WO2022211574A1 - 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 만성신장질환의 예방 또는 치료용 조성물 - Google Patents

항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 만성신장질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2022211574A1
WO2022211574A1 PCT/KR2022/004706 KR2022004706W WO2022211574A1 WO 2022211574 A1 WO2022211574 A1 WO 2022211574A1 KR 2022004706 W KR2022004706 W KR 2022004706W WO 2022211574 A1 WO2022211574 A1 WO 2022211574A1
Authority
WO
WIPO (PCT)
Prior art keywords
formula
straight
chain
oxazol
aryl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2022/004706
Other languages
English (en)
French (fr)
Korean (ko)
Inventor
정동주
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Klotho Sciences Co Ltd
Original Assignee
Klotho Sciences Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220040453A external-priority patent/KR102463786B1/ko
Priority to JP2023561148A priority Critical patent/JP7728030B2/ja
Priority to CA3213910A priority patent/CA3213910A1/en
Priority to BR112023020026A priority patent/BR112023020026A2/pt
Priority to CN202280026646.XA priority patent/CN117157280A/zh
Priority to EP22781693.1A priority patent/EP4317140A4/en
Application filed by Klotho Sciences Co Ltd filed Critical Klotho Sciences Co Ltd
Priority to US18/553,392 priority patent/US20240216341A1/en
Priority to AU2022248891A priority patent/AU2022248891A1/en
Publication of WO2022211574A1 publication Critical patent/WO2022211574A1/ko
Anticipated expiration legal-status Critical
Priority to AU2025202595A priority patent/AU2025202595A1/en
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/423—Oxazoles condensed with carbocyclic rings
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A61K9/0056—Mouth soluble or dispersible forms; Suckable, eatable, chewable coherent forms; Forms rapidly disintegrating in the mouth; Lozenges; Lollipops; Bite capsules; Baked products; Baits or other oral forms for animals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys

Definitions

  • the present invention relates to a composition for preventing or treating chronic kidney disease (CKD) comprising a compound inducing the expression of the anti-aging gene klotho.
  • CKD chronic kidney disease
  • Chronic kidney disease refers to a disease state in which there is kidney damage lasting more than 3 months or kidney function decreases, and is recognized as a serious disease worldwide.
  • Chronic kidney disease is increasing with the aging of the population and the increase of chronic diseases, so it is an important health problem in many countries such as high prevalence and incidence, complications such as stroke, heart disease, diabetes and infection, and increase in medical expenses.
  • mice that could not express this gene premature aging occurred and lifespan was shortened. More interestingly, mice that later increased the expression of this gene increased their lifespan by 20.0 to 30.8% in males and by 18.8 to 19.0% in females. This was an opportunity to inform the world for the first time that the lifespan of mice can be increased or decreased depending on the expression of a single gene. And, the nucleotide sequence of the Klotho gene is very similar between animals, and it has been reported that about 98% coincidence between mice and humans. This indicates that lifespan can be regulated by the expression of klotho gene even in humans.
  • the klotho gene is located on the 13th chromosome and produces a membrane protein similar in sequence to ⁇ -glucosidase.
  • Klotho protein is mainly expressed in renal tubular epithelial cells and in the choroid plexus of the brain and has been reported to be expressed in some parathyroid glands.
  • the Klotho gene is a gene related to various aging phenotypes. In mice lacking the klotho gene, aging processes such as reduced lifespan, decreased activity, growth retardation, atherosclerosis, calcification of arteries, osteoporosis, reproductive immaturity, infertility, skin atrophy, emphysema, etc.
  • a syndrome similar to In Klotho mutant mice atherosclerosis similar to Monckeberg type atherosclerosis caused by aging in humans was observed in all arteries from the aorta to arterioles, and angiogenesis and vasculogenesis were impaired.
  • Klotho mRNA expression is significantly higher in kidney tissue than in other tissues, but the expression of klotho mRNA is reduced in the kidneys of mouse models of diseases such as hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure.
  • NO nitric oxide
  • OLETF Otsuka Long-Evans Tokushima fatty rat
  • klotho gene affects glucose and insulin metabolism in mice, and statin, a representative hypercholesterolemia treatment, increases klotho mRNA expression in renal proximal tubule cells.
  • statin a representative hypercholesterolemia treatment
  • osteopenia with low bone turnover due to impaired differentiation of both osteoblasts and osteoclasts occurs, which is similar to the characteristics of age-related bone loss and senile osteoporosis in humans.
  • Klotho mutant rats abnormal trabecular height and micro-computed tomography in the epiphyseal region of the trabecular bone were observed. The clinical phenotype changes due to Klotho gene mutations observed in humans are diverse.
  • KL-VS (functional variant of klotho) variant with mutations in three regions of Klotho gene exon2 is related to lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease and cerebrovascular disease, microsatellite polymorphism and single base of Klotho gene Gene polymorphisms were associated with bone mineral density, and it was also reported that single nucleotide polymorphisms of the Klotho gene were associated with cardiovascular disease risk factors and bone mineral density in healthy adult women. Recently, the association between the Klotho gene and Alzheimer's has been reported in several papers. It has been reported that overexpression of klotho in a mouse model of Alzheimer's dementia increases the lifespan of mice by 30% and suppresses cognitive decline.
  • amyloid beta protein in the brain was reduced by 50% by klotho expression.
  • the expression level of klotho is inversely proportional to the progression of Alzheimer's disease, and it has been reported that klotho protein reduces the amount of inflammatory cytokines in the blood of Alzheimer's disease patients.
  • Efforts have been made to develop a substance capable of inducing the expression of the klotho gene, which has such a pronounced anti-aging effect.
  • known substances those reported to be capable of inducing klotho expression include rapamycin, vitamin D, and statin.
  • a research team at Boston University reported three compounds by screening for compounds capable of inducing klotho gene expression using a library of 150,000 compounds.
  • the present inventor selected a compound called compound H, which has a structure that is highly likely to be developed as a pharmaceutical, from among the compounds, confirmed that this compound can express the klotho gene in cells through actual experiments, and reported the study results on the mechanism of action. announced as After that, an experiment was conducted to analyze the structure of compound H (Comparative Example 1) to determine the structural characteristics of a compound capable of inducing klotho expression, and based on this, a new compound with increased activity 10 times or more was created. In addition, the present inventors have experimentally confirmed that the novel compound inducing the expression of the anti-aging gene klotho is useful for the prevention or treatment of chronic kidney disease, and completed the present invention.
  • Another object of the present invention is to provide a health functional food composition for the prevention or improvement of chronic kidney disease, or a food composition, comprising a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the present invention provides a pharmaceutical composition for preventing or treating chronic kidney disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, C 1-10 straight or branched chain alkyl, or C 6-8 arylamide, wherein the aryl of the arylamide includes halogen, —NO 2 and C 1-10 One or more of the straight-chain or branched alkyl halide may be substituted;
  • R 1 and R 2 together with the carbon atom to which they are connected may form a C 6-8 aryl
  • R 3 , R 4 , R 5 , R 6 and R 7 are each -H, halogen, -NO 2 or C 1-10 straight-chain or branched alkyl).
  • the present invention provides a health functional food composition for preventing or improving chronic kidney disease comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a food composition for preventing or improving chronic kidney disease, comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a method for preventing or treating chronic kidney disease, comprising administering or taking a composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient to an individual.
  • the present invention provides a use for preventing or treating chronic kidney disease of a composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the compound represented by Formula 1 according to the present invention has an excellent effect of improving the expression level of the Klotho gene, which is a gene associated with aging, and can be usefully used as a pharmaceutical composition or food composition for the prevention, improvement or treatment of chronic kidney disease. .
  • 1A shows the results of a luciferase expression experiment using a reporter gene including a promoter up to 1.7 kbp from the start of the human klotho gene of Comparative Examples 1 to 4;
  • 1B shows the results of a luciferase expression experiment using a reporter gene including a promoter up to 240 bp from the start of the human klotho gene of Comparative Examples 1 to 4;
  • FIG. 2 shows the results of a luciferase expression experiment using a reporter gene including a promoter included up to -2.1 kb upstream of the human klotho gene of Examples 1 to 6.
  • FIG. 3 shows the results of a luciferase expression experiment using a reporter gene including a promoter included up to -2.1 kb upstream of the human klotho gene of Examples 1 to 3.
  • Figure 7a schematically shows a protocol for making a disease model by treating HK-2 cells (human kidney cells) with cisplatin.
  • Figure 7b is a result of analyzing the Klotho protein expression level in HK-2 cells obtained according to the protocol of Figure 7a.
