WO2022020559A1 - Methods and compositions for treating metabolic disorders - Google Patents

Methods and compositions for treating metabolic disorders Download PDF

Info

Publication number
WO2022020559A1
WO2022020559A1 PCT/US2021/042723 US2021042723W WO2022020559A1 WO 2022020559 A1 WO2022020559 A1 WO 2022020559A1 US 2021042723 W US2021042723 W US 2021042723W WO 2022020559 A1 WO2022020559 A1 WO 2022020559A1
Authority
WO
WIPO (PCT)
Prior art keywords
aac
current
mitochondrial
test compound
proton
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/042723
Other languages
French (fr)
Inventor
Yuriy KIRICHOK
Ambre BERTHOLET
Michael GRABE
Paola BISIGNANO
Andrew NATALE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Publication of WO2022020559A1 publication Critical patent/WO2022020559A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5076Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving cell organelles, e.g. Golgi complex, endoplasmic reticulum
    • G01N33/5079Mitochondria

Definitions

  • the mitochondrial ADP/ATP carrier is a major transport protein of the inner mitochondrial membrane (IMM). It exchanges mitochondrial ATP for cytosolic ADP and controls cellular ATP production.
  • AAC mitochondrial ADP/ATP carrier
  • H + transport There are two distinct transport modes of ACC: ADP/ATP exchange and H + transport.
  • the AAC -mediated H + current requires free fatty acids and resembles the H + leak via the thermogenic uncoupling protein 1 of brown fat.
  • the ADP/ATP exchange via AAC negatively regulates the H + leak, but does not induce complete inhibition. This suggests that the H + leak and mitochondrial uncoupling could be dynamically controlled by cellular ATP demand and the rate of ADP/ATP exchange.
  • AAC intimately connects coupled (ATP production) and uncoupled (thermogenesis) energy conversion in mitochondria.
  • AAC1-AAC4 AAC4 is specific to germ cells and pluripotent stem cells
  • AAC4 is specific to germ cells and pluripotent stem cells
  • Mice lack AAC3 (Levy, S. E. et al., Gene 254, 57-66 (2000); Graham, B. H. et al. Nat Genet 16, 226-234, (1997)).
  • AAC operates by the alternating access mechanism with a single substrate binding site (SBS) intermittently exposed to either cytosolic (c-state) or matrix (m-state) side of the IMM (Klingenberg, supra , Ruprecht, J. J. et al. , Cell, (2019). Additionally, two other roles, in mitochondrial uncoupling (Andreyev, A. et al, FEBS lett 226, 265-269 (1988); Skulachev, V. P. Biochim Biophys Acta - Bioenergetics 1363, 100-124, (1998); Houseovetsky, N. & Klingenberg, M., J Biol Chem 269, 27329-27336 (1994); Brand, M. D. et al..
  • SBS substrate binding site
  • Uncoupling proteins mediate H + leak (/ // ) across the IMM.
  • I H uncouples the H + flows via electron transport chain and the ATP synthase to reduce efficiency of ATP production and cause mitochondrial thermogenesis.
  • I H also decreases reactive oxygen species (ROS) production, protecting mitochondrial integrity (Skulachev, supra ; Korshunov, S. S. et al., FEBS lett 416, 15-18 (1997)).
  • I H via UCPs is activated by free long-chain fatty acids (FA) (Wojtczak, L. & Schonfeld, P., Biochim Biophys Acta 1183, 41-57 (1993).
  • FA free long-chain fatty acids
  • I H may also occur through the lipid phase without protein involvement (Gutknecht, J., J Membr Biol 106, 83-93 (1988)). With so many proposed I H pathways, the molecular mechanisms of mitochondrial uncoupling remains unclear.
  • mitochondrial H + leak and thermogenesis represent valuable therapeutic targets for treating diseases mediated by energy expenditure.
  • the compounds capable of increasing H + leak and mitochondrial thermogenesis through binding to AAC are needed to realize a therapeutic effect of these targets.
  • the method further includes determining whether said compound induces proton
  • a method of treating a metabolic disorder in a subject in need thereof comprising administering to said subject an effective amount of an AAC proton leak inducing agent.
  • the method further comprising binding of said AAC proton leak inducing agent within the AAC binding site.
  • Figs. 1A-1F Pharmacological and biophysical properties of I H .
  • FIGs. 2A-2C AAC is required for I H .
  • Figs. 3A-3E Adenine nucleotide transport by AAC.
  • 3A Left panel: AAC current before (control, black) and after (red) addition of 5 mM ADP to the bath solution.
  • Pipette solution contained 5 mM ATP.
  • 3B AAC current before (control, black) and after (red) addition of 5 mM ATP to the bath solution.
  • Pipette solution contained 5 mM ADP.
  • Figs. 4A-4E Nucleotide exchange negatively regulates IH.
  • 4A Left panel: I H induced by 2 mM AA (1), followed by a transient inhibition by 1 mM of bath ADP (2), and subsequent recovery (3).
  • 4B Left panel: I H activated by 2 mM AA (red) was inhibited by addition of 1 mM ADP to bath. Pipette solution contained 1 mM ADP. Heart mitoplast. Right panel: I H time course of the left panel.
  • FIGs. 5A-5E Mitochondrial uncoupling requires AAC.
  • FIGs. 6A-6D FA-dependent IH in the IMM and plasma membrane.
  • 6A Left panel ⁇ a diagram of patch-clamp recording from a vesicle of the whole IMM (mitoplast). After forming a gigaohm seal between the patch pipette and the mitoplast, the IMM patch under the pipette is broken by applying short pulses of high voltage (200-500 mV, 5-30 ms) combined with light suction to gain access into the mitoplast through the pipette. In this configuration, called the “whole-mitoplast” configuration, the interior of the mitoplast (mitochondrial matrix) is perfused with the pipette solution.
  • high voltage 200-500 mV, 5-30 ms
  • the bath is also perfused to control the experimental solution on the cytosolic side of the IMM.
  • the voltage across the IMM is set using the patch-clamp amplifier.
  • Directions of currents flowing across the IMM inward currents (flowing into the mitoplast) are negative, while outward currents are positive.
  • Right panel an example of a ///current trace recorded in the whole-mitoplast mode.
  • the voltage protocol used to induce the currents is shown above. All indicated voltages are within the mitochondrial matrix relative to the bath (cytosol).
  • the voltage of the bath solution is defined to be zero. Baseline (zero current level) as well as negative (inward) and positive (outward) currents are indicated.
  • Figs. 7A-7E UCPl-independent IH in various mouse tissues.
  • FIGs. 9A-9L AAC-dependent and -independent currents induced by FA.
  • 9A Current induced by 4 pM palmitic acid (PA, red) was inhibited by 1 pM CATR (blue). Control current is shown in black.
  • Representative experiments performed in heart mitoplasts, n 4.
  • 9C Upper panel, currents induced by 22 pM of AA (green), PA (blue), and LA (red) in the same mitoplast. Control current is shown in black.
  • Heart mitoplasts, n 4.
  • 9K Inhibition of the inward / // induced by 2 pM AA in SM, heart, liver, and kidney by 1 pM CATR.
  • 9L Inhibition of the outward current induced by 2 pM AA in SM, heart, liver, and kidney by 1 mM CATR. Remaining outward current measured at +100 mV is shown as a percentage of control.
  • FIGs. 10A-10F FA-dependent/i/via AAC is potentiated by oxidation.
  • Bar graphs show ratio of / // amplitudes at -160 mV before and after addition of
  • FIGs. 11A-11J FA-dependent currents in AAC1 knockout and AAC2 hypomorphic mice.
  • Data are mean ⁇ SEM.
  • 12E Current before (control, black) and after (red) application of 50 mM C6-sulf to the bath. Pipette solution contained 50 mM C6-sulf. Symmetrical pH 6.0.
  • the negatively charged head of FA is likely to interact with the SBS, while the hydrophobic carbon tail may protrude into the membrane and/or be stabilized by hydrophobic interactions within AAC (2 and 3).
  • FIGs. 13A-13G Adenine nucleotide exchange by AAC.
  • 13A The alternating access mechanism of adenine nucleotide transport by AAC.
  • AAC is shown in green, and its substrate binding site (SBS, overall positively charged) located in the middle of the membrane is shown in blue.
  • SBS substrate binding site
  • Cytosolic ADP binds to AAC in the c-state (1).
  • AAC transitions to the m-state, and ADP is released into the matrix (2 and 3).
  • Matrix ATP binds to AAC in the m-state (4).
  • AAC transitions to the c-state, and ATP is released into the cytosol (5).
  • Pipette solution contained 4 mM AA.
  • Heart mitoplast, n 4.
  • 13G Control current (black) and current after addition of 1 mM ADP to the bath solution (red).
  • AA (2 mM) was added to the bath solution at the end of experiment (blue).
  • Pipette solution contained 4 mM AA.
  • Heart mitoplasts, n 4.
  • Figs. 14A-14F Regulation of FA-dependent IH by nucleotides.
  • 14A Explanation of transient / // inhibition by cytosolic adenine nucleotides.
  • AAC in c-state with FA anion in the translocation pathway, mediates / // ( 1).
  • Cytosolic ADP3- binds in c-state and expels FA anion/blocks translocation pathway, leading to / // inhibition (2).
  • ADP dissociates into matrix (pipette) solution (3).
  • FA anion re-associates with AAC in m-state, restoring / // ( 4). Cytosolic ADP cannot inhibit / // while AAC is in m-state (5). See also Fig. 4 A. 14B:
  • 14C Remaining / // after inhibition by different concentrations of ADP applied to both sides of the EMM to induce continuous adenine nucleotide exchange via AAC as in (e).
  • ADP/ ADP exchange was used to avoid contaminating / // with ADP/ATP exchange current.
  • Figs. 15A-15H Phenotypes associated with AAC deficiency.
  • PA palmitic acid
  • buffer black
  • Fig. 16 depicts the amino acid sequence of human SLC25A4 (ANTI) protein (SEQ ID NO.
  • Adenosine diphosphate (ADP)/adenosine triphosphate (ATF) carrier refers to a transport protein of the inner mitochondrial membrane (IMM) that exchanges mitochondrial ATP for cytosolic ADP and controls cellular ATP production.
  • IMM inner mitochondrial membrane
  • AAC1-AAC4 human AAC isoforms
  • AAC operates by the alternating access mechanism with a single substrate binding site (SBS) intermittently exposed to either cytosolic (c-state) or matrix (m-state) side of the IMM.
  • AAC current refers to a distinct transport mode from the inner mitochondrial membrane which can be through either ADP/ATP exchange or H + transport.
  • AAC-mediated H + current refers to AAC-mediated proton current that requires free fatty acids and is similar to the H + leak via the thermogenic uncoupling protein 1 of brown fat.
  • Binding site refers to a region on a macromolecule such as a protein that binds to another molecule with specificity.
  • the binding partner of the macromolecule is often referred to as a ligand.
  • Ligands may include other proteins, enzyme substrates, second messengers, hormones, or allosteric modulators.
  • the binding site is a fatty acid binding site wihin AAC.
  • the binding site is an aromatic binding site within AAC.
  • Binding activity refers to a strength of association between two molecules, for example, the binding activity of a tested compound to a fatty acid binding site of AAC or an aromatic binding site of AAC in the inner mitochondrial membrane.
  • Inner mitochondrial membrane refers to the mitochondrial membrane which separates the mitochondrial matrix from the intermembrane space and is highly compartmentalized into numerous cristae to expand its surface area and enhance its ability to produce ATP.
  • Cell plasma membrane refers to a biological membrane that separates the interior of a cell from the outside environment (the extracellular space) which protects the cell from its environment.
  • Mitochondrial respiration refers to a set of metabolic reactions requiring oxygen to convert the energy stored in macronutrients to ATP within mitochondria.
  • Protonatable group refers to a chemical group that is able to attract protons.
  • an analog or “analogue” is used in accordance with its plain ordinary meaning within Chemistry and Biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called “reference” compound) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound. Accordingly, an analog is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound.
  • salts are meant to include salts of the active compounds that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein.
  • base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in an inert solvent.
  • pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt.
  • acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in an inert solvent.
  • Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids selected from hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids selected from acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolyl sulfonic, citric, tartaric, oxalic, methanesulfonic, and the like.
  • inorganic acids selected from hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydr
  • salts of amino acids e.g ., but not limited to, arginate and the like
  • salts of organic acids e.g., but not limited to, glucuronic or galactunoric acids and the like
  • the 5-HT 2B agonist may contain both basic and acidic functionalities that allow conversion into either base or acid addition salts.
  • an “effective amount” is an amount sufficient for a test compound (including pharmaceutically acceptable salts thereof) to accomplish a stated purpose relative to the absence of a test compound (including pharmaceutically acceptable salts thereof) (e.g. achieve the effect for which it is administered, treat a disease, reduce protein/enzyme activity, increase protein/enzyme activity, reduce a signaling pathway, or reduce one or more symptoms of a disease or condition).
  • an “effective amount” is an amount of a test compound (including pharmaceutically acceptable salts thereof) which is sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.”
  • a “reduction” of a symptom or symptoms means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s) (e.g. seizures).
  • a “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms (e.g. seizures).
  • the full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses.
  • a prophylactically effective amount may be administered in one or more administrations.
  • test compound including pharmaceutically acceptable salts thereof
  • Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art.
  • therapeutically effective amounts for use in humans can also be determined from animal models.
  • a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals.
  • the dosage in humans can be adjusted by monitoring compounds effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.
  • Dosages may be varied depending upon the requirements of the patient and the compound being employed.
  • the dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.
  • Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particular clinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
  • an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.
  • Control or “control experiment” is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. In some instances, the control is used as a standard of comparison in evaluating experimental effects.
  • a control is the measurement of the activity of a protein in the absence of a test compound (including pharmaceutically acceptable salts thereof).
  • test compound refers to an experimental compound used in a screening process to identify activity, non-activity, or other modulation of a particularized biological target or pathway.
  • modulation refers to a composition that increases or decreases the level of a target molecule or the function of a target molecule or the physical state of the target of the molecule.
  • Modulation refers to the process of changing or varying one or more properties. For example, as applied to the effects of a modulator on a biological target, to modulate means to change by increasing or decreasing a property or function of the biological target or the amount of the biological target.
  • the term “inhibition”, “inhibit”, “inhibiting” and the like in reference to a AAC-related H + current means negatively affecting (e.g. decreasing) the AAC-related H + current relative to the function in the absence of the inhibitor.
  • Inhibition as used herein may refer to inhibition of the transport of protons through the inner mitochondrial membrane.
  • activation or “induction”, “activating” or “inducing” and the like in reference to a AAC-related H + current that positively affect (e.g. increase) the AAC-related H + current relative to the activity in absence of the activator compound.
  • Activation may refer to enhanced activity of a particular protein target.
  • Activation may refer to restoration of loss-of-function of a mutated protein target.
  • Activation as used herein may refer to activation of the transport of protons through the inner mitochondrial membrane
  • Contacting is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g., but not limited to chemical compounds, biomolecules, or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated; however, the resulting reaction product may be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents that can be produced in the reaction mixture.
  • contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be a compound as described herein and a protein or enzyme. In some embodiments contacting includes allowing a test compound described herein to interact with a mitochondrial-containing cell.
  • association or “associated with” in the context of a substance or substance activity or function associated with a disease means that the disease is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
  • “Patient” or “subject in need thereof’ refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a pharmaceutical composition as provided herein.
  • Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, zebrafish, and other non-mammalian animals.
  • a patient may be human.
  • Disease or “condition” refer to a state of being or health status of a patient or subject capable of being treated with the compounds or methods provided herein.
  • Metabolic disorder is a medical condition characterized by problems with an organism's metabolism. Metabolic disorder is a broad range of conditions including, but not limited to, Tay- Sachs disease, Wilson's disease, type II diabetes, fatty liver disease, obesity, hyperthyroidism, hypothyroidism, galactosemia, dyslipidemia, hypolididemia, and phenylketonuria.
  • “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” or “carrier moiety” refer to a substance that aids the administration of a test-compound (including pharmaceutically acceptable salts thereof) to and absorption by a subject and can be included in the compositions without causing a significant adverse toxicological effect on the subject.
  • Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates (e.g., but not limited to, lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like.
  • Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds herein).
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds herein.
  • test compound including pharmaceutically acceptable salts thereof
  • encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
  • a carrier which is thus in association with it.
  • cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.
  • administering means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini- osmotic pump, to a subject.
  • Administration is by any route, including parenteral and transmucosal (e.g, buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal).
  • Parenteral administration includes, e.g, intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial.
  • Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
  • test compound including pharmaceutically acceptable salts thereof
  • pharmaceutical compositions thereof may be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
  • Oral preparations include tablets, pills, powder, dragees, capsules, liquids, lozenges, cachets, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient.
  • Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules.
  • Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions.
  • a test compound may additionally include components to provide sustained release and/or comfort. Such components include high molecular weight, anionic mucomimetic polymers, gelling polysaccharides and finely-divided drug carrier substrates. These components are discussed in greater detail in U.S. Pat. Nos. 4,911,920; 5,403,841; 5,212,162; and 4,861,760. The entire contents of these patents are incorporated herein by reference in their entirety for all purposes.
  • a test compound may also be delivered as microspheres for slow release in the body.
  • microspheres can be administered via intradermal injection of drug-containing microspheres, which slowly release subcutaneously (see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995; as biodegradable and injectable gel formulations (see, e.g., Gao Pharm. Res. 12:857-863, 1995); or, as microspheres for oral administration (see, e.g., Eyles, J. Pharm. Pharmacol. 49:669-674, 1997).
  • compositions of a test compound may be delivered by the use of liposomes which fuse with the cellular membrane or are endocytosed, i.e., by employing receptor ligands attached to the liposome, that bind to surface membrane protein receptors of the cell resulting in endocytosis.
  • liposomes particularly where the liposome surface carries receptor ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the compositions of a test compound (including pharmaceutically acceptable salts thereof) into the target cells in vivo.
  • a test compound including pharmaceutically acceptable salts thereof
  • compositions may also be delivered as nanoparticles.
  • compositions described herein are administered at the same time, just prior to, or just after the administration of one or more additional therapies.
  • a test compound including pharmaceutically acceptable salts thereof
  • Co-administration is meant to include simultaneous or sequential administration of the compounds individually or in combination (more than one compound).
  • the preparations may also be combined, when desired, with other active substances (e.g. to reduce metabolic degradation).
  • test compound may be delivered transdermally, by a topical route, or formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
  • ADP adenosine diphosphate
  • ATP adenosine triphosphate
  • the method of activating AAC includes docking a test compound in a AAC fatty acid binding site. In embodiments, the method includes docking a test compound in a AAC aromatic binding site.
  • the test compound increases mitochondrial respiration in a mitochondrial - containing cell. In embodiments, the test compound decreases mitochondrial respiration in a mitochondrial-containing cell.
  • the method of activating AAC comprises an activation of proton current through AAC by the test compound. In embodiments, the method of activating AAC comprises an inhibition of ADP/ATP exchange by the test compound.
  • a mitochondrial-containing cell is a myocyte cell. In embodiments, a mitochondrial-containing cell is an intact myocyte cell. In embodiments, a mitochondrial-containing cell is an intact myocyte C2C1 cell.
  • the method of identifying a compound that activates AAC further comprising determining whether said compound induces proton current across a cell plasma membrane. In embodiments, the method of identifying a compound that activates AAC further comprising determining whether said compound induces proton current across a cell plasma membrane at micromolar concentrations or less.
