WO2022264095A1 - Expression vectors, bacterial sequence-free vectors, and methods of making and using the same - Google Patents

Expression vectors, bacterial sequence-free vectors, and methods of making and using the same Download PDF

Info

Publication number
WO2022264095A1
WO2022264095A1 PCT/IB2022/055620 IB2022055620W WO2022264095A1 WO 2022264095 A1 WO2022264095 A1 WO 2022264095A1 IB 2022055620 W IB2022055620 W IB 2022055620W WO 2022264095 A1 WO2022264095 A1 WO 2022264095A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
nucleic acid
vector
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2022/055620
Other languages
English (en)
French (fr)
Inventor
Roderick Slavcev
Nafiseh Nafissi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mediphage Bioceuticals Inc
Original Assignee
Mediphage Bioceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BR112023026176A priority Critical patent/BR112023026176A2/pt
Priority to AU2022292197A priority patent/AU2022292197A1/en
Priority to CN202280055798.2A priority patent/CN117881788A/zh
Priority to MX2023014628A priority patent/MX2023014628A/es
Priority to JP2023577551A priority patent/JP2024523343A/ja
Priority to CA3222578A priority patent/CA3222578A1/en
Application filed by Mediphage Bioceuticals Inc filed Critical Mediphage Bioceuticals Inc
Priority to KR1020247001300A priority patent/KR20240021906A/ko
Priority to EP22824423.2A priority patent/EP4355883A4/en
Publication of WO2022264095A1 publication Critical patent/WO2022264095A1/en
Priority to US18/541,459 priority patent/US20240229071A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16141Use of virus, viral particle or viral elements as a vector
    • C12N2710/16143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16141Use of virus, viral particle or viral elements as a vector
    • C12N2710/16145Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/30Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/15Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/46Vector systems having a special element relevant for transcription elements influencing chromatin structure, e.g. scaffold/matrix attachment region, methylation free island
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present disclosure provides expression vectors, bacterial sequence-free vectors, vector production systems for making the bacterial sequence-free vectors, and uses thereof.
  • viral delivery systems such as adenoviral vectors, lentiviral vectors, and adeno-associated viral vectors. While progress has been made, viral systems vary in transduction and transgene expression efficiencies and concerns remain regarding undesirable effects such as inflammatory and immune responses or insertional mutagenesis. Moreover, production, purification, and storage of viral vectors is often costly, highly variable, and inefficient. See , e.g., Lingelbach, D., Drug Development & Delivery 20(5): 50-54 (2020); Wright, J.F., Gene Therapy 75:840- 848 (2008).
  • Nonviral vectors also have been investigated as gene therapy delivery systems.
  • nonviral vectors While safer than their viral counterparts, the effectiveness of nonviral vectors can be limited, for example, by low transgene expression levels and durability of expression. See , e.g., Kay, M., Nature Reviews Genetics 12: 316-328 (2011).
  • the present disclosure is directed to an expression vector comprising: (a) a backbone sequence, (b) a sequence comprising: (i) an expression cassette comprising a nucleic acid sequence of interest, (ii) a first target sequence for a first recombinase flanking the 5' side of the expression cassette, (iii) a second target sequence for the first recombinase flanking the 3' side of the expression cassette, and (iv) one or more additional target sequences for one or more additional recombinases integrated within the first and second target sequences in non-binding regions for the first recombinase, and (c) one or more of: (i) an endonuclease target sequence integrated within the first and/or second target sequences for the first recombinase in non-binding regions for the first recombinase and the one or more additional recombinases, wherein the endonuclease target sequence is between the backbone sequence and
  • the expression vector comprises an endonuclease target sequence integrated within the first and/or second target sequences for the first recombinase in non- binding regions for the first recombinase and the one or more additional recombinases, wherein the endonuclease target sequence is between the backbone sequence and cleavage sites for the first recombinase and the one or more additional recombinases.
  • the endonuclease target sequence is integrated within the first and second target sequences for the first recombinase.
  • the endonuclease target sequence is for a homing endonuclease.
  • the endonuclease target sequence is for I-Anil, I-Ceul, I-Chul, I-Cpal, I-CpaII, I-Crel, I-Dmol, H-Drel, I-Hmul, I- HmuII, I-Llal, I-Msol, Pl-Pful, PI-PkoII, I-Porl, I-Ppol, PI-PspI, I-Scal, I-Scel, PI-SceI, I-SceII, I-SecIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-Ssp6803I, I-Tevl, I-TevII, I- TevIII, PI-Tlil, PI-TliII, I-Tsp061I, or I-Vdil41I.
  • the endonuclease target sequence is for I-Scel. In some aspects, the endonuclease target sequence is for PI- Scel. In some aspects, the endonuclease target sequence is for a Cas endonuclease. In some aspects, the Cas endonuclease is Cas9.
  • the expression vector comprises a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 integrated between the 3' end of the first target sequence for the first recombinase and the 5' end of another enhancer or a promoter in the expression cassette.
  • the synthetic enhancer comprises multiple contiguous copies of a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12.
  • the synthetic enhancer comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO:46.
  • the synthetic enhancer is integrated at the 5' end of a chicken b-actin promoter.
  • a chimeric intron comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:47 is integrated at the 3' end of the chicken b-actin promoter and 5' to the nucleic acid sequence of interest.
  • the expression vector comprises a CMV enhancer integrated between the 3' end of the first target sequence for the first recombinase and the 5' end of a promoter in the expression cassette.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 or SEQ ID NO:46.
  • a CMV promoter is integrated at the 3' end of the CMV enhancer and 5' to the nucleic acid sequence of interest.
  • the expression vector comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39 integrated between the first target sequence for the first recombinase and the nucleic acid sequence of interest.
  • the expression vector comprises a 5'UTR comprising an intron, wherein the 5'UTR is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest.
  • the intron comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO:l.
  • the 5'UTR further comprises a non-coding sequence integrated within the intron.
  • the 5'UTR comprises a non-coding sequence integrated between two of the nucleotides in the intron corresponding to any two nucleotides from positions 25 to 55 of SEQ ID NO:l.
  • the non-coding sequence is an S/MAR.
  • the S/MAR is MAR-5.
  • the 5'UTR comprises a nucleic acid sequence at least about 90% identical SEQ ID NO:3. In some aspects, the 5'UTR comprises a nucleic acid sequence at least about 90% identical SEQ ID NO:5. In some aspects, the promoter is a chicken b-actin promoter. In some aspects, the promoter is a CMV promoter. In some aspects, the promoter is integrated at the 3' end of a CMV enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 or SEQ ID NO:46.
  • the expression vector comprises a polyadenylation signal that is integrated at the 3' end of the nucleic acid sequence of interest.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the expression vector comprises a vertebrate chromatin insulator integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal.
  • the vertebrate chromatin insulator is 5'-HS4 chicken-P-globin insulator (cHS4).
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the expression vector comprises a WPRE integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the expression vector comprises a S/MAR integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal.
  • the S/MAR is MAR-5.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the expression vector comprises an enhancer sequence flanking each side of the first and second target sequences for the first recombinase. In some aspects, the expression vector comprises at least two enhancer sequences flanking each side of the first and second target sequences for the first recombinase. In some aspects, the enhancer sequence is a SV40 enhancer sequence.
  • the expression vector comprises a DTS integrated within the first and/or second target sequences for the first recombinase in non-binding regions for the first recombinase and the one or more additional recombinases, wherein the DTS is between the expression cassette and cleavage sites for the first recombinase and the one or more additional recombinases.
  • the DTS is a SV40 enhancer sequence.
  • the DTS is cell-specific.
  • the first and second target sequences and the one or more additional target sequences are selected from the group consisting of the PY54 pal site, theN15 telRL site, the loxP site, cpK02 telRL site, the FRT site, the phiC31 attP site, and the l attP site.
  • the expression vector comprises each of the target sequences.
  • the expression vector comprises the pal site and the telRL, loxP, and FRT recombinase target binding sequences integrated within the pal site.
  • the first and second target sequences for the first recombinase each comprise the nucleic acid sequence of SEQ ID NO:33.
  • the expression vector is for producing a bacterial sequence-free vector.
  • the bacterial sequence-free vector is a circular covalently closed vector.
  • the bacterial sequence-free vector is a linear covalently closed vector.
  • the present disclosure is directed to a vector production system comprising recombinant cells encoding a recombinase under the control of an inducible promoter, wherein the recombinant cells comprise any of the above expression vectors, and wherein the recombinase targets the first and second target sequences for the first recombinase or one of the one or more additional target sequences for the one or more additional recombinases in the expression vector.
  • the recombinase is TelN, Tel,
  • the recombinant cells further encode an endonuclease under the control of an inducible promoter, wherein the endonuclease targets the endonuclease target sequence in an expression vector comprising the endonuclease target sequence.
  • the endonuclease is a homing endonuclease.
  • the homing endonuclease is I-Anil, I-Ceul, I-Chul, I-Cpal, I-CpaII, I-Crel, I-Dmol, H-Drel, I-Hmul, I-HmuII, I-Llal, I-Msol, Pl-Pful, PI-PkoII, I-Porl, I-Ppol, PI-PspI, I-Scal, I-Scel, PI-SceI, I-SceII, I-SecIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-Ssp6803I, I-Tevl, I-TevII, I- TevIII, PI-Tlil, PI-TliII, I-Tsp061I, or I-Vdil41I.
  • the endonuclease is I- Scel. In some aspects, the endonuclease is PI-SceI. In some aspects, the recombinant cells encode a nuclease genome editing system comprising the endonuclease. In some aspects, the nuclease genome editing system is a clustered regularly interspaced short palindromic repeats (CRISPR) nuclease system comprising a guide RNA and a Cas endonuclease. In some aspects, the Cas endonuclease is Cas9. In some aspects, the inducible promoter is thermally-regulated, chemically-regulated, IPTG regulated, glucose-regulated, arabinose inducible, T7 polymerase regulated, cold-shock inducible, pH inducible, or combinations thereof.
  • CRISPR regularly interspaced short palindromic repeats
  • the present disclosure is directed to a method of producing a bacterial sequence- free vector comprising incubating any of the above vector production systems under suitable conditions for expression of the recombinase.
  • the method further comprises incubating any of the above vector production systems that encode an endonuclease under suitable conditions for expression of the endonuclease.
  • the method further comprises incubating any of the above vector production systems that encode a nuclease genome editing system under suitable conditions for expression of the nuclease genome editing system.
  • the method further comprises harvesting the bacterial sequence-free vector.
  • the present disclosure is directed to a bacterial sequence-free vector produced by any of the above methods of producing a bacterial sequence-free vector. [0025] The present disclosure is directed to a bacterial sequence-free vector comprising:
  • an expression cassette comprising a nucleic acid sequence of interest, and (b) one or more of: (i) a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 located 5' to another enhancer or a promoter in the expression cassette, (ii) a CMV enhancer located 5' to a promoter in the expression cassette, (iii) a 5'UTR comprising an intron, wherein the 5'UTR is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest, (iv) a vertebrate chromatin insulator integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal, (v) a WPRE integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal, (vi) a S/MAR integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal, or (vii) a DTS located 5' to the expression
  • the bacterial sequence-free vector comprises a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 located 5' to another enhancer or a promoter in the expression cassette.
  • the synthetic enhancer comprises multiple contiguous copies of a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12
  • the synthetic enhancer comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO:46.
  • the synthetic enhancer is integrated at the 5' end of a chicken b-actin promoter.
  • a chimeric intron comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:47 is integrated at the 3' end of the chicken b-actin promoter and 5' to the nucleic acid sequence of interest.
  • the bacterial sequence-free vector comprises a CMV enhancer located 5' to a promoter in the expression cassette.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 or SEQ ID NO:46.
  • a CMV promoter is integrated at the 3' end of the CMV enhancer and 5' to the nucleic acid sequence of interest.
  • the bacterial sequence-free vector comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39 located 5' to the nucleic acid sequence of interest.
  • the bacterial sequence-free vector comprises a 5'UTR comprising an intron, wherein the 5'UTR is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest.
  • the intron comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO:l.
  • the 5'UTR further comprises a non-coding sequence integrated within the intron.
  • the 5'UTR further comprises a non-coding sequence integrated between two of the nucleotides in the intron corresponding to any two nucleotides from nucleotide positions 25 and 55 of SEQ ID NO:l.
  • the non-coding sequence is an S/MAR.
  • the S/MAR is MAR-5.
  • the 5'UTR comprises a nucleic acid sequence at least about 90% identical SEQ ID NO:3.
  • the 5'UTR comprises a nucleic acid sequence at least about 90% identical SEQ ID NO:5.
  • the promoter is a chicken b-actin promoter. In some aspects, the promoter is a CMV promoter.
  • the promoter is integrated at the 3' end of a CMV enhancer.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 or SEQ ID NO:46.
  • the bacterial sequence-free vector comprises a polyadenylation signal that is integrated at the 3' end of the nucleic acid sequence of interest.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the bacterial sequence-free vector comprises a vertebrate chromatin insulator integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal.
  • the vertebrate chromatin insulator is cHS4.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the bacterial sequence-free vector comprises a WPRE integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the bacterial sequence-free vector comprises a S/MAR integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal. In some aspects, the S/MAR is MAR-5. [0034] In some aspects, the bacterial sequence-free vector comprises an enhancer sequence flanking each side of the expression cassette. In some aspects, the bacterial sequence-free vector comprises at least two enhancer sequences flanking each side of the expression cassette. In some aspects, the enhancer sequence is a SV40 enhancer sequence.
  • the bacterial sequence-free vector comprises a DTS located 5' to the expression cassette.
  • the DTS is a SV40 enhancer sequence.
  • the DTS is cell-specific.
  • the bacterial sequence-free vector is a circular covalently closed vector.
  • the bacterial sequence-free vector is a linear covalently closed vector.
  • the present disclosure is directed to a recombinant cell comprising any of the above expression vectors or any of the above bacterial sequence-free vectors.
  • composition comprising any of the above expression vectors or any of the above bacterial sequence-free vectors.
  • the composition further comprises a delivery agent.
  • the delivery agent is a nanoparticle.
  • the delivery agent comprises a targeting ligand.
  • the composition is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.
  • the present disclosure is directed to a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject any of the above expression vectors, any of the above bacterial sequence-free vectors, or the above pharmaceutical composition.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 1.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:2.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:3.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 5. [0045] The present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:46.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 13.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 14.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 15.
  • any of the above polynucleotides comprising a nucleic acid sequence at least about 90% identical to any one of SEQ ID NOs: 13-15 further comprises 100 to 120 adenine nucleotides at the 3' end of the nucleic acid sequence.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 16.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 17.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 18.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:35.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:36.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:37.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:38.
  • the present disclosure is directed to a polynucleotide comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO:39.
  • the present disclosure is directed to an expression vector comprising any of the above polynucleotides.
  • the present disclosure is directed to an expression vector comprising a polynucleotide comprising a nucleic acid sequence at least about 90% identical to any one of SEQ ID NOs:2, 3, or 5, and (i) a polynucleotide comprising a nucleic acid sequence at least about 90% identical to any one of SEQ ID NOs: 13-18, or (ii) a polynucleotide comprising a nucleic acid sequence at least about 90% identical to any one of SEQ ID NOs: 13-15 and 100 to 120 adenine nucleotides at the 3' end of the nucleic acid sequence.
  • the present disclosure is directed to a method of gene editing comprising inserting a nucleic acid sequence of interest from any of the above expression vectors, any of the bacterial sequence-free vectors, or any of the above pharmaceutical compositions into a target site for gene editing.
  • the gene editing is by non-homologous end joining.
  • the gene editing is by homology-directed repair.
  • Figure 1 shows a vector map of the expression vector pGL2-SS*-CAG-SecNLuc-
  • Figure 2 shows a vector map of the expression vector pcDNA-CMV-5'UTR-
  • Figure 3 shows photomicrographs evaluating fluorescence in HEK-293 cells via live imaging.
  • A shows negative control cells exposed to lipofectamine without plasmid
  • B shows cells transfected with the expression vector of Figure 1
  • C shows cells transfected with the expression vector of Figure 2
  • D shows positive control cells transfected with a parental expression vector, pGL2-SS*-CAG-eGFP-BGpA-SS* (PP- CAG-GFP), expressing eGFP under the control of a CAG promoter.
  • Figure 4 shows a bar graph of the relative fluorescence intensities of cells transected according to Figure 3(A)-(D).
  • pGL2-SecNLuc-eGFP indicates cells transfected with the pGL2-SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS* expression vector of Figure 1.
  • pcDNA-SecNLuc-eGFP indicates cells transfected with the pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA expression vector of Figure 2
  • Figure 5 shows a bar graph of relative luciferase intensities in the media of cells transfected according to Figure 3(A)-(C).
  • Figure 6 shows a vector map of the expression vector pGL2-SS*-CAG-SecNLuc-
  • Figure 7 shows a vector map of the expression vector pGL2-SS*-CMV-UTRl-
  • Figure 8 shows a vector map of the expression vector pGL2-SS*-CMV-UTR2-
  • Figure 9 shows a line graph of long-term luciferase activity as indicated by luminescence in Relative Luminometer Units (also termed Relative Light Units, RLU) in the media of HEK-293 cells at Days 2, 6, 10, 14, 17, 20, 27, and 34 after electroporation of cells with the expression vectors of Figure 1 (pGL2-SecNLuc-eGFP), Figure 6 (WPRE), Figure 7 (5UTR1+WPRE), and Figure 8 (5UTR2+WPRE) as compared to a negative control in which cells were electroporated with a puc57 plasmid lacking a mammalian expression cassette (Neg. Ctl. (no plasmid)).
  • Figure 10 shows a bar graph of luciferase activity as indicated by luminescence in
  • Figure 12 shows fluorescence in cells transfected with the expression vector of
  • FIG. 1 shows photomicrographs evaluating fluorescence in HEK-293 cells via live imaging at passage numbers 1, 2, 3, and 5.
  • Figure 13 shows a line graph of RLU/mg protein in plasma collected from wild- type mice at days 1, 3, 7, 10, 15, 22, 28, 42, and 56 after a single hydrodynamic tail vein injection of 50 pg of pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA (positive control, PSNLuc), pGL2-SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS* (pCAGLuc), or pGL2- S S * -CM V -UTR 1 - S ecNLuc-2 A-eGFP- WPRE-B Gp A- S S * (pGSNLuc-WPRE).
  • Figure 14 shows a line graph of RLU/mg protein in plasma collected from wild- type mice at days 1, 3, 7, 10, 15, 22, 28, 42, and 56 after a single hydrodynamic tail vein injection of 50 pg of pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA (positive control, PSNLuc), pGL2-SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS* (pCAGLuc), or pGL2-S S *-C AG-SecNLuc-2 A-eGFP-WPRE-BGp A-S S * (pCAGLucWPRE).
  • Figure 15 shows a line graph of RLU/mg protein in plasma collected from wild- type mice at days 1, 3, 7, 10, 15, 22, 28, 42, and 56 after a single hydrodynamic tail vein injection of 5 pg of pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA (positive control, pDNA CMV-U (no SSeq)), pGL2-SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS* (SSeq pDNA CAG), or pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA-SS* (SSeq pDNA CAG-W).
  • pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA positive control, pDNA CMV-U (no SSeq)
  • Figure 16 shows a line graph of RLU/mg protein in plasma collected from wild- type mice at days 1, 3, 7, 10, 15, 22, 28, 42, and 56 after a single hydrodynamic tail vein injection of 5 pg of pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA (positive control, No-SSeq pDNA CMV-U), pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA-SS* (2XSSeq pDNA CAG-W), or msDNA-C AG-SecNLuc-2 A-eGFP-WPRE-BGp A (2XSSeq msDNA CAG-W).
  • Figure 17A-D show bar graphs of GFP expression as determined by ELISA in liver from wild-type mice at day 56 after a single hydrodynamic tail vein injection of 5 pg of the vectors described in Figure 16 as well as a negative control mouse with no injection of vector.
