WO2021247367A1 - Compounds and compositions for treating, ameliorating, and/or preventing sars-cov-2 infection and/or complications thereof - Google Patents
Compounds and compositions for treating, ameliorating, and/or preventing sars-cov-2 infection and/or complications thereof Download PDFInfo
- Publication number
- WO2021247367A1 WO2021247367A1 PCT/US2021/034536 US2021034536W WO2021247367A1 WO 2021247367 A1 WO2021247367 A1 WO 2021247367A1 US 2021034536 W US2021034536 W US 2021034536W WO 2021247367 A1 WO2021247367 A1 WO 2021247367A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino
- pyridinecarboxylic acid
- pyridinyl
- pyrimidinyl
- alanine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4418—Non condensed pyridines; Hydrogenated derivatives thereof having a carbocyclic group directly attached to the heterocyclic ring, e.g. cyproheptadine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/444—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
Definitions
- the histone modifying enzyme is at least one selected from the group consisting of KDM6A, KMT2D, and JMJD6.
- R 1 is: C 1-6 alkyl; C 3-7 cycloalkyl; C 1-6 haloalkyl; a 5, 6 or 7-membered aryl or heteroaryl (which heteroaryl contains one or more heteroatoms selected from N, O and S and which is optionally fused to phenyl), said 5-, 6- or 7-membered aryl or heteroaryl being optionally substituted with one or more substituents independently selected from C 1-3 alkyl; 0-C 1-6 alkyl (which is optionally substituted by phenyl or naphthyl, each of which may be substituted by one of more substituents independently selected from halo); -O-cyclohexyl (which is optionally fused with phenyl); -C(O)NR C 2; or -NR a R b , each R a and R b is independently selected from: H; C 1-3 alkyl which is optionally substituted by one or more substituents independently selected from phenyl (which
- R 2 is a linker group with a maximum length of 5 atoms between R and R 3 and is selected from: -CO-C 1-6 alkyl-, -CO-, -CO-C 1-6 alkyl-O-, -CO- C 1-6 alkyl-S-, -CO- C 1-6 alkyl-O- C 1-6 alkyl-, -C 1-3 alkyl-, -C 1-3 alkyl-O-, -C 1-5 alkyl-S02-, -C 1-3 alkyl-NH-CO-, or -C 1-3 alkyl-C3- 8cycloalkyl-C 1-3 alkyl-0-; wherein each alkyl is straight chain or branched and may be optionally substituted by one or more substituents independently selected from phenyl or -OH;
- R 3 is selected from: a C6-12 mono or bicyclic aryl group, (each of which may be optionally substituted one or more times by substituents independently selected from halo, C 1-6 alkyl, Ci- 6haloalkyl, C 1-6 alkoxy, NHCOC 1-3 alkyl, -O-phenyl, -CH 2 -phenyl, phenyl (optionally substituted by C 1-3 alkyl), OH, NH 2 , CONH 2 , CN, -NHCOC 1-3 alkylNH 2 , -NHCOC 1-3 alkyl, NHCOOC 1-3 alkyl, -NHSOiC 1-3 alkyl, -SO 2 C 1-3 alkyl or a 5-12 membered mono or bicyclic heteroaryl group (optionally substituted by one or more substituents independently selected from phenyl, CH 2 phenyl, -C 1-6 alkyl, -oxo), a 5- or 6-membered
- R 3 is C 1 -C 2 alkyl and halogen- substituted C 1 -C 2 alkyl, R 4 is hydrogen,
- R 5 is H, Cl, or Br.
- I-BET151 (GSK1210151A or 7-(3,5-Dimethyl-1,2-oxazol-4-yl)-8-methoxy-1-[(lR)-1- pyridin-2-ylethyl]-3H-imidazo[4,5-c]quinolin-2-one);
- FIG. 5 illustrates key therapeutic targets implicated in SARS-CoV-2 infection by this work.
- FIG. 6G is a Venn diagram of top 100 pro-viral genes from SARS-CoV-2, rcVSV- SARS-CoV-2-S, HKU5-SARS-CoV-1-S and MERS-CoV screens.
- FIG. 8B shows a correlation matrix depicting the Pearson correlation between the guide-level log-fold change values relative to the plasmid DNA for the 13 subpool screens with the indicated viruses. All viruses were screened in duplicate (#1 and #2) except IAV- WSN. VSV was also screened but no cells survived infection.
- FIG. 8C is a PCA plot of all viruses revealing clustering and overlap of gene hits amongst SARS-CoV-2, rcVSV-SARS- CoV-2-S, HKU5-SARS-CoV-1-S, MERS-CoV WT and T1015N cluster. Influenza A virus/WSN/1933 (IAV-WSN) and encephalomyocarditis virus (EMCV) are outliers amongst the coronavirus screens.
- IAV-WSN IAV-WSN
- EMCV encephalomyocarditis virus
- FIG. 9C shows Western blots for ACE2, SMARCA4, KDM6A and SMAD3 expression in control and respective gene disrupted Vero-E6 cells.
- FIG. 9D shows Z-scores from genome-wide CRISPR screen correlating with cell viability of individually disrupted genes. Genes with multiple sgRNAs from (FIG. 9B) are averaged to generate one point per gene in (FIG. 9D). Data were analyzed by one-way ANOVA with Tukey's multiple comparison test. Shown are means ⁇ SEM. ns, not statistically significant; *P ⁇ 0.05; **P ⁇ 0.01; ***P ⁇ 0.001.
- FIGs. 10F-10H Vero-E6 (FIG. 10F), Huh7.5 (FIG. 10G) and Calu-3 (FIG. 10H) cells were pretreated with 10 pM SIS3 and 40 pM PFI-3 for 48 hours and then infected with SARS-CoV-2 at a MOI of 0.1.
- FIGs. 21 A-21C illustrate therapeutic targets of SMARCA4.
- FIG. 21 A shows the small molecule Compound 12, which inhibits SMARCA2 and SMARCA4, reduces SARS-CoV-2 - induced cell death in Vero-E6 cells.
- FIG. 21B shows Compound 12 reduces infection as measured by SARS-CoV-2 mNeon Green reporter expression.
- FIG. 21C shows Compound 12 reduces Ace2 mRNA expression in VeroE6 cells as measured by qPCR.
- antibody refers to an immunoglobulin molecule which specifically binds with an antigen.
- Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules.
- Effective amount or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to, anti-tumor activity as determined by any means suitable in the art.
- moduleating mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject.
- the term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
- Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
- the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
- specifically binds as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species.
- compositions and methods for treating, preventing, and/or ameliorating SARS-CoV-2 infection in a mammal such as but not limited to a human.
- the compound is selected from the group consisting of: N-[6-(1,1-dimethylethyl)-2-(2-pyridinyl)-4-pyrimidinyl]- ⁇ -alanine; N-[2-(2-pyridinyl)-6-(trifluoromethyl)-4-pyrimidinyl]- ⁇ -alanine; N-[6-(4-morpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]- ⁇ -alanine; N-[6-(methylamino)-2-(2-pyridinyl)-4-pyrimidinyl]- ⁇ -alanine; N-[2-(2-pyridinyl)-6-(1-pyrrolidinyl)-4-pyrimidinyl]- ⁇ -alanine; N-[6-[(2-hydroxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- ⁇ -alanine; N-[6-[6-[
- the compound contemplated within the invention is any JMJD3 inhibitor disclosed in International PCT Application No. W0213143597, published October 3, 2013, the contents of which are incorporated herein in their entireties by reference.
- the compound contemplated within the invention comprises, and/or is: wherein
- X is not: -NHCO-tert butyl; -NHCO-isobutyl; -OCH 2 phenyl; 4-pyridylmethylamino; -NHphenyl; or -NHcyclohexyl.
- the method comprises administering to the subject a therapeutically effective amount of an inhibitor of a molecule selected from the group consisting of ACE2, DYRK1A, SMARCA4, KDM6A, JMJD6, RAD54L2, DPF2, UBXN7, ARID 1 A, SMAD4, SH3Y11, PHIP, LDB1, SMARCEl, CTSL, ZNF628, RYBP, TMX3, HMGB1, SPTY2D1, ACVR1B, EIF3C, SERTAD4, CREBBP, SMAD3, TCEB3, SIAH1, BCBD1, and PKMYT1.
- an inhibitor of a molecule selected from the group consisting of ACE2, DYRK1A, SMARCA4, KDM6A, JMJD6, RAD54L2, DPF2, UBXN7, ARID 1 A, SMAD4, SH3Y11, PHIP, LDB1, SMARCEl, CTSL, ZNF628, RYBP, TMX3, HMGB1, SP
- compositions may be administered multiple times or in a single administration. Administration of the pharmaceutical composition may be combined with other methods useful to treat the disease or condition as determined by those of skill in the art.
- Vero-E6 cells 293T cells and Huh7.5 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) with 10% heat-inactivated fetal bovine serum (FBS), and 1% Penicillin/Streptomycin unless otherwise indicated.
- DMEM Dulbecco's Modified Eagle Medium
- FBS heat-inactivated fetal bovine serum
- Penicillin/Streptomycin 1% Penicillin/Streptomycin unless otherwise indicated.
- Calu-3 cells were cultured in Eagle's Minimum Essential Medium (EMEM) with 10% FBS, 1% Penicillin/Streptomycin, 1 mM sodium pyruvate and 4 mM L-Glutamine.
- EMEM Eagle's Minimum Essential Medium
- a plasmid encoding codon-optimized SARS-COV-2 S glycoprotein was obtained through BEI Resources (#NR-52309).
- VSV-delta G-luciferase plasmid was purchased from Kerafast.
- the African Green Monkey (AGM) genome- wide CRISPR knockout library which contains four unique sgRNA per gene, was delivered by lentiviral transduction of 2xl0 8 Vero-E6-Cas9 at -0.3 MOI. This equates to 6xl0 7 transduced cells, which is sufficient for the integration of each sgRNA 600 independent times. Two days post transduction, puromycin was added to the media and transduced cells were selected for seven days. Five conditions were set up for the screening. For each condition, 4xl0 7 cells were seeded in ten T175 flasks. Cells were infected with SARS-CoV-2 at MOI of 1.
- gDNA genomic DNA
- Illumina sequencing and screening analysis PCR was performed on gDNA to construct Illumina sequencing libraries, each containing 10 ⁇ g gDNA following the Broad Institute protocol PCR of sgRNAs for Illumina sequencing. The resulting sequencing reads were trimmed to 20-nt potential sgRNA sequences. Screens were analyzed as described below in “Screen analysis”
- SARS-CoV2 Plaque Assays Vero-E6 cells were seeded at 4 x 10 5 cells/well of a six- well plate. The following day, media was removed and 10-fold dilutions of virus was applied to each well for 1 hour with gentle rocking. After 1 hour incubation, overlay media was added (DMEM, 2% FBS, 0.6% Avicel RC-581). At 2 dpi for SARS-CoV-2 and 3 dpi for other coronaviruses, plates were fixed with 10% formaldehyde for 1 hour prior, stained with crystal violet solution (0.5% crystal violet and 20% ethanol) for 30 min, and then rinsed with deionized water to visualize plaques.
- VSV-based pseudotyped viruses were produced as described (Pernet et al. (2014) Nat Commun. Nov 18;5:5342. Briefly, 293T cells were transfected with pCAGGS expressing the SARS-CoV-2 spike glycoprotein and then inoculated with a replication-deficient VSV vector that contains expression cassettes for luciferase/eGFP instead of the VSV-G open reading frame. After an incubation period of 1 h at 37°C, the inoculum was removed and cells were washed with PBS before media supplemented with anti -VSV-G. Clone 14 was added in order to neutralize residual input virus (no antibody was added to cells expressing VSV-G). Pseudotyped particles were harvested 24 h post inoculation, clarified from cellular debris by centrifugation and stored at - 80°C before use.
- Vero-E6 cells were transduced with lenti- Cas9 (Cas9-vl, Addgene 52962) or pLX_311-Cas9 (Cas9-v2, Addgene 96924) and selected with blasticidin (5 ⁇ g/ml) for 10 days.
- Cas9 activity was assessed by transducing parental Vero-E6 or Vero-E6-Cas9 cells with pXPR_047 (Addgene 107645), which expresses eGFP and an sgRNA targeting eGFP (Doench et al. , (2014) Nature biotechnology , 32(12), pp. 1262-1267).
- Vero-E6- Cas9-v2 cells were individually transduced with lentiviruses expressing one to three unique sgRNA per gene and then selected with puromycin for 7 days. After selection, 1.25 x 10 3 cells were seeded in each well of a 384-well black walled clear bottom plate in 20 ⁇ l of DMEM + 5% FBS. The following day, 5 ⁇ l of SARS-CoV-2 was added for a final MOI of 0.2. Cells were incubated for three days before assessing cellular viability by CellTiter Glo (Promega). For each cell line, viability was determined in SARS-CoV-2 infected relative to mock infected cells. Five replicates per condition were performed in each of three independent experiments.
- SARS-CoV-2 fluorescent reporter virus assa Vero-E6 cells were plated at 2.5 x 10 3 cells per well in a 384-well plate and then the following day, icSARS-CoV-2-mNG was added at a MOI of 1.0 (Xie etal. (2020) Cell host & microbe , 27(5), pp. 841-848. e3). Infected cell frequencies as measured by mNeonGreen expression were assessed at 2 dpi by high content imaging (Cytation 5, BioTek) configured with bright field and GFP cubes. Total cell numbers were quantified by Gen5 software of brightfield images. Object analysis was used to determine the number of mNeonGreen positive cells. The percentage of infection was calculated as the ratio between the number of mNeonGreen+ cells and the total number of cells in brightfield. Data are normalized to the average of DMSO treated cells.
- Vero E6 cells 1250 Vero E6 cells were plated in each well in 20 ⁇ l of phenol-red free DMEM containing 5% FBS. Two days later, 5,000 PFU (MOI ⁇ 1) icSARS-CoV-2-mNG in 5 ⁇ l media was added. Cells were incubated at 37°C and 5% CO 2 for two days. Infected cell frequencies were quantified by mNeon Green expression at 2 dpi (Cytation 5, BioTek).
- RNA-seq Total cellular RNA was extracted using Direct-zol RNA MiniPrep Kit and submitted to the Yale Center for Genome Analysis for library preparation. RNA-seq libraries were sequenced on an Illumina NovaSeq 6000 instrument with the goal of at least 25 c 10 6 reads per sample. Reads were aligned to reference genome chlSab2, NCBI annotation release 100, using STAR aligner v2.7.3 a (Dobin et al., (2013) Bioinformatics , 29(1), pp. 15-21) with parameters — winAnchorMultimapNmax 200 — outFilterMultimapNmax 100 — quantMode GeneCounts.
- ChIP-seq libraries were sequenced on a Illumina NovaSeq 6000 instrument as 101 nt long paired-end reads, with the goal of at least 20 c 10 6 reads per IP. Reads were trimmed of adaptor sequences using Cutadapt (Martin, (2011) EMBnet.journal , 17(1), pp. 10-12) and aligned to the reference genome chlSab2 using Bowtie2 (Langmead and Salzberg, (2012) Nature methods , 9(4), pp. 357-359). Alignments were filtered using SAMtools (Li et al., (2009) Bioinformatics, 25(16), pp. 2078-2079), and peak calls and enrichment tracks were created using MACS2 (Zhang et al.
- Vero-E6 cells were mock-infected or infected with SARS-CoV-2 at a MOI of 1.0 for 24 hours before cellular fractionation was performed using a Nuclear/Cytosol fractionation kit (BioVision Cat#K266-25) according to manufacturer instructions. In brief, 1 x 10 7 cells were collected by centrifugation at 600 x g for 5 min at 4°C. Add 0.2 ml Cytosol Extraction Buffer A (CEB-A) to fully resuspend the cell pellet.
- CEB-A Cytosol Extraction Buffer A
- VSV-based pseudoviruses were produced in 293T cells. Cells were transfected with pCAGGS or pcDNA3.1 vector expressing the CoV spike glycoprotein and then inoculated with a replication-deficient VSV virus that contains expression cassettes for Renilla luciferase instead of the VSV-G open reading frame.
- Plasmids encoding codon-optimized form of SARS-CoV-1-S glycoprotein, MERS-CoV SACT and NL63 SACT glycoproteins lacking cytoplasmic tail were previously described (Huang el al. , 2006; (2006), Journal of Biological Chemistry , pp. 3198-3203. doi: 10.1074/ jbc.m508381200; Letko, Marzi and Munster, (2020) Nature microbiology , 5(4), pp. 562- 569).
- Vector pCAGGS containing the SARS-CoV-2, Wuhan-Hu-1 Spike Glycoprotein Gene, NR-52310 was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH.
- SWESNF Switch/ Sucrose Non-Fermentable
- SMARCA4 S witch/ Sucrose Non-Fermentable
- DPF2 DPF2
- ARID 1 A SMARCEl
- SMARCEB 1 S witch/ Sucrose Non-Fermentable
- SMARCA4 S witch/ Sucrose Non-Fermentable
- SMARCEl S witch/ Sucrose Non-Fermentable
- SMARCEB 1 S witch/ Sucrose Non-Fermentable
- the SWESNF complex is a highly conserved ATP- dependent chromatin remodeling complex implicated in a number of cancers. This suggests therapeutic antagonists of the SWESNF pathway would have anti-viral activity.
- TGF ⁇ signaling pathway SMAD3, SMAD4, SERTAD4, and ACTVR1B
- SIS3 and SB-505124 which, according to data disclosed herein, are anti-viral for SARS-CoV-2.
- Antagonists of the TGF ⁇ and SWI/SNF pathways represent novel drugs against SARS-CoV-2.
- the identification of the role of these well-studied and druggable regulatory pathways revealed novel therapeutic targets for COVID-19 and provided insight into viral tropism and the variation in host susceptibility to severe disease.
- Example 2 Drugs exhibiting anti-viral activity
- FIG. 4 and FIGs. 21-23 Various drugs were tested for anti -viral activity (FIG. 4 and FIGs. 21-23). Drugs that exhibit anti-viral activity in VeroE6 cells are tested for efficacy and toxicity in human Calu3 cells, human Huh7.5 cells, and primary human bronchial epithelial cells cultured at an air- liquid interface. Cells are treated with the drug at various concentrations starting at 40 micromolar and then SARS-CoV-2 is added. Viral replication is monitored by plaque assay. Drugs that exhibit anti-viral activity are also tested in transgenic K18-hACE2 mice which express the human ACE2 receptor under control of a K18 promoter. These mice succumb to intranasal SARS-CoV-2 infection and thus anti-viral drugs reduce viral load, mitigate weight loss, and increase survival (FIGs. 21-23).
- SARS-CoV-2 resistance genes ARID1 A, DYRK1A, KDM6A , and CTSL were also highly enriched in the MERS-CoV screen (FIG. 6F). Pairwise correlations of all genome-wide screens are shown in FIGs. 14A-14G (z-scores for all genes are shown in Table S2 of Wei et al, (2021) Cell 184, 76-91). Next, the top 100 resistance genes across the genome-wide screens were compared with SARS-CoV-2, rcVSV-SARS-CoV-2-S, HKU5-SARS-CoV-1-S, and MERS-CoV (WT) viruses.
- MERS-CoV 14 genes scored in the three SARS-lineage viruses but not MERS-CoV including A CE2, HMGB1, SMARCA4, DYRK1A , and DPF2 , suggesting these genes mediate entry of SARS-lineage viruses (FIG. 6G).
- the MERS receptor DIPL along with AXIN1 and TMEM41B were identified as MERS-CoV specific pro- viral genes while SMAD3 and SMAD4 were enriched only in the SARS-CoV-2 screens.
- BPTF which encodes the scaffold for the NURF chromatin remodeling complex, was broadly depleted for all four viruses.
- the SWI/SNF complex is an ATP-dependent nucleosome remodeling complex that regulates chromatin accessibility and gene expression.
- SWI/SNF complex genes ARID l A, SMARCB1, and SMARCC1 were enriched in both SARS- lineage and MERS-CoV screens
- SMARCA4 was enriched only in the SARS-lineage screens.
- histone modifying enzymes were also identified as key regulators of SARS- CoV-2-induced cell death (FIG. 6C and 13B).
- sgRNAs targeting H IRA , CABIN1, and ASF1A were negatively selected, revealing an anti-viral function.
- a custom CRISPR subpool was generated containing 10 sgRNAs for each of the top 250 and bottom 250 genes from an earlier analysis of the SARS-CoV-2 screen along with 500 non-targeting control sgRNAs and sgRNAs targeting other genes of interest such as the MERS-CoV receptor, DPP4.
- This sgRNA library was introduced into Vero-Cas9-v2 cells and this pool was challenged with either SARS-CoV- 2, rcVSV-SARS-CoV-2-S, HKU5-SARS-CoV-1-S, MERS-CoV, or MERS-CoV T1015N.
- the secondary screens for rcVSV-SARS-CoV-2-S and HKU5-SARS-CoV-1-S showed strong agreement with the SARS-CoV-2 secondary screen with correlation coefficients of 0.90 and 0.89, respectively (FIGs. 8D-8E).
- Minimal correlation was observed between either IAV or EMCV and SARS-CoV-2, with correlations of 0.23 and 0.042 respectively (FIG. 8G-8H). No cells survived infection with VSV thus precluding analysis. Together this demonstrates the virus-specificity of the identified host genes and provides insight into the stage of the virus life cycle mediated by critical genes.
- HMGB1 is a DNA binding protein that regulates chromatin
- HMGB1 controls a pro-viral gene expression program.
- the differentially expressed genes between control and HMGB1 disrupted cells were compared with the gene-level z- scores from the genome-wide CRISPR screen.
- pro-viral genes only HMGB1 , ACE2 and CTSL gene expression was significantly downregulated in HMGBI disrupted cells (FIG.
- the first genome-wide screens for host genes that affect infection by pandemic coronaviruses SARS-CoV-2 and MERS-CoV as well as the recombinant bat coronavirus HKU5-SARS-CoV-1-S were performed.
- the identification of the viral receptors A ( 7/2 and DPP4 and protease CTSL demonstrate the technical quality of the screens, providing confidence in the additional genes that regulate SARS-CoV-2 infection.
- Genes involved in diverse biological processes including chromatin remodeling, histone modification, cellular signaling, and RNA regulation were discovered.
- anti-HMGBl therapies can reduce respiratory syncytial virus replication and IAV-induced lung pathology in animal models, while in adenovirus infection, the viral protein VII binds HMGB1 and inhibits its proinflammatory functions.
- HMGB1 regulates ACE2 expression in a cell-intrinsic manner and not via its function as a cytokine or alarmin, suggesting a distinct mechanism of HMGB1 in SARS-CoV-2 infection.
- the pro-viral and anti-viral genes identified herein have important implications for understanding COVID-19 pathogenesis, therapeutics, and vaccine design.
- SARS-CoV- 2 can cause diverse phenotypes ranging from asymptomatic infection to severe respiratory failure and death. The basis for this variation among people and between species is unclear.
- the genes and pathways identified herein may explain this variation, as disease susceptibility may positively correlate with expression of resistance genes and negatively correlate with sensitization genes on the cellular, tissue, and organismal level. For example, cigarette smoking both increases ACE2 expression and exacerbates COVID-19 pathogenesis.
- SARS-CoV-1, MERS-CoV, and SARS-CoV-2 reveal the pandemic potential and dangers of emerging coronaviruses.
- This study represents the first genome-wide genetic screen performed with any human coronaviruses.
- these findings can be broadly applicable to other human and emerging coronaviruses, which will facilitate development of host-directed therapies against existing and future pandemic coronaviruses.
- Example 7 Small molecule inhibitors that inhibit coronavirus infection and pathogenesis
- KDM6A histone lysine demethylase
- H3K27 histone H3
- H3K27me3 Tri-methylated H3K27
- KDM6A is a frequently mutated epigenetic regulator in several cancer types which has led to the development of small molecule inhibitors (Yin etal. (2019) Biomed Pharmacother 118, 109384). Both enzyme-dependent and -independent functions of KDM6A have been reported. The role of KDM6A in viral infection is largely unknown although it has been shown to promote inflammation in response to respiratory syncytial virus and VSV infection.
- the KDM6A/B small molecule inhibitor GSK-J4 was tested for inhibition of SARS- CoV-2 replication in human Huh7.5 and Calu-3 cells (FIG. 22). GSK-J4 treatment resulted in a >2 log decrease in SARS-CoV-2 replication. Next, GSK-J4 was tested to see if it confers a survival advantage to high-dose (10 6 PFU) intranasal SARS-CoV-2 challenge. Consistent with the reduction in viral replication cell lines, GSK-J4 confers a survival advantage from SARS-CoV-2 in vivo using K18-human ACE2 mice (FIG. 23).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
Abstract
The present disclosure includes compositions and methods for treating, ameliorating, and/or preventing SARS-CoV-2 infection, and/or one or more complications thereof. In certain embodiments, the methods comprise administering a therapeutically effective amount of an inhibitor of a molecule in the SWI/SNF complex, inhibitor of a molecule in the TGFβ signaling pathway, and/or inhibitor of a histone regulator molecule to a subject in need thereof.
Description
TITLE
COMPOUNDS AND COMPOSITIONS FOR TREATING, AMELIORATING, AND/OR PREVENTING SARS-COV-2 INFECTION AND/OR COMPLICATIONS THEREOF
CROSS-REFERENCE TO RELATED APPLICATION
The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63/033,301, filed June 2, 2020, which is hereby incorporated by reference in its entirety herein.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR
DEVELOPMENT
This invention was made with government support under All 28043 awarded by National Institutes of Health. The government has certain rights in the invention
SEQUENCE LISTING
The ASCII text file named "047162-7293 WO 1 Sequence Listing ST25" created on May 27, 2021, comprising 9 Kbytes, is hereby incorporated by reference in its entirety.
BACKGROUND
Severe Acute Respiratory Syndrome-Coronavirus-2 (SARS-CoV-2), which is the causative agent of Coronavirus Disease 2019 (COVID-19), represents the greatest public health threat in a century. To date, more than 164,000,000 people have been infected with over than 3,400,000 deaths globally. Novel therapeutics and vaccines are desperately needed.
Coronaviruses are enveloped positive-sense RNA viruses with genomes of approximately 30kb. They exhibit broad host-range among birds and mammals and are typically transmitted via the respiratory route. There are four circulating seasonal coronaviruses in humans (NL63, OC43, 229E, and HKUl) and three highly pathogenic zoonotic coronaviruses (SARS-CoV, MERS, and SARS-CoV-2), none of which have effective therapeutics or vaccines.
The first stage of the SARS-CoV-2 life cycle is viral entry, which is mediated by the viral spike protein. The receptor binding domain of the spike binds to the cell surface receptor angiotensin-converting enzyme 2 (ACE2). Receptor expression is the primary determinant of host range and cell tropism. In addition to receptor binding, coronavirus entry requires proteolytic processing of the spike protein at the interface of the SI and S2 domains to enable
viral membrane fusion. Both the plasma membrane protease TMPRSS2 and the endosomal protease Cathepsin L have been reported to cleave SARS-CoV-2 spike. In fact, protease inhibitors that block spike activation are effective inhibitors of SARS-CoV-2 infection in vitro. Upon viral membrane fusion, the viral RNA is released into the cytoplasm, where it is translated and establishes viral replicase complexes in the endoplasmic reticulum before trafficking to the plasma membrane where it buds.
There is an urgent need to identify host factors essential for infection. Such information is critical to inform basic mechanisms of COVID-19 pathogenesis, reveal variation in host susceptibility, and/or identify novel host-directed therapies that have efficacy against current and future pandemic coronaviruses. The present invention addresses this need.