  • a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.1 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.25 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.5 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.75 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 1 nM.
  • a test compound induces proton current across a cell plasma membrane at a concentration of less than 10 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 25 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 50 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 75 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 100 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 200 nM.
  • a test compound induces proton current across a cell plasma membrane at a concentration of less than 300 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 400 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 500 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 600 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 700 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 800 nM.
  • a test compound induces proton current across a cell plasma membrane at a concentration of less than 900 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 1 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 2 pM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 3 pM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 4 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 5 mM.
  • a test compound induces proton current across a cell plasma membrane at a concentration of less than 6 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 7 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 8 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 9 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 10 mM. hi embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 15 mM.
  • a test compound induces proton current across a cell plasma membrane at a concentration of less than 20 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 25 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 50 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 75 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 100 mM.
  • the concentration of a test compound that induces proton current across a cell plasma membrane is about 0.1 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 0.5 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 10 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 25 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 50 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 100 nM.
  • the concentration of a test compound that induces proton current across a cell plasma membrane is about 200 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 300 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 400 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 500 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 600 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 600 nM.
  • the concentration of a test compound that induces proton current across a cell plasma membrane is about 600 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 700 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 800 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 900 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about ImM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 2mM.
  • the concentration of a test compound that induces proton current across a cell plasma membrane is about 5mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 10 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 25 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 50 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 75 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 100 mM.
  • a method of identifying a compound that activates AAC comprises a protonable group that is located proximal to amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC sequence set forth in Fig. 16.
  • the protonable group is located proximal to amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC fatty acid binding site.
  • a method of identifying a compound that activates AAC comprises a protonable group that is located proximal to an amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in the AAC sequence set forth in Fig. 16.
  • the protonable group is located proximal to amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in said AAC aromatic binding site.
  • “located proximal to” means 5 A 0 or less, 4 A 0 or less, or 2 A 0 or less.
  • the AAC proton leak inducing agent binds within the AAC binding site. In embodiments, the AAC proton leak inducing agent binds within the AAC fatty acid binding site. In embodiments, the AAC proton leak inducing agent binds within the AAC aromatic binding site.
  • the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC sequence set forth in Fig. 16. In embodiments, the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC fatty acid binding site.
  • the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in the AAC sequence set forth in Fig. 16. In embodiments, the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in the AAC aromatic binding site.
  • the pharmaceutical composition may consiste a test compound that activates AAC (including pharmaceutically acceptable salts thereof) contained in a therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose.
  • a therapeutically effective amount i.e., in an amount effective to achieve its intended purpose.
  • the actual amount effective for a particular application will depend, inter alia, on the condition being treated.
  • such compositions will contain amounts of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof effective to achieve the desired result.
  • the dosage and frequency (single or multiple doses) of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof administered can vary depending upon a variety of factors, including route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated; presence of other diseases or other health-related problems; kind of concurrent treatment; and complications from any disease or treatment regimen. Other therapeutic regimens or agents can be used in conjunction with the methods described herein.
  • the therapeutically effective amounts of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof for treating metabolic diseases described herein may be initially determined from cell culture assays. Target concentrations will be those concentrations of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof capable of inhibiting or otherwise decreasing metabolism disfunction in a patient.
  • Therapeutically effective amounts of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof for use in humans may be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring response of the patient to the treatment and adjusting the dosage upwards or downwards, as described above.
  • Dosages may be varied depending upon the requirements of the subject and the compound being employed.
  • the dose administered to a subject should be sufficient to effect a beneficial therapeutic response in the subject over time.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side effects. Generally, treatment is initiated with smaller dosages, which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.
  • Dosage amounts and intervals can be adjusted individually to provide levels of the administered AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof effective for the particular metabolic disorder being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
  • an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is entirely effective to treat the clinical symptoms demonstrated by the particular patient.
  • This planning should involve the careful choice of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof by considering factors such as potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration, and the toxicity profile of the selected agent.
  • Embodiment 1 A method of identifying a compound that activates adenosine diphosphate (ADP)/ adenosine triphosphate (ATP) carrier (AAC), said method comprising:
  • Embodiment 2 The method of embodiment 1, further comprising determining whether said compound induces proton current across a cell plasma membrane.
  • Embodiment 3 The method of embodiment 1, further comprising determining whether said compound induces proton current across a cell plasma membrane at micromolar concentrations or less.
  • Embodiment 4 The method of one of embodiments 1 to 3, wherein said mitochondrial-containing cell is an intact myocyte C2C12 cell.
  • Embodiment 5 The method of one of embodiments 1 to 4, wherein the measuring of said ACC current is accomplished using a mitochondrial patch-clamp method.
  • Embodiment 6 The method of one of embodiments 1 to 5, wherein said compound activates proton current via AAC at the concentration of about 1 nM to 100 mM.
  • Embodiment 7. The method of one of embodiments 1 to 6, wherein said compound activates proton current via AAC at the concentration of about 1 to 5 mM.
  • Embodiment 8 The method of one of embodiments 1 to 7, wherein said protonatable group is located proximal to amino acid residues E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in said AAC fatty acid binding site or amino acid residues E29, K32, Y186, G224, S227, D231, R234, or R235 in said AAC aromatic binding site, when performing said docking.
  • Embodiment 9 A method of treating a metabolic disorder in a subject in need thereof, said method comprising administering to said subject an effective amount of an AAC proton leak inducing agent.
  • Embodiment 10 The method of embodiment 9, wherein said AAC proton leak inducing agent binds within the AAC fatty acid binding site.
  • Embodiment 11 The method of embodiment 9 or 10, wherein said AAC proton leak inducing agent contacts amino acid residues E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 within said AAC fatty acid binding site.
  • Embodiment 12 The method of embodiment 9, wherein said AAC proton leak inducing agent binds within the AAC aromatic binding site.
  • Embodiment 13 The method of embodiment 12, wherein said AAC proton leak inducing agent contacts amino acid residues E29, K32, Y186, G224, S227, D231, R234, or R235 within said AAC aromatic binding site.
  • mice were maintained on a standard rodent chow diet under 12-h light and dark cycles. All animal experiments were performed with male mice according to procedures approved by the UCSF Institutional Animal Care and Use Committee.
  • B6.129-UcpltmlKz/J mice (abbreviated l ICP G )
  • B6.129S4-Ucp2tmlLowl/J mice (abbreviated l ICP 2 )
  • B6;129S4-Ucp3tmlLowl/J mice abbreviated UCP3 mice
  • the Ant2SIBN 129/B6 mice (abbreviated AAC2 hypom orphic) were provided by the laboratory of Dr. Naohiro Terada (Cho et al, supra), and AAC1 -deficient mice on C57BL/6J2z background were obtained from the laboratory of Dr. Douglas Wallace (Graham et al, supra). Chemicals
  • arachidonic acid sodium salt (AA, SIGMA A8798), palmitic acid (PA, SIGMA P0500), sodium dodecanoate (LA, SIGMA L9755), carboxyatractyloside potassium salt (CATR, SIGMA 4992), Bongkrekic acid triammonium salt (BKA, Millipore 203671), guanosine 5 '-diphosphate tris salt (GDP, SIGMA G7252), adenosine 5'- diphosphate sodium salt (ADP, SIGMA A2754), adenosine 5 '-triphosphate disodium salt hydrate (ATP, SIGMA A6419), m ethyl -b-cyclodextrin (Mbq ⁇ , SIGMA C4555), mersalyl acid (SIGMA M9784), arachidonic acid sulfonate sodium salt (AA-sulf, CAYMAN 9001886)
  • mice were sacrificed by CO2 asphyxiation followed by cervical dislocation.
  • SM brown fat, kidney, and liver
  • the selected mouse tissues were isolated, rinsed, and homogenized in ice-cold medium containing 250 mM sucrose, 10 mM HEPES, 1 mM EGTA, and 0.1% bovine serum albumin (BSA) (pH adjusted to 7.2 with Trizma® base) using a glass grinder with six slow strokes of a Teflon pestle rotating at 275 (soft tissues) or 600 (fibrous tissues) rotations per minute.
  • BSA bovine serum albumin
  • the homogenate was centrifuged at 700 x g for 5-10 min to pellet nuclei and unbroken cells.
  • the first nuclear pellet was resuspended in the same solution and homogenized again to increase the yield of mitochondria. Mitochondria were collected by centrifugation of the supernatant at 8,500 x g for 10 min.
  • Mitoplasts were produced from mitochondria using a French press. Briefly, mitochondria were suspended in a solution containing 140 mM sucrose, 440 mM D-mannitol, 5 mM HEPES, and 1 mM EGTA (pH adjusted to 7.2 with Trizma® base) and then subjected to a French press at 1200- 2,000 psi to rupture the outer membrane. Mitoplasts were pelleted at 10,500 x g for 15 min and resuspended for storage in 500 pi of solution containing 750 mM KC1, 100 mM HEPES, and 1 mM EGTA (pH adjusted to 7.2 with Trizma® base).
  • Mitochondria and mitoplasts were prepared at 0- 4 °C and stored on ice for up to 5 h. Immediately before the electrophysiol ogical experiments, 15-50 pi of the mitoplast suspension was added to 500 m ⁇ solution containing 150 mM KC1, 10 mM HEPES, and 1 mM EGTA (pH adjusted to 7.0 with Trizma® base) and plated on 5-mm coverslips pretreated with 0.1% gelatin to reduce mitoplast adhesion. Nearly all AAC molecules in isolated mitoplasts were initially in the c-state (see Fig. 1 A and 3E). A likely explanation for this initial c- state is the presence of endogenous adenine nucleotides in the matrix and not in the isolation media during mitochondria/mitoplast isolation.
  • AA was selected as the I H activator, because this polyunsaturated FA is a principal product of membrane phospholipid hydrolysis (Burke & Dennis, J lipid Res 50 Suppl, S237-242, 2009). In the absence of significant cytosolic triglyceride storage in non-adipose tissues, membrane phospholipid hydrolysis may be an important source of free FA for/ // activation in vivo (Fedorenko et al, supra ; Gadd etal, supra). To record UCP1 currents, before the application of AA, the endogenous membrane FA were removed by a 30-40s pre-treatment with 10 mM MpCD (Fedorenko et al, supra). Low pH 6.0 was employed in some UCP1 experiments to further suppress production of endogenous FA in brown fat mitoplasts (Fedorenko et al, supra).
  • Mitochondrial respiration on isolated heart mitochondria [0105] Mitochondria were isolated from WT and AACl ⁇ hearts (5 months old, 3-4 mice per genotype) as described above. The organelles were rinsed with a BSA-free isolation buffer (250 mM sucrose, 10 mM HEPES, 1 mM EGTA, pH adjusted to 7.2 with Trizma® base) to remove the BSA. Mitochondrial oxygen consumption rates (OCRs) were evaluated in heart isolated mitochondria using the Seahorse XF24 Analyzer (Seahorse Bioscience, Billerica, MA).
  • BSA-free isolation buffer 250 mM sucrose, 10 mM HEPES, 1 mM EGTA, pH adjusted to 7.2 with Trizma® base
  • the experiments were performed with respiratory buffer (sucrose 70 mM, mannitol 220 mM, potassium phosphate monobasic 10 mM, magnesium chloride 5 mM, HEPES 2 mM, EGTA 1 mM, glutamate 10 mM, and malate 2 mM) supplemented with 0.02% FA-free BSA.
  • respiratory buffer sucrose 70 mM, mannitol 220 mM, potassium phosphate monobasic 10 mM, magnesium chloride 5 mM, HEPES 2 mM, EGTA 1 mM, glutamate 10 mM, and malate 2 mM
  • Mitochondrial protein was quantified using Bradford protein assay. 5 pg of mitochondrial proteins per well were used.
  • the mitochondrial respiration was measured before any addition (basal), then after addition of 4 pg/ml oligomycin (Oligo), followed by 50 pM or 100 pM palmitic acid (PA) or respiration buffer to study the H + leak, and then after addition of 0.1 pM FCCP to induce maximal respiration. Finally, 1 pM rotenone was applied to inhibit mitochondrial respiration. In each experiment, 2-3 wells were left unseeded for the collection of background measurements. Each experimental condition was applied to 3-4 wells per plate and repeated over 3-4 days (independent mitochondrial isolation).
  • Basal respiration was measured at three consecutive time points; the effect of oligomycin was measured at two consecutive time points; the effect of FA was measured at nine consecutive time points (30 min total); and the effects of FCCP and rotenone were measured at one or two consecutive time points.
  • the OCRs immediately after the addition of PA and after 30 min are reported.
  • the C2C12 cell line was purchased from ATCC (https://www.atcc.org/) and cultured in complete Dulbecco’s Modified Eagle Medium (DMEM; DMEM with 25 mM Glucose, 10% fetal bovine serum [FBS], penicillin and streptomycin antibiotics).
  • DMEM Modified Eagle Medium
  • FBS fetal bovine serum
  • the AACl AAC2 DKO cells were generated by Alstem LLC (http://www.alstembio.com/) using the Crispr-Cas9 system.
  • Transfection of gRNA Cas9 plasmids was performed using the Invitrogen Neon transfection system. gRNA candidates were selected via PCR amplification and selected for single-cell clone isolation.
  • DKO cells were glycolytic (Fig. 15H)
  • growing them in a low-glucose medium would put DKO cells at a significant disadvantage as compared to WT cells, effectively resulting in vastly different growing conditions for the two cell lines. Therefore, the same growth medium containing 25 mM glucose was used for both for WT and DKO cells.
  • C2C12 cells were seeded on 2-cm diameter coverslips in a multi-well plate. For immunostaining, cells were fixed in 3.7% paraformaldehyde for 20 min at 37°C and permeabilized in 0.5% Triton X-100 for 10 min at room temperature.
  • C2C12 cells (WT or DKO) from ten 15-cm dishes were trypsinized and harvested with ice- cold PBS at 1,000 g for 5 min. The cell pellet was incubated with hypotonic buffer (20 mM HEPES, pH 7.5, 5 mM KC1, 1.5 mM MgCh, and 1 mg/ml essentially FA- free BSA) on ice for 10 min.
  • hypotonic buffer (20 mM HEPES, pH 7.5, 5 mM KC1, 1.5 mM MgCh, and 1 mg/ml essentially FA- free BSA
  • Cells were then homogenized (25 strokes) using a tight-fitting glass dounce tissue grinder and rapidly made isotonic by adding the homogenate to 2/3 volume of 2.5x MSH (20 mM HEPES, pH 7.5, 525 mM mannitol, 175 mM sucrose, 5 mM EDTA, and 1 mg/ml essentially FA-free BSA).
  • the homogenate was centrifuged at 600 x g for 10 min, and the supernatant was then centrifuged at 8,500 x g for 10 min to pellet mitochondria.
  • Mitochondria were resuspended in MSH buffer (20 mM HEPES, pH 7.5, 210 mM mannitol, 70 mM sucrose, and 2 mM EDTA). Mitochondrial protein was quantified using the bicinchoninic acid assay (Thermo Fisher Scientific).
  • Respiration buffer (20 mM Tris, pH 7.4, 210 mM mannitol, 70 mM sucrose, 0.1 mM EGTA, 3 mM MgCh, 5 mM KH2PO4, 0.1% essentially FA-free BSA, 10 mM sodium pyruvate, and 5 mM malate
  • the OCRs were recorded using a mix (20 s) and measure (2 min) cycle.
  • FCCP was added at 10 mM (isolated mitochondria).
  • Gramicidin A was added at IOmM.
  • GCCAGCCTCTCCTGATTTTAGTGT-3’ (SEQ ID NO. 1) and reverse primers REV: 5’- GGGAACAC AAAAGACCTCTTCTGG-3 ’ (SEQ ID NO. 2)) and one mtDNA target (NDl forward FWD: 5 ’ -CTAGC AGAAAC AAACCGGGC-3 ’ (SEQ ID NO. 3) and reverse primers REV: 5’- CCGGCTGCGTATTCTACGTT-3 ’ (SEQ ID NO. 4)).
  • Lysates were resolved by SDS-PAGE; transferred to PVDF membrane (Millipore); and probed with anti-Na + /K + -ATPase antibody (Abeam, ab76020), anti-TOM20 (Santa Cruz, sc-11415), OXPHOS cocktail (Abeam, abl 10413), anti-AACl (ab 102032) and anti-AAC2 (CST 1467S).
  • Mitochondrial uncoupling is potentiated by both mitochondrial hyperpolarization and ROS, which serve as a negative feedback mechanism for mitochondrial ROS production (Korshunov et al, FEBS LETT 416, 15-18, 1997; Echtay etal, Nature 415, 96-99, 2002; Echtay et aI.,EMBO J 22, 4103-4110, 2003; Parker et al, Biochem J 412, 131-139, 2008). Accordingly, the current-voltage relationship of the AAC-dependent I H was non-linear, with I H increasing sharply with membrane hyperpolarization (Fig. IE and IF).
  • tBHP /cvV-butyl hydroperoxide
  • TBT tributyltin
  • 4-HNE 4-hydroxynonenal
  • AAC1 and AAC2 are the only somatic isoforms (Rodic et al, Stem Cells 23, 1314- 1323, 2005; Levy et al, Gene 254, 57-66, 2000). AAC1 expression is highest in heart and SM, and AAC2 - in kidney (Levy, supra ; Cho et al, Cell Death Differ 22, 1437-1450, 2015). In heart of AAC1 mice (Graham et al, Nat Genet 16, 226-234, 1997; Morrow et al, PNAS Sci USA 114, 2705-2710, 2017), AA failed to induce I H at negative potentials in all mitoplasts tested except one (Fig. 2a).
  • I H reduction was also drastic in A ACC SM (Fig. 2B), with some mitoplasts having no I H , while the remaining I H in others was still inhibited by CATR, suggesting AAC2 involvement (Fig. 2B, 111 and 11 J).
  • I H in kidney where AAC1 expression is low (Levy et al, supra) was not significantly affected in AACl ⁇ and remained CATR-sensitive (Fig. 2C).
  • I H was not significantly altered in heart or kidney of AAC2 hypomorphic mice (Levy et al, supra)) (Fig. 11 A and 1 IB), and was CATR-sensitive likely due to compensation with AAC1 (Levy et al, supra)) (Fig. 11 A and 1 IB).
  • AAC1 plays a crucial role in I H , at least in heart and SM.
  • the recording of a CATR-sensitive I H in SM and kidney of AACT ⁇ mice suggests that AAC2 is capable of mediating IH.
  • I H activation requires FA binding within the translocation pathway (Fedorenko et al, supra).
  • the FA binding is facilitated by a longer carbon chain and higher FA hydrophobicity (Fedorenko et al, supra ; Bertholet etal, Biochimie 134, 28-34, 2017).
  • the protonatable carboxylic group of the FA located within the translocation pathway enables H + transport.
  • Nonprotonatable low-pKa FA analogs (such as alkylsulfonales) inhibit / // by competing with FA for binding to UCP1 (Fedorenko et ah, supra ; Bertholet et al, supra).
  • Purine nucleotides, blockers of the UCP1 translocation pathway abolish / // via UCP1 (Fedorenko et al, supra ; Bertholet et al, supra)..
  • UCP1 transport both, H + and FA, and operates as a FA anion/H + cotransporter (Fedorenko et al, supra ; Bertholet etal, CellMetab 25, 811-822, 2017; Bertholet et al, supra ;
  • AA-sulf long-chain alkyl sulfonates
  • AA-sulf long-chain alkyl sulfonates
  • FIG. 13 A AAC currents associated with the exchange of Mg 2+ -free ADP and ATP were recorded.
  • AAC has two transport modes: the electrogenic ADP/ ATP exchange that relies on the c-m conformational change (Fig. 13 A) and I H that is activated by cytosolic FA independently of the AAC conformation (Extended Data Fig. 12G).
  • I H via AAC is reduced, but not fully inhibited, by adenine nucleotide exchange.
  • the two transport modes of AAC appear to compete and likely occur via overlapping translocation pathways.
  • Mitochondria of various tissues possess phospholipase A2 activity (Fedorenko etal, supra , Bertholet etal, supra ; Gadd et al, J Biol Chem , 281, 6931-6939, 2006; Kinsey et al, Am J Physiol Renal Physiol 292, F853-F860, 2006), which may be the primary physiological source of FA for AAC-dependent/ //.
  • AAC With AAC, E is negatively regulated by ADP/ATP exchange, whereas with UCP1, E is simply inhibited by cytosolic adenine nucleotides. This ability to dynamically adjust E in accordance with ADP/ATP exchange (and thus cellular ATP demand) could make AAC uniquely suited to be the UCP of mitochondria that specialize in ATP production. Thus, AAC appears to serve as a master regulator of mitochondrial energy output, maintaining a delicate balance between ATP production and thermogenesis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Provided, inter alia, are methods and compositions for treating a metabolic disorder and methods of identifying a compound that activates adenosine diphosphate/adenosine triphosphate carrier.

