WO2021256530A1 - Il-21に対するアプタマーおよびその使用 - Google Patents
Il-21に対するアプタマーおよびその使用 Download PDFInfo
- Publication number
- WO2021256530A1 WO2021256530A1 PCT/JP2021/023023 JP2021023023W WO2021256530A1 WO 2021256530 A1 WO2021256530 A1 WO 2021256530A1 JP 2021023023 W JP2021023023 W JP 2021023023W WO 2021256530 A1 WO2021256530 A1 WO 2021256530A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- aptamer
- sequence
- formula
- represented
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5041—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/313—Phosphorodithioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/317—Chemical structure of the backbone with an inverted bond, e.g. a cap structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3515—Lipophilic moiety, e.g. cholesterol
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
Definitions
- the present invention is an invention relating to an aptamer for interleukin-21.
- Pulmonary arterial pulmonary hypertension is a disease having hyperproliferation of the media and intima of the pulmonary artery as a pathological background.
- PAH Pulmonary arterial pulmonary hypertension
- IL-6 interleukin-6
- Th17 cells which are a type of helper T cells
- IL-6 interleukin-6
- IL-21 interleukin-21
- IL-21 induces macrophages present in the lung to a predominant state of M2 macrophages, and correlates with the accumulation of M2 macrophages in lung tissue to promote the proliferation of pulmonary artery smooth muscle cells, thereby promoting PAH. It is thought to lead to the onset.
- Patent Document 1 describes that inhibition of signal transduction from IL-21 enables prevention and treatment of pulmonary hypertension. Specifically, it is based on the fact that the anti-IL-21 antibody inhibits the interaction between IL-21 and the IL-21 receptor, thereby inhibiting signal transduction from IL-21.
- Patent Document 1 describes IL-21 antibody, IL-21 receptor antibody, IL-21 and IL-21 receptors as substances capable of inhibiting the interaction between IL-21 and IL-21 receptor. Peptides that bind to the IL-21 aptamer are mentioned, but neither is described nor suggested.
- Aptamers are nucleic acids that specifically bind to target molecules (proteins, sugar chains, hormones, etc.) and can bind to target molecules via the three-dimensional structure formed by single-stranded RNA (or DNA). can.
- a screening method called the SELEX method Systematic Evolution of Ligands by Exponential Engineering
- the chain length of the aptamer obtained by the SELEX method is about 80 nucleotides, and then the chain length is shortened by using the physiological inhibitory activity of the target molecule as an index.
- chemical modification is added for the purpose of improving stability in the living body, and optimization as a pharmaceutical product is achieved.
- Aptamers are less susceptible to immune exclusion and are less likely to have side effects such as antibody-specific antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cellular cytotoxicity (CDC).
- ADCC antibody-specific antibody-dependent cellular cytotoxicity
- CDC complement-dependent cellular cytotoxicity
- aptamers are highly water-soluble, which is also advantageous.
- long-term storage stability, heat, and solvent resistance are also predominant features of aptamers.
- aptamers generally have a shorter half-life in blood than antibodies. However, this point may also be advantageous from the viewpoint of toxicity.
- RNA aptamer drugs have been developed, including Macugen (target disease: age-related macular degeneration), which is the first RNA aptamer drug approved in the United States in December 2004.
- Macugen target disease: age-related macular degeneration
- DNA aptamers that can be stably and inexpensively produced in vivo have been developed.
- aptamers have a higher affinity than antibodies with similar functions. From the viewpoint of delivery, since the aptamer has a molecular size of about 1/10 of that of the antibody, tissue migration is likely to occur, and it is easier to deliver the drug to the target site. Therefore, it may be possible to develop drugs that are more useful than antibodies.
- An object of the present invention is to provide an aptamer for IL-21.
- the present invention is as follows.
- Aptamer [4] The aptamer according to [3], wherein the hydroxy group at the ribose 2'position is substituted with a fluoro group in the first C in the formula (1).
- N 1a is an arbitrary nucleotide sequence of 3 to 7 lengths
- N 2a is an arbitrary nucleotide sequence of 3 to 8 lengths
- X 1 and X 6 , X 2 And X 5 and X 3 and X 4 are complementary nucleotides, respectively, where R represents A or G, Y represents C or U, K represents G or U, and M represents G or U.
- the aptamer according to any one of [1] to [7], which comprises a nucleotide sequence represented by A or C).
- the aptamer comprising a nucleotide sequence in which one or several nucleotides are substituted, deleted, inserted or added.
- II) The 2'position of ribose of each pyrimidine nucleotide is a fluorine atom.
- [13] The aptamer according to [8] or [9], which comprises the following nucleotide sequence of (a) or (b).
- the aptamer of the present invention or a complex containing an aptamer may be useful for the prevention or treatment of diseases associated with IL-21, particularly for the prevention or treatment of pulmonary hypertension. Alternatively, it may be useful for purification and concentration of IL-21, labeling of IL-21, and detection and quantification of IL-21.
- FIG. 1 shows the secondary structure prediction of each aptamer represented by SEQ ID NOs: 1 and 2.
- FIG. 2 is a sensorgram showing that each aptamer represented by SEQ ID NOs: 1 and 2 binds to human IL-21.
- FIG. 3 is a sensorgram showing that the aptamer represented by SEQ ID NO: 1 inhibits the binding of human IL-21 to its receptor.
- FIG. 4 shows the secondary structure prediction of each aptamer represented by SEQ ID NOs: 3-5 and 7.
- FIG. 5 shows a secondary structure prediction of the aptamer represented by SEQ ID NO: 22.
- FIG. 6 shows the secondary structure prediction of each aptamer represented by SEQ ID NOs: 25 to 36.
- the present invention provides an aptamer that binds to interleukin (IL) 21, that is, an aptamer that has a binding activity to IL-21 (hereinafter, may be referred to as "aptamer of the present invention").
- IL interleukin
- An aptamer is a nucleic acid molecule having a binding activity to a predetermined target molecule. Aptamers can inhibit the activity of a given target molecule by binding to the given target molecule.
- the aptamer of the present invention can be RNA, DNA, modified nucleic acid or a mixture thereof. Further, the aptamer of the present invention may be in a linear, annular or stem-loop shape, but preferably has a stem-loop structure described later.
- the aptamer of the present invention binds to IL-21 in a physiological buffer.
- the buffer solution is not particularly limited, but a buffer solution having a pH of about 5.0 to 10.0 is preferably used, and as such a buffer solution, for example, Solution A described later (see Example 1). Can be mentioned.
- the aptamer of the present invention binds to IL-21 with a strength that can be detected by any of the following tests. Biacore T200 manufactured by GE Healthcare is used for measuring the bond strength. One measurement method is to first immobilize the aptamer on the sensor chip.
- the IL-21 solution for analysis is prepared to 0.1 ⁇ M and injected to detect the binding of human IL-21 to the aptamer.
- an aptamer targeting other than human IL-21 (hereinafter, “non-human IL-21 aptamer”) is used as a negative control, and human IL-21 is compared with the control nucleic acid.
- non-human IL-21 aptamer When it binds to an aptamer significantly strongly, it can be determined that the aptamer has a binding ability to human IL-21.
- the aptamer of the present invention can bind to IL-21 and inhibit the activity of IL-21. That is, the aptamer of the present invention may also have an inhibitory activity against IL-21.
- the inhibitory activity against IL-21 means an inhibitory ability against any activity possessed by IL-21.
- IL-21 acts on IL-21 receptor-expressing cells to activate signal transduction and induce the production of various cell growth factors and their receptors. Therefore, the inhibitory activity against IL-21 may be an activity that inhibits intracellular signal transduction via the IL-21 receptor. Expression of these various cell growth factors and their receptors may result in increased cell growth activity and migration activity, or may reduce the secretion of certain humoral factors from various cells. Therefore, the inhibitory activity of IL-21 means inhibition of those activities and reduction of humoral factors secreted by conventional stimulation of IL-21.
- the aptamer of the present invention when the aptamer of the present invention binds to IL-21 and inhibits the binding between IL-21 and the IL-21 receptor, the action associated with the activation of the intracellular signal transduction pathway mediated by the IL-21 receptor, For example, the secretion of interferon ⁇ in NK cells can be inhibited.
- the aptamer of the present invention when the aptamer of the present invention reduces the secretion of interferon gamma in NK cells, the aptamer of the present invention binds to IL-21 and inhibits the binding of IL-21 to the IL-21 receptor. It can be said that there is.
- IL-21 is a cytokine strongly expressed in CD4-positive T cells and natural killer T cells, and is, for example, a protein having an amino acid sequence represented by SEQ ID NO: 44.
- IL-21 in the present invention can also be produced using mammalian cells such as mice, insect cells, cultured cells such as Escherichia coli, and further can be produced by chemical synthesis. When prepared by cultured cells or chemical synthesis, a mutant can be easily prepared by a method known per se.
- the "variant" of IL-21 is a substance in which one or several amino acids are substituted, deleted, added, etc. from a known amino acid sequence of IL-21, or a part of a known amino acid sequence of IL-21.
- IL-21 in the present invention contains these variants.
- the IL-21 receptor means a cell surface protein to which IL-21 binds.
- IL-21R a protein having an amino acid sequence represented by SEQ ID NO: 45 is known.
- the IL-21 receptor in the present invention may be a protein containing a natural amino acid sequence or a variant thereof.
- the "variant" of the IL-21 receptor is one in which one to several amino acids constituting the amino acid sequence of the known IL-21 receptor are substituted, deleted, added, etc., or known. It consists of an amino acid sequence that is a part of the amino acid sequence of the IL-21 receptor, and means a protein or peptide having a binding activity to IL-21.
- the invention provides an aptamer that inhibits the binding of IL-21 to the IL-21 receptor.
- the aptamer of the present invention is not particularly limited as long as it is an aptamer that binds to any part of IL-21. Further, the aptamer of the present invention is not particularly limited as long as it can bind to any portion of IL-21 and inhibit its activity.
- the length of the aptamer of the present invention is not particularly limited and may be usually about 200 nucleotides or less, but for example, about 100 nucleotides or less, preferably about 70 nucleotides or less, and more preferably 65 nucleotides or less. It is even more preferably 50 nucleotides or less, even more preferably about 40 nucleotides or less, and most preferably 37 nucleotides or less.
- the smaller the total number of nucleotides the easier the chemical synthesis and mass production, and the greater the cost advantage. In addition, it is considered to be easy to chemically modify, have high in vivo stability, and have low toxicity.
- the lower limit of the aptamer length of the present invention is not particularly limited as long as it contains a common sequence (CGRYKACY) and can adopt a stem-loop structure described later, but the aptamer length is, for example, 20 nucleotides or more, preferably 30 nucleotides or more. As mentioned above, it may be more preferably 35 nucleotides or more. From the above, in a particularly preferred embodiment of the present invention, the length of the aptamer of the present invention is 35 to 40 nucleotides.
- the aptamer of the present invention is formulated in formula (1) :. CGRYKACY (1) (In the formula, R represents A or G, Y represents C or U, and K represents G or U), which is an aptamer that binds to IL-21 and comprises a nucleotide sequence. ..
- Each nucleotide constituting the aptamer of the present invention may be ribose or deoxyribose independently.
- uracil (U) shall be read as thymine (T).
- the fourth Y is preferably C
- the K is preferably U
- the eighth Y is preferably U.
- the aptamer of the present invention is the formula (2) :.
- CCKYC (2) In the formula, K represents G or U, Y represents C or U
- GYMCG (3) In the formula, Y represents C or U and M represents A or C, which is an aptamer that binds to IL-21 and further comprises a nucleotide sequence.
- K is preferably U, and Y is preferably U. Further, in the formula (3), Y is preferably C, and M is preferably C.