SUMMARY OF THE DISCLOSURE
The present disclosure provides a method for treating, ameliorating, and/or preventing SARS-CoV-2 infection, and/or one or more complications thereof, in a subject in need thereof.
In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of an inhibitor of a molecule in the TGFβ signaling pathway.
In certain embodiments, the molecule in the TGFβ signaling pathway is at least one selected from the group consisting of SMAD3, SMAD4, SERTAD4, and ACTVR1B.
In certain embodiments, the inhibitor is at least one selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, a recombinant protein, a ligand, and a receptor decoy.
In certain embodiments, the small molecule drug is selected from the group consisting of: SIS3 ((E)-1-(6,7-Dimethoxy-3,4-dihydroisoquinolin-2(lH)-yl)-3-(1-methyl-2-phenyl-1H- pyrrolo[2,3-b]pyridin-3-yl)prop-2-en-1-one), SB-505124 (2-[4-(1,3-Benzodioxol-5-yl)-2- (1,1-dimethylethyl)-1H-imidazol-5-yl]-6-methyl-pyridine), EW-7197 or vactosertib (N-((5- ([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4-(6-methylpyridin-2-yl)-1H-imidazol-2-yl)methyl)-2- fluoroaniline), K02288 (3-(6-amino-5-(3,4,5-trimethoxyphenyl)pyridin-3-yl)phenol), LDN- 212854 (5-[6-[4-(1-Piperazinyl)phenyl]pyrazolo[l,5-a]pyrimidin-3-yl]-quinoline), SB- 431542 (4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide), or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the method comprises administering to the subject a
therapeutically effective amount of a histone modifying enzyme inhibitor.
In certain embodiments, the histone modifying enzyme is at least one selected from the group consisting of KDM6A, KMT2D, and JMJD6.
In certain embodiments, the inhibitor is at least one selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, a recombinant protein, a ligand, and a receptor decoy.
In certain embodiments, the small molecule drug is selected from the group consisting of: metformin, MLN4924 (pevonedistat or [(lS,2S,4R)-4-[4-[[(lS)-2,3-Dihydro-1H-inden-1- yl]amino]pyrrolo[2,3-d]pyrimidin-7-yl]-2-hydroxycyclopentyl]methyl sulfamate); I-CBP112 (1-[7-(3,4-Dimethoxyphenyl)-9-[[(3S)-1-methylpiperidin-3-yl]methoxy]-2,3,4,5-tetrahydro- 1,4-benzoxazepin-4-yl]propan-1-one); GSK-J1 (3-((2-(pyridin-2-yl)-6-(1,2,4,5-tetrahydro- 3H-benzo[d]azepin-3-yl)pyrimidin-4-yl)amino)propanoic acid); GSK-J2 (3-((2-(pyridin-3- yl)-6-(1,2,4,5-tetrahydro-3H-benzo[d]azepin-3-yl)pyrimidin-4-yl)amino)propanoic acid); GSK-J3 (3-((2-(4-(3-(methylamino)propyl)pyridin-2-yl)-6-(1,2,4,5-tetrahydro-3H- benzo[d]azepin-3-yl)pyrimidin-4-yl)amino)propanoic acid); GSK-J4 (ethyl 3-((2-(pyridin-2- yl)-6-(1,2,4,5-tetrahydro-3H-benzo[d]azepin-3-yl)pyrimidin-4-yl)amino)propanoate); GSK- J5 (ethyl 3-((2-(pyridin-3-yl)-6-(1,2,4,5-tetrahydro-3H-benzo[d]azepin-3-yl)pyrimidin-4- yl)amino)propanoate); or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
R1 is: C1-6 alkyl; C3-7 cycloalkyl; C1-6 haloalkyl; a 5, 6 or 7-membered aryl or heteroaryl (which heteroaryl contains one or more heteroatoms selected from N, O and S and which is optionally fused to phenyl), said 5-, 6- or 7-membered aryl or heteroaryl being optionally substituted with one or more substituents independently selected from C1-3alkyl; 0-C1-6alkyl (which is optionally substituted by phenyl or naphthyl, each of which may be substituted by one of more substituents independently selected from halo); -O-cyclohexyl (which is optionally fused with phenyl); -C(O)NRC2; or -NRaRb, each Ra and Rb is independently selected from: H; C1-3alkyl which is optionally
substituted by one or more substituents independently selected from phenyl (which phenyl is optionally substituted by one or more substituents independently selected from C1-3alkyl, O-C1-3alkyl, C(O)NRC2, halo and cyano), C(O)NRC2, a 4-, 5-, 6- or 7-membered heterocyclic or heteroaryl group (containing one or more heteroatoms independently selected from N, O and, S), a 3-, 4-, 5-, 6- or 7-membered cycloalkyl group (which is optionally fused to phenyl), halo, OC1-3alkyl, OH, -NHCOC1-3alkylNRc 2 and C(O)NHCH2C(O)NRc 2; a 3-, 4-, 5-, 6- or 7- membered cycloalkyl group (which is optionally fused to phenyl), or Ra and Rb together form a 5-, 6- or 7-membered heterocyclic group optionally containing one or more further heteroatoms independently selected from N, O, S or S(O)2 said heterocyclic group being optionally fused to a 5-, 6- or 7-membered aryl or heteroaryl ring containing one or more heteroatoms independently selected from N, O and S; the heterocylic ring and/or the aryl or heteroaryl to which it is optionally fused being optionally substituted by one or more substituents independently selected from halo, OH, C1-3alkyl, O-C1-3alkyl, C(O)C1-3alkyl, S(O)2C1-3alkyl, NHC(O)C1-3alkyl, NHS(O)2C1-3alkyl, C(O)NRc 2, C(O)NRd 2 (wherein Rd and Rd together form a 5- or 6-membered heterocylic ring), NRC2 C(O)phenyl, S(O)2NRC2, =0 (oxo) and 5-, 6- or 7-membered aryl or heteroaryl (containing one or more heteroatoms independently selected from N, O and S);
R2 and R3 are each independently selected from: H, (CH2)1-3NRc(CH2) 1-3NRc2 ; (CH2)I- eNRc2; C1-3 alkyl; 0-C1-3alkyl; C1-3haloalkyl; (CH2)0-3NRaRb (wherein Ra and Rb are as defined above); (CH2)0-3NHPh; (CH2)0-30Ph; (CH2)0-30h; or R2 and R3 together form a fused phenyl ring, and each Rc is independently selected from hydrogen and C1-3alkyl; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the small molecule drug is:
N-[6-(1,1-dimethylethyl)-2-(2-pyridinyl)-4-pyrimidiny1]-p-alanine; N-[2-(2-pyridinyl)-6-(trifluoromethyl)-4-pyrimidinyl]-β-alanine; N-[6-(4-morpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-p-alanine; N-[6-(methylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[2-(2-pyridinyl)-6-(l -pyrrolidinyl)-4-pyrimidinyl]-p-alanine;
N-[6-[(2-hydroxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-p-alanine;
N-[6-[(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-hydroxyethyl)(methyl)amino]-2-(2-pyTidinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(dimethylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-p-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine; N-[6-pheny1-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(aminocarbonyl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[4-(aminocarbonyl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-({[3,4-bis(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(3-amino-3-oxopropyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; N-[6-{[(3,4-dichlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-({[3-(aminocarbonyl)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{ [(4-chl orophenyl)methyl ]ami no}-2-(2-pyridi nyl)-4-pyri midi nyl]-β-alanine; N-[6-(lH-pyrazo1-4-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3-methyl-l H-pyrazol-4-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(3-chlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(2-methylphenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{ 2-(2-pyridinyl )-6-[(2-thienyl methyl )amino]-4-pyri midi nyl }-β-alanine; N-[6-({[3-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-{2-(2-pyridinyl)-6-[(2-pyridinylmethyl)amino]-4-pyrimidinyl]-β-alanine; N-[6-({[4-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(cyclopropyl methyl )amino]-2-(2-pyridi nyl )-4-pyri midi nyl ]-β-alanine; N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-( 1 -methyl ethyl )-2-(2-pyridi nyl )-4-pyrimidi nyl ]-β-alanine;
N-[6-cyclopropyl-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(diethylamino)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(1,3,4-oxadiazol-2-yl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[4-(1,3-thiazol-2-yl)-1-piperazinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(4-phenyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(4-chlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(hexahydro-1H-azepin-1-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1-benzothien-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3,4-dihydro-2(l H)-isoquinolinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{4-[(methylamino)carbonyl]-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(7-hydroxy-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine;
N-[6-(7-bromo-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[6-(5-hydroxy-1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-{2-(2-pyridinyl)-6-[(4-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine; N-{2-(2-pyridinyl)-6-[(3-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine N-[6-(2,3-dihydro-l H-inden-2-ylamino)-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; N-[6-[(2-phenylethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; N-[6-[methyl(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; 3-{[6-(1,1-dimethylethyl)-2-(2-pyridinyl)-4-pyrimidinyl]amino}-2-methylpropanoic acid; N-[6-(methyloxy)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(1,1-dimethylethyl)-2-(3-isoquinolinyl)-4-pyrimidinyl]-β-alanine; N-{6-(1,1-dimethylethyl)-2-[5-(trifluorc>methyl)-2-pyridinyl]-4-pyrimidinyl}-β-alanine; N-[6-(1,1-dimethylethyl)-2-(4-methyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-{6-(1,1-dimethylethyl)-2-[4-(methyloxy)-2-pyridinyl]-4-pyrimidinyl}-β-alanine; N-{6-(1,1-dimethylethyl)-2-[5-(methyloxy)-2-pyridinyl]-4-pyrimidinyl}-β-alanine; N-[6-(1,1-dimethylethyl)-2-(5-methyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[2-[4-(dimethylamino)-2-pyridinyl]-6-(1,1-dimethylethyl)-4-pyrimidinyl]-β-alanine; N-[6-[7-(methyloxy)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-(4-acetyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(methylsulfonyl)-1-piperazinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(acetylamino)-1-pyrrolidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{3-[(methylsulfonyl)amino]-1-pyrrolidinyl}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(phenylmethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(acetylamino)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{3-[(methylsulfonyl)amino]-1-piperiddinyl}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-phenyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-hydroxy-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[(4-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-{2-(2-pyridinyl)-6-[(3-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-[6-(2,3-dihydro-l H-inden-2-ylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-phenylethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(4-thiomorpholinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3-hydroxy-1-pyrrolidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(l,3,4,5-tetrahydro-2H-2-benzazepin-2-yl)-4-pyrimidinyl]-β-alanine;
N-[6-(1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-methyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-({[3-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(3-cyanophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[2-(methyloxy)ethyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1,1-dioxido-4-thiomorpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[bis(2 -hydroxy ethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[4-(phenylcarbonyl)-1-piperazinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{3-[(methylamino)carbonyl]-1-piperidinyl}-2-(2-pyridinyl)-4-pyrimidiyl]-β-alanine; N-{2-(2-pyridinyl)-6-[3-(1-pynOlidinylcarbonyl)-1-piperidinyl]-4-pyrimidinyl}-β-alanine; N-[6-(4-methyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(4,4-dimethyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(4-propanoyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(5-chloro-1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[5-(methyloxy)-1,3-dihydro-2H-isoindol-2-yl]-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[6-[(2-phenylethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(1-oxo-3,4-dihydro-2(1H)-isoquinolinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(2 -methyl-4, 5, 7, 8-tetrahydro-6 H-[l,3]thiazolo[4,5-d]azepin-6-yl)-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-[7-(methylsulfonyl)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-[7-(aminosulfonyl)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,3,4-tetrahydro-2-naphthalenyloxy)-4-pyrimidinyl]-β-alanine;
N-{6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-2-[4-(1,2,4,5-tetrahydro-3H-3-benzazepin-
3-yl)-2-pyridinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(1-benzothien-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-(6-( 1,3 -dihydro-2 H-isoindol-2-yl)-2-{4-[(phenylamino)methyl]-2-pyridinyl}-4- pyrimidinyl]-β-alanine;
N-(6-( 1,3 -dihydro-2 H-isoindol-2-yl)-2-{4-[(phenyloxy)methyl]-2-pyridinyl}-4-pyrimidinyl]- b-alanine;
N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(4-phenyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(methylamino)carbonyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-( 1 , 1 -di methyl ethyl )-2-(4-methyl -2-pyridinyl)-4-pyri mi dinyl]-β-alanine;
N-[6-[{[3-(aminocarbonyl)phenyl]methyl}(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]-β-alanine;
3-({2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-[(phenylmethyl)amino]-4- pyrimidinyl} amino) propanoic acid;
3-({2-(4-{3-[(2-aminoethyl)amino]propyl}-2-pyridinyl)-6-[(phenylmethyl)amino]-4- pyrimidinyl}amino)propanoic acid;
3-{[2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]amino}propanic acid;
3-{[6-{[3-(methylamino)-3-oxopropyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]amino) propanoic acid;
N-[6-[(2-carboxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanyl-Nl- methylglycinamide;
N-[6-({2-[3-(β-alanylamino)phenyl]ethyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(2,6-dimethylphenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine
N-[2-{4-[(2-hydroxyethyl)amino]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[4-(1-pyrrolidinylcarbonyl)-1-piperidinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(cyclohexylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6- {4-[(di methyl ami no(carbonyl]- l -piperidinyl }-2-(2-pyridinyl(-4-pyrimidinyl]-β-alanine;
3 - { [6- (methyl [3 -(methylamino)-3 -oxopropyl]amino } -2-(2-pyridinyl)-4- pyrimidinyl] amino } propanoic acid;
N-[6-{ [(3, 4-di chlorophenyl (methyl ]oxy }-2-(2-pyri dinyl(-4-pyri midi nyl]-β-alanine;
N-[6-[(1-phenylethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{ [(3 -chi orophenyl (methyl ]oxy }-2-(2-pyridinyl(-4-pyrimidinyl]-β-alanine;
N-[6-[(2-naphthalenylmethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine;
N-[6-( 1 -methyl ethyl (-2-(2-pyridinyl(-4-pyrimidinyl]-β-alanine,
N-[2-(2-pyridinyl)-6-(trifluoromethyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-morpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(methylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1-pyrrolidinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-hydroxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-hydroxyethyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(dimethylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
X is -(R1)0-1-(R2)0-1-R3 or -R1-R4; each R is independently NH, N(CH3), or O;
R2 is a linker group with a maximum length of 5 atoms between R and R3 and is selected from: -CO-C1-6alkyl-, -CO-, -CO-C1-6alkyl-O-, -CO- C1-6alkyl-S-, -CO- C1-6alkyl-O- C1-6alkyl-, -C1-3alkyl-, -C1-3alkyl-O-, -C1-5alkyl-S02-, -C1-3alkyl-NH-CO-, or -C1-3alkyl-C3- 8cycloalkyl-C1-3alkyl-0-; wherein each alkyl is straight chain or branched and may be optionally substituted by one or more substituents independently selected from phenyl or -OH;
R3 is selected from: a C6-12 mono or bicyclic aryl group, (each of which may be optionally substituted one or more times by substituents independently selected from halo, C1-6alkyl, Ci- 6haloalkyl, C1-6alkoxy, NHCOC1-3alkyl, -O-phenyl, -CH2-phenyl, phenyl (optionally substituted by C1-3alkyl), OH, NH2, CONH2, CN, -NHCOC1-3alkylNH2, -NHCOC1-3alkyl, NHCOOC1-3alkyl, -NHSOiC1-3alkyl, -SO2C1-3alkyl or
a 5-12 membered mono or bicyclic heteroaryl group (optionally substituted by one or more substituents independently selected from phenyl, CH2phenyl, -C1-6 alkyl, -oxo), a 5- or 6-membered heterocyclic group containing one or more heteromoieties independently selected from N, S, SO, SO2 or O and optionally fused to a phenyl group
(optionally substituted by one or more substituents independently selected from phenyl, CH2phenyl, C1-3alkyl) or a 3-7 membered cycloalkyl (including bridged cycloalkyl) and optionally fused to a phenyl group (and optionally substituted by one or more substituents independently selected from OH, phenyl, -CH2 phenyl),
R4 is selected from: C1-6 straight chain or branched alkyl (optionally substituted byNH2), or COCi-8 straight chain or branched alkyl; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, X is not: -NHCO-tert butyl; -NHCO-isobutyl; -OQ/bphenyl; 4-pyridylmethylamino; -NHphenyl; or -NHcyclohexyl.
In certain embodiments, the small molecule drug is at least one of the following: 3-{[(4-chlorophenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-{[(4-methylphenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-[(3-phenylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylcarbonyl)amino]-4-pyridinecarboxylic acid; 3-[(2,2-dimethylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-{[(phenyloxy)acetyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(4-methylphenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-[(2-naphthalenylacetyl)amino]-4-pyridinecarboxylic acid; 3-{[4-(2-naphthalenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(4-bromophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(3,4-dichlorophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[(3,4-dichlorophenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-({4-[3-(acetylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-{[4-(4-pyridinyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-[(2-methyl-4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(phenyloxy)propanoyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(phenylthio)propanoyl]amino}-4-pyridinecarboxylic acid; 3-({[3,4-bis(methyloxy)phenyl]acetyl}amino)-4-pyridinecarboxylic acid; 3-[(3,4-dihydro-2(lH)-isoquinolinylacetyl)amino]-4-pyridinecarboxylic acid; 3-[(1,3-dihydro-2H-isoindol-2-ylacetyl)amino]-4-pyridinecarboxylic acid; 3-[(2-phenylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-({4-[3-(methyloxy)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid;
3-[(2-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(2-phenylpropyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methyl-2-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(4-phenylbutyl)oxy]-4-pyridinecarboxylic acid; 3-{[3-(2-naphthalenyloxy)propyl]amino}-4-pyridinecarboxylic acid;
3 -[(3- { [3 -(trill uoromethyl)phenyl]oxy [propyl )amino]-4-pyridinecarboxylic acid; 3-({3-[(3-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-{[3-(7-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(5-quinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid;
3 - { [3 -(4-biphenylyloxy)propyl]amino} -4-pyridinecarboxylic acid;
3- { [4-(3-aminophenyl)butanoyl]amino} -4-pyridinecarboxylic acid; 3-(3-phenylpropyl)-4-pyridinecarboxylic acid;
3-({3-[(2-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-[(3-phenylpropyl)amino]-4-pyridinecarboxylic acid;
3- { [4-(3-hydroxyphenyl)butanoyl]amino} -4-pyridinecarboxylic acid;
3- i [4-(4-hydroxyphenyl)butanoyl]amino} -4-pyridinecarboxylic acid; 3-[(4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylacetyl)amino]-4-pyridinecarboxylic acid; 3-(hexanoylamino)-4-pyridinecarboxylic acid; 3-({[(phenylmethyl)oxy]acetyl}amino)-4-pyridinecarboxylic acid; 3-[(2-methylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-[(3,3-dimethylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-[(5-phenylpentanoyl)amino]-4-pyridinecarboxylic acid; 3-({4-[4-(methyloxy)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid;
3-[ [4-(4-chlorophenyl)butanoyl]amino} -4-pyridinecarboxylic acid; 3-[(4-phenylbutyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methyl-4-phenylbutyl)amino]-4-pyridinecarboxylic acid; 3-({3-[(4-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-[(2-aminoethyl)amino]-4-pyridinecarboxylic acid; 3-({2-[(phenylcarbonyl)amino]ethyl}amino)-4-pyridinecarboxylic acid; 3-{[3-(phenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[2-(2-naphthalenyl)ethyl]amino}-4-pyridinecarboxylic acid; 3-{[(1-phenyl-1H-pyrazol-4-yl)methyl]amino}-4-pyridinecarboxylic acid;
3-{[2-(4-bromophenyl)ethyl]amino}-4-pyridinecarboxylic acid; 3-{[2-hydroxy-3-(phenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(4-phenylpentyl)amino]-4-pyridinecarboxylic acid;
3-[({l-[(phenyloxy)methyl]cyclopropyl}methyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(phenylsulfonyl)propyl]amino}-4-pyridinecarboxylic acid; 3-{[(1-phenyl-3-pyrrolidinyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(diphenylmethyl)amino]-4-pyridinecarboxylic acid;
3-({[1-(phenylmethyl)-3-pyrrolidinyl]methyl}amino)-4-pyridinecarboxylic acid; 3-[methyl(phenylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[2-(4-biphenylyl)ethyl]amino}-4-pyridinecarboxylic acid; 3-[(2,4-diphenylbutyl)amino]-4-pyridinecarboxylic acid; 3-{[(1-phenyl-1H-pyrazol-4-yl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[1-(phenylmethyl)-1H-pyrazol-4-yl]amino}-4-pyridinecarboxylic acid; 3-({3-[(2-oxo-1,2,3,4-tetrahydro-6-quinolinyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-{[1-(phenylmethyl)-l H-1,2,4-triazol-3-yl]amino}-4-pyridinecarboxylic acid;
3-[(l S,4R)-bicyclo[2.2.1 ]hept-2-ylamino]-4-pyridinecarboxylic acid; 3-[(tetrahydro-2H-pyran-2-ylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(2-cyanophenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(4-pyridinylmethyl)amino]-4-pyridinecarboxylic acid;
3 -({ [ 1 -(phenylmethyl)- lH-pyrazol-4-yl]methyl } amino)-4-pyridinecarboxylic acid; 3-{[3-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-(2,3-dihydro-1H-inden-1-ylamino)-4-pyridinecarboxylic acid; 3-[(2-pyridinylmethyl)amino]-4-pyridinecarboxylic acid; 3-(3-biphenylylamino)-4-pyridinecarboxylic acid; 3-{[3-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-{[(3-cyanophenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-({[2-(acetylamino)phenyl]methyl}amino)-4-pyridinecarboxylic acid;
3 -[(cyclohexyl methyl )amino]-4-pyridinecarboxylic acid; 3-({4-[4-(β-alanylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-[(4-{3-[(N-{[(1,1-dimethylethyl)oxy]carbonyl}-b-alanyl)amino]phenyl}butanoyl)amino]-4- pyridinecarboxylic acid;
3-({4-[3-(β-alanylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-{[(lS,2R)-2-hydroxy-2,3-dihydro-1H-inden-1-yl]amino}-4-pyridinecarboxylic acid; 3-[(3-biphenylylmethyl)amino]-4-pyridinecarboxylic acid;
3-[(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)amino]-4-pyridinecarboxylic acid; 3-{[(1-phenylcyclohexyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-(2-pyridinylamino)-4-pyridinecarboxylic acid; 3-{[(2'-methyl-2-biphenylyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[2-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-[(4-phenylcyclohexyl)amino]-4-pyridinecarboxylic acid; 3-(2-biphenylylamino)-4-pyridinecarboxylic acid; 3-{[4-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-{[2-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-[(2,2,6,6-tetramethyl-4-piperidinyl)amino]-4-pyridinecarboxylic acid; 3-(1,3-dihydro-2H-isoindol-2-yl)-4-pyridinecarboxylic acid;
3 -(4-phenyl- l-piperazinyl)-4-pyridinecarboxylic acid; 3-(1,2,3,4-tetrahydro-1-naphthalenylamino)-4-pyridinecarboxylic acid;
3-( i [1 -(phenylmethyl)-3-piperidinyl]methyl Jamino)-4-pyridinecarboxylic acid; 3-[(4-biphenylylmethyl)amino]-4-pyridinecarboxylic acid;
3 -(2, 3 -dihydro- 1 H-inden-2-ylamino)-4-pyridinecarboxylic acid; 3-[(1-cyclohexylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1,1-dimethylethyl)amino]-4-pyridinecarboxylic acid;
3 3-[(3-{[3-(1-piperazinyl)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(6-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(3-pyridinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-{[3-(methyloxy)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-({3-[(3-fluorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-[(3-{[3-(phenyloxy)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-[(cyclopropylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(3-thienylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(3-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(lH-imidazol-4-ylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methylethyl)amino]-4-pyridinecarboxylic acid; 3-{[(lR)-1-(2-methylphenyl)butyl]amino}-4-pyridinecarboxylic acid; 3-[(lH-pyrazol-5-ylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(1-methylcyclohexyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(5-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid;
3-[(2-furanylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(lS)-1-(2-methylphenyl)butyl]amino}-4-pyridinecarboxylic acid; 3-(cyclobutylamino)-4-pyridinecarboxylic acid; 3-[(2-cyclopentyl-1-methylethyl)amino]-4-pyridinecarboxylic acid; 3-{[(2,4-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(2-thienylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(2,3-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid;
3 -[(cyclopentyl methyl )amino]-4-pyridinecarboxy lie acid; 3-{[(2,5-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(3-pentyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(4-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(2,6-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid;
3 - { [3 -({ 3 -[(methyl sulfonyl)amino]phenyl Joxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-{ [3 -(methyl sulfonyl)phenyl]oxy [propyl )amino]-4-pyridinecarboxyhc acid; 3-({3-[(3-methylphenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid;
3-{[3-(2-oxo-l (2H)-pyridinyl)propyl]amino}-4-pyridinecarboxylic acid; 3-[(4-cyclohexylbutanoyl)amino]-4-pyridinecarboxyhc acid; 3-{[3-(2-pyridinyloxy)propyl]amino}-4-pyridinecarboxylic acid;
3-[(3-{ [4-(ami nocarbonyl )phenyl]oxy [propyl )amino]-4-pyridinecarboxyhc acid; 3-{[3-({4-[(methylsulfonyl)amino]phenyl}oxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(8-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(1-naphthalenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-aminopropyl)amino]-4-pyridinecarboxylic acid;
3 -[(cyclobutyl methyl )amino]-4-pyridinecarboxylic acid; 3-(propylamino)-4-pyridinecarboxylic acid; 3-[methyl(4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-({2-[2-(methyloxy)phenyl]ethyl}amino)-4-pyridinecarboxylic acid; 3-[(2-methylpropyl)amino]-4-pyridinecarboxylic acid; 3-(methylamino)-4-pyridinecarboxylic acid;
3-(butylamino)-4-pyridinecarboxylic acid; 3-[(2-cyclohexylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methyl-1-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-(cyclopentylamino)-4-pyridinecarboxylic acid;
3-(cyclohexylamino)-4-pyridinecarboxylic acid; 3-[(2-cyclopentylethyl)amino]-4-pyridinecarboxylic acid; 3-[(2-cyclohexyl-1,1-dimethylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-cyclohexyl-1-methylethyl)amino]-4-pyridinecarboxylic acid; 3-[(4-{3-[(N-{5-[(3aS,4S,6aR)-2-oxohexahydro-l H-thieno[3,4-d]imidazol-4- yl]pentanalanyl)amino]phenyl}butanoyl)amino]-4-pyridinecarboxylic acid; 3-{[(lR,2S)-1-hydroxy-2,3-dihydro-l H-inden-2-yl]amino}-4-pyridinecarboxylic acid; 3-[(1-cyclohexylcyclopropyl)amino]-4-pyridinecarboxylic acid; 3-({2-[4-(2-thienyl)phenyl]ethyl}amino)-4-pyridinecarboxylic acid; 3-{[(2,4-difluorophenyl)carbonyl]amino}-4-pyridinecarboxylic acid; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of an inhibitor of a molecule in the Switch/ Sucrose Non- Fermentable (SWI/SNF) complex.
In certain embodiments, the molecule in the SWI/SNF complex is at least one selected from the group consisting of SMARCA4, DPF2, ARID 1 A, SMARCEl, and SMARCEB 1.
In certain embodiments, the inhibitor is at least one selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, a recombinant protein, a ligand, and a receptor decoy.