Description

METHODS AND COMPOSITIONS FOR TREATING METABOLIC DISORDERS
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0001] This invention was made with government support under grants no. R01 GM089740 and R01 GM118931 awarded by The National Institutes of Health. The government has certain rights in the invention.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM LISTING APPENDIX SUBMITTED AS AN ASCII FILE
[0002] The Sequence Listing written in file 048536-659001WO_SequenceListing_ST25.txt, created July 21, 2021, 5,021 bytes, machine format IBM-PC, MS Windows operating system, is hereby incorporated by reference.
BACKGROUND
[0003] The mitochondrial ADP/ATP carrier (AAC) is a major transport protein of the inner mitochondrial membrane (IMM). It exchanges mitochondrial ATP for cytosolic ADP and controls cellular ATP production. There are two distinct transport modes of ACC: ADP/ATP exchange and H+ transport. The AAC -mediated H+ current requires free fatty acids and resembles the H+ leak via the thermogenic uncoupling protein 1 of brown fat. The ADP/ATP exchange via AAC negatively regulates the H+ leak, but does not induce complete inhibition. This suggests that the H+ leak and mitochondrial uncoupling could be dynamically controlled by cellular ATP demand and the rate of ADP/ATP exchange. By mediating two distinct transport modes, ADP/ATP exchange and H+ leak, AAC intimately connects coupled (ATP production) and uncoupled (thermogenesis) energy conversion in mitochondria.
[0004] There are four human AAC isoforms, AAC1-AAC4 (AAC4 is specific to germ cells and pluripotent stem cells) (Klingenberg, M., Biochim Biophys Acta 1778, 1978-2021,(2008); Stepien, G. et al., J Biol Chem 267, 14592-14597 (1992), Rodic, N. et al. Stem Cells 23, 1314-1323 (2005)). Mice lack AAC3 (Levy, S. E. et al., Gene 254, 57-66 (2000); Graham, B. H. et al. Nat Genet 16, 226-234, (1997)). AAC operates by the alternating access mechanism with a single substrate binding site (SBS) intermittently exposed to either cytosolic (c-state) or matrix (m-state) side of the IMM (Klingenberg, supra , Ruprecht, J. J. et al. , Cell, (2019). Additionally, two other roles, in mitochondrial uncoupling (Andreyev, A. et al, FEBS lett 226, 265-269 (1988); Skulachev, V. P. Biochim Biophys Acta - Bioenergetics 1363, 100-124, (1998); Brustovetsky, N. & Klingenberg, M., J Biol Chem 269, 27329-27336 (1994); Brand, M. D. et al.. Biochem J 392, 353-362, (2005)) and the permeability transition pore (PTP) (Halestrap, A. P. & Richardson, A. P., JMol Cell Cardiol , (2014); Bemardi, P. et al., Physiol Rev 95, 1111-1155, (2015) have been proposed for AAC.
[0005] Uncoupling proteins (UCPs) mediate H+ leak (///) across the IMM. IH uncouples the H+ flows via electron transport chain and the ATP synthase to reduce efficiency of ATP production and cause mitochondrial thermogenesis. IH also decreases reactive oxygen species (ROS) production, protecting mitochondrial integrity (Skulachev, supra ; Korshunov, S. S. et al., FEBS lett 416, 15-18 (1997)). IH via UCPs is activated by free long-chain fatty acids (FA) (Wojtczak, L. & Schonfeld, P., Biochim Biophys Acta 1183, 41-57 (1993). It was suggested that all ~50 members of the SLC25 superfamily of mitochondrial solute carriers can contribute to IH (Roussel, D., et al. , J Bioenerg Biomembr 34, 165-176 (2002), most notably the close UCP1 homologs UCP2 and UCP3 (Echtay,
K. S., et al., Proc Natl Acad Sci U S A 98, 1416-1421, (2001); Jaburek, M. et al. J Biol Chem 274, 26003-26007 (1999); Krauss, S., et al., Nat Rev Mol Cell Biol 6, 248-261 (2005)), AAC (Andreyev, supra ; Skulachev, supra ; Brustovetsky, supra), aspartate-glutamate carrier (Skulachev, supra, Samartsev, V. N. etal. Biochim Biophys Acta - Bioenergetics 1319, 251-257, (1997), dicarboxylate carrier (Skulachev, supra, Wieckowski, M. R. & Wojtczak, L., Biochem Biophys Res Commun 232, 414-417, (1997), and phosphate carrier (Zackova, M., et al., IntJ Biochem Cell Biol 32, 499-508 (2000); Engstova, H. et al, J Biol Chem 276, 4683-4691, (2001)). IH may also occur through the lipid phase without protein involvement (Gutknecht, J., J Membr Biol 106, 83-93 (1988)). With so many proposed IH pathways, the molecular mechanisms of mitochondrial uncoupling remains unclear.
[0006] Thus, mitochondrial H+ leak and thermogenesis represent valuable therapeutic targets for treating diseases mediated by energy expenditure. The compounds capable of increasing H+ leak and mitochondrial thermogenesis through binding to AAC are needed to realize a therapeutic effect of these targets. BRIEF SUMMARY
[0007] Provided herein, inter alia , are methods and compositions for treating a metabolic disorder. In one aspect, provided herein is a method of identifying a compound that activates adenosine diphosphate (ADP)/ adenosine triphosphate (ATP) carrier (AAC), said method comprising docking a test compound in a AAC fatty acid binding site or an AAC aromatic binding site to evaluate a binding capacity of said compound to a FA binding site or an aromatic binding site of AAC in the inner mitochondrial membrane; combining a mitochondrial-containing cell and said test compound in a reaction vessel and measuring a decrease or increase in mitochondrial respiration in said mitochondrial-containing cell; and combining an inner mitochondrial membrane (IMM) with said test compound and measuring an AAC current to determine whether said test compound (i) inhibits ADP/ ATP exchange or (ii) activates proton current through AAC, thereby identifying said test compound as a compound that activates AAC. The method further includes determining whether said compound induces proton current across a cell plasma membrane.
[0008] In another aspect, provided herein is a method of treating a metabolic disorder in a subject in need thereof, said method comprising administering to said subject an effective amount of an AAC proton leak inducing agent. The method further comprising binding of said AAC proton leak inducing agent within the AAC binding site.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0010] Figs. 1A-1F. Pharmacological and biophysical properties of IH. lA: IH induced by 2 mM AA (red) was inhibited by 1 mM CATR (blue) in SM (n=22), heart (n=18), kidney (n=4), and liver (n=7) mitoplasts. Right panel: IH current densities at -160 mV in SM (n=56), heart (n=67), kidney (n=8), and liver (n=13) . Data represent mean±SEM. IB: Representative recording from SM (upper panel, n=5) and heart (lower panel, n=4) mitoplasts pre-treated with 50 pM mersalyl. IH induced by 2 pM AA (red) was inhibited by 1 pM CATR (blue). 1C: UCP1 -dependent IH induced by 2 pM AA (red) in brown fat mitoplast (n=3) was inhibited by 1 mM GDP (blue). ID: Densities of AAC and UCP1 IH induced by 2 pM AA at -160 mV in SM (n=56) and brown fat (n=3). Data represent mean±SEM. IE: Representative IH induced by 2 mM AA at different membrane voltages. Heart mitoplasts, n=4. IF : Current-voltage (EV) curve of IH based on data in (e). Data are mean±SEM.
[0011] Figs. 2A-2C. AAC is required for IH. Representative currents induced by 2 mM AA in WT and AAOGA mitoplasts of heart (2A), SM (2B), and kidney (2C). Right panels: IH current densities at -160 mV for WT and AAC1 A mitoplasts. All AAC1 A experiments used the same WT control as in Fig. 1A. Heart: WT, n=67 and AACL' n=ll. SM: WT, n=56 and AACl^, n=14. Kidney: WT, n=13 and AAOGa, n=6. Mann-Whitney test, two-tailed. Data are mean±SEM.
[0012] Figs. 3A-3E. Adenine nucleotide transport by AAC. 3A, Left panel: AAC current before (control, black) and after (red) addition of 5 mM ADP to the bath solution. Pipette solution contained 5 mM ATP. Subsequent addition of 5 mM CATR (blue) inhibited ADP/ ATP exchange. Right panel. The same experiment performed in A ACL mitoplasts. Heart mitoplasts, n=7 (WT), and n=4 (AACLa). 3B: AAC current before (control, black) and after (red) addition of 5 mM ATP to the bath solution. Pipette solution contained 5 mM ADP. Subsequent addition of 5 mM CATR (blue) inhibited ADP/ ATP exchange. Heart mitoplasts, n=5. 3C: Current before (control, black) and after (red) addition of 5 mM ADP to the bath solution. Pipette solution contained 5 mM ADP. Heart mitoplasts, n=3. 3D: Densities of the ADP/ ATP exchange current in WT (n=7) and A ACL (n=4) heart mitoplasts, measured at -160 mV in (a). Mann-Whitney test, two-tailed. Data represent mean±SEM. 3E: IH activated by 2 mM AA before (red) and after (blue) addition of 1 mM CATR to bath (SM mitoplast). The mitoplast was pretreated with 1 mM ADP just before AA application.
Heart and SM mitoplasts, n=7.
[0013] Figs. 4A-4E. Nucleotide exchange negatively regulates IH. 4A, Left panel: IH induced by 2 mM AA (1), followed by a transient inhibition by 1 mM of bath ADP (2), and subsequent recovery (3). SM mitoplast. Right panel: IH time course of left panel. IH was measured at -160 mV. The experiment was repeated with the similar result (n=7) in heart and SM mitoplasts. 4B, Left panel: IH activated by 2 mM AA (red) was inhibited by addition of 1 mM ADP to bath. Pipette solution contained 1 mM ADP. Heart mitoplast. Right panel: IH time course of the left panel. The experiment was repeated with the similar result (n=9) in heart and SM mitoplasts. 4C: ADP inhibition of IH in points 2 and 3 as in (a). Heart and SM mitoplasts, n=7. Paired t-test, two-tailed. Data are mean±SEM. 4D: ADP inhibition of IH in point 2 as in (b). Heart and SM mitoplasts, n=9. Paired t- test, two-tailed. Data are mean±SEM. 4E: Mean densities of IH via UCP1 (dark grey) and AAC (light grey) in control (n=l 1, UCP1; n=9, AAC) and in the presence of 100 mM (n=5, UCP 1 ; n=8, AAC) and 1 mM ADP (n=3, UCP1; n=8, AAC). IH was measured as in Figs. 14E and 14F. Brown fat and heart mitoplasts. Data are mean±SEM.
[0014] Figs. 5A-5E. Mitochondrial uncoupling requires AAC. 5A: OCR of isolated heart mitochondria of WT (left panel) and AACl f mice (right panel) normalized to the basal value. Arrows indicate addition of oligomycin (Oligo) and either palmitic acid (PA: 50 mM, light orange, n=5 for WT, n=3 for AAC 1 _/ ; and 100 mM, dark orange, n=4 for WT, n=3 for AACl ) or buffer (black, n=5 for WT, n=3 for AAC 1 ' ). Each n corresponds to independent mitochondrial isolations (also see Methods). The effect of the PA was recorded upon addition (tO) and 30 min later (t30). Paired t-test, two-tailed. **no FA ( =0.0009) vs 50 pM PA; #no FA vs 100 pM (P=0.0183). Data represent mean±SEM. 5B: OCR of mitochondria isolated from WT (black) and DKO (grey) C2C12 cells before (basal, oligomycin added; n=50 for WT, and n=47 for DKO) and after addition of gramicidin A (n=40 for WT and n=30 for DKO). Each n corresponds to individual respiration wells. Mann-Whitney test, two-tailed. Data represent mean±SEM. 5C: OCR of mitochondria from WT (grey, n=20 wells) and DKO (white, n=16 wells) C2C12 cells before (basal) and after sequential addition of increasing concentrations of PA, followed by FCCP. All OCR values were normalized by basal OCR. Mann-Whitney test, two-tailed. Data represent mean±SEM. 5D: OCR of WT (black, n=22 wells) and DKO (grey, n=22 wells) C2C12 cells before (basal) and after addition of oligomycin. Mann-Whitney test, two-tailed. Data represent mean±SEM. 5E: OCR of WT (grey, n=20 wells) and DKO (white, n=19 wells) C2C12 cells in the presence of oligomycin and after sequential addition of increasing concentrations of PA. All OCR values were normalized by the OCR with oligomycin. Mann-Whitney test, two-tailed. Data represent mean±SEM. The growth medium for WT and DKO cell contained 25 mM glucose.
[0015] Figs. 6A-6D. FA-dependent IH in the IMM and plasma membrane. 6A, Left panel· a diagram of patch-clamp recording from a vesicle of the whole IMM (mitoplast). After forming a gigaohm seal between the patch pipette and the mitoplast, the IMM patch under the pipette is broken by applying short pulses of high voltage (200-500 mV, 5-30 ms) combined with light suction to gain access into the mitoplast through the pipette. In this configuration, called the “whole-mitoplast” configuration, the interior of the mitoplast (mitochondrial matrix) is perfused with the pipette solution. The bath is also perfused to control the experimental solution on the cytosolic side of the IMM. The voltage across the IMM is set using the patch-clamp amplifier. Directions of currents flowing across the IMM: inward currents (flowing into the mitoplast) are negative, while outward currents are positive. Right panel: an example of a ///current trace recorded in the whole-mitoplast mode. The voltage protocol used to induce the currents is shown above. All indicated voltages are within the mitochondrial matrix relative to the bath (cytosol). The voltage of the bath solution is defined to be zero. Baseline (zero current level) as well as negative (inward) and positive (outward) currents are indicated. 6B: ///induced in a SM mitoplast by 1.5 mM (IMM, upper panel, n=l 1) or 15 mM (IMM, lower panel, n=3) AA. Voltage protocol is shown above the traces. Bath (cytosolic side of the IMM) and pipette (matrix side) pH are indicated in the pipette-mitoplast diagram. 6C: Same experiment performed in the plasma membrane (PM, n=4 at 1.5 pM, n=4 at 15 pM) of HEK293 cells. 6D: ///densities in the IMM of SM and PM of HEK293 cells at 1.5 (n=l 1 for IMM, n=4 for PM) and 15 pM A A (n=3 for IMM, n=4 for PM) ///measured at -160 mV. Data represent mean±SEM.
[0016] Figs. 7A-7E. UCPl-independent IH in various mouse tissues. 7A: ///induced in mitoplasts of heart (n=6), liver (n=5), and brown fat (IICPI- - ice, n=6) by application of 1.5 pM AA on the cytosolic side of the IMM. Voltage protocol is shown above the traces. Bath and pipette pH are indicated in the pipette-mitoplast diagram. 7B: ///induced in mitoplasts of skeletal muscle (SM) of wild-type (WT, n=7), UCP2-/- (n=8), and UCP3-/- (n=l 1) mice by application of 1.5 pM AA on the cytosolic side of the IMM. 7C: ///densities in SM mitoplasts of WT (n=7), UCP2-/- (n=8), and UCP3-/- (n=l 1) mice, measured at -160 mV as in (b). Data represent mean±SEM. 7D:
Representative SM mitochondrial ///induced by 1.5 pM AA before (red) and after application of 1 mM GDP (blue) (n=4). 7E: Mitochondrial ///recorded in the absence of added FA (control, black) was deactivated by addition of 10 mM Mbqϋ to the bath (n=10).
[0017] Figs. 8A-8D. H+ selectivity of mitochondrial IH 8A, Left panel , representative mitochondrial IH recorded at □ pH = 1 in response to the voltage step protocol indicated at the top (SM mitoplast, n=6); □ V = 40 mV. A holding potential of -60 mV (close to the EH) was selected to minimize H+ current and depletion of the proton buffer between applications of voltage steps. A zero current level is indicated by the red dotted line. Right panel, the EV curve corresponding to the current traces in the left panel (SM mitoplast, n=6). Note the reversal potential. The pH values in the pipette and bath solutions are indicated on the diagram. 8B, Left panel, mitochondrial IH recorded at □ pH = 1.5 in response to the voltage step protocol indicated at the top of the panel (SM mitoplast, n=3); □ V = 60 mV. Holding potential was -90 mV (close to the EH). Right panel, the EV curve corresponding to the current traces in the left panel (SM mitoplast, n=6). 8C, Left panel, mitochondrial IH recorded at DpH = -0.5 in response to the voltage step protocol indicated at the top of the panel (SM mitoplast, n=4); □ V = 40 mV. Holding potential was 0 mV. Right panel, the I/V curve corresponding to the current traces in the left panel. All currents were induced by 1.5 mM AA (SM mitoplast, n=6). 8D: ///reversal potentials (Vrev) compared to Nernst H+ equilibrium potentials (EH). Linear fitting of Vrev (red) and EH at 24°C (black) vs. transmembrane ApH; pH 6/7, n=6; pH 6/7.5, n=3; pH 6.5/6, n=4. SM mitoplasts. Data represent mean±SEM.
[0018] Figs. 9A-9L. AAC-dependent and -independent currents induced by FA. 9A: Current induced by 4 pM palmitic acid (PA, red) was inhibited by 1 pM CATR (blue). Control current is shown in black. Representative experiments performed in heart mitoplasts, n=4. 9B: The same experiment performed with 100 pM lauric acid (LA), n=5. 9C: Upper panel, currents induced by 22 pM of AA (green), PA (blue), and LA (red) in the same mitoplast. Control current is shown in black. Heart mitoplasts, n=4. Lower panel, mean ///current densities at -160 mV induced by 2 pM of AA (n=6), PA (n=7), and LA (n=4) as in experiment shown in the upper panel. Heart mitoplasts. Data represent mean±SEM. 9D, Left panel: ///induced by 2 pM AA (red) was inhibited by 4 pM BKA (blue). Control currents are shown in black. Representative experiment performed in a heart mitoplast (n=4). Right panel: inhibition of ///induced by 2 pM AA in heart mitoplasts by 4 pM BKA. Remaining ///measured at -160 mV is shown as a percentage of control, n=4. Paired t-test, two-tailed. Data represent mean±SEM. 9E: Current induced by 2 pM AA sulfonate before (red) and after (blue) addition of lpM CATR. Representative experiment performed in heart mitoplast. n=6. 9F: Current induced by 2 pM AA sulfonate before (red) and after (blue) addition of 50 pM mersalyl. Representative experiment performed in a heart mitoplast. n=4. 9G: Currents induced by 2 pM AA before (red) and after (blue) addition of 50 pM mersalyl. Note that only the outward current was inhibited. Representative experiment performed in a heart mitoplast. n=6. 9H: The outward current activated by 2 pM AA (red) is inhibited by 50 pM mersalyl (blue) and is next recovered by 1 mM DTT (green). Control current is shown in black. Heart mitoplasts, n= 4. 91: Whole-mitoplast current before (control, black), after application of 2 pM AA (red), and upon washout of AA (blue). Heart mitoplasts, n=6. 9J: ///induced by 2 pM AA (red) was inhibited by 1 pM CATR (blue). Control current is shown in black. Symmetrical pH 6.0. Heart mitoplasts, n=4. 9K: Inhibition of the inward ///induced by 2 pM AA in SM, heart, liver, and kidney by 1 pM CATR. SM (n=22), heart (n=18), liver (n=4), and kidney (n=7) for both control and CATR treatment. Remaining inward current measured at -160 mV is shown as a percentage of control. Paired t test, two-tailed. Data represent mean±SEM. 9L: Inhibition of the outward current induced by 2 pM AA in SM, heart, liver, and kidney by 1 mM CATR. Remaining outward current measured at +100 mV is shown as a percentage of control. SM (n=21), heart (n=17), liver (n=4), and kidney (n=7) for both control and CATR treatment. Paired t-test, two-tailed. Data represent mean±SEM.
[0019] Figs. 10A-10F. FA-dependent/i/via AAC is potentiated by oxidation. 10A, 10C,10E:/// activated by 2 mM AA (red) was then potentiated by oxidizers 250 mM tBHP, 100 pM 4-HNE, or
[0020] 20 pM TBT (blue) ///potentiated by oxidizers was inhibited by CATR (green). Control current is
[0021] shown in black. Bar graphs show ratio of ///amplitudes at -160 mV before and after addition of
[0022] oxidizer. Heart mitoplasts. Note that TBT and 4-HNE, but not tBHP, inhibited the AACindependent
[0023] outward current observed at positive membrane potentials. Panel (a) n=4, panel (c) n=3, and panel (e) n=5 for all experimental conditions. Paired t-test, two-tailed. Data represent mean±SEM. 10B, 10D, 10F: currents before (control, black) and after (red) application of 250 pM tBHP (n=3),
20 pM TBT (n=3), and 100 pM 4-HNE (n=3).
[0024] Figs. 11A-11J. FA-dependent currents in AAC1 knockout and AAC2 hypomorphic mice. 11 A, 11B: Representative currents induced by 2 pM AA in WT and AAC 2 hypomorphic mitoplasts of heart (n=9 for WT and n=9 for hypo) (a) and kidney (n=4 for WT and n=5 for hypo) 11B, Right panels: ///current densities at -160 mV for WT (n=10 for heart and n=5 for kidney) and AAC2 hypomorphic mitoplasts (n=10 for heart and n=6 for kidney). Data are mean±SEM. 11C-11E: Densities of the outward current measured at +100 mV for WT and AAC1-/- mitoplasts of heart (n=14 for WT and n=10 for AAC !-/-), SM (n=21 for WT and n=12 for AAC 1-/2), and kidney (n=5 for WT and n=6 for AAC1-/-). Mann-Whitney test, two-tailed. Data are mean+SEM. 11F, 11G:
Densities of the outward current measured at +100 mV for WT (n=9 for heart and n=5 for kidney) and AAC2 hypomorphic (n=10 for heart and n=5 for kidney) mitoplasts of heart and kidney. Mann- Whitney test, two-tailed. Data are mean+SEM. 11H: Inhibition of the outward current induced by 2 pM AA in AAC1-/- heart mitoplasts by 1 mM CATR (n=5, control and CATR). Remaining outward current measured at +100 mV is shown as a percentage of control. Paired t-test, two-tailed. Data are mean+SEM. Ill: Left panel: inhibition of inward ///induced by 2 pM AA in AACl- - SM mitoplasts by 1 mM CATR (n=10, control and CATR). Remaining ///measured at -160 mV is shown as a percentage of control. Right panel: inhibition of the outward current induced by 2 mM AA in in AAC1-/- SM mitoplasts by 1 mM CATR (n=9, control and CATR). Remaining current measured at +100 mV is shown as a percentage of control. Paired t-test, two-tailed. Data are mean±SEM. 11 J: Two representative experiments in which the ///induced by 2pM AA in AACl-/- mitoplasts of SM was the smallest (left panel, n=4) and the largest (right panel, n=3). ///induced by 2 pM AA (red) was inhibited by 1 mM CATR (blue). Control current is shown in black.
[0025] Figs. 12A-12G. Interaction of FA anions with AAC. 12A: ///induced by 2 pM AA (red) was inhibited by 66+2% (n=4, SM mitoplasts) by 5 pM AA-sulf (blue). Data are mean±SEM. 12B: Current induced by 5 pM AA-sulf (left panel, red) or 1 pM AA (right panel, red) was inhibited by 1 pM CATR (blue). Control currents are shown in black. Smaller [AA] was used to induce comparable currents with AA-sulf. Heart mitoplasts, n=4. 12C and 12D: Currents recorded before (control, black) and after addition of 5 pM AA-sulf (c) or 10 mM C6-sulf (d) to bath (red). Brown fat mitoplast (UCP1, left panel), heart mitoplast (AAC, right panel), n=4 for each. Currents were measured at pH 6.0 to inhibit the production of FA by phospholipase A2 (PLA2) associated with the brown fat EMM and ensure that UCP1 currents were activated by exogenously applied FA anions only. 12E: Current before (control, black) and after (red) application of 50 mM C6-sulf to the bath. Pipette solution contained 50 mM C6-sulf. Symmetrical pH 6.0. Heart mitoplasts, n=3. 12F: Current before (control, black) and after (red) application of 5 pM AA-sulf to the bath. Pipette solution contained 10 pM AA-sulf. Bath AA-sulf was kept at 5 pM because higher concentrations disrupted the EMM. Symmetrical pH 6.0. Heart mitoplasts, n=3. 12G: Proposed model of FA-dependent///via AAC. Without FA, AAC is impermeable for H+(l). When FA binds in the AAC translocation pathway, its protonatable headgroup enables H+ binding and transport (2). FA can activate ///with AAC in either the c- or m-state (2 and 3). Because the SBS is positively charged and retains its structure with c-m conformational change, the negatively charged head of FA is likely to interact with the SBS, while the hydrophobic carbon tail may protrude into the membrane and/or be stabilized by hydrophobic interactions within AAC (2 and 3).