- each nucleotide sequence is arranged in the order of 2), formula (1), and formula (3).
- the aptamer of the present invention can be satisfactorily bound to IL-21.
- each of the nucleotide sequences of the formulas (1), (2) and (3) may be linked via a nucleotide sequence serving as a linker (spacer).
- the nucleotide sequence serving as a linker is not particularly limited, and any sequence can be adopted as long as the aptamer of the present invention binds to IL-21.
- the aptamer of the present invention is more preferably the following formula (4): CCKYC-N 1- CGRYKACY-N 2- GYMCG (4) (In the formula, N 1 is an arbitrary nucleotide sequence of 5 to 9 lengths, N 2 is an arbitrary nucleotide sequence of 5 to 10 lengths, and R represents A or G. , Y represents C or U, K represents G or U, and M represents A or C), including an aptamer comprising a nucleotide sequence represented by).
- N 1 and N 2 correspond to the nucleotide sequence serving as the linker
- the formula (2), the formula (1), and the formula (3) are in this order from the 5'end side via the linker. It can be seen that the nucleotide sequences are aligned.
- the length of N 1 is usually 5 to 9 nucleotides, preferably 5 to 7 nucleotides, and most preferably 6 nucleotides.
- the length of N 2 is usually 5-10 nucleotides, preferably 5-8 nucleotides, most preferably 6 or 7 nucleotides.
- the difference in length between N 1 and N 2 is preferably 0 to 2, and more preferably 0 or 1.
- N 1 and N 2 located on both sides of the equation (1) form a stem structure, and this stem structure has a partial bulge structure or loop structure due to mismatch as long as the stem structure is formed as a whole. It may be included.
- the formula (2) portion (CCKYC) and the formula (3) portion (GYMCG) form a base pair at both ends of each to form an internal loop, and the formula (2) is formed.
- It may be any nucleotide sequence as long as the moiety (CGRYKACY) can form a loop.
- Formula (1) portion may form a loop in the whole (CG R YKAC Y), for example, base pairs with the underlined R and Y (e.g., A-U)
- a loop may be formed by forming the loop. Regardless of which loop is formed, the function of the aptamer of the present invention is exhibited as long as it retains the above-mentioned common sequence.
- the 2 nucleotides on the 5'end side of N 2 form a stem structure with the "CG" on the 5'end side of the formula (1), as long as the sequence forms the stem structure. It is not limited, but is preferably "CG”.
- the preferred nucleotides in each partial sequence corresponding to the formulas (1) to (3) are as described above for the formulas (1) to (3).
- the following formula (5) is more preferable.
- N 1a is an arbitrary nucleotide sequence of 3 to 7 lengths
- N 2a is an arbitrary nucleotide sequence of 3 to 8 lengths
- X 1 and X 6 , X 2 And X 5 and X 3 and X 4 are complementary nucleotides, respectively, where R represents A or G, Y represents C or U, K represents G or U, and M represents G or U.
- R represents A or G
- Y represents C or U
- K represents G or U
- M represents G or U.
- an aptamer comprising a nucleotide sequence represented by (representing A or C).
- N 1a and N 2a correspond to the nucleotide sequence serving as the linker, and the formula (2), the formula (1), and the formula (3) are in this order from the 5'end side via the linker. It can be seen that the nucleotide sequences are aligned.
- the formulas (1), (2) and (3) in an arrangement and positional relationship as in the formula (5), the aptamer of the present invention binds to IL-21 even more strongly, and therefore has a high effect. Can be demonstrated.
- the length of N 1a is usually 3 to 7 nucleotides, preferably 3 to 5 nucleotides, and most preferably 4 nucleotides.
- the length of N 2a is usually 3 to 8 nucleotides, preferably 3 to 6 nucleotides, and most preferably 4 or 5 nucleotides.
- the difference in length between N 1a and N 2a is preferably 0 to 2, and more preferably 0 or 1.
- N 1a and N 2a form a stem structure together with X 2 , X 3 and X 5 , X 4 , respectively, but this stem structure as a whole forms a stem structure as long as it is formed. It may include a partial bulge structure or loop structure due to a mismatch between N 1a and N 2a.
- X 1 and X 6 and X 2 and X 5 form base pairs, respectively, so that the equation (2) moiety (CCKYC) and the equation (3) moiety (GYMCG) form an internal loop. Further stabilized, X 3 and X 4 wherein by the base pairing (1) part (CGRYKACY) is to form a loop.
- the preferred nucleotides in each partial sequence corresponding to the formulas (1) to (3) are as described above for the formulas (1) to (3).
- examples of the aptamer of the present invention include aptamers comprising the nucleotide sequences represented by SEQ ID NOs: 1-5, 7, 20-29 and 31-43.
- the nucleotide sequences represented by SEQ ID NOs: 1 to 5, 7, 20 to 29 and 31 to 43 (where uracil may be thymine) are shown below.
- the underline shows the common sequence (formula (2), formula (1) and formula (3) in order from the 5'end side).
- SEQ ID NO: 40 GGA CCUCC AACACG CGACUACU CGUGAUU GCCCG UCC
- SEQ ID NO: 41 GGA CCUUC AACACG CGACGACU CGUGAUU GCCCG UCC
- SEQ ID NO: 42 GGA CCUUC AACACG CGACUACC CGUGAUU GCCCG
- SEQ ID NO: 43 GGA CCUUC AACACG CGACUACU CGUGAUU GCACG UCC
- the aptamer of the invention comprises the sequence represented by SEQ ID NO: 24 or 38.
- the aptamer of the invention comprises a nucleotide sequence in which one or several nucleotides have been substituted, deleted, inserted or added in any of the above aptamers, and the binding activity to IL-21.
- it is an aptamer having an activity of inhibiting the binding of IL-21 to its receptor.
- the number of nucleotides to be substituted, deleted, inserted or added is not particularly limited as long as it still binds to IL-21 even after the substitution, deletion, insertion or addition, but is preferably 1 to about 10, for example. It can be 1 to 6, more preferably 1 to 5, still more preferably 1 to 4, still more preferably 1 to 3, and most preferably 1 or 2.
- the site where the nucleotide is substituted, deleted, inserted or added is also not particularly limited as long as it still binds to IL-21 even after the substitution, deletion, insertion or addition, but the above formulas (1), (2) and (3).
- Nucleotides can be substituted, deleted, inserted or added in 1 to 3 places, preferably 1 or 2 places, more preferably 1 place (provided that the formulas (1), (2) and In (3), at a site where a plurality of types of nucleotides can be taken (that is, R, Y, K or M), substitutions between nucleotides included in the options shall not be included). Particularly preferably, the formulas (1), (2) and (3) do not include nucleotide substitutions, deletions or insertions. On the other hand, at other sites, substitutions or deletions of more nucleotides (eg, 1 to about 10, preferably 1 to 6, more preferably 1 to 5, still more preferably 1 to 4), Insertion or addition may also be acceptable.
- substitutions or deletions of more nucleotides eg, 1 to about 10, preferably 1 to 6, more preferably 1 to 5, still more preferably 1 to 4
- Insertion or addition may also be acceptable.
- the aptamer of the present invention may also be a conjugate containing a plurality of conjugates of any one of the above-mentioned aptamers, and one or more of each of two or more selected aptamers selected from the above. These conjugates can also bind to IL-21.
- the connection can be performed by a tandem bond.
- a linker may be used for the connection.
- the linkers include nucleotide chains (eg, 1 to about 20 nucleotides), non-nucleotide chains (eg,-(CH 2 ) n -linker,-(CH 2 CH 2 O) n -linker, hexaethylene glycol linker, TEG linker.
- the plurality in the plurality of conjugates is not particularly limited as long as it is two or more, but may be, for example, two, three, or four.
- Each nucleotide contained in the aptamer of the present invention is the same or different, and is a nucleotide containing a hydroxy group at the 2'position of ribose (eg, ribose of pyrimidine nucleotide, ribose of purimidine nucleotide) (that is, a natural ribose).
- ribose eg, ribose of pyrimidine nucleotide, ribose of purimidine nucleotide
- the hydroxy group can be a nucleotide substituted (modified) with any atom or group (sometimes referred to herein as a "modified nucleotide").
- Such arbitrary atoms or groups include, for example, hydrogen atom, fluorine atom or -O-alkyl group (eg, -O-Me group), -O-acyl group (eg, -O-CHO group), amino. Groups (eg, -NH 2 groups) and the like can be mentioned.
- the aptamers of the invention also have at least one (eg, 1, 2, 3 or 4) nucleotides at the 2'position of ribose, a hydroxy group, or any atom or group described above, eg, a hydrogen atom. It may contain at least two (eg, 2, 3 or 4) atoms or groups selected from the group consisting of a fluorine atom, an —O—Me group.
- pyrimidine nucleotides are nucleotides in which the 2'position of ribose is a fluorine atom, or whether the fluorine atom is the same or different and unsubstituted, any of the above-mentioned. It can be an atom or group, preferably a nucleotide substituted with an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and a methoxy group.
- an aptamer in which the ribose 2'position of the pyrimidine nucleotide is fluorolated can be obtained.
- the aptamer in which the fluorine atom is substituted with the other atom or group described above can be produced by the method described below.
- all purine nucleotides are either nucleotides in which the 2'position of ribose is a hydroxy group, or the hydroxy groups are the same or different and unsubstituted, as described above. It can be an atom or group, preferably a nucleotide substituted with an atom or group selected from the group consisting of a hydrogen atom, a methoxy group and a fluorine atom. Aptamers in which the hydroxy group is substituted with the other atom or group described above can be produced by the method described below.
- all pyrimidine nucleotides are selected from the group consisting of any of the atoms or groups mentioned above, eg, a hydrogen atom, a hydroxy group and an -O-Me group, in which the fluorine atom at the 2'position of ribose is located. It can be a nucleotide substituted with the same atom or group.
- all purine nucleotides are also selected from the group consisting of any of the above-mentioned atoms or groups in which the hydroxy group at the 2'position of ribose is described, for example, a hydrogen atom, a fluorine atom and an —O—Me group. It can be a nucleotide substituted with the same atom or group.
- each pyrimidine nucleotide contained in the aptamer of the present invention is a nucleotide containing a fluorine atom at the 2'position of ribose, and each purine nucleotide has a hydroxy group at the 2'position of ribose. Containing nucleotides.
- the 2'-fluorine atom of the ribose of each pyrimidine nucleotide may be independently substituted with an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and a methoxy group.
- hydroxy group at the 2'position of the ribose of each of the above-mentioned purine nucleotides may be independently substituted with an atom or group selected from the group consisting of a hydrogen atom, a methoxy group and a fluorine atom.
- the nucleotide constituting the aptamer is RNA (that is, the sugar group is ribose), and the mode of modification to the sugar group in the nucleotide will be described. It does not mean that DNA is excluded from the nucleotides constituting the above, and is appropriately read as a modification to DNA.
- the nucleotide constituting the aptamer is DNA
- the replacement of the hydroxyl group at the 2'position of ribose with X is read as the replacement of the hydrogen atom at the 2'position of deoxyribose with X.
- one or several of the phosphate diester bonds in the nucleotides are modified with arbitrary substituents. Alternatively, it may be replaced.
- the phosphate diester bond may be replaced with a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond, or the like.
- the nucleotide is replaced with a phosphorothioate bond
- the phosphate group at the binding site between adjacent nucleotides is sulfurized, that is, the phosphodiester bond is modified to a phosphorothioate bond.
- aptamer of the present invention one or several, for example, 1 to 2, 1 to 3, 1 to 4, 1 to 5 nucleotides are used for the purpose of stabilizing the aptamer and improving its activity. It may be substituted with the crosslinked nucleic acid Bridged Nucleic Acid (BNA) or Locked Nucleic Acid (LNA).