In certain embodiments, the small molecule drug is at least one of the following:
PFI-3 ((E)-1-(2-Hydroxyphenyl)-3-((lR,4R)-5-(pyridin-2-yl)-2,5-diazabicyclo[2.2.1]heptan- 2-yl)prop-2-en- 1 -one); a compound of formula:
wherein:
R1 is H, amino, or hydroxy-substituted C1-C2 alkyl,
R2 is H,
R3 is C1-C2 alkyl and halogen- substituted C1-C2 alkyl, R4 is hydrogen,
R5 is H, F, Cl, Br, or I, and
R6 is H, F, Cl, Br, or I; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, R1 is H, amino, or hydroxymethyl.
In certain embodiments, R3 is methyl, difluoromethyl or trifluoromethyl.
In certain embodiments, R5 is H, Cl, or Br.
In certain embodiments, R6 is H or F.
In certain embodiments, the small molecule drug is: 1-(2-chloropyridin-4-yl)-3-(3-methylisothiazol-5-yl)urea, 1-(2-chloropyridin-4-yl)-3-(3-(trifluoromethyl)isothiazol-5-yl)urea, 1-(2-chloropyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(5-amino-2-chloropyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(2-chloro-5-(hydroxymethyl)pyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(2-fluoro-5-(hydroxymethyl)pyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(5-amino-2-fluoropyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(3-(difluoromethyl)isothiazol-5-yl)-3-(2-fluoro-3-(hydroxymethyl)pyridin-4-yl)urea, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of at least one of the following drugs:
INDY ((lZ)-1-(3-Ethyl-5-hydroxy-2(3H)-benzothiazolylidene)-2-propanone);
Leucettine L41 ((5Z)-5-(1,3-Benzodioxol-5-ylmethylene)-3,5-dihydro-2-(phenylamino)-4H- imidazol-4-one);
CX-4945 (Silmitasertib or 5-(3-Chloroanilino)benzo[c][2,6]naphthyridine-8-carboxylic acid); Harmine (7-Methoxy-l -methyl -9H-pyrido[3,4-b]-indole);
TBB (4,5,6,7-Tetrabromobenzotriazole);
I-BET151 (GSK1210151A or 7-(3,5-Dimethyl-1,2-oxazol-4-yl)-8-methoxy-1-[(lR)-1- pyridin-2-ylethyl]-3H-imidazo[4,5-c]quinolin-2-one);
ML-385 (N-[4-[2,3-Dihydro-1-(2-methylbenzoyl)-1H-indol-5-yl]-5-methyl-2-thiazolyl]-1,3- b enzodi oxol e- 5 -acetami de) ;
A 83-01 (3-(6-Methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1- carbothioamide);
PR-619 (2,6-Diamino-3,5-dithiocyanatopyridine);
Calpain Inhibitor III (MDL 28170, or Benzyl N-[(2S)-3-methyl-1-oxo-1-[(1-oxo-3- phenylpropan-2-yl)amino]butan-2-yl]carbamate);
or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of an inhibitor of a molecule selected from the group consisting of ACE2, DYRK1A, SMARCA4, KDM6A, JMJD6, RAD54L2, DPF2, UBXN7, ARID 1 A, SMAD4, SH3Y11, PHIP, LDB1, SMARCE1, CTSL, ZNF628, RYBP, TMX3, HMGB1, SPTY2D1, ACVR1B, EIF3C, SERTAD4, CREBBP, SMAD3, TCEB3, SIAH1, BCBD1, and PKMYT1.
In certain embodiments, the subject is a mammal.
In certain embodiments, the mammal is human.
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description of specific embodiments of the disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosure, exemplary embodiments are shown in the drawings. It should be understood, however, that the disclosure is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
FIGs. 1 A- 1C illustrate a genome-wide CRISPR screen that identified host genes and pathways critical for SARS-CoV-2 infection. FIG. 1 A shows results from experiments wherein VeroE6 cells were transduced with lentivirus encoding Cas9 nuclease. Vero Cas9 cells were then transduced with a genome-wide sgRNA lentiviral library targeting each of the 20,000 monkey genes with four individual sgRNAs. This pool of cells was then challenged with SARS-CoV-2 under different cell densities, multiplicities of infection, and serum concentrations. Genomic DNA from surviving cells was purified and the integrated sgRNAs were sequenced to identify pro-viral host genes and anti-viral host genes. FIG. IB shows genes essential for SARS-CoV-2 infection on top, and genes that inhibit SARS-CoV-2 infection on bottom. Inhibitors of pro-viral genes block infection. Agonists of anti-viral genes also are predicted to block infection. FIG. 1C shows gene ontology (Panther GO) pathway analysis identifies pathways important for SARS-CoV-2 infection. A more detailed pathway analysis follows in FIGs. 2A-2C and FIG. 3.
FIGs. 2A-2C illustrate GO enriched pathways in positively selected genes which are critical for SARS-CoV-2 infection.
FIG. 3 illustrates GO enriched pathways in negatively selected genes which increase SARS-CoV-2 infection.
FIG. 4 illustrates the CRISPR screen leads to identification of drugs that inhibit SARS-CoV-2 infection. 1250 VeroE6 cells were plated in each well of a 384-well plate coated with indicated drugs at the indicated concentrations. Two days later, cells were infected with the reporter virus, icSARS-CoV-2 mNG, at a multiplicity of infection of 1.0. One day post-infection, the percent of infected cells was quantified by viral-encoded mNeon Green expression. Calpain inhibitor II, SIS3, Silmisaterib, I-BET151, 1-CBP112, MLN4924, and PR-619 all inhibited SARS-CoV-2 infection.
FIG. 5 illustrates key therapeutic targets implicated in SARS-CoV-2 infection by this work.
FIGs. 6A-6G illustrate genome-wide CRISPR screens that identify genes critical for coronaviruses-induced cell death. FIG. 6A is a schematic of pooled screen. Vero-E6-Cas9 cells transduced with the genome-wide C. sabaeus library either received a mock treatment or were challenged with SARS-CoV-2, rc VS V- SARS-CoV-2- S, HKU5-SARS-CoV-1-S, MERS-CoV or MERS-CoV T1015N. Surviving cells from each virus infection were isolated and the sgRNA sequences were amplified by PCR and sequenced. FIG. 6B is a Volcano plot showing top genes conferring resistance and sensitivity to SARS-CoV-2. The gene-level z- score and -loglO (FDR) were both calculated using the mean of the five Cas9-v2 conditions. Non-targeting control sgRNAs were randomly grouped into sets of 4 to serve as "dummy" genes. FIG. 6C shows heatmaps of the top gene hits for SARS-CoV-2 resistance (20) and sensitization (20), ranked by mean z-score. The top 5 hits for MERS-CoV are also included and indicated by an asterisk. ARID1 A was a top resistance gene for both SARS-CoV-2 and MERS-CoV. FIGs. 6D-6F: Correlation between gene enrichment in SARS-CoV-2 and rcVSV-SARS-CoV-2-S (FIG. 6D), HKU5-SARS-CoV-1-S (FIG. 6E), MERS-CoV (FIG. 6F) screens. FIG. 6G is a Venn diagram of top 100 pro-viral genes from SARS-CoV-2, rcVSV- SARS-CoV-2-S, HKU5-SARS-CoV-1-S and MERS-CoV screens.
FIGs. 7A-7F illustrate performance of genes in top gene sets. FIG. 7A shows the top three gene sets, which score in the positive direction (resistance), and top gene set that scores in the negative direction (sensitization), or both, filtered for gene sets with at least five genes and which are most central to a given module and then ranked by mean absolute z-score. The number of genes in each set is indicated in parentheses. FIG. 7B: For each gene in the "SWI/SNF complex" gene set from STRING, the z-score in each virus screen is shown. Similarly, the genes in the gene sets (FIG. 7C) "RUNX3 regulates CDKN1A transcription" from Reactome, (FIG. 7D) "Cy statin, and endolysosome lumen" from STRING, (FIG. 7E) "Viral translation" from GO, and (FIG. 7F) "NURF complex" from GO.
FIGs. 8A-8I illustrate CRISPR subpool screens validate primary genome-wide screens and demonstrate specificity of hits for coronaviruses. A CRISPR subpool was generated with 10 sgRNAs per gene for each of the top 250 and bottom 250 genes from the SARS-CoV-2 genome-wide screen along with non-targeting controls and other genes of interest including DPP4. FIG. 8A illustrates correlation between gene enrichment in primary genome-wide and secondary subpool SARS-CoV-2 subscreens. Pearson correlation is reported. FIG. 8B shows a correlation matrix depicting the Pearson correlation between the guide-level log-fold change values relative to the plasmid DNA for the 13 subpool screens with the indicated viruses. All viruses were screened in duplicate (#1 and #2) except IAV- WSN. VSV was also screened but no cells survived infection. FIG. 8C is a PCA plot of all viruses revealing clustering and overlap of gene hits amongst SARS-CoV-2, rcVSV-SARS- CoV-2-S, HKU5-SARS-CoV-1-S, MERS-CoV WT and T1015N cluster. Influenza A virus/WSN/1933 (IAV-WSN) and encephalomyocarditis virus (EMCV) are outliers amongst the coronavirus screens. FIGs. 8D-8H: Comparison of gene enrichment in SARS-CoV-2 relative to rcVSV-SARS-CoV-2-S (FIG. 8D), HKU5-SARS-CoV-1-S (FIG. 8E), MERS- CoV (FIG. 8F), IAV-WSN (FIG. 8G), and EMCV (FIG. 8H). Pearson correlation is reported. (FIG. 81) A CRISPR subpool targeting 32 genes (inclusive of control genes) was generated in the human lung cancer cell line Calu-3. Gene enrichment from the primary SARS-CoV-2 screen correlates with results in Calu-3 cells. Pearson correlation is reported.
FIGs. 9A-9D illustrate arrayed validation of 18 resistance and 7 sensitization hit genes. FIG. 9A shows performance in the pooled screen of sgRNAs targeting the 25 genes selected for further validation. The mean residual across the five Cas9-v2 conditions is plotted for the full library (top) and for the 3-4 sgRNAs targeting each gene. The dashed line indicates a residual of 0. FIG. 9B: 42 unique sgRNAs targeting 25 genes were introduced into Vero-E6-Cas9-v2 cells. SARS-CoV-2 was added at MOI 0.2 and cell viability was measured at 3 dpi. FIG. 9C shows Western blots for ACE2, SMARCA4, KDM6A and SMAD3 expression in control and respective gene disrupted Vero-E6 cells. FIG. 9D shows Z-scores from genome-wide CRISPR screen correlating with cell viability of individually disrupted genes. Genes with multiple sgRNAs from (FIG. 9B) are averaged to generate one point per gene in (FIG. 9D). Data were analyzed by one-way ANOVA with Tukey's multiple comparison test. Shown are means ± SEM. ns, not statistically significant; *P < 0.05; **P < 0.01; ***P < 0.001.
FIGs. 10A-10H illustrate small molecules protect cells from SARS-CoV-2-induced cell death. (FIGs. 10A-10D), Vero-E6 cells were pretreated with the indicated concentrations
of Cathepsin L inhibitor Calpain Inhibitor III (FIG. 10 A), SMARCA4 inhibitor PFI-3 (FIG. 10B), or SMAD3 inhibitor SIS3 (FIG. IOC) for 48 hours and then infected with SARS-CoV- 2 at a MOI of 0.2. Cell viability was measured at 3 dpi and compared to mock infected controls. FIGs. 10D-10E: Vero-E6 cells were pretreated with 10 mM Calpain inhibitor III, PFI-3 or SIS3 for 48 hours and then infected with icSARS-CoV-2 mNG at a MOI of 1. Infected cell frequencies were measured by mNeonGreen expression at 2 dpi. Scale bar 300 pm. FIGs. 10F-10H: Vero-E6 (FIG. 10F), Huh7.5 (FIG. 10G) and Calu-3 (FIG. 10H) cells were pretreated with 10 pM SIS3 and 40 pM PFI-3 for 48 hours and then infected with SARS-CoV-2 at a MOI of 0.1. Viral production as measured by plaque forming units (PFU/ml) was determined by plaque assay. LOD, limit of detection. Data were analyzed by one-way ANOVA with Tukey's multiple comparison test. Shown are means ± SEM. ns, not statistically significant; *P < 0.05; **P < 0.01; ***P < 0.001.
FIGs. 11 A-l 1H illustrate the finding that HMGB1 is a novel regulator of ACE2. FIG. 11 A shows performance of individual guide RNAs targeting LOC103214541(HMGBl-like). The mean residual across the five Cas9-v2 conditions is plotted for the full library (top) and for the 3 guide RNAs targeting that gene. FIG. 1 IB shows Western blots for HMGB 1 expression in control and HMGB1 disrupted Vero-E6, Huh7.5 and Calu-3 cells. FIG. 11C: Control and HMGB1 disrupted Vero-E6, Huh7.5 and Calu-3 cells were infected with SARS- CoV-2 at a MOI of 0.2. Cell viability relative to an uninfected control was measured 3 dpi (Vero-E6 and Calu-3) or 4 dpi (Huh7.5) with CellTiter Glo. FIG. 1 ID: Vero-E6 cells were infected with SARS-CoV-2 at a MOI of 0.1. Viral production as measured by plaque assay. FIG. 1 IE shows correlation between CRISPR screen z-score and gene expression in control and HMGB I di srupted Vero-E6 cells reveals downregulation of ACE2 in HMGB1 disrupted cells. FIG. 1 IF shows results from qPCR and western blots performed in HMGB1 knockout and complemented Vero-E6 cells. FIG. 11G shows genome tracks of RNA-seq, ChIP-seq for H3K27ac and ATAC-seq at the ACE2 locus in control and HMGB1 disrupted Vero-E6 cells. Displayed p-values for ChIP-seq and ATAC-seq are for the genomic region indicated by the black bar underneath the tracks. FIG. 11H: HMGB1 knockout and complemented Vero-E6 cells were infected with VSVpp-SARS-CoV-1-S, VSVpp-SARS-CoV-2-S, VSVpp-NL63-S, VSVpp-MERS-S and VSVpp-VSVG pseudoviruses. Luciferase relative to a VSVpp-VSVG control was measured 1 dpi. LOD, limit of detection. Data were analyzed by one-way ANOVA with Tukey's multiple comparison test. Shown are means ± SEM. ns, not statistically significant; *P < 0.05; **P < 0.01; ***P < 0.001.
FIGs. 12A-12F illustrate quality control metrics for CRISPR screen. FIG. 12A shows
a correlation matrix depicting the Pearson correlation between the guide-level log-fold change values relative to the plasmid DNA. Cells were cultured in DMEM with 2% FBS (D2), 5% FBS (D5), 10% FBS (D10), plated at 2.5 x 106 or 5.0 x 106 cells per T150 flask and infected at a MOI 0.1 (hi) or MOI 0.01 (lo). FIG. 12B is a receiver-operator characteristic (ROC) curve for the recovery of guides targeting essential genes in the mock-treated condition of the Cas9-vl and Cas9-v2 screens. True positives are n = 1,528 essential genes (n = 6,178 guides); true negative genes are n = 622 non-essential genes (n = 2,504 guides). Essential and non-essential genes, which were derived for human cell lines, were mapped to the African green monkey genome simply by matching gene symbols. AUC = area under curve. FIG. 12C shows correlation between gene enrichment in Cas9-vl and Cas9-v2 screens. Pearson correlation is reported. FIGs. 12D-12E show GFP-based Cas9 activity assay in Vero-E6 cells stably expressing either Cas9-vl (FIG. 12D) or Cas9-v2 (FIG. 12E). The pXPR_047 construct expresses GFP and an sgRNA targeting GFP; therefore, cells without Cas9 activity will express GFP, whereas cells with high Cas9 activity will knock out GFP and resemble parental cells. FIG. 12F shows an approach to calculate residuals from log-fold change data, using ACE2 and the 5% FBS, 5 x 106 cells/flask, MOI 0.1 condition as an example. A natural cubic spline with four degrees of freedom is shown, and a residual for each sgRNA is calculated to be the vertical distance from the fit spline.
FIGs. 13A-13C illustrate genome-wide CRISPR screen identifies genes critical for SARS-CoV-2-induced cell death. FIG. 13 A shows performance of individual sgRNAs targeting ACE 2, SMARCA4 , CTSL, and TMPRSS2. The mean residual across the five Cas9-v2 conditions is plotted for the full library (top) and for the 4 guide RNAs targeting each gene. FIG. 13B shows heatmaps of the top 25 gene hits for resistance and sensitivity, ranked by mean z-score in the Cas9-v2 conditions. Genes that are included in one of the gene sets labeled in (FIG. 7A) are colored accordingly. Condition A: Cas9-v2 D5 (DMEM+5%FBS)
2.5 x 106 cells/flask MOI 0.1; B: Cas9-v2 D5 5 x 106 cells/flask MO 0.1; C: Cas9-v2 D2 (DMEM+2%FBS) 5 x 106 cells/flask MOI 0.1; D: Cas9-v2 D10 (DMEM+ 10%FB S) 5 x 106 cells/flask MOI 0.1; E: Cas9-v2 D5 2.5 x 106 cells/flask MOI 0.01. FIG. 13C: Nodes represent significantly enriched gene sets. The size of each gene set is proportional to its mean absolute z-score. Gene sets are colored by the direction in which they score. Edges represent significant overlap between gene sets. The transparency of each edge is proportional to the fraction of genes shared by two gene sets. Gene sets were clustered using the infomap algorithm and the most central set by PageRank is labelled for each cluster. The Fruchterman-Reingold algorithm was used to lay out the network.
FIGs. 14A-14G illustrate comparison of all viruses from genome-wide CRISPR screens. Comparison of gene enrichment of (FIG. 14A) SARS-CoV-2 relative to MERS-CoV T1015N, (FIG. 14B) rcVSV-SARS-CoV-2-S relative to HKU5-SARS-CoV-1-S, (FIG. 14C) rcVSV-SARS-CoV-2-S relative to MERS-CoV WT, (FIG. 14D) rcVSV-SARS-CoV-2-S relative to MERS-CoV T1015N, (FIG. 14E) HKU5-SARS-CoV-1-S relative to MERS-CoV WT (FIG. 14F), HKU5-SARS-CoV-1-S relative to MERS-CoV T1015N, and (FIG. 14G) MERS-CoV WT relative to MERS-CoV T1015N. Pearson correlation is reported.
FIGs. 15A-15D illustrate comparison of secondary CRISPR subpool screens. FIG. 15A is a heatmap depicting genes with a z-score >10 in any of the secondary subpool screens. FIG. 15B is a heatmap showing genes involved in the SWI/SNF chromatin remodeling complex. FIG. 15C is a heatmap showing genes in the "Runx3 regulates CDKN1A transcription" pathway. FIG. 15D is a heatmap showing genes in the HUCA histone H3.3 chaperone complex
FIGs. 16A-16F illustrate the finding that HMGB1 acts cell-intrinsically to regulate susceptibility to SARS-CoV-2 infection. FIG. 16A: Vero-E6 cells were mock-treated or infected with SARS-CoV-2 at a MOI of 1 for 24 hours before cell fractionation was performed. FIGs. 16B-16C show infection resulted in release of HMGB1 protein in the supernatant which was quantified by ELISA from Vero-E6 (FIG. 16B) and Huh7.5 (FIG.
16C) cells infected with SARS-CoV-2 for the indicated times. FIG. 16D: Vero-E6 cells were pre-treated with the indicated concentration of recombinant HMGB1 (rHMGBl) for 24 hours and then infected with SARS-CoV-2 at a MOI of 0.2. Cell viability was measured at 3 dpi and compared to mock infected controls. FIG. 16E: Vero-E6 cells were pre-treated with rHMGBl for 24 hours and then infected with icSARS-CoV-2 mNG at a MOI of 1. Infected cell frequencies were measured by mNeonGreen expression at 1 dpi. FIG. 16F: Vero-E6 cells were pre-treated with the indicated concentration of rHMGB 1 for 24 hours and then infected with VSVpp-SARS-CoV-2-S and VSVpp-VSVG pseudovirus. Luciferase relative to VSVG control was measured at 1 dpi. Data were analyzed by one-way ANOVA with Tukey's multiple comparison test. Shown are means ± SEM. ns, not statistically significant; *P <
0.05; **P < 0.01; ***P < 0.001.
FIGs. 17A-17E illustrate the effects of HMGB1 loss on chromatin states across the Vero-E6 genome. FIG. 17A is a Volcano plot for RNA sequencing of control and HMGB1 disrupted cells. The x-axis shows log2 fold-change and the y-axis shows -loglO of the adjusted P value (adj. P) as calculated by DESeq2. FIG. 17B shows the top gene sets, which significantly enriched in the up regulated, down regulated or both of differentially expression
genes (fold change >1.5 and p<0.05) from GO. FIGs. 17C-17D are Volcano plots for ATAC- seq (FIG. 17C) and H3K27ac ChIP-seq (FIG. 17D) of control and HMGB1 disrupted cells. Fold change and adjusted p-value for each called peak was calculated by DESeq2. FIG. 17E shows correlation between changes in overlapping ATAC-seq and H3K27ac ChIP-seq peaks upon HMGB1 disruption. Dashed lines represent p=0.01. Data were analyzed by one-way ANOVA with Tukey's multiple comparison test. Shown are means ± SEM. ns, not statistically significant; *P < 0.05; **P < 0.01; ***P < 0.001.
FIGs. 18A-18H illustrate the finding that SMARCA4 promotes SARS-CoV-2 infection through its ATPase catalytic activity. SMARCA4 KO Vero E6 cells are resistant to virus induced cell death by (FIG. 18 A) HKU5 bat coronavirus expressing the SARS-CoV-1 spike and (FIG. 18B) SARS-CoV-2. Virus induced cell death can be rescued by expressing functional SMARCA4 in trans but not a catalytically inactive SMARCA4 (K785R). FIG. 18C shows SMARCA4 KO does not affect MERS-CoV induced cell death. FIG. 18D shows SARS-CoV-2 expressing mNeonGreen replicates in WT VeroE6 cells but not SMARCA4 KO cells. This can be rescued with WT but not K785R SMARCA4. This data is quantified in FIG. 18E. FIG. 18F shows SMARCA4 KO reduces viral replication as measured by plaque assay. SMARCA4 acts at the level of viral entry as (FIG. 18G) SARS-CoV-1 spike pseudovtyped on a VSV core expressing luciferase (VSV Rluc). FIG. 18H shows SARS- CoV-2 spike VSVRluc have impaired entry into SMARCA4 KO cells. MERS-CoV pseudovirus infects WT and KO cells with similar efficiency.
FIGs. 19A-19B illustrate the finding that SMARCA4/BRG1 is required for SARS- CoV-2 infection in human Huh7.5 cells. SMARCA4 is essential for SARS-lineage virus entry in human cells. SMARCA4 (BRG1) KO human liver Huh7.5 cells were generated by CRISPR Cas9 mediated editing using two independent CRISPR sgRNAs: BRG-sg#l ACCCCCATCCAGAAGCCGCG (SEQ ID NO: 50) and BRG-sg #2: GCATGCTCAGAGCCACCCAG (SEQ ID NO: 51). FIG. 19A shows KO cells are resistant to SARS-CoV-2 mNeon Green. This is quantified in FIG. 19B.
FIGs. 20A-20C illustrate the finding that SMARCA4 regulates ACE2 expression. RNAseq was performed on WT, SMARCA4 KO, and complemented Vero E6 cells which revealed reduced ACE2 expression in KO cells (FIG. 20A). This was confirmed by (FIG. 20B) qPCR and (FIG. 20C) western blot for ACE2.
FIGs. 21 A-21C illustrate therapeutic targets of SMARCA4. FIG. 21 A shows the small molecule Compound 12, which inhibits SMARCA2 and SMARCA4, reduces SARS-CoV-2 -
induced cell death in Vero-E6 cells. FIG. 21B shows Compound 12 reduces infection as measured by SARS-CoV-2 mNeon Green reporter expression. FIG. 21C shows Compound 12 reduces Ace2 mRNA expression in VeroE6 cells as measured by qPCR.
FIG. 22 illustrates the finding that pharmacologic inhibition of KDM6A/B reduces SARS-CoV-2 in human liver (Huh7.5) and lung (Calu-3) cell lines. Huh7.5 and Calu-3 cells were cultured GSK-J4 (4mM) for two days prior to infection with SARS-CoV-2 at an MOI 0.1. Virus replication was assessed by plaque assay. This demonstrates KDM6A/B regulates SARS-CoV-2 infection independent of the host species and cell type.
FIG. 23 illustrates the finding that KDM6A/B inhibitor GSK-J4 (Kruidenier et al. (2012 ) Nature 488(7411): 404-408, which describes GSK-J1 through GSK-J5) confers survival advantage to SARS-CoV-2 infection in vivo. K18-hACE2 mice were administered 5mg/kg of GSK-J4 intraperitoneally daily starting two days prior to intranasal challenge with 106 PFU of SARS-CoV-2. GSK-J4 resulted in a statistically significant survival advantage relative to a DMSO control. P<0.05 Kaplan Meier Survival Analysis. Five mice per group. The LD50 was later determined to be 102 PFU per mouse which 10,000-fold less than that used.
DETAILED DESCRIPTION
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, illustrative materials and methods are described herein. In describing and claiming the present disclosure, the following terminology will be used.
It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
"About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the
specified value, as such variations are appropriate to perform the disclosed methods.
The term "antibody," as used herein, refers to an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present disclosure may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies (scFv) and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments.
An "antibody heavy chain," as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations.
An "antibody light chain," as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations. Kappa and lambda light chains refer to the two major antibody light chain isotypes.
By the term "synthetic antibody" as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate. In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it
would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
"Effective amount" or "therapeutically effective amount" are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to, anti-tumor activity as determined by any means suitable in the art.
"Identity" as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g ., if a position in each of two polypeptide molecules is occupied by an Arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g. , if half (e.g, five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g, 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
The term "immune response" as used herein is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and/or activate lymphocytes to remove the antigen.
As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the disclosure. The instructional material of the kit of the disclosure may, for example, be affixed to a container which contains the nucleic acid, peptide, and/or composition of the disclosure or be shipped together with a container which contains the nucleic acid, peptide, and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
The term "limited toxicity" as used herein, refers to the peptides, polynucleotides, cells and/or antibodies of the disclosure manifesting a lack of substantially negative biological effects, anti-tumor effects, or substantially negative physiological symptoms toward a healthy cell, non-tumor cell, non-diseased cell, non-target cell or population of such cells either in vitro or in vivo.
By the term "modified" as used herein, is meant a changed state or structure of a molecule or cell of the disclosure. Molecules may be modified in many ways, including chemically, structurally, and functionally. Cells may be modified through the introduction of nucleic acids.
By the term "modulating," as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
In the context of the present disclosure, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.
Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
"Parenteral" administration of an immunogenic composition includes, e.g ., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrastemal injection, or infusion techniques.
As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
By the term "specifically binds," as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross- species reactivity does not itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific. In some instances, the terms "specific binding" or "specifically binding," can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope "A", the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled "A" and the antibody, will reduce the amount of labeled A bound to the antibody.
The term "subject" is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A "subject" or "patient," as used therein, may be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
A "target site" or "target sequence" refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
The term "therapeutic" as used herein means a treatment and/or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
To "treat" a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
Ranges: throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to
4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Description
The present disclosure compositions and methods for treating, preventing, and/or ameliorating SARS-CoV-2 infection in a mammal, such as but not limited to a human.
As described herein, a genome- wide CRISPR screen was performed, revealing host genes and pathways essential for SARS-CoV-2 infection. The SARS-CoV-2 receptor ACE2 and protease Cathepsin L were highly enriched. The SWT/8NF chromatin remodeling complex and key components of the signaling pathway were identified as critical pro- viral factors. In contrast, genes involved in the histone H3.3 chaperone complex (CAB IN1/HIRA/Asf1 a) were negatively selected. Together this revealed novel therapeutic targets for SARS-CoV-2 and highlighted host genes that may regulate COVID-19 pathogenesis.