[0026] Figs. 13A-13G. Adenine nucleotide exchange by AAC. 13A: The alternating access mechanism of adenine nucleotide transport by AAC. AAC is shown in green, and its substrate binding site (SBS, overall positively charged) located in the middle of the membrane is shown in blue. Cytosolic ADP binds to AAC in the c-state (1). AAC transitions to the m-state, and ADP is released into the matrix (2 and 3). Matrix ATP binds to AAC in the m-state (4). AAC transitions to the c-state, and ATP is released into the cytosol (5). 13B: AAC current activated by 1 mM ADP (red) is inhibited by ImM CATR (blue). Pipette solution contained and 1 mM ATP. Heart mitoplast, n=3. Control trace is in black. 13C: Inhibition of the inward ADP/ ATP exchange current via AAC by 1 mM CATR. Heart mitoplast, n=6 (control and CATR treatment). Paired t-test, two-tailed. Data are mean±SEM. Remaining inward current measured at -160 mV is shown as a percentage of control. See also Fig. 3a. 13D: Inhibition of the outward ATP/ ADP exchange current via AAC by 1 mM CATR. Heart mitoplast, n=5 (control and CATR treatment). Paired t-test, two-tailed. Data are mean±SEM. Remaining outward current measured at -100 mV is shown as a percentage of control. See also Fig. 3b. 13E: Inhibition of the inward ///induced by 2 mM AA by 1 mM CATR after ADP pre-treatment. Heart mitoplast, n=7 (control and CATR treatment). Paired t-test, two-tailed. Data are mean±SEM Remaining ///measured at -160 mV is shown as a percentage of control. See also Fig. 3e. 13F: Current before (control, black) and after (red) addition of 2 mM AA to bath. Subsequent addition of 1 mM CATR (blue) inhibited IH. Pipette solution contained 4 mM AA. Heart mitoplast, n=4. 13G: Control current (black) and current after addition of 1 mM ADP to the bath solution (red). AA (2 mM) was added to the bath solution at the end of experiment (blue). Pipette solution contained 4 mM AA. Heart mitoplasts, n=4.
[0027] Figs. 14A-14F. Regulation of FA-dependent IH by nucleotides. 14A: Explanation of transient ///inhibition by cytosolic adenine nucleotides. AAC in c-state, with FA anion in the translocation pathway, mediates ///( 1). Cytosolic ADP3- binds in c-state and expels FA anion/blocks translocation pathway, leading to ///inhibition (2). Upon AAC conformation change, ADP dissociates into matrix (pipette) solution (3). FA anion re-associates with AAC in m-state, restoring ///( 4). Cytosolic ADP cannot inhibit ///while AAC is in m-state (5). See also Fig. 4 A. 14B:
Proposed mechanism of ///inhibition by adenine nucleotide exchange. AAC in c-state, with FA anion in the translocation pathway, mediates ///( 1). Cytosolic ADP3- binds in c-state and expels FA anion/blocks translocation pathway, leading to ///inhibition (2). The resultant continuous exchange of cytosolic and matrix adenine nucleotides inhibits FA anion binding and ///( 3, 4, and 5). ATP (and not ADP) is shown as a matrix adenine nucleotide to reflect physiological conditions. See also Fig. 4B. 14C: Remaining ///after inhibition by different concentrations of ADP applied to both sides of the EMM to induce continuous adenine nucleotide exchange via AAC as in (e). ADP/ ADP exchange was used to avoid contaminating ///with ADP/ATP exchange current. Heart and SM mitoplasts, n=5 (control and 10 mM ADP), n=8 (control and 100 mM ADP, n=9 (control and 1 mM ADP). Data are mean±SEM. 14D: ///via UCP1 is inhibited by 100 mM Mg2+-free ADP (upper panel, n=5) and 1 mM Mg2+-free ADP (lower panel, n=3). ///activated by 2 mM AA is shown before (red) and after inhibition by ADP (blue). In the beginning of the experiment, before the application of AA, the endogenous membrane FA were removed by a 30-40s pre-treatment with 10 mM Mbqϋ (black, control). All recording solutions contained 1 mM CATR to reduce AAC contribution to the IH measured. Pipette solution contained either 100 mM ADP (upper panel) or 1 mM ADP (lower panel) to match the recording conditions for AAC (e). Brown fat mitoplasts. 14E: ///via AAC is inhibited by 100 mM Mg2+-free ADP (upper panel, n=8) and 1 mM Mg2+-free ADP (lower panel, n=8). IH activated by 2 mM AA is shown before (red) and after inhibition by ADP (blue). Pipette solution contained either 100 mM ADP (upper panel) or 1 mM ADP (lower panel) to achieve symmetrical [ADP] on both side of EMM. Heart mitoplasts. 14F: Mean densities of ///via UCP1 (dark grey) and AAC (light grey) in control (brown fat, n=l 1 and heart, n=9) and in the presence of 100 mM (brown fat, n=5 and heart, n=8) and 1 mM ADP (brown fat, n=3 and heart, n=8) on both sides of the IMM. ///amplitudes were measured at -160 mV. The same data as in Fig. 4E. Data represent mean±SEM.
[0028] Figs. 15A-15H. Phenotypes associated with AAC deficiency. 15A: Representative OCRs of isolated heart mitochondria from WT (left panel, n=3 wells) and AAC1-/- mice (right panel, n=4 wells). As indicated by the arrows, first oligomycin and then either palmitic acid (PA: 50 mM, light orange and 100 mM, dark orange) or buffer (black) were added, following by FCCP and rotenone. Higher PA concentrations were used than those for electrophysiological experiments, because in suspensions of isolated mitochondria and in the presence of albumin, the effective concentration of PA is significantly lower. FCCP-induced uncoupled respiration in WT and AAC1-/- mitochondria validated their respiration capacity. Data represent mean±SEM. This experiment was repeated with independent mitochondrial isolations in WT (n=4) and AAC 1-/- (n=3) with the same results. 15B: Basal OCR of isolated heart mitochondria of WT (n=24 wells) and A AC l- - (n= 18 wells) mice. Mann-Whitney test, two-tailed. Data represent mean±SEM.15C: Representative immunoblots in WT (n=5) and DKO (n=7) C2C12 cells for: NDUFB8 (complex I, Cl), SDHA (complex II, CII), core 2 subunit (complex III, CIII), CIV-I subunit (complex IV, CIV), and ATP5A (complex V, CV), TOM20, and the loading control (plasma membrane Na+/K+ ATPase). 15D: Basal and ADP- stimulated OCR of mitochondria from WT (basal, ADP 100 mM, and ADP 200 mM, n=20) and DKO (n=16 for basal, n=16 for ADPIOO mM, and n=17 for ADP 200 mM) C2C12 cells. Mann-Whitney test, two-tailed. Data represent mean±SEM. 15E: Representative confocal micrographs of WT (upper panels, n=45 cells) and DKO (lower panels, n=45 cells) C2C12 cells immunolabeled with TOM20 (green) and tubulin (red) antibodies. Insets show magnified area from the same images.
15F: Mitochondrial biomass per cellin WT and DKO C2C12 cells, calculated as a ratio between TOM20 signal and the total area of the cell, n=45 per each group. Data represent mean±SEM. 15G: Comparison of a ratio between mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) from WT (n=6) and DKO (n=6) C2C12 cells. Data represent mean±SEM. 15H: Kinetic study of ECAR in WT (n=22) and DKO (n=22) C2C12 cells under basal conditions and upon addition of oligomycin into the respiration medium. Note that inhibition of mitochondrial ATP production in DKO cells with oligomycin did not affect ECAR, whereas in WT cells, oligomycin potently stimulated ECAR. Data represent mean±SEM.
[0029] Fig. 16 depicts the amino acid sequence of human SLC25A4 (ANTI) protein (SEQ ID NO.
5)·
DETAILED DESCRIPTION
I. Definitions
[0030] “Adenosine diphosphate (ADP)/adenosine triphosphate (ATF) carrier (AAC), as used herein, refers to a transport protein of the inner mitochondrial membrane (IMM) that exchanges mitochondrial ATP for cytosolic ADP and controls cellular ATP production. There are four human AAC isoforms, AAC1-AAC4. AAC operates by the alternating access mechanism with a single substrate binding site (SBS) intermittently exposed to either cytosolic (c-state) or matrix (m-state) side of the IMM.
[0031] “AAC current”, as used herein, refers to a distinct transport mode from the inner mitochondrial membrane which can be through either ADP/ ATP exchange or H+ transport.
[0032] “AAC-mediated H+ current”, as used herein, refers to AAC-mediated proton current that requires free fatty acids and is similar to the H+ leak via the thermogenic uncoupling protein 1 of brown fat.
[0033] “Binding site”, as used herein, refers to a region on a macromolecule such as a protein that binds to another molecule with specificity. The binding partner of the macromolecule is often referred to as a ligand. Ligands may include other proteins, enzyme substrates, second messengers, hormones, or allosteric modulators. In embodiments, the binding site is a fatty acid binding site wihin AAC. In embodiments, the binding site is an aromatic binding site within AAC.
[0034] “Binding activity”, as used herein’, refers to a strength of association between two molecules, for example, the binding activity of a tested compound to a fatty acid binding site of AAC or an aromatic binding site of AAC in the inner mitochondrial membrane.
[0035] “Inner mitochondrial membrane”, as used herein, refers to the mitochondrial membrane which separates the mitochondrial matrix from the intermembrane space and is highly compartmentalized into numerous cristae to expand its surface area and enhance its ability to produce ATP.
[0036] “Cell plasma membrane”, as used herein, refers to a biological membrane that separates the interior of a cell from the outside environment (the extracellular space) which protects the cell from its environment.
[0037] “Mitochondrial respiration”, as used herein, refers to a set of metabolic reactions requiring oxygen to convert the energy stored in macronutrients to ATP within mitochondria.
[0038] “Protonatable group”, as used herein, refers to a chemical group that is able to attract protons.
[0039] “Analog” or “analogue” is used in accordance with its plain ordinary meaning within Chemistry and Biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called “reference” compound) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound. Accordingly, an analog is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound.
[0040] The term “pharmaceutically acceptable salts” is meant to include salts of the active compounds that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. When a test compound contains relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in an inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When a test compound contains relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in an inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids selected from hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids selected from acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolyl sulfonic, citric, tartaric, oxalic, methanesulfonic, and the like. Also included are salts of amino acids ( e.g ., but not limited to, arginate and the like), and salts of organic acids (e.g., but not limited to, glucuronic or galactunoric acids and the like) (see, for example, Berge etal, “Pharmaceutical Salts”, Journal of Pharmaceutical Science, 1977, 66, 1- 19). The 5-HT2B agonist may contain both basic and acidic functionalities that allow conversion into either base or acid addition salts.
[0041] An “effective amount” is an amount sufficient for a test compound (including pharmaceutically acceptable salts thereof) to accomplish a stated purpose relative to the absence of a test compound (including pharmaceutically acceptable salts thereof) (e.g. achieve the effect for which it is administered, treat a disease, reduce protein/enzyme activity, increase protein/enzyme activity, reduce a signaling pathway, or reduce one or more symptoms of a disease or condition). An example of an “effective amount” is an amount of a test compound (including pharmaceutically acceptable salts thereof) which is sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s) (e.g. seizures). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms (e.g. seizures). The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
[0042] The therapeutically effective amount of a test compound (including pharmaceutically acceptable salts thereof) can be initially determined from cell culture assays. Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art.
[0043] As is well known in the art, therapeutically effective amounts for use in humans can also be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring compounds effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.
[0044] Dosages may be varied depending upon the requirements of the patient and the compound being employed. The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.
[0045] Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particular clinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state. [0046] Utilizing the teachings provided herein, an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.
[0047] “Control” or “control experiment” is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. In some instances, the control is used as a standard of comparison in evaluating experimental effects.
In some embodiments, a control is the measurement of the activity of a protein in the absence of a test compound (including pharmaceutically acceptable salts thereof).
[0048] A “test compound” as used herein refers to an experimental compound used in a screening process to identify activity, non-activity, or other modulation of a particularized biological target or pathway.
[0049] The term “modulation”, “modulate”, or “modulator” are used in accordance with their plain ordinary meaning and refer to the act of changing or varying one or more properties. “Modulator” refers to a composition that increases or decreases the level of a target molecule or the function of a target molecule or the physical state of the target of the molecule. “Modulation” refers to the process of changing or varying one or more properties. For example, as applied to the effects of a modulator on a biological target, to modulate means to change by increasing or decreasing a property or function of the biological target or the amount of the biological target.
[0050] As defined herein, the term “inhibition”, “inhibit”, “inhibiting” and the like in reference to a AAC-related H+ current means negatively affecting (e.g. decreasing) the AAC-related H+ current relative to the function in the absence of the inhibitor. Inhibition as used herein may refer to inhibition of the transport of protons through the inner mitochondrial membrane.
[0051] The term “activation” or “induction”, “activating” or “inducing” and the like in reference to a AAC-related H+ current that positively affect (e.g. increase) the AAC-related H+ current relative to the activity in absence of the activator compound. Activation may refer to enhanced activity of a particular protein target. Activation may refer to restoration of loss-of-function of a mutated protein target. Activation as used herein may refer to activation of the transport of protons through the inner mitochondrial membrane
[0052] “Contacting” is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g., but not limited to chemical compounds, biomolecules, or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated; however, the resulting reaction product may be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents that can be produced in the reaction mixture.
[0053] The term “contacting” may include allowing two species to react, interact, or physically touch, wherein the two species may be a compound as described herein and a protein or enzyme. In some embodiments contacting includes allowing a test compound described herein to interact with a mitochondrial-containing cell.
[0054] The term “associated” or “associated with” in the context of a substance or substance activity or function associated with a disease means that the disease is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
[0055] “Patient” or “subject in need thereof’ refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a pharmaceutical composition as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, zebrafish, and other non-mammalian animals. A patient may be human.
[0056] “Disease” or “condition” refer to a state of being or health status of a patient or subject capable of being treated with the compounds or methods provided herein.
[0057] “Metabolic disorder” is a medical condition characterized by problems with an organism's metabolism. Metabolic disorder is a broad range of conditions including, but not limited to, Tay- Sachs disease, Wilson's disease, type II diabetes, fatty liver disease, obesity, hyperthyroidism, hypothyroidism, galactosemia, dyslipidemia, hypolididemia, and phenylketonuria. [0058] “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” or “carrier moiety” refer to a substance that aids the administration of a test-compound (including pharmaceutically acceptable salts thereof) to and absorption by a subject and can be included in the compositions without causing a significant adverse toxicological effect on the subject. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates (e.g., but not limited to, lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds herein). One of skill in the art will recognize that other pharmaceutically acceptable excipients are useful in the present invention.
[0059] The term "preparation" is intended to include the formulation of a test compound (including pharmaceutically acceptable salts thereof) with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.
[0060] As used herein, the term "administering" means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini- osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g, buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g, intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
[0061] A test compound (including pharmaceutically acceptable salts thereof) and pharmaceutical compositions thereof may be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols. Oral preparations include tablets, pills, powder, dragees, capsules, liquids, lozenges, cachets, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions. A test compound (including pharmaceutically acceptable salts thereof) may additionally include components to provide sustained release and/or comfort. Such components include high molecular weight, anionic mucomimetic polymers, gelling polysaccharides and finely-divided drug carrier substrates. These components are discussed in greater detail in U.S. Pat. Nos. 4,911,920; 5,403,841; 5,212,162; and 4,861,760. The entire contents of these patents are incorporated herein by reference in their entirety for all purposes. A test compound (including pharmaceutically acceptable salts thereof) may also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug-containing microspheres, which slowly release subcutaneously (see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995; as biodegradable and injectable gel formulations (see, e.g., Gao Pharm. Res. 12:857-863, 1995); or, as microspheres for oral administration (see, e.g., Eyles, J. Pharm. Pharmacol. 49:669-674, 1997). The formulations of the compositions of a test compound (including pharmaceutically acceptable salts thereof) may be delivered by the use of liposomes which fuse with the cellular membrane or are endocytosed, i.e., by employing receptor ligands attached to the liposome, that bind to surface membrane protein receptors of the cell resulting in endocytosis. By using liposomes, particularly where the liposome surface carries receptor ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the compositions of a test compound (including pharmaceutically acceptable salts thereof) into the target cells in vivo. (See, e.g., Al-Muhammed, J. Microencapsul. 13:293-306, 1996; Chonn, Curr. Opin. Biotechnol. 6:698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46:1576-1587, 1989). The compositions may also be delivered as nanoparticles.
[0062] By "co-administer" it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies. A test compound (including pharmaceutically acceptable salts thereof) may be administered alone or can be co-administered to the patient. Co-administration is meant to include simultaneous or sequential administration of the compounds individually or in combination (more than one compound). Thus, the preparations may also be combined, when desired, with other active substances (e.g. to reduce metabolic degradation). A test compound (including pharmaceutically acceptable salts thereof) may be delivered transdermally, by a topical route, or formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
II. Methods of Treatment
[0063] Provided herein, inter alia , are methods and compositions for treating a metabolic disorder. In one aspect, provided herein is a method of identifying a compound that activates adenosine diphosphate (ADP)/ adenosine triphosphate (ATP) carrier (AAC), said method includes docking a test compound in a AAC fatty acid binding site or an AAC aromatic binding site to evaluate a binding capacity of said compound to a FA binding site or an aromatic binding site of AAC in the inner mitochondrial membrane; combining a mitochondrial-containing cell and said test compound in a reaction vessel and measuring a decrease or increase in mitochondrial respiration in said mitochondrial-containing cell; and combining an inner mitochondrial membrane (IMM) with said test compound and measuring an AAC current to determine whether said test compound (i) inhibits ADP/ ATP exchange or (ii) activates proton current through AAC, thereby identifying said test compound as a compound that activates AAC.
[0064] In embodiments, the method of activating AAC includes docking a test compound in a AAC fatty acid binding site. In embodiments, the method includes docking a test compound in a AAC aromatic binding site.
[0065] In embodiments, the test compound increases mitochondrial respiration in a mitochondrial - containing cell. In embodiments, the test compound decreases mitochondrial respiration in a mitochondrial-containing cell.
[0066] In embodiments, the method of activating AAC comprises an activation of proton current through AAC by the test compound. In embodiments, the method of activating AAC comprises an inhibition of ADP/ATP exchange by the test compound.
[0067] In embodiments, a mitochondrial-containing cell is a myocyte cell. In embodiments, a mitochondrial-containing cell is an intact myocyte cell. In embodiments, a mitochondrial-containing cell is an intact myocyte C2C1 cell.