- BNA Bridged Nucleic Acid
- LNA Locked Nucleic Acid
- bridged nucleic acid refers to a nucleic acid having a structure in which the degree of freedom of the nucleic acid is constrained by intramolecular cross-linking to enhance the binding affinity for the complementary sequence and acquire nuclease resistance, for example, 2 ', 4'-BNA (LNA), 2'-O, 4'-C-ethylene-bridged Nucleic Acid (ENA) and the like can be mentioned, but the present invention is not limited thereto.
- the aptamer of the present invention may be one in which the sugar residue (eg, ribose) of each nucleotide is modified in order to enhance the binding property, stability, drug delivery property and the like to IL-21.
- the site modified in the sugar residue include those in which the oxygen atom at the 2'position, 3'position and / or 4'position of the sugar residue is replaced with another atom.
- Types of modification include, for example, fluorolysis, O-alkylation (eg, O-methylation, O-ethylation), O-allylation, S-alkylation (eg, S-methylation, S-ethylation). ), S-allylation, amination (eg, -NH 2 ).
- aptamer of the present invention may be produced with a certain modification of the oxygen atom at the ribose 2'position of the pyrimidine nucleotide from the production method. For example, when the production method using T7 Transcription Kit (manufactured in-house) is applied.
- the aptamer of the present invention may preferably be an aptamer modified with a sugar residue of at least one nucleotide.
- modification of sugar residues can be carried out by a method known per se (eg, Sproat et al., (1991), Nucl. Acid. Res. 19, 733-738; Cotton et al., (1991). ), Nucl. Acid. Res.
- the hydroxyl group at the ribose 2'position is selected from the group consisting of a hydrogen atom, a hydroxyl group and a methoxy group based on the aptamer in which the hydroxyl group at the ribose 2'position of all pyrimidine nucleotides is replaced with a fluoro group.
- Aptamers substituted with atoms or groups can be produced.
- the hydroxy group at the ribose 2'position is substituted with a fluoro group in the first C in the formula (1).
- the hydroxy group at the ribose 2'position is substituted with a fluoro group.
- the hydroxy group at the ribose 2'position is substituted with a fluoro group in the fourth C in the formula (3): GYMCG.
- the aptamers of the present invention also have nucleobases (eg, purines, pyrimidines) modified (eg, chemically substituted) to enhance binding to IL-21, prevention of multimerization, stability, drug delivery, etc. It may be the one. Such modifications include, for example, 5-position pyrimidine modification, 6- and / or 8-position purine modification, modification with an extracyclic amine, substitution with 4-thiouridine, substitution with 5-bromo or 5-iodo-uracil. Can be mentioned. Further, the phosphate group contained in the aptamer of the present invention may be modified so as to be resistant to nucleases and hydrolysis.
- nucleobases eg, purines, pyrimidines
- modifications include, for example, 5-position pyrimidine modification, 6- and / or 8-position purine modification, modification with an extracyclic amine, substitution with 4-thiouridine, substitution with 5-bromo or 5-iodo-uracil.
- the P (O) O group is P (O) S (thioate), P (S) S (dithioate), P (O) N (R) R'(amidate), P (O) R, P ( O) oR, CO or CH 2 (formacetal) or 3'-amine (-NH-CH 2 -CH 2 - ) wherein each R or R 'may be substituted [wherein the independently, H Alkyl (eg, methyl, ethyl) that is, is substituted, or is not substituted].
- the linking group include -O-, -N- or -S-, which can be attached to an adjacent nucleotide through the linking group. Modifications may also include 3'and 5'modifications such as capping.
- Modifications are further made on polyethylene glycol (PEG), amino acids, peptides, inverted dT, nucleic acids, nucleosides, Myristoyl, Lysotropic-oleyl, Docosanyl, Lauroyl, Stearoyl, Palmitoyl, Oleoyl, Linoleoyl, other lipids.
- PEG polyethylene glycol
- amino acids amino acids
- peptides inverted dT
- nucleic acids nucleosides
- Myristoyl Lysotropic-oleyl
- Docosanyl Lauroyl
- Stearoyl Stearoyl
- Palmitoyl Oleoyl
- Linoleoyl other lipids.
- Dyes fluorescent substances
- anticancer agents toxins
- enzymes enzymes
- radioactive substances biotin and the like
- the molecular weight of PEG is not particularly limited, but is preferably 1000 to 100,000, more preferably 30,000 to 90000.
- the PEG may be linear or branched into two or more chains (multi-arm PEG). End addition of PEG is useful for preventing aptamer multimerization, which will be described later.
- Such PEG is not particularly limited, and a commercially available or known PEG can be appropriately selected and used by those skilled in the art (for example, http: //www.peg-drug.com/peg_product/brunched.html).
- 2 branches aS type molecular weight 40000 (functional group: -CH 2 -COO-NHS) PEG (Y-NHS-40K (Made by Jenkem)
- 2-branched GS type with a molecular weight of 40,000 (functional group: -CO- (CH 2 ) 3- COO-NHS) PEG (SUNBRIGHT GL2-400GS)
- 2-branched TS type with a molecular weight of 40,000 active group: -COO-NHS) PEG (SUNBRIGHT GL2-400TS made by Nichiyu)
- 4-branched TS type PEG (SUNBRIGHT GL4-400TS made by Nichiyu) with a molecular weight of 40,000
- 2-branched TS type PEG (SUNBRIGHT GL2-800TS made by Nichiyu) with a molecular weight of 80000. )
- 4-branched TS type PEG having a molecular weight 40000 functional group: -CH 2 -COO-NHS) P
- the aptamer of the present invention may have PEG directly added to the end, but a linker having a group capable of binding to PEG is added to the end thereof, and PEG is added to the aptamer of the present invention via the linker. It is more preferable to add it.
- the linker of PEG and the aptamer used in the present invention is not particularly limited, and the number of carbon chains, functional groups and the like can be appropriately selected according to the binding site, the type of PEG and the like.
- Examples of such a linker include a linker having an amino group, and specifically, when added to the 5'end, ssH Linker (SAFC) or DMS (O) MT-AMINO-MODEFIER (GLENRESEARCH) can be used.
- SAFC ssH Linker
- DMS O
- MT-AMINO-MODEFIER MT-AMINO-MODEFIER
- this linker for example, an active group of N-hydroxysuccinimide is added to PEG, and this is reacted with an amino group on the linker side, whereby the aptamer used in the present invention and PEG are transferred via the linker. Can be combined.
- PEG and the linker commercially available ones can be preferably used. Further, those skilled in the art can appropriately set the reaction conditions and the like regarding the binding of PEG, the linker and the aptamer used in the present invention.
- the aptamer of the present invention can be chemically synthesized by the methods disclosed in the present specification and known in the art.
- the aptamer binds to the target substance by various binding modes such as ionic bond using negative charge of phosphate group, hydrophobic bond and hydrogen bond using ribose, hydrogen bond and stacking bond using nucleobase.
- ionic bond utilizing the negative charge of the phosphate group existing as many as the number of constituent nucleotides is strong, and the ionic bond is bound to the positive charge of lysine and arginine existing on the surface of the protein. Therefore, nucleobases that are not directly involved in binding to the target substance can be substituted.
- the stem structure portion has already been base paired and faces the inside of the double helix structure, it is difficult for the nucleobase to directly bind to the target substance. Therefore, replacing a base pair with another base pair often does not reduce the activity of the aptamer. Even in structures that do not form base pairs, such as loop structures, base substitution is possible when the nucleobase is not involved in direct binding to the target molecule.
- the modification of the 2'position of ribose in rare cases, the functional group at the 2'position of ribose may interact directly with the target molecule, but in many cases it is irrelevant and is replaced with another modified molecule. It is possible. Thus, aptamers often retain their activity unless the functional groups involved in direct binding to the target molecule are substituted or deleted. It is also important that the overall three-dimensional structure does not change significantly.
- Aptamers should utilize the SELEX method and its improved methods (eg, Ellington et al., (1990), Nature, 346,818-822; Tuerk et al., (1990), Science, 249,505-510). Can be made with.
- the SELEX method by increasing the number of rounds or using a competing substance, an aptamer having a stronger binding force to the target substance is concentrated and selected. Therefore, by adjusting the number of rounds of SELEX and / or changing the race condition, aptamers having different binding forces, aptamers having different binding forms, and aptamers having the same binding force and binding form but different base sequences. You may be able to get an aptamer.
- the SELEX method includes an amplification process by PCR, and by inserting mutations such as by using manganese ions in the process, it becomes possible to perform SELEX with more variety.
- the aptamers obtained by SELEX are nucleic acids with high affinity for the target substance, but that does not necessarily mean that those aptamers bind to the active site of the target substance. Therefore, the aptamer obtained by SELEX does not always affect the function of the target substance. Aptamers that do not bind to the active site may not affect the activity of the target substance.
- BINKLEY et al. Nucleic Acids Res. 23 (16): 3198-3205 (1995) discloses several types of aptamers that bind to nerve growth factor (NGF) obtained by SELEX, and among them, three types having high affinity for NGF.
- NGF nerve growth factor
- Whether or not the aptamer for IL-21 obtained by SELEX inhibits the activity of IL-21 is determined, for example. , Can be verified using the various assay methods described in the Examples below.
- the active aptamer selected in this way can be further improved in performance by performing optimized SELEX.
- optimized SELEX a template in which a part of the aptamer having a certain sequence is made into a random sequence or a template in which a random sequence of about 10 to 30% is doped is prepared, and SELEX is performed again.
- the aptamer obtained by SELEX has a length of about 80 nucleotides, and it is difficult to use it as it is as a medicine. Therefore, by repeating trial and error, the length is shortened to a length that allows easy chemical synthesis (for example, chemical synthesis is possible in an amount of about 60 nucleotides or less, more preferably about 50 nucleotides or less, still more preferably 45 nucleotides or less). Is preferable.
- the aptamer obtained with SELEX depends on its primer design, and the ease of subsequent minimization work changes. If the primers are not designed well, even if SELEX can select active aptamers, further development will be impossible.
- Aptamer can be chemically synthesized, so it is easy to modify. Which nucleotides can be replaced or deleted by the aptamer by predicting the secondary structure using the MFOLD program, and by predicting the three-dimensional structure by X-ray analysis or NMR analysis, and where new nucleotides can be used. Can be predicted to some extent whether it can be inserted. The predicted new sequence of aptamers can be easily chemically synthesized, and whether or not the aptamers retain their activity can be confirmed by an existing assay system.
- the important part of the obtained aptamer for binding to the target substance can be identified by repeating the above trial and error, the activity often changes even if a new sequence is added to both ends of the sequence. do not do.
- the length of the new sequence is not particularly limited.
- the aptamer can be highly designed or modified.
- the present invention also includes a predetermined sequence (eg, a sequence corresponding to a portion selected from a stem portion, an internal loop portion, a hairpin loop portion and a single chain portion: hereinafter abbreviated as a fixed sequence if necessary).
- a predetermined sequence eg, a sequence corresponding to a portion selected from a stem portion, an internal loop portion, a hairpin loop portion and a single chain portion: hereinafter abbreviated as a fixed sequence if necessary.
- a method for producing an aptamer in which the aptamer can be highly designed or modified.
- the method for manufacturing such an aptamer is as follows:
- (N) a represents a nucleotide chain consisting of a N
- (N) b represents a nucleotide chain consisting of b N
- N is the same or different, respectively, A, G, A nucleotide selected from the group consisting of C, U and T (preferably A, G, C and U).