  • A shows the GFP concentration in pg/mL.
  • B shows pg of GFP normalized to pg of total protein.
  • C shows pg of GFP normalized to g of total tissue.
  • D shows expression levels of GFP relative to control. *P ⁇ 0.05, ** P ⁇ 0.01, ***P ⁇ 0.001,
  • Figure 18 shows a bar graph of cytoplasmic GFP protein concentration (pg/mL) in liver from wild-type mice at day 56 after a single hydrodynamic tail vein injection of 5 pg of vectors as described in Figure 16 as well as a negative control mouse with no injection of vector.
  • Figure 19 shows a bar graph of total flux in photons/second from in vivo whole body bioluminescence imaging after a single intravenous tail vein injection in mice with a lipid nanoparticle (LNP) carrier (Vehicle(control)) or lipoplex of the LNP and msDNA- C AG- S ecNLuc-2 A-eGFP- WPRE-B Gp A (LNP-2G msDNA-CAG-SecretedNanoLuc), pGL2-S S *-C AG-SecNLuc-2 A-eGFP-WPRE-BGpA-S S * (LNP-2G ppDNA-CAG- SecretedNanoLuc), msDNA-CMV-UTRl-SecNLuc-2A-eGFP-WPRE-BGpA (LNP-2G msDNA-CMV-SecretedNanoLuc), pGL2-SS*-CMV-UTRl-SecNLuc-2A
  • FIG 20 shows photomicrographs of green fluorescent protein (GFP) expression in sagittal brain sections from the cortex, thalamus, brainstem, and cerebellum from a mouse injected with msDNA-C AG-SecNLuc-2 A-eGFP-WPRE-BGp A.
  • White arrows indicate transgene expression. Nuclei are indicated by staining with diamidino-2- phenylindole (DAPI).
  • DAPI diamidino-2- phenylindole
  • Figures 21-22 show photomicrographs of GFP expression in sagittal brain sections from the cortex and thalamus ( Figure 21) and from the cerebellum and brainstem ( Figure 22) from a mouse injected with msDNA-CAG-SecNLuc-2A-eGFP- WPRE-BGpA. Neurons are indicated with the neuronal marker NeuN.
  • Figures 23-24 show photomicrographs of GFP expression in sagittal brain sections from the cortex and thalamus ( Figure 23) and from the cerebellum and brainstem ( Figure 24) from a mouse injected with msDNA-CMV-UTRl-SecNLuc-2A- eGFP-WPRE-BGpA. Neurons are indicated with the neuronal marker NeuN.
  • Figures 25-26 show bar graphs of luminescence associated with luciferase expression in human T cells (Pan-T(TA+) cells, Figure 25) or hepatocytes (Huh7 cells, Figure 26) at 3 and 5 days after transfection with a lipoplex of a lipid nanoparticle carrier (LNP) and pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA (positive control, LNP- Conv .
  • LNP lipid nanoparticle carrier
  • pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA positive control, LNP- Conv .
  • Figure 27A-C, Figure 28A-C, and Figure 29A-B show fluorescence activated cell sorting (FACS) scatter plots of knock-in (KI) efficiencies (Q3) for a gene of interest (GOI) at 3 days (Figure 27A-C), 7 days ( Figure 28A-C), and 15 days (Figure 29A-B) after transfection of a CRISPR gene editing system and either a conventional plasmid or msDNA carrying the GOI flanked by 5’ and 3’ homology arms (HDR-GOI-HDR).
  • FACS fluorescence activated cell sorting
  • FIG. 27 and 28 shows a FACS scatter plot for control, wild-type (WT) induced pluripotent stem cells (iPSCs) without any HDR KI of the GOI.
  • WT wild-type
  • iPSCs induced pluripotent stem cells
  • FIG. 29 show a FACS scatter plot in iPSCs following HDR KI of the GOI using a conventional plasmid (Plasmid DNA HDR-GOI-HDR).
  • C in Figures 27-28 and (B) in Figure 29 show a FACS scatter plot in iPSCs following HDR KI of the GOI using msDNA (msDNA HDR-GOI-HDR).
  • Figure 30 shows a vector map of the expression vector SS*-CMV-UTR1-
  • Figure 31 shows a vector map of the expression vector SS*-E1-CMV-UTR1-
  • Figure 32 shows a vector map of the expression vector SS*-E1-CMV-UTR1-
  • Figure 33 shows a vector map of the expression vector SS*-UCOE-El-CMV-
  • Figure 34 shows a vector map of the expression vector SS*-E1-CMV-UTR1-
  • Figure 35 shows a vector map of the expression vector SS*-UCOE-El-CMV-
  • Figure 36 shows a vector map of the expression vector SS*-UCOE-El-CMV-
  • Figure 37 shows a vector map of the expression vector SS*-E1-CMV-UTR1-
  • Figure 38 shows a vector map of the expression vector SS*-UCOE-El-CMV-
  • Figure 39 shows a line graph of luciferase activity as indicated by luminescence in RLU in the media of HEK-293 cells at Days 2, 3, 7, 10, 14, 21, and 28 after electroporation of cells with the expression vectors of Figure 2 (Conventional pDNA CMV-U), Figure 30 (A: CMV-U1-3'UTR), Figure 31 (B: E1-CMV-U1-3'UTR), and Figure 32 (C: El -CMV-U l-WPRE-3'UTR).
  • Figure 40 shows a line graph of relative luciferase intensity in HEK-293 cells at passage numbers 1, 2, 3, 4, and 5 after passaging every 7 days following electroporation of the cells at day 0 with the expression vectors described in Figure 39.
  • * p ⁇ 0.05 and **
  • Figure 41 shows a vector map of the expression vector pGL2-CAG-SecNLuc-2A- eGFP-WPRE-bGlobin polyA.
  • Figure 42 shows a vector map of the expression vector 4-1 pGL2-SS*-CAG
  • Figure 43 shows a vector map of the expression vector 4-2 pGL2-SS*-CAG [El
  • Figure 44 shows a vector map of the expression vector 4-3 pGL2-SS*-CAG
  • Figure 45 shows a vector map of the expression vector 4-4 pGL2-SS*-CAG [El
  • Figure 46 shows a vector map of the expression vector 4-5-pGL2-SS*-CAG [E2
  • Figure 47 shows a vector map of the expression vector 4-6-pGL2-SS*-CMV enhancer-EF 1 -UTR1 -SecNLuc-2 A-eGFP-WPRE-3 ’UTR( 108 to 120 polyA)-SS*.
  • Figure 48 shows a bar graph of luciferase activity as indicated by luminescence in
  • Figure 49 shows a diagram of an exemplary sequence for a self-restricting
  • CRISPR gene editing system that contains flanking Super Sequences (SSeq), a synthetic enhancer (El), a CMV promoter (PCMV), a synthetic 5'UTR containing an optimized internal intron with a tRNA-gRNA-PAM insertion (UTR-tRNA-gRNA-PAM-1), a CasP2 gene, and a 3'UTR containing a human beta-globin polyadenylation signal and a gRNA- PAM insertion (HBg3'UTR-gRNA-PAM).
  • Figure 50 shows a diagram of self-limiting Cas expression from the sequence of
  • Figure 51 shows a diagram for two gene-editing scenarios with a self-restricting
  • a msDNA containing a human expression cassette e.g ., therapeutic GOI
  • a msDNA containing a human expression cassette e.g ., therapeutic GOI
  • HDR knock-in is mediated by a single msDNA containing both the self-restricting CRISPR gene editing system and the human expression cassette flanked by homology arms.
  • the present disclosure provides expression vectors, bacterial sequence-free vectors (e.g., ministring DNA (msDNA)), vector production systems, methods of making the bacterial sequence-free vectors, compositions, and uses thereof.
  • bacterial sequence-free vectors e.g., ministring DNA (msDNA)
  • vector production systems methods of making the bacterial sequence-free vectors, compositions, and uses thereof.
  • a or “an” entity refers to one or more of that entity; for example, “a nucleotide sequence,” is understood to represent one or more nucleotide sequences.
  • the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
  • any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. Numeric ranges are inclusive of the numbers defining the range.
  • nucleotide sequences are written left to right in 5' to 3' orientation.
  • Amino acid sequences are written left to right in amino to carboxy orientation.
  • amino acid is a molecule having the structure wherein a central carbon atom
  • an amino acid (the alpha-carbon atom) is linked to a hydrogen atom, a carboxylic acid group (the carbon atom of which is referred to herein as a “carboxyl carbon atom"), an amino group (the nitrogen atom of which is referred to herein as an "amino nitrogen atom"), and a side chain group, R.
  • an amino acid When incorporated into a peptide, polypeptide, or protein, an amino acid loses one or more atoms of its amino acid carboxylic groups in the dehydration reaction that links one amino acid to another.
  • an amino acid is referred to as an "amino acid residue.”
  • Protein or “polypeptide” refers to any polymer of two or more individual amino acids (whether or not naturally occurring) linked via a peptide bond, and occurs when the carboxyl carbon atom of the carboxylic acid group bonded to the alpha-carbon of one amino acid (or amino acid residue) becomes covalently bound to the amino nitrogen atom of amino group bonded to the non alpha-carbon of an adjacent amino acid.
  • protein and “polypeptide” can be used interchangeably herein.
  • polypeptide comprises a chimera of two or more parental peptide segments or proteins.
  • PTM post-translation modification
  • polypeptide includes disulfide bond formation, glycosylation, carbamylation, lipidation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, modification by non-naturally occurring amino acids, or any other manipulation or modification, such as conjugation with a labeling component.
  • a polypeptide can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It can be generated in any manner, including by chemical synthesis.
  • An "isolated" polypeptide or a fragment, variant, or derivative thereof refers to a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can simply be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for the purpose of the disclosure, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
  • Recombinant polypeptides comprising two or more proteins as disclosed herein can be encoded by a single coding sequence that comprises polynucleotide sequences encoding each protein.
  • the polynucleotide sequences encoding each protein are "in frame" such that translation of a single mRNA comprising the polynucleotide sequences results in a single polypeptide comprising each protein.
  • the proteins in a recombinant polypeptide as described herein will be fused directly to one another or will be separated by a peptide linker.
  • Various polynucleotide sequences encoding peptide linkers are known in the art and include, for example, self-cleaving peptides.
  • Polynucleotide or “nucleic acid” as used herein refers to a polymeric form of nucleotides.
  • a polynucleotide comprises a sequence that is either not immediately contiguous with the coding sequences or is immediately contiguous (on the 5' end or on the 3' end) with the coding sequences in the naturally occurring genome of the organism from which it is derived.
  • the term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule ( e.g ., a cDNA) independent of other sequences.
  • the nucleotides of the disclosure can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide.
  • a polynucleotide as used herein refers to, among others, single- and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • the term polynucleotide encompasses genomic DNA or RNA (depending upon the organism, i.e., RNA genome of viruses), as well as mRNA encoded by the genomic DNA, and cDNA.
  • a polynucleotide comprises a conventional phosphodiester bond or a non- conventional bond (e.g ., an amide bond, such as found in peptide nucleic acids (PNA)).
  • PNA peptide nucleic acids
  • isolated nucleic acid or polynucleotide is intended a nucleic acid molecule, e.g., DNA or RNA, which has been removed from its native environment.
  • a nucleic acid molecule comprising a polynucleotide encoding a recombinant polypeptide contained in a vector is considered “isolated” for the purposes of the present disclosure.
  • Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) from other polynucleotides in a solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of polynucleotides of the present disclosure.
  • Isolated polynucleotides or nucleic acids according to the present disclosure further include polynucleotides and nucleic acids (e.g., nucleic acid molecules) produced synthetically.
  • a "coding region” or “coding sequence” is a portion of a polynucleotide, which consists of codons translatable into amino acids. Although a “stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region.
  • a coding region typically determined by a start codon at the 5' terminus, encoding the amino-terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl-terminus of the resulting polypeptide.
  • an "expression cassette” comprises a nucleic acid sequence of interest (e.g, a nucleic acid sequence for expression of a polypeptide, DNA, or RNA) and an expression control region.
  • transgene can be used interchangeably with “gene of interest
  • GOI "GOI" and refers to a portion of a polynucleotide that contains codons translatable into amino acids.
  • a "stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a transgene, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of the transgene.
  • the boundaries of a transgene are typically determined by a start codon at the 5' terminus, encoding the amino-terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl-terminus of the resulting polypeptide.
  • expression control region refers to a transcription control element that is operably associated with a coding region to direct or control expression of the product encoded by the coding region, including, for example, cis- regulatory modules (CRMs), promoters (e.g, a tissue specific promoter and/or an inducible promoter), enhancers, operators, repressors, ribosome binding sites, translation leader sequences, introns, post-transcriptional elements, polyadenylation recognition sequences, RNA processing sites, effector binding sites, stem-loop structures, and transcription termination signals, miRNA binding sites, and combinations thereof.
  • CCMs cis- regulatory modules
  • promoters e.g, a tissue specific promoter and/or an inducible promoter
  • enhancers e.g, a tissue specific promoter and/or an inducible promoter
  • enhancers e.g., a tissue specific promoter and/or an inducible promoter
  • enhancers e.g., a tissue specific
  • Expression control regions include nucleotide sequences located upstream (5'), within, or downstream (3') of a nucleic acid sequence of interest, and which influence the transcription, RNA processing, stability, or translation of the associated nucleic acid sequence of interest. If a transgene is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the transgene.
  • a coding region and a promoter are "operably associated" (i.e., “operably linked”) if induction of promoter function results in the transcription of mRNA comprising a coding region that encodes the product, and if the nature of the linkage between the promoter and the coding region does not interfere with the ability of the promoter to direct the expression of the product encoded by the coding region or interfere with the ability of the DNA template to be transcribed.
  • Expression control regions include nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • host cell and “cell” can be used interchangeably and can refer to any type of cell or a population of cells, e.g., a primary cell, a cell in culture, or a cell from a cell line, that harbors or is capable of harboring a nucleic acid molecule (e.g., a recombinant nucleic acid molecule).
  • Host cells can be a prokaryotic cell, or alternatively, the host cells can be eukaryotic, for example, fungal cells, such as yeast cells, and various animal cells, such as insect cells or mammalian cells.
  • Culture means to incubate cells under in vitro conditions that allow for cell growth or division or to maintain cells in a living state.
  • Cultured cells means cells that are propagated in vitro.
  • a “subject” includes any human or nonhuman animal.
  • the term “nonhuman animal” includes, but is not limited to, vertebrates such as mammals, avians, pets, farm animals, nonhuman primates, sheep, cows, goats, pigs, chickens, dogs, cats, and rodents such as mice, rats, and guinea pigs.
  • the subject is a human.
  • the terms, "subject” and “patient” are used interchangeably herein.
  • administering refers to the physical introduction of a therapeutic agent to a subject, using any of the various methods and delivery systems known to those skilled in the art.
  • treat refers to any type of intervention or process performed on, or administering an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, or slowing down or preventing the progression, development, severity or recurrence of a symptom, complication, condition or biochemical indicia associated with a disease or enhancing overall survival.
  • Treatment can be of a subject having a disease or a subject who does not have a disease (e.g., for prophylaxis, such as vaccination).
  • an effective dose is defined as an amount of an agent sufficient to achieve or at least partially achieve a desired effect.
  • a “therapeutically effective amount” or “therapeutically effective dosage” of a drug or therapeutic agent is any amount of the drug that, when used alone or in combination with another therapeutic agent, promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom- free periods, an increase in overall survival (the length of time from either the date of diagnosis or the start of treatment for a disease that patients diagnosed with the disease are still alive), or a prevention of impairment or disability due to the disease affliction.
  • a therapeutically effective amount or dosage of a drug includes a "prophy tactically effective amount” or a “prophylactically effective dosage”, which is any amount of the drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of developing a disease or of suffering a recurrence of disease, inhibits the development or recurrence of the disease.
  • a therapeutic agent to promote disease regression or inhibit the development or recurrence of the disease can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.
  • each SS contains a target sequence for a first recombinase, with an additional target sequence for one or more additional recombinases integrated within non-binding regions for the first recombinase.
  • a bacterial sequence-free vector containing the expression cassette is separated from the backbone DNA of the expression vector.
  • CCC circular covalently closed
  • the expression vector is placed into a recombinant cell expressing a recombinase such as Cre or Flp, for example, that acts through its target sequences in the SS.
  • LCC linear covalently closed
  • msDNA ministring DNA
  • the expression vector is placed into a recombinant cell expressing a recombinase such as TelN or Tel, for example, that acts through its target sequences in the SS.
  • a recombinase such as TelN or Tel, for example
  • TelN a recombinase
  • the bacterial sequence-free vector resulting from the recombination can then be purified from the cells and used directly as a delivery vector. See U.S. Patent Nos. 9,290,778 and 9,862,954, Nafissi and Slavcev, and Nafissi et al.
  • msDNA vectors with LCC ends are torsion-free and not subject to gyrase-directed negative supercoiling during their production in E. coli. Furthermore, due to its double stranded LCC topology, integration of msDNA into a cell's chromosome causes a chromosomal break, thereby eliminating the cell from the population. Thus, msDNA eliminates any risk of insertional mutagenesis, protecting patients who are administered the msDNA from potential genotoxicity and cancer (Nafissi et.al).
  • the present disclosure provides improved production of bacterial sequence-free vectors and improved bacterial sequence-free vectors.
  • production of the bacterial sequence-free vectors is improved by removal of contaminating expression vector sequences.
  • the bacterial sequence-free vectors is improved through its capacity for establishment in cells (i.e., transfection efficiencies), improved transgene expression (e.g ., mediated by a combination of enhanced transcription and translation), and improved expansion in cells (e.g., replication and partition of the vector to daughter cells).
  • the improvements disclosed herein can be adapted to CCC or
  • an expression vector comprising: (a) a backbone sequence, (b) a sequence comprising: (i) an expression cassette comprising a nucleic acid sequence of interest, (ii) a first target sequence for a first recombinase flanking the 5' side of the expression cassette, (iii) a second target sequence for the first recombinase flanking the 3' side of the expression cassette, and (iv) one or more additional target sequences for one or more additional recombinases integrated within the first and second target sequences in non-binding regions for the first recombinase, and (c) one or more of: (i) an endonuclease target sequence integrated within the first and/or second target sequences for the first recombinase in non-binding regions for the first recombinase and the one or more additional recombinases, wherein the endonuclease target sequence is between the backbone sequence and cle
  • a "backbone" sequence as referred to herein is the sequence of the expression vector outside of the sequence of the expression cassette and the flanking SS sites comprising the first and second target sequences of the first recombinase.
  • the backbone sequence can include, for example, sequences for amplification and antibiotic selection of the expression vector in a host cell ( e.g ., E. coli) as described herein.
  • Non-binding regions for a recombinase are regions within the target sequence for the first recombinase that are not acted upon by a recombinase as described herein (e.g., not bound and/or cleaved by the recombinase).
  • a "cleavage site" for a recombinase is the site at which a recombinase initiates a double-strand break or single-stranded nick in the DNA associated with recombination.
  • the expression vector comprises an endonuclease target sequence integrated within the first and/or second target sequences for the first recombinase in non- binding regions for the first recombinase and the one or more additional recombinases, wherein the endonuclease target sequence is between the backbone sequence and cleavage sites for the first recombinase and the one or more additional recombinases.
  • the endonuclease target sequence is integrated within the first target sequence for the first recombinase.
  • the endonuclease target sequence is integrated within the second target sequence for the first recombinase.
  • the endonuclease target sequence is integrated within the first and second target sequences for the first recombinase. In some aspects, the same endonuclease target sequence is integrated within the first and second target sequences for the first recombinase. In some aspects, the endonuclease target sequences integrated within the first and second target sequences for the first recombinase are for the same endonuclease. In some aspects, the endonuclease target sequence integrated within the first target sequence for the first recombinase is different from the endonuclease target sequence integrated within the second target sequence for the first recombinase.
  • the endonuclease target sequence integrated within the first target sequence for the first recombinase is for a different endonuclease than the endonuclease target sequence integrated within the second target sequence for the first recombinase.
  • sequences containing backbone sequence and the endonuclease target site can be removed from a preparation containing bacterial sequence-free vector by exposure to an endonuclease, reducing or avoiding the need for purification steps to remove backbone sequences in methods of producing the bacterial sequence-free vector.
  • the endonuclease is expressed following recombination in a host cell of a vector production system as described herein, wherein the endonuclease cuts the DNA at the endonuclease target site, and the sequence containing the backbone sequence and the endonuclease target site is degraded by an exonuclease (e.g ., exonuclease V).
  • an exonuclease e.g ., exonuclease V
  • the expression vector comprises an endonuclease target sequence for a homing endonuclease.
  • the endonuclease target sequence is for I- Anil, I-Ceul, I-Chul, I-Cpal, I-CpaII, I-Crel, I-Dmol, H-Drel, I-Hmul, I-HmuII, I-Llal, I- Msol, PI-PfuI, PI-PkoII, I-Porl, I-Ppol, PI-PspI, I-Scal, I-Scel, PI-SceI, I-SceII, I-SecIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-Ssp6803I, I-Tevl, I-TevII, I-TevIII, PI-Tlil, PI-