  • Figure 8a schematically shows a protocol for obtaining experimental samples by injecting KS1 compound into an animal model of unilateral ureteric obstruction.
  • Figure 8b is a result of analyzing the degree of kidney hypertrophy using the experimental sample obtained according to the protocol of Figure 8a.
  • 16 is a result of analyzing changes in microalbumin levels in a chronic kidney disease model.
  • BUN blood urea nitrogen
  • the present invention relates to a composition for preventing or treating/improving chronic kidney disease (CKD) comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • CKD chronic kidney disease
  • Chronic kidney disease is characterized by the presence of structural or functional abnormalities of the kidneys (eg, proteinuria, hematuria or pathological abnormalities) for more than 3 months, i.e., 'kidney damage' or the glomeruli regardless of whether the kidneys are damaged or not. It is defined as when the filtration rate has decreased to 60 mL/min/1.73 m 2 or less for more than 3 months and is a disease accompanied by various complications such as cardiovascular disease, mineral bone metabolism, and anemia.
  • structural or functional abnormalities of the kidneys eg, proteinuria, hematuria or pathological abnormalities
  • the compound represented by the following formula (1) according to the present invention is excellent in the effect of improving the expression level of the Klotho gene, which is a gene associated with aging, and can be usefully used as a pharmaceutical composition or food composition for the prevention, improvement or treatment of chronic kidney disease. have.
  • composition for preventing or treating chronic kidney disease comprising
  • the present invention provides a pharmaceutical composition for preventing or treating chronic kidney disease, comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
  • L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, C 1-10 straight or branched chain alkyl, or C 6-8 arylamide, wherein the aryl of the arylamide includes halogen, —NO 2 and C 1-10 One or more of the straight-chain or branched alkyl halide may be substituted;
  • R 1 and R 2 together with the carbon atom to which they are connected may form a C 6-8 aryl
  • R 3 , R 4 , R 5 , R 6 and R 7 may each be —H, halogen, —NO 2 or C 1-10 straight-chain or branched alkyl.
  • the L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, C 1-5 straight or branched chain alkyl, or C 6-7 arylamide, wherein the aryl of the arylamide includes halogen, —NO 2 and C 1-5 One or more of the straight-chain or branched alkyl halide may be substituted;
  • R 1 and R 2 together with the carbon atom to which they are connected may form a C 6-7 aryl
  • R 3 , R 4 , R 5 , R 6 and R 7 may each be —H, halogen, —NO 2 or C 1-5 straight-chain or branched alkyl.
  • the L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, —CH 3 , or phenylamide, wherein the phenyl of the phenylamide may be substituted with one or more of —Cl, —NO 2 and —CH 2 Cl;
  • R 1 and R 2 together with the carbon atom to which they are connected may form phenyl
  • R 3 , R 4 , R 5 , R 6 and R 7 may each be -H, -F, -Cl, -NO 2 or -CH 2 CH 3 .
  • the L 1 is a single bond or ego
  • R 1 is -H, -OH, -CH 3 , , , or ego;
  • R 2 is —H
  • R 1 and R 2 together with the carbon atom to which they are connected may form phenyl
  • R 3 is —H or —Cl
  • R 4 is —H, —F or —Cl
  • R 5 is —F, —Cl, —NO 2 , or —CH 2 CH 3 ;
  • R 6 is —H
  • R 7 may be -H.
  • Preferred examples of the compound represented by Formula 1 according to the present invention include the following compound groups.
  • a preferred embodiment of the compound represented by the formula (1) may include a compound represented by the following formula (1-1).
  • L 1 is a single bond
  • R 1 and R 2 are each —H, or C 1-10 straight-chain or branched alkyl
  • R 3 , R 4 , R 5 , R 6 and R 7 are each —H or halogen).
  • the compound represented by Formula 1 of the present invention may be used in the form of a pharmaceutically acceptable salt, and as the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful.
  • the expression pharmaceutically acceptable salt is a concentration having an effective action that is relatively non-toxic and harmless to a patient, and any organic or means inorganic addition salts.
  • inorganic acids and organic acids can be used as free acids, and hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc. can be used as inorganic acids, and citric acid, acetic acid, lactic acid, maleic acid, fumarin, etc. can be used as organic acids.
  • these salts include alkali metal salts (sodium salt, potassium salt, etc.) and alkaline earth metal salt (calcium salt, magnesium salt, etc.) and the like.
  • acid addition salts include acetate, aspartate, benzate, besylate, bicarbonate/carbonate, bisulfate/sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, Gluceptate, gluconate, glucuronate, hexafluorophosphate, hebenzate, hydrochloride/chloride, hydrobromide/bromide, hydroiodide/iodide, isethionate, lactate, malate, maleate , malonate, mesylate, methylsulfate, naphthylate, 2-naphsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate/hydrogen phosphate/dihydrogen phosphate, saccharate , stearate, succinate, tartrate, tosylate, trifluoroacetate,
  • the compound represented by Formula 1 of the present invention includes all salts, isomers, hydrates and solvates that can be prepared by conventional methods as well as pharmaceutically acceptable salts.
  • the addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving the compound of Formula 1 in a water-miscible organic solvent, such as acetone, methanol, ethanol, or acetonitrile, and adding an excess of organic acid or inorganic acid It can be prepared by precipitation or crystallization after addition of an aqueous acid solution of Subsequently, after evaporating the solvent or excess acid from this mixture, it can be dried to obtain an addition salt, or it can be prepared by suction filtration of the precipitated salt.
  • a water-miscible organic solvent such as acetone, methanol, ethanol, or acetonitrile
  • step 1 After dissolving compound 2 in an organic solvent, adding compound 3 and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 4 (step 1); and
  • step 2 To an organic solvent in which potassium superoxide is dissolved, the organic solvent in which the compound 4 obtained in step 1 is dissolved is added dropwise, and then reacted at 15 to 30° C. for 10 to 16 hours to obtain compound 1A (step 2) ;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above,
  • Compound 1A is included in Formula 1 above.
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • examples of the compound that can be prepared by the preparation method include 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, 2-[N-( 3,4-dichlorophenyl)] aminobenzoxazole, N- (3,4-dichlorophenyl) naphtho [2,3-d] oxazol-2-amine, N- (3,4-difluorophenyl) )-5-methylbenzo[d]oxazol-2-amine or N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.
  • step 1 After dissolving compound 5 in an organic solvent, adding compound 3 and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 6 (step 1);
  • step 2 To the organic solvent in which potassium peroxide (Potassium superoxide) is dissolved, the organic solvent in which the compound 6 obtained in step 1 is dissolved is added dropwise, and then reacted for 12 to 24 hours to obtain compound 7 (step 2); and
  • R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above,
  • the compound 1B is included in the formula (1).
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • examples of the compound that can be prepared by the preparation method may be 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol.
  • step One After dissolving compound 8, carbon disulfide, iodomethane, and sodium hydride in an organic solvent, reacting at 10 to 50° C. for 2 to 8 hours to obtain compound 9 (step One); and
  • step 2 After dissolving compound 9 and compound 2 in an organic solvent, reacting for 2 to 8 hours to obtain compound 1C (step 2);
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above,
  • the compound 1C is included in the formula (1).
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • an example of the compound that can be prepared by the preparation method may be N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide.