- Each of a and b may be the same or different and may be any number, but for example, 1 to about 100, preferably 1 to about 50, more preferably 1 to about 30, still more preferably 1 to about 20 or 1.
- a single nucleic acid molecule or a plurality of nucleic acid molecules eg, a library of nucleic acid molecules having different numbers of a, b, etc.
- the present invention also provides a complex containing the aptamer of the present invention and a functional substance bound thereto.
- the bond between the aptamer and the functional substance in the complex of the present invention can be a covalent bond or a non-covalent bond.
- the complex of the present invention may be a combination of the aptamer of the present invention and one or more (eg, 2 or 3) functional substances of the same kind or different kinds.
- the functional substance is not particularly limited as long as it can newly add some function to the aptamer of the present invention or change (eg, improve) some property that can be retained by the aptamer of the present invention.
- Functional substances include proteins, peptides, amino acids, lipids, carbohydrates, monosaccharides, polynucleotides, and nucleotides.
- Functional substances also include, for example, affinity substances (eg, biotin, streptavidin, polynucleotides having an affinity for the target complementary sequence, antibodies, glutathionecepharose, histidine), labeling substances (eg, fluorescent substances, etc.).
- affinity substances eg, biotin, streptavidin, polynucleotides having an affinity for the target complementary sequence, antibodies, glutathionecepharose, histidine
- labeling substances eg, fluorescent substances, etc.
- drug delivery media eg, liposomes, microspheres, peptides, polyethylene glycols
- drugs eg, calikeamycin, duocalmycin, etc.
- nitrogen mustard analogs such as cyclophosphamide, melfaran, ifosphamide or trophosphamide
- ethyleneimines such as thiotepa, nitrosolea such as carmustine, alkylating agents such as temozolomid or dacarbazine
- Folic acid-like antimetabolites such as methotrexate or lartitrexed
- purine analogs such as thioguanine, cladribine
- Podophilotoxin derivatives such as docetaxel or paclitaxane, anthracyclines and analogs such as doxorubicin, epirubicin, idarubicin and mitoxanthrone, other cytotoxic antibiotics such as bleomycin and mitomycin, platinum such as cisplatin, carboplatin and oxaliplatin.
- examples include compounds, pentostatin, myrtefosine, estramstine, topotecan, irinotecan and bicartamide), toxins (eg, lysine toxins, riatoxins and verotoxins). These functional molecules may eventually be removed.
- it may be a peptide that can be recognized and cleaved by an enzyme such as thrombin, matrix metalloproteinase (MMP), or FactorX, or a polynucleotide that can cleave a nuclease or a restriction enzyme.
- an enzyme such as thrombin, matrix metalloproteinase (MMP), or FactorX
- MMP matrix metalloproteinase
- FactorX FactorX
- the aptamer or complex of the present invention can be used, for example, as a pharmaceutical or diagnostic agent, a test agent, or a reagent.
- a pharmaceutical or diagnostic agent for example, a pharmaceutical or diagnostic agent, a test agent, or a reagent.
- it is useful as a drug for treating or preventing pulmonary hypertension, or as a diagnostic agent, a test agent, or a reagent.
- the pharmaceutical product of the present invention may contain a pharmaceutically acceptable carrier.
- Pharmaceutically acceptable carriers include, for example, excipients such as sucrose, starch, mannit, sorbit, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate, cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone.
- Glue gelatin, gum arabic, polyethylene glycol, sucrose, starch and other binders, starch, carboxymethyl cellulose, hydroxypropyl starch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, calcium citrate and other disintegrants, magnesium stearate , Lubricants such as aerodil, talc, sodium lauryl sulfate, fragrances such as citric acid, menthol, glycyrrhizin ammonium salt, glycine, orange powder, preservatives such as sodium benzoate, sodium hydrogen sulfite, methylparaben, propylparaben, citric acid , Stabilizers such as sodium citrate and acetic acid, suspending agents such as methyl cellulose, polyvinylpyrrolidone and aluminum stearate, dispersants such as surfactants, diluents such as water, physiological saline and orange juice, cacao butter and polyethylene. Examples thereof include base
- Suitable formulations for oral administration are liquids in which an effective amount of ligand is dissolved in a dilute solution such as water, physiological saline, orange juice, capsules containing an effective amount of ligand as solids or granules, sachets, or These include tablets, suspensions in which an effective amount of the active ingredient is suspended in an appropriate dispersion medium, and an emulsion in which a solution in which an effective amount of the active ingredient is dissolved is dispersed and emulsified in an appropriate dispersion medium.
- the pharmaceutical product of the present invention can be coated by a method known per se for the purpose of masking taste, enteric solubility or persistence, if necessary.
- the coating agent used for coating include hydroxypropylmethyl cellulose, ethyl cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, polyoxyethylene glycol, Tween 80, Pluronic F68, cellulose acetate phthalate, hydroxypropylmethyl cellulose phthalate, hydroxymethyl cellulose acetate succinate, and the like.
- Eudragit Ros, Germany, methacrylic acid / acrylic acid copolymer
- dyes eg, Bengala, titanium dioxide, etc.
- the pharmaceutical product may be either a quick-release preparation or a sustained-release preparation.
- the base material of the sustained release preparation include liposomes, atelocollagen, gelatin, hydroxyapatite, PLGA and the like.
- Suitable formulations for parenteral administration are aqueous and non-aqueous isotonic.
- sterile injectable solutions which may contain antioxidants, buffers, antibacterial agents, isotonic agents and the like.
- examples thereof include aqueous and non-aqueous sterile suspensions, which may include suspending agents, solubilizers, thickeners, stabilizers, preservatives and the like.
- the pharmaceutical product can be encapsulated in a container at a unit dose or a plurality of doses like an ampoule or a vial.
- the active ingredient and a pharmaceutically acceptable carrier can be freeze-dried and stored in a state where it can be dissolved or suspended in a suitable sterile solvent immediately before use.
- inhalants and ointments are also possible.
- the lyophilized active ingredient is atomized and administered by inhalation using an appropriate inhalation device.
- a conventionally used surfactant, oil, seasoning, cyclodextrin or a derivative thereof and the like can be appropriately added to the inhalant.
- examples of the surfactant include oleic acid, lecithin, diethylene glycol dioleate, tetrahydrofurfuryloleate, ethyloleate, isopropylmillistate, glyceryltrioleate, glycerylmonolaurate, glycerylmonooleate, and glycerylmonosteer.
- Span, Tween, Epoxy, Brij, Genapol and Synperonic are trademarks.
- the oil include corn oil, olive oil, cottonseed oil, sunflower oil and the like.
- appropriate pharmaceutically acceptable bases yellow petrolatum, white petrolatum, paraffin, plastic base, silicone, white ointment, beeswax, pig oil, vegetable oil, hydrophilic ointment, hydrophilic petrolatum, purified lanolin, hydrolyzed lanolin , Water-absorbing ointment, hydrophilic plastic base, macrogol ointment, etc.
- the inhalant can be manufactured according to the conventional method. That is, it can be produced by powdering or liquidizing the above-mentioned aptamer or composite of the present invention, blending it in an inhalation propellant and / or carrier, and filling it in an appropriate inhalation container. Further, when the aptamer or composite of the present invention is powder, a normal mechanical powder inhaler can be used, and when it is liquid, an inhaler such as a nebulizer can be used.
- propellants can be widely used, and Freon-11, Freon-12, Freon-21, Freon-22, Freon-113, Freon-114, Freon-123, Freon-142c, Freon-134a can be widely used.
- a compressed gas such as a gas can be exemplified.
- the medicine of the present invention can be administered not only directly to the lesion site but also by other methods described above.
- the aptamer of the present invention is a single-stranded nucleic acid, it can be detoxified by administration of a nucleotide containing a complementary sequence, and it may be a safer drug than a neutralizing antibody whose dynamic control after administration is difficult. expensive. This can be said to be an extremely advantageous point in view of the problem of infectious diseases caused by the long residence time of the antibody in the body, which may occur in antibody drug treatment.
- the drug of the present invention when used as a preventive or therapeutic drug for the above-mentioned diseases, it is safer to use an aptamer that can easily control pharmacokinetics, considering the seriousness of the disease and the risk of side effects. It is clear that you can get medicine.
- the dose of the drug of the present invention varies depending on the type / activity of the active ingredient, the severity of the disease, the animal species to be administered, the drug acceptability of the administration target, the body weight, the age, etc., but is usually per adult per day.
- the amount of active ingredient may be from about 0.0001 to about 100 mg / kg, such as from about 0.0001 to about 10 mg / kg, preferably from about 0.005 to about 1 mg / kg.
- RNA aptamers that specifically bind to human IL-21 were made using the SELEX method. SELEX was performed with reference to the method of Ellington et al. (Ellington and Szostak, Nature 346, 818-822, 1990) and the method of Tuerk et al. (Tuerk and Gold, Science 249, 505-510, 1990). Human IL-21 (manufactured by PeproTech) and mouse IL-21 (manufactured by PeproTech) were used as target substances.
- Human IL-21 and mouse IL-21 were separately immobilized on a carrier of NHS-activated Humanose 4 Fast Flow (manufactured by GE Healthcare).
- the method for immobilizing IL-21 on the carrier was performed according to the specifications of GE Healthcare.
- the amount of immobilization was confirmed by examining the IL-21 solution before immobilization and the supernatant immediately after immobilization by SDS-PAGE. As a result of SDS-PAGE, it was confirmed that the band of IL-21 was not detected from the supernatant and almost all of the IL-21 used was immobilized.
- the RNA (35N) used in the first round was obtained by double-stranding the DNA template obtained by chemical synthesis using a Fwd primer and transcribing it using a T7 Transcription Kit (manufactured in-house).
- the RNA obtained by this method is obtained by fluorolating the 2'position of ribose of the pyrimidine nucleotide.
- As the DNA template a DNA having a length of 84 nucleotides having primer sequences at both ends of a random sequence of 35 nucleotides shown below was used. DNA templates and primers were made by chemical synthesis.
- DNA template 5'-AGCGCAGAGCGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGTTCTTCTCCCCATAGTGTGTTAGG-3'(SEQ ID NO: 46)
- Primer Fwd 5'-CCTAATACGACTCACTATAGGGAGAAGACCTTC-3' (SEQ ID NO: 47)
- Primer Rev 5'-AGCGCAGAGCGTCG-3'(SEQ ID NO: 48)
- N in the DNA template is any combination of 35 nucleotides (35N: each N is A, C, G or T) and the resulting aptamer-specific sequence region. Occurs.
- Primer Fwd contains the promoter sequence of T7 RNA polymerase.
- carriers in which human IL-21 and mouse IL-21 were immobilized were mixed and used, and then two rounds were alternately used to carry out SELEX.
- An RNA pool was added to the carrier on which IL-21 was immobilized, and the mixture was held at 37 ° C. for 20 minutes with gentle stirring, and then the resin was washed with Solution A to remove RNA that did not bind to IL-21.
- the solution A is a mixed solution of 145 mM sodium chloride, 5.4 mM potassium chloride, 1.8 mM calcium chloride, 0.8 mM magnesium chloride, 20 mM tris (pH 7.6), and 0.05% Tween 20.
- RNA bound to IL-21 was heat-treated at 85 ° C. for 2 minutes by adding 6M urea as an eluent, and recovered from the supernatant. The recovered RNA was amplified by reverse transcription PCR, transcribed with T7 Transcription Kit, and used as a pool for the next round. The above was regarded as one round, and the same work was repeated a plurality of times.
- the resin was washed with Solution A'(solution in which 145 mM sodium chloride was changed to 295 mM sodium chloride) in order to remove RNA weakly bound to the resin.