  • the endonuclease target sequence is for I- Scel. In some aspects, the endonuclease target sequence is for PI-SceI. Target sequences for homing endonucleases are well-known in the art. [0147] In some aspects, the expression vector comprises an endonuclease target sequence for an endonuclease used in genome editing, including an endonuclease that is part of a nuclease genome editing system.
  • the nuclease genome editing system is a Clustered Regularly Interspaced Short Palindromic Repeats-Cas (CRISPR-Cas) system, a Transcription Activator-Like Effector Nuclease (TALEN) system, a Zinc-Finger Nuclease (ZFN) system, or a meganuclease system.
  • CRISPR-Cas Clustered Regularly Interspaced Short Palindromic Repeats-Cas
  • TALEN Transcription Activator-Like Effector Nuclease
  • ZFN Zinc-Finger Nuclease
  • the expression vector comprises an endonuclease target sequence for a Cas endonuclease.
  • the Cas endonuclease is Cas9 (e.g ., a Streptococcus pyogenes Cas 9 (SpCas9), a Staphlococcus aureus Cas9 (SaCas9), a Francisella novicida Cas9 (FnCas9), or a Neisseria meningitides Cas9 (NmCas9)), a Cas9 variant (e.g., Cas9p2, xCas9, SpCas9-NG, SpCas9-NRRH, SpCas9-NRCH, SpCas9- NRTH, SpG, SpRY), Cas3, Cas 12 (e.g, Cas 12a, Cas 12b, Cas 12c, Cas 12d, or Casl2e),
  • Cas9 e.g.
  • an endonuclease target sequence for a Cas endonuclease as used herein is homologous to a guide RNA (gRNA) targeting sequence and includes a protospacer adjacent motif (PAM) recognized by a Cas endonuclease.
  • gRNA guide RNA
  • PAM protospacer adjacent motif
  • Sequences homologous to gRNA targeting sequences with PAM sites can be routinely designed based on well-known CRISPR systems.
  • the gRNA comprises a fusion of a targeting RNA (crRNA) sequence and a trans-activating RNA (tracrRNA) sequence, which interact and function to direct the Cas endonuclease to the endonuclease target site and catalyze cleavage.
  • crRNA targeting RNA
  • tracrRNA trans-activating RNA
  • the expression vector comprises a synthetic enhancer comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12 integrated between the 3' end of the first target sequence for the first recombinase and the 5' end of another enhancer or a promoter in the expression cassette.
  • the expression vector comprises a synthetic enhancer comprising the nucleic acid sequence of SEQ ID NO: 12 integrated between the 3' end of the first target sequence for the first recombinase and the 5' end of another enhancer or a promoter in the expression cassette.
  • the synthetic enhancer comprises multiple contiguous copies of the nucleic acid sequence, such as, for example, 1, 2, 3, 4, 5, or more contiguous copies.
  • the synthetic enhancer comprises 3 contiguous copies of the nucleic acid sequence.
  • the synthetic enhancer comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:46.
  • the synthetic enhancer comprises the nucleic acid sequence of SEQ ID NO:46.
  • the synthetic enhancer is integrated at the 5' end of a chicken b-actin promoter.
  • a chimeric intron comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:47 is integrated at the 3' end of the chicken b-actin promoter and 5' to the nucleic acid sequence of interest. In some aspects, a chimeric intron comprising the nucleic acid sequence of SEQ ID NO:47 is integrated at the 3' end of the chicken b-actin promoter and 5' to the nucleic acid sequence of interest.
  • the expression vector comprises a CMV enhancer integrated between the 3' end of the first target sequence for the first recombinase and the 5' end of a promoter in the expression cassette.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising the nucleic acid sequence of SEQ ID NO: 12.
  • the CMV enhancer is integrated at the 3' end of multiple contiguous copies of the synthetic enhancer, such as, for example, at the 3' end of 1, 2, 3, 4, 5, or more contiguous copies of the synthetic enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of 3 contiguous copies of the synthetic enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:46.
  • the CMV enhancer is integrated at the 3' end of the nucleic acid sequence of SEQ ID NO:46. In some aspects, a CMV promoter is integrated at the 3' end of the CMV enhancer and 5' to the nucleic acid sequence of interest.
  • the expression vector comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39 integrated between the first target sequence for the first recombinase and the nucleic acid sequence of interest.
  • the expression vector comprises the nucleic acid sequence of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39 integrated between the first target sequence for the first recombinase and the nucleic acid sequence of interest.
  • a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, or the nucleic acid sequence of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39, comprises all regulatory elements in the expression cassette located 5' to the nucleic acid sequence of interest.
  • the expression vector comprises a 5'UTR comprising an intron, wherein the 5'UTR (i.e., the 5'UTR comprising the intron) is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest.
  • the 5'UTR is for improving transgene transcript splicing and translation from the expression vector or from a bacterial sequence-free vector produced from the expression vector as compared to the same expression vector or bacterial sequence-free vector, respectively, lacking the 5'UTR.
  • the intron comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:l.
  • the intron comprises the nucleic acid sequence of SEQ ID NO: 1.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:2, which is an optimized 5'UTR with an internal minimal intron, also referred to herein as "5'UTR1.”
  • the 5'UTR comprises the nucleic acid sequence of SEQ ID NO:2.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:4. In some aspects, the 5'UTR comprises the nucleic acid sequence of SEQ ID NO:4.
  • the 5'UTR further comprises a non-coding sequence integrated within the intron.
  • the intron is at least about 90%, at least about 91%, at least about
  • the non-coding sequence is non-prokaryotic and non-viral. In some aspects, the non-coding sequence is a eukaryotic sequence. In some aspects, the non-coding sequence comprises an intron, a ubiquitous chromatin opening element (UCOE), an S/MAR, an SV40 enhancer sequence (e.g ., one or more than one SV40 enhancer sequences, such as two, three, four, five or more SV40 enhancer sequences), a vertebrate chromatin insulator (e.g., cHS4), a WPRE, or any combination thereof.
  • UCOE ubiquitous chromatin opening element
  • S/MAR an SV40 enhancer sequence
  • SV40 enhancer sequence e.g ., one or more than one SV40 enhancer sequences, such as two, three, four, five or more SV40 enhancer sequences
  • a vertebrate chromatin insulator e.g., cHS4
  • WPRE or any combination thereof.
  • the non-coding sequence comprises an S/MAR.
  • the S/MAR is MAR-5, provided herein as SEQ ID NO:9.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:3.
  • the 5'UTR comprises SEQ ID NO:3.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:5.
  • the 5'UTR comprises SEQ ID NO:5.
  • the 5'UTR is integrated in the expression cassette between a chicken b-actin promoter and the nucleic acid sequence of interest.
  • the 5'UTR is integrated in the expression cassette between a
  • the 5'UTR is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest, wherein the promoter is integrated at the 3' end of a CMV enhancer.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising the nucleic acid sequence of SEQ ID NO: 12.
  • the CMV enhancer is integrated at the 3' end of multiple contiguous copies of the synthetic enhancer, such as, for example, at the 3' end of 1, 2, 3, 4, 5, or more contiguous copies of the synthetic enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of 3 contiguous copies of the synthetic enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 46. In some aspects, the CMV enhancer is integrated at the 3' end of a nucleic acid sequence of SEQ ID NO:46.
  • the expression vector comprises a polyadenylation signal integrated at the 3' end of the nucleic acid sequence of interest.
  • the polyadenylation signal comprises a Xenopus leavis beta-globin polyadenylation signal, a human beta-globin polyadenylation signal, or a hybrid Xenopus leavis and human beta- globin polyadenylation signal.
  • the polyadenylation signal comprises multiple copies of a Xenopus leavis beta-globin polyadenylation signal, a human beta- globin polyadenylation signal, or a hybrid Xenopus leavis and human beta-globin polyadenylation signal, such as, for example, 1, 2, 3, 4, or 5 copies.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the polyadenylation signal comprises the nucleic acid sequence of SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • a polyadenylic acid tail i.e., poly(A) tail is located at the 3' end of the polyadentylation signal.
  • the poly(A) tail is 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, or more residues in length.
  • sequence comprising the polyadenylation signal and the poly(A) tail is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.
  • sequence comprising the polyadenylation signal and the poly(A) tail comprises SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.
  • the expression vector comprises a vertebrate chromatin insulator in the expression cassette.
  • the vertebrate chromatin insulator is 5'-HS4 chicken-P-globin insulator (cHS4). See, e.g., Benabdellah etal, PLoS ONE 9(1): e84268 (2014); Lu etal., FEBS Open Bio 10: 644-656 (2020); Hanawa etal., Mol. Ther. 77(4): 667-674 (2009); Walters etal., Mol. Cell. Biol. 19(5): 3714-3726 (1999).
  • cHS4 5'-HS4 chicken-P-globin insulator
  • the vertebrate chromatin insulator is integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal as described herein. In some aspects, the vertebrate chromatin insulator is integrated within the intron of a 5'UTR as described herein.
  • the vertebrate chromatin insulator comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 8.
  • the vertebrate chromatin insulator comprises SEQ ID NO:8.
  • the vertebrate chromatin insulator is for improving establishment
  • transfection efficiency of the expression vector or a bacterial sequence-free vector produced from the expression vector as compared to the same expression vector or bacterial sequence-free vector, respectively, without the vertebrate chromatin insulator.
  • the expression vector comprises a WPRE in the expression cassette. See, e.g., Higashimoto et al., Gene Therapy 14: 1298-1304 (2007).
  • the WPRE is integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal as described herein.
  • the WPRE is integrated in the expression cassette at the 3' end of a S/MAR as described herein and the 5' end of a polyadenylation signal as described herein.
  • the WPRE is integrated within the intron of a 5'UTR as described herein.
  • the WPRE comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 11. In some aspects, the WPRE comprises SEQ ID NO: 11.
  • the WPRE improves expression of the transgene from the expression vector or the bacterial sequence-free vector produced from the expression vector as compared to the same expression vector or bacterial sequence-free vector, respectively, lacking the WPRE.
  • the expression vector comprises a S/MAR in the expression cassette. See , e.g. , Martens et aI.,Mo ⁇ Cell. Biol. 22(8): 2598-2606 (2002); Narwade et al., Nucleic Acids Res. ⁇ 7(14): 7247-7261 (2019).
  • the S/MAR is integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal.
  • the S/MAR is integrated in the expression cassette at the 3' end of a nucleic acid sequence of interest and the 5' end of a WPRE as described herein.
  • the S/MAR is integrated within the intron of a 5'UTR as described herein.
  • the S/MAR is MAR-3, MAR-4, or MAR-5, which are fragments of human beta-interferon MAR. See , e.g., Wang et al., Mol. Biol. Cell 30: 2761-2770 (2019).
  • the S/MAR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:9.
  • the S/MAR comprises SEQ ID NO:9.
  • the S/MAR is human cytotoxic serine protease-B (CSP-B) MAR or CSP-C MAR. See, e.g., Hanson and Ley, Blood 79(3):610-618 (1992); Klein et al., Tissue Antigens 35( 5):220-228 (1990).
  • the S/MAR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 10.
  • the S/MAR comprises SEQ ID NO: 10.
  • the S/MAR is for improving expression levels, stability, and/or durability (e.g ., by episomal maintenance and replication, such as expansion and partition of the vector to daughter cells, and/or by preventing epigenetic silencing) of the expression vector or a bacterial sequence-free vector (produced from the expression vector as compared to the same expression vector or bacterial sequence-free vector, respectively, lacking the S/MAR.
  • the expression vector comprising any one of more of (c)(i)-
  • (c)(vii) as described above further comprises an enhancer sequence flanking each side of the first and second target sequences for the first recombinase.
  • the enhancer sequence flanking each side of the first and second target sequences for the first recombinase is at least two enhancer sequences flanking each side of the first and second target sequences for the first recombinase.
  • the enhancer sequence is a SV40 enhancer sequence.
  • the expression vector comprises a DTS. In some aspects, the
  • DTS is integrated within the first and/or second target sequences for the first recombinase in non-binding regions for the first recombinase and the one or more additional recombinases, wherein the DTS is between the expression cassette and cleavage sites for the first recombinase and the one or more additional recombinases.
  • the DTS is a SV40 enhancer sequence.
  • the DTS is cell-specific.
  • the DTS is specific for smooth muscle cells, embryonic stem cells, type II pneumonocytes, endothelial cells, or osteoblasts.
  • the location of the DTS between the expression cassette and cleavage sites for the recombinases in the expression vector ensures that the DTS remains associated with the bacterial sequence-free vector, and not the backbone sequence, following recombination as described herein.
  • the expression vector comprises a UCOE in the expression cassette. See , e.g., Miiller-Kuller et al, Nucleic Acids Res. 43(3): 1577-1592 (2015); Skipper et al, BMC Biotechnol. 19:15 (2019); Rudina et al, bioRxiv, doi.org/10.1101/626713 (2019); Neville et al, Biotechnol. Adv. 35(5): 557-564 (2017).
  • the UCOE is located between the 3' end of the first target sequence for the first recombinase and the 5' end of a promoter or any enhancer in the expression cassette.
  • the UCOE is integrated within the intron of a 5'UTR as described herein.
  • the UCOE is A2UCOE.
  • the UCOE comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:6.
  • the UCOE is SEQ ID NO:6.
  • the UCOE is SRF-UCOE. See, e.g., International Publication No.
  • the UCOE comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:7. In some aspects, the UCOE is SEQ ID NO:7.
  • the UCOE improves expression of the transgene from the expression vector or a bacterial sequence-free vector produced from the expression vector as compared to the same expression vector or bacterial sequence-free vector, respectively, lacking the UCOE.
  • the expression vector comprises Enhancer- 1 in the expression cassette.
  • Enhancer-1 is integrated between the 3' end of the first target sequence for the first recombinase and the 5' end of a promoter or any other enhancer in the expression cassette.
  • Enhancer-1 is integrated between the 3' end of a UCOE and the 5' end of a CMV enhancer.
  • Enhancer-1 comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12.
  • Enhancer- 1 is SEQ ID NO: 12.
  • the expression vector comprises a CMV, EF1, SV40, CAG, Rho,
  • the expression vector comprises a CMV promoter variant in the expression cassette. See , e.g. , International Publication No. W02012099540; Xu etal. , Bioengineered 10(1): 548-560, DOI: 10.1080/21655979.2019.1684863 (2019). [0186] In some aspects, the expression vector comprises an EF1 -alpha promoter in the expression cassette. In some aspects, the expression vector comprises a CMV enhancer and an EF1 -alpha promoter in the expression cassette.
  • the expression vector comprises a 3'UTR in the expression cassette comprising two copies of a beta-globin polyadenylation signal.
  • the 3'UTR is integrated between the nucleic acid sequence of interest and the 5' end of the second target sequence for the first recombinase.
  • the 3'UTR comprises two copies of a Xenopus laevis beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 13.
  • the 3'UTR is SEQ ID NO:13.
  • the 3'UTR comprises two copies of a human beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 14.
  • the 3'UTR is SEQ ID NO: 14.
  • the 3'UTR comprises one copy of a Xenopus laevis beta-globin polyadenylation signal and one copy of a human beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 15.
  • the 3'UTR is SEQ ID NO: 15.
  • the 3'UTR further comprises a poly(A) tail ⁇ i.e., at the 3' end of the 3'UTR) comprising 100 to 120 adenine nucleotides, i.e., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 adenine nucleotides.
  • a poly(A) tail ⁇ i.e., at the 3' end of the 3'UTR
  • 100 to 120 adenine nucleotides i.e., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 adenine nucleotides.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 16.
  • the 3'UTR is SEQ ID NO: 16.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 17.
  • the 3'UTR is SEQ ID NO: 17.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 18.
  • the 3'UTR is SEQ ID NO: 18.
  • the expression vector can contain any combination of the above modifications to the first and/or second target sequences and/or the expression cassette as described herein. In some aspects, the combination provides a synergistic effect.
  • the first and second target sequences for the first recombinase and the one or more additional target sequences for the one or more additional recombinases are selected from the group consisting of the PY54 pal site, the N15 telRL site, the loxP site, cpK02 telRL site, the FRT site, the phiC31 attP site, and the l attP site.
  • the expression vector comprises each of the target sequences.
  • the expression vector comprises the pal site and the telRL, loxP, and FRT recombinase target binding sequences integrated within the pal site.
  • the first and second target sequences for the first recombinase each comprise the nucleic acid sequence of SEQ ID NO:33.
  • the nucleic acid sequence of interest in any of the expression cassettes described herein comprises a sequence encoding: a polypeptide, an RNA (messenger RNA (mRNA), micro-RNA (miRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), ribozyme, or antisense RNA), or a non-coding DNA (e.g, an antisense oligonucleotide).
  • mRNA messenger RNA
  • miRNA micro-RNA
  • siRNA small interfering RNA
  • shRNA small hairpin RNA
  • antisense RNA e.g, an antisense oligonucleotide
  • the nucleic acid sequence of interest is a genomic DNA sequence comprising introns and/or exons.
  • the nucleic acid sequence of interest comprises a sequence encoding: an anti-cancer agent, a tumor suppressor, an apoptotic agent, an anti-angiogenesis agent, an enzyme, a cytotoxic agent, a suicide gene, a cytokine, an interferon, an interleukin, an immunomodulatory agent, an immunostimulatory agent, an immunoinhibitory agent, a chemokine, an antigen for stimulating an antigen-presenting cell, an antibody (e.g ., a heavy chain and/or a light chain of an antibody, such as a monoclonal, chimeric, humanized, or human antibody, or an antigen-binding fragment thereof), a genome editing system or a portion thereof (e.g., CRISPR-Cas, TALEN, ZFN, or meganuclease systems or portions thereof, such as a Cas endonuclease or a gRNA), or an immunogenic agent (e.g, as a VLP), or an immuno
  • Exemplary therapeutic targets and indications include: a gene associated with a monogenic disorder, including, for example, a liver, blood, or eye disorder, galactosidase alpha (GLA, e.g, for treating Fabry disease), sodium voltage-gated channel alpha subunit 1 (SCN1A, e.g, for treating dravet syndrome), ATP binding cassette subfamily A member 4 (ABCA4, e.g, for treating Stargardt disease), surfactant protein B (SP-B, e.g, for treating surfactant dysfunction disorder), surfactant protein C (SP-C, e.g, for treating surfactant dysfunction disorder), ATP -binding cassette sub-family A member 3 (ABCA3, e.g, for treating surfactant dysfunction disorder), solute carrier family 34 member 2 (SLC34A2, e.g, for treating pulmonary alveolar microlithiasis and/or testicular microlithiasis), cystic fibrosis transmembrane conductance regulator (CF
  • retinoschisin 1 e.g. , for treating X-linked juvenile retinoschisis
  • alpha- 1 antitrypsin AAT, e.g. , for treating hereditary emphysema or AAT deficiency
  • minidystrophin e.g, for treating Duchenne’s muscular dystrophy
  • a-sarcoglycan aSG, e.g, for treating Duchenne’s muscular dystrophy or limb girdle muscular dystrophy type 2
  • b-sarcoglycan b SG
  • g-sarcoglycan ySG, e.g, for treating limb girdle muscular dystrophy type 2)
  • d-sarcoglycan ySG
  • ipoprotein lipase LPL, e.g, for treating familial LPL deficiency
  • GAA acid alpha-glucosidase
  • PUMA p53 upregulated modulator of apoptosis
  • TNF tumor necrosis factor
  • TRAIL tumor necrosis factor-related apoptosis-inducing ligand
  • lymphoma hepatocellular carcinoma, head and neck squamous cell carcinoma (i.e., head and neck cancer), or glioblastoma
  • soluble TRAIL e.g, for treating cancer, e.g, liver cancer or lung adenocarcinoma
  • IFN-b e.g, for treating cancer, e.g, colorectal cancer, lung cancer, neuroblastoma, or glioblastoma multiforme
  • IFN-a e.g, for treating cancer, e.g, metastatic melanoma
  • CD-40 ligand (CD40L) or CD40L mutant e.g, for treating cancer, e.g, lung cancer
  • melanoma differentiation-associated gene-7 and interleukin 24 mda-7 and IL24, e.g, for treating cancer, e.g, Ehrlich ascites tumor
  • apoptotin and IL24 e.g, for treating cancer, e.g, liver
  • RNA against highly expressed in cancer 1 Heel, e.g. , for treating cancer, e.g. , glioma
  • shRNA against Epstein-Barr virus latent membrane protein-1 EBV LMP-1, e.g. , for treating cancer, e.g. , nasopharyngeal cancer
  • HPV16-E7 anti-sense RNA against human papilloma virus 16 E7 oncogene
  • RNA against androgen receptor AR, e.g. , for treating cancer, e.g., prostate cancer
  • siRNA against Snail also known as SNA1, e.g, for treating cancer, e.g, pancreatic cancer
  • siRNA against Slug i.e., the protein product of SNAI2, e.g, for treating cancer, e.g, cholangiocarcinoma (liver cancer)
  • shRNA against Four and a half LIM-only protein 2 FHL2, e.g, for treating cancer, e.g, colon cancer
  • miR-26a e.g, for treating cancer, e.g, hepatocellular carcinoma
  • HPV 16 structural protein LI HPV16-L1, e.g, for treating cancer, e.g, cervical cancer
  • HPV 16 E5, E6, and E7 oncogenes HPV16 E5/E6/E7, e.g, for treating cancer, e.g, cervical cancer
  • nucleic acid sequence of interest is for use in gene editing
  • the nucleic acid sequence of interest is for insertion into a target site for gene editing (i.e ., a site within a DNA or RNA sequence that is the target of gene editing).
  • a target site for gene editing includes any genetic element, such as any cis element.
  • the target site for gene editing is located within an exon of a gene, an intron of a gene, or a regulatory element of a gene.
  • the gene editing comprises an endonuclease.
  • the endonuclease is associated with a genome editing system.
  • the endonuclease is, for example, a homing endonuclease, a site-specific nuclease, a structure-guided nuclease, or an RNA-guided nuclease (e.g, a transposon-encoded RNA- guided nuclease).
  • the gene editing comprises a genome editing system that produces a double-strand break within the target site for gene editing.
  • the genome editing system is a CRISPR-Cas, TALEN, ZFN, or meganuclease gene editing system.
  • the nucleic acid sequence of interest is inserted into the target site for gene editing by non-homologous end joining at the double-strand break.
  • the double-strand break is produced by a CRISPR-Cas system.