  • step 1 After dissolving compound 10 and compound 3 in an organic solvent, reacting at 10 to 50° C. for 20 to 28 hours to obtain compound 11 (step 1);
  • step 2 To the organic solvent in which potassium superoxide is dissolved, the organic solvent in which the compound 11 obtained in step 1 is dissolved is added dropwise, and then reacted at 10 to 50° C. for 12 to 24 hours to obtain compound 12 (step 2) ;
  • step 3 after adding compound 12 to an organic solvent together with a catalyst, injecting hydrogen gas and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 13 (step 3);
  • step 4 After dissolving compound 13 and compound 14 in an organic solvent, reacting at 10 to 50° C. for 12 to 24 hours to obtain compound 1D (step 4);
  • R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above;
  • R 8 is at least one of halogen, —NO 2 and C 1-10 linear or branched alkyl halide
  • the compound 1D is included in the formula (1).
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • examples of the compound that can be prepared by the preparation method include N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5 -nitrobenzamide, N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide or N-(2-(4-ethylphenylamino)benzo [d]oxazol-5-yl)-3-(chloromethyl)benzamide.
  • the composition can improve the expression level of the Klotho gene.
  • the chronic kidney disease may be defined as a disease state in which there is kidney damage lasting 3 months or more or kidney function is reduced.
  • the chronic kidney disease is chronic nephritis, chronic pyelonephritis, nephrotic syndrome, chronic pyelonephritis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, nephrosis syndrome, microglomerular sclerosis, membranous nephropathy, and membranous proliferative glomerulonephritis. It may include one or more substances selected from the group, but is not limited thereto.
  • the compound of the present invention may be administered in various oral and parenteral dosage forms during clinical administration, and when formulated, commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. manufactured.
  • commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. manufactured.
  • Solid preparations for oral administration include tablets, patients, powders, granules, capsules, troches, and the like, and such solid preparations include one or more compounds of the present invention and at least one excipient, for example, starch, calcium carbonate, water It is prepared by mixing sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate talc are also used.
  • Liquid formulations for oral administration include suspensions, solutions, emulsions, or syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. can
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspension solutions, emulsions, lyophilized formulations, suppositories, and the like.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerol, gelatin, etc. may be used.
  • the effective dose of the compound of the present invention to the human body may vary depending on the patient's age, weight, sex, dosage form, health status and disease level, and is generally about 0.001-100 mg/kg/day, preferably Usually 0.01-35 mg/kg/day. Based on an adult patient weighing 70 kg, it is generally 0.07-7000 mg/day, preferably 0.7-2500 mg/day, and once a day at regular time intervals according to the judgment of a doctor or pharmacist It may be administered in several divided doses.
  • the present invention provides a food composition or health functional food composition for preventing or improving chronic kidney disease, comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the composition can improve the expression level of the Klotho gene.
  • the chronic kidney disease may be defined as a disease state in which there is kidney damage lasting 3 months or more or kidney function is reduced.
  • the chronic kidney disease is chronic nephritis, chronic pyelonephritis, nephrotic syndrome, chronic pyelonephritis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, nephrosis syndrome, microglomerular sclerosis, membranous nephropathy, and membranous proliferative glomerulonephritis. It may include one or more diseases selected from the group, but is not limited thereto.
  • Examples of foods to which the active substance of the present invention can be added include drinks, meat, sausage, bread, biscuits, rice cakes, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, There are various soups, beverages, alcoholic beverages and vitamin complexes, dairy products and processed dairy products, and includes all health food and health functional food in the ordinary sense.
  • the health food and health functional food composition containing the active substance according to the present invention may be added to food as it is or used together with other food or food ingredients, and may be appropriately used according to a conventional method.
  • the mixing amount of the active substance may be appropriately determined depending on the purpose of its use (for prevention or improvement).
  • the amount of the composition in health food and health functional food may be added in an amount of 0.1 to 90 parts by weight based on the total weight of the food.
  • the above amount may be less than the above range, and since there is no problem in terms of safety, the active substance may be used in an amount above the above range.
  • the food composition and health functional food composition of the present invention are not particularly limited in other ingredients except for containing the active substance of the present invention as an essential ingredient in the indicated ratio, and various flavoring agents or natural carbohydrates are added as additional ingredients like conventional beverages. may contain.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents tacmatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • the proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 g of the dietary supplement of the present invention.
  • food compositions and health functional food compositions containing the active substances of the present invention are various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.) ), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the food composition and health functional food composition of the present invention may contain natural fruit juice, fruit juice beverage, and fruit for the production of vegetable beverage.
  • These components may be used independently or in combination.
  • the proportion of these additives is not so important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and health functional food composition containing the active substance of the present invention.
  • Step 1 Preparation of dimethyl (2-chloro-4-nitrobenzoyl) carbonimidodithioate (Dimethyl (2-chloro-4-nitrobenzoyl) carbonimidodithioate, 17064-2-1)
  • reaction mixture was purified by silica-gel column chromatography (10% Ethyl acetate / n-hexane) to dimethyl (2-chloro-4-nitrobenzoyl) carbonimidodithioate (Dimethyl (2- chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1) was obtained as a pale yellow solid (160 mg, 21%).
  • Step 2 N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide ( N Preparation of -(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide, FCCS-17064)
  • Step 1 1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-methylphenyl) thiourea (1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-methylphenyl) thiourea, 17065-2-1) preparation
  • Step 2 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, FCCS-17065) Produce
  • Step 1 1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-methoxyphenyl) thiourea (1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-) Preparation of methoxyphenyl)thiourea, 17066-3-1)
  • Step 2 N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine ,17066-3-2) preparation
  • reaction mixture was purified by chromatography (Silica-gel column chromatography) (20% Ethyl acetate / n-hexane) to N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine ,17066-3-2) was obtained as a brown solid (230 mg, 35%).
  • Step 3 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol ,FCCS -17066) preparation
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (40% Ethyl acetate / n-hexane) to obtain the target compound 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol ,FCCS-17066) was obtained as a brown solid (97 mg, 50%).