[0068] In embodiments, the method of identifying a compound that activates AAC further comprising determining whether said compound induces proton current across a cell plasma membrane. In embodiments, the method of identifying a compound that activates AAC further comprising determining whether said compound induces proton current across a cell plasma membrane at micromolar concentrations or less.
[0069] In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.1 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.25 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.5 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 0.75 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 1 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 10 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 25 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 50 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 75 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 100 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 200 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 300 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 400 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 500 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 600 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 700 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 800 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 900 nM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 1 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 2 pM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 3 pM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 4 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 5 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 6 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 7 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 8 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 9 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 10 mM. hi embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 15 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 20 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 25 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 50 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 75 mM. In embodiments, a test compound induces proton current across a cell plasma membrane at a concentration of less than 100 mM.
[0070] In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 0.1 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 0.5 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 10 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 25 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 50 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 100 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 200 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 300 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 400 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 500 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 600 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 600 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 600 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 700 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 800 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 900 nM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about ImM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 2mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 5mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 10 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 25 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 50 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 75 mM. In embodiments, the concentration of a test compound that induces proton current across a cell plasma membrane is about 100 mM.
[0071] In embodiments, a method of identifying a compound that activates AAC comprises a protonable group that is located proximal to amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC sequence set forth in Fig. 16. In embodiments, the protonable group is located proximal to amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC fatty acid binding site. In embodiments, a method of identifying a compound that activates AAC comprises a protonable group that is located proximal to an amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in the AAC sequence set forth in Fig. 16. In embodiments, the protonable group is located proximal to amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in said AAC aromatic binding site. In embodiments, “located proximal to” means 5 A0 or less, 4 A0 or less, or 2 A0 or less. [0072] Provided herein is a method of treating a metabolic disorder. In one aspect, the method is a method of treating a metabolic disorder comprising administering to a subject in need thereof an effective amount of an AAC proton leak inducing agent.
[0073] In embodiments, the AAC proton leak inducing agent binds within the AAC binding site. In embodiments, the AAC proton leak inducing agent binds within the AAC fatty acid binding site. In embodiments, the AAC proton leak inducing agent binds within the AAC aromatic binding site.
[0074] In embodiments, the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC sequence set forth in Fig. 16. In embodiments, the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in the AAC fatty acid binding site. In embodiments, the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in the AAC sequence set forth in Fig. 16. In embodiments, the AAC proton leak inducing agent contacts amino acid residues corresponding to E29, K32, Y186, G224, S227, D231, R234, or R235 in the AAC aromatic binding site.
III. Effective Dosages
[0075] The pharmaceutical composition may incluse a test compound that activates AAC (including pharmaceutically acceptable salts thereof) contained in a therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, inter alia, on the condition being treated. For example, when administered in methods to treat a metabolic disorder, such compositions will contain amounts of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof effective to achieve the desired result.
[0076] The dosage and frequency (single or multiple doses) of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof administered can vary depending upon a variety of factors, including route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated; presence of other diseases or other health-related problems; kind of concurrent treatment; and complications from any disease or treatment regimen. Other therapeutic regimens or agents can be used in conjunction with the methods described herein. [0077] The therapeutically effective amounts of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof for treating metabolic diseases described herein may be initially determined from cell culture assays. Target concentrations will be those concentrations of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof capable of inhibiting or otherwise decreasing metabolism disfunction in a patient.
[0078] Therapeutically effective amounts of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof for use in humans may be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring response of the patient to the treatment and adjusting the dosage upwards or downwards, as described above.
[0079] Dosages may be varied depending upon the requirements of the subject and the compound being employed. The dose administered to a subject, in the context of the pharmaceutical compositions presented herein, should be sufficient to effect a beneficial therapeutic response in the subject over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side effects. Generally, treatment is initiated with smaller dosages, which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.
[0080] Dosage amounts and intervals can be adjusted individually to provide levels of the administered AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof effective for the particular metabolic disorder being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
[0081] Utilizing the teachings provided herein, an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is entirely effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of the AAC activating test compound (including pharmaceutically acceptable salts thereof) or a pharmaceutical composition thereof by considering factors such as potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration, and the toxicity profile of the selected agent.
EMBODUMENTS
[0082] Embodiment 1. A method of identifying a compound that activates adenosine diphosphate (ADP)/ adenosine triphosphate (ATP) carrier (AAC), said method comprising:
(a) docking a test compound in a AAC fatty acid binding site or an AAC aromatic binding site to evaluate a binding capacity of said compound to a FA binding site or an aromatic binding site of AAC in the inner mitochondrial membrane;
(b) combining a mitochondrial-containing cell and said test compound in a reaction vessel and measuring a decrease or increase in mitochondrial respiration in said mitochondrial - containing cell; and
(c) combining an inner mitochondrial membrane (IMM) with said test compound and measuring an AAC current to determine whether said test compound (i) inhibits ADP/ ATP exchange or (ii) activates proton current through AAC, thereby identifying said test compound as a compound that activates AAC.
[0083] Embodiment 2. The method of embodiment 1, further comprising determining whether said compound induces proton current across a cell plasma membrane.
[0084] Embodiment 3. The method of embodiment 1, further comprising determining whether said compound induces proton current across a cell plasma membrane at micromolar concentrations or less.
[0085] Embodiment 4. The method of one of embodiments 1 to 3, wherein said mitochondrial-containing cell is an intact myocyte C2C12 cell.
[0086] Embodiment 5. The method of one of embodiments 1 to 4, wherein the measuring of said ACC current is accomplished using a mitochondrial patch-clamp method.
[0087] Embodiment 6. The method of one of embodiments 1 to 5, wherein said compound activates proton current via AAC at the concentration of about 1 nM to 100 mM. [0088] Embodiment 7. The method of one of embodiments 1 to 6, wherein said compound activates proton current via AAC at the concentration of about 1 to 5 mM.
[0089] Embodiment 8. The method of one of embodiments 1 to 7, wherein said protonatable group is located proximal to amino acid residues E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in said AAC fatty acid binding site or amino acid residues E29, K32, Y186, G224, S227, D231, R234, or R235 in said AAC aromatic binding site, when performing said docking.
[0090] Embodiment 9. A method of treating a metabolic disorder in a subject in need thereof, said method comprising administering to said subject an effective amount of an AAC proton leak inducing agent.
[0091] Embodiment 10. The method of embodiment 9, wherein said AAC proton leak inducing agent binds within the AAC fatty acid binding site.
[0092] Embodiment 11. The method of embodiment 9 or 10, wherein said AAC proton leak inducing agent contacts amino acid residues E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 within said AAC fatty acid binding site.
[0093] Embodiment 12. The method of embodiment 9, wherein said AAC proton leak inducing agent binds within the AAC aromatic binding site.
[0094] Embodiment 13. The method of embodiment 12, wherein said AAC proton leak inducing agent contacts amino acid residues E29, K32, Y186, G224, S227, D231, R234, or R235 within said AAC aromatic binding site.
EXAMPLES
Methods
Animals
[0095] Mice were maintained on a standard rodent chow diet under 12-h light and dark cycles. All animal experiments were performed with male mice according to procedures approved by the UCSF Institutional Animal Care and Use Committee. B6.129-UcpltmlKz/J mice (abbreviated l ICP G ), B6.129S4-Ucp2tmlLowl/J mice (abbreviated l ICP 2 ) and B6;129S4-Ucp3tmlLowl/J mice (abbreviated UCP3 ) were obtained from the Jackson Laboratory. The Ant2SIBN 129/B6 mice (abbreviated AAC2 hypom orphic) were provided by the laboratory of Dr. Naohiro Terada (Cho et al, supra), and AAC1 -deficient mice on C57BL/6J2z background were obtained from the laboratory of Dr. Douglas Wallace (Graham et al, supra). Chemicals
[0096] The following chemicals were used in the study: arachidonic acid sodium salt (AA, SIGMA A8798), palmitic acid (PA, SIGMA P0500), sodium dodecanoate (LA, SIGMA L9755), carboxyatractyloside potassium salt (CATR, SIGMA 4992), Bongkrekic acid triammonium salt (BKA, Millipore 203671), guanosine 5 '-diphosphate tris salt (GDP, SIGMA G7252), adenosine 5'- diphosphate sodium salt (ADP, SIGMA A2754), adenosine 5 '-triphosphate disodium salt hydrate (ATP, SIGMA A6419), m ethyl -b-cyclodextrin (Mbqϋ, SIGMA C4555), mersalyl acid (SIGMA M9784), arachidonic acid sulfonate sodium salt (AA-sulf, CAYMAN 9001886), 1- hexadecanesulfonic acid sodium salt (C6-sulf, SIGMA 106410), Gramicidin A (Abeam ab 144510), DL-Dithiothreitol solution (DTT, SIGMA 646563). Zb/V-butyl hydroperoxide solution (tBHP, SIGMA 416665), 4-hydroxy nonenal (4-HNE, CAYMAN 75899-68-2), and tributyltin chloride (TBT, SIGMA T50202).
Isolation of mitochondria and mitoplasts from tissues [0097] Mice were sacrificed by CO2 asphyxiation followed by cervical dislocation. For the preparation of mitoplasts from heart, SM, brown fat, kidney, and liver, the selected mouse tissues were isolated, rinsed, and homogenized in ice-cold medium containing 250 mM sucrose, 10 mM HEPES, 1 mM EGTA, and 0.1% bovine serum albumin (BSA) (pH adjusted to 7.2 with Trizma® base) using a glass grinder with six slow strokes of a Teflon pestle rotating at 275 (soft tissues) or 600 (fibrous tissues) rotations per minute. The homogenate was centrifuged at 700 x g for 5-10 min to pellet nuclei and unbroken cells. For some tissues, the first nuclear pellet was resuspended in the same solution and homogenized again to increase the yield of mitochondria. Mitochondria were collected by centrifugation of the supernatant at 8,500 x g for 10 min.
[0098] Mitoplasts were produced from mitochondria using a French press. Briefly, mitochondria were suspended in a solution containing 140 mM sucrose, 440 mM D-mannitol, 5 mM HEPES, and 1 mM EGTA (pH adjusted to 7.2 with Trizma® base) and then subjected to a French press at 1200- 2,000 psi to rupture the outer membrane. Mitoplasts were pelleted at 10,500 x g for 15 min and resuspended for storage in 500 pi of solution containing 750 mM KC1, 100 mM HEPES, and 1 mM EGTA (pH adjusted to 7.2 with Trizma® base). Mitochondria and mitoplasts were prepared at 0- 4 °C and stored on ice for up to 5 h. Immediately before the electrophysiol ogical experiments, 15-50 pi of the mitoplast suspension was added to 500 mΐ solution containing 150 mM KC1, 10 mM HEPES, and 1 mM EGTA (pH adjusted to 7.0 with Trizma® base) and plated on 5-mm coverslips pretreated with 0.1% gelatin to reduce mitoplast adhesion. Nearly all AAC molecules in isolated mitoplasts were initially in the c-state (see Fig. 1 A and 3E). A likely explanation for this initial c- state is the presence of endogenous adenine nucleotides in the matrix and not in the isolation media during mitochondria/mitoplast isolation.
Patch-clamp recordings
[0099] Patch-clamp recording was performed from isolated mitoplasts. The mitoplasts used for patch-clamp experiments were 3-5 pm in diameter and had membrane capacitances of 0.3-1.2 pF. Gigaohm seals were formed in the bath solution containing 150 mM KC1, 10 mM HEPES, and 1 mM EGTA (pH 7 adjusted with Trizma® base). Voltage steps of 250-500 mV and 1-50 ms were applied to break-in into the mitoplast and obtain the whole-mitoplast configuration (Fig. 6A), as monitored by the appearance of capacitance transients. Mitoplasts were stimulated every 5 s. Currents were normalized per membrane capacitance to obtain current densities (pA/pF).
[0100] All indicated voltages are on the matrix side of the EMM (pipette solution) as compared to the cytosolic side (bath solution, defined to be 0 mV). Normally, currents were induced by a voltage ramp from -160 mV to +100 mV to cover all physiological voltages across the EMM, but other voltage protocols were also used as indicated in the figures. Currents flowing into mitochondria are shown as negative, while those flowing out are positive (Fig. 6). Membrane capacitance transients observed upon application of voltage steps were removed from current traces.
[0101] Both the bath and pipette solutions were formulated to record H+ currents and contained only salts that dissociate into large anions and cations normally impermeant through ion channels or transporters. In the majority of experiments, we used a low pH gradient across the EMM (pH 7.5 and 7.0 on the matrix and cytosolic sides, respectively) to approximate physiological conditions. However, other pH gradients were also used as indicated.
[0102] Pipettes were filled with 130 mM tetramethylammonium hydroxide (TMA), 1.5 mM EGTA, 2 mM Tris chloride, and 100 mM HEPES (or MES). pH was adjusted to 6-7.5 with D- gluconic acid, and tonicity was adjusted to ~360 mmol/kg with sucrose. Typically, pipettes had resistances of 25-35 MW, and the access resistance was 40-75 MW. [0103] Whole-mitoplast IH was recorded in the bath solution containing 100 mM HEPES (or MES) and 1 mM EGTA (pH adjusted to 6.0-7.5 with Trizma® base, and tonicity adjusted to ~300 mmol/kg with sucrose). AA was selected as the IH activator, because this polyunsaturated FA is a principal product of membrane phospholipid hydrolysis (Burke & Dennis, J lipid Res 50 Suppl, S237-242, 2009). In the absence of significant cytosolic triglyceride storage in non-adipose tissues, membrane phospholipid hydrolysis may be an important source of free FA for/// activation in vivo (Fedorenko et al, supra ; Gadd etal, supra). To record UCP1 currents, before the application of AA, the endogenous membrane FA were removed by a 30-40s pre-treatment with 10 mM MpCD (Fedorenko et al, supra). Low pH 6.0 was employed in some UCP1 experiments to further suppress production of endogenous FA in brown fat mitoplasts (Fedorenko et al, supra).
[0104] All experiments were performed under continuous perfusion of the bath solution. All electrophysiol ogical data presented were acquired at 10 kHz and filtered at 1 kHz.
Mitochondrial respiration on isolated heart mitochondria [0105] Mitochondria were isolated from WT and AACl^ hearts (5 months old, 3-4 mice per genotype) as described above. The organelles were rinsed with a BSA-free isolation buffer (250 mM sucrose, 10 mM HEPES, 1 mM EGTA, pH adjusted to 7.2 with Trizma® base) to remove the BSA. Mitochondrial oxygen consumption rates (OCRs) were evaluated in heart isolated mitochondria using the Seahorse XF24 Analyzer (Seahorse Bioscience, Billerica, MA). The experiments were performed with respiratory buffer (sucrose 70 mM, mannitol 220 mM, potassium phosphate monobasic 10 mM, magnesium chloride 5 mM, HEPES 2 mM, EGTA 1 mM, glutamate 10 mM, and malate 2 mM) supplemented with 0.02% FA-free BSA. Mitochondrial protein was quantified using Bradford protein assay. 5 pg of mitochondrial proteins per well were used. The mitochondrial respiration was measured before any addition (basal), then after addition of 4 pg/ml oligomycin (Oligo), followed by 50 pM or 100 pM palmitic acid (PA) or respiration buffer to study the H+ leak, and then after addition of 0.1 pM FCCP to induce maximal respiration. Finally, 1 pM rotenone was applied to inhibit mitochondrial respiration. In each experiment, 2-3 wells were left unseeded for the collection of background measurements. Each experimental condition was applied to 3-4 wells per plate and repeated over 3-4 days (independent mitochondrial isolation). Basal respiration was measured at three consecutive time points; the effect of oligomycin was measured at two consecutive time points; the effect of FA was measured at nine consecutive time points (30 min total); and the effects of FCCP and rotenone were measured at one or two consecutive time points. The OCRs immediately after the addition of PA and after 30 min are reported.
C2C12 cell culture and AAC1/AAC2 knockout generation [0106] The C2C12 cell line was purchased from ATCC (https://www.atcc.org/) and cultured in complete Dulbecco’s Modified Eagle Medium (DMEM; DMEM with 25 mM Glucose, 10% fetal bovine serum [FBS], penicillin and streptomycin antibiotics). The AACl AAC2 DKO cells were generated by Alstem LLC (http://www.alstembio.com/) using the Crispr-Cas9 system. Transfection of gRNA Cas9 plasmids was performed using the Invitrogen Neon transfection system. gRNA candidates were selected via PCR amplification and selected for single-cell clone isolation. AACl gRNA target 1 “CGCCGCCGTCTCCAAGACGG CGG” (SEQ ID NO. 6) and target 2 “GGGGCGGGGCGCGCGCGCGTCA GGG” (SEQ ID NO. 7); AAC2 gRNA target 1 “CGGCTTTGACTCCCGGGCTC TGG” (SEQ ID NO. 8) and target 2 “AGGTACGTTCTGAGATCGAG GGG” (SEQ ID NO. 9).
[0107] Because DKO cells were glycolytic (Fig. 15H), growing them in a low-glucose medium would put DKO cells at a significant disadvantage as compared to WT cells, effectively resulting in vastly different growing conditions for the two cell lines. Therefore, the same growth medium containing 25 mM glucose was used for both for WT and DKO cells.
Immunocytochemistry
[0108] C2C12 cells were seeded on 2-cm diameter coverslips in a multi-well plate. For immunostaining, cells were fixed in 3.7% paraformaldehyde for 20 min at 37°C and permeabilized in 0.5% Triton X-100 for 10 min at room temperature. A 2-h incubation in primary rabbit polyclonal anti-TOM20 (Santa Cruz Biotechnology: FL-145) and mouse monoclonal anti-tubulin antibodies (Abeam: A44928) both diluted at 1:500 was followed by incubation in solution containing the secondary antibodies Alexa Fluor 488-conjugated goat anti-rabbit (Invitrogen: A11008) and Alexa Fluor 568-conjugated goat anti -mouse (Invitrogen: A11004) for 1 h at room temperature. The coverslips were mounted onto a cover glass using Prolong mounting medium (Invitrogen: P36934). Images were acquired using a Yokogawa CSU-X1 spinning disk confocal on an inverted Nikon Ti fluorescence microscope equipped with a 63x or IOOc oil immersion objective. Image analysis and processing were performed using the NIS Elements software on 0.2-pm z-stack images acquired with the lOOx objective. To quantify mitochondrial area, the maximum -intensity projections labeled with TOM20 on each acquired z-stack image were used. C2C12 mitochondrial isolation