  • an expression vector as described herein comprises a Cas endonuclease target sequence (i.e., a sequence homologous to a gRNA targeting sequence) located between the first and second target sequences for the first recombinase and the nucleic acid sequence of interest (i.e., between the 5' Super Sequence and the nucleic acid sequence of interest and between the 3' Super Sequence and the nucleic acid sequence of interest), wherein the target site for gene editing (e.g, a target site in a chromosome) comprises the same Cas endonuclease target sequence.
  • a Cas endonuclease target sequence i.e., a sequence homologous to a gRNA targeting sequence
  • processing of the Cas endonuclease target sequences flanking the nucleic acid sequence in a bacterial sequence-free vector results in removal of the Super Sequences, rendering a linear covalently closed bacterial sequence-free vector such as msDNA to instead be linear and open-ended, with reactive ends that are amenable to non- homologous end-joining events.
  • a bacterial sequence-free vector e.g, msDNA
  • the nucleic acid sequence of interest is inserted into the target site for gene editing by homology-directed repair, which occurs through recombination between sequences flanking the double-strand break and homologous sequences associated with the nucleic acid sequence of interest.
  • the nucleic acid sequence of interest has sufficient homology with sequences flanking the double-strand break to support homology-directed repair.
  • nucleic acid sequence of interest is flanked by 5’ and 3’ homology arms (i.e., sequences that have sufficient homology with sequences flanking the double-strand break to mediate homology-directed repair).
  • sufficient homology to mediate homology-directed repair comprises at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% homology between the nucleic acid sequence of interest and the sequences flanking the double-strand break or between homology arms flanking the nucleic acid sequence of interest and the sequences flanking the double-strand break.
  • a sequence flanking the double-strand break is within about 100 bases, about 90 bases, about 80 bases, about 70 bases, about 60 bases, about 50 bases, about 45 bases, about 40 bases, about 35 bases, about 30 bases, about 25 bases, about 20 bases, about 15 bases, about 10 bases, or about 5 bases of the double- strand break, or immediately flanks the double-strand break.
  • the homology-directed repair is by a CRISPR-Cas system.
  • an expression vector as described herein comprises the CRISPR-Cas system.
  • the expression vector comprises a tRNA-gRNA polycistron flanking each side of a sequence encoding a Cas endonuclease ( e.g ., an immunosilenced Cas9-P2).
  • a Cas endonuclease e.g ., an immunosilenced Cas9-P2
  • An exemplary aspect is shown in Figure 49.
  • the expression vector comprises a 5'UTR (e.g., 5'UTR1) as described herein comprising the tRNA- gRNA polycistron in an intron.
  • the expression vector comprises a chimeric intron as described herein comprising the tRNA-gRNA polycistron.
  • an EF1 -alpha promoter as described herein comprises the tRNA-gRNA polycistron in an inherent intron.
  • a polyadenylation signal or 3'UTR as described herein comprises a tRNA-gRNA polycistron.
  • a Cas endonuclease from the vector i.e., from the expression vector or bacterial sequence-free vector (e.g, msDNA)
  • the gRNA is excised as free RNA and targets the Cas endonuclease to the target site for gene editing (e.g, a target site in a chromosome) as well as the flanking gRNA sites on the vector.
  • gene editing e.g, a target site in a chromosome
  • an expression vector as described herein comprises the nucleic acid sequence of interest flanked by homology arms as shown, for example, in Scenario 1 of Figure 51.
  • a nucleic acid sequence of interest and a self-restricting CRISPR-Cas system as described herein are located on a single expression vector as described herein as shown in Scenario 2 of Figure 51.
  • the sequences comprising the self-restricting CRISPR-Cas system are located 5' to the sequence comprising the nucleic acid sequence of interest flanked by homology arms.
  • the nucleic acid sequence of interest is homologous to the target site for gene editing and comprises one or more nucleotide insertions, deletions, inversions, or rearrangements as compared to the target site.
  • the nucleic acid of interest is a genomic sequence, a coding region, an exon, an intron, or any portion thereof that replaces a homologous sequence at the target site.
  • the nucleic acid sequence of interest is non-homologous to the target site for gene editing.
  • the nucleic acid sequence of interest restores a missing function, corrects an abnormal function, or provides an additional function associated with the target site for gene editing.
  • the nucleic acid sequence of interest is for knockout of gene expression associated with a target site for gene editing (i.e., gene silencing).
  • the nucleic acid sequence of interest is for in vivo gene editing.
  • the nucleic acid sequence of interest is for in vitro gene editing.
  • the nucleic acid sequence of interest is for ex vivo gene editing e.g ., cell therapy, such as chimeric antigen receptor (CAR) T cell therapy).
  • cell therapy such as chimeric antigen receptor (CAR) T cell therapy.
  • the gene editing comprises an epigenetic modification
  • an expression vector as described herein comprises an epigenetic effector molecule as the nucleic acid of interest.
  • the epigenetic effector molecule mediates, for example, acetylation or deacetylation, methylation or demethylation, or phosphorylation or dephosphorylation.
  • the epigenetic effector molecule inhibits acetylation or deacetylation, methylation or demethylation, or phosphorylation or dephosphorylation.
  • the epigenetic modification is a histone modification.
  • the histone modification is histone acetylation and the nucleic acid of interest is a histone acetyltransferase. In some aspects, the histone modification is histone deacetylation and the nucleic acid of interest is a histone deacetylase. In some aspects, the epigenetic modification is a DNA modification. In some aspects, the DNA modification is DNA methylation and the nucleic acid of interest is a DNA methylase. In some aspects, the DNA modification is DNA demethylation and the nucleic acid of interest is a DNA demethylase. In some aspects, the epigenetic effector molecule is fused to a targeting molecule, such as a DNA-binding molecule to target the effector to a location on the chromosome.
  • a targeting molecule such as a DNA-binding molecule to target the effector to a location on the chromosome.
  • the expression cassette is polygenic, i.e., the expression cassette comprises two or more nucleic acid sequences of interest encoding two or more polypeptides, respectively.
  • the expression cassette comprises a single open reading frame comprising a nucleic acid sequence encoding a self-cleaving peptide between each nucleic acid sequence encoding a polypeptide, such that the translation product of the expression cassette is cleaved intracellularly into two or more polypeptides.
  • the self-cleaving peptide is a 2A self-cleaving peptide.
  • the 2A self-cleaving peptide is P2A from porcine teschovirus-1.
  • the 2A self- cleaving peptide is T2A from thosea asigna virus 2A.
  • the self-cleaving peptide comprises any one or more of 2A, P2A, and T2A.
  • the self- cleaving peptide comprises P2A and T2A.
  • the expression cassette further comprises a nucleic acid sequence encoding a marker for gene expression.
  • the marker for gene expression is a fluorescent reporter gene, such as green fluorescent protein (GFP, e.g ., enhanced GFP (eGFP)), red fluorescent protein (RFP), yellow fluorescent protein (YFP), or near-infrared fluorescent protein (iRFP); a bioluminescent reporter genes such as luciferase (e.g, nanoluciferase, i.e., NanoLuc® (NLuc), England etal., Bioconjug. Chem. 27( 5): 1175- 1187 (2016), Promega Corporation); a selectable antibiotic marker; or LacZ.
  • the expression cassette comprises a nucleic acid sequence encoding a self- cleaving peptide between the nucleic acid sequence encoding a marker for gene expression and any other nucleic acid sequence encoding a polypeptide.
  • the expression cassette can contain any expression control region known to those of skill in the art operably linked to the nucleic acid sequence(s) of interest.
  • the expression control region is a promoter, enhancer, operator, repressor, ribosome binding site, translation leader sequence, intron, polyadenylation recognition sequence, RNA processing site, effector binding site, stem-loop structure, transcription termination signal, or a combination thereof.
  • the expression vector is for producing a bacterial sequence-free vector.
  • the bacterial sequence-free vector is a circular covalently closed vector.
  • the bacterial sequence-free vector is a linear covalently closed vector.
  • a vector production system comprising recombinant cells encoding a recombinase under the control of an inducible promoter, wherein the recombinant cells comprise an expression vector as described herein that contains first and second target sequences for a first recombinase and one or more additional target sequences for one or more additional recombinases, and wherein the recombinase targets the first and second target sequences for the first recombinase or one of the one or more additional target sequences for the one or more additional recombinases.
  • Suitable host cells for use in the vector production system include microbial cells, for example, bacterial cells such as E. coli cells, and yeast cells such as S. cerevisiae. Mammalian host cells can also be used, including Chinese hamster ovary (CHO) cells (e.g., the K1 lineage (ATCC CCL 61) or the Pro5 variant (ATCC CRL 1281)); fibroblast- like cells derived from SV40-transformed African Green monkey kidney of the CV-1 lineage (ATCC CCL 70), of the COS-1 lineage (ATCC CRL 1650), or of the COS-7 lineage (ATCC CRL 1651; murine L-cells; murine 3T3 cells (ATCC CRL 1658); murine C127 cells; human embryonic kidney cells of the 293 lineage (ATCC CRL 1573); human carcinoma cells including those of the HeLa lineage (ATCC CCL 2); and neuroblastoma cells of the lines IMR-32 (ATCC CCL 127), SK
  • Suitable recombinases catalyze DNA exchange at a target sequence for a recombinase as described herein including, but not limited to, TelN, Tel, Tel (gp26 K02 phage), Cre, Flp, phiC31, Int, and other lambdoid phage integrases, e.g. phi 80, HK022 and HP1 recombinases.
  • the recombinase is TelN, Tel, Cre, or Flp.
  • the recombinant cells further encode an endonuclease under the control of an inducible promoter, wherein the endonuclease targets an endonuclease target sequence in the expression vector.
  • Suitable endonucleases cleave polynucleotides at the endonuclease target sequence.
  • the endonuclease is a homing endonuclease.
  • the homing endonuclease is I-Anil, I-Ceul, I-Chul, I-Cpal, I-CpaII, I-Crel, I-Dmol, H- Drel, I-Hmul, I-HmuII, I-Llal, I-Msol, PI-PfuI, PI-PkoII, I-Porl, I-Ppol, PI-PspI, I-Scal, I-Scel, Pl-Scel, I-Scell, I-SecIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-Ssp6803I, I-Tevl, I-T
  • the endonuclease is I-Scel. In some aspects, the endonuclease is Pl-Scel. In some aspects, the recombinant cells encode a nuclease genome editing system comprising the endonuclease. In some aspects, the genome editing system is a CRISPR-Cas, a TALEN, a ZFN, or a meganuclease system. In some aspects, the nuclease genome editing system is a Class 1 or a Class 2 CRISPR-Cas system. In some aspects, the nuclease genome editing system is Type I, II, III, IV, V, or VI CRISPR-Cas system.
  • the Cas endonuclease in the CRISPR-Cas system is Cas9 (e.g, a SpCas9, a SaCas9, a FnCas9, or aNmCas9), a Cas9 variant (e.g, CasP9, xCas9, SpCas9-NG, SpCas9-NRRH, SpCas9- NRCH, SpCas9-NRTH, SpG, SpRY), Cas3, Cas 12 (e.g, Cas 12a, Cas 12b, Cas 12c, Casl2d, or Casl2e), Casl3 (e.g, Casl3a, Casl3b, Casl3c, or Casl3d), or Casl4.
  • Cas9 e.g, a SpCas9, a SaCas9, a FnCas9, or aNmCas9
  • Recombinant host cells encoding a recombinase, or a recombinase and an endonuclease are prepared using well-known techniques. For example, a nucleic acid sequence encoding a selected recombinase or endonuclease is introduced into the cell using a suitable vector under appropriate conditions for cell transformation. The recombinant host cells can be transformed via an expression vector, or by integration of a recombinase-encoding and/or endonuclease-encoding nucleic acid sequence into the host cell genome.
  • the host cell can be designed to encode all of the components of the nuclease genome editing system, either by transformation of the host cell with one or more expression vectors comprising all of the components, by integration of all of the components into the host cell genome, or by a mixture of transformation and integration of the components.
  • the host cell encodes a Cas or Cas-like endonuclease and a gRNA.
  • Expression of the recombinase or endonuclease, including an endonuclease of a nuclease genome editing system is under the control of an inducible promoter, /. e. , a promoter which is activated under a particular physical or chemical condition or stimulus.
  • the inducible promoter is thermally-regulated, chemically-regulated, IPTG regulated, glucose-regulated, arabinose inducible, T7 polymerase regulated, cold- shock inducible, pH inducible, or combinations thereof.
  • a recombinant cell comprising an expression vector as described herein that contains first and second target sequences for a first recombinase and one or more additional target sequences for one or more additional recombinases.
  • the recombinant cell encodes the first recombinase and/or one or more of the one or more recombinases as described herein.
  • the recombinant cell encodes one or more endonucleases as described herein.
  • the recombinant cell encodes a nuclease genome editing system as described herein.
  • a method of producing a bacterial sequence-free vector comprising incubating a vector production system as described herein under suitable conditions for expression of the recombinase.
  • the method further comprises incubating the vector production system under suitable conditions for expression of an endonuclease encoded by the recombinant cells.
  • the method further comprises incubating the vector production system under suitable conditions for expression of a nuclease genome editing system encoded by the recombinant cells.
  • the method further comprises harvesting the bacterial sequence-free vector.
  • a bacterial sequence-free vector produced by a method of producing a bacterial sequence-free vector as described herein.
  • a bacterial sequence-free vector comprising: (a) an expression cassette comprising a nucleic acid sequence of interest, and (b) one or more of: (i) a synthetic enhancer comprising a nucleic acid sequence at least about 90% identical to SEQ ID NO: 12 located 5' to another enhancer or a promoter in the expression cassette,
  • a CMV enhancer located 5' to a promoter in the expression cassette
  • a 5'UTR comprising an intron
  • the 5'UTR is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest
  • a vertebrate chromatin insulator integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal
  • a WPRE integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal
  • a S/MAR integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal
  • a DTS located 5' to the expression cassette.
  • the bacterial sequence-free vector comprises a synthetic enhancer comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12 located 5' to another enhancer or a promoter in the expression cassette.
  • the bacterial sequence-free vector comprises a synthetic enhancer comprising the nucleic acid sequence of SEQ ID NO: 12 located 5' to another enhancer or a promoter in the expression cassette.
  • the synthetic enhancer comprises multiple contiguous copies of the nucleic acid sequence, such as, for example, 1, 2, 3, 4, 5, or more contiguous copies. In some aspects, the synthetic enhancer comprises 3 contiguous copies of the nucleic acid sequence. In some aspects, the synthetic enhancer comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:46. In some aspects, the synthetic enhancer comprises the nucleic acid sequence of SEQ ID NO:46.
  • the synthetic enhancer is integrated at the 5' end of a chicken b-actin promoter.
  • a chimeric intron comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:47 is integrated at the 3' end of the chicken b-actin promoter and 5' to the nucleic acid sequence of interest.
  • a chimeric intron comprising the nucleic acid sequence of SEQ ID NO:47 is integrated at the 3' end of the chicken b- actin promoter and 5' to the nucleic acid sequence of interest.
  • the bacterial sequence-free vector comprises a CMV enhancer located 5' to a promoter in the expression cassette.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising the nucleic acid sequence of SEQ ID NO: 12. In some aspects, the CMV enhancer is integrated at the 3' end of multiple contiguous copies of the synthetic enhancer, such as, for example, at the 3' end of 1, 2, 3, 4, 5, or more contiguous copies of the synthetic enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of 3 contiguous copies of the synthetic enhancer.
  • the CMV enhancer is integrated at the 3' end of a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:46.
  • the CMV enhancer is integrated at the 3' end of the nucleic acid sequence of SEQ ID NO:46.
  • a CMV promoter is integrated at the 3' end of the CMV enhancer and 5' to the nucleic acid sequence of interest.
  • the bacterial sequence-free vector comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39 located 5' to the nucleic acid sequence of interest.
  • the bacterial sequence-free vector comprises the nucleic acid sequence of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39 located 5' to the nucleic acid sequence of interest.
  • a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39, or the nucleic acid sequence of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39, comprises all regulatory elements in the expression cassette located 5' to the nucleic acid sequence of interest.
  • the bacterial sequence-free vector comprises a 5'UTR comprising an intron, wherein the 5'UTR (i.e., the 5'UTR comprising the intron) is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest.
  • the 5'UTR is for improving transgene transcript splicing and translation from the bacterial sequence-free vector as compared to the same bacterial sequence-free vector lacking the 5'UTR.
  • the intron comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:l.
  • the intron comprises the nucleic acid sequence of SEQ ID NO: 1.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:2. In some aspects, the 5'UTR comprises the nucleic acid sequence of SEQ ID NO:2.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:4. In some aspects, the 5'UTR comprises the nucleic acid sequence of SEQ ID NO:4.
  • the 5'UTR further comprises a non-coding sequence integrated within the intron.
  • the intron is at least about 90%, at least about 91%, at least about
  • the non-coding sequence is non-prokaryotic and non-viral. In some aspects, the non-coding sequence is eukaryotic. In some aspects, the non-coding sequence comprises an intron, a UCOE, a S/MAR, a SV40 enhancer sequence (e.g ., one or more than one SV40 enhancer sequences, such as two, three, four, five or more SV40 enhancer sequences), a vertebrate chromatin insulator (e.g ., cHS4), a WPRE, or any combination thereof.
  • a SV40 enhancer sequence e.g ., one or more than one SV40 enhancer sequences, such as two, three, four, five or more SV40 enhancer sequences
  • a vertebrate chromatin insulator e.g ., cHS4
  • WPRE or any combination thereof.
  • the non-coding sequence comprises an S/MAR.
  • the S/MAR is MAR-5, provided herein as SEQ ID NO:9.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:3.
  • the 5'UTR comprises SEQ ID NO:3.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:5.
  • the 5'UTR comprises SEQ ID NO:5.
  • the 5'UTR is integrated in the expression cassette between a chicken b-actin promoter and the nucleic acid sequence of interest.
  • the 5'UTR is integrated in the expression cassette between a
  • the 5'UTR is integrated in the expression cassette between a promoter and the nucleic acid sequence of interest, wherein the promoter is integrated at the 3' end of a CMV enhancer.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12.
  • the CMV enhancer is integrated at the 3' end of a synthetic enhancer comprising the nucleic acid sequence of SEQ ID NO: 12.
  • the CMV enhancer is integrated at the 3' end of multiple contiguous copies of the synthetic enhancer, such as, for example, at the 3' end of 1, 2, 3, 4, 5, or more contiguous copies of the synthetic enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of 3 contiguous copies of the synthetic enhancer. In some aspects, the CMV enhancer is integrated at the 3' end of a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 46. In some aspects, the CMV enhancer is integrated at the 3' end of a nucleic acid sequence of SEQ ID NO:46.
  • the bacterial sequence-free vector comprises a polyadenylation signal integrated at the 3' end of the nucleic acid sequence of interest.
  • the polyadenylation signal comprises a Xenopus leavis beta-globin polyadenylation signal, a human beta-globin polyadenylation signal, or a hybrid Xenopus leavis and human beta- globin polyadenylation signal.
  • the polyadenylation signal comprises multiple copies of a Xenopus leavis beta-globin polyadenylation signal, a human beta- globin polyadenylation signal, or a hybrid Xenopus leavis and human beta-globin polyadenylation signal, such as, for example, 1, 2, 3, 4, or 5 copies.
  • the polyadenylation signal comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • the polyadenylation signal comprises the nucleic acid sequence of SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
  • a polyadenylic acid tail i.e., poly(A) tail is located at the 3' end of the polyadenylation signal.
  • the poly(A) tail is 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, or more residues in length.
  • sequence comprising the polyadenylation signal and the poly(A) tail is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.
  • sequence comprising the polyadenylation signal and the poly(A) tail comprises SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.
  • the bacterial sequence-free vector comprises a vertebrate chromatin insulator in the expression cassette.
  • the vertebrate chromatin insulator is cHS4.
  • the vertebrate chromatin insulator is integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal as described herein.
  • the vertebrate chromatin insulator is integrated within the intron of a 5'UTR as described herein.
  • the vertebrate chromatin insulator comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 8.
  • the vertebrate chromatin insulator comprises SEQ ID NO:8.
  • the vertebrate chromatin insulator is for improving establishment
  • transfection efficiency of a bacterial sequence-free vector as compared to the same bacterial sequence-free vector without the vertebrate chromatin insulator.
  • the bacterial sequence-free vector comprises a WPRE in the expression cassette.
  • the WPRE is integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal as described herein.
  • the WPRE is integrated in the expression cassette at the 3' end of a S/MAR as described herein and the 5' end of a polyadenylation signal as described herein.
  • the WPRE is integrated within the intron of a 5'UTR as described herein.
  • the WPRE comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 11. In some aspects, the WPRE comprises SEQ ID NO: 11.
  • the WPRE improves expression of the transgene from the bacterial sequence-free vector as compared to the same bacterial sequence-free vector lacking the WPRE.
  • the bacterial sequence-free vector comprises an S/MAR in the expression cassette.
  • the S/MAR is integrated in the expression cassette between the nucleic acid of interest and a polyadenylation signal.
  • the S/MAR is integrated in the expression cassette at the 3' end of a nucleic acid sequence of interest and the 5' end of a WPRE as described herein.