  • Step 1 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea, Interm Preparation of -3-1)
  • Step 2 N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine (N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine, Interm-3- 2) Manufacturing
  • Step 3 N- (4-ethylphenyl) benzo [d] oxazole-2,5-diamine (N- (4-ethylphenyl) benzo [d] oxazole-2,5-diamine, Interm-3-3) Produce
  • Step 4 N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (N-(2-(4-Ethylphenylamino)benzo[d] Preparation of ]oxazol-5-yl)-2-chloro-5-nitrobenzamide ,FCCS-17067)
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (40% Ethyl acetate / n-hexane) to obtain the target compound N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl) -2-chloro-5-nitrobenzamide (N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide ,FCCS-17067) as a pale yellow solid ( 120 mg, 27%).
  • Interm-3-3 (253 mg, 1 mmol) and 3,4-dichlorobenzoyl chloride (209 mg, 1 mmol) obtained in step 3 of Example 4 were mixed with dimethylformamide ( N ,N -dimethylformamide, DMF) (4 mL) was added, and then diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, extracted with ethyl acetate, and the organic layer was washed sequentially with saturated aqueous NaHCO 3 and brine. The organic layer was dried over Na 2 SO 4 and the solvent was removed under reduced pressure.
  • DIPEA diisopropylethylamine
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (40% Ethyl acetate / n-hexane) to obtain the target compound FCCS-17068 as a pale white solid (270 mg, 64 %).
  • the organic layer was dried over Na 2 SO 4 and the solvent was removed under reduced pressure.
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (30% Ethyl acetate / n-hexane) to obtain the target compound FCCS-17067 as a pale white solid (170 mg, 40%).
  • Step 1 1- (3,4-dichlorophenyl) -3- (2-hydroxyphenyl) thiourea (1- (3,4-dichlorophenyl) -3- (2-hydroxyphenyl) thiourea , FCCS-17065-A Preparation of -2-1)
  • Step 2 Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, FCCS-17065-A)
  • FCCS-17065-A-2-1 400 mg, 1.277 mmol
  • potassium peroxide (KO 2 ) 454 mg, 6.386 mmol
  • acetonitrile acetonitrile, MeCN
  • Step 1 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea (1-(3,4-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl) ) Preparation of thiourea, FCCS-17065-B-2-1)
  • 3-amino-2-naphthol (3-Amino-2-naphthol) (350 mg, 2.119 mmol) was mixed with methanol (anhydrous MeOH) (7 mL) and chloroform (CHCl 3 ) (2 mL) After adding and stirring at room temperature for 5 minutes, 3,4-dichlorophenyl isothiocyanate (0.38 mL, 2.638 mmol) was slowly added dropwise and stirred at room temperature for 13 hours.
  • Step 2 N- (3,4-dichlorophenyl) naphtho [2,3-d] oxazol-2-amine (N- (3,4-dichlorophenyl) naphtho [2,3-d] oxazol-2- Preparation of amine, FCCS-17065-B)
  • FCCS-17065-B-2-1 400 mg, 1.101 mmol
  • potassium peroxide (KO 2 ) 391 mg, 5.505 mmol
  • acetonitrile acetonitrile, MeCN
  • Step 1 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4-difluorophenyl)-3-(2-hydroxy-5-) Preparation of methylphenyl)thiourea, FCCS-17065-C-2-1)
  • Step 2 N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2- Preparation of amine, FCCS-17065-C)
  • FCCS-17065-C-2-1 400 mg, 1.359 mmol
  • potassium peroxide (KO 2 ) 483 mg, 6.795 mmol
  • acetonitrile acetonitrile, MeCN
  • MeCN MeCN
  • Step 1 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea, FCCS-19025 Preparation of -2-1)
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (20% Acetone / n-hexane) to 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1 -(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea, FCCS-19025-2-1) was obtained as a pale yellow solid (354 mg, 92%).
  • Step 2 N- (3,4-difluorophenyl) benzo [d] oxazol-2-amine (N- (3,4-difluorophenyl) benzo [d] oxazol-2-amine , FCCS-19025) Produce
  • FCCS-19025-2-1 (224 mg, 0.80 mmol) and potassium peroxide (KO 2 ) (284 mg, 4.00 mmol) obtained in step 1 under Ar gas atmosphere were mixed with acetonitrile (MeCN) (25 mL), and stirred at room temperature for 14 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), acetonitrile (MeCN) was removed under reduced pressure.
  • MeCN acetonitrile
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (10 to 20% Ethyl acetate / n-hexane) to obtain the target compound N-(3,4-difluorophenyl)benzo[d]oxazole-2-
  • An amine N- (3,4-difluorophenyl) benzo [d] oxazol-2-amine , FCCS-19025) was obtained as a white solid (160 mg, 82%).
  • N-(2-chlorophenyl)-1H-indole-3-carboxamide N-(2-chlorophenyl)-1H-indole-3-carboxamide was used as Comparative Example 1.
  • N-methyl-1H-indole-3-carboxamide N-methyl-1H-indole-3-carboxamide, FCCS-16030 was purchased and used as Comparative Example 3.
  • Step 1 Preparation of methyl 2-(1H-indole-3-carboxamido)acetate (CCS-16031-3-1)
  • Step 2 Preparation of 2-(1H-indole-3-carboxamido)acetic acid (2-(1H-indole-3-carboxamido)acetic acid, FCCS-16031-3-2)
  • 2-(1H-indole-3-carboxamido)acetate (methyl 2-(1H-indole-3-carboxamido)acetate, CCS-16031-3-1) (220 mg, 0.947 mmol) obtained in step 1 was Dissolve in tetrahydrofuran (6 mL), put a solution of lithium hydroxide monohydrate (LiOH monohydrate) (131 mg, 3.126 mmol) in water (2 mL), and stir at room temperature for 1 hour. A 1.0N HCl aqueous solution was added to adjust the pH to 2, followed by extraction with ethyl acetate. After passing through anhydrous Na 2 SO 4 Pad to remove the remaining moisture, the solvent is removed under reduced pressure.
  • LiOH monohydrate lithium hydroxide monohydrate
  • Step 3 N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (N-(2-((2-chlorophenyl)amino)-2- Preparation of oxoethyl)-1H-indole-3-carboxamide, FCCS-16031)
  • 2-(1H-indole-3-carboxamido)acetic acid (2-(1H-indole-3-carboxamido)acetic acid, FCCS-16031-3-2) (200 mg, 0.917 mmol) and TSTU (N,N,N',N'-Tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate) (290 mg, 0.962 mmol) were mixed with dimethylformamide (N,N-dimethylformamide) (4 mL, anhydorus) and N,N-diisopropylethylamine (DIEA) (0.4 mL, 2.293 mmol) was added thereto, followed by stirring at room temperature for 3 hours.
  • DIEA N,N-diisopropylethylamine
  • the target compound N-(2-((2-chlorophenyl)amino)-2-oxoethyl) by performing silica-gel flash column chromatography (70% ethyl acetate/n-hexane) -1H-indole-3-carboxamide (N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide ,FCCS-16031) 20 mg (white solid, 6.6% ) was obtained.
  • RPTEC human renal proximal tubule epithelial cell, ATCC CRL-4031
  • ATCC CRL-4031 human renal proximal tubule epithelial cell
  • Renal Epithelial Growth Medium (REGMTM) Bulletkit manufactured by Lonza was also used, and cultured at 37° C., 5% CO 2 conditions.
  • a plasmid for luciferase expression was used in which the promoter region of the human KL (klotho) gene was arranged to regulate the firefly luciferase gene expression.
  • the plasmid was introduced into cells using Roche's X-treme GENE transfection reagent.
  • the luciferase activity expressed in the cells was measured using a Dual-Luciferase reporter assay system manufactured by Promega.
  • the luciferase activity was measured after each compound was treated with the indicated concentrations in the cultured cells for 24 hours.
  • the high activity of luciferase indirectly indicates that the expression of klotho gene can be increased.
  • Comparative Examples 1 to 4 were treated in RPTEC cells at a concentration of 5 ⁇ M, and a reporter gene including a promoter from the start site of the human klotho gene to the front of 1.7 kbp or from the start site of the human klotho gene to the front of 240 bp. Expression of the reporter gene was confirmed using a reporter gene including a promoter.
  • Examples 1 to 6 were treated with RPTEC, which is an epithelial cell of the proximal tubule of the human kidney, at concentrations of 0.5, 1, and 5 ⁇ M, respectively, and Comparative Example 1 was treated with a concentration of 5 ⁇ M to treat human klotho
  • RPTEC which is an epithelial cell of the proximal tubule of the human kidney
  • Comparative Example 1 was treated with a concentration of 5 ⁇ M to treat human klotho
  • FIGS. 2 and 3 The results of confirming the expression of the reporter gene using a reporter gene (pHKP-luc) including a promoter included up to -2.1 kb upstream of the gene are shown in FIGS. 2 and 3 .
