEASES |
| US20220064636A1 (en) | 2018-10-05 | 2022-03-03 | Ionis Pharmaceuticals, Inc. | Modified oligomeric compounds and uses thereof |
| JP2024523363A (ja) | 2021-06-18 | 2024-06-28 | アイオーニス ファーマシューティカルズ, インコーポレーテッド | Ifnar1の発現を低減するための化合物及び方法 |
-
2022
- 2022-06-17 KR KR1020247001511A patent/KR20240023602A/ko active Pending
- 2022-06-17 US US17/842,960 patent/US11753644B2/en active Active
- 2022-06-17 WO PCT/US2022/033935 patent/WO2022266414A1/en not_active Ceased
- 2022-06-17 JP JP2023577660A patent/JP2024523364A/ja active Pending
- 2022-06-17 EP EP22825886.9A patent/EP4355759A1/en active Pending
- 2022-06-17 CN CN202280043046.4A patent/CN117500815A/zh active Pending
- 2022-06-17 IL IL309217A patent/IL309217A/en unknown
- 2022-06-17 BR BR112023026050A patent/BR112023026050A2/pt unknown
- 2022-06-17 TW TW111122644A patent/TW202317765A/zh unknown
- 2022-06-17 AU AU2022293556A patent/AU2022293556A1/en active Pending
- 2022-06-17 CA CA3223192A patent/CA3223192A1/en active Pending
- 2022-06-17 MX MX2023015230A patent/MX2023015230A/es unknown
-
2023
- 2023-07-26 US US18/359,429 patent/US20230357779A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017216390A1 (en) * | 2016-06-17 | 2017-12-21 | F. Hoffmann-La Roche Ag | Nucleic acid molecules for reduction of papd5 or papd7 mrna for treating hepatitis b infection |
| US20200199589A1 (en) * | 2016-09-29 | 2020-06-25 | Biogen Ma Inc. | Compounds and Methods for Reducing Tau Expression |
| WO2019157531A1 (en) * | 2018-02-12 | 2019-08-15 | Ionis Pharmaceuticals, Inc. | Modified compounds and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112023026050A2 (pt) | 2024-03-05 |
| EP4355759A1 (en) | 2024-04-24 |
| JP2024523364A (ja) | 2024-06-28 |
| AU2022293556A1 (en) | 2024-01-18 |
| CN117500815A (zh) | 2024-02-02 |
| CA3223192A1 (en) | 2022-12-22 |
| MX2023015230A (es) | 2024-01-18 |
| US20230025910A1 (en) | 2023-01-26 |
| US11753644B2 (en) | 2023-09-12 |
| IL309217A (en) | 2024-02-01 |
| KR20240023602A (ko) | 2024-02-22 |
| US20230357779A1 (en) | 2023-11-09 |
| TW202317765A (zh) | 2023-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230020192A1 (en) | Compounds and methods for modulating c90rf72 | |
| AU2022334739A1 (en) | Compounds and methods for modulating scn1a expression | |
| US11833221B2 (en) | Oligomeric compounds for reducing DMPK expression | |
| US20250188476A1 (en) | Compounds and methods for reducing ifnar1 expression | |
| US20250177433A1 (en) | Compounds and methods for reducing dmpk expression | |
| US12152052B2 (en) | Compounds and methods for reducing MECP2 expression | |
| US20230374519A1 (en) | Compounds and methods for modulating pmp22 | |
| US20230357770A1 (en) | Compounds and methods for reducing apoe expression | |
| US11732263B2 (en) | Compounds and methods for modulating PLP1 | |
| US20240301411A1 (en) | Compounds and methods for reducing app expression | |
| US11753644B2 (en) | Compounds and methods for reducing IFNAR1 expression | |
| WO2024064854A2 (en) | Compounds and methods for reducing mecp2 expression | |
| US20230124616A1 (en) | Compounds and methods for modulating kcnq2 | |
| WO2025030064A1 (en) | Compounds and methods for reducing tubb4a expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22825886 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 309217 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3223192 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2023/015230 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2023577660 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280043046.4 Country of ref document: CN |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023026050 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 806893 Country of ref document: NZ Ref document number: AU2022293556 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202447002447 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20247001511 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020247001511 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: 2022293556 Country of ref document: AU Date of ref document: 20220617 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022825886 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022825886 Country of ref document: EP Effective date: 20240118 |
|
| ENP | Entry into the national phase |
Ref document number: 112023026050 Country of ref document: BR Kind code of ref document: A2 Effective date: 20231211 |