  • the S/MAR is integrated within the intron of a 5'UTR as described herein.
  • the S/MAR is MAR-3, MAR-4, or MAR-5. In some aspects, the
  • S/MAR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:9.
  • the S/MAR comprises SEQ ID NO:9.
  • the S/MAR is human CSP-B MAR or CSP-C MAR.
  • the S/MAR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 10.
  • the S/MAR comprises SEQ ID NO: 10.
  • the S/MAR is for improving expression levels, stability, and/or durability of the bacterial sequence-free vector (e.g ., by episomal maintenance and replication, such as expansion and partition of the vector to daughter cells, and/or by preventing epigenetic silencing) as compared to the same bacterial sequence-free vector lacking the S/MAR.
  • the bacterial sequence-free vector comprising any one of more of
  • the enhancer sequence flanking each side of the expression cassette is at least two enhancer sequences flanking each side of the expression cassette. In some aspects, the enhancer sequence is a SV40 enhancer sequence.
  • the bacterial sequence-free vector comprises a DTS.
  • the DTS is located 5' to the expression cassette.
  • the DTS is a SV40 enhancer sequence.
  • the DTS is cell-specific.
  • the DTS is specific for smooth muscle cells, embryonic stem cells, type II pneumonocytes, endothelial cells, or osteoblasts.
  • a bacterial sequence-free vector as described herein further comprises a UCOE in the expression cassette.
  • the UCOE is located 5' to the promoter or any enhancer in the expression cassette.
  • the UCOE is integrated within the intron of a 5'UTR as described herein.
  • the UCOE is A2UCOE.
  • the UCOE comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:6.
  • the UCOE is SEQ ID NO:6.
  • the UCOE is SRF-UCOE.
  • the UCOE comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:7.
  • the UCOE is SEQ ID NO:7.
  • the UCOE improves expression of the transgene from the bacterial sequence-free vector as compared to the same bacterial sequence-free vector lacking the UCOE.
  • the bacterial sequence-free vector comprises Enhancer-1 in the expression cassette.
  • Enhancer-1 is integrated 5' to the promoter or any other enhancer in the expression cassette.
  • Enhancer-1 is integrated between the 3' end of a UCOE and the 5' end of a CMV enhancer.
  • Enhancer-1 comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12.
  • Enhancer-1 is SEQ ID NO: 12.
  • the bacterial sequence-free vector comprises a CMV, EF1, SV40,
  • the bacterial sequence-free vector comprises a CMV promoter variant in the expression cassette.
  • the bacterial sequence-free vector comprises an EF1 -alpha promoter in the expression cassette. In some aspects, the bacterial sequence-free vector comprises a CMV enhancer and an EF1 -alpha promoter in the expression cassette.
  • the bacterial sequence-free vector comprises a 3'UTR in the expression cassette comprising two copies of a beta-globin polyadenylation signal.
  • the 3'UTR is integrated 3' to the nucleic acid sequence of interest.
  • the 3'UTR comprises two copies of a Xenopus laevis beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 13.
  • the 3'UTR is SEQ ID NO:13.
  • the 3'UTR comprises two copies of a human beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 14.
  • the 3'UTR is SEQ ID NO: 14.
  • the 3'UTR comprises one copy of a Xenopus laevis beta-globin polyadenylation signal and one copy of a human beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 15.
  • the 3'UTR is SEQ ID NO: 15.
  • the 3'UTR further comprises a poly (A) tail comprising 100 to
  • 120 adenine nucleotides i.e., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 adenine nucleotides.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 16.
  • the 3'UTR is SEQ ID NO: 16.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 17.
  • the 3'UTR is SEQ ID NO: 17.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 18.
  • the 3'UTR is SEQ ID NO: 18.
  • the nucleic acid sequence of interest of a bacterial sequence-free vector as described herein includes any of the nucleic acid sequences described herein with respect to the expression vectors for producing the bacterial sequence-free vectors.
  • a bacterial sequence-free vector as described herein comprises a
  • Cas endonuclease target sequence i.e., a sequence homologous to a gRNA targeting sequence located 5' and 3' to the nucleic acid sequence of interest, wherein a target site for gene editing (e.g ., a target site in a chromosome) comprises the same Cas endonuclease target sequence.
  • a bacterial sequence-free vector as described herein comprises a
  • the bacterial sequence-free vector comprises a tRNA-gRNA polycistron flanking each side of a sequence encoding a Cas endonuclease (e.g., an immunosilenced Cas9-P2).
  • the bacterial sequence-free vector comprises a 5'UTR (e.g, 5'UTR1) as described herein comprising the tRNA-gRNA polycistron in an intron.
  • the bacterial sequence-free vector comprises a chimeric intron as described herein comprising the tRNA-gRNA polycistron.
  • an EF1 -alpha promoter as described herein comprises the tRNA-gRNA polycistron in an inherent intron.
  • a polyadenylation signal or 3'UTR as described herein comprises a tRNA-gRNA polycistron.
  • a nucleic acid sequence of interest and a self-restricting CRISPR-Cas system as described herein are located on a single bacterial sequence-free vector as described herein. In the latter aspects, the sequences comprising the self-restricting CRISPR-Cas system are located 5' to the sequence comprising the nucleic acid sequence of interest flanked by homology arms.
  • a bacterial sequence-free vector as described herein can contain any combination of the above modifications. In some aspects, the combination provides a synergistic effect.
  • the bacterial sequence-free vector is a circular covalently closed vector.
  • the bacterial sequence-free vector is a linear covalently closed vector.
  • a recombinant cell comprising a bacterial sequence-free vector as disclosed herein.
  • nucleic acid sequences described herein are provided as DNA sequences, and the expression vectors are DNA expression vectors.
  • nucleic acid sequences described herein are provided as RNA sequences, and the expression vectors are RNA expression vectors.
  • RNA sequences can correspond to the DNA sequence provided as any SEQ ID NO herein or can correspond to the DNA sequence that is complementary to the DNA sequence provided as any SEQ ID NO herein.
  • polynucleotide comprising any combination of nucleic acid sequences as described herein.
  • polynucleotide comprising a nucleic acid sequence of: an intron, a 5'UTR comprising an intron, and/or a 3'UTR as described herein.
  • polynucleotide comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 1, 2, 3, 5, 13, 14, 15, 16, 17, or 18.
  • the polynucleotide comprises 100 to 120 adenine nucleotides at the 3' end of the nucleic acid sequence.
  • the polynucleotide comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 13, 14, or 15, and 100 to 120 adenine nucleotides at the 3' end of the nucleic acid sequence.
  • the polynucleotide comprises the nucleic acid sequence of any one of SEQ ID NOs: 1, 2, 3, 5, 13, 14, 15, 16, 17, or 18.
  • the expression vector comprises a polynucleotide comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 1, 2, 3, 5, 13, 14, 15, 16, 17, or 18.
  • the polynucleotide comprises 100 to 120 adenine nucleotides at the 3' end of the nucleic acid sequence.
  • the polynucleotide comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 13, 14, or 15, and 100 to 120 adenine nucleotides at the 3' end of the nucleic acid sequence.
  • the expression vector comprises a polynucleotide comprising the nucleic acid sequence of any one of SEQ ID NOs: 1, 2, 3, 5, 13, 14, 15, 16, 17, or 18.
  • the expression vector comprises a polynucleotide comprising the nucleic acid sequence of any one of SEQ ID NOs: 2, 3, or 5, and (a) a polynucleotide comprising the nucleic acid sequence of any one of SEQ ID NOs: 13, 14, 15, 16, 17, or 18, or (b) a polynucleotide comprising the nucleic acid sequence of any one of SEQ ID NOs: 13, 14, or 15 and 100 to 120 adenine nucleotides at the 3' end of the nucleic acid sequence.
  • an expression vector comprising: a 5'UTR comprising an intron, wherein the 5'UTR is integrated in the expression cassette between a promoter and a nucleic acid sequence of interest, and/or a 3'UTR comprising two copies of a beta- globin polyadenylation signal integrated in the expression cassette 3' to the nucleic acid sequence of interest.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:2. In some aspects, the 5'UTR comprises the nucleic acid sequence of SEQ ID NO:2.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:4. In some aspects, the 5'UTR comprises the nucleic acid sequence of SEQ ID NO:4.
  • the 5'UTR further comprises a non-coding sequence integrated within the intron.
  • the intron is at least about 90%, at least about 91%, at least about
  • the non-coding sequence is non-prokaryotic and non-viral. In some aspects, the non-coding sequence is a eukaryotic sequence. In some aspects, the non-coding sequence comprises an intron, a UCOE, an S/MAR, an SV40 enhancer sequence (e.g ., one or more than one SV40 enhancer sequences, such as two, three, four, five or more SV40 enhancer sequences), a vertebrate chromatin insulator (e.g., cHS4), a WPRE, or any combination thereof.
  • an SV40 enhancer sequence e.g ., one or more than one SV40 enhancer sequences, such as two, three, four, five or more SV40 enhancer sequences
  • a vertebrate chromatin insulator e.g., cHS4
  • WPRE or any combination thereof.
  • the non-coding sequence is an S/MAR. In some aspects, the
  • S/MAR is MAR-5, provided herein as SEQ ID NO:9.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:3.
  • the 5'UTR comprises SEQ ID NO:3.
  • the 5'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:5.
  • the 5'UTR comprises SEQ ID NO:5.
  • the 3'UTR comprises two copies of a Xenopus laevis beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 13.
  • the 3'UTR is SEQ ID NO:13.
  • the 3'UTR comprises two copies of a human beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 14.
  • the 3'UTR is SEQ ID NO: 14.
  • the 3'UTR comprises one copy of a Xenopus laevis beta-globin polyadenylation signal and one copy of a human beta-globin polyadenylation signal.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 15.
  • the 3'UTR is SEQ ID NO: 15.
  • the 3'UTR further comprises a poly (A) tail comprising 100 to
  • 120 adenine nucleotides i.e., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 adenine nucleotides.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 16.
  • the 3'UTR is SEQ ID NO: 16.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 17.
  • the 3'UTR is SEQ ID NO: 17.
  • the 3'UTR comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 18.
  • the 3'UTR is SEQ ID NO: 18.
  • an expression vector comprising a synthetic enhancer comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 12.
  • the expression vector comprises a synthetic enhancer comprising the nucleic acid sequence of SEQ ID NO: 12.
  • the synthetic enhancer comprises multiple contiguous copies of the nucleic acid sequence, such as, for example, 1, 2, 3, 4, 5, or more contiguous copies.
  • the synthetic enhancer comprises 3 contiguous copies of the nucleic acid sequence.
  • the synthetic enhancer comprises a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:46. In some aspects, the synthetic enhancer comprises the nucleic acid sequence of SEQ ID NO:46.
  • an expression vector comprising a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39.
  • the expression vector comprises the nucleic acid sequence of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39.
  • a nucleic acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39, or the nucleic acid sequence of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39, comprises all regulatory elements in an expression cassette located 5' to a nucleic acid sequence of interest in the expression vector.
  • composition comprising an expression vector or bacterial sequence-free vector as described herein.
  • nucleic acids A variety of methods are known in the art and are suitable for introduction of nucleic acids into a cell. Examples include, but are not limited to, electroporation, calcium phosphate mediated transfer, nucleofection, sonoporation, heat shock, magnetofection, liposome mediated transfer, microinjection, microprojectile mediated transfer (nanoparticles), cationic polymer mediated transfer (DEAE-dextran, polyethylenimine, polyethylene glycol (PEG), and the like), or cell fusion.
  • Nanoparticle carriers such as liposomes, micelles, and polymeric nanoparticles have been investigated for improving bioavailability and pharmacokinetic properties of therapeutics via various mechanisms, for example, the enhanced permeability and retention (EPR) effect.
  • EPR enhanced permeability and retention
  • Targeting ligands that have been investigated include folate, transferrin, antibodies, peptides, and aptamers. Additionally, multiple functionalities can be incorporated into the design of nanoparticles, e.g., to enable imaging and to trigger intracellular drug release.
  • the composition further comprises a delivery agent.
  • the delivery agent is a nanoparticle.
  • the delivery agent is selected from the group consisting of liposomes, non-lipid polymeric molecules, endosomes, and any combination thereof.
  • the delivery agent e.g ., a nanoparticle
  • the delivery agent comprises a targeting ligand.
  • the composition further comprises a physiologically acceptable carrier, excipient, or stabilizer.
  • a physiologically acceptable carrier e.g., Remington: The Science and Practice of Pharmacy, 22 nd ed. (2013).
  • Acceptable carriers, excipients, or stabilizers can include those that are nontoxic to a subject.
  • the composition or one or more components of the composition are sterile.
  • a sterile component can be prepared, for example, by filtration (e.g, by a sterile filtration membrane) or by irradiation (e.g, by gamma irradiation).
  • composition comprising an expression vector or bacterial sequence-free vector as described herein is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.
  • an excipient of the present invention can be described as a "pharmaceutically acceptable" excipient when added to a pharmaceutical composition, meaning that the excipient is a compound, material, composition, salt, and/or dosage form which is, within the scope of sound medical judgment, suitable for contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problematic complications over the desired duration of contact commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized international pharmacopeia for use in animals, and more particularly in humans.
  • Various excipients can be used.
  • the excipient can be, but is not limited to, an alkaline agent, a stabilizer, an antioxidant, an adhesion agent, a separating agent, a coating agent, an exterior phase component, a controlled-release component, a solvent, a surfactant, a humectant, a buffering agent, a filler, an emollient, or combinations thereof.
  • Excipients in addition to those discussed herein can include excipients listed in, though not limited to, Remington: The Science and Practice of Pharmacy, 22 nd ed. (2013). Inclusion of an excipient in a particular classification herein (e.g., "solvent”) is intended to illustrate rather than limit the role of the excipient.
  • a particular excipient can fall within multiple classifications.
  • a pharmaceutical composition of the disclosure is formulated to be compatible with its intended route of administration.
  • routes of administration include enteral, topical, parenteral, oral, pulmonary, intranasal, intravenous, epidermal, transdermal, subcutaneous, intramuscular, or intraperitoneal administration, or inhalation.
  • Parenter administration means modes of administration other than enteral and topical administration, usually by injection or infusion, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, intrapleural, and intrasternal injection and infusion, as well as in vivo electroporation.
  • the formulation is administered via a non- parenteral route, in some aspects, orally.
  • Other non-parenteral routes include a topical, epidermal, or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingually or topically.
  • the pharmaceutical composition is lyophilized.
  • a method of treating a disease or disorder in a subject in need thereof comprising administering an expression vector, bacterial sequence-free vector, or pharmaceutical composition as described herein to the subject.
  • the expression vector, bacterial sequence-free vector, or composition can be administered to a subject by any route of administration that is effective for treating the disease or disorder.
  • the administering is by enteral, topical, parenteral, oral, pulmonary, intranasal, intravenous, epidermal, transdermal, subcutaneous, intramuscular, intrathecal, or intraperitoneal administration, inhalation, or cerebrospinal fluid (CSF)- based delivery via intracerebroventricular (ICV) injection, cistema magna administration (ICM), or lumbar intrathecal puncture (LIT).
  • ICV intracerebroventricular
  • ICM cistema magna administration
  • LIT lumbar intrathecal puncture
  • the administering is by parenteral or non-parenteral administration.
  • the parenteral administration is by injection or infusion.
  • the parenteral administration is by intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, retroorbital, intracerebroventricular, subarachnoid, intraspinal, epidural, intrapleural, or intrasternal injection or infusion, or by in vivo electroporation, nucleofection, microbubble, or ultrasound.
  • the non-parenteral administration is oral, topical, epidermal, mucosal, intranasal, vaginal, rectal, or sublingual.
  • the administering is by oral, pulmonary, intranasal, intravenous, epidermal, transdermal, subcutaneous, intramuscular, or intraperitoneal administration, or by inhalation.
  • the administering is by oral, nasal, or pulmonary administration.
  • the administering is by nasal administration.
  • Administering can be performed, for example, once, a plurality of times, and/or over one or more extended periods.
  • the administering is one time, two times (e.g ., a first administration followed by a second administration about 1, about 2, about 3, about 4 or more weeks later), once about every week, once about every month, once about every 2 months, once about every 3 months, once about every 4 months, once about every 6 months, once about every year, or once about every decade.
  • a method of gene editing comprising inserting a nucleic acid sequence of interest from an expression vector, bacterial sequence-free vector, or pharmaceutical composition as described herein into a target site for gene editing.
  • the inserting is by non-homologous end joining.
  • the inserting is by homology directed repair.
  • the nucleic acid sequence of interest is flanked by 5’ and 3’ homology arms as described herein.
  • the nucleic acid sequence of interest is homologous to the target site for gene editing and comprises one or more nucleotide insertions, deletions, inversions, or rearrangements as compared to the target site.
  • the nucleic acid sequence of interest is non-homologous to the target site for gene editing.
  • the nucleic acid sequence of interest restores a missing function, corrects an abnormal function, or provides an additional function associated with the target site for gene editing. [0335] In some aspects, the nucleic acid sequence of interest is for knockout of gene expression associated with the target site for gene editing.
  • the method of gene editing is a method of treating a disease or disorder in a subject in need thereof.
  • the nucleic acid sequence of interest is for in vivo gene editing.
  • the nucleic acid sequence of interest is for in vitro gene editing.
  • the nucleic acid sequence of interest is for ex vivo gene editing
  • cell therapy e.g ., cell therapy, such as CAR T cell therapy.
  • the method is an in vitro method.
  • the in vitro method further comprises administering the expression vector, bacterial sequence-free vector, or pharmaceutical composition to cells (e.g., for in vitro or ex vivo gene editing).
  • the in vitro method further comprises administering an endonuclease for gene editing, or a genome editing system or components thereof (e.g, Cas endonuclease and gRNA for a CRISPR-Cas system) to the cells.
  • the genome editing system is a CRISPR-Cas, TALEN, ZFN, or meganuclease gene editing system.
  • the method is an in vivo method.
  • the in vivo method further comprises administering the expression vector, bacterial sequence-free vector, or pharmaceutical composition to a subject.
  • the in vivo method further comprises administering an endonuclease for gene editing, or a genome editing system or components thereof (e.g, Cas endonuclease and gRNA for a CRISPR-Cas system) to the subject.
  • the genome editing system is a CRISPR-Cas, TALEN, ZFN, or meganuclease gene editing system.
  • the endonuclease for gene editing, or the genome editing system or components thereof can be administered by any methods described herein or as known in the art for administering nucleic acid sequences and/or polypeptides to cells or subjects, including through electroporation or vectors as applicable to the administration.
  • RNA encoding Cas and/or gRNA can be administered, Cas and/or gRNA can be directly administered, bacterial sequence-free vectors or expression vectors as described herein can be administered that encode Cas and/or gRNA, or any other suitable vector known in the art can be administered that encode Cas and/or gRNA.
  • the nucleic acid of interest is provided in a linear covalently closed bacterial sequence-free vector (i.e ., msDNA) as described herein.
  • a linear covalently closed bacterial sequence-free vector i.e ., msDNA
  • use of the linear covalently closed bacterial sequence-free vector in gene editing avoids any undesired non-homologous end joining because the ends of the bacterial sequence- free vector are closed and non-reactive with double strand breaks.
  • use of the linear covalently closed bacterial sequence-free vector in gene editing enhances homology-directed repair.
  • the recombination rate for homology-directed repair is higher when the nucleic acid sequence of interest is provided by a linear covalently closed bacterial sequence-free vector as described herein than when the nucleic acid sequence of interest is provided by a circular supercoiled vector.
  • Example 1 Expression vectors containing a chimeric intron or a 5'UTR A. Expression vectors
  • a polygenic expression vector was prepared by replacing the eGFP coding sequence of a parent ministring expression vector (Mediphage Bioceuticals, Inc., Toronto, CA, U.S. Patent Nos. 9,290,778 and 9,862,954), pGL2-SS*-CAG-eGFP-BGpA-SS*, with an expression cassette encoding enhanced green fluorescent protein (eGFP) and the NanoLuc® luciferase reporter modified with a secretion sequence for extracellular expression (NLuc, Promega Corporation) between the two specialized Super Sequence (SS*) sites of the parent vector.
  • eGFP enhanced green fluorescent protein
  • SS* Super Sequence
  • the expression cassette of the parent vector and the polygenic vector contained a
  • CAG promoter which is a synthetic promoter that includes a cytomegalovirus (CMV) enhancer, a promoter from chicken b-actin, and a chimeric intron.
  • CMV cytomegalovirus
  • SecNLuc-2A-eGFP-BGpA-SS* which contains a specialized Super Sequence site (SS*) having recombinase target sequences (telL, FRT (minimal), and loxP) flanking a polygenic expression cassette containing the CAG promoter, sequences encoding enhanced green fluorescent protein (eGFP) and secreted nano-luciferase (SecNLuc) connected by P2A and T2A self-cleaving peptides (SecNLuc-2A-eGFP), and a rabbit beta-globin polyadenylation signal (BGpA).
  • the nucleic acid sequence for the vector is provided as SEQ ID NO: 19.
  • a second polygenic expression vector was prepared by cloning the same eGFP and Nluc sequences along with a 5'UTR into the pcDNA3.1 vector (Thermo Fisher Scientific).