  • RPTEC cells were treated with Comparative Examples 1 and 1 to 3 at a concentration of 5 ⁇ M, and a reporter gene (pHKP-luc) including a promoter included up to -2.1 kb upstream of the human klotho gene (pHKP-luc) was added.
  • pHKP-luc a reporter gene including a promoter included up to -2.1 kb upstream of the human klotho gene
  • RNA extraction from RPTEC cells which are epithelial cells of the proximal tubule of a human kidney, treated with the compounds of Comparative Example 1 and Examples 1 and 2 for 6 hours.
  • the extracted RNA was cDNA prepared using Thermo's Superscript II kit, and the KL (klotho) gene-specific kit was performed using Appliedbiosystem's Taqman Gene Expression assays, as shown in FIG. 4 .
  • Example 2 As shown in FIG. 4 , it was confirmed that the compound of Example 2 was at a level similar to that of Comparative Example 1.
  • Examples 7 to 10 were treated in RPTEC cells, which are epithelial cells of the proximal tubule of human kidney, by 2.5 ⁇ M for 6 hours, then RNA was extracted from the cells, and the extracted RNA was obtained using Thermo's Superscript II kit. cDNA was prepared and then subjected to general PCR.
  • the primer information used in the experiment is as follows.
  • GAPDH-F TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3)
  • GAPDH-R AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4)
  • the DNA amplified by PCR was confirmed by ethidium bromide staining after electrophoresis on an agarose gel, and the amount of DNA in the band was quantitatively compared using the SpeedyQuant program and is shown in FIG. 5 .
  • Example 10 was improved by about 10 times compared to Comparative Example 1.
  • the compound of Example 10 exhibited the least toxicity when treated at a concentration of 12.5 ⁇ M or 25 ⁇ M, and it was confirmed that the toxicity was improved by 20% or more even when compared with Comparative Example 1.
  • HK-2 cells human kidney cells
  • cisplatin cisplatin 20 ⁇ M
  • KS1 compound 3 ⁇ M
  • the cells were harvested, and the Klotho protein expression level was confirmed.
  • FIG. 7b the expression of Klotho protein in HK-2 cells was decreased in the group treated with cisplatin and increased in the group treated with the KS1 compound (Example 10).
  • KS1 compound (20mg/kg/day) was injected into the abdominal cavity every day from 24 hours later. Thereafter, samples were collected by sacrificing on the 7th and 14th days and the experiment was performed (FIG. 8a).
  • the unilateral ureteral obstruction model showed an enlarged kidney, and the kidney treated with the KS1 compound showed no size difference ( FIG. 8b ).
  • H&E staining was performed to examine changes in the nucleus and cytoplasm in the unilateral ureteral obstruction model, and the results are shown in FIG. 9 .
  • the number of nuclei increased significantly.
  • the cytoplasm was destroyed, but in the KS1-treated sample, tissue destruction was greatly reduced. results were shown (FIG. 9).
  • Sirius Red staining was performed in order to examine changes according to the progression of fibrosis in the unilateral ureteral obstruction model.
  • tissue sample of the unilateral ureteral obstruction model untreated with KS1 fibrosis began to progress in red, and the fibrosis in the 2-week sample showed more advanced fibrosis than the 1-week sample.
  • the KS1 treated group showed less fibrosis than the unilateral ureteral obstruction model that was not treated with KS1 (FIG. 10).
  • TUNEL staining was performed to determine the degree of apoptosis in the unilateral ureteral obstruction model. Apoptosis occurred in the 1-week tissue sample of the unilateral ureteral obstruction model that was not treated with KS1, and the apoptosis was increased in the 2-week sample compared to the 1-week sample. However, in the KS1-treated group, apoptosis was significantly reduced compared to the unilateral ureteral obstruction model that was not treated with KS1 (FIG. 11).
  • MMP-9 As a result of confirming the change in MMP-9 protein, an inflammatory marker, in the unilateral ureteral obstruction model, MMP-9 increased in the samples of the unilateral ureteric obstruction model not treated with KS1 at 1 week and 2 weeks, but MMP-9 was increased when KS1 was treated. -9 It showed a result that the expression level was significantly reduced (FIG. 13).
  • mice 10 5-week-old, 10 6-week-old
  • 50 db/db mouse 25 5-week-old, 25 6-week-old
  • the experiment was started (mouse model number JAX 000642 - BKS.Cg-Dock7m +/+ Leprdb/j 5W/M Wildtype for Dock7m, BKS.Cg-Dock7m +/+ Leprdb/j 5W/M Heterozygous for Dock7m).
  • Each group had a large number of individuals, so the experiment was divided into set 1 (set1) and set 2 (set2).
  • mice Five-week-old rats were used as set 2 (set2), and the experiment was carried out one week later, so that all mice participated in the experiment from 6 weeks of age. adjusted. After measuring the weight, they were evenly distributed to each group, and then a normal diet (ND) and a high protein diet (HPD) were supplied. After administration of a high-protein diet for 3 weeks, urine was collected for 2 hours through a metabolic cage and used for analysis. From week 5, when it was confirmed that total protein and microalbumin levels increased in the high-protein diet group through urine analysis, the drug (KS1) was divided into concentrations (2, 10, and 50 mg/kg) and garbage collected daily. (gavage) was administered orally. After 12 weeks of drug administration, mice were sacrificed and blood and organs were obtained and used for blood analysis and tissue analysis. Urine analysis was requested to the SCL healthcare center and results were obtained, and blood analysis was performed using an I-STAT cartridge (CHEM 8+).
  • I-STAT cartridge CHEM 8+
  • the animals were anesthetized with an anesthetic, they were perfused and fixed with a fixative (Periodate-Lysine-2% paraformaldehyde) through the heart for 8 minutes. It was further fixed at 4°C for 16 hours or more in the same fixing solution. After being dehydrated through an alcohol series, embedded in wax, and cut into 5 ⁇ m to prepare tissue slides. After re-hydrating the tissue through the hydration process, it was heated by immersing it in a citric acid solution of pH 6 to retrieve the protein fixed to the aldehyde.
  • a fixative Periodate-Lysine-2% paraformaldehyde
  • microalbumin level was measured through urine analysis, and the microalbumin level was expressed in proportion to the creatinine value to correct for the difference in muscle mass between individual experimental mice. As a result, a statistically significant ( p ⁇ 0.05) decrease in microalbumin levels was observed in mice administered with the KS1 compound ( FIG. 16 ).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nutrition Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physiology (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/KR2022/004706 2021-04-01 2022-04-01 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 만성신장질환의 예방 또는 치료용 조성물 Ceased WO2022211574A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU2022248891A AU2022248891A1 (en) 2021-04-01 2022-04-01 Composition for preventing or treating chronic kidney disease, comprising compound that induces expression of anti-aging gene klotho
CA3213910A CA3213910A1 (en) 2021-04-01 2022-04-01 Composition for preventing or treating chronic kidney disease, comprising compounds that induces expression of anti-aging gene klotho
BR112023020026A BR112023020026A2 (pt) 2021-04-01 2022-04-01 Composição para prevenir ou tratar doença renal crônica compreendendo compostos que induzem a expressão do gene antienvelhecimento klotho
CN202280026646.XA CN117157280A (zh) 2021-04-01 2022-04-01 包含诱导抗老化基因klotho的表达的化合物的用于预防或治疗慢性肾脏疾病的组合物
EP22781693.1A EP4317140A4 (en) 2021-04-01 2022-04-01 Composition for preventing or treating chronic kidney disease, comprising compound that induces expression of anti-aging gene klotho
JP2023561148A JP7728030B2 (ja) 2021-04-01 2022-04-01 抗老化遺伝子ｋｌｏｔｈｏの発現を誘導する化合物を含む慢性腎疾患の予防または治療用組成物
US18/553,392 US20240216341A1 (en) 2021-04-01 2022-04-01 Composition for preventing or treating chronic kidney disease, comprising compound that induces expression of anti-aging gene klotho
AU2025202595A AU2025202595A1 (en) 2021-04-01 2025-04-11 Composition for preventing or treating chronic kidney disease, comprising compound that induces expression of anti-aging gene klotho