[0109] C2C12 cells (WT or DKO) from ten 15-cm dishes were trypsinized and harvested with ice- cold PBS at 1,000 g for 5 min. The cell pellet was incubated with hypotonic buffer (20 mM HEPES, pH 7.5, 5 mM KC1, 1.5 mM MgCh, and 1 mg/ml essentially FA- free BSA) on ice for 10 min. Cells were then homogenized (25 strokes) using a tight-fitting glass dounce tissue grinder and rapidly made isotonic by adding the homogenate to 2/3 volume of 2.5x MSH (20 mM HEPES, pH 7.5, 525 mM mannitol, 175 mM sucrose, 5 mM EDTA, and 1 mg/ml essentially FA-free BSA). The homogenate was centrifuged at 600 x g for 10 min, and the supernatant was then centrifuged at 8,500 x g for 10 min to pellet mitochondria. Mitochondria were resuspended in MSH buffer (20 mM HEPES, pH 7.5, 210 mM mannitol, 70 mM sucrose, and 2 mM EDTA). Mitochondrial protein was quantified using the bicinchoninic acid assay (Thermo Fisher Scientific).
Extracellular flux analysis of C2C12 cell-derived mitochondria [0110] In a volume of 50 mΐ, 30 pg of mitochondrial protein was added to each well of a XF cell culture microplate (on ice). The mitochondria-loaded XF microplate was centrifuged at 2,000 x g for 20 min for adherence of organelles. Respiration buffer (20 mM Tris, pH 7.4, 210 mM mannitol, 70 mM sucrose, 0.1 mM EGTA, 3 mM MgCh, 5 mM KH2PO4, 0.1% essentially FA-free BSA, 10 mM sodium pyruvate, and 5 mM malate) was added to a final volume of 0.5 ml, and the XF microplate was warmed at 37 °C for 8 min prior to loading into a XFe24 Extracellular Flux Analyzer (Seahorse Bioscience). The OCRs were recorded using a mix (20 s) and measure (2 min) cycle. FCCP was added at 10 mM (isolated mitochondria). Gramicidin A was added at IOmM.
Extracellular flux analysis of cultured C2C12 cells [0111] Cells were plated in an XF microplate the evening before respirometry at 60,000 cells or 50,000 per well. Cells were washed with 250 mΐ unbuffered DMEM (Sigma, D5030), supplemented with 0.2% and 1 mM sodium pyruvate. Then 600 mΐ of unbuffered DMEM (supplemented with 0.2% and 1 mM sodium pyruvate) was added to the cells before incubation at 37 °C without CO2 for 45 min. The OCRs were recorded using a mix (3 min), wait (2 min), and measure (3 min) cycle. The final concentrations of palmitate were 200, 400, or 600 mM, and that of FCCP was 4 mM.
Analysis of mtDNA/nDNA ratio from C2C12 cells with quantitative PCR (qPCR)
[0112] After collecting ~5 million cells (WT and DKO, n=6), global DNA (including genomic and mitochondrial DNA) was extracted using the QIAamp DNA Mini Kit (ID: 51304 from Qiagen). We proceed to a serial 1/10-fold dilution of a WT sample for all the standard curves. Each sample has been diluted with a 1/5 ratio (genomic target, forward FWD: 5’-
GCCAGCCTCTCCTGATTTTAGTGT-3’ (SEQ ID NO. 1) and reverse primers REV: 5’- GGGAACAC AAAAGACCTCTTCTGG-3 ’ (SEQ ID NO. 2)) and one mtDNA target (NDl forward FWD: 5 ’ -CTAGC AGAAAC AAACCGGGC-3 ’ (SEQ ID NO. 3) and reverse primers REV: 5’- CCGGCTGCGTATTCTACGTT-3 ’ (SEQ ID NO. 4)).
[0113] 1 pi of DNA and final concentration of 0.2 mM of each primer were mixed with Power SYBR Green Master Mix (Thermo Fisher Scientific) according to manufacturer’s protocol. We normalized all our expression values to the expression of the genomic target.
Immunoblots
[0114] For western blot analysis, cells were lysed in RIPA buffer (1% Igepal, 0.1% sodium dodecyl sulfate, 0.5% sodium deoxycholate, 150 mMNaCl, 1 mM EDTA, 50 mM Tris-HCl (pH 7.4) and a cocktail of proteases inhibitors. Lysates were resolved by SDS-PAGE; transferred to PVDF membrane (Millipore); and probed with anti-Na+/K+-ATPase antibody (Abeam, ab76020), anti-TOM20 (Santa Cruz, sc-11415), OXPHOS cocktail (Abeam, abl 10413), anti-AACl (ab 102032) and anti-AAC2 (CST 1467S).
Statistical analysis
[0115] Data are presented as mean ± SEM as specified in the figure legend. Statistical analysis was performed using software GraphPad Prism 8. Statistical significance with exact p value was determined with the method used as indicated in corresponding figure legend.
Results
Identification of ubiquitous FA-dependent mitochondrial IH
[0116] To characterize IH in tissues that do not express UCP1, the whole-EMM patch-clamp was used (Fedorenko et al, Cell 151, 400-413, 2012; Bertholet et al, CellMetab 25, 811-822, 2017) (Fig. 6A). Application of 1.5 mM arachidonic acid (AA) on the cytosolic side (bath) induced IH across the whole EMM of skeletal muscle (SM; Fig. 6B), heart, liver, and brown fat (Fig. 7A). IH reversed at the calculated H+ Nernst potentials (Fig. 8). A small IH appeared before AA addition that was inhibited by FA acceptor m ethyl -b-cy cl odextrin (Mbϋϋ) and likely activated by FA within the IMM (Fig. 7E). [0117] It was proposed that FA possess protonophoric activity and cause H+ current across any lipid bilayer, independent of transport proteins (Gutknecht, J., JMembr Biol 106, 83-93, 1988). However, neither 1.5 mM nor 15 pM AA induced measurable currents across the plasma membrane but generated robust IH across the IMM (Fig. 6B-6D). Thus, FA-dependent IH is not a universal property of lipid bilayers but a feature of the IMM.
[0118] No difference was found in IH amplitude in SM mitoplasts isolated from mice deficient for UCP2 and UCP3 as compared to WT (Fig. 7B and 7C). Guanosine diphosphate (GDP), an inhibitor of UCPs (Echtay etal, PNA Sci USA 98, 1416-1421, 2001; Jaburek etal, J Biiol Chem 274, 26003-26007, 1999; Krauss et al, Nat Rev Mol Cell Biol 6, 248-261, 2005; Nedergaard et al, Exp Physiol 88, 65-84, 2003) also had no effect on IH (Fig. 7D). This finding correlates with the recently proposed roles of these proteins in mitochondrial transport of C4 metabolites and glucose/pyruvate metabolism, rather than mitochondrial uncoupling (Bouillaud, F., Biochim Biophys Acta 1787, 377- 383, 2009; Vozza etal, PNASW&N 111, 960-965, 2014).
Pharmacological and biophysical properties of IH
[0119] At physiological pH (7.5/7.0 inside/outside of mitoplast), 2 pM AA induced both inward (observed at negative membrane voltages) and outward (at positive voltages) currents in SM, heart, kidney, and liver mitoplasts (Fig. 1 A). This effect was reversible upon FA washout (Fig. 91). A specific AAC inhibitor carboxyatractyloside (CATR) (Klingenberg, M., Biochim Biophys Acta 1778, 197802021, 2008) strongly inhibited the inward current but only partially the outward current (Fig. 1 A, 9K and 9L). Shorter chain palmitic acid (PA) and lauric acid induced similar CATR- sensitive currents (Fig. 9A-9C). Another selective AAC inhibitor, bongkrekic acid (BKA), also suppressed IH (Fig. 9D). Thus, the CATR- and BKA-sensitive inward IH observed at physiologically relevant negative membrane potentials is likely mediated by AAC. In contrast, the largely CATR- and BKA-insensitive outward current observed at positive voltages is partially mediated by another transport mechanism.
[0120] It was hypothesized that the outward current is mainly carried by FA anions as it was greatly reduced in a low pH bath solution with fewer cytosolic FA anions (Fig. 6B, 7A, and 9J). To test this, 2 pM AA-sulfonate (AA-sulf, an AA analog that exists only in the unprotonated anionic form at physiological pH) was added to the bath and observed only an outward current, as expected for transport of negatively charged AA-sulf into the mitoplast (Fig. 9E). Notably, this current was not affected by CATR (Fig. 9E), ruling out AAC involvement. Sulfhydryl reagent mersalyl strongly inhibited the outward FA anion current induced by AA-sulf (Fig. 9F) or AA (Fig. 9G) but did not affect the inward IH induced by AA (Fig. 9G), further confirming that different proteins carry the AA anion and H+ currents induced by AA. Mersalyl washout did not restore the outward AA anion current, whereas dithiothreitol (DTT) addition did (Fig. 9H), suggesting cystein oxidation involvement. Pre-treatment with mersalyl before AA application allowed measuring the AAC- dependent IH in isolation (Fig. IB). The outward IH via AAC was smaller than the inward IH due to the inward H+ gradient used in this experiment (Fig. IB). In this study, we avoided using mersalyl and measured AAC-dependent IH in isolation from the AAC-independent FA anion current either at negative potentials or low pH.
[0121] In the absence of purine nucleotides that negatively regulate IH via both UCP1 and AAC (Fig. 4, and 14D-14F), the density of the AAC-dependent In was about ~5 times smaller than that of the UCP1 -dependent/// (Fig. 1B-1D).
[0122] Mitochondrial uncoupling is potentiated by both mitochondrial hyperpolarization and ROS, which serve as a negative feedback mechanism for mitochondrial ROS production (Korshunov et al, FEBS LETT 416, 15-18, 1997; Echtay etal, Nature 415, 96-99, 2002; Echtay et aI.,EMBO J 22, 4103-4110, 2003; Parker et al, Biochem J 412, 131-139, 2008). Accordingly, the current-voltage relationship of the AAC-dependent IH was non-linear, with IH increasing sharply with membrane hyperpolarization (Fig. IE and IF). Also, application of /cvV-butyl hydroperoxide (tBHP), tributyltin (TBT), or 4-hydroxynonenal (4-HNE), known to oxidize AAC cysteines (Nishikimi et al., Biochem J 356, 621-626, 2001; Vieira et al., Oncogene 20, 4305-4316, 2001), on the cytosolic face of the IMM significantly potentiated ///via AAC (Fig. 10A, IOC, and 10E). Importantly, because tBHP, TBT, and 4-HNE activated no currents in the absence of FA (Fig. 10B, 10D, and 10F), they do not act independently but potentiate the FA-induced IH.
[0123] Thus, pharmacological evidence suggests that AAC is responsible for the FA-induced mitochondrial IH. Importantly, low micromolar FA are required for IH via both AAC and UCP1 (Fedorenko et al, Cell 151, 400-413, 2012). Previous suggestions that UCP1 or AAC mediate a “basal” ///that is FA-independent (Brand et al, Biochem J 392, 353-362, 2005) or activated by nanomolar FA concentrations (Cunningham etal, Eur J Biochem 157, 415-420, 1986) were likely associated with the inabilty to reliably control FA concentrations in mitochondrial respiration experiments (Klingenberg & Huang, Biochim Biophys Acta 1415, 271-296, 1999). AAC is required for IH
[0124] In mice, AAC1 and AAC2 are the only somatic isoforms (Rodic et al, Stem Cells 23, 1314- 1323, 2005; Levy et al, Gene 254, 57-66, 2000). AAC1 expression is highest in heart and SM, and AAC2 - in kidney (Levy, supra ; Cho et al, Cell Death Differ 22, 1437-1450, 2015). In heart of AAC1 mice (Graham et al, Nat Genet 16, 226-234, 1997; Morrow et al, PNAS Sci USA 114, 2705-2710, 2017), AA failed to induce IH at negative potentials in all mitoplasts tested except one (Fig. 2a). The IH reduction was also drastic in A ACC SM (Fig. 2B), with some mitoplasts having no IH , while the remaining IH in others was still inhibited by CATR, suggesting AAC2 involvement (Fig. 2B, 111 and 11 J). IH in kidney (where AAC1 expression is low (Levy et al, supra)) was not significantly affected in AACl^ and remained CATR-sensitive (Fig. 2C). IH was not significantly altered in heart or kidney of AAC2 hypomorphic mice (Levy et al, supra)) (Fig. 11 A and 1 IB), and was CATR-sensitive likely due to compensation with AAC1 (Levy et al, supra)) (Fig. 11 A and 1 IB). In contrast to IH, the outward current observed at positive potentials (primarily the AAC- independent FA anion current) was still present in both HHC-deficient mice in all tissues tested (Fig. 2, 11 A-l 1G). This current was partially inhibited by 1 mM CATR (Fig. 1 IH), but short of full inhibition expected for the current mediated only by AAC (Klingenberg, M, supra).
[0125] Thus, AAC1 plays a crucial role in IH, at least in heart and SM. However, the recording of a CATR-sensitive IH in SM and kidney of AACT^ mice suggests that AAC2 is capable of mediating IH.
FA as co-factors for H+ transport by AAC
[0126] In UCP1, IH activation requires FA binding within the translocation pathway (Fedorenko et al, supra). The FA binding is facilitated by a longer carbon chain and higher FA hydrophobicity (Fedorenko et al, supra ; Bertholet etal, Biochimie 134, 28-34, 2017). The protonatable carboxylic group of the FA located within the translocation pathway enables H+ transport. Nonprotonatable low-pKa FA analogs (such as alkylsulfonales) inhibit ///by competing with FA for binding to UCP1 (Fedorenko et ah, supra ; Bertholet et al, supra). Purine nucleotides, blockers of the UCP1 translocation pathway, abolish ///via UCP1 (Fedorenko et al, supra ; Bertholet et al, supra)..
[0127] The mechanism of IH via AAC appears to be similar. Blocking the AAC translocation pathway with CATR or BKA abolished IH (Fig. 1 A, 9D). Higher FA hydrophobicity facilitated IH activation (Fig. 9A-9C). Finally, AA-sulf failed to induce IH (Fig. 9E) but inhibited the IH activated by AA (Fig. 12A).
[0128] However, UCP1 transport both, H+ and FA, and operates as a FA anion/H+ cotransporter (Fedorenko et al, supra ; Bertholet etal, CellMetab 25, 811-822, 2017; Bertholet et al, supra ;
Garlid etal, J Biol Chem 271, 2615-2620, 1996). The FA anion transport can be studied in isolation from IH using alkyl sulfonates (Fedorenko et al, supra ; Bertholet et al, Biochimie 134, 28-34, 2017). Short-chain alkyl sulfonates (e.g., C6-sulf) are transported by UCP1 and induce a steady outward transmembrane current (Fig. 12D, left panel) (Fedorenko et al, supra ; Bertholet et al, Biochimie 134, 28-34, 2017). In contrast, long-chain alkyl sulfonates (e.g., AA-sulf) cannot dissociate from UCP1 due to strong hydrophobic interactions but move within the translocation pathway in response to voltage steps, giving rise to transient currents (Fig. 12C, left panel) (Fedorenko et al, supra ; Bertholet et al, supra; Bertholet et al, supra ). However, neither AA- nor C6-sulf induced measurable AAC currents under these conditions (Fig. 12C and 12D, right panels). Attempts to induce FA anion currents via AAC by applying AA-sulf or C6-sulf on both sides of the IMM also resulted in no measurable FA anion currents (Fig. 12E and 12F). However, at higher voltage (-160 mV), a small transient current likely generated by AA-sulf trapped within AAC translocation pathway was detected (Fig. 12C, left panel). In contrast, AA induced a steady IH under the same conditions (Fig. 12B).
[0129] Thus, the presence of protonatable FA within the translocation pathway appears to be the common feature in FA-dependent H+ transport by AAC and UCP1. However, FA serve as cofactors (Klingenberg & Huang, Biochim Biophys Acta 1415, 271-296, 1999) in H+ translocation by AAC , not co-transported species (Fedorenko etal, supra) as for UCP1 (Fig. 12G).
Adenine nucleotide transport by AAC
[0130] AAC currents associated with the exchange of Mg2+-free ADP and ATP were recorded (Fig. 13 A). Application of 1 mM ADP on the cytosolic IMM face, while the matrix solution contained 1 mM ATP, resulted in a small CATR-sensitive current (Fig. 14B). The current increased significantly in 5 mM [ATP] and [ADP] and, as expected for electrogenic exchange of cytosolic ADP3 for matrix ATP4 , was observed only in the inward direction at negative voltages (Fig. 3A, left panel and 13C). This current was dramatically reduced in AACl^ heart mitoplasts (Fig. 3 A and 3D). With matrix ADP and cytosolic ATP, the current reversed and was only observed in the outward direction at positive voltages (Fig. 3B and 13D). Finally, 5 mM ADP on both IMM sides resulted in no current (Fig. 3C), as expected for homoexchange (Klingenberg etal, supra). The ability to measure ADP/ ATP exchange and control AAC conformations with the patch-clamp technique provided further insight into the mechanism of FA-dependent ///.
[0131] Nearly all AAC molecules in isolated mitoplasts were initially in the c-state (see Methods), because CATR, a c-state-specific AAC inhibitor (Klingenberg et al, supra ; Rebay-Peyroula,
Nature , 426, 39-44, 2003) almost completely blocked FA-dependent IH (Fig. 1A and 9K). Interestingly, pre-treatment of a mitoplast with cytosolic ADP to induce an m-state transition of the AAC molecules did not prevent subsequent activation of IH with FA but, made IH insensitive to CATR (Fig. 3E and 13E). Thus, IH inhibition by the c-state-specific inhibitor CATR allows identification of AAC conformational states during patch-clamp experiments. This experiment demonstrates that: 1) cytosolic FA activate IH with AAC in either the c- or m-state; 2) FA cannot induce the c-m conformational change (only adenine nucleotides can) and are not AAC transport substrates (see also Fig. 12C-12F).
[0132] Interestingly, 4 mM of matrix AA did not activate IH when AAC was either in the c-state (Fig. 13F) or m-state (after treatment with cytosolic ADP, Fig. 13G), but subsequent addition of 2 pM AA on the cytosolic side activated robust IH. Therefore, similar to UCP1 (Fedorenko et al, supra), FA only bind to AAC on the cytosolic face of the IMM.
[0133] Thus, AAC has two transport modes: the electrogenic ADP/ ATP exchange that relies on the c-m conformational change (Fig. 13 A) and IH that is activated by cytosolic FA independently of the AAC conformation (Extended Data Fig. 12G).
Nucleotide exchange negatively regulates IH
[0134] Application of ADP only on the cytosolic face of the IMM induced transient and partial IH inhibition (Fig. 4A and 4C). Such transient inhibition likely occurred because cytosolic ADP caused transient ADP transport and thus only briefly obstructed the translocation pathway for/// (Fig. 14A). Addition of 1 mM ADP on both IMM sides to activate continuous adenine nucleotide exchange via AAC led to steady (but still partial) inhibition of IH (Fig. 4B and 4D, and 14B). Symmetrical addition of 100 pM ADP caused smaller IH inhibition, while 10 pM ADP had no effect (Fig. 14C). [0135] Interestingly, the same ADP concentrations more profoundly inhibited IH via UCP1 as compared to AAC. For example, 100 mM ADP inhibited IH via UCP1 by >10-fold, compared to an ~2-fold inhibition of IH via AAC (Fig. 4E and 14D-14F). The stronger inhibition of UCP1 is likely because adenine nucleotides are not transported species but blockers of UCP1. Thus, despite a higher H+-transport capacity of UCP1 (Fig. ID), adenine nucleotides make ///via UCP1 and AAC comparable in amplitude, suggesting their closer impact on mitochondrial uncoupling in situ.
[0136] In conclusion, IH via AAC is reduced, but not fully inhibited, by adenine nucleotide exchange. The two transport modes of AAC appear to compete and likely occur via overlapping translocation pathways.
AAC deficiency disrupts mitochondrial uncoupling
[0137] In agreement with the dramatically reduced IH in AACl~/~ mouse heart mitoplasts (Fig. 2A), FA-induced uncoupled respiration was completely disrupted in isolated heart mitochondria oiAACT mice (Fig. 5 A and 15 A). The basal respiration of AAC I mitochondria was slightly greater than that of WT mitochondria (Fig. 15A and 15B), likely due to their greater exposure to oxidative stress in vivo and susceptibility to PTP activation (Morrow et ah, supra ; Esposito et ah, PNAS Sci USA 96, 4820-4825, 1999).
[0138] C2C12 mouse cell line deficient for AAC1 and AAC2 ( AACI/AAC2 double knockout,
DKO) was generated. The abundances of mitochondrial respiratory complexes and ATP synthase, the mitochondrial morphology, mitochondrial biomass per cell, and mitochondrial DNA abundance were overall similar in WT and DKO cells (Fig. 15C and 15E-15G). Isolated DKO mitochondria had disrupted ADP-dependent respiration (Fig. 15D). The DKO cells were more glycolytic and demonstrated a higher extracellular acidification rate than WT cells (Fig. 15H). Strikingly, the basal respiration of isolated DKO mitochondria was dramatically reduced both in the presence (Fig. 5B) and in the absence (Fig. 15D) of the ATP synthase inhibitor oligomycin, which illustrates that FA- dependent IH via AAC, strongly contributes to mitochondrial uncoupling. PA-induced uncoupled respiration was also disrupted in isolated DKO mitochondria (Fig. 5C). However, gramicidin A stimulated respiration to a similar degree in DKO and WT mitochondria confirming intact respiratory capacity of DKO mitochondria (Fig. 5B). [0139] Intact DKO cells had a significantly reduced basal respiration rate (Fig. 5D), which was expected because their mitochondria support neither ADP-dependent nor uncoupled respiration (Fig. 15Dd and Fig. 5B). Importantly, the respiration rates of WT and DKO cells with oligomycin treatment still differed significantly (Fig. 5D), demonstrating severe disruption of uncoupled respiration in intact DKO cells. Finally, sequentially higher PA concentrations failed to increase uncoupled respiration of DKO cells (Fig. 5E).
[0140] Together, these data demonstrate that disruption of the AAC-dependent IH profoundly affects mitochondrial uncoupling in isolated mitochondria and intact cells.
[0141] The data suggest that AAC is responsible for mitochondrial IH in all tissues that do not express UCP1. The principal characteristics of IH mediated by AAC and UCP1 are similar, with FA being activators and purine nucleotides being negative regulators. The data argue against the notions that close UCP1 homologs, UCP2 and UCP3, and all other SLC25 family members contribute to FA-dependent IH. If they did, we would detect significant AAC -independent IH in patch-clamp experiments, but we do not. We also did not identify large PTP-like channels/pores possibly formed by AAC, but the AAC-dependent IH may facilitate PTP opening by inducing mitochondrial depolarization, a key PTP activator (Halestrap & Richardson, J Mol Cell Cardiol , 2014; Bernardi el al, Physiol Rev 95, 1111-1155, 2015).
[0142] It was previously suggested that AAC can mediate FA-independent “basal” IH (Brand et al, Biochem J 392, 353-362, 2005), but the data demonstrate that FA are required for H+ transport via AAC. In fact, the presence of protonatable FA within the translocation pathway is the common requirement for IH via both AAC and UCP1. However, unlike with UCP1, FA appear to bind within the AAC translocation pathway as co-factors rather than transport substrates. Mitochondria of various tissues possess phospholipase A2 activity (Fedorenko etal, supra , Bertholet etal, supra ; Gadd et al, J Biol Chem , 281, 6931-6939, 2006; Kinsey et al, Am J Physiol Renal Physiol 292, F853-F860, 2006), which may be the primary physiological source of FA for AAC-dependent///.
[0143] With AAC, E is negatively regulated by ADP/ATP exchange, whereas with UCP1, E is simply inhibited by cytosolic adenine nucleotides. This ability to dynamically adjust E in accordance with ADP/ATP exchange (and thus cellular ATP demand) could make AAC uniquely suited to be the UCP of mitochondria that specialize in ATP production. Thus, AAC appears to serve as a master regulator of mitochondrial energy output, maintaining a delicate balance between ATP production and thermogenesis.
[0144] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Claims