  • a map of the expression vector is shown in Figure 2 (vector pcDNA-CMV- 5'UTR-SecNLuc-P2A-eGFP-bGHpA), which contains a polygenic expression cassette containing the CMV enhancer/promoter, sequences encoding eGFP and SecNLuc connected by a P2A self-cleaving peptide (SecNLuc-P2A-eGFP), and a bovine growth hormone polyadenylation signal (bGHpA).
  • the nucleic acid sequence for the vector is provided as SEQ ID NO:20.
  • Adherent human embryonic kidney 293 (HEK293) cells were seeded in a 24-well plate at lxlO 5 cells/well.
  • a complex of expression vector (1 pg) and lipofectamine (3 pL) was prepared and incubated using standard operating procedures for each of (1) pGL2-SS*-CAG-SecNLuc- 2 A-eGFP-B Gp A- S S * , (2) pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA, and (3) pGL2-SS*-CAG-eGFP-BGpA-SS*.
  • the three complexes were used to separately transfect HEK293 cells via electroporation in individual wells, which were then incubated for 48 hours.
  • HEK293 cells in other wells were treated with 3 pL lipofectamine containing no plasmid as a negative control.
  • Cytoplasmic GFP expression was used as a measure of transfection efficiency and gene expression levels by the polygenic expression vectors. Expression was evaluated by fluorescent microscopy, and mean GFP expression/intensity of the experimental expression vectors (pGL2-SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS* and pcDNA-CMV- 5'UTR-SecNLuc-P2A-eGFP -bGHpA) was measured relative to the negative control (cells treated with lipofectamine and no plasmid) and the positive control (pGL2-SS*-CAG- eGFP-BGpA-SS*), also referred to herein as parental plasmid CAG-GFP, /. e. , PP-CAG- GFP).
  • Luciferase expression was evaluated by measuring the intensity of secreted luciferase in the media of transfected cells and negative control cells using the Nano- Glo® Luciferase Assay System (Promega) according to manufacturer protocols. Both experimental expression vectors expressed luciferase. See Figure 5. The mean relative luciferase intensity in the media of cells transfected with the experimental expression vectors was at least 300-fold higher than in the media of negative control cells. Id.
  • Example 2 Expression vectors containing WPRE and engineered 5'UTRs A. Expression vectors
  • a polygenic expression vector was prepared by cloning a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) between the sequence encoding eGFP and BGpA in the expression vector of Figure 1.
  • WPRE woodchuck hepatitis virus post-transcriptional regulatory element
  • the map of the resultant expression vector is shown in Figure 6 (pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE- BGpA-SS*).
  • the nucleic acid sequence for the vector is provided as SEQ ID NO:21.
  • polygenic expression vector was prepared that contains a CMV enhancer/promoter and an engineered 5'UTR containing an internal minimal intron sequence (i.e., 5'UTR1, SEQ ID NO:2) in place of the CAG promoter in Figure 6.
  • the map of the resultant expression vector is shown in Figure 7 (pGL2-SS*-CMV-UTRl- SecNLuc-2A-eGFP-WPRE-BGpA-SS*).
  • the nucleic acid sequence for the vector is provided as SEQ ID NO:22.
  • a further polygenic expression vector was prepared that contains a CMV enhancer/promoter and an engineered 5'UTR containing an intron with an integrated MAR-5 (i.e., 5'UTR2, SEQ ID NO:5) in place of the CAG promoter in Figure 6.
  • the map of the resultant expression vector is shown in Figure 8 (pGL2-SS*-CMV-UTR2- SecNLuc-2A-eGFP-WPRE-BGpA-SS*).
  • the nucleic acid sequence for the vector is provided as SEQ ID NO:23.
  • Adherent HEK293 cells were detached, resolved in electroporation media, and counted at lxlO 6 cells/tube.
  • the expression vector (1 pg) was prepared and incubated with cells using standard operating procedures for each of (1) pGL2-SS*-CAG-SecNLuc-2A-eGFP- BGpA-SS* (see Example 1), (2) P GL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA- SS*, (3) pGL2-S S * -CMV -UTR1 - SecNLuc-2 A-eGFP-WPRE-B Gp A-S S * , and (4) pGL2- S S * -CM V -UTR2- SecNLuc-2 A-eGFP-WPRE-BGp A-S S * .
  • HEK293 cells were seeded and adhered to wells at 3xl0 5 cells/well.
  • luciferase expression was evaluated by measuring the intensity of secreted luciferase in 20 pL of cell culture media in triplicate for each of the four transfections and the negative control using the Nano-Glo® Luciferase Assay System (Promega) according to manufacturer protocols. Luciferase activity was measured using a BioTek® plate reader and displayed in Relative Luminometer Units (RLU). Statistical analysis of luciferase activity was performed by Student's T-test.
  • HEK293 cells were transfected with the four expression vectors or the puc57 plasmid as a negative control, as described in part B of this example. Cells were passaged weekly for five passages. At the time of cell passaging, cells were re-seeded at 1/6 of the original cell density for passage numbers 1-3, and 1/10 of the original cell density for passage numbers 4-5. For each cell passage, secreted luciferase expression was measured 6-8 days after cell re-seeding as described in part B of this example. See Figure 10, showing expression levels in media from cells transfected with the vectors as compared to the negative control at each passage number. Statistical analysis and p values were as noted in part B of this example.
  • Luciferase expression was detected from cells transfected with any of the four expression vectors at each passage number, showing that the vectors were passed down to daughter cells with durable expression of luciferase.
  • pGL2-SS*-CAG-SecNLuc-2A- eGFP-WPRE-BGpA-SS*, pGL2-SS*-CMV-UTRl-SecNLuc-2A-eGFP-WPRE-BGpA- SS*, and pGL2-SS*-CMV-UTR2-SecNLuc-2A-eGFP-WPRE-BGpA-SS* all showed significantly higher luciferase expression at each passage number as compared to pGL2- SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS*, with pGL2-SS*-CMV-UTRl-SecNLuc-2A- eGFP-WPRE-BGpA-SS* showing the highest enhancement of expression.
  • msDNA was produced from pGL2-SS*-CMV-UTRl-SecNLuc-2A- eGFP-WPRE-BGpA-SS* in an inducible E. coli vector production system using methods described herein and in U.S. Patent Nos. 9,290,778 and 9,862,954.
  • HEK293 cells were separately transfected with the vectors via electroporation in individual wells for a total of 0.25 pmol vector /well. Cells were passaged 7 times, with a 10-fold cell dilution at each passage. Relative luciferase intensity was determined on days 8, 15, 24, 31, 38, 45, and 52 for passage numbers 1, 2, 3, 4, 5, 6, and 7, respectively.
  • BGpA-SS* i.e., pDNA (CMV+U1+W)
  • msDNA-CMV-UTRl-SecNLuc-2A-eGFP- WPRE-BGpA i.e., msDNA (CMV+U1+W) demonstrated durable transgene expression at much higher levels across all passage numbers than pcDNA-CMV-5'UTR-SecNLuc- P2A-eGFP-bGHpA (i.e., conventional plasmid containing no supersequence (conventional pcDNA)).
  • Imaging was performed 6 to 8 days after cell passaging for each passage number.
  • Live cell imaging was performed using a BioTek® CytationTM 5 plate reader. See Figure 12A, showing representative photomicrographs of fluorescence in HEK-293 cells at passage numbers 1, 2, 3, and 5.
  • eGFP expression was detected from cells transfected with either of the expression vectors at each passage number, showing that the vectors were passed down to daughter cells with durable expression of eGFP.
  • pGL2-SS*-CMV-UTRl- SecNLuc-2A-eGFP-WPRE-BGpA-SS* showed a stronger fluorescent signal at each passage number as compared to pGL2-SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS*, indicating a higher transfection efficiency.
  • ROAs routes of administration
  • TE transfection efficiency
  • msDNA showed strong efficacy and tolerability profiles in the brain and liver tissues via multiple intracerebroventricular (ICV) or hydrodynamic injections (HDI) and intravenous (IV) injections, respectively.
  • ICV intracerebroventricular
  • HDI hydrodynamic injections
  • IV intravenous
  • msDNA showed sustained secreted luciferase levels (>10 8 RLU/mg protein) after a single IV injection.
  • the msDNA showed durable (>100 days) expression in the liver tissue after a single IV injection.
  • Significant biodistribution to deep tissue regions was also demonstrated, with 80% to 97% TE in brainstem, cerebellum, cortex, and thalamus.
  • the triple ICV injections with the nanocarrier-msDNA complex did not show any side effects.
  • mice C57BL/6J male wild-type adult 8-12 weeks old mice were administered a single high dose of 2 mg/kg (50 pg) of carrier-free pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP- bGHpA (positive control with no supersequence), pGL2-SS*-CAG-SecNLuc-2A-eGFP- BGpA-SS*, pGL2- S S * -CM V -UTR1 - SecNLuc-2 A-eGFP-WPRE-B Gp A-S S * , or pGL2- SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA-SS* by hydrodynamic injection (HDI) via the tail vein.
  • HDI hydrodynamic injection
  • the plasma of the treated mice was collected on days 1, 3, 7, 10, 15, 22, 28, 42, and 56 after HDI to examine luciferase gene expression.
  • day 1 post-vector administration all mice exhibited high levels of luciferase expression (10 8 -10 9 RLU per mg of plasma protein).
  • day-7 the pCAGLuc and the pCAGLuc-WPRE treated mice produced 10 7 -10 8 RLU/mg of plasma protein, but the pGSNLuc-WPRE treated mice yielded lower luciferase levels ( ⁇ 10 6 RLU/mg protein).
  • After 8-weeks post-vector administration all mice exhibited low levels of luciferase expression (around 10 5 RLU/mg protein). The rapid drop of luciferase levels may have resulted from humoral or cell-mediated immune responses induced in the plasmid treated mice. See Figures 13-14.
  • mice C57BL/6J male wild-type adult 8-12 weeks old mice were administered a single low dose of 0.2 mg/kg (5 pg) of carrier-free pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP- bGHpA (positive control with no supersequence, 2 mice), pGL2-SS*-CAG-SecNLuc-2A- eGFP-B Gp A- S S * (2 mice), or pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA-SS*
  • mice by HDI via the tail vein.
  • An additional 2 mice were not injected and served as a negative control.
  • the plasma of the mice was collected on days 1, 3, 7, 10, 15, 22, 28, 42, and 56 after HDI to examine luciferase gene expression.
  • the mice treated with pGL2- SS*-CAG-SecNLuc-2A-eGFP-BGpA-SS* and pGL2-SS*-CAG-SecNLuc-2A-eGFP- WPRE-BGpA-SS* showed sustained high levels of luciferase expression (10 7 -10 8 RLU/mg protein) more than 8 weeks post-vector administration and more than 100-fold higher expression than the conventional control plasmid having an isogenic expression cassette but with no supersequence (SS).
  • msDNAs were produced from pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-
  • mice C57BL/6J male wild-type adult 8-12 weeks old mice were administered a single low dose of 0.2 mg/kg (5 pg) of carrier-free pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP- bGHpA (positive control, 5 mice), msDNA-CAG-SecNLuc-2A-eGFP-WPRE-BGpA (5 mice), or msDNA-CMV-UTRl-SecNLuc-2A-eGFP-WPRE-BGpA (5 mice) by hydrodynamic injection (HDI) via the tail vein. An additional 2 mice were not injected and served as a negative control. The plasma of the treated mice was collected on days 1, 3, 7, 10, 15, 22, 28, 42, and 56 after HDI to examine luciferase gene expression.
  • HDI hydrodynamic injection
  • BGpA treated mice produced sustained high levels of luciferase expression (10 7 -10 8 RLU/mg protein) more than 8 weeks post-vector administration, whereas the luciferase expression in msDNA-CMV-UTRl-SecNLuc-2A-eGFP-WPRE-BGpA treated mice dropped to low levels ( ⁇ 10 6 RLU/mg protein) in less than one month.
  • the rapid drop of luciferase expression in msDNA-CMV-UTRl-SecNLuc-2A-eGFP-WPRE-BGpA treated mice was likely due to silencing of the CMV promoter in hepatocytes.
  • Table 1 provides data from individual mice on days 1, 7, and 28 for luciferase expression in plasma samples (RLU/mg protein) and as detected by BLI (photons/sec).
  • WPRE-BGpA demonstrated a 10-fold increase in luciferase expression as compared to the parental plasmid, pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA-SS* at day 56 after HDI.
  • Intracellular cytoplasmic eGFP expression levels were evaluated by ELISA.
  • liver samples were collected from mice at 56 days after HDI with the single low dose of 0.2 mg/kg (5 pg) of the vectors as described in part 3 and homogenized for protein extraction. Total protein concentrations were determined from the liver lysates. GFP protein levels were then analyzed by ELISA.
  • mice C57BL/6J male wild-type adult 8-12 weeks old mice were administered 0.3 mg/kg pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA (positive control with no supersequence), msDNA-CMV-UTRl-SecNLuc-2A-eGFP-WPRE-BGpA, pGL2-SS*- CM V -UTR 1 - S ecNLuc-2 A-eGFP- WPRE-B Gp A- S S * , m sDN A-C AG- S ecNLuc-2 A- eGFP-WPRE-BGpA, or pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA-SS* lipoplexed with a lipid nanoparticle carrier through a single intravenous tail vein injection.
  • the carrier also served as a negative vehicle control.
  • ALT serum alanine aminotransferase
  • liver cytotoxicity liver cytotoxicity
  • cytokine responses also were evaluated following injection of the vectors.
  • Precursor plasmid and msDNA containing the CAG promoter showed a higher tolerability profile compared to constructs containing the CMV promoter.
  • msDNA containing the CMV promoter showed dramatically lower cytokine and liver toxicity responses compared to the CMV precursor parent and the conventional plasmid. See Table 2, below, showing cytokine concentrations (pg/mL) and enzyme concentrations (U/L) of liver function markers at 4 hours and 14 days after injection.
  • msDNAs were produced from pGL2-SS*-CAG-SecNLuc-2A-eGFP-WPRE-
  • WPRE-BGpA formulated with a nanocarrier (3 mice) or msDNA-CMV-UTRl-SecNLuc- 2A-eGFP-WPRE-BGpA formulated with a nanocarrier (3 mice) by three intracerebroventricular (ICV) injections of 1 ⁇ g DNA each via implanted cannula on days 0, 14, and 28 after implantation. Animals were euthanized on day 42 after implantation, and sagittal brain sections were collected from the cortex, thalamus, brainstem, and cerebellum.
  • ICV intracerebroventricular
  • Figure 20 shows cortex, thalamus, brainstem and cerebellum sections from
  • Mouse #1 of the treatment group injected with msDNA-CAG-SecNLuc-2A-eGFP- WPRE-BGpA Transfection efficiencies for msDNA in the sections were determined to be 81.9%, 73.0%, 69.2%, and 96.0% in the cortex, thalamus, brainstem, and cerebellum (Purkinje cells), respectively. Transfection efficiencies were calculated as the percentage of cells positive for both GFP and DAPI among all DAPI-positive cells.
  • Figure 21 shows sections from the cortex and thalamus and Figure 22 shows sections from the brainstem and cerebellum from Mouse #2 of the treatment group injected with msDNA-CAG-SecNLuc-2A-eGFP-WPRE-BGpA. Neurons were marked with the neuronal marker NeuN and transfected cells were shown to express GFP. Transfection efficiencies were determined to be 99.6%, 98.8%, 98.5%, and 80.8% in the cortex, thalamus, brainstem, and the cerebellum (Purkinje cells), respectively. Transfection efficiencies were calculated as the percentage of cells positive for both GFP and NeuN among all NeuN-positive cells.
  • Figure 23 shows sections from the cortex and thalamus and Figure 24 shows sections from the brainstem and cerebellum from Mouse #1 of the treatment group injected with msDNA-CMV-UTRl-SecNLuc-2A-eGFP-WPRE-BGpA. Neurons were marked with the neuronal marker NeuN and transfected cells were shown to express GFP. Transfection efficiencies were determined to be 91.1%, 88.8%, 73.7%, and 92.1% in the cortex, thalamus, brainstem, and the cerebellum (Purkinje cells), respectively. Transfection efficiencies were calculated as the percentage of cells positive for both GFP and NeuN among all NeuN-positive cells.
  • CAG-WPRE msDNA-CAG-SecNLuc-2A-eGFP-WPRE-BGpA
  • CMV-WPRE msDNA-CMV-UTRl -SecNLuc-2A-eGFP-WPRE-BGpA
  • CM V -UTR 1 - S ecNLuc-2 A-eGFP- WPRE-B Gp A, pGL2-SS*-CMV-UTRl-SecNLuc-2A- eGFP- WPRE-B Gp A- S S * , msDNA-CAG-SecNLuc-2A-eGFP-WPRE-BGpA, or pGL2- SS*-CAG-SecNLuc-2A-eGFP-WPRE-BGpA-SS* were each lipoplexed with a lipid nanoparticle carrier.
  • msDNA Lipoplexed msDNA was also well-tolerated in human peripheral blood mononuclear cells (PBMCs) ex vivo.
  • PBMCs peripheral blood mononuclear cells
  • msDNA showed significantly lower cytokine profile levels in human PBMCs compared to conventional plasmid (data not shown).
  • a conventional plasmid was produced with an expression cassette containing a gene of interest (GOI) flanked by 5' and 3' homology arms (Plasmid DNA HDR-GOI- HDR).
  • GOI gene of interest
  • msDNA expression vector was produced with the same HDR-GOI-HDR sequence as used in the conventional plasmid flanked by two Super Sequence sites.
  • msDNA containing the HDR-GOI-HDR was then produced in an inducible E. coli vector production system using methods described herein and in U.S. Patent Nos. 9,290,778 and 9,862,954.
  • iPSCs Induced pluripotent stem cells
  • Plasmid DNA HDR-GOI-HDR or msDNA HDR-GOI-HDR along with a CRISPR gene editing system to mediate homology directed repair knock-in (HDR KI) of the GOI.
  • HDR KI Homology directed repair knock-in
  • Expression vectors containing two Super Sequence sites, a CMV enhancer/promoter, an engineered 5'UTR containing an internal minimal intron sequence, and a polygenic expression cassette encoding eGFP and Nluc as described in Examples 1 and 2 were also designed to contain a 3'UTR containing two copies of a human beta- globin polyadenylation signal and 120 adenine nucleotides (i.e., 2huBGpA-A120, SEQ ID NO: 17) and one or more of: (1) a synthetic enhancer (i.e., Enhancer-1 (El), SEQ ID NO: 12) located at the 5' end of the CMV enhancer, (2) a WPRE located at the 5' end of the 3'UTR, (3) a SRF-UCOE located at the 3' end of the 5' Super Sequence; and (4) a human CSP-B MAR (huMAR) located at the 3' end of eGFP.
  • a synthetic enhancer i.e., Enhanc
  • Maps of the designed vectors are shown in Figures 30-38.
  • Figure 30 shows a map of the expression vector containing the 3'UTR (SS*-CMV-UTRl-SecNLuc-2A-eGFP-3'UTR[2hBGpA-A120]- SS*, SEQ ID NO: 24).
  • Figure 31 shows a map of the expression vector containing the El and 3'UTR (SS*-El-CMV-UTRl-SecNLuc-2A-eGFP-3'UTR[2hBGpA-A120]-SS*, SEQ ID NO: 25).
  • Figure 32 shows a map of the expression vector containing the El, WPRE, and 3 'UTR (S S * -E 1 -CMV-UTR1 - SecNLuc-2 A-eGFP-WPRE-3 'UTR[2hB Gp A- A 120]- SS*, SEQ ID NO: 26).
  • Figure 33 shows a map of the expression vector containing the UCOE, El, WPRE, and 3'UTR (SS*-UCOE-El-CMV-UTRl-SecNLuc-2A-eGFP- WPRE-3 'UTR[2hB Gp A- A 120] - S S * , SEQ ID NO: 27).
  • Figure 34 shows a map of the expression vector containing the El, huMAR, and 3'UTR (SS*-E1-CMV-UTR1- SecNLuc-2 A-eGFP-huM AR-3 'UTR[2hB Gp A- A 120] -S S * , SEQ ID NO: 28).
  • Figure 35 shows a map of the expression vector containing the UCOE, El, huMAR, and 3'UTR (S S * -UCOE-E 1 -CMV -UTR1 - SecNLuc-2 A-eGFP-huMAR-3 'UTR[2hB Gp A- A 120]- S S * , SEQ ID NO: 29).
  • Figure 36 shows a map of the expression vector containing the UCOE, El, WPRE, and 3'UTR (SS*-UCOE-El-CMV-UTRl-SecNLuc-2A-eGFP-WPRE- 3'UTR[2hBGpA-A120]-SS*, SEQ ID NO: 30).
  • Figure 37 shows a map of the expression vector containing the El, huMAR, WPRE, and 3'UTR (SS*-E1 -CMV-UTR1 -SecNLuc-
  • Figure 38 shows a map of the expression vector containing the UCOE, El, huMAR, WPRE, and
  • HEK293 cells were separately transfected with (1) a conventional plasmid, pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA as shown in Figure 2, (2) SS*-CMV- UTRl-SecNLuc-2A-eGFP-3'UTR[2hBGpA-A120]-SS*, (3) S*-E1-CMV-UTR1- SecNLuc-2 A-eGFP-3 'UTR[2hB Gp A- A 120]- S S * , and (4) SS*-E1-CMV-UTR1- SecNLuc-2A-eGFP-WPRE-3'UTR[2hBGpA-A 120]-SS* using standard operating procedures.
  • luciferase expression was evaluated by measuring the intensity of secreted luciferase from the media of cultured cells as described in Example 2B. See Figure 39, showing expression levels in media from cells transfected with pcDNA-CMV-5'UTR-SecNLuc-P2A-eGFP-bGHpA (Conventional pDNA CMV-U), SS*-CMV-UTRl-SecNLuc-2A-eGFP-3UTR[2hBGpA- A120]-SS* (A: CMV-U1-3'UTR), SS*-El-CMV-UTRl-SecNLuc-2A-eGFP- 3 'UTR[2hB Gp A- A 120] - S S * (B: E1-CMV-U1-3'UTR), and SS*-E1-CMV-UTR1- SecNLuc-2 A-eGFP-WPRE-3
  • HEK293 cells were transfected with the four expression vectors described in part
  • Example 8 Expression vectors containing synthetic promoter sequences A. Expression vectors
  • CAG [E1X3+CBA promoter+intron] (SEQ ID NO: 35), containing three copies of the synthetic enhancer El (/. ., 3 copies of SEQ ID NO: 12), a chicken b-actin promoter, and chimeric intron
  • CAG [E2+CBA promoter+intron] (SEQ ID NO: 36), containing E2 (U100), a chicken b- actin promoter, and chimeric intron
  • CAG [E1X3+CBA promoter+UTRl] (SEQ ID NO: 37), containing three copies of the synthetic enhancer El, a chicken b-actin promoter, and 5'UTR1 (i.e., SEQ ID NO: 2)
  • CAG [E2 (U100)+CBA promoter+UTRl] (SEQ ID NO: 38), containing E2 (U100), a chicken b-actin promoter, and 5'UTRl
  • SEQ ID NO: 38 CAG [E2 (U100)
  • a conventional plasmid was produced containing a CMV enhancer, a chicken b- actin promoter, and chimeric intron and a polygenic expression cassette encoding eGFP and Nluc as described in Examples 1 and 2.
  • a map of the conventional plasmid is shown in Figure 41 (pGL2-CAG-SecNLuc-2A-eGFP-WPRE-bGlobin poly A, SEQ ID NO: 34).
  • An msDNA expression vector was produced containing two Super Sequences sites, a CMV enhancer, a chicken b-actin promoter, chimeric intron, a polygenic expression cassette encoding eGFP and Nluc, WPRE, and 3'UTR.
  • a map of the vector is shown in Figure 42 (4-1 pGL2-SS*-CAG [CMV enhancer+CBA Promoter+intron]- SecNLuc-2A-eGFP-WPRE-3’UTR(108 to 120 polyA)-SS*, SEQ ID NO: 40).
  • HEK293 cells were seeded in a 24-well plate at lxlO 5 cells/well and separately transfected with a complex of lipofectamine and the vectors described in part A of this example at 0.25 pmol DNA/well.
  • Secreted luciferase expression was measured as described in Example 2B at 3 and 6 days after transfection. See Figure 48, showing expression levels in media from cells transfected with the msDNA expression vectors as compared to the conventional plasmid.
  • Luciferase expression levels were higher for all msDNA expression vectors as compared to the conventional plasmid. The highest expression was observed with 4-6- pGL2-SS*-CMV enhancer-EF l-UTRl-SecNLuc-2A-eGFP-WPRE-3 , UTR(l 08 to 120 polyA (4-6: CMV-EF1-UTR1-W-3'UTR), which contains the EF-1 promoter element in combination with the CMV enhancer and 5'UTR1.
  • Modifications will include individual modifications and combinations such as, but not limited to, an endonuclease target sequence integrated in non-binding regions for the recombinases in the SS between the vector backbone and the cleavage sites for the recombinases, a CAG promoter integrated between the 3' end of the first target sequence for the first recombinase (i.e., the 3' end of the 5' SS) and 5' to the promoter in the expression cassette, a CMV enhancer integrated between the 3' end of the first target sequence for the first recombinase (i.e., the 3' end of the 5' SS) and 5' to the promoter in the expression cassette, an Enhancer-1 sequence located 5' to a CMV enhancer and/or 3' to a UCOE, a CMV, EF1, SV40, CAG, Rho, VDM2, HCR, or HLP promoter or variant thereof, a CMV promoter variant, an EF1
  • SEQ ID NO: 14 2 copies of human beta-globin polyadenylation signal (2huBGpA) gctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaac tgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttatttttcatt gcaagctcgctttcttgctgtccaattttctattaaaggttccttttgttccctaagtccaactact aaactgggggatattatgaagggccttgagcatctggattctgctaataaaaacatttattttt cattgcaa
  • SEQ ID NO: 15 hybrid Xenopus leavis and human beta-globin polyadenylation signal (xlhuBGpA) aaccagcctcaagaacacccgaatggagtctctaagctacataataccaacttacactttacaaa atgttgtcccccaaaatgtagccattcgtatctgctcctaataaaaagaaagtttcttcacgctc gcttgctgtccaattttctattaaaggttcctttgttccctaagtccaactactaaactggg ggatattatgaagggccttgagcatctggattctgctaataaaaaacatttattttcattgcaa