Methods
The present disclosure includes methods for treating, ameliorating, and/or preventing a Coronavirus infection (e.g. SARS-CoV-2), and/or one or more complications thereof, in a subject (e.g. a human) in need thereof. Coronaviruses that can be treated, ameliorated, and/or prevented with the compositions and methods disclosed herein include, but are not limited to, SARS-CoV-2, SARS-CoV, MERS-CoV, 229E (alpha coronavirus), NL63 (alpha coronavirus), OC43 (beta coronavirus), HKU1 (beta coronavirus), and 2019-nCoV.
The inhibitors used in the disclosed methods can be any type of inhibitor known to one of ordinary skill in the art. The inhibitor can inhibit any form of molecule including proteins or nucleic acids (DNA or RNA). As contemplated herein, an inhibitor is a chemical and/or biological agent that decreases and/or nullifies the biological role of a target molecule by decreasing the expression, concentration, and/or biological activity of the target molecule. In certain embodiments, the inhibitor decreases expression and/or concentration of the target molecule by decreasing expression of and/or increasing degradation of the target molecule. In certain embodiments, the inhibitor decreases biological activity of the target molecule by binding to the target molecule and interfering with biological process(es) in which the target molecule takes part.
In certain embodiments, the method comprises administering to a subject a therapeutically effective amount of an inhibitor of a molecule in the transforming growth
factor-b ( TGFβ) signaling pathway. The TGF-b signaling plays a critical role in the regulation of cell growth, differentiation, and development in a wide range of biological systems. Molecules in the TGFβ signaling pathway include, but are not limited to, TGFB1 ligand, TGF-beta receptor type-2 (TGFBR2), TGFBR1, SMAD1, SMAD2, SMAD3,
SMAD4, SMAD5, SMAD6, SMAD7, SMAD9, Smurf E3 ubiquitin ligases, USP4/11/15 deubiquitinases, MAPK, Erk, SAPK, INK, and p38 MAPK, Rho GTPase (RhoA), mDia, ROCK, Cdc42, Rac, PAK, PKC, c-Abl, SERTAD4, and/or ACTVR1B. In certain embodiments, the molecule in the TGFβ signaling pathway contemplated by the methods disclosed herein is selected from the group consisting of SMAD3, SMAD4, SERTAD4, and ACTVR1B.
The inhibitor of the TGFβ signaling pathway can be any inhibitor known to one of ordinary skill in the art including, but not limited to a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, or a recombinant protein such as a ligand or receptor decoy. In certain embodiments, the TGFβ signaling pathway inhibitor is selected from the group consisting of SIS3 and SB-505124.
In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of a histone modifying enzyme inhibitor. In certain embodiments, the histone modifying enzyme is selected from the group consisting of KDM6A, KMT2D, and JMJD6. In certain embodiments, the inhibitor is selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, or a recombinant protein such as a ligand or receptor decoy. In certain embodiments, the small molecule is selected from the group consisting of GSK-J1, GSK-J2, GSK-J3, GSK-J4, GSK-J5, MLN4924, 1-CBP112, and metformin.
In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of an inhibitor of a molecule in the Switch/ Sucrose Non- Fermentable (SWI/SNF) complex. Any molecule in the SWI/SNF complex can be targeted for inhibition including, but not limited to, SMARCA4, DPF2, ARIDl A, SMARCEl, and SMARCEBl. In certain embodiments, the inhibitor is selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, or a recombinant protein such as a ligand or receptor decoy. In certain embodiments, the small molecule is PFI-3.
In another aspect, the method comprises administering to the subject a therapeutically effective amount of any of the drugs listed in Table 1, or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
Table 1: Exemplary Drugs Useful for Treating SARS-CoV-2
In certain embodiments, the compound contemplated within the invention is any compound disclosed in International PCT Application No. W02020/035779 Al, published February 20, 2020, the contents of which are incorporated herein in their entireties by reference. In certain embodiments, the compound contemplated within the invention comprises, and/or is:
wherein:
R1 is H, amino, or hydroxy-substituted C1-C2 alkyl; R2 is H;
R3 is C1-C2 alkyl and halogen- substituted C1-C2 alkyl;
R4 is hydrogen;
R5 is H, F, Cl, Br, or I; and R6 is H, F, Cl, Br, or I or a salt, solvate, tautomer, geometric isomer, enantiomer, diastereoisomer, and/or any mixtures thereof.
In certain embodiments, R1 is H, amino, or hydroxymethyl. In certain embodiments, R2 is H. In certain embodiments, R3 is methyl, difluoromethyl or trifluorom ethyl. In certain embodiments, R4 is hydrogen. In certain embodiments, R5 is H, Cl, or Br. In certain embodiments, R6 is H or F.
In certain embodiments, the compound is 1-(2-chloropyridin-4-yl)-3-(3- methylisothiazol-5-yl)urea
, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof
In certain embodiments, the compound is 1-(2-chloropyridin-4-yl)-3-(3-
(trifluoromethyl)isothiazol-5-yl)urea
, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the compound is 1-(2-chloropyridin-4-yl)-3-(3-
(difluoromethyl)isothiazol-5-yl)urea
, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the compound is 1-(5-amino-2-chloropyridin-4-yl)-3-(3-
(difluoromethyl)isothiazol-5-yl)urea
, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the compound is 1-(2-chloro-5-(hydroxymethyl)pyridin-4- yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea
, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the compound is 1-(2-fluoro-5-(hydroxymethyl)pyridin-4-
yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea
or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the compound is 1-(5-amino-2-fluoropyridin-4-yl)-3-(3-
(difluoromethyl)isothiazol-5-yl)urea
, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the compound is 1-(3-(difluoromethyl)isothiazol-5-yl)-3-(2- fluoro-3-(hydroxymethyl)pyridin-4-yl)urea
, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
In certain embodiments, the compound contemplated within the invention is any JMJD3 inhibitor disclosed in International PCT Application No. W02020/052390 Al, published April 26, 2012, the contents of which are incorporated herein in their entireties by reference. In certain embodiments, the compound contemplated within the invention comprises, and/or is:
wherein:
R1 is:
• C1-6 alkyl;
• C3-7 cycloalkyl;
• C1-6 haloalkyl;
• a 5, 6 or 7-membered aryl or heteroaryl (which heteroaryl contains one or more heteroatoms selected from N, O and S and which is optionally fused to phenyl), said 5-, 6- or
7-membered aryl or heteroaryl being optionally substituted with one or more substituents independently selected from C1-3alkyl;
• 0-C1-6alkyl (which is optionally substituted by phenyl or naphthyl, each of which may be substituted by one of more substituents independently selected from halo);
• -O-cyclohexyl (which is optionally fused with phenyl);
• C(O)NRc2 or
• NRaRb, each Ra and Rb is independently selected from:
• H;
• C1-3alkyl which is optionally substituted by one or more substituents independently selected from phenyl (which phenyl is optionally substituted by one or more substituents independently selected from C1-3alkyl, 0-C1-3alkyl, C(O)NRC2, halo and cyano), C(O)NRC2, a 4-, 5-, 6- or 7-membered heterocyclic or heteroaryl group (containing one or more heteroatoms independently selected from N, O and, S), a 3-, 4-, 5-, 6- or 7-membered cycloalkyl group (which is optionally fused to phenyl), halo, OC1-3alkyl, OH, -NHCOCi- 3alkylNRc2 and C(O)NHCH2C(O)NRc 2;
• a 3-, 4-, 5-, 6- or 7-membered cycloalkyl group (which is optionally fused to phenyl), or
• Ra and Rb together form a 5-, 6- or 7-membered heterocyclic group optionally containing one or more further heteroatoms independently selected from N, O, S or S(O)2 said heterocyclic group being optionally fused to a 5-, 6- or 7-membered aryl or heteroaryl ring containing one or more heteroatoms independently selected from N, O and S; the heterocylic ring and/or the aryl or heteroaryl to which it is optionally fused being optionally substituted by one or more substituents independently selected from halo, OH, C1-3alkyl, O- C1-3alkyl, C(O)C1-3alkyl, S(O)2C1-3alkyl, NHC(O)C1-3alkyl, NHS(O)2C1-3alkyl, C(O)NRc 2, C(O)NRd2 (wherein Rd and Rd together form a 5- or 6-membered heterocylic ring), NRC2 C(O)phenyl, S(O)2NRC2, =0 (oxo) and 5-, 6- or 7-membered aryl or heteroaryl (containing one or more heteroatoms independently selected from N, O and S);
R2 and R3 are each independently selected from:
• H,
• (CH2)1-3NRC(CH2)1-3NRC2,
• (CH2)1-6NRC2;
• C1-3 alkyl;
• 0-C1-3alkyl;
• C1-3haloalkyl;
• (CH2)0-3NRaRb (wherein Ra and Rb are as defined above);
• (CH2)0-3NHPh;
• (CH2)0-3OPh;
• (CH2)0-3Ph; or R2 and R3 together form a fused phenyl ring, and each Rc is independently selected from hydrogen and C1-3alkyl or a pharmaceutically acceptable salt thereof and one or more of pharmaceutically acceptable carriers, diluents and excipients.
In certain embodiments, the compound is selected from the group consisting of: N-[6-(1,1-dimethylethyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[2-(2-pyridinyl)-6-(trifluoromethyl)-4-pyrimidinyl]-β-alanine; N-[6-(4-morpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(methylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[2-(2-pyridinyl)-6-(1-pyrrolidinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(2-hydroxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2 -hydroxy ethyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(dimethylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine; N-[6-phenyl-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(aminocarbonyl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[4-(aminocarbonyl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-({[3,4-bis(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(3-amino-3-oxopropyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; N-[6-{ [(3, 4-dichlorophenyl (methyl ]ami no} -2-(2-pyridinyl)-4-pyri midi nyl]-β-alanine; N-[6-({[3-(aminocarbonyl)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{ [(4-chl orophenyl (methyl ]ami no} -2-(2-pyridinyl )-4-pyri midi nyl]-β-alanine; N-[6-(lH-pyrazol-4-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3-methyl-l H-pyrazol-4-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{ [(3 -chi orophenyl (methyl ]ami no} -2-(2-pyridinyl(-4-pyri midi nyl]-β-alanine; N-[6-{[(2-methylphenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{ 2-(2-pyridinyl )-6-[(2-thienyl methyl )amino]-4-pyri midi nyl [-β-alanine; N-[6-({[3-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-{2-(2-pyridinyl)-6-[(2-pyridinylmethyl)amino]-4-pyrimidinyl]-β-alanine; N-[6-({[4-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(cyclopropyl methyl )amino]-2-(2-pyridi nyl )-4-pyri midi nyl ]-β-alanine; N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-( 1 -methyl ethyl )-2-(2-pyridi nyl )-4-pyrimidi nyl ]-β-alanine;
N-[6-cyclopropyl-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(diethylamino)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(l,3,4-oxadiazol-2-yl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[4-(1,3-thiazol-2-yl)-1-piperazinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(4-phenyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(4-chlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(hexahydro-1H-azepin-1-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1-benzothien-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3,4-dihydro-2(l H)-isoquinolinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{4-[(methylamino)carbonyl]-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(7-hydroxy-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine;
N-[6-(7-bromo-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[6-(5-hydroxy-1,3-dihydro-2 H-i soindol -2-yl)-2-(2-pyridi nyl )-4-pyri midi nyl ]-β-alanine;
N-{2-(2-pyridinyl)-6-[(4-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-{2-(2-pyridinyl)-6-[(3-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine
N-[6-(2,3-dihydro-l H-inden-2-ylamino)-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine;
N-[6-[(2-phenylethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine;
N-[6-[methyl(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine;
3-{[6-(1,1-dimethylethyl)-2-(2-pyridinyl)-4-pyrimidinyl]amino}-2-methylpropanoic acid;
N-[6-(methyloxy)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1,1-dimethylethyl)-2-(3-isoquinolinyl)-4-pyrimidinyl]-β-alanine;
N-{6-(1,1-dimethylethyl)-2-[5-(trifluoromethyl)-2-pyridinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(1,1-dimethylethyl)-2-(4-methyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{6-(1,1-dimethylethyl)-2-[4-(methyloxy)-2-pyridinyl]-4-pyrimidinyl}-β-alanine;
N-{6-(1,1-dimethylethyl)-2-[5-(methyloxy)-2-pyridinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(1,1-dimethylethyl)-2-(5-methyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[2-[4-(dimethylamino)-2-pyridinyl]-6-(1,1-dimethylethyl)-4-pyrimidinyl]-β-alanine; N-[6-[7-(methyloxy)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-(4-acetyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(methylsulfonyl)-1-piperazinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(acetylamino)-1-pyrrolidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{3-[(methylsulfonyl)amino]-1-pyrrolidinyl}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(phenylmethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(acetylamino)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{3-[(methylsulfonyl)amino]-1-piperiddinyl}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-phenyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-hydroxy-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[(4-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-{2-(2-pyridinyl)-6-[(3-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-[6-(2,3-dihydro-l H-inden-2-ylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-phenyl ethyl )amino]-2-(2-pyridinyl)-4-pyri mi dinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(4-thiomorpholinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3-hydroxy-1-pyrrolidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(l,3,4,5-tetrahydro-2H-2-benzazepin-2-yl)-4-pyrimidinyl]-β-alanine;
N-[6-(1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-methyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-({[3-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(3-cyanophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[2-(methyloxy)ethyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-( 1 , 1 -dioxido-4-thiomorpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[bis(2 -hydroxy ethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(phenylcarbonyl)-1-piperazinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{3-[(methylamino)carbonyl]-1-piperidinyl}-2-(2-pyridinyl)-4-pyrimidiyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[3-(1-pyrrolidinylcarbonyl)-1-piperidinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(4-methyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4,4-dimethyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-propanoyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(5-chloro-1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[5-(methyloxy)-1,3-dihydro-2H-isoindol-2-yl]-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[6-[(2-phenylethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(1-oxo-3,4-dihydro-2(l H)-isoquinolinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(2 -methyl-4, 5, 7, 8-tetrahydro-6 H-[l,3]thiazolo[4,5-d]azepin-6-yl)-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-[7-(methylsulfonyl)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-[7-(aminosulfonyl)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,3,4-tetrahydro-2-naphthalenyloxy)-4-pyrimidinyl]-β-alanine;
N-{6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-2-[4-(1,2,4,5-tetrahydro-3H-3-benzazepin-
3-yl)-2-pyridinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(1-benzothien-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-(6-( 1,3 -dihydro-2 H-isoindol-2-yl)-2-{4-[(phenylamino)methyl]-2-pyridinyl}-4- pyrimidinyl]-β-alanine;
N-(6-( 1,3 -dihydro-2 H-isoindol-2-yl)-2-{4-[(phenyloxy)methyl]-2-pyridinyl}-4-pyrimidinyl]- b-alanine;
N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(4-phenyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[(methylamino)carbonyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-( 1 , 1 -di methyl ethyl )-2-(4-methyl -2-pyridinyl)-4-pyri mi dinyl]-β-alanine;
N-[6-[{[3-(aminocarbonyl)phenyl]methyl}(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]-β-alanine;
3-({2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-[(phenylmethyl)amino]-4- pyrimidinyl} amino) propanoic acid;
3-({2-(4-{3-[(2-aminoethyl)amino]propyl}-2-pyridinyl)-6-[(phenylmethyl)amino]-4- pyrimidinyl}amino)propanoic acid;
3-{[2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]amino}propanic acid;
3-{[6-{[3-(methylamino)-3-oxopropyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]amino) propanoic acid;
N-[6-[(2-carboxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanyl-N l - methylglycinamide;
N-[6-({2-[3-(b-alanylamino)phenyl]ethyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{[(2,6-dimethylphenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine N-[2-{4-[(2-hydroxyethyl)amino]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[4-(1-pyrrolidinylcarbonyl)-1-piperidinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(cyclohexylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6- {4-[(di methyl ami no)carbonyl]- l -piperidinyl J-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; 3 - { [6- {methyl [3 -(methylamino)-3 -oxopropyljamino } -2-(2-pyridinyl)-4- pyrimidinyl] amino } propanoic acid;
N-[6-{ [(3, 4-di chlorophenyl {methyl ]oxy }-2-(2-pyri dinyl)-4-pyri midi nyl]-β-alanine; N-[6-[(1-phenylethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{ [(3 -chi orophenyl {methyl ]oxy }-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-naphthalenylmethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine;
N-[6-(l -methyl ethyl {-2-(2-pyridinyl{-4-pyrimidinyl]-β-alanine,
N-[2-(2-pyridinyl)-6-(trifluoromethyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-morpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(methylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1-pyrrolidinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-hydroxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2 -hydroxy ethyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(dimethylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine.
In certain embodiments, the compound contemplated within the invention is any JMJD3 inhibitor disclosed in International PCT Application No. W0213143597, published October 3, 2013, the contents of which are incorporated herein in their entireties by reference. In certain embodiments, the compound contemplated within the invention comprises, and/or is:
wherein
X is -(R1)0-1-(R2)0-1-R3 or -R3-R4; each R is independently NH, N(CH3), or O;
R2 is a linker group with a maximum length of 5 atoms between R and R3 and is selected from:
-CO-C1-6alkyl-,
-CO-,
-CO-C1-6alkyl-O-,
-CO- C1-6alkyl-S-,
-CO- C1-6alkyl-O-C1-6alkyl-,
-C1-5alkyl-,
-C1-5alkyl-0-,
-C1-5alkyl-SO2-,
-C1-3alkyl-NH-CO-,
-C1-3alkyl-C3-8cycloalkyl-C1-3alkyl-0-; wherein each alkyl is straight chain or branched and may be optionally substituted by one or more substituents independently selected from phenyl or -OH;
R3 is selected from: a C6-12 mono or bicyclic aryl group, (each of which may be optionally substituted one or more times by substituents independently selected from halo, C1-6alkyl, Ci- 6haloalkyl, C1-6alkoxy, NHCOC1-3alkyl, -O-phenyl, -CH2-phenyl, phenyl (optionally substituted by C1-3alkyl), OH, NH2, CONH2, CN, -NHCOC1-3alkylNH2, -NHCOC1-3alkyl, NHCOOC1-3alkyl, -NHSO2C1-3alkyl, -SO2C1-3alkyl or
a 5-12 membered mono or bicyclic heteroaryl group (optionally substituted by one or more substituents independently selected from phenyl, CH2p phenyl -C1-6 alkyl, -oxo), a 5- or 6-membered heterocyclic group containing one or more heteromoieties independently selected from N, S, SO, SO2 or O and optionally fused to a phenyl group
(optionally substituted by one or more substituents independently selected from phenyl, CH2phenyl, C1-3alkyl) or a 3-7 membered cycloalkyl (including bridged cycloalkyl) and optionally fused to a phenyl group (and optionally substituted by one or more substituents independently selected from OH, phenyl, -CH2 phenyl),
R4 is selected from: C1-6 straight chain or branched alkyl (optionally substituted by NH2),
COC1-8 straight chain or branched alkyl; or a pharmaceutically acceptable salt thereof and one or more of pharmaceutically acceptable carriers, diluents and excipients.
In certain embodiments, X is not: -NHCO-tert butyl; -NHCO-isobutyl; -OCH2phenyl; 4-pyridylmethylamino; -NHphenyl; or -NHcyclohexyl.
In certain embodiments, the compound is at least one of the following: 3-{[(4-chlorophenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-{[(4-methylphenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-[(3-phenylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylcarbonyl)amino]-4-pyridinecarboxylic acid; 3-[(2,2-dimethylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-{[(phenyloxy)acetyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(4-methylphenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-[(2-naphthalenylacetyl)amino]-4-pyridinecarboxylic acid; 3-{[4-(2-naphthalenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(4-bromophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(3,4-dichlorophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[(3,4-dichlorophenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-({4-[3-(acetylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-{[4-(4-pyridinyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-[(2-methyl-4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(phenyloxy)propanoyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(phenylthio)propanoyl]amino}-4-pyridinecarboxylic acid; 3-({[3,4-bis(methyloxy)phenyl]acetyl}amino)-4-pyridinecarboxylic acid; 3-[(3,4-dihydro-2(lH)-isoquinolinylacetyl)amino]-4-pyridinecarboxylic acid; 3-[(1,3-dihydro-2H-isoindol-2-ylacetyl)amino]-4-pyridinecarboxylic acid; 3-[(2-phenylpropanoyl)amino]-4-pyridinecarboxylic acid;
3-({4-[3-(methyloxy)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-[(2-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(2-phenylpropyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methyl-2-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(4-phenylbutyl)oxy]-4-pyridinecarboxylic acid; 3-{[3-(2-naphthalenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-{[3-(trifluoromethyl)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-({3-[(3-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-{[3-(7-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(5-quinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid;
3 - { [3 -(4-biphenylyloxy)propyl]amino} -4-pyridinecarboxylic acid;
3- { [4-(3-aminophenyl)butanoyl]amino} -4-pyridinecarboxylic acid; 3-(3-phenylpropyl)-4-pyridinecarboxylic acid;
3-({3-[(2-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-[(3-phenylpropyl)amino]-4-pyridinecarboxylic acid; 3-{ [4-(3-hydroxyphenyl)butanoyl]amino} -4-pyridinecarboxylic acid; 3-{ [4-(4-hydroxyphenyl)butanoyl]amino} -4-pyridinecarboxylic acid; 3-[(4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylacetyl)amino]-4-pyridinecarboxylic acid; 3-(hexanoylamino)-4-pyridinecarboxylic acid; 3-({[(phenylmethyl)oxy]acetyl}amino)-4-pyridinecarboxylic acid; 3-[(2-methylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-[(3,3-dimethylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-[(5-phenylpentanoyl)amino]-4-pyridinecarboxylic acid; 3-({4-[4-(methyloxy)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-{ [4-(4-chlorophenyl)butanoyl]amino} -4-pyridinecarboxylic acid; 3-[(4-phenylbutyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methyl-4-phenylbutyl)amino]-4-pyridinecarboxylic acid; 3-({3-[(4-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-[(2-aminoethyl)amino]-4-pyridinecarboxylic acid; 3-({2-[(phenylcarbonyl)amino]ethyl}amino)-4-pyridinecarboxylic acid; 3-{[3-(phenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[2-(2-naphthalenyl)ethyl]amino}-4-pyridinecarboxylic acid;
3-{[(1-phenyl-1H-pyrazol-4-yl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[2-(4-bromophenyl)ethyl]amino}-4-pyridinecarboxylic acid; 3-{[2-hydroxy-3-(phenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(4-phenylpentyl)amino]-4-pyridinecarboxylic acid;
3-[({l-[(phenyloxy)methyl]cyclopropyl}methyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(phenylsulfonyl)propyl]amino}-4-pyridinecarboxylic acid; 3-{[(1-phenyl-3-pyrrolidinyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(diphenylmethyl)amino]-4-pyridinecarboxylic acid;
3-({[1-(phenylmethyl)-3-pyrrolidinyl]methyl}amino)-4-pyridinecarboxylic acid; 3-[methyl(phenylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[2-(4-biphenylyl)ethyl]amino}-4-pyridinecarboxylic acid; 3-[(2,4-diphenylbutyl)amino]-4-pyridinecarboxylic acid; 3-{[(1-phenyl-1H-pyrazol-4-yl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[1-(phenylmethyl)-1H-pyrazol-4-yl]amino}-4-pyridinecarboxylic acid;
3 -({ 3 - [(2-oxo- 1 ,2,3 ,4-tetrahy dro-6-quinolinyl)oxy Jpropyl } amino)-4- pyridinecarboxylic acid;
3-{[1-(phenylmethyl)-l H-1,2,4-triazol-3-yl]amino}-4-pyridinecarboxylic acid; 3-[(l S,4R)-bicyclo[2.2.1 ]hept-2-ylamino]-4-pyridinecarboxylic acid; 3-[(tetrahydro-2H-pyran-2-ylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(2-cyanophenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(4-pyridinylmethyl)amino]-4-pyridinecarboxylic acid;
3 -({ [ 1 -(phenylmethyl)- lH-pyrazol-4-yl]methyl } amino)-4-pyridinecarboxylic acid; 3-{[3-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-(2,3-dihydro-1H-inden-1-ylamino)-4-pyridinecarboxylic acid; 3-[(2-pyridinylmethyl)amino]-4-pyridinecarboxylic acid; 3-(3-biphenylylamino)-4-pyridinecarboxylic acid; 3-{[3-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-{[(3-cyanophenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-({[2-(acetylamino)phenyl]methyl}amino)-4-pyridinecarboxylic acid; 3-[(cyclohexylmethyl)amino]-4-pyridinecarboxylic acid; 3-({4-[4-(β-alanylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-[(4-{3-[(N-{[(1,1-dimethylethyl)oxy]carbonyl}-b- alanyl)amino]phenyl}butanoyl)amino]-4- pyridinecarboxylic acid;
3-({4-[3-(β-alanylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid;
3-{[(lS,2R)-2-hydroxy-2,3-dihydro-1H-inden-1-yl]amino}-4-pyridinecarboxylic acid; 3-[(3-biphenylylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)amino]-4-pyridinecarboxylic acid; 3-{[(1-phenylcyclohexyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-(2-pyridinylamino)-4-pyridinecarboxylic acid; 3-{[(2'-methyl-2-biphenylyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[2-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-[(4-phenylcyclohexyl)amino]-4-pyridinecarboxylic acid; 3-(2-biphenylylamino)-4-pyridinecarboxylic acid; 3-{[4-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-{[2-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; 3-[(2,2,6,6-tetramethyl-4-piperidinyl)amino]-4-pyridinecarboxylic acid; 3-(1,3-dihydro-2H-isoindol-2-yl)-4-pyridinecarboxylic acid;
3 -(4-phenyl- l-piperazinyl)-4-pyridinecarboxylic acid; 3-(1,2,3,4-tetrahydro-1-naphthalenylamino)-4-pyridinecarboxylic acid; 3-({[1-(phenylmethyl)-3-piperidinyl]methyl}amino)-4-pyridinecarboxylic acid; 3-[(4-biphenylylmethyl)amino]-4-pyridinecarboxylic acid;
3 -(2, 3 -dihydro- 1 H-inden-2-ylamino)-4-pyridinecarboxylic acid; 3-[(1-cyclohexylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1,1-dimethylethyl)amino]-4-pyridinecarboxylic acid;
3 3-[(3-{[3-(1-piperazinyl)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(6-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(3-pyridinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-{[3-(methyloxy)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-({3-[(3-fluorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-[(3-{[3-(phenyloxy)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-[(cyclopropylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(3-thienylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(3-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(lH-imidazol-4-ylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methylethyl)amino]-4-pyridinecarboxylic acid; 3-{[(lR)-1-(2-methylphenyl)butyl]amino}-4-pyridinecarboxylic acid; 3-[(lH-pyrazol-5-ylmethyl)amino]-4-pyridinecarboxylic acid;
3-{[(1-methylcyclohexyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(5-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(2-furanylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(lS)-1-(2-methylphenyl)butyl]amino}-4-pyridinecarboxylic acid; 3-(cyclobutylamino)-4-pyridinecarboxylic acid; 3-[(2-cyclopentyl-1-methylethyl)amino]-4-pyridinecarboxylic acid; 3-{[(2,4-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-[(2-thienylmethyl)amino]-4-pyridinecarboxylic acid; 3-{[(2,3-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid;
3 -[(cyclopentyl methyl )amino]-4-pyridinecarboxy lie acid; 3-{[(2,5-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(3-pentyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(4-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; 3-{[(2,6-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid;
3 - { [3 -( i 3 -[(methyl sulfonyl)amino]phenyl }oxy)propyl]amino}-4-pyridinecarboxylic
3-[(3-{ [3 -(methyl sulfonyl)phenyl]oxy [propyl )amino]-4-pyridinecarboxylic acid; 3-({3-[(3-methylphenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-{[3-(2-oxo-l (2H)-pyridinyl)propyl]amino}-4-pyridinecarboxylic acid; 3-[(4-cyclohexylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(2-pyridinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-{[4-(aminocarbonyl)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-{[3-({4-[(methylsulfonyl)amino]phenyl}oxy)propyl]amino}-4-pyridinecarboxylic
3-{[3-(8-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(1-naphthalenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-aminopropyl)amino]-4-pyridinecarboxylic acid; 3-[(cyclobutylmethyl)amino]-4-pyridinecarboxylic acid; 3-(propylamino)-4-pyridinecarboxylic acid; 3-[methyl(4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-({2-[2-(methyloxy)phenyl]ethyl}amino)-4-pyridinecarboxylic acid; 3-[(2-methylpropyl)amino]-4-pyridinecarboxylic acid; 3-(methylamino)-4-pyridinecarboxylic acid;
3-(butylamino)-4-pyridinecarboxylic acid;
3-[(2-cyclohexylethyl)amino]-4-pyridinecarboxylic acid;
3-[(1-phenylethyl)amino]-4-pyridinecarboxylic acid;
3-[(1-methyl-1-phenylethyl)amino]-4-pyridinecarboxylic acid;
3-(cyclopentylamino)-4-pyridinecarboxylic acid;
3-(cyclohexylamino)-4-pyridinecarboxylic acid;
3-[(2-cyclopentylethyl)amino]-4-pyridinecarboxylic acid;
3-[(2-cyclohexyl-1,1-dimethylethyl)amino]-4-pyridinecarboxylic acid;
3-[(1-cyclohexyl-1-methylethyl)amino]-4-pyridinecarboxylic acid;
3-[(4-{3-[(N-{5-[(3aS,4S,6aR)-2-oxohexahydro-l H-thieno[3,4-d]imidazol-4- yl]pentanalanyl)amino]phenyl}butanoyl)amino]-4-pyridinecarboxylic acid;
3-{[(lR,2S)-1-hydroxy-2,3-dihydro-l H-inden-2-yl]amino}-4-pyridinecarboxylic acid;
3-[(1-cyclohexylcyclopropyl)amino]-4-pyridinecarboxylic acid;
3-({2-[4-(2-thienyl)phenyl]ethyl}amino)-4-pyridinecarboxylic acid;
3-{[(2,4-difluorophenyl)carbonyl]amino}-4-pyridinecarboxylic acid; or a pharmaceutically acceptable salt thereof.