- Solution A' solution in which 145 mM sodium chloride was changed to 295 mM sodium chloride
- the base sequence was analyzed using the next-generation sequencer.
- the Ion PGM TM system manufactured by Thermo was used for the next-generation sequencer, and the analysis was performed according to the specifications of Thermo.
- SEQ ID NOs: 1-2 There were 182 sequences represented by SEQ ID NO: 1. There were 69 sequences represented by SEQ ID NO: 2.
- SEQ ID NOs: 1 and 2 are underlined in their respective sequences. Since the 15 bases at each terminal are primer regions, they have a common sequence. Each nucleotide sequence is shown below.
- the individual sequences listed below are represented in the 5'to 3'direction, the purine bases (A and G) are 2'-OH forms, and the pyrimidine bases (U and C) are. It is a 2'-fluoromodified product.
- the secondary structure prediction of the aptamer represented by both SEQ ID NOs is shown in FIG. The secondary structure was predicted using the MFOLD program (M. Zukker, Nucleic Acids Res. 31 (13), 3406-3415, 2003) (same for FIGS. 4-6).
- SEQ ID NO: 1 GGGAGAAGAA CCUUC AACAG CGACUACU CGUGAUU GCCCG UUCUGACCCCAGACGCUCGCU
- SEQ ID NO: 2 GGGAGAAGAA CCUUC CACGAC CGACUACU GUCAAUG GCCCG UUCUUGCCCAGACGCUCGCU
- the binding activity of the aptamers represented by SEQ ID NOs: 1 and 2 to human IL-21 was evaluated by the surface plasmon resonance method.
- a Biacore T200 manufactured by GE Healthcare was used for the measurement.
- As the sensor chip a CM4 chip in which a dextran having a CM group introduced was immobilized was used.
- RNA to be analyzed was prepared to 0.1 ⁇ M using Solution A and injected at a flow rate of 20 ⁇ L / min for 60 seconds. Solution A was also used as the running buffer.
- aptamers represented by SEQ ID NOs: 1 and 2 bind to human IL-21.
- a sensorgram showing how these aptamers bind to human IL-21 is shown in FIG.
- the nucleotide sequence used as a negative control did not bind to human IL-21. From the above, it was shown that the aptamers represented by SEQ ID NOs: 1 and 2 are sequence-specifically bound to human IL-21.
- Whether or not the aptamer represented by SEQ ID NO: 1 inhibits the binding between human IL-21 and its receptor IL-21R was evaluated by the surface plasmon resonance method.
- Biacore T200 manufactured by GE Healthcare was used for the measurement.
- As the sensor chip a CM5 chip in which a dextran having a CM group introduced was immobilized was used, and Protein A (manufactured by Pierce) was immobilized on the CM5 chip by about 1500 RU.
- a human IL-21R / Fc chimeric protein (manufactured by R & D systems) as a ligand was prepared in solution A at 0.1 ⁇ M, injected at a flow rate of 10 ⁇ L / min for 60 seconds, and immobilized at about 700 RU.
- human IL-21 prepared at 0.02 ⁇ M is injected at a flow rate of 10 ⁇ L / min for 30 seconds, binding of about 35 RU is observed.
- a mixed solution of human IL-21 and aptamers was injected under the same conditions.
- the mixed solution was prepared with Solution A so that the human IL-21 concentration in the solution was 0.02 ⁇ M and the aptamer concentration was 0.2 ⁇ M.
- Solution A was also used as the running buffer.
- Figure 3 shows the sensorgram obtained by the measurement. No binding to the receptor IL-21R was observed in the mixed solution of human IL-21 and SEQ ID NO: 1, indicating that the aptamer represented by SEQ ID NO: 1 inhibits the binding of human IL-21 to IL-21R. was done.
- NK92 cells Natural killer cells -like cell line NK92 cells (purchased from American Type Culture Collection) secrete interferon- ⁇ (IFN- ⁇ ), which is a type of cytokine, by stimulation with human IL-21.
- IFN- ⁇ interferon- ⁇
- Inhibition rate (%) (C IL-21- Capt ) / (C IL-21- C 0 ) x100
- C IL-21 is the IFN- ⁇ concentration per unit volume when only human IL-21 is added
- Capt is the IFN- ⁇ concentration when human IL-21 and aptamer are added at the same time, C 0. Is the IFN- ⁇ concentration when human IL-21 is not added.
- Table 1 summarizes the evaluation results of the aptamers represented by SEQ ID NOs: 1 and 2 above.
- "++" of the binding indicates that the binding amount (RU value) of the aptamer to the human IL-21 immobilized on the CM4 chip is 100 or more. Further, “nd” indicates unmeasured.
- the aptamers represented by SEQ ID NOs: 1 and 2 bind to human IL-21 and inhibit its action with the receptor IL-21R. The effect is also exhibited under conditions that imitate the environment in blood such as a cell evaluation system, and it has been shown that it is an excellent aptamer that inhibits human IL-21.
- Example 2 Shortening of aptamers (1) From the secondary structure prediction obtained in FIG. 1, the aptamer represented by SEQ ID NO: 1 was shortened.
- the nucleotide sequence of the aptamer prepared by shortening the chain is shown below as SEQ ID NOs: 3-19.
- the underline in each sequence indicates the common sequence (in order from the 5'end side, the underline corresponds to the formula (2), the formula (1) and the formula (3) (the underline in SEQ ID NO: 6 corresponds to the formula (1))). ..
- the individual sequences listed below shall be represented in the 5'to 3'direction, the purine bases (A and G) are 2'-OH forms, and the pyrimidine bases (U and C) are. It is a 2'-fluoromodified product.
- SEQ ID NO: 3 (a sequence obtained by shortening the sequence represented by SEQ ID NO: 1 to a length of 51 nucleotides): GGGAGAAGAA CCUUC AACAG CGACUACU CGUGAUU GCCCG UUCUGACCC
- SEQ ID NO: 4 (a sequence obtained by shortening the sequence represented by SEQ ID NO: 1 to a length of 43 nucleotides): GGAGAA CCUUC AACACG CGACUACU CGUGAUU GCCCG UUCUCC
- SEQ ID NO: 5 (a sequence obtained by shortening the sequence represented by SEQ ID NO: 1 to a length of 37 nucleotides): GGA CCUUC AACACG CGACUACU CGUGAUU GCCCG UCC
- SEQ ID NO: 6 (a sequence obtained by shortening the sequence represented by SEQ ID NO: 1 to a length of 27 nucleotides): GGCAACAG CGACUACU CGUGAUGCC
- SEQ ID NO: 7 (a sequence shortened to a length of 35 nucleotides by deleting the AU base pair consisting of the 3rd and 35th bases of the sequence represented by SEQ ID NO: 5): GG CCUUC AACACG CGACUACU CGUGAUU GCCCG CC
- SEQ ID NO: 8 (a 35-nucleotide sequence in which a CG base pair (base in a common sequence) consisting of the third and 33rd bases of the sequence represented by SEQ ID NO: 7 is replaced with an AU base pair): GG ACUUC AACAG CGACUACU CGUGAUU GCCCU CC
- SEQ ID NO: 9 (a sequence in which the fifth C (base in the common sequence) of the sequence represented by SEQ ID NO: 5
- SEQ ID NO: 11 (a sequence in which the 15th C (base in the common sequence) of the sequence represented by SEQ ID NO: 5 is deleted and shortened to a length of 36 nucleotides): GGA CCUUC AACACG GACUACU CGUGAUU GCCCG UCC SEQ ID NO: 12 (a sequence in which the 16th G (base in the common sequence) of the sequence represented by SEQ ID NO: 5 is deleted and shortened to a length of 36 nucleotides): GGA CCUUC AACACG CACUACU CGUGAUU GCCCG UCC SEQ ID NO: 13 (a sequence in which the 17th A (base in the common sequence) of the sequence represented by SEQ ID NO: 5 is deleted and shortened to a length of 36 nucleotides): GGA CCUUC AACACG CGCUACU CGUGAUU GCCCG UCC SEQ ID NO: 14 (a sequence in which the 18th C (base in the common sequence) of the sequence represented by SEQ ID NO: 5 is deleted
- SEQ ID NO: 16 (a sequence in which the 20th A (base in the common sequence) of the sequence represented by SEQ ID NO: 5 is deleted and shortened to a length of 36 nucleotides): GGA CCUUC AACACG CGACUCU CGUGAUU GCCCG UCC SEQ ID NO: 17 (a sequence in which the 21st C (base in the common sequence) of the sequence represented by SEQ ID NO: 5 is deleted and shortened to a length of 36 nucleotides): GGA CCUUC AACACG CGACUAU CGUGAUU GCCCG UCC SEQ ID NO: 18 (a sequence in which the 22nd U (base in the common sequence) of the sequence represented by SEQ ID NO: 5 is deleted and shortened to a length of 36 nucleotides): GGA CCUUC AACACG CGACUAC CGUGAUU GCCCG UCC SEQ ID NO: 19 (a sequence in which the 31st C (base in the common sequence) of the sequence represented by SEQ ID NO: 5
- Whether these aptamers bind to human IL-21 and inhibit its function was evaluated by the same method as in Example 1.
- Aptamers were obtained by transcription using double-stranded DNA as a template. The results are shown in Table 2.
- "++" in the binding activity at Biacore indicates that the binding amount (RU value) is 100 or more, "+” indicates that the binding amount is 20 or more and less than 100, and "-" indicates that the binding amount is less than 20. ..
- the “+” of the inhibitory activity indicates that the inhibition rate (%) in the cell evaluation system was 20% or more with an aptamer having a concentration of 10 nM, and those lacking the criteria are indicated by "-". Further, "nd" indicates unmeasured.
- FIG. 4 shows the prediction of the secondary structure of the aptamers represented by SEQ ID NOs: 3 to 5 and 7, which showed inhibitory activity in the cell evaluation system. From these results, it was found that the activity can be maintained even if the terminal side is deleted from the aptamer represented by SEQ ID NO: 1 to shorten the chain to 37 bases. In addition, from the results of the aptamer represented by SEQ ID NO: 7, it is possible to shorten the chain from the 37-base aptamer represented by SEQ ID NO: 5 to 35 bases by deleting the AU base pair consisting of the 3rd and 35th base pairs. It was shown to be.
- Example 3 Modification of aptamer and examination of terminal modification (1)
- idT is added to the 3'end to add a 2'-O-methyl group.
- the introduced variant was prepared.
- the modified sequences are shown in SEQ ID NOs: 4 (1) to 4 (13).
- a modified product in which PEG was added to the 5'end of the sequence obtained by further shortening SEQ ID NOs: 4 and 5 and 5 was prepared. These are shown in SEQ ID NOs: 4 (14), 5 (1), 20 and 21.
- nucleotide sequences of the aptamers represented by SEQ ID NOs: 4 (1) to 4 (14), 5 (1), 20 and 21 are shown below together with modifications. Unless otherwise noted, the individual sequences listed below shall be represented in the 5'to 3'direction, with capital letters indicating RNA.
- the parentheses in the nucleotide indicate the modification of the 2'position of ribose, F indicates a fluorine atom, and M indicates an O-methyl group.
- the idT at the end of the sequence indicates modification with inverted-dT, and the PEG indicates modification with 40 kDa branched polyethylene glycol.
- the underline in each sequence indicates a common sequence (corresponding to the formula (2), the formula (1) and the formula (3) in order from the 5'end side), and [] indicates the introduction of 2'-O-methyl modification, etc. , Indicates a base into which a modification or mutation has been introduced in the SEQ ID NO:.