WHAT IS CLAIMED IS:
1. A method of identifying a compound that activates adenosine diphosphate (ADP)/ adenosine triphosphate (ATP) carrier (AAC), said method comprising:
(a) docking a test compound in a AAC fatty acid binding site or an AAC aromatic binding site to evaluate a binding capacity of said compound to a FA binding site or an aromatic binding site of AAC in the inner mitochondrial membrane;
(b) combining a mitochondrial-containing cell and said test compound in a reaction vessel and measuring a decrease or increase in mitochondrial respiration in said mitochondrial-containing cell; and
(c) combining an inner mitochondrial membrane (IMM) with said test compound and measuring an AAC current to determine whether said test compound (i) inhibits
ADP/ ATP exchange or (ii) activates proton current through AAC, thereby identifying said test compound as a compound that activates AAC.
(d) The method of claim 1, further comprising determining whether said compound induces proton current across a cell plasma membrane.
(e) The method of claim 1, further comprising determining whether said compound induces proton current across a cell plasma membrane at micromolar concentrations or less.
(f) The method of claim 1, wherein said mitochondrial-containing cell is an intact myocyte C2C12 cell.
(g) The method of claim 1, wherein the measuring of said ACC current is accomplished using a mitochondrial patch-clamp method.
(h) The method of claim 1, wherein said compound activates proton current via AAC at the concentration of about 1 nM to 100 mM.
(i) The method of claim 1, wherein said compound activates proton current via AAC at the concentration of about 1 to 5 pM.
(j) The method of claim 1, wherein said protonatable group is located proximal to amino acid residues E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 in said AAC fatty acid binding site or amino acid residues E29, K32, Y186, G224, S227, D231, R234, or R235 in said AAC aromatic binding site, when performing said docking. (k) A method of treating a metabolic disorder in a subject in need thereof, said method comprising administering to said subject an effective amount of an AAC proton leak inducing agent.
(l) The method of claim 9, wherein said AAC proton leak inducing agent binds within the AAC fatty acid binding site.
(m) The method of claim 9, wherein said AAC proton leak inducing agent contacts amino acid residues E29, K32, T220, A221, R235, N276, V277, R279, G280, or M281 within said AAC fatty acid binding site.
(n) The method of claim 9, wherein said AAC proton leak inducing agent binds within the AAC aromatic binding site.
(o) The method of claim 12, wherein said AAC proton leak inducing agent contacts amino acid residues E29, K32, Y186, G224, S227, D231, R234, or R235 within said AAC aromatic binding site.
PCT/US2021/042723 2020-07-24 2021-07-22 Methods and compositions for treating metabolic disorders Ceased WO2022020559A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063056350P 2020-07-24 2020-07-24
US63/056,350 2020-07-24