In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of an inhibitor of a molecule selected from the group consisting of ACE2, DYRK1A, SMARCA4, KDM6A, JMJD6, RAD54L2, DPF2, UBXN7, ARID 1 A, SMAD4, SH3Y11, PHIP, LDB1, SMARCEl, CTSL, ZNF628, RYBP, TMX3, HMGB1, SPTY2D1, ACVR1B, EIF3C, SERTAD4, CREBBP, SMAD3, TCEB3, SIAH1, BCBD1, and PKMYT1.
Pharmaceutical compositions
Pharmaceutical compositions of the present disclosure may comprise any of the inhibitors described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants e.g ., aluminum hydroxide); and preservatives.
Pharmaceutical compositions of the present disclosure may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type
and severity of the patient's disease, although appropriate dosages may be determined by clinical trials.
Pharmaceutical compositions may be administered multiple times or in a single administration. Administration of the pharmaceutical composition may be combined with other methods useful to treat the disease or condition as determined by those of skill in the art.
The administration of the composition of the disclosure may be carried out in any convenient manner known to those of skill in the art. For example, the composition may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation, transplantation, transarterially, subcutaneously, intradermally, intranodally, intramedullary, intramuscularly, by intravenous (z.v.) injection, or intraperitoneally.
It should be understood that the method and compositions that would be useful in the present disclosure are not limited to the particular formulations set forth in the examples. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the disclosure, and are not intended to limit the scope of what the inventors regard as their disclosure.
The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and chemistry, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", fourth edition (Sambrook, 2012); "Oligonucleotide Synthesis" (Gait, 1984); "Culture of Animal Cells" (Freshney, 2010); "Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1997); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Short Protocols in Molecular Biology" (Ausubel, 2002); "Polymerase Chain Reaction: Principles, Applications and Troubleshooting", (Babar, 2011); "Current Protocols in Immunology" (Coligan, 2002). These techniques are applicable to the production of the polynucleotides and polypeptides of the disclosure, and, as such, may be considered in making and practicing the disclosure. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
EXPERIMENTAL EXAMPLES
The disclosure is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the disclosure is not limited to
these Examples, but rather encompasses all variations that are evident as a result of the teachings provided herein.
The materials and methods employed in these experiments are now described.
Cell Culture: Vero-E6 cells, 293T cells and Huh7.5 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) with 10% heat-inactivated fetal bovine serum (FBS), and 1% Penicillin/Streptomycin unless otherwise indicated. For Vero-E6 cells, 5 μg/ml of puromycin (Gibco) and 5 μg/ml blasticidin (Gibco), were added as appropriate. Calu-3 cells were cultured in Eagle's Minimum Essential Medium (EMEM) with 10% FBS, 1% Penicillin/Streptomycin, 1 mM sodium pyruvate and 4 mM L-Glutamine.
Constructs: A plasmid encoding codon-optimized SARS-COV-2 S glycoprotein was obtained through BEI Resources (#NR-52309). VSV-delta G-luciferase plasmid was purchased from Kerafast.
CRISPR Screen: Vero-E6 cells were transduced with Ienti-Cas9 (pXR l 11 Addgene plasmid 96924) and selected with blasticidin for 10 days. Cas9 activity was assessed by transducing parental Vero-E6 or Vero-E6-Cas9 cells with pXPR_047 (Addgene plasmid 107645), which expresses eGFP and a sgRNA targeting eGFP. Cells were transduced for 24 hours and subsequently, selected for five days with puromycin and the frequency of eGFP expression was assessed by flow cytometry. The African Green Monkey (AGM) genome- wide CRISPR knockout library, which contains four unique sgRNA per gene, was delivered by lentiviral transduction of 2xl08 Vero-E6-Cas9 at -0.3 MOI. This equates to 6xl07 transduced cells, which is sufficient for the integration of each sgRNA 600 independent times. Two days post transduction, puromycin was added to the media and transduced cells were selected for seven days. Five conditions were set up for the screening. For each condition, 4xl07 cells were seeded in ten T175 flasks. Cells were infected with SARS-CoV-2 at MOI of 1. Mock infected cells were harvested 48 hours after seeding and served as a reference for sgRNA enrichment analysis. Seven days post-infection genomic DNA (gDNA) of surviving cells was isolated using a Zymo gDNA cleanup kit according to manufacturer instructions (Zymo D4065).
For Illumina sequencing and screening analysis, PCR was performed on gDNA to construct Illumina sequencing libraries, each containing 10 μg gDNA following the Broad Institute protocol PCR of sgRNAs for Illumina sequencing. The resulting sequencing reads were trimmed to 20-nt potential sgRNA sequences. Screens were analyzed as described below in “Screen analysis”
Generation of SARS-CoV-2 Stocks: SARS-CoV-2 was obtained from BEI following
isolation from a patient in Washington State (WA-1 strain - BEI #NR-52281). Virus was expanded in VeroE6 cells for 3-4 days and harvested at approximately 50% cytopathic effects. Media was clarified by centrifugation (450g x 5min) and filtered through a 0.45 micron filter, and then aliquoted for storage at -80°C. To generate icSARS-CoV-2-mNG stocks, lyophilized icSARS-CoV-2-mNG was resuspended in 0.5ml of deionized water and then 50ul of virus was diluted in 5ml media. This was then added to 10e6 Vero E6 cells in a T175 flask. Three days post infection, the supernatant was collected and clarified by centrifugation (450g x 5min), filtered through a 0.45 micron filter, and aliquoted for storage at -80°C. Virus titer was determined by plaque assay using Vero E6 cells.
To generate viral stocks, Huh7.5 (for SARS-CoV-2) or Vero-E6 (for UKU5-SARS- CoV-1-S and MERS-CoVs) were inoculated with HKU5-SARS-CoV-1-S (BEI Resources #NR-48814), SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources #NR-52281), MERS- CoV and MERS-CoV T1015N (BEI Resources #NR-48813 and #NR-48811) at a MOI of approximately 0.01 for three days to generate a PI stock. The PI stock was then used to inoculate Vero-E6 cells for three days at approximately 50% cytopathic effects. Supernatant was harvested and clarified by centrifugation (450 gx 5 min) and filtered through a 0.45- micron filter, and then aliquoted for storage at -80°C. Virus titer was determined by plaque assay using Vero-E6 cells. To generate icSARS-CoV-2-mNG stocks, lyophilized icSARS- CoV-2-mNG was resuspended in 0.5 ml of deionized water and then 50 μl of virus was diluted in 5 ml media (Xie etal ., (2020) Cell host & microbe , 27(5), pp. 841-848. e3). icSARS-CoV-2-mNG was provided by the World Reference Center for Emerging Viruses and Arboviruses (Galveston, TX). This was then added to 107 Vero-E6 cells in a T175 flask. At 3 dpi, the supernatant was collected and clarified by centrifugation (450 gx 5 min), filtered through a 0.45-micron filter, and aliquoted for storage at -80°C. All work with infectious virus was performed in a Biosafety Level 3 laboratory and approved by Yale University Biosafety Committee.
SARS-CoV2 Plaque Assays: Vero-E6 cells were seeded at 4 x 105 cells/well of a six- well plate. The following day, media was removed and 10-fold dilutions of virus was applied to each well for 1 hour with gentle rocking. After 1 hour incubation, overlay media was added (DMEM, 2% FBS, 0.6% Avicel RC-581). At 2 dpi for SARS-CoV-2 and 3 dpi for other coronaviruses, plates were fixed with 10% formaldehyde for 1 hour prior, stained with crystal violet solution (0.5% crystal violet and 20% ethanol) for 30 min, and then rinsed with deionized water to visualize plaques.
Pseudotype Virus Production: VSV-based pseudotyped viruses were produced as
described (Pernet et al. (2014) Nat Commun. Nov 18;5:5342. Briefly, 293T cells were transfected with pCAGGS expressing the SARS-CoV-2 spike glycoprotein and then inoculated with a replication-deficient VSV vector that contains expression cassettes for luciferase/eGFP instead of the VSV-G open reading frame. After an incubation period of 1 h at 37°C, the inoculum was removed and cells were washed with PBS before media supplemented with anti -VSV-G. Clone 14 was added in order to neutralize residual input virus (no antibody was added to cells expressing VSV-G). Pseudotyped particles were harvested 24 h post inoculation, clarified from cellular debris by centrifugation and stored at - 80°C before use.
Virus Entry Assay: In brief, 2xl04 cells were seeded in each well of a 96-well plate. The following day pseudovirus was added and incubated for one day. Cells were lysed with Renilla-Glo (Promega) at room temperature for 5 min. The luciferase activity was measured using a microplate reader (BioTek Synergy).
Secondary Assessment of CRISPR Screen Hits by Cell Viability: sgRNAs were cloned into lentiCRISPR v2 (Addgene plasmid #52961). Vero-E6-Cas9 cells were individually transduced with lentiviruses expressing two unique sgRNA per gene and selected with puromycin. Cells were infected with SARS-CoV2 at an MOI 0.1, and incubated for three days before assessing cellular viability by CellTiter Glo.
Secondary Assessment of CRISPR Screen Hits by Viral Replication: Gene-edited cells described above were plated at 2500 cells per well in a 384-well plate and then the following day, icSARS-CoV-2-mNG was added at a MOI of 1.0 and 0.01. Infected cell frequencies as measured by mNeon Green expression were assessed at 1, 2, and 3 dpi by high content imaging (BioTek Cytation 5). Total cell numbers were quantified by Gen5 software of brightfield images.
Genome-wide CRISPR screens: Vero-E6 cells (ATCC) were transduced with lenti- Cas9 (Cas9-vl, Addgene 52962) or pLX_311-Cas9 (Cas9-v2, Addgene 96924) and selected with blasticidin (5 μg/ml) for 10 days. Cas9 activity was assessed by transducing parental Vero-E6 or Vero-E6-Cas9 cells with pXPR_047 (Addgene 107645), which expresses eGFP and an sgRNA targeting eGFP (Doench et al. , (2014) Nature biotechnology , 32(12), pp. 1262-1267). Susceptibility to SARS-CoV-2 infection remained similar between parental cells and Cas9 expressing cells. Cells were transduced for 24 hours, selected for five days with puromycin, and the frequency of eGFP expression was assessed by flow cytometry on a Cytoflex S (Beckman). The African green monkey (AGM) genome-wide CRISPR knockout library (CP0070), which contains four unique sgRNA per gene in pXPR_050 (Addgene
96925) was designed according to the same general principles as the 'Brunello' human genome-wide library (Sanson et al., (2018 ) Nature communications , 9(1), p. 5416), was delivered by lentiviral transduction of 2 x 108 Vero-E6-Cas9 at -0.3 MOI. This equates to 6 x 107 transduced cells, which is sufficient for the integration of each sgRNA into -750 unique cells. Two days post-transduction, puromycin was added to the media and transduced cells were selected for seven days.
For SARS-CoV-2 screens, two infection conditions were set up for the screening with Cas9-vl: (1) 10% FBS, 5 x 106 cells, MOI 0.1 (2) 10% FBS, 5 x 106 cells, MOI 0.01. Five infection conditions were set up for the screening with Cas9-v2: (1) 10% FBS, 5 x 106 cells, MOI 0.1; (2) 5% FBS, 5 x 106 cells, MOI 0.1; (3) 5% FBS, 2.5 x 106 cells, MOI 0.1; (4) 5% FBS, 2.5 x 106 cells, MOI 0.01; (5) 2% FBS, 5 x 106 cells, MOI 0.1. For each condition, a total of 4 x 107cells were seeded in T175 flasks at the indicated cell concentrations. For the Cas9-vl screen, the mock sample was plated in 10% FBS at 5 x 106 cells in each of eight T175 flasks. For the Cas9-v2 screen, the mock sample was plated identically to condition (2) above in 5% FBS at 5 x 106 cells in each of eight T175 flasks. Cells were infected with SARS-CoV-2 at the indicated MOI. One condition (5% FBS, 2.5 x 106 cells per T175 flask, MOI 0.1) was used for HKU5-SARS-CoV-1-S, rcVSV-SARS-CoV-2-S, MERS-CoV WT (EMC/2012) and MERS-CoV T1015N screens. Mock infected cells were harvested 48 hours after seeding and served as a reference for sgRNA enrichment analysis. At 4 dpi, 80% of the media was exchanged for fresh media. At 7-9 dpi, cell lysates were harvested in DNA/RNA shield (Zymo Research) and genomic DNA (gDNA) of surviving cells was isolated using a gDNA cleanup kit according to manufacturer instructions (Zymo Research, D4065). For Illumina sequencing and screening analysis, PCR was performed on gDNA to construct Illumina sequencing libraries, with each well containing 10 μg gDNA (Doench et al. , (2016) The Lancet infectious diseases , 20(5), pp. 533-534; Orchard et al. , (2016) Science ,
353(6302), pp. 933-936). For PCR amplification, gDNA was divided into 100 μL reactions such that each well had at most 10 μg of gDNA. Per 96 well plate, a master mix consisted of 144 pL of 50x Titanium Taq DNA Polymerase (Takara), 960 pL of lOx Titanium Taq buffer, 768 pL of dNTP (stock at 2.5mM) provided with the enzyme, 48 pL of P5 stagger primer mix (stock at 100 pM concentration), 480 pL of DMSO, and 1.44 mL water. Each well consisted of 50 pL gDNA plus water, 40 pL PCR master mix, and 10 pL of a uniquely barcoded P7 primer (stock at 5 pM concentration).
PCR cycling conditions: an initial 1 min at 95 °C; followed by 30 s at 94 °C, 30 s at 53 °C, 30 s at 72 °C, for 28 cycles; and a final 10 min extension at 72 °C. PCR primers were
synthesized at Integrated DNA Technologies (IDT). PCR products were purified with Agencourt AMPure XP SPRI beads according to manufacturer's instructions (Beckman Coulter, A63880). Samples were sequenced on a HiSeq2500 High Output flowcell (Illumina). Reads were counted by alignment to a reference file of all possible guide RNAs present in the library. The read was then assigned to a condition (e.g. a well on the PCR plate) on the basis of the 8 nt index included in the P7 primer. The lentiviral plasmid DNA pool was also sequenced as a reference. sgRNA sequences for the genome-wide CRISPR library are in Table S5 ofWei etal. , (2021) Cell 184, 76-91.
To assess technical performance, the log-fold change of each guide was calculated relative to the original lentivirus plasmid pool and observed strong correlation between different cell culture conditions, with the greatest distinction between the two different Cas9 constructs (Pearson's r>0.61 among Cas9-v2 conditions and r>0.46 among Cas9-vl conditions; FIG. 12A). The depletion of sgRNAs targeting essential genes versus sgRNAs targeting non-essential genes in the mock-infected conditions was compared with each Cas9 construct and superior performance was observed with the Cas9-v2 construct (AUC = 0.82 vs 0.70 for Cas9-vl; FIG. 12B), although the top positively and negatively selected hits remained concordant between the two Cas9 constructs (Pearson's r = 0.24, FIG. 12C) (Hart el al ., (2014) Molecular systems biology , 10, p. 733; Hart etal., (2015) Cell , 163(6), pp. 1515— 1526). The enhanced Cas9 activity of Cas9-v2 was confirmed with a GFP reporter assay (FIGs. 12D-12E). The study therefore proceeded with the data from the Cas9-v2 screens and a guide-level residual (representing a log2 fold change) between mock-infected and SARS- CoV-2 infected cells was calculated (FIG. 12F). A positive residual indicates a gene is pro- viral and confers resistance to virus-induced cell death, while a negative residual indicates a gene is anti-viral and sensitizes a cell to virus-induced cell death. A z-score for enrichment or depletion was determined for each condition based on the distribution of residuals for all sgRNAs. z-scores were averaged across all five Cas9-v2 screen conditions, p-values combined using Fisher's method, and a false discovery rate (FDR) calculated using the Benjamini-Hochberg procedure to identify hit genes.
Secondary CRISPR subpool screen: A custom secondary CRISPR knockout subpool library (CP 1564) was designed with 6208 unique sgRNAs including 10 sgRNAs for each of the top 250 and bottom 250 genes from the genome-wide SARS-CoV-2 screen. 500 non- targeting control sgRNAs and other genes of interest including DPP4 were also included. The sgRNAs were cloned into pXPR_050 (Addgene 96925). The sgRNAs were delivered by lentiviral transduction of 4 x 107 Vero-E6-Cas9-v2 at -0.2 MOI. This equates to 8 x 106
transduced cells, which is sufficient for the integration of each sgRNA into -1000 unique cells. Two days post-transduction, puromycin was added to the media and transduced cells were selected for seven days. Eight viruses were used for the secondary CRISPR screen, including HKU5-SARS-CoV-1-S, SARS-CoV-2, rcVSV-SARS-CoV-2-S, MERS-CoV, MERS-CoV T1015N, IAV-WSN, EMCV, and VSV (Indiana). All the viruses were screened in duplicate except IAV-WSN. 3 x 106 transduced Vero-E6 cells were plated in 5% FBS in T150 flasks. Mock infected cells were harvested 48 hours after seeding and served as a reference for sgRNA enrichment analysis. At 4 dpi, 80% of the media was exchanged for fresh media. At 7 dpi, cell lysates were harvested in DNA/RNA shield buffer and gDNA of surviving cells was isolated for sequencing.
Tertiary CRISPR screen in Calu-3 cells: Tertiary CRISPR knockout library (CP1560), which contains 148 sgRNAs by targeting 32 human genes with 4 sgRNAs per gene and 20 non-targeting control sgRNAs in lentiCRISPRv2 (Addgene 52961), was delivered by lentiviral transduction of 2 x 106 Calu-3 cells at -0.2 MOI. Two days post- transduction, puromycin was added to the media and transduced cells were selected for ten days. 5 x 105 Calu-3 cells were plated in 5% FBS media in 6-well plates and infected with SARS-CoV-2 at 0.1 MOI. At 4 dpi, 80% of the media was exchanged for fresh media. At 7 dpi, genomic DNA of surviving cells was isolated for sequencing.
Screen analysis: Guide sequences were extracted from the sequencing reads with PoolQ version 3.2.9 (Broad Institute, portals dot broadinstitute dot org/gpp/public/software/poolq), using a "CACCG" search prefix, and a counts matrix was generated. Read counts were log-normalized within each condition using the following formula: log-normalized reads per million for guide = log2((# of reads for guide / total reads in condition x le6) + 1)
Prior to analysis, any sgRNAs with an outlier abundance in the plasmid DNA pool (defined as a log-normalized read count > 3 standard deviations from the mean) or that had > 5 predicted off-target sites with a CFD score = 1 ("Match Bin I") were filtered out. This removed 755 sgRNAs; the remaining 84,208 sgRNAs were used for all analyses. Log-fold changes (LFCs) were then calculated by subtracting the log-normalized plasmid DNA. For each condition, a natural cubic spline was fit with 4 degrees of freedom, using the mock infected LFCs as the independent variable and the relevant condition's LFCs as the dependent variable. The residual from this fit spline was used to represent the deviation from the expected LFC for each guide. To combine these residuals at the gene level, a z-score was
calculated for each condition, z=(c-m)/(s/h), where x is the mean residual for a gene, m is the mean residual of all sgRNAs, s is the standard deviation of all sgRNAs and n is the number of sgRNAs for a given gene. The normal distribution function was used to calculate p-values from the z-scores. To combine p-values across multiple conditions Fisher's method was used. Finally, to calculate the false discovery rate for each gene the Benjamini-Hochberg procedure was used. The same pDNA and off-target filters were used for the secondary and tertiary libraries. To analyze these libraries, LFCs were z-scored using intergenic control sgRNAs.
Gene set enrichment and network analysis: The STRING enrichment detection tool was used to identify significantly enriched gene sets, using African green monkey gene symbols, but testing for enrichment across human gene sets. Sets from all available sources provided by that tool were analyzed, including sets of clusters of protein-protein interactors in STRING, and excluding the PubMed gene sets. A network of enriched gene sets was generated by drawing edges between sets with a significant overlap between genes. The significance of overlap was evaluated using Fisher's exact test. The network was clustered using a weighted graph, treating the fraction of genes that overlap between any sets as edge weights and proteins as nodes, weighted by the absolute value of the z-score. Then, the infomap algorithm (Rosvall and Bergstrom, (2008) Proceedings of the National Academy of Sciences of the United States of America, 105(4), pp. 1118-1123) was used to cluster the network. The centrality of each node to a given cluster was evaluated using the PageRank algorithm with a damping factor of 0.5 and the same edge and node weights (for personalized PageRank) were employed was done with clustering (Brin and Page, (1998) Computer Networks , vol. 30, pp. 107-117).
Arrayed secondary assessment of CRISPR screen hits by cell viability : HMGB1 sgRNAs were cloned into lentiCRISPRv2 (Addgene 52961) which also encodes the Cas9 gene (Sanjana, Shalem and Zhang, (2014) Nature methods , 11(8), pp. 783-784). sgRNAs for all other genes were cloned into lentiGuide-Puro or a variant thereof, pXPR_050 (Addgene 52963, 96925, respectively). Individual sgRNAs target sequences are in Table 2. Vero-E6- Cas9-v2 cells were individually transduced with lentiviruses expressing one to three unique sgRNA per gene and then selected with puromycin for 7 days. After selection, 1.25 x 103 cells were seeded in each well of a 384-well black walled clear bottom plate in 20 μl of DMEM + 5% FBS. The following day, 5 μl of SARS-CoV-2 was added for a final MOI of 0.2. Cells were incubated for three days before assessing cellular viability by CellTiter Glo (Promega). For each cell line, viability was determined in SARS-CoV-2 infected relative to mock infected cells. Five replicates per condition were performed in each of three
independent experiments.
SARS-CoV-2 fluorescent reporter virus assa : Vero-E6 cells were plated at 2.5 x 103 cells per well in a 384-well plate and then the following day, icSARS-CoV-2-mNG was added at a MOI of 1.0 (Xie etal. (2020) Cell host & microbe , 27(5), pp. 841-848. e3). Infected cell frequencies as measured by mNeonGreen expression were assessed at 2 dpi by high content imaging (Cytation 5, BioTek) configured with bright field and GFP cubes. Total cell numbers were quantified by Gen5 software of brightfield images. Object analysis was used to determine the number of mNeonGreen positive cells. The percentage of infection was calculated as the ratio between the number of mNeonGreen+ cells and the total number of cells in brightfield. Data are normalized to the average of DMSO treated cells.
Identification of Anti-Viral Drugs Targeting CRISPR Gene Hits: Calpain Inhibitor III (#14283), SIS3 (#15495), and PFI-3 (#15267) were purchased from Cayman Chemical.
All compounds were resuspended at a final concentration of 40mM in DMSO and then two- fold serial dilutions were performed in DMSO. 20 nanoliters of 1000X drug was spotted into each well of a 384-well plate using an Labcyte ECHO acoustic dispenser (Yale Center for
Molecular Discovery). 1250 Vero E6 cells were plated in each well in 20μl of phenol-red free DMEM containing 5% FBS. Two days later, 5,000 PFU (MOI ~1) icSARS-CoV-2-mNG in 5 μl media was added. Cells were incubated at 37°C and 5% CO2 for two days. Infected cell frequencies were quantified by mNeon Green expression at 2 dpi (Cytation 5, BioTek). In parallel, 1000 PFU (MOI-0.2) SARS-CoV-2 was added to replicate plates and cell viability
was quantified by CellTiter Glo at 3dpi.Vero-E6, Huh7.5 and Calu-3 cells were pretreated with 10 mM SIS3 and 40 mM PFI-3 for 48 hours and then infected with SARS-CoV-2 at a MOI of 0.1. Viral production was determined by plaque assay. Cytotoxicity was not observed in these cell lines during the time and concentration of drug used.
RNA-seq: Total cellular RNA was extracted using Direct-zol RNA MiniPrep Kit and submitted to the Yale Center for Genome Analysis for library preparation. RNA-seq libraries were sequenced on an Illumina NovaSeq 6000 instrument with the goal of at least 25 c 106 reads per sample. Reads were aligned to reference genome chlSab2, NCBI annotation release 100, using STAR aligner v2.7.3 a (Dobin et al., (2013) Bioinformatics , 29(1), pp. 15-21) with parameters — winAnchorMultimapNmax 200 — outFilterMultimapNmax 100 — quantMode GeneCounts. Differential expression was obtained using the R package DESeq2 vl.32 (Dobin etal. , (2013) Bioinformatics , 29(1), pp. 15-21; Love, Huber and Anders, (2014) Pediatric research , 83(5), pp. 1049-1056). Bigwig files were generated using deeptools v3.1.3 (Ramirez etal. , (2016) Nucleic acids research, 44(W1), pp. W160-5) with parameter — normalizeUsing RPKM.