- SEQ ID NO: 4 (1) (sequence in which idT is added to the 3'end of the sequence represented by SEQ ID NO: 4): GGAGAA C (F) C (F) U (F) U (F) C (F) AAC (F) AC (F) GC (F) GAC (F) U (F) AC (F) U (F) C (F) GU (F) GAU (F) U (F) GC (F) C (F) C (F) GU (F) U (F) C (F) U (F) C (F) C (F) -idT SEQ ID NO: 4 (2) (sequence in which 2'-O-methyl modification is introduced in one place of the sequence represented by SEQ ID NO: 4 and idT is added to the 3'end): GGAGAA C (F) C (F) U (F) U (F) C (F) [A (M)] AC (F) AC (F) GC (F) GAC (F) U
- SEQ ID NO: 4 (6) (sequence in which 2'-O-methyl modification is introduced in one place of the sequence represented by SEQ ID NO: 4 and idT is added to the 3'end): GGAGAA C (F) C (F) U (F) U (F) C (F) AAC (F) AC (F) GC (F) [G (M)] AC (F) U (F) AC ( F) U (F) C (F) GU (F) GAU (F) U (F) GC (F) C (F) C (F) GU (F) U (F) C (F) U (F) ) C (F) -idT SEQ ID NO: 4 (7) (sequence in which 2'-O-methyl modification is introduced in one place of the sequence represented by SEQ ID NO: 4 and idT is added to the 3'end): GGAGAA C (F) C (F) U (F) U (F) C (F) AAC (F) AC (
- SEQ ID NO: 4 (11) (sequence in which 2'-O-methyl modification is introduced in one place of the sequence represented by SEQ ID NO: 4 and idT is added to the 3'end): GGAGAA C (F) C (F) U (F) U (F) C (F) AAC (F) AC (F) GC (F) GAC (F) U (F) AC (F) U (F) C (F) GU (F) G [A (M)] U (F) U (F) GC (F) C (F) C (F) GU (F) U (F) C (F) U ( F) C (F) C (F) -idT SEQ ID NO: 4 (12) (sequence in which 2'-O-methyl modification is introduced in one place of the sequence represented by SEQ ID NO: 4 and idT is added to the 3'end): GGAGAA C (F) C (F) U (F) U (F) C (F) AAC (F
- SEQ ID NO: 5 (1) (sequence in which PEG is added to the 5'end of the sequence represented by SEQ ID NO: 5 and idT is added to the 3'end): PEG-GGA C (F) C (F) U (F) U (F) C (F) AAC (F) AC (F) GC (F) GAC (F) U (F) AC (F) U ( F) C (F) GU (F) GAU (F) U (F) GC (F) C ( F) C (F) GU (F) C (F) C (F) -idT SEQ ID NO: 20 (A sequence in which PEG is added to the 5'end and idT is added to the 3'end to 35 bases shortened by deleting the GC base pair consisting of the bases at each end of the sequence represented by SEQ ID NO: 5.
- aptamers bind to human IL-21 and inhibit its function, or aptamers were prepared by chemical synthesis and evaluated by the same method as in Example 1. Inhibition evaluation in the cell evaluation system was performed at final nucleic acid concentrations of 1 nM and 0.2 nM. The results are shown in Table 3.
- "++" in the binding activity at Biacore indicates that the aptamer binding amount (RU value) to human IL-21 immobilized on the CM4 chip is 100 or more.
- “+” In the inhibitory activity indicates that 1 nM inhibited 40% or more and 0.2 nM inhibited 15% or more, and those that did not meet the criteria are indicated by “-”.
- nd indicates unmeasured.
- idT can be added to the 3'end of the aptamer of the present invention.
- the inhibitory activity of the synthetic product of SEQ ID NO: 4 (1) in this example is higher than the inhibitory activity of the transcript of SEQ ID NO: 4 performed in Example 2, which is the nucleic acid of interest by chemical synthesis. It is considered that the purity of the sequence was increased and the resistance to degradation by 3'exonuclease was improved by the addition of idT.
- Example 4 Modification of aptamer (2)
- SEQ ID NO: 5 the 2'position of the ribose of the pyrimidine nucleotide is fluorolated
- a variant having a 2'-O-methyl group introduced was prepared.
- the nucleotide sequences of the prepared variants are shown below with modifications as SEQ ID NOs: 5 (2) to 5 (18).
- a variant in which a part of the sequence was replaced was prepared.
- the nucleotide sequences of the variants prepared by sequence substitution are shown below with modifications as SEQ ID NOs: 22 and 23.
- RNA Ribonucleic acid sequence
- F indicates a fluorine atom
- M indicates an O-methyl group.
- the idT at the end of the sequence indicates modification by inverted-dT.
- the underline in each sequence indicates a common sequence (corresponding to the formula (2), the formula (1) and the formula (3) in order from the 5'end side), and [] indicates the introduction of 2'-O-methyl modification, etc. , The bases newly modified or mutated with respect to the latest SEQ ID NO: are shown.
- SEQ ID NO: 5 (2) (sequence in which idT is added to the 3'end of the sequence represented by SEQ ID NO: 5): GGA C (F) C (F) U (F) U (F) C (F) AAC (F) AC (F) GC (F) GAC (F) U (F) AC (F) U (F) C (F) GU (F) GAU (F) U (F) GC (F) C (F) C (F) GU (F) C (F) C (F) -idT SEQ ID NO: 5 (3) (The sequence represented by SEQ ID NO: 5 is modified to reflect the 2'-O-methyl modification of SEQ ID NOs: 4 (3), (8) to (11), (13).
- SEQ ID NO: 22 sequence in which the 17th A (base in the common sequence) of the sequence represented by SEQ ID NO: 5 (3) is replaced with G
- SEQ ID NO: 5 (4) (A sequence in which the sequence represented by SEQ ID NO: 5 (3) is modified to reflect the 2'-O-methyl modification of SEQ ID NO: 4 (4)): GGA C (F) C (F) U (F) U (F) C (F) AA (M) C (F) [A (M)] C (F) GC (F) GAC (F) U ( F) A (M) C (F) U (F) C (F) G (M) U (F) G (M) A (M) U (F) U (F) GC (F) C (F) C (F) G (M) U (F) C (F) C (F) -idT SEQ ID NO: 5 (5) (a sequence in which the sequence represented by SEQ ID NO: 5 (4) is modified to reflect the 2'-O-methyl modification of SEQ ID NO: 4 (5)): GGA C (F) C (F) U (F) U (F) C (F) AA (M) C (F
- SEQ ID NO: 23 (sequence in which the GC base pair consisting of the second and 36th bases of the sequence represented by SEQ ID NO: 5 (8) is replaced with AU base pair): G (M) [A (M )] A (M) C (F) C (F) U (F) U (F) C (F) AA (M) C (F) AC (F) G C (F ) GAC (F) U (F) A (M) C (F) U (F) C (F) G (M) U (F) G (M) A (M) U (F) U (F) GC (F) C (F) C (F) G (M) [U (M)] C (M) -idT
- SEQ ID NO: 5 (9) (sequence in which 2'-O-methyl modification is introduced in one place of the sequence represented by SEQ ID NO: 5 and idT is added to the 3'end): GGA [C (M)] C (F) U (F) U (F) C (F) AAC (F) AC (F) GC (F) GAC (F) U (F) AC (F) U ( F) C (F) GU (F) GAU (F) U (F) GC (F) C ( F) C (F) GU (F) C (F) C (F) -idT SEQ ID NO: 5 (10) (sequence in which 2'-O-methyl modification is introduced in two places of the sequence represented by SEQ ID NO: 5 and idT is added to the 3'end): GGA C (F) C (F) U (F) U (F) C (F) AA [C (M)] A [C (M)] GC (F) GAC (F
- aptamers bind to human IL-21 and inhibit its function, or aptamers were prepared by chemical synthesis and evaluated by the same method as in Example 1. Inhibition evaluation in the cell evaluation system was performed at final nucleic acid concentrations of 1 nM and 0.2 nM. The results are shown in Table 4.
- "++" of the binding at Biacore indicates that the binding amount (RU value) of the aptamer to the human IL-21 immobilized on the CM4 chip is 100 or more.
- the "+” of inhibition indicates that the inhibition was 40% or more at 1 nM and 15% or more at 0.2 nM, and those that did not meet the criteria are indicated by "-”.
- "nd" indicates unmeasured.
- the 2'-O-methyl modification introduced one base at a time with the aptamer represented by SEQ ID NO: 4 can be introduced in combination with the aptamer. It was found that the inhibitory activity was not affected, but rather the activity was improved. For the sites where 2'-O-methyl modification was newly investigated, the activity is maintained or improved in the aptamers represented by SEQ ID NOs: 5 (9) to 5 (10) and 5 (14) to 5 (17). It has been shown. On the other hand, the inhibitory activity of the aptamers represented by SEQ ID NOs: 5 (11) to 5 (13) and 5 (18) decreased.
- the 15th to 19th bases (CGACU) of the aptamer represented by SEQ ID NO: 5 are reduced in activity by 2'-O-methyl modification.
- This sequence is a part of the common sequence (CGACUACU: formula (1)), and the results of this example also showed that the common sequence portion is important for the inhibitory activity.
- the third A in the common sequence of SEQ ID NO: 5 (CGACUACU: formula (1)) was replaced with G, and it was found that this base substitution did not affect the inhibitory activity.
- this base substitution changed the prediction of secondary structure of aptamers.
- the secondary structure prediction of the aptamer represented by SEQ ID NO: 22 is shown in FIG. From the results of the aptamer represented by SEQ ID NO: 23, it was found that substituting the GC base pair consisting of the second and 36th bases of the sequence represented by SEQ ID NO: 5 with the AU base pair does not affect the activity. ..
- Example 5 Modification of aptamer (3)
- a variant into which a 2'-O-methyl group was introduced and a variant in which some bases were replaced with DNA were prepared.
- the prepared variants are shown in SEQ ID NOs: 22 (1) to 22 (14).
- SEQ ID NO: 22 (2) was modified with PEG at the 5'end, and the sequence was further shortened by 2 bases to prepare a variant having the same terminal modification. These are shown in SEQ ID NOs: 22 (15) and 24.
- nucleotide sequences of the aptamers represented by SEQ ID NOs: 22 (1) to 22 (15) and 24 are shown below together with modifications. Unless otherwise noted, the individual sequences listed below shall be represented in the 5'to 3'direction, with uppercase letters indicating RNA and lowercase letters indicating DNA.
- the parentheses in the nucleotide indicate the modification of the 2'position of ribose, F indicates a fluorine atom, and M indicates an O-methyl group.
- the idT at the end of the sequence indicates modification with inverted-dT, and the PEG indicates modification with 40 kDa branched polyethylene glycol.
- the underline in each sequence indicates a common sequence (corresponding to the formula (2), the formula (1) and the formula (3) in order from the 5'end side), and [] indicates the introduction of 2'-O-methyl modification, etc. , The bases newly modified or mutated with respect to the latest SEQ ID NO: are shown.
- SEQ ID NO: 22 (1) (2'-O-methyl of SEQ ID NO: 5 (7), (8), (12), (16), (18), (20) in the sequence represented by SEQ ID NO: 22
- aptamers bind to human IL-21 and inhibit its function, or aptamers were prepared by chemical synthesis and evaluated by the same method as in Example 1. Inhibition evaluation in the cell evaluation system was performed at final nucleic acid concentrations of 1 nM and 0.2 nM. The results are shown in Table 5.
- "++" of the binding at Biacore indicates that the binding amount (RU value) of the aptamer to the human IL-21 immobilized on the CM4 chip is 100 or more.
- the "+” of inhibition indicates that the inhibition was 40% or more at 1 nM and 15% or more at 0.2 nM, and those that did not meet the criteria are indicated by "-”.
- "nd" indicates unmeasured.