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210042955 2021-04-01
KR10-2021-0042955 2021-04-01
KR10-2022-0040453 2022-03-31
KR1020220040453A KR102463786B1 (ko) 2021-04-01 2022-03-31 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 만성신장질환의 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2022211574A1 true WO2022211574A1 (ko) 2022-10-06

Family

ID=83456608

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004706 Ceased WO2022211574A1 (ko) 2021-04-01 2022-04-01 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 만성신장질환의 예방 또는 치료용 조성물

Country Status (7)

Country Link
US (1) US20240216341A1 (https=)
EP (1) EP4317140A4 (https=)
JP (1) JP7728030B2 (https=)
AU (2) AU2022248891A1 (https=)
BR (1) BR112023020026A2 (https=)
CA (1) CA3213910A1 (https=)
WO (1) WO2022211574A1 (https=)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020089493A (ko) * 2000-04-28 2002-11-29 상꾜 가부시키가이샤 ＰＰＡＲγ모듈레이터
WO2016176473A1 (en) * 2015-04-28 2016-11-03 Sanford-Burnham Medical Researc Institute Apelin receptor agonists and methods of use thereof
KR20170024522A (ko) * 2015-08-24 2017-03-07 이화여자대학교 산학협력단 2-(페닐아미노)벤조[d]옥사졸-5-올 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 염증성 질환의 예방 또는 치료용 약학적 조성물
KR20210042955A (ko) 2018-08-16 2021-04-20 제네럴 일렉트릭 테크놀러지 게엠베하 전력 송전 매체의 상태를 모니터링하기 위한 장치
KR20220040453A (ko) 2019-06-20 2022-03-30 주식회사 레이지소사이어티 면도날 자동주문 장치

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8318703B2 (en) * 2001-12-06 2012-11-27 Fibrogen, Inc. Methods for improving kidney function
EP1388341A1 (en) 2002-08-07 2004-02-11 Aventis Pharma Deutschland GmbH Acylamino-substituted heteroaromatic compounds and their use as pharmaceuticals
WO2011084452A1 (en) 2009-12-16 2011-07-14 Eli Lilly And Company Therapeutic uses of soluble alpha-klotho
KR101372721B1 (ko) 2010-06-18 2014-03-14 이화여자대학교 산학협력단 Ｉｎｔｅｒｌｅｕｋｉｎ―６ 억제 작용을 갖는 신규한 벤즈옥사졸 유도체, 이의 제조 방법 및 이를 포함하는 약학적 조성물
KR20250097990A (ko) * 2016-11-10 2025-06-30 베링거 인겔하임 인터내셔날 게엠베하 약제학적 조성물, 치료 방법 및 이의 용도
IT201900007446A1 (it) * 2019-05-29 2020-11-29 Giuseppe Castellano Composizione comprendente citrato e carnitina in grado di attivare la produzione della proteina klotho
JP7412546B2 (ja) 2019-10-02 2024-01-12 克洛索科学公司 抗老化遺伝子ｋｌｏｔｈｏの発現を誘導する化合物およびその用途
KR102375097B1 (ko) * 2021-04-01 2022-03-17 주식회사 클로소사이언스 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020089493A (ko) * 2000-04-28 2002-11-29 상꾜 가부시키가이샤 ＰＰＡＲγ모듈레이터
WO2016176473A1 (en) * 2015-04-28 2016-11-03 Sanford-Burnham Medical Researc Institute Apelin receptor agonists and methods of use thereof
KR20170024522A (ko) * 2015-08-24 2017-03-07 이화여자대학교 산학협력단 2-(페닐아미노)벤조[d]옥사졸-5-올 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 염증성 질환의 예방 또는 치료용 약학적 조성물
KR20210042955A (ko) 2018-08-16 2021-04-20 제네럴 일렉트릭 테크놀러지 게엠베하 전력 송전 매체의 상태를 모니터링하기 위한 장치
KR20220040453A (ko) 2019-06-20 2022-03-30 주식회사 레이지소사이어티 면도날 자동주문 장치