ChIP-seq: All ChIP samples were prepared in duplicate. Approximately 20 x 106 Vero-E6 cells were used per immunoprecipitation. Cells were washed twice with PBS and crosslinked with 1% formaldehyde (Pierce) for 10 min at room temperature. Crosslinking was quenched with 125 mM (final) glycine for 5 min and washed 2x with PBS. Cells were lysed in 4 ml lysis buffer (50 mM HEPES pH 7.9, 140 mM NaCl, 1 mM EDTA, 10% glycerol,
0.5% NP-40, 0.25% Triton X-100), 1 x Protease inhibitor (Roche) for 10 min on ice. Lysed cells were centrifuged at 4,000 rpm for 5 min at 4 °C and washed 2x with 4 ml cold wash buffer (10 mM Tris-Cl pH 7.5, 200 mM NaCl, 1 mM EDTA pH 8.0, 0.5 mM EGTA pH 8.0), lx protease inhibitors. The pellet was resuspended in 1 ml shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris pH 7.5), 1 x protease inhibitor and sheared on Covaris S220 (140 W, 5% duty factor, 200 bursts per cycle, 4 °C) for 12 min (determined by time course optimization experiment). Extract was diluted with Triton X-100 (1% final) and NaCl (150 mM final) and cleared by centrifugation at 21 ,000g, 4 °C for 10 min. For input, 10% of material was set aside. Cleared extract was supplemented with 2 μg of antibody and incubated overnight at 4 °C. Immuno-precipitated chromatin was captured on 30 μl of Dynabeads protein G (Invitrogen) at 4 °C for 1.5 h. Beads were washed twice with low-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM HEPES-potassium hydroxide pH 7.5, 150 mM NaCl),
2x with high-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM HEPES- potassium hydroxide pH 7.5, 500 mM NaCl), 1 x LiCl Buffer (100 mM Tris-HCl pH 7.5, 0.5
M LiCl, 1% NP-40, 1% sodium deoxycholate) and l x TE buffer (10 mM Tris-HCl pH 8.0,
0.1 mM EDTA). Enriched DNA was eluted in 100 μl of proteinase K buffer (20mM HEPES pH 7.5, 1 mM EDTA, 0.5% SDS) supplemented with 40 μg of proteinase K (Ambion) for 30 min at 50 °C. Formaldehyde crosslinks were reversed by adding NaCl (150 mM final) and 0.25 μg DNase-free RNase (Roche), followed by incubation overnight at 65 °C. DNA was isolated using QIAquick PCR purification kit (Qiagen) and submitted to the Yale Center for Genome Analysis for library preparation. ChIP-seq libraries were sequenced on a Illumina NovaSeq 6000 instrument as 101 nt long paired-end reads, with the goal of at least 20 c 106 reads per IP. Reads were trimmed of adaptor sequences using Cutadapt (Martin, (2011) EMBnet.journal , 17(1), pp. 10-12) and aligned to the reference genome chlSab2 using Bowtie2 (Langmead and Salzberg, (2012) Nature methods , 9(4), pp. 357-359). Alignments were filtered using SAMtools (Li et al., (2009) Bioinformatics, 25(16), pp. 2078-2079), and peak calls and enrichment tracks were created using MACS2 (Zhang et al. , (2008) Genome biology , 9(9), p. R137). Differential analysis at called peaks was performed using DESeq2 (Love, Huber and Anders, (2014) Pediatric research , 83(5), pp. 1049-1056). Peaks were assigned to the nearest transcription start site within lOOkb for integration with RNA-seq data and overlaps of ChIP-seq and ATAC-seq peaks were determined using bedtools.
ATAC-seq: ATAC-seq libraries were generated following the omni-ATAC protocol as described (Corces etal ., (2017) Microbiology, 17(3), pp. 181-192). Two biological repeats were generated per each sample. 50,000 viable cells were resuspended in 50 μl cold ATAC- Resuspension Buffer (RSB) (lOmM Tris-HCl, pH7.4, lOmM NaCl, and 3mM MgCl2) containing 0.1% NP40, 0.1% Tween-20, and 0.01% digitonin and incubated on ice for 3 minutes. 1ml of cold ATAC-RSB containing 0.1% Tween-20 was then added to wash out the lysis. Samples were centrifuged at 500 RCF for 10 minutes at 4°C. The nuclei pellets were resuspended in 50 pi transposase reaction mix (25 μl 2x TD buffer, 2.5 pi transposase, 16.5 pi PBS, 0.5 pi 1% digitonin, 0.5 pi 10% Tween-20, and 5 μl H2O) and incubated at 37°C for 30 minutes in a thermomixer with 1000 RPM mixing. Reactions were cleaned up with Zymo DNA Clean and Concentrator-5 kit; Transposed DNA sample was eluted in a 20 pi elution buffer. Transposed samples were pre-amplified for 5 cycles using NEBNext 2x Master Mix in 50 μl reaction mix (2.5 μl of 25 mM primer Adi, 2.5 μl of 25 mM primer Ad2, 25 μl of 2x Master Mix and 20 μl transposed elution) at cycling conditions as following: 72°C, 5 minutes; 98°C, 30 seconds; then 5 cycles of (98°C, 10 seconds; 63°C, 30 seconds; 72°C, 1 minute). 15 μl of qPCR amplification reaction (5 pi of pre-amplified sample; 0.5 pi of 25 mM primer Adi, 0.5 μl of 25 mM primer Ad2, 5 μl of 2x NEBNext Master Mix, 0.24 μl of 25x
SYBR Green in DMSO, and 3.76 μl of H2O) was carried out at cycling conditions as following: 98°C, 30 seconds; then 20 cycles of (98°C, 10 seconds; 63°C, 30 seconds; 72°C, 1 minute. The required number of additional cycles for each sample was determined as described (Buenrostro etal. , (2015) Current protocols in molecular biology , edited by Frederick M. Ausubel, 109, pp. 21.29.1-21.29.9). After the final amplification, PCR reaction was purified using a Zymo DNA Clean and Concentrator-5 kit and eluted in 20 μl H2O. To remove primer dimers and larger than 1,000 bp fragments, double-sided bead purification was proceeded with Ampure XP beads. 0.5x volume AMPure XP beads were added to each reaction and incubated at room temperature for 10 minutes and then separated in a magnetic rack for 5 minutes. Supernatant was transferred to a new tube and incubated with 1.3x original volume AMPure XP beads at room temperature for 10 minutes and then separated in a magnetic rack for 5 minutes. Supernatant was discarded. Beads were washed twice with 200 μl 80% ethanol (freshly made) and air dried to ensure all ethanol was removed. Final ATAC-seq libraries were eluted in 20 μl nuclease-free H2O from the beads. ATAC-seq libraries were sequenced on an Illumina NovaSeq S4 instrument as 101 nt long paired-end reads, with the goal of at least 50 c 106 reads per replicate. Reads were trimmed of Nextera adaptor sequences using Trimmomatic v0.39 (Bolger, Lohse and Usadel, (2014) Bioinformatics , 30(15), pp. 2114-2120) and aligned to chlSab2 using Bowtie2 v2.2.9 (Langmead and Salzberg, (2012) Nature methods , 9(4), pp. 357-359) with parameter -X2000. Duplicates were marked using Picard Tools v2.9.0 (Broad Institute version 2.9.0. "Picard Tools." Broad Institute, GitHub repository broadinstitute dot github dot io/picard/). Duplicated, unpaired, and mitochondrial reads were removed using SAMTools vl.9 (Li el al ., (2009) Bioinformatics , 25(16), pp. 2078-2079). Reads were shifted +4 bp and -5 bp for forward and reverse strands, respectively. Peaks were called using MACS2 v2.2.6 (Zhang el al ., (2008) Genome biology , 9(9), p. R137) with parameters —nomodel — keep-dup all -s 1 — shift -75 — extsize 150. Reads that fell inside peaks were counted using featureCounts vl.6.2 (Liao, Smyth and Shi, (2014) Bioinformatics , 30(7), pp. 923-930) and differential accessibility analysis was performed using DESeq2 vl.32 (Love, Huber and Anders, (2014) Pediatric research , 83(5), pp. 1049-1056). Bigwig files were generated using deeptools v3.1.3 (Ramirez etal. , (2016) Nucleic acids research, 44(W1), pp. W 160-5) with parameter - -normalizeUsing RPKM.
RT-qPCR: Total RNA was isolated from cells using Direct-zol RNA MiniPrep Plus kit, reverse transcribed, and subjected to real-time PCR analysis to measure mRNA levels of tested genes. Data shown are the relative abundance of the indicated mRNA normalized to
that of actin. Gene-specific primer sequences were as follows ACE2:
GGGAT C AGAGATCGGAAGAAGA (forward) (SEQ ID NO: 46) and AAGGAGGTCTGAACATCATCAGTG (reverse) (SEQ ID NO: 47); Actin: GAGCACAGAGCCTCGCCTTT (forward) (SEQ ID NO: 48) and AT CAT C ATCC AT GGT GAGCTGG (reverse) (SEQ ID NO: 49).
Nuclear/Cytosol Fractionation: Vero-E6 cells were mock-infected or infected with SARS-CoV-2 at a MOI of 1.0 for 24 hours before cellular fractionation was performed using a Nuclear/Cytosol fractionation kit (BioVision Cat#K266-25) according to manufacturer instructions. In brief, 1 x 107 cells were collected by centrifugation at 600 x g for 5 min at 4°C. Add 0.2 ml Cytosol Extraction Buffer A (CEB-A) to fully resuspend the cell pellet.
After 10 min incubation on ice, add 11 μl of ice-cold CEB-B and incubate on ice for lmin. Centrifuge at 16000 x g- for 5 min, the supernatant was collected as cytoplasmic fraction. The pellet was resuspended in 100 μl of ice-cold Nuclear Extraction Buffer (NEB) vertex every 10 min for a total of 40 min. The samples were centrifuge at 16000 x g- for 10 min, and the supernatant was collected as the nuclear fraction.
Western blot: Cells were collected and lysed in Nonidet P-40 lysis buffer (20 mM Tris-HCl [pH 7.4], 150 mMNaCl, 1 mM EDTA, 1% Nonidet P-40, 10 mg/ml aprotinin, 10 mg/ml leupeptin, and 1 mM PMSF). The cell lysates or cellular fractions were fractionated on SDS-PAGE and transferred to a PVDF membrane. Immunoblotting analyses were performed with the indicated antibodies and visualized with horseradish peroxidase-coupled goat anti- mouse/rabbit IgG using a chemiluminescence detection system (BioRad ChemiDoc MP).
Generation ofHMGBl knockout and complemented cells: Vero-E6 cells were individually transduced with lentiviruses expressing two guide RNAs targeting HMGB 1 (Table S6 of Wei etal. , (2021) Cell 184, 76-91) and then selected with puromycin for 7 days. Single cells were then sorted by flow cytometry and HMGB1 knockout was confirmed by western blot. HMGB1 KO clones were complemented by lentiviral transduction of pLenti6/V5-DEST vector containing human HMGB1 with a C-terminal V5. Two days post transduction, blasticidin was added and cells were selected for five days. The expression of HMGB1 in complemented cells was detected by western blot.
Pseudovirus production: VSV-based pseudoviruses were produced in 293T cells. Cells were transfected with pCAGGS or pcDNA3.1 vector expressing the CoV spike glycoprotein and then inoculated with a replication-deficient VSV virus that contains expression cassettes for Renilla luciferase instead of the VSV-G open reading frame. After an incubation period of 1 h at 37°C, the inoculum was removed and cells were washed with PBS
before media supplemented with anti-VSV-G clone IE9F9 was added in order to neutralize residual input virus (no antibody was added to cells expressing VSV-G) (Lefrancois and Lyles, (1982) Virology , 121(1), pp. 157-167). Pseudotyped particles were harvested 24 hours post inoculation, clarified from cellular debris by centrifugation and stored at -80°C before use. Plasmids encoding codon-optimized form of SARS-CoV-1-S glycoprotein, MERS-CoV SACT and NL63 SACT glycoproteins lacking cytoplasmic tail were previously described (Huang el al. , 2006; (2006), Journal of Biological Chemistry , pp. 3198-3203. doi: 10.1074/ jbc.m508381200; Letko, Marzi and Munster, (2020) Nature microbiology , 5(4), pp. 562- 569). Vector pCAGGS containing the SARS-CoV-2, Wuhan-Hu-1 Spike Glycoprotein Gene, NR-52310, was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH.
Pseudovirus entry assay: 1x104 Vero-E6 cells were seeded in 100 μl total volume in each well of a black-walled clear bottom 96-well plate. The following day spike expressing VSV pseudovirus was added at 1:10 final concentration volume/volume and incubated for one day. Cells were lysed with Renilla Luciferase Assay System (Promega) according to manufacturer instructions. Luciferase activity was measured using a microplate reader (BioTek Synergy or Cytation 5).
Quantification and statistical analysis: Statistical significance was determined as p < 0.05 using GraphPad Prism 8 unless otherwise indicated. Experiments were analyzed by unpaired two-tailed t tests, Mann-Whitney test, or ANOVA, as indicated.
The results of the experiments are now described.
Example 1: Genome-wide CRISPR screen reveals therapeutic targets for SARS-CoV-2
Discovery of host genes and pathways that mediate pathogenesis of pandemic coronaviruses is a critical resource that promotes our understanding of how these viruses cause disease, why there is variable host susceptibility, the origins of host species range, and reveals host-directed therapeutic targets against both known and unknown coronaviruses of pandemic potential. To identify host genes essential for cell survival in response to SARS- CoV-2, a number of mammalian cell lines were first screened for cytopathic effects (CPE) in response to SARS-CoV-2 infection. Although numerous ACE2 expressing cell lines were susceptible to infection, CPE was observed only in the Chlorocebussabaeus (African Green Monkey) cell line Vero E6. Next, a novel C. sabaeus genome-wide CRISPR library was generated, comprised of approximately four single-guide RNAs targeting each of the 20,000 C. sabaeus genes for a total of 80,000 unique targeting sgRNAs and 250 non-targeting
control sgRNAs. VeroE6 cells were stably transduced with a lentivirus expressing Cas9 nuclease. Cas9 activity was confirmed by transduction of a GFP expressing lentivirus that also expresses a GFP-specific sgRNA. Vero-Cas9 cells were transduced with the C.sabaeus sgRNA library and cells were challenged with SARS-CoV-2 (FIG. 1 A). To generate a robust dataset, five independent genome-wide screens were simultaneously performed with varying fetal bovine serum (FBS) concentrations, cell densities, and multiplicities of infection. SgRNAs from surviving cells were sequenced and mapped to the C.sabaeus genome, and a z- score for enrichment or depletion was determined based on the distribution of the 250 non- targeting sgRNAs.
The top hit across the median of the five screens was the viral receptor ACE2 (FIG. IB). CTSL which encodes the Cathepsin L protease was also a hit in all conditions. Surprisingly, TMPRSS2 was not enriched in any condition. The proteases TMPRSS4 and Furin, which have also been suggested to be involved in SARS-CoV-2 entry, were similarly not enriched suggesting these proteases are not essential for infection in Vero E6 cells under the conditions herein.
Pathway analysis revealed genes involved in nucleosome regulation, chromatin regulation, histone modification, and transcription were positively selected (FIGs. 1C, 2A- 2C). In particular, nearly all members of the SWESNF (S witch/ Sucrose Non-Fermentable) complex including SMARCA4, DPF2, ARID 1 A, SMARCEl, and SMARCEB 1 were positively selected. The SWESNF complex is a highly conserved ATP- dependent chromatin remodeling complex implicated in a number of cancers. This suggests therapeutic antagonists of the SWESNF pathway would have anti-viral activity.
Enrichment in the TGFβ signaling pathway (SMAD3, SMAD4, SERTAD4, and ACTVR1B) was also observed. A number of biologic and small molecule antagonists have been developed targeting this pathway including SIS3 and SB-505124 which, according to data disclosed herein, are anti-viral for SARS-CoV-2.
Next key histone modifying enzymes including KDM6A, KMT2D, JMJD6 were identified that were also pro-viral. According to these data, existing small molecules targeting these histone regulators such as GSK-J1, GSK-J2, GSK-J3, GSK-J4, GSK-J5, MLN4924, 1- CBP112, and metformin have activity against SARS-CoV-2.
The results demonstrate the first genome-wide CRISPR screen with SARS-CoV-2. Novel genes and pathways critical for virus-induced cell death in Vero E6 cells were discovered. The identification of known pro-viral genes ACE2 and CTSL demonstrated the power of the screen which enabled the revelation of a novel regulatory framework that
regulates SARS-CoV-2 permissiveness. Specifically, this work suggests that the TGFβ signaling pathway through Activin 1RB, SMAD3, and SMAD4 promotes the SWI/SNF chromatin remodeling complex that in turn induces expression of proviral genes including ACE2 and CTSL. It was also revealed herein that this process is inhibited by the histone H3.3 complex. Antagonists of the TGFβ and SWI/SNF pathways, as well as agonists of the histone H3.3 pathway, represent novel drugs against SARS-CoV-2. The identification of the role of these well-studied and druggable regulatory pathways revealed novel therapeutic targets for COVID-19 and provided insight into viral tropism and the variation in host susceptibility to severe disease.
Example 2: Drugs exhibiting anti-viral activity
Various drugs were tested for anti -viral activity (FIG. 4 and FIGs. 21-23). Drugs that exhibit anti-viral activity in VeroE6 cells are tested for efficacy and toxicity in human Calu3 cells, human Huh7.5 cells, and primary human bronchial epithelial cells cultured at an air- liquid interface. Cells are treated with the drug at various concentrations starting at 40 micromolar and then SARS-CoV-2 is added. Viral replication is monitored by plaque assay. Drugs that exhibit anti-viral activity are also tested in transgenic K18-hACE2 mice which express the human ACE2 receptor under control of a K18 promoter. These mice succumb to intranasal SARS-CoV-2 infection and thus anti-viral drugs reduce viral load, mitigate weight loss, and increase survival (FIGs. 21-23).
FIG. 5 depicts a model for how host proteins are acting to control virus infection and illustrates key therapeutic targets implicated in SARS-CoV-2 infection by this work.
Example 3: CRISPR screens of highly pathogenic coronaviruses reveal host genes essential for infection
Discovery of host genes and pathways that mediate pathogenesis of pandemic coronaviruses is a critical resource that promotes our understanding of how these viruses cause disease, why there is variable host susceptibility, the origins of host species range, and reveals host-directed therapeutic targets against both known and unknown coronaviruses of pandemic potential. To identify host factors essential for cell survival in response to pandemic human coronaviruses including SARS-CoV-1, SARS-CoV-2 and MERS-CoV, Vero-E6 cells were used, which is a model cell line for isolating viruses that were selected based on their susceptibility and cytopathic effects in response to all three pandemic CoVs (Matsuyama et al. , (2020) Proceedings of the National Academy of Sciences of the United
States of America, 117(13), pp. 7001-7003; Ogando etal, (2020) bioRxiv. doi: 10.1101/2020.04.20.049924; Woolsey etal. , (2020) bioRxiv. doi:
10.1101/2020.05.17.100289. Genome-wide CRISPR screens were performed with SARS- CoV-2 (isolate US A-W A 1/2020), MERS-CoV (EMC/2012), a tissue culture-adapted MERS- CoV (T1015N), and a recombinant bat coronavirus (HKU5) containing the spike protein of SARS-CoV-1 (HKU5-SARS-CoV-1-S) (Scobey el al. , (2013) Proceedings of the National Academy of Sciences of the United States of America, 110(40), pp. 16157-16162; Agnihothram etal, (2014) mBio, 5(2), pp. e00047-14). HKU5-SARS-CoV-1-S was used as a surrogate for SARS-CoV-1, which is a select agent. Further, to test whether genes implicated in SARS-CoV-2 infection acted at the level of viral entry, a genome-wide screen was performed with replication competent vesicular stomatitis virus (VSV) expressing the SARS-CoV-2 spike protein (rcVSV-SARS-CoV-2-S). rcVSV-SARS-CoV-2-S is deficient for the broadly fusogenic VSV glycoprotein (G), and thus, viral entry is entirely mediated by the SARS-CoV-2 spike protein.
A C. sabaeus genome-wide pooled CRISPR library composed of 83,963 targeting single guide RNAs (sgRNAs) was used, with an average of four sgRNAs per gene, and 1,000 non-targeting control sgRNAs. Initially, two independent SARS-CoV-2 genome-wide screens were performed with Vero-E6 lines expressing two different Cas9 nuclease constructs (Cas9- vl and Cas9-v2); Cas9-v2 has an additional nuclear localization sequence to increase activity. Vero-Cas9 cell lines were transduced with the C. sabaeus sgRNA library and challenged with SARS-CoV-2 (FIG. 6A). To generate a robust dataset, independent screens were performed at different cell densities, fetal bovine serum (FBS) concentrations, and multiplicities of infection (MOI). Z-scores for all SARS-CoV-2 screens are in Table SI of Wei et al, (2021) Cell 184, 76-91, which is incorporated by reference in its entirely herein. Subsequent MERS- CoV WT, MERS-CoV T1015N, HKU5-SARS-CoV-1-S, and rcVSV-SARS-CoV-2-S screens were performed in duplicate under a single cell density, FBS concentration, and MOI. Genomic DNA was harvested from surviving cells at 7-9 days post-infection (dpi) and guide abundance was determined by PCR and massively parallel sequencing. Technical performance of the screens is described in FIGs. 12A-12F.
The SARS-CoV-2 screen identified numerous genes that confer either resistance (pro- viral) or sensitization (anti-viral) when targeted by sgRNAs, with a minimum FDR of 0.03 for non-targeting controls (FIGs. 6B-6C), demonstrating high technical quality. The strongest resistance hit was the viral receptor ACE2 (mean z-score = 4.9; descending rank = 1; FIGs. 6B-6C and 13A-13B). CTSL, which encodes the Cathepsin L protease, was also positively
selected in all conditions (mean z-score = 3.0; descending rank = 18; FIGs. 6B-6C and 13B). TMPRSS2 (mean z-score = 0.9; descending rank = 2726) nor the proteases TMPRSS4 or FURIN (mean z-scores = 1.1, 0.4; descending ranks = 1657, 7180, respectively), which have also been implicated in SARS-CoV-2 entry, were enriched suggesting these proteases are either not essential in a cell-intrinsic manner for SARS-CoV-2-induced cell death as performed herein and/or are functionally redundant.
Comparison of SARS-CoV-2 to rc VS V- SARS-CoV-2- S revealed substantial concordance between the viruses, suggesting that concordant genes act at the level of viral entry (FIG. 6C-6D). SARS-CoV-2 and HKU5-SARS-CoV-1-S screens also yielded similar overlap consistent with similar mechanisms of entry as mediated by the SARS-CoV-1 and SARS-CoV-2 spike proteins (FIG. 6E). Next, the relationship between MERS-CoV and SARS-CoV-2 screens was assessed. The MERS-CoV receptor DPP4 was the top resistance hit in the MERS-CoV screen, whereas ACE2 was not enriched (FIG. 6F). SARS-CoV-2 resistance genes ARID1 A, DYRK1A, KDM6A , and CTSL were also highly enriched in the MERS-CoV screen (FIG. 6F). Pairwise correlations of all genome-wide screens are shown in FIGs. 14A-14G (z-scores for all genes are shown in Table S2 of Wei et al, (2021) Cell 184, 76-91). Next, the top 100 resistance genes across the genome-wide screens were compared with SARS-CoV-2, rcVSV-SARS-CoV-2-S, HKU5-SARS-CoV-1-S, and MERS-CoV (WT) viruses. Five genes (ARID 1 A, KDM6A, JMJD6, SMARCC1, and CTSL) scored in each of the four virus screens. That these genes were enriched in the SARS-CoV-2, HKU5-SARS-CoV- 1-S, and MERS-CoV (WT) screens suggests they are potentially pan-coronaviral. Because they also were enriched in the rcVSV-SARS-CoV-2-S screen, they act at the level of coronavirus entry (FIG. 6G). Together this indicates these genes promote lineage- independent entry of pandemic coronaviruses. 14 genes scored in the three SARS-lineage viruses but not MERS-CoV including A CE2, HMGB1, SMARCA4, DYRK1A , and DPF2 , suggesting these genes mediate entry of SARS-lineage viruses (FIG. 6G). The MERS receptor DIPL along with AXIN1 and TMEM41B were identified as MERS-CoV specific pro- viral genes while SMAD3 and SMAD4 were enriched only in the SARS-CoV-2 screens. Amongst sensitization genes, BPTF, which encodes the scaffold for the NURF chromatin remodeling complex, was broadly depleted for all four viruses. Similarly, the interferon- stimulated gene LY6E, which was recently identified as a pan-coronaviral entry inhibitor, was identified as an anti-viral gene for both SARS-lineage and MERS-CoV screens. This is despite Vero-E6 cells being deficient in type I interferon. Overall, these results show that a survival assay in Vero-E6 cells is able to distinguish host factors both common to and
specific for a variety of pathogenic coronaviruses.
While all the genome-wide screens were validated, SARS-CoV-2 was focused on given the immediacy of the current pandemic. To systematically identify hit gene sets enriched in the SARS-CoV-2 screen, the STRING-db enrichment detection tool was used and 623 significant gene sets were identified (FIG. 13C) from 10 sources (e.g. KEGG, GO process) (Szklarczyk etal. , (2019) Nucleic acids research , 47(D1), pp. D607-D613). The top gene sets that scored in the positive direction (pro-viral), negative direction (anti-viral), or both directions and their respective genes are shown in FIGs. 7A-7F. SMARCA4 ( BRG1 ), the catalytic subunit of the SWI/SNF remodeling complex, scored after ACE2 as the second- strongest SARS-CoV-2 resistance hit (mean z-score = 4.9; descending rank = 2; FIG. 6B- 6D), with several other members including ARID 1 A, SMARCE1 , SMARCB1 , and SMARCC1 showing enrichment (mean z-scores = 3.6, 2.8, 2.4, 2.3, descending ranks = 9, 20, 47, 59, respectively; FIG. 7B). The SWI/SNF complex is an ATP-dependent nucleosome remodeling complex that regulates chromatin accessibility and gene expression. Interestingly, while SWI/SNF complex genes ARID l A, SMARCB1, and SMARCC1 were enriched in both SARS- lineage and MERS-CoV screens, SMARCA4 was enriched only in the SARS-lineage screens. Several other histone modifying enzymes were also identified as key regulators of SARS- CoV-2-induced cell death (FIG. 6C and 13B). Other pro-viral genes include the histone demethylase KDM6A (mean z-score = 4.1; descending rank = 4), histone methyltransferase KMT2D (mean z-score = 2.6; descending rank = 35), as well as the lysyl hydroxylase JMJD6 (mean z-score = 3.7; descending rank = 6) (FIG. 6C and 13B). In contrast, sgRNAs targeting H IRA , CABIN1, and ASF1A were negatively selected, revealing an anti-viral function. These genes encode three of the four proteins in the HUCA histone H3.3 chaperone complex (mean z-scores = -5.7, -5.4, -3.0; ascending ranks = 1, 2, 64, respectively), suggesting an anti -viral role for the deposition of the histone variant H3.3.
Enrichment was also observed in the "RUNX3 regulates CDKN1A transcription" gene set from Reactome (FIG. 7A and 7C). This is driven by enrichment of sgRNAs targeting the signal transducers SMAD3 and SMAD4 (mean z-scores = 2.8, 3.1; descending ranks = 21, 15, respectively). The "cystatin and endolysosome lumen" gene set which includes CTSL was also enriched (FIG. 7D). Unsurprisingly, enrichment of "Viral translation" was observed in both positive and negative directions (FIG. 7E). The NURF complex was the top gene set enriched in the negative direction (FIG. 7F).