- Example 6 Preparation of RNA aptamer that specifically binds to human IL-21 (2) The same SELEX as in Example 1 was performed using a template having a random sequence and a primer sequence different from those used in Example 1.
- human IL-21 manufactured by PeproTech
- NHS-active Sepharose 4 Fast Flow manufactured by GE Healthcare
- the sequences of the templates and primers used are shown below. DNA templates and primers were prepared by chemical synthesis. Mutations have been introduced into the template DNA based on the sequence of SEQ ID NO: 4.
- DNA template 5'-GCAGAGCTCGTGCTC (A) (G) (A) (A) (C) (G) (G) (G) (C) (A) (A) (T) (C) (A) ( C) (G) (A) (G) (T) (A) (G) (T) (C) (G) (T) (T) (G) (A) (A) (G) (G) (T) (T) (C) (T) (G) (A) (A) (G) (G) (T) (T) (T) (G) (A) (A) (G) (G) (T) (T) (C) (T) (T) (G) (A) (A) (G) (G) (T) (T) (C) (T) (T) (G) (A) (A) (G) (G) (T) (T) (C) (T) (T) (G) (A) (A) (G) (G) (T) (T) (
- RNA pool is added to the carrier on which human IL-21 is immobilized, and the mixture is held at 37 ° C. for 20 minutes with gentle stirring, and then the resin is washed with solution A to remove RNA that does not bind to human IL-21. did.
- solution A is a mixed solution of 145 mM sodium chloride, 5.4 mM potassium chloride, 1.8 mM calcium chloride, 0.8 mM magnesium chloride, 20 mM tris (pH 7.6), and 0.05% Tween 20.
- RNA bound to human IL-21 was heat-treated at 90 ° C. for 2 minutes by adding ultrapure water (ELGA water), and recovered from the supernatant.
- the recovered RNA was amplified by reverse transcription PCR, transcribed with T7 Transcription Kit, and used as a pool for the next round. The above was regarded as one round, and the same work was repeated a plurality of times.
- the resin was washed with Solution A'(solution in which 145 mM sodium chloride was changed to 295 mM sodium chloride) in order to remove RNA weakly bound to the resin.
- Solution A' solution in which 145 mM sodium chloride was changed to 295 mM sodium chloride
- the base sequence was analyzed using the next-generation sequencer.
- the Ion PGM TM system manufactured by Thermo
- nucleotide sequences of each aptamer represented by SEQ ID NOs: 25 to 36 are shown below. Unless otherwise noted, the individual sequences listed below shall be represented in the 5'to 3'direction, with purine bases (A and G) being 2'-OH forms and pyrimidine bases (U and C). Is a 2'-fluoromodified product.
- Whether these aptamers bind to human IL-21 and inhibit its function was evaluated by the same method as in Example 1.
- Aptamers were obtained by transcription using double-stranded DNA as a template. Inhibition evaluation in the cell evaluation system was performed at final nucleic acid concentrations of 30 nM and 10 nM. The results are shown in Table 6.
- "++" of the binding at Biacore indicates that the binding amount (RU value) of the aptamer to the human IL-21 immobilized on the CM4 chip is 100 or more.
- An “+” of inhibition indicates that the inhibition was 50% or more at 30 nM and 20% or more at 10 nM, and those that did not meet the criteria are indicated by "-".
- SEQ ID NO: 30 As shown in FIG. 6, there was a place where the same base substitution occurred in a plurality of clones.
- CGACUACU formula (1)
- CCUC formula (2)
- Example 7 Modification of aptamer (4)
- a variant having a 2'-O-methyl group introduced was prepared.
- PEG modification at the 5'end was also performed.
- the nucleotide sequence of the prepared variant is shown below with modifications as SEQ ID NOs: 37, 38, 38 (1). Unless otherwise noted, the individual sequences listed below shall be represented in the 5'to 3'direction, with capital letters indicating RNA.
- the parentheses in the nucleotide indicate the modification of the 2'position of ribose, F indicates a fluorine atom, and M indicates an O-methyl group.
- the idT at the end of the sequence indicates modification with inverted-dT
- the PEG indicates modification with 40 kDa branched polyethylene glycol.
- the underline in each sequence indicates a common sequence (corresponding to the formula (2), the formula (1) and the formula (3) in order from the 5'end side), and [] indicates the introduction of 2'-O-methyl modification, etc. , The bases newly modified or mutated with respect to the latest SEQ ID NO: are shown.
- SEQ ID NO: 37 (the 17th A of the sequence represented by SEQ ID NO: 28 is replaced with G, and 2'-O-methyl modification is introduced so as to reflect the modification at the 2'position of SEQ ID NO: 22 (2).
- sequence with idT added to the 3'end [G (M)] [G (M)] [A (M)] [C (M)] C (F) U (F) U (F) C (F) [A (M)] [A (M) )] [A (M) )] [C (M)] [C (M)] [G (M)] C (F) G [G] C (F) U (F) [A (M)] [C (M)] [C (M)] U (F) C (F) [G (M)] [G (M)] [A (M)] [U (M)] [G (M)] [C (M)] [C (F)] [G (M)] [G (M)] [G (M)] [
- aptamers bind to human IL-21 and inhibit its function, or aptamers were prepared by chemical synthesis and evaluated by the same method as in Example 1.
- "++" in the binding activity at Biacore indicates that the aptamer binding amount (RU value) to human IL-21 immobilized on the CM4 chip is 100 or more.
- Inhibition evaluation in the cell evaluation system was performed at final nucleic acid concentrations of 1 nM and 0.2 nM.
- the aptamer concentration (IC 50 ) when IFN- ⁇ secretion by IL-21 stimulation was inhibited by 50% was determined. The results are shown in Table 7. In the table, "nd" indicates unmeasured.
- Example 8 Modification of aptamer and terminal modification (5)
- a variant in which a part of the base was replaced with DNA from RNA and a variant in which phosphorothioate was introduced were prepared.
- the nucleotide sequences of the prepared variants are shown below with modifications as SEQ ID NOs: 38 (2) to 38 (21). Unless otherwise noted, the individual sequences listed below shall be represented in the 5'to 3'direction, with uppercase letters indicating RNA and lowercase letters indicating DNA.
- the parentheses in the nucleotide indicate the modification of the 2'position of ribose, F indicates a fluorine atom, and M indicates an O-methyl group.
- the idT at the end of the sequence indicates modification with inverted-dT, and the PEG indicates modification with 40 kDa branched polyethylene glycol.
- Myr indicates myristic acid and Pal indicates palmitic acid.
- s indicates that the phosphate group connecting the nucleotides has been phosphorothioated.
- the underlined line in each sequence indicates the common sequence (corresponding to the formulas (2), (1) and (3) in order from the 5'end side), and [] is the most recent sequence such as substitution with DNA. The bases newly modified or mutated with respect to the numbers are shown.
- SEQ ID NO: 38 (2) (A sequence in which one of the bases in which the 2'position of the sequence represented by SEQ ID NO: 38 is fluoride is substituted with DNA): G (M) A (M) C (M) [c] U (F) U (F) C (F) A (M) A (M) C (M) C (M) C (M) G (M) ) C (F) GGC (F) U (F) A (M) C (M) U (F) C (F) G (M) G (M) G (M) G (M) A (M) U (M) U (M) G (M) C (M) C (F) G (M) U (M) C (M) -idT SEQ ID NO: 38 (3) (A sequence in which one of the bases in which the 2'position of the sequence represented by SEQ ID NO: 38 is fluoride is substituted with DNA): G (M) A (M) C (M) C (F) [u] U (F) C (F
- SEQ ID NO: 38 (6) (A sequence in which one of the bases in which the 2'position of the sequence represented by SEQ ID NO: 38 is fluoride is substituted with DNA): G (M) A (M) C (M) C (F) U (F) U (F) C (F) A (M) A (M) C (M) C (M) C (M) G ( M) [c] GGC (F) U (F) A (M) C (M) U (F) C (F) G (M) G (M) G (M) G (M) A (M) U (M) U (M) G (M) C (M) C (F) G (M) U (M) C (M) -idT SEQ ID NO: 38 (7) (A sequence in which one of the bases in which the 2'position of the sequence represented by SEQ ID NO: 38 is fluoride is substituted with DNA): G (M) A (M) C (M) C (F) U (F) U (F) C (F
- SEQ ID NO: 38 (11) (A sequence in which one of the bases in which the 2'position of the sequence represented by SEQ ID NO: 38 is fluoride is substituted with DNA): G (M) A (M) C (M) C (F) U (F) U (F) C (F) A (M) A (M) C (M) C (M) C (M) G ( M) C (F) GGC (F) U (F) A (M) C (M) U (F) C (F) G (M) G (M) G (M) G (M) A (M) U (M) U (M) G (M) C (M) [c] G (M) U (M) C (M) -idT SEQ ID NO: 38 (12) (sequence in which all the bases in which the 2'position of the sequence represented by SEQ ID NO: 38 is fluoropholated are replaced with DNA and PEG is added to the 5'end): PEG-G (M) A (M) C (M)
- SEQ ID NO: 38 (16) (sequence in which phosphorothioate modification is introduced in two places of the sequence represented by SEQ ID NO: 38 (1)): PEG-G (M) A (M) C (M) C (F) U (F) U (F) C (F) A (M) A (M) C (M) C (M) C (M) G (M) [C (F) s] [Gs] GC (F) U (F) A (M) C (M) U (F) C (F) G (M) G (M) G (M) A (M) U (M) U (M) G (M) C (M) C (F) G (M) U (M) C (M) -idT SEQ ID NO: 38 (17) (sequence in which phosphorothioate modification is introduced in two places of the sequence represented by SEQ ID NO: 38 (1)): PEG-G (M) A (M) C (M) C (F) U (F) C (
- SEQ ID NO: 38 (21) (sequence in which P is added to the 5'end of the sequence represented by SEQ ID NO: 38): Pal-G (M) A (M) C (M) C (F) U (F) U (F) C (F) A (M) A (M) C (M) C (M) C (M) G (M) C (F) GGC (F) U (F) A (M) C (M) U (F) C (F) G (M) G (M) G (M) G (M) A (M) U ( M) U (M) G (M) C (M) C (M) C (F) G (M) U (M) C (M) -idT
- aptamers bind to human IL-21 and inhibit its function, or aptamers were prepared by chemical synthesis and evaluated by the same method as in Example 1. Inhibition evaluation in the cell evaluation system was performed at final nucleic acid concentrations of 1 nM and 0.1 nM. The results are shown in Table 8.
- "++" of the binding at Biacore indicates that the binding amount (RU value) of the aptamer to the human IL-21 immobilized on the CM4 chip is 100 or more.
- An “+” of inhibition indicates that the inhibition was 40% or more at 1 nM and 15% or more at 0.1 nM, and those that did not meet the criteria are indicated by "-”.
- "nd" indicates unmeasured.
- the aptamers represented by SEQ ID NOs: 38 (2) to 38 (11) showed inhibitory activity against human IL-21, although the inhibitory activity was high or weak. From these results, it was found that the activity can be maintained even if at least one of the bases in which the 2'position of the aptamer represented by SEQ ID NO: 38 is fluoromorphized is replaced with DNA. However, from the results of the aptamer represented by SEQ ID NO: 38 (12), the binding activity disappears when all the sites are collectively replaced with DNA. All of the aptamers represented by SEQ ID NOs: 38 (13) to 38 (19) maintain high inhibitory activity, and in the three sites examined this time, even if the phosphate group is phosphorothioated, the activity is affected. It turned out not. From the results of the aptamers represented by SEQ ID NOs: 38 (20) and 38 (21), it was found that the modification to the 5'end can be performed not only with PEG but also with fatty acids and the like.