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BRADFORD SHAYNA T.J., RANGHINI EGON J., GRIMLEY EDWARD, LEE PIL H., DRESSLER GREGORY R.: "High-throughput screens for agonists of bone morphogenetic protein (BMP) signaling identify potent benzoxazole compounds", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 294, no. 9, 1 March 2019 (2019-03-01), US , pages 3125 - 3136, XP055972586, ISSN: 0021-9258, DOI: 10.1074/jbc.RA118.006817 *
KIM DARONG; WON HEE YEON; HWANG EUN SOOK; KIM YOUNG-KOOK; CHOO HEA-YOUNG PARK: "Synthesis of benzoxazole derivatives as interleukin-6 antagonists", BIOORGANIC & MEDICINAL CHEMISTRY, ELSEVIER, AMSTERDAM, NL, vol. 25, no. 12, 7 April 2017 (2017-04-07), AMSTERDAM, NL, pages 3127 - 3134, XP085030746, ISSN: 0968-0896, DOI: 10.1016/j.bmc.2017.03.072 *
See also references of EP4317140A4

Also Published As

Publication number Publication date
AU2025202595A1 (en) 2025-05-01
BR112023020026A2 (pt) 2024-01-23
EP4317140A4 (en) 2025-04-09
AU2022248891A1 (en) 2023-10-26
JP2024512813A (ja) 2024-03-19
US20240216341A1 (en) 2024-07-04
CA3213910A1 (en) 2022-10-06
JP7728030B2 (ja) 2025-08-22
EP4317140A1 (en) 2024-02-07
AU2022248891A9 (en) 2023-11-09

Similar Documents

Publication Publication Date Title
WO2021066608A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물 및 이의 용도
WO2022211420A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물
WO2021256861A1 (ko) 신규한 산 분비 억제제 및 이의 용도
WO2021145655A1 (ko) 신규한 피라졸 유도체
WO2019168237A1 (ko) 신규 화합물 및 이를 유효성분으로 함유하는 섬유증 또는 비알코올성 지방간염의 예방, 개선 또는 치료용 조성물
WO2012115479A2 (en) Diaminopyrimidine derivatives and processes for the preparation thereof
WO2012161518A2 (ko) ＲＯＲα의 활성자로서의 신규한 ｔｈｉｏｕｒｅａ 유도체 및 이를 함유하는 약학적 조성물
WO2014171801A1 (ko) 아미도피리딘올 유도체 또는 이의 약제학적 허용가능한 염 및 이를 유효성분으로 함유하는 약학조성물
WO2021118318A2 (ko) 신규한 인돌 유도체 및 이의 용도
WO2013105753A1 (en) Substituted piperidine derivatives and methods for preparing the same
WO2023224371A1 (ko) 신규 옥사다이아졸 유도체 화합물 및 이를 포함하는 신경염증성 질환 예방 또는 치료용 약학적 조성물
WO2011049274A1 (en) Imidazole derivatives and compositions for treating melanoma
WO2022211574A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 만성신장질환의 예방 또는 치료용 조성물
WO2011105643A1 (ko) 퍼록시솜 증식자 활성화 수용체 리간드 셀레나졸 유도체, 이의 제조방법 및 이들 화합물의 용도
WO2012148140A2 (ko) 혈관 신생 억제 및 항산화 효과를 가지는 이미다졸계 알칼로이드 유도체 및 이의 제조방법
WO2025034034A1 (ko) 신규한 화합물, 및 이를 포함하는 암 또는 종양의 예방 또는 치료용 약학적 조성물
WO2023080652A1 (en) Androgen receptor degraders for the treatment of castration-resistant prostate cancer and use thereof
WO2020101450A1 (ko) 아질사르탄 유도체 화합물, 이의 중간체, 이의 제조방법 및 이를 포함하는 조성물
WO2023013996A1 (ko) 인돌 유도체, 이의 제조방법 및 약학적 용도
WO2023013994A1 (ko) 신규한 인돌 유도체, 이를 포함하는 약학적 조성물, 및 이의 용도
WO2010140835A2 (ko) 신규한 피리돈 화합물 또는 이의 약학적으로 허용가능한 염, 이의 제조방법 및 이를 포함하는 암 치료용 약학 조성물
WO2022019663A1 (ko) 벤조퓨란계 n-아실하이드라존 유도체를 포함하는 항염증 조성물
WO2021096314A1 (ko) 신규한 벤즈이미다졸 유도체 및 이의 용도
WO2022235097A1 (ko) 신규한 피라졸로[3,4-b]피리딘 유도체를 포함하는 비만 및 당뇨병을 비롯한 대사성 질환 또는 비알콜성 지방간염의 예방 또는 치료용 약학 조성물
WO2020045982A1 (ko) 치환된 인돌 유도체, 이의 제조방법 및 이를 유효성분으로 포함하는 PPARα, PPARγ 및 PPARδ 관련 질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22781693

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3213910

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 18553392

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2023561148

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: AU2022248891

Country of ref document: AU

Ref document number: 2022248891

Country of ref document: AU

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023020026

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022248891

Country of ref document: AU

Date of ref document: 20220401

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202327074354

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2022781693

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022781693

Country of ref document: EP

Effective date: 20231102

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112023020026

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230927