Example 4: Pooled and arrayed validation confirms genome-wide CRISPR screen hits
and reveals virus-specificity
To validate the genome-wide screens, a custom CRISPR subpool was generated containing 10 sgRNAs for each of the top 250 and bottom 250 genes from an earlier analysis of the SARS-CoV-2 screen along with 500 non-targeting control sgRNAs and sgRNAs targeting other genes of interest such as the MERS-CoV receptor, DPP4. This sgRNA library was introduced into Vero-Cas9-v2 cells and this pool was challenged with either SARS-CoV- 2, rcVSV-SARS-CoV-2-S, HKU5-SARS-CoV-1-S, MERS-CoV, or MERS-CoV T1015N. The orthomyxovirus Influenza A virus (A/WSN/1933) (IAV), the picornavirus EMCV, and VSV (Indiana) were included as control viruses, which all cause cytopathic effects in Vero- E6 cells. All eight viruses were screened in duplicate except for IAV. The secondary screen validated the top pro-viral and anti-viral genes from the primary genome-wide SARS-CoV-2 screen (FIG. 8A and Table S3 of Wei et al, (2021) Cell 184, 76-91). Clustering the correlations between the log2-fold changes of each condition revealed that the viruses containing a SARS-lineage spike grouped together, as did MERS-CoV WT and T1015N, whereas IAV and EMCV were outliers, as expected (FIG. 8B). A principal component analysis of the secondary screens revealed clusters of gene hits in an unbiased manner (FIG. 8C). Focusing on the top resistance hits for each virus screen, SARS-lineage specific (e.g. ACE2, PHIP ), MERS-lineage specific (e.g. DPP 4) and pan-coronaviruses specific genes (e.g. CTSL, ARID 1 A, PCBD1 and KMT2D ) were observed (FIG. 15 A). Consistent with the genome-wide CRISPR screens, the key genes encoding members of the SWI/SNF complex are pro-viral for coronaviruses but not IAV or EMCV (FIG. 15B). SMAD3 and SMAD4 were modestly enriched in the SARS-CoV-2 and rcVSV-SARS-CoV-2-S subpool screens (FIG. 15C). In addition, the top sensitization genes involved in the HUCA histone H3.3 chaperone complex were specific to the SARS-lineage spike protein (FIG. 15D). The secondary screens for rcVSV-SARS-CoV-2-S and HKU5-SARS-CoV-1-S showed strong agreement with the SARS-CoV-2 secondary screen with correlation coefficients of 0.90 and 0.89, respectively (FIGs. 8D-8E). The MERS-CoV secondary screen correlated with the SARS-CoV-2 screen to a lesser extent than rcVSV-SARS-CoV-2-S and HKU5-SARS-CoV-1-S (r = 0.43; FIG. 8F). Minimal correlation was observed between either IAV or EMCV and SARS-CoV-2, with correlations of 0.23 and 0.042 respectively (FIG. 8G-8H). No cells survived infection with VSV thus precluding analysis. Together this demonstrates the virus-specificity of the identified host genes and provides insight into the stage of the virus life cycle mediated by critical genes.
To begin to understand the generalizability of these hits to human cells, a small
CRISPR subpool targeting 32 genes in Calu-3 cells, a lung adenocarcinoma line that natively expresses ACE2, were screened (Table S4 of Wei el al. , (2021) Cell 184, 76-91). This screen revealed significant overlap in both pro-viral (including ACE2, DYRK1A, SMARCA4,
KDM6A, JMJD6, SMARCE1 andSIAHl) and anti-viral genes (including HIRA, PIAS2 and SMARCA5 ) between Vero-E6 and Calu-3 cells (FIG. 81), suggesting the conserved role of these genetic hits across species. Notably, TMPRSS2 but not CTSL was enriched in the Calu- 3 subpool screen, consistent with TMPRSS2 expression in Calu-3 cells but not Vero-E6 cells.
Twenty-five genes were selected for further validation of the SARS-CoV-2 screen in an arrayed rather than pooled format, consisting of 18 resistance and 7 sensitization genes (FIG. 9A). Vero-Cas9-v2 cells were transduced with one of 42 individual sgRNAs (1 to 3 sgRNAs per gene). Each of the 42 cell lines was challenged with SARS-CoV-2 and cell viability assessed. Cells receiving sgRNAs targeting pro-viral genes exhibited greater viability than those with non-targeting control sgRNAs. The knockout efficiency of several genes (including ACE2, SMARCA4, KDM6A and SMAD3 ) was validated by western blot, and the protein abundance correlated with the degree of protection (FIG. 9B-9D). Cells receiving sgRNAs targeting anti-viral genes in the primary screen exhibited increased susceptibility to cell death relative to controls, confirming the efficiency and reproducibility of the screen (FIG. 9B and 9D). The robust concordance between the primary screens and the several subsequent validation approaches indicates that these screens will be a useful resource for further investigation of coronavirus host pathogen interactions.
Example 5: CRISPR screen reveals potential host-directed therapeutic targets
Next, it was asked whether the genes and pathways revealed by the screen could be targeted with small molecules. Antagonists previously described to inhibit these gene products were selected and their effects on SARS-CoV-2-induced cell death were investigated. In addition, a replication competent infectious clone of SARS-CoV-2 expressing the fluorescent reporter mNeonGreen (icSARS-CoV-2-mNG) was utilized to quantify the influence of these molecules on viral replication (Xie et al. (2020) Cell host & microbe ,
27(5), pp. 841-848. e3).
Dose-dependent inhibition of SARS-CoV-2-induced cell death and virus replication was observed with Calpain Inhibitor III, whose targets include Cathepsin L (FIGs. 10A, 10D- 10E). Given the pro-viral role of SMARCA4 and SMAD3, it was tested whether existing small molecule antagonists of these pathways have antiviral activity against SARS-CoV-2. Specifically, treatment with PFI-3, which targets the bromodomains of the SWESNF proteins
SMARCA4 and SMARCA2 (Fedorov et al, (2015) Science advances , 1(10), p. el500723; Xie et al. , (2020) Cell host & microbe , 27(5), pp. 841-848. e3), conferred protection from virus-induced cell death (FIG. 10B) and reduced frequency of viral infection, as measured by expression of mNeonGreen (FIGs. 10D-10E). The small molecule SIS3 was also assessed, which targets the pro-viral gene SMAD3 identified in the screen. SIS3 exhibited dose- dependent protection from virus-induced cell death and also inhibited SARS-CoV-2 fluorescent reporter expression (FIGs. lOC-lOE). SARS-CoV-2 growth curves were performed to investigate the effects of PFI-3 and SIS3 in Vero-E6, Calu-3, and the human liver cell line, Huh7.5. A ~l-log reduction in PFI-3-treated cells and ~2-log reduction in SIS3-treated cells was observed (FIG. 10F-10H). This provides pharmacological validation in Vero-E6 and human cells in addition to genetic evidence that these pathways are critical to SARS-CoV-2 infection.
Example 6: HMGB1 regulates ACE2 expression and is essential for viral entry of SARS-CoV-1, SARS-CoV-2, and NL63
The SARS-CoV-2 screen revealed a putative pro-viral role for the gene LOC103214541 , which is annotated as "HMGBl-like" in the C. sabaeus genome (mean z- score = 3.6, descending rank = 10; FIG. 6C and 6A and 11 A). HMGB1 is a nuclear protein that binds DNA but translocates to the cytoplasm under conditions of stress and can be secreted extracellularly where it functions as an alarmin. HMGBl-like was also identified as pro-viral in the rcVSV-SARS-CoV-2-S and HKU5-SARS-CoV-1-S but not the MERS-CoV screens (FIG. 6C, G and FIGs. 8C-8E). To validate the role of HMGB1 in SARS-CoV-2 infection, two independent sgRNAs targeting HMGB1 were introduced into each of three independent cell lines: Vero-E6, Huh7.5, and Calu-3 cells. Depletion of HMGB1 protein was measured by western blot (FIG. 1 IB). HMGB1 disruption protected cells from SARS-CoV-2 - induced cell death, and the degree of protection correlated with HMGB1 protein abundance (FIG. 11C). SARS-CoV-2 growth curves were performed on control and HMGB1- disrupted cells and a ~2-log reduction in SARS-CoV-2 replication was observed at both 24 and 48 hours post-infection (FIG. 1 ID). Next it was investigated whether HMGB1 is acting cell- intrinsically or acting as an alarmin to regulate SARS-CoV-2 infection. SARS-CoV-2 infection increased HMGB1 protein levels in the nucleus and cytoplasm (FIG. 16A) and culture media (FIG. 16B-16C). Recombinant HMGB1 protein had no effect on SARS-CoV-2 infection when added extracellularly to either WT or HMGB1 KO cells as measured by cell viability, icSARS-CoV-2-mNG infection, and SARS-CoV-2 pseudovirus infection (FIG.
16D-16F), demonstrating that HMGB1 is acting cell-intrinsically, rather than as an alarmin or chemokine, to regulate SARS-CoV-2 infection.
As HMGB1 is a DNA binding protein that regulates chromatin, it was hypothesized that HMGB1 controls a pro-viral gene expression program. The differentially expressed genes between control and HMGB1 disrupted cells were compared with the gene-level z- scores from the genome-wide CRISPR screen. Among pro-viral genes only HMGB1 , ACE2 and CTSL gene expression was significantly downregulated in HMGBI disrupted cells (FIG.
1 IE and 17A). Interestingly, few other differentially expressed genes were enriched in either the positive or negative direction in the CRISPR screen. ACE2 transcripts were significantly reduced in HMGB1 knockout cells compared to WT Vero-E6 cells, as confirmed by quantitative PCR (RT-qPCR), as were ACE2 protein levels by western blot (FIG. 1 IF). Gene Ontology enrichment analysis indicated 16 gene sets were significantly enriched in differentially expression genes; however, these gene sets were not enriched in the SARS- CoV-2 CRISPR screen (FIG. 17B).
The effects of HMGB1 disruption on chromatin states across the genome were analyzed by chromatin immunoprecipitation sequencing (ChIP-seq) and assayed for transposase-accessible chromatin sequencing (ATAC-seq; FIG. 17C-17D). Upon HMG I disruption, changes in chromatin accessibility by ATAC-seq were positively correlated with changes in H3K27ac ChIP-Seq, a marker of active enhancers (FIG. 17E), as expected. ChIP- seq revealed significant reduction in H3K27ac level (p=0.01) at a peak immediately downstream from the ACE2 transcription start site in HMGBI disrupted cells compared to control cells (FIG. 11G and 17D). In addition, a trend was observed towards reduced chromatin accessibility at the overlapping ATAC-seq peak at the ACE2 locus (p=0.057) in HMGBI disrupted cells compared to control cells (FIG. 11G and 17C). HMGBI is necessary for ACE2 expression, as well as viral entry of SARS-CoV-1, SARS-CoV-2, and NL63, but not MERS-CoV which mirrors receptor utilization (FIG. 1 IF and 11H). Taken together, these findings demonstrate that HMGBI is a novel regulator of ACE2 expression which affects susceptibility to SARS-CoV-2.
Example 6:
Herein, the first genome-wide screens for host genes that affect infection by pandemic coronaviruses SARS-CoV-2 and MERS-CoV as well as the recombinant bat coronavirus HKU5-SARS-CoV-1-S were performed. The identification of the viral receptors A ( 7/2 and DPP4 and protease CTSL demonstrate the technical quality of the screens, providing
confidence in the additional genes that regulate SARS-CoV-2 infection. Genes involved in diverse biological processes including chromatin remodeling, histone modification, cellular signaling, and RNA regulation were discovered. Key genes were validated in both a pooled and arrayed format, including both pro-viral and anti-viral genes, and small molecule antagonists were identified that confer protection to SARS-CoV-2-induced cell death and infection in Vero-E6, human hepatocytes, and human lung cells.
The screen identified many genes with functional roles in chromatin regulation and histone modification which highlight the potential importance of epigenetic regulation of pathogenic coronavirus infection. Epigenetic processes are implicated in regulating antigen presentation and interferon-stimulated gene induction after MERS-CoV and SARS-CoV-1 infection; however, given that Vero-E6 cells are type I interferon-deficient, distinct mechanism(s) may be at play. Interestingly, the majority of both pro-viral and anti -viral genes identified function at the level of viral entry as determined by the high degree of concordance between SARS-CoV-2 and rcVSV-SARS-CoV-2-S screens. Both ACE2 dependent and independent mechanisms regulating coronavirus entry were identified.
Specifically, a novel epigenetic role for HMGB1 in regulating ACE2 expression and thus susceptibility to SARS-CoV-1, SARS-CoV-2, and NL63 was identified. This was demonstrated both in Vero-E6 cells and two human IFN-sufficient cell lines. HMGB1 is a pleiotropic protein that binds nucleosomes regulating chromatin in the nucleus, acts as a sentinel of non-self nucleic acids, transports genetic material, and functions as a secreted alarmin in response to virus infection. Interestingly, anti-HMGBl therapies can reduce respiratory syncytial virus replication and IAV-induced lung pathology in animal models, while in adenovirus infection, the viral protein VII binds HMGB1 and inhibits its proinflammatory functions. Notably, it was discovered herein that HMGB1 regulates ACE2 expression in a cell-intrinsic manner and not via its function as a cytokine or alarmin, suggesting a distinct mechanism of HMGB1 in SARS-CoV-2 infection.
Genes encoding members of the SWESNF chromatin remodeling complex were identified as pro-viral for SARS-CoV-2, MERS-CoV, and HKU5-SARS-CoV-1-S, suggesting this complex is broadly important for pathogenic coronaviruses. These genes were also identified as pro-viral for rcVSV-SARS-CoV-2-S suggesting a role for SWESNF complexes in promoting coronavirus entry. The SWESNF complex is comprised of a catalytic ATPase subunit, either SMARCA2 or SMARCA4, and a larger, non-catalytic protein scaffold core that is bridged to the ATPase via ARIDl A. SWESNF complexes lack intrinsic DNA sequence specificity and thus their targeting specificity is conferred by DNA-
binding proteins, which bind and recruit them to genomic target sites where they then slide and eject nucleosomes regulating chromatin accessibility and gene expression. The pro-viral role of SWI/SNF complexes may be opposed by the histone H3.3 (HUCA chaperone) complex, which has been shown to co-target with SWI/SNF complexes on chromatin.
The pro-viral and anti-viral genes identified herein have important implications for understanding COVID-19 pathogenesis, therapeutics, and vaccine design. First, SARS-CoV- 2 can cause diverse phenotypes ranging from asymptomatic infection to severe respiratory failure and death. The basis for this variation among people and between species is unclear. The genes and pathways identified herein may explain this variation, as disease susceptibility may positively correlate with expression of resistance genes and negatively correlate with sensitization genes on the cellular, tissue, and organismal level. For example, cigarette smoking both increases ACE2 expression and exacerbates COVID-19 pathogenesis. The regulatory network underlying this is unknown, but it is intriguing to speculate that the chromatin and histone modifying genes identified here contribute to expression of a heterogeneous pro-viral gene expression program that potentially regulates ACE2 and other viral interacting genes. In addition, despite Vero-E6 cells being deficient in interferon, the interferon-stimulated gene LY6E was identified as an anti -viral entry factor for both SARS- lineage and MERS-CoV. This suggests basal expression of LY6E in the absence of type I interferon and reveals the utility and applicability of Vero-E6 cells as a model system to reveal host-pathogen interactions of pathogenic coronaviruses.
The genetic screen revealed novel therapeutic targets for SARS-CoV-2 infection. Several small molecule inhibitors were tested and three molecules that inhibit SARS-CoV-2 replication and virus-induced cell death were identified. Therapeutic targeting of these genes and pathways, including the SWI/SNF complex and SMAD3/SMAD4, can be clinically useful. Additionally, anti -viral genes were identified and validated, including regulators of the histone variant H3.3 {CABIN 1, HIRA , ASF1A). While these genes potentially provide protection from SARS-CoV-2, they can also prove fruitful in generating knockout cell lines with increased susceptibility to diverse human coronaviruses, which may facilitate coronavirus vaccine production.
SARS-CoV-1, MERS-CoV, and SARS-CoV-2 reveal the pandemic potential and dangers of emerging coronaviruses. This study represents the first genome-wide genetic screen performed with any human coronaviruses. Ultimately, these findings can be broadly applicable to other human and emerging coronaviruses, which will facilitate development of host-directed therapies against existing and future pandemic coronaviruses.
Example 7: Small molecule inhibitors that inhibit coronavirus infection and pathogenesis
Small molecule inhibitors were identified that effectively inhibit coronavirus infection and pathogenesis. Specifically, Compound 12 was identified (Papillon et al ., (2018) J Med. Chem ., 61, 10155-10172), which targets the catalytic subunits (SMARCA4 and SMARCA2) of the SWI/SNF chromatin remodeling complex as anti-viral. It was discovered herein that SMARCA4 is essential for SARS-CoV-1 and SARS-CoV-2 mediated entry into cells but not that of MERS-CoV (FIGs. 18A-18I). This requires the catalytic activity of SMARCA4 as SMARCA4 could be genetically disrupted by CRISPR and then complemented with either a WT SMARCA4 transgene or a catalytically inactive (K785R) SMARCA4 mutant. WT SMARCA4 but not the K785R mutant rescued susceptibility to SARS-lineage virus entry. Using the human liver cell line Huh7.5, it was demonstrated that SMARCA4 is essential for infection of human cells (FIGs. 19A-19B). SMARCA4 is also essential for expression of the SARS-lineage receptor ACE2 as measured by mRNA (FIGs. 20A-20B) and western blot (FIG. 20C). Finally, it was demonstrated that Compound 12 inhibits SARS-CoV-2 induced cell death and replication in a dose-dependent manner. Compound 12 blocks Ace2 expression suggesting it could be an effective therapeutic and prophylactic for any pathogen or disease that utilizes Ace2 (e.g. cardiovascular disease).
Also identified herein is a small molecule that targets KDM6A called GSK-J4, which has anti-viral activity. The gene KDM6A scored amongst the top hits for SARS-CoV-2, MERS-CoV, and HKU5-SARS-CoV-1-S in the forward genetic screens described herein. KDM6A encodes a histone lysine demethylase (KDM6A) that removes methyl groups from lysine position 27 of histone H3 (H3K27). Tri-methylated H3K27 (H3K27me3) marks repressed chromatin and correlates with reduced gene expression. Removal of the H3K27 tri- methyl groups by demethylases such as KDM6A classically promotes gene expression. KDM6A is a frequently mutated epigenetic regulator in several cancer types which has led to the development of small molecule inhibitors (Yin etal. (2019) Biomed Pharmacother 118, 109384). Both enzyme-dependent and -independent functions of KDM6A have been reported. The role of KDM6A in viral infection is largely unknown although it has been shown to promote inflammation in response to respiratory syncytial virus and VSV infection.
The KDM6A/B small molecule inhibitor GSK-J4 was tested for inhibition of SARS- CoV-2 replication in human Huh7.5 and Calu-3 cells (FIG. 22). GSK-J4 treatment resulted in a >2 log decrease in SARS-CoV-2 replication. Next, GSK-J4 was tested to see if it confers a
survival advantage to high-dose (106 PFU) intranasal SARS-CoV-2 challenge. Consistent with the reduction in viral replication cell lines, GSK-J4 confers a survival advantage from SARS-CoV-2 in vivo using K18-human ACE2 mice (FIG. 23).
Together this reveals novel anti-viral functions of Compound 12 and GSK-J4 that are useful for the prevention or treatment of diverse coronaviruses via a novel mechanism of action.
Other Embodiments
The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this disclosure has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this disclosure may be devised by others skilled in the art without departing from the true spirit and scope of the disclosure. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
Claims
1. A method for treating, ameliorating, and/or preventing SARS-CoV-2 infection, and/or one or more complications thereof, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of a molecule in the TGFβ signaling pathway.
2. The method of claim 1, wherein the molecule in the TGFβ signaling pathway is at least one selected from the group consisting of SMAD3, SMAD4, SERTAD4, and ACTVR1B.
3. The method of claim 2, wherein the inhibitor is at least one selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, a recombinant protein, a ligand, and a receptor decoy.
4. The method of any one of claims 1-3, wherein the small molecule drug is selected from the group consisting of:
SIS3 ((E)-1-(6,7-Dimethoxy-3,4-dihydroisoquinolin-2(lH)-yl)-3-(1-methyl-2-phenyl-1H- pyrrolo[2,3-b]pyridin-3-yl)prop-2-en-1-one),
SB-505124 (2-[4-(1,3-Benzodioxol-5-yl)-2-(1,1-dimethylethyl)-1H-imidazol-5-yl]-6-methyl- pyridine),
EW-7197 or vactosertib (N-((5-([ 1,2, 4]triazolo[l,5-a]pyridin-6-yl)-4-(6-methylpyri din-2 -yl)- lH-imidazol-2-yl)methyl)-2-fluoroaniline),
K02288 (3-(6-amino-5-(3,4,5-trimethoxyphenyl)pyridin-3-yl)phenol),
LDN-212854 (5-[6-[4-(1-Piperazinyl)phenyl]pyrazolo[l,5-a]pyrimidin-3-yl]-quinoline), SB-431542 (4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide), or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
5. A method for treating, ameliorating, and/or preventing SARS-CoV-2 infection, and/or one or more complications thereof, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a histone modifying enzyme inhibitor.
6. The method of claim 5, wherein the histone modifying enzyme is at least one selected from the group consisting of KDM6A, KMT2D, and JMJD6.
7. The method of claim 5, wherein the inhibitor is at least one selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, a recombinant protein, a ligand, and a receptor decoy.