- Example 9 Examination of base substitution of aptamer From the results of the previous examples, the base sequence of the common sequence portion is important for inhibiting the function of human IL-21, but there is a place where base substitution is possible. I also understood. Therefore, a sequence was prepared in which a part of the common sequence portion of the aptamer represented by SEQ ID NO: 5 was replaced with a base. The nucleotide sequences of some of the prepared base substituents are shown below as SEQ ID NOs: 39 to 43. Unless otherwise noted, the individual sequences listed below shall be represented in the 5'to 3'direction, the purine bases (A and G) are 2'-OH forms, and the pyrimidine bases (U and C) are.
- SEQ ID NO: 39 (sequence in which the sixth U of the sequence represented by SEQ ID NO: 5 is replaced with G): GGA CC [G] UC AACAG CGACUACU CGUGAUU GCCCG UCC
- SEQ ID NO: 40 (sequence in which the 7th U of the sequence represented by SEQ ID NO: 5 is replaced with C): GGA CCU [C] C AACAG CGACUACU CGUGAUU GCCCG UCC
- SEQ ID NO: 41 (the 19th U of the sequence represented by SEQ ID NO: 5 replaced with G): GGA CCUUC AACACG CGAC [G] ACU CGUGAUU GCCCG UCC
- SEQ ID NO: 42 (sequence in which the 22nd U of the sequence represented by SEQ ID NO: 5 is replaced with C): GGA CCUUC AACACG CGACUAC [C] CGUGAUU GCCCG UCC
- SEQ ID NO: 43 (sequence in which the
- Whether these aptamers bind to human IL-21 and inhibit its function was evaluated by the same method as in Example 1.
- Aptamers were obtained by transcription using double-stranded DNA as a template. Inhibition evaluation in the cell evaluation system was performed at a final nucleic acid concentration of 10 nM. The results are shown in Table 9.
- "++" of the binding at Biacore indicates that the binding amount (RU value) of the aptamer to the human IL-21 immobilized on the CM4 chip is 100 or more.
- “+” Of inhibition indicates that the inhibition was 20% or more at 10 nM, and those that did not meet the criteria are indicated by "-”.
- "nd" indicates unmeasured.
- the aptamers represented by SEQ ID NOs: 39 to 43 all inhibited the function of human IL-21, similar to the aptamers represented by SEQ ID NO: 5. From these results, it was found that in the common sequence (CGACUACU: formula (1)), the 5th U can be replaced with G and the 8th U can be replaced with C. Similarly, it was found that the part (2) of the formula (CCUUC) can be CCGUC or CCUCC, and the part (3) of the formula (GCCCG) can also be GCACG.
- the aptamer of the present invention is useful as a drug for treating or preventing pulmonary hypertension, or as a diagnostic agent, a test agent, or a reagent.
- This application is based on Japanese Patent Application No. 2020-108431 (Filing date: June 17, 2nd year of Reiwa), the entire contents of which are incorporated herein by reference.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Pulmonology (AREA)
- Epidemiology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Food Science & Technology (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022531903A JP7797016B2 (ja) | 2020-06-17 | 2021-06-17 | Il-21に対するアプタマーおよびその使用 |
| AU2021291555A AU2021291555A1 (en) | 2020-06-17 | 2021-06-17 | Aptamer for IL-21 and use thereof |
| US18/010,945 US20230235333A1 (en) | 2020-06-17 | 2021-06-17 | Aptamer for il-21 and use thereof |
| CA3187798A CA3187798A1 (en) | 2020-06-17 | 2021-06-17 | Aptamer for il-21 and use thereof |
| IL299193A IL299193A (en) | 2020-06-17 | 2021-06-17 | Aptamer for IL-21 and its use |
| KR1020237002051A KR20230051484A (ko) | 2020-06-17 | 2021-06-17 | Il-21에 대한 압타머 및 그 사용 |
| EP21826651.8A EP4170030A4 (en) | 2020-06-17 | 2021-06-17 | APTAMER FOR IL-21 AND ITS USE |
| CN202180041659.XA CN115916979A (zh) | 2020-06-17 | 2021-06-17 | 针对il-21的适体及其应用 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2020104831 | 2020-06-17 | ||
| JP2020-104831 | 2020-06-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021256530A1 true WO2021256530A1 (ja) | 2021-12-23 |
Family
ID=79268059
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2021/023023 Ceased WO2021256530A1 (ja) | 2020-06-17 | 2021-06-17 | Il-21に対するアプタマーおよびその使用 |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20230235333A1 (https=) |
| EP (1) | EP4170030A4 (https=) |
| JP (1) | JP7797016B2 (https=) |
| KR (1) | KR20230051484A (https=) |
| CN (1) | CN115916979A (https=) |
| AU (1) | AU2021291555A1 (https=) |
| CA (1) | CA3187798A1 (https=) |
| IL (1) | IL299193A (https=) |
| TW (1) | TW202214861A (https=) |
| WO (1) | WO2021256530A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025100427A1 (ja) * | 2023-11-06 | 2025-05-15 | 国立研究開発法人国立循環器病研究センター | 肺高血圧症の予防および/または治療用医薬 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20250118759A (ko) | 2024-01-30 | 2025-08-06 | 한국공학대학교산학협력단 | 공정 시계열 데이터 이상치 자동탐지를 위한 반지도 학습 기반의 LSTM-based Encoder-Decoder 모델 학습 데이터 정제 시스템 및 그 동작 방법 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5660985A (en) | 1990-06-11 | 1997-08-26 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
| WO2013057259A2 (en) | 2011-10-21 | 2013-04-25 | Arcelik Anonim Sirketi | A cooling device comprising a door opening mechanism |
| JP2020104831A (ja) | 2018-12-28 | 2020-07-09 | 株式会社デンソーテン | 制御装置および制御方法 |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS57102402A (en) | 1980-12-15 | 1982-06-25 | Shin Meiwa Ind Co Ltd | Controller for garbage wagon |
| EP0786469B1 (en) | 1990-06-11 | 2006-03-01 | Gilead Sciences, Inc. | Methods of use of nucleic acid ligands |
| PT668931E (pt) | 1992-09-29 | 2006-05-31 | Gilead Sciences Inc | Ligandos de acidos nucleicos e metodos para producao dos mesmos |
| CA2169536A1 (en) | 1993-09-08 | 1995-03-16 | Gilead Sciences, Inc. | Nucleic acid ligands and improved methods for producing the same |
| JP5515101B2 (ja) * | 2009-03-23 | 2014-06-11 | ベース ペア バイオテクノロジーズ,インク. | 機能的リガンドの同時合成方法 |
| CN111542607B (zh) * | 2017-11-09 | 2024-10-11 | 力博美科股份有限公司 | 针对adamts5的适配体及其应用 |
-
2021
- 2021-06-17 TW TW110122136A patent/TW202214861A/zh unknown
- 2021-06-17 AU AU2021291555A patent/AU2021291555A1/en active Pending
- 2021-06-17 KR KR1020237002051A patent/KR20230051484A/ko active Pending
- 2021-06-17 CN CN202180041659.XA patent/CN115916979A/zh active Pending
- 2021-06-17 US US18/010,945 patent/US20230235333A1/en active Pending
- 2021-06-17 IL IL299193A patent/IL299193A/en unknown
- 2021-06-17 CA CA3187798A patent/CA3187798A1/en active Pending
- 2021-06-17 EP EP21826651.8A patent/EP4170030A4/en active Pending
- 2021-06-17 JP JP2022531903A patent/JP7797016B2/ja active Active
- 2021-06-17 WO PCT/JP2021/023023 patent/WO2021256530A1/ja not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5660985A (en) | 1990-06-11 | 1997-08-26 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
| WO2013057259A2 (en) | 2011-10-21 | 2013-04-25 | Arcelik Anonim Sirketi | A cooling device comprising a door opening mechanism |
| JP2020104831A (ja) | 2018-12-28 | 2020-07-09 | 株式会社デンソーテン | 制御装置および制御方法 |
Non-Patent Citations (10)
| Title |
|---|
| ANONYMOUS: "Presentation of research results on the development of innovative therapeutic agents for pulmonary arterial hypertension using anti- IL -21 aptamers", RIBOMIC INC, 30 January 2019 (2019-01-30), pages 1, XP055894788, Retrieved from the Internet <URL:https://ssl4.eir-parts.net/doc/4591/tdnet/1665714/00.pdf> [retrieved on 20210719] * |
| BINKLEY ET AL., NUCLEIC ACIDS RES., vol. 23, no. 16, 1995, pages 3198 - 3205 |
| BIOCHEMISTRY, vol. 12, 1973, pages 5138 - 5145 |
| COTTON ET AL., NUCL. ACID. RES., vol. 19, 1991, pages 2629 - 2635 |
| ELLINGTONSZOSTAK, NATURE, vol. 346, 1990, pages 818 - 822 |
| M. ZUKKER, NUCLEIC ACIDS RES., vol. 31, no. 13, 2003, pages 3406 - 3415 |
| NAKAMURA, EMIKO: "Chapter 7: Ribomic's aptamer drug discovery technology", FARUMASHIA, vol. 54, no. 7, 30 November 2017 (2017-11-30), JP , pages 706 - 708, XP009542170, ISSN: 0014-8601, DOI: 10.14894/faruawpsj.54.7_706 * |
| PNAS, vol. 112, no. 20, 19 May 2015 (2015-05-19), pages E2677 - E2686 |
| See also references of EP4170030A4 |
| TUERK ET AL., SCIENCE, vol. 249, 1990, pages 505 - 510 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025100427A1 (ja) * | 2023-11-06 | 2025-05-15 | 国立研究開発法人国立循環器病研究センター | 肺高血圧症の予防および/または治療用医薬 |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3187798A1 (en) | 2021-12-23 |
| TW202214861A (zh) | 2022-04-16 |
| US20230235333A1 (en) | 2023-07-27 |
| JP7797016B2 (ja) | 2026-01-13 |
| JPWO2021256530A1 (https=) | 2021-12-23 |
| IL299193A (en) | 2023-02-01 |
| AU2021291555A1 (en) | 2023-02-02 |
| EP4170030A4 (en) | 2024-09-25 |
| EP4170030A1 (en) | 2023-04-26 |
| KR20230051484A (ko) | 2023-04-18 |
| CN115916979A (zh) | 2023-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102021626B1 (ko) | Ngf에 대한 압타머 및 그의 용도 | |
| JP5704638B2 (ja) | Il−17に対するアプタマー及びその使用 | |
| JP6352810B2 (ja) | ミッドカインに対するアプタマー及びその用途 | |
| WO2013186857A1 (ja) | Fgf2に対するアプタマー及びその使用 | |
| JP2023099157A (ja) | Adamts5に対するアプタマー及びその使用 | |
| JP7797016B2 (ja) | Il-21に対するアプタマーおよびその使用 | |
| JP6586669B2 (ja) | オートタキシンに結合しオートタキシンの生理活性を阻害するアプタマー及びその利用 | |
| US9987298B2 (en) | Aptamer for FGF2 and use thereof | |
| HK40090301A (en) | Aptamer for il-21 and use thereof | |
| JP6249453B2 (ja) | Il−17に対するアプタマー及びその使用 | |
| KR20070044813A (ko) | 이뮤노글로불린 e에 대한 핵산 리간드 및 아토피성 질환치료제로서의 이의 용도 | |
| HK1234092A1 (en) | Aptamer for fgf2 and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21826651 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2022531903 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 3187798 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021826651 Country of ref document: EP Effective date: 20230117 |
|
| ENP | Entry into the national phase |
Ref document number: 2021291555 Country of ref document: AU Date of ref document: 20210617 Kind code of ref document: A |