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/IB2022/055620 2021-06-16 2022-06-16 Expression vectors, bacterial sequence-free vectors, and methods of making and using the same Ceased WO2022264095A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
AU2022292197A AU2022292197A1 (en) 2021-06-16 2022-06-16 Expression vectors, bacterial sequence-free vectors, and methods of making and using the same
CN202280055798.2A CN117881788A (zh) 2021-06-16 2022-06-16 表达载体、无细菌序列载体及其制备和使用方法
MX2023014628A MX2023014628A (es) 2021-06-16 2022-06-16 Vectores de expresion, vectores libres de secuencias bacterianas y metodos para fabricar y usar los mismos.
JP2023577551A JP2024523343A (ja) 2021-06-16 2022-06-16 発現ベクター、細菌配列不含有ベクターならびにそれらの作製方法および使用方法
CA3222578A CA3222578A1 (en) 2021-06-16 2022-06-16 Expression vectors, bacterial sequence-free vectors, and methods of making and using the same
BR112023026176A BR112023026176A2 (pt) 2021-06-16 2022-06-16 Vetores de expressão, vetores livres de sequência bacteriana e métodos de fabricação e uso dos mesmos
KR1020247001300A KR20240021906A (ko) 2021-06-16 2022-06-16 발현 벡터, 박테리아 서열-무함유 벡터, 및 이를 제조하고 사용하는 방법
EP22824423.2A EP4355883A4 (en) 2021-06-16 2022-06-16 Expression vectors, bacterial sequence-free vectors, and methods of making and using the same
US18/541,459 US20240229071A1 (en) 2021-06-16 2023-12-15 Expression vectors, bacterial sequence-free vectors, and methods of making and using the same