Publications (1)

Publication Number Publication Date
WO2022020559A1 true WO2022020559A1 (en) 2022-01-27

Family

ID=79729854

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/042723 Ceased WO2022020559A1 (en) 2020-07-24 2021-07-22 Methods and compositions for treating metabolic disorders

Country Status (1)

Country Link
WO (1) WO2022020559A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999064458A1 (en) * 1998-06-08 1999-12-16 Trustees Of Boston University Novel methods for identifying modulators of mitochondrial anion carrier activity

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999064458A1 (en) * 1998-06-08 1999-12-16 Trustees Of Boston University Novel methods for identifying modulators of mitochondrial anion carrier activity

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BERTHOLE T ET AL.: "H+ Transport is an Integral Function of the Mitochondrial ADP/ATP Carrier", NATURE, vol. 571, no. 7766, July 2019 (2019-07-01), pages 515 - 520, XP036841903, DOI: 10.1038/s41586-019-1400-3 *
KUNJI ET AL.: "The transport mechanism of the mitochondrial ADP/ATP carrier", BIOCHIMICA.ET BIOPHYSICA ACTA (BBA)-MOLECULAR CELL RESEARCH, vol. 1863, no. 10, October 2016 (2016-10-01), pages 2379 - 93, XP029681016, DOI: 10.1016/j.bbamcr.2016.03.015 *

Similar Documents

Publication Publication Date Title
Casarotto et al. Antidepressant drugs act by directly binding to TRKB neurotrophin receptors
Duan et al. Mdivi-1 attenuates oxidative stress and exerts vascular protection in ischemic/hypoxic injury by a mechanism independent of Drp1 GTPase activity
Geoffroy et al. Positive allosteric modulation of NMDA receptors: mechanisms, physiological impact and therapeutic potential
Amato et al. GQ-16, a novel peroxisome proliferator-activated receptor γ (PPARγ) ligand, promotes insulin sensitization without weight gain
Lu et al. Succinate induces aberrant mitochondrial fission in cardiomyocytes through GPR91 signaling
McQuail et al. NR2A-containing NMDARs in the prefrontal cortex are required for working memory and associated with age-related cognitive decline
Nunes et al. New insights into RhoA/Rho-kinase signaling: a key regulator of vascular contraction
Peschke et al. New evidence for a role of melatonin in glucose regulation
Govers et al. Cellular regulation of endothelial nitric oxide synthase
Lin et al. Cardiac contraction and relaxation are regulated by distinct subcellular cAMP pools
Guo et al. Vascular endothelial growth factor signaling requires glycine to promote angiogenesis
Busquets-Garcia et al. Hippocampal protein kinase C signaling mediates the short-term memory impairment induced by delta9-tetrahydrocannabinol
Shahi et al. The possible roles of hyperpolarization-activated cyclic nucleotide channels in regulating pacemaker activity in colonic interstitial cells of Cajal
Zhang et al. AdipoRon, an adiponectin receptor agonist, attenuates cardiac remodeling induced by pressure overload
Yang et al. Oxidative stress inhibits vascular KATP channels by S-glutathionylation
Zhang et al. An underlying mechanism of dual Wnt inhibition and AMPK activation: mitochondrial uncouplers masquerading as Wnt inhibitors
WO2018053373A1 (en) Uses of satl-inducible kinase (sik) inhibitors for treating osteoporosis
Ying et al. The microtubule associated protein syntabulin is required for glucose-stimulated and cAMP-potentiated insulin secretion
Chan et al. Cysteine allostery and autoinhibition govern human STING oligomer functionality
Butler et al. Preferential formation of human heteromeric SK2: SK3 channels limits homomeric SK channel assembly and function
WO2022020559A1 (en) Methods and compositions for treating metabolic disorders
Qi et al. Novel α‐amino‐3‐hydroxy‐5‐methyl‐4‐isoxazole‐propionic acid receptor (AMPAR) potentiator LT‐102: A promising therapeutic agent for treating cognitive impairment associated with schizophrenia
EP2785335A1 (en) Methods and pharmaceutical compositions for the treatment of darier disease
Hool Elucidating the role of the L-type calcium channel in excitability and energetics in the heart: The ISHR 2020 Research Achievement Award Lecture
US9874553B2 (en) Targeted chemical high-throughput screening method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21845513

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21845513

Country of ref document: EP

Kind code of ref document: A1