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202163211343P 2021-06-16 2021-06-16
US63/211,343 2021-06-16
US202263306015P 2022-02-02 2022-02-02
US63/306,015 2022-02-02
US202263331638P 2022-04-15 2022-04-15
US63/331,638 2022-04-15

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/541,459 Continuation US20240229071A1 (en) 2021-06-16 2023-12-15 Expression vectors, bacterial sequence-free vectors, and methods of making and using the same

Publications (1)

Publication Number Publication Date
WO2022264095A1 true WO2022264095A1 (en) 2022-12-22

Family

ID=84527300

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/055620 Ceased WO2022264095A1 (en) 2021-06-16 2022-06-16 Expression vectors, bacterial sequence-free vectors, and methods of making and using the same

Country Status (9)

Country Link
US (1) US20240229071A1 (https=)
EP (1) EP4355883A4 (https=)
JP (1) JP2024523343A (https=)
KR (1) KR20240021906A (https=)
AU (1) AU2022292197A1 (https=)
BR (1) BR112023026176A2 (https=)
CA (1) CA3222578A1 (https=)
MX (1) MX2023014628A (https=)
WO (1) WO2022264095A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024058155A1 (ja) * 2022-09-12 2024-03-21 株式会社カネカ 二本鎖環状dnaベクター、直鎖状共有結合閉鎖dnaの作製方法、並びにプロテロメラーゼ及びエンドヌクレアーゼを含む融合ポリペプチド
WO2025057672A1 (ja) * 2023-09-12 2025-03-20 株式会社カネカ 形質転換細胞及び直鎖状共有結合閉鎖dnaの作製方法
WO2025175381A1 (en) * 2024-02-22 2025-08-28 Pegasus Biotech Incorporated Plasmid and method for production of dna vaccines and dna products
WO2025250465A1 (en) * 2024-05-28 2025-12-04 Nanjing Probio Biotech Co., Ltd. Vector composition and use thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9862954B2 (en) * 2012-11-22 2018-01-09 Mediphage Bioceuticals, Inc. DNA vector production system

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9862954B2 (en) * 2012-11-22 2018-01-09 Mediphage Bioceuticals, Inc. DNA vector production system

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHEN ZY ET AL.: "Improved production and purification of minicircle DNA vector free of plasmid bacterial sequences and capable of persistent transgene expression in vivo", HUM GENE THER., vol. 16, no. 1, 2005, pages 126 - 31, XP002431639, ISSN: 1043-0342, DOI: 10.1089/hum.2005.16.126 *
See also references of EP4355883A4 *
SHIRLEY WONG, ET AL.: "Production of Double-stranded DNA Ministrings", JOURNAL OF VISUALIZED EXPERIMENTS, vol. 108, no. 53177, 29 February 2016 (2016-02-29), pages 1 - 2, XP055587725, DOI: 10.3791/53177 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024058155A1 (ja) * 2022-09-12 2024-03-21 株式会社カネカ 二本鎖環状dnaベクター、直鎖状共有結合閉鎖dnaの作製方法、並びにプロテロメラーゼ及びエンドヌクレアーゼを含む融合ポリペプチド
WO2025057672A1 (ja) * 2023-09-12 2025-03-20 株式会社カネカ 形質転換細胞及び直鎖状共有結合閉鎖dnaの作製方法
WO2025175381A1 (en) * 2024-02-22 2025-08-28 Pegasus Biotech Incorporated Plasmid and method for production of dna vaccines and dna products
WO2025250465A1 (en) * 2024-05-28 2025-12-04 Nanjing Probio Biotech Co., Ltd. Vector composition and use thereof

Also Published As

Publication number Publication date
JP2024523343A (ja) 2024-06-28
EP4355883A1 (en) 2024-04-24
KR20240021906A (ko) 2024-02-19
AU2022292197A1 (en) 2023-12-21
MX2023014628A (es) 2024-02-28
BR112023026176A2 (pt) 2024-03-05
EP4355883A4 (en) 2025-06-18
CA3222578A1 (en) 2022-12-22
US20240229071A1 (en) 2024-07-11

Similar Documents

Publication Publication Date Title
US20240229071A1 (en) Expression vectors, bacterial sequence-free vectors, and methods of making and using the same
KR102647714B1 (ko) CRISPR/Cas 시스템을 사용한 동물에서의 전사 조절
AU2018338790B2 (en) Non-human animals comprising a humanized TTR locus and methods of use
TW202028461A (zh) 核酸構築體及使用方法
JP2002535995A (ja) 染色体標的部位での二本鎖dna切断の誘導を含む遺伝子修復
JP7756639B2 (ja) X連鎖性若年網膜分離療法のためのcrisprおよびaav戦略
KR102927708B1 (ko) 베타-슬립 돌연변이를 갖는 인간화 ttr 좌위를 포함하는 비-인간 동물 및 사용 방법
KR102925054B1 (ko) 뉴클레아제-매개 반복부 팽창
EP3867375A1 (en) Genome editing methods and constructs
JP2020533957A (ja) Crisprリポーター非ヒト動物およびその使用
JP2024540390A (ja) 可動因子及びそのキメラ構築物
US12582104B2 (en) Mutant myocilin disease model and uses thereof
US20230081547A1 (en) Non-human animals comprising a humanized klkb1 locus and methods of use
US9816077B2 (en) Use of integrase for targeted gene expression
LLADO SANTAEULARIA THERAPEUTIC GENOME EDITING IN RETINA AND LIVER
WO2024229240A2 (en) Compositions and methods for treating stargardt disease
AU2004202860B2 (en) Gene repair involving in vivo excision of targeting DNA
HK40051560A (en) Nucleic acid constructs and methods of use
Prather Development of a process for the production and purification of minicircles for biopharmaceutical application

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22824423

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2022292197

Country of ref document: AU

Ref document number: AU2022292197

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 3222578

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/014628

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 202317084846

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2023577551

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023026176

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022292197

Country of ref document: AU

Date of ref document: 20220616

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20247001300

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020247001300

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2022824423

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022824423

Country of ref document: EP

Effective date: 20240116

WWE Wipo information: entry into national phase

Ref document number: 202280055798.2

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 112023026176

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231212