8. The method of claim 7, wherein the small molecule drug is selected from the group consisting of: metformin,
MLN4924 (pevonedistat or [(lS,2S,4R)-4-[4-[[(lS)-2,3-Dihydro-1H-inden-1- yl]amino]pyrrolo[2,3-d]pyrimidin-7-yl]-2-hydroxycyclopentyl]methyl sulfamate);
I-CBP112 (1 -[7-(3,4-Dimethoxyphenyl)-9-[[(3S)-1-methylpiperidin-3-yl]methoxy]-2, 3,4,5- tetrahydro- 1 ,4-benzoxazepin-4-yl]propan- 1 -one);
GSK-J1 (3-((2-(pyridin-2-yl)-6-(1,2,4,5-tetrahydro-3H-benzo[d]azepin-3-yl)pyrimidin-4- yl)amino)propanoic acid);
GSK-J2 (3-((2-(pyridin-3-yl)-6-(1,2,4,5-tetrahydro-3H-benzo[d]azepin-3-yl)pyrimidin-4- yl)amino)propanoic acid);
GSK-J3 (3-((2-(4-(3-(methylamino)propyl)pyridin-2-yl)-6-(1,2,4,5-tetrahydro-3H- benzo[d]azepin-3-yl)pyrimidin-4-yl)amino)propanoic acid);
GSK-J4 (ethyl 3-((2-(pyridin-2-yl)-6-(1,2,4,5-tetrahydro-3H-benzo[d]azepin-3-yl)pyrimidin- 4-yl)amino)propanoate);
GSK- J5 (ethyl 3 -((2-(pyri din-3 -yl)-6-( 1 ,2,4, 5-tetrahydro-3H-benzo[d]azepin-3 -yl)pyrimidin- 4-yl)amino)propanoate); or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
R1 is: C1-6 alkyl; C3-7 cycloalkyl; C1-6 haloalkyl; a 5, 6 or 7-membered aryl or heteroaryl (which heteroaryl contains one or more heteroatoms selected from N, O and S and which is optionally fused to phenyl), said 5-, 6- or 7-membered aryl or heteroaryl being optionally substituted with one or more substituents independently selected from C1-3alkyl; 0-C1-6alkyl (which is optionally substituted by phenyl or naphthyl, each of which may be substituted by one of more substituents independently selected from halo); -O-cyclohexyl (which is optionally fused with phenyl); -C(O)NRC2; or -NRaRb, each Ra and Rb is independently selected from: H; C1-3alkyl which is optionally substituted by one or more substituents independently selected from phenyl (which phenyl is optionally substituted by one or more substituents independently selected from C1-3alkyl, O- C1-3alkyl, C(O)NRC2, halo and cyano), C(O)NRC2, a 4-, 5-, 6- or 7-membered heterocyclic or heteroaryl group (containing one or more heteroatoms independently selected from N, O and, S), a 3-, 4-, 5-, 6- or 7-membered cycloalkyl group (which is optionally fused to phenyl), halo, OC1-3alkyl, OH, -NHCOC1-3alkylNRc 2 and C(O)NHCH2C(O)NRc 2; a 3-, 4-, 5-, 6- or 7- membered cycloalkyl group (which is optionally fused to phenyl), or Ra and Rb together form a 5-, 6- or 7-membered heterocyclic group optionally containing one or more further heteroatoms independently selected from N, O, S or S(O)2 said heterocyclic group being optionally fused to a 5-, 6- or 7-membered aryl or heteroaryl ring containing one or more heteroatoms independently selected from N, O and S; the heterocylic ring and/or the aryl or heteroaryl to which it is optionally fused being optionally substituted by one or more substituents independently selected from halo, OH, C1-3alkyl, 0-C1-3alkyl, C(O)C1-3alkyl, S(O)2C1-3alkyl, NHC(O)C1-3alkyl, NHS(O)2C1-3alkyl, C(O)NRc 2, C(O)NRd 2 (wherein Rd and Rd together form a 5- or 6-membered heterocylic ring), NRC2 C(O)phenyl, S(O)2NRC2, =0 (oxo) and 5-, 6- or 7-membered aryl or heteroaryl (containing one or more heteroatoms independently selected from N, O and S);
R2 and R3 are each independently selected from: H, (CH2)1-3NRC(CH2)1-3NRC2; (CH2)1- 6NRC2; C1-3 alkyl; O-C1-3alkyl; C1-3haloalkyl; (CH2)0-3NRaRb (wherein Ra and Rb are as defined above); (CH2)0-3NHPh; (CH2)0-30Ph; (CH2)0-30h; or R2 and R3 together form a
fused phenyl ring, and each Rc is independently selected from hydrogen and C1-3alkyl; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
10. The method of claim 9, wherein the small molecule drug is: N-[6-(1,1-dimethylethyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyri dinyl)-6-(trifluorom ethyl )-4-pyri mi dinyl]-β-alanine;
N-[6-(4-morpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(methylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1-pyrrolidinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-hydroxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2 -hydroxy ethyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(dimethylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine; N-[6-phenyl-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(aminocarbonyl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(aminocarbonyl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-({[3,4-bis(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(3-amino-3-oxopropyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine;
N-[6-{[(3,4-dichlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-({[3-(aminocarbonyl)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(4-chlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(lH-pyrazol-4-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3-methyl-l H-pyrazol-4-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(3-chlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(2-methylphenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[(2-thienylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-[6-({[3-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[(2-pyridinylmethyl)amino]-4-pyrimidinyl]-β-alanine;
N-[6-({[4-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(cyclopropyl methyl )amino]-2-(2-pyridinyl)-4-pyri mi dinyl]-β-alanine;
N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-( 1 -methyl ethyl )-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-cyclopropyl-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(diethylamino)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(l,3,4-oxadiazol-2-yl)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[4-(1,3-thiazol-2-yl)-1-piperazinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(4-phenyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(4-chlorophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(hexahydro-1H-azepin-1-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1-benzothien-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3,4-dihydro-2(l H)-isoquinolinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{4-[(methylamino)carbonyl]-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(7-hydroxy-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine;
N-[6-(7-bromo-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[6-(5-hydroxy-1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-{2-(2-pyridinyl)-6-[(4-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine; N-{2-(2-pyridinyl)-6-[(3-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine N-[6-(2,3-dihydro-l H-inden-2-ylamino)-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; N-[6-[(2-phenylethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; N-[6-[methyl(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]- b-alanine; 3-{[6-(1,1-dimethylethyl)-2-(2-pyridinyl)-4-pyrimidinyl]amino}-2-methylpropanoic acid; N-[6-(methyloxy)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(1,1-dimethylethyl)-2-(3-isoquinolinyl)-4-pyrimidinyl]-β-alanine; N-{6-(1,1-dimethylethyl)-2-[5-(trifluoromethyl)-2-pyridinyl]-4-pyrimidinyl}-β-alanine; N-[6-(1,1-dimethylethyl)-2-(4-methyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-{6-(1,1-dimethylethyl)-2-[4-(methyloxy)-2-pyridinyl]-4-pyrimidinyl}-β-alanine; N-{6-(1,1-dimethylethyl)-2-[5-(methyloxy)-2-pyridinyl]-4-pyrimidinyl}-β-alanine; N-[6-(1,1-dimethylethyl)-2-(5-methyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[2-[4-(dimethylamino)-2-pyridinyl]-6-(1,1-dimethylethyl)-4-pyrimidinyl]-β-alanine; N-[6-[7-(methyloxy)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-(4-acetyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[4-(methylsulfonyl)-1-piperazinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(acetylamino)-1-pyrrolidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{3-[(methylsulfonyl)amino]-1-pyrrolidinyl}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(phenylmethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[3-(acetylamino)-1-piperidinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{3-[(methylsulfonyl)amino]-1-piperiddinyl}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-phenyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-hydroxy-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[(4-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-{2-(2-pyridinyl)-6-[(3-pyridinylmethyl)amino]-4-pyrimidinyl}-β-alanine;
N-[6-(2,3-dihydro-l H-inden-2-ylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-phenyl ethyl )amino]-2-(2-pyridinyl)-4-pyri mi dinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(4-thiomorpholinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(3-hydroxy-1-pyrrolidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(l,3,4,5-tetrahydro-2H-2-benzazepin-2-yl)-4-pyrimidinyl]-β-alanine;
N-[6-(1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-methyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-({[3-(methyloxy)phenyl]methyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(3-cyanophenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[2-(methyloxy)ethyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1,1-dioxido-4-thiomorpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[bis(2 -hydroxy ethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[4-(phenylcarbonyl)-1-piperazinyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-{3-[(methylamino)carbonyl]-1-piperidinyl}-2-(2-pyridinyl)-4-pyrimidiyl]-β-alanine; N-{2-(2-pyridinyl)-6-[3-(1-pyrrolidinylcarbonyl)-1-piperidinyl]-4-pyrimidinyl}-β-alanine; N-[6-(4-methyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(4,4-dimethyl-1-piperidinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(4-propanoyl-1-piperazinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(5-chloro-1,3-dihydro-2 H-isoindol-2-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-[5-(methyloxy)-1,3-dihydro-2H-isoindol-2-yl]-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[6-[(2-phenylethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(1-oxo-3,4-dihydro-2(lH)-isoquinolinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; N-[6-(2 -methyl-4, 5, 7, 8-tetrahydro-6 H-[l,3]thiazolo[4,5-d]azepin-6-yl)-2-(2-pyridinyl)-4-
pyrimidinyl]-β-alanine;
N-[6-[7-(methylsulfonyl)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[6-[7-(aminosulfonyl)-1,2,4,5-tetrahydro-3 H-3-benzazepin-3-yl]-2-(2-pyridinyl)-4- pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,3,4-tetrahydro-2-naphthalenyloxy)-4-pyrimidinyl]-β-alanine;
N-{6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-2-[4-(1,2,4,5-tetrahydro-3H-3-benzazepin-
3-yl)-2-pyridinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(1-benzothien-3-yl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-(6-( 1,3 -dihydro-2 H-isoindol-2-yl)-2-{4-[(phenylamino)methyl]-2-pyridinyl}-4- pyrimidinyl]-β-alanine;
N-(6-( 1,3 -dihydro-2 H-isoindol-2-yl)-2-{4-[(phenyloxy)methyl]-2-pyridinyl}-4-pyrimidinyl]- b-alanine;
N-[6-(1,3-dihydro-2 H-isoindol-2-yl)-2-(4-phenyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(methylamino)carbonyl]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(1,1-dimethylethyl)-2-(4-methyl-2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[{[3-(aminocarbonyl)phenyl]methyl}(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β- alanine;
N-[2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]-β-alanine;
3-({2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-[(phenylmethyl)amino]-4- pyrimidinyl} amino) propanoic acid;
3-({2-(4-{3-[(2-aminoethyl)amino]propyl}-2-pyridinyl)-6-[(phenylmethyl)amino]-4- pyrimidinyl}amino)propanoic acid;
3-{[2-{4-[3-(methylamino)propyl]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]amino}propanic acid;
3-{[6-{[3-(methylamino)-3-oxopropyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]amino) propanoic acid;
N-[6-[(2-carboxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanyl-Nl- methylglycinamide;
N-[6-({2-[3-(β-alanylamino)phenyl]ethyl}amino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(2,6-dimethylphenyl)methyl]amino}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine
N-[2-{4-[(2-hydroxyethyl)amino]-2-pyridinyl}-6-(1,2,4,5-tetrahydro-3 H-3-benzazepin-3- yl)-4-pyrimidinyl]-β-alanine;
N-{2-(2-pyridinyl)-6-[4-(1-pynOlidinylcarbonyl)-1-piperidinyl]-4-pyrimidinyl}-β-alanine;
N-[6-(cyclohexylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{4-[(dimethylamino)carbonyl]-1-piperidinyl}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine; 3 - { [6- {methyl [3 -(methylamino)-3 -oxopropyl] amino } -2-(2-pyridinyl)-4- pyrimidinyl]amino}propanoic acid;
N-[6-{ [(3, 4-di chi orophenyl {methyl ]oxy }-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(1-phenylethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-{[(3-chlorophenyl)methyl]oxy}-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-naphthalenylmethyl)oxy]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine;
N-[6-(1-methylethyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine,
N-[2-(2-pyridinyl)-6-(trifluoromethyl)-4-pyrimidinyl]-β-alanine;
N-[6-(4-morpholinyl)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(methylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1-pyrrolidinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-hydroxyethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(phenylmethyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-[(2-hydroxyethyl)(methyl)amino]-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[6-(dimethylamino)-2-(2-pyridinyl)-4-pyrimidinyl]-β-alanine;
N-[2-(2-pyridinyl)-6-(1,2,4,5-tetrahydro-3H-3-benzazepin-3-yl)-4-pyrimidinyl]-β-alanine; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
X is -(R1)0-1-(R2)0-1-R3 or -R1-R4; each R is independently NH, N(CH3), or O;
R2 is a linker group with a maximum length of 5 atoms between R and R3 and is selected from: -CO-C1-6alkyl-, -CO-, -CO-C1-6alkyl-O-, -CO- C1-6alkyl-S-, -CO- C1-6alkyl-O-
C1-6alkyl-, -C1-3alkyl-, -C1-3alkyl-O-, -C1-5alkyl-S02-, -C1-3alkyl-NH-CO-, or -C1-3alkyl-C3- 8cycloalkyl-C1-3alkyl-0-; wherein each alkyl is straight chain or branched and may be optionally substituted by one or more substituents independently selected from phenyl or -OH;
R3 is selected from: a C6-12 mono or bicyclic aryl group, (each of which may be optionally substituted one or more times by substituents independently selected from halo, C1-6alkyl, Ci- 6haloalkyl, C1-6alkoxy, NHCOC1-3alkyl, -O-phenyl, -CH2-phenyl, phenyl (optionally substituted by C1-3alkyl), OH, NH2, CONH2, CN, -NHCOC1-3alkylNH2, -NHCOC1-3alkyl, NHCOOC1-3alkyl, -NHSO2C1-3alkyl, -SO2C1-3alkyl or
a 5-12 membered mono or bicyclic heteroaryl group (optionally substituted by one or more substituents independently selected from phenyl, CH2phenyl, -C1-6 alkyl, -oxo), a 5- or 6-membered heterocyclic group containing one or more heteromoieties independently selected from N, S, SO, SO2 or O and optionally fused to a phenyl group (optionally substituted by one or more substituents independently selected from phenyl, CH2phenyl, C1-3alkyl) or a 3-7 membered cycloalkyl (including bridged cycloalkyl) and optionally fused to a phenyl group (and optionally substituted by one or more substituents independently selected from OH, phenyl, -CH2 phenyl),
R4 is selected from: C1-6 straight chain or branched alkyl (optionally substituted by NH2), or COCi-8 straight chain or branched alkyl; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
12. The method of claim 11, wherein X is not: -NHCO-tert butyl; -NHCO-isobutyl; - OCH2phenyl; 4-pyridylmethylamino; -NHphenyl; or -NHcyclohexyl.
13. The method of claim 11, wherein the small molecule drug is at least one of the following:
3-{[(4-chlorophenyl)acetyl]amino}-4-pyridinecarboxylic acid;
3-{[(4-methylphenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-[(3-phenylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylcarbonyl)amino]-4-pyridinecarboxylic acid; 3-[(2,2-dimethylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-{[(phenyloxy)acetyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(4-methylphenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-[(2-naphthalenylacetyl)amino]-4-pyridinecarboxylic acid; 3-{[4-(2-naphthalenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{ [4-(4-bromophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[4-(3,4-dichlorophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-{[(3,4-dichlorophenyl)acetyl]amino}-4-pyridinecarboxylic acid; 3-({4-[3-(acetylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-{[4-(4-pyridinyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-[(2-methyl-4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(phenyloxy)propanoyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(phenylthio)propanoyl]amino}-4-pyridinecarboxylic acid; 3-({[3,4-bis(methyloxy)phenyl]acetyl}amino)-4-pyridinecarboxylic acid; 3-[(3,4-dihydro-2(lH)-isoquinolinylacetyl)amino]-4-pyridinecarboxylic acid; 3-[(1,3-dihydro-2H-isoindol-2-ylacetyl)amino]-4-pyridinecarboxylic acid; 3-[(2-phenylpropanoyl)amino]-4-pyridinecarboxylic acid; 3-({4-[3-(methyloxy)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; 3-[(2-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(2-phenylpropyl)amino]-4-pyridinecarboxylic acid; 3-[(phenylmethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methyl-2-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(4-phenylbutyl)oxy]-4-pyridinecarboxylic acid; 3-{[3-(2-naphthalenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-{[3-(trifluoromethyl)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-({3-[(3-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; 3-{[3-(7-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(5-quinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid;
3 - { [3 -(4-biphenylyloxy)propyl]amino} -4-pyridinecarboxylic acid;
3-{ [4-(3-aminophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; 3-(3-phenylpropyl)-4-pyridinecarboxylic acid;
-({3-[(2-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; -[(3-phenylpropyl)amino]-4-pyridinecarboxylic acid; -{[4-(3-hydroxyphenyl)butanoyl]amino}-4-pyridinecarboxylic acid; -i [4-(4-hydroxy phenyl )butanoy ljamino} -4-pyridinecarboxy lie acid; -[(4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; -[(phenylacetyl)amino]-4-pyridinecarboxylic acid; -(hexanoylamino)-4-pyridinecarboxylic acid; -({[(phenylmethyl)oxy]acetyl}amino)-4-pyridinecarboxylic acid; -[(2-methylpropanoyl)amino]-4-pyridinecarboxylic acid; -[(3,3-dimethylbutanoyl)amino]-4-pyridinecarboxylic acid; -[(5-phenylpentanoyl)amino]-4-pyridinecarboxylic acid; -({4-[4-(methyloxy)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; -{[4-(4-chlorophenyl)butanoyl]amino}-4-pyridinecarboxylic acid; -[(4-phenylbutyl)amino]-4-pyridinecarboxylic acid; -[(1-methyl-4-phenylbutyl)amino]-4-pyridinecarboxylic acid; -({3-[(4-chlorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; -[(2-aminoethyl)amino]-4-pyridinecarboxylic acid; -({2-[(phenylcarbonyl)amino]ethyl}amino)-4-pyridinecarboxylic acid; -{[3-(phenyloxy)propyl]amino}-4-pyridinecarboxylic acid; -{[2-(2-naphthalenyl)ethyl]amino}-4-pyridinecarboxylic acid; -{[(1-phenyl-1H-pyrazol-4-yl)methyl]amino}-4-pyridinecarboxylic acid; -{[2-(4-bromophenyl)ethyl]amino}-4-pyridinecarboxylic acid; -{[2-hydroxy-3-(phenyloxy)propyl]amino}-4-pyridinecarboxylic acid; -[(4-phenylpentyl)amino]-4-pyridinecarboxylic acid; -[({l-[(phenyloxy)methyl]cyclopropyl}methyl)amino]-4-pyridinecarboxylic acid;-{[3-(phenylsulfonyl)propyl]amino}-4-pyridinecarboxylic acid; -{[(1-phenyl-3-pyrrolidinyl)methyl]amino}-4-pyridinecarboxylic acid; -[(diphenylmethyl)amino]-4-pyridinecarboxylic acid; -({[1-(phenylmethyl)-3-pyrrolidinyl]methyl}amino)-4-pyridinecarboxylic acid;-[methyl(phenylmethyl)amino]-4-pyridinecarboxylic acid; -{[2-(4-biphenylyl)ethyl]amino}-4-pyridinecarboxylic acid; -[(2,4-diphenylbutyl)amino]-4-pyridinecarboxylic acid; -{[(1-phenyl-1H-pyrazol-4-yl)methyl]amino}-4-pyridinecarboxylic acid; -{[1-(phenylmethyl)-1H-pyrazol-4-yl]amino}-4-pyridinecarboxylic acid;
-({3-[(2-oxo-1,2,3,4-tetrahydro-6-quinolinyl)oxy]propyl}amino)-4-pyridinecarboxylic acid;-{[1-(phenylmethyl)-l H-1,2,4-triazol-3-yl]amino}-4-pyridinecarboxylic acid; -[(l S,4R)-bicyclo[2.2.1 ]hept-2-ylamino]-4-pyridinecarboxylic acid; -[(tetrahydro-2H-pyran-2-ylmethyl)amino]-4-pyridinecarboxylic acid; -{[(2-cyanophenyl)methyl]amino}-4-pyridinecarboxylic acid; -[(4-pyridinylmethyl)amino]-4-pyridinecarboxylic acid; -({ [ 1 -(phenylmethyl)- lH-pyrazol-4-yl]methyl } amino)-4-pyridinecarboxylic acid; -{[3-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; -(2,3-dihydro-1H-inden-1-ylamino)-4-pyridinecarboxylic acid; -[(2-pyridinylmethyl)amino]-4-pyridinecarboxylic acid; -(3-biphenylylamino)-4-pyridinecarboxylic acid; -{[3-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; -{[(3-cyanophenyl)methyl]amino}-4-pyridinecarboxylic acid; -({[2-(acetylamino)phenyl]methyl}amino)-4-pyridinecarboxylic acid; -[(cyclohexylmethyl)amino]-4-pyridinecarboxylic acid; -({4-[4-(β-alanylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; -[(4-{3-[(N-{[(1,1-dimethylethyl)oxy]carbonyl}-b-alanyl)amino]phenyl}butanoyl)amino]-4- pyridinecarboxylic acid; -({4-[3-(β-alanylamino)phenyl]butanoyl}amino)-4-pyridinecarboxylic acid; -{[(lS,2R)-2-hydroxy-2,3-dihydro-1H-inden-1-yl]amino}-4-pyridinecarboxylic acid; -[(3-biphenylylmethyl)amino]-4-pyridinecarboxylic acid; -[(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)amino]-4-pyridinecarboxylic acid; -{[(1-phenylcyclohexyl)methyl]amino}-4-pyridinecarboxylic acid; -{[4-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; -(2-pyridinylamino)-4-pyridinecarboxylic acid; -{[(2'-methyl-2-biphenylyl)methyl]amino}-4-pyridinecarboxylic acid; -{[2-(phenylmethyl)phenyl]amino}-4-pyridinecarboxylic acid; -[(4-phenylcyclohexyl)amino]-4-pyridinecarboxylic acid; -(2-biphenylylamino)-4-pyridinecarboxylic acid; -{[4-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; -{[2-(aminocarbonyl)phenyl]amino}-4-pyridinecarboxylic acid; -[(2,2,6,6-tetramethyl-4-piperidinyl)amino]-4-pyridinecarboxylic acid; -(1,3-dihydro-2H-isoindol-2-yl)-4-pyridinecarboxylic acid; -(4-phenyl- l-piperazinyl)-4-pyridinecarboxylic acid;
-(1,2,3,4-tetrahydro-1-naphthalenylamino)-4-pyridinecarboxylic acid; -({[1-(phenylmethyl)-3-piperidinyl]methyl}amino)-4-pyridinecarboxylic acid; -[(4-biphenylylmethyl)amino]-4-pyridinecarboxylic acid; -(2, 3 -dihydro- 1 H-inden-2-ylamino)-4-pyridinecarboxylic acid; -[(1-cyclohexylethyl)amino]-4-pyridinecarboxylic acid; -[(1,1-dimethylethyl)amino]-4-pyridinecarboxylic acid; 3-[(3-{[3-(1-piperazinyl)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; -{[3-(6-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; -{[3-(3-pyridinyloxy)propyl]amino}-4-pyridinecarboxylic acid; -[(3-{ [3-(methyloxy)phenyl]oxy }propyl)amino]-4-pyridinecarboxylic acid; -({3-[(3-fluorophenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid; -[(3-{[3-(phenyloxy)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; -[(cyclopropylmethyl)amino]-4-pyridinecarboxylic acid; -[(3-thienylmethyl)amino]-4-pyridinecarboxylic acid; -{[(3-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; -[(1H-imidazol-4-ylmethyl)amino]-4-pyridinecarboxylic acid; -[(1-methylethyl)amino]-4-pyridinecarboxylic acid; -{[(lR)-1-(2-methylphenyl)butyl]amino}-4-pyridinecarboxylic acid; -[(lH-pyrazol-5-ylmethyl)amino]-4-pyridinecarboxylic acid; -{[(1-methylcyclohexyl)methyl]amino}-4-pyridinecarboxylic acid; -{[(5-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; -[(2-furanylmethyl)amino]-4-pyridinecarboxylic acid; -{[(lS)-1-(2-methylphenyl)butyl]amino}-4-pyridinecarboxylic acid; -(cyclobutylamino)-4-pyridinecarboxylic acid; -[(2-cyclopentyl-1-methylethyl)amino]-4-pyridinecarboxylic acid; -{[(2,4-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; -[(2-thienylmethyl)amino]-4-pyridinecarboxylic acid; -{[(2,3-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; -[(cyclopentyl methyl )amino]-4-pyridinecarboxy lie acid; -{[(2,5-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; -{[(3-pentyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; -{[(4-methyl-2-thienyl)methyl]amino}-4-pyridinecarboxylic acid; -{[(2,6-dimethylphenyl)methyl]amino}-4-pyridinecarboxylic acid; -{[3-({3-[(methylsulfonyl)amino]phenyl}oxy)propyl]amino}-4-pyridinecarboxylic acid;
3-[(3-{ [3 -(methyl sulfonyl )phenyl ]oxy } propyl )amino]-4-pyridinecarboxylic acid; 3-({3-[(3-methylphenyl)oxy]propyl}amino)-4-pyridinecarboxylic acid;
3-{[3-(2-oxo-l (2H)-pyridinyl)propyl]amino}-4-pyridinecarboxylic acid; 3-[(4-cyclohexylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-{[3-(2-pyridinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-{[4-(aminocarbonyl)phenyl]oxy}propyl)amino]-4-pyridinecarboxylic acid; 3-{[3-({4-[(methylsulfonyl)amino]phenyl}oxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(8-isoquinolinyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-{[3-(1-naphthalenyloxy)propyl]amino}-4-pyridinecarboxylic acid; 3-[(3-aminopropyl)amino]-4-pyridinecarboxylic acid; 3-[(cyclobutylmethyl)amino]-4-pyridinecarboxylic acid; 3-(propylamino)-4-pyridinecarboxylic acid; 3-[methyl(4-phenylbutanoyl)amino]-4-pyridinecarboxylic acid; 3-({2-[2-(methyloxy)phenyl]ethyl}amino)-4-pyridinecarboxylic acid; 3-[(2-methylpropyl)amino]-4-pyridinecarboxylic acid; 3-(methylamino)-4-pyridinecarboxylic acid;
3-(butylamino)-4-pyridinecarboxylic acid; 3-[(2-cyclohexylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-methyl-1-phenylethyl)amino]-4-pyridinecarboxylic acid; 3-(cyclopentylamino)-4-pyridinecarboxylic acid; 3-(cyclohexylamino)-4-pyridinecarboxylic acid; 3-[(2-cyclopentylethyl)amino]-4-pyridinecarboxylic acid; 3-[(2-cyclohexyl-1,1-dimethylethyl)amino]-4-pyridinecarboxylic acid; 3-[(1-cyclohexyl-1-methylethyl)amino]-4-pyridinecarboxylic acid; 3-[(4-{3-[(N-{5-[(3aS,4S,6aR)-2-oxohexahydro-l H-thieno[3,4-d]imidazol-4- yl]pentanalanyl)amino]phenyl}butanoyl)amino]-4-pyridinecarboxylic acid; 3-{[(lR,2S)-1-hydroxy-2,3-dihydro-l H-inden-2-yl]amino}-4-pyridinecarboxylic acid; 3-[(1-cyclohexylcyclopropyl)amino]-4-pyridinecarboxylic acid; 3-({2-[4-(2-thienyl)phenyl]ethyl}amino)-4-pyridinecarboxylic acid; 3-{[(2,4-difluorophenyl)carbonyl]amino}-4-pyridinecarboxylic acid; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
14. A method for treating, ameliorating, and/or preventing SARS-CoV-2 infection, and/or one or more complications thereof, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of a molecule in the S witch/ Sucrose Non-Fermentable (SWI/SNF) complex.
15. The method of claim 14, wherein the molecule in the SWI/SNF complex is at least one selected from the group consisting of SMARCA4, DPF2, ARIDIA, SMARCE1, and SMARCEB 1.
16. The method of claim 14, wherein the inhibitor is at least one selected from the group consisting of a small molecule drug, an antibody, a miRNA, a CRISPR system, a RNAi, a shRNA, a nanobody, a recombinant protein, a ligand, and a receptor decoy.
17. The method of claim 16, wherein the small molecule drug is at least one of the following:
PFI-3 ((E)-1-(2-Hydroxyphenyl)-3-((lR,4R)-5-(pyridin-2-yl)-2,5-diazabicyclo[2.2.1]heptan- 2-yl)prop-2-en- 1 -one); a compound of formula:
wherein:
R1 is H, amino, or hydroxy-substituted C1-C2 alkyl,
R2 is H,
R3 is C1-C2 alkyl and halogen- substituted C1-C2 alkyl,
R4 is hydrogen,
R5 is H, F, Cl, Br, or I, and R6 is H, F, Cl, Br, or I; or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
18. The method of claim 17, wherein R1 is H, amino, or hydroxymethyl.
19. The method of claim any one of claims 17-18, wherein R3 is methyl, difluoromethyl or trifluorom ethyl.
20. The method of claim any one of claims 17-19, wherein R5 is H, Cl, or Br.
21. The method of claim any one of claims 17-20, wherein R6 is H or F.
22. The method of claim any one of claims 17-21, wherein the small molecule drug is: 1-(2-chloropyridin-4-yl)-3-(3-methylisothiazol-5-yl)urea, 1-(2-chloropyridin-4-yl)-3-(3-(trifluoromethyl)isothiazol-5-yl)urea, 1-(2-chloropyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(5-amino-2-chloropyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(2-chloro-5-(hydroxymethyl)pyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(2-fluoro-5-(hydroxymethyl)pyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(5-amino-2-fluoropyridin-4-yl)-3-(3-(difluoromethyl)isothiazol-5-yl)urea, 1-(3-(difluoromethyl)isothiazol-5-yl)-3-(2-fluoro-3-(hydroxymethyl)pyridin-4-yl)urea, or a salt, solvate, tautomer, geometric isomer, and/or any mixtures thereof.
23. A method of treating, ameliorating, and/or preventing SARS-CoV-2 infection, and/or one or more complications thereof, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of at least one of the following drugs:
INDY ((1Z)-1-(3-Ethyl-5-hydroxy-2(3H)-benzothiazolylidene)-2-propanone);
Leucettine L41 ((5Z)-5-(1,3-Benzodioxol-5-ylmethylene)-3,5-dihydro-2-(phenylamino)-4H- imidazol-4-one);
CX-4945 (Silmitasertib or 5-(3-Chloroanilino)benzo[c][2,6]naphthyridine-8-carboxylic acid); Harmine (7-Methoxy-1 -methyl -9H-pyrido[3,4-b]-indole);
TBB (4,5,6,7-Tetrabromobenzotriazole);
I-BET151 (GSK1210151A or 7-(3,5-Dimethyl-1,2-oxazol-4-yl)-8-methoxy-1-[(lR)-1- pyridin-2-ylethyl]-3H-imidazo[4,5-c]quinolin-2-one);
ML-385 (N-[4-[2,3-Dihydro-1-(2-methylbenzoyl)-1H-indol-5-yl]-5-methyl-2-thiazolyl]-1,3- b enzodi oxol e- 5 -acetami de) ;
A 83-01 (3-(6-Methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1- carbothioamide);
PR-619 (2,6-Diamino-3,5-dithiocyanatopyridine);
Calpain Inhibitor III (MDL 28170, or Benzyl N-[(2S)-3-methyl-1-oxo-1-[(1-oxo-3- phenylpropan-2-yl)amino]butan-2-yl]carbamate); or a salt, solvate, tautomer, enantiomer, diastereoisomer, geometric isomer, and/or any mixtures thereof.
24. A method of treating, ameliorating, and/or preventing SARS-CoV-2 infection, and/or one or more complications thereof, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of a molecule selected from the group consisting of ACE2, DYRK1 A, SMARCA4, KDM6A, JMJD6, RAD54L2, DPF2, UBXN7, ARID 1 A, SMAD4, SH3Y11, PHIP, LDB1, SMARCEl, CTSL, ZNF628, RYBP, TMX3, HMGB1, SPTY2D1, ACVR1B, EIF3C, SERTAD4, CREBBP, SMAD3, TCEB3, SIAH1, BCBD1, and PKMYT1.
25. The method of any of claims 1-24, wherein the subject is a mammal.
26. The method of claim 25, wherein the mammal is human.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063033301P | 2020-06-02 | 2020-06-02 | |
| US63/033,301 | 2020-06-02 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021247367A1 true WO2021247367A1 (en) | 2021-12-09 |
Family
ID=78831474
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/034536 Ceased WO2021247367A1 (en) | 2020-06-02 | 2021-05-27 | Compounds and compositions for treating, ameliorating, and/or preventing sars-cov-2 infection and/or complications thereof |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2021247367A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210308110A1 (en) * | 2020-03-30 | 2021-10-07 | Senhwa Biosciences, Inc. | Antiviral compounds and method for treating rna viral infection, particularly covid-19 |
| WO2023195509A1 (en) * | 2022-04-08 | 2023-10-12 | 国立大学法人京都大学 | Vascular endothelial barrier failure inhibitor and use thereof |
| JP2023147179A (en) * | 2022-03-29 | 2023-10-12 | 大日精化工業株式会社 | Antiviral agent, antiviral resin composition, and antiviral article |
-
2021
- 2021-05-27 WO PCT/US2021/034536 patent/WO2021247367A1/en not_active Ceased
Non-Patent Citations (4)
| Title |
|---|
| ALHELFAWI MOHAMED ALI: "Potential Approach for Fighting Against Corona Virus Disease", AMERICAN SCIENTIFIC RESEARCH JOURNAL FOR ENGINEERING, TECHNOLOGY, AND SCIENCES (ASRJETS, vol. 66, no. 1, 12 March 2020 (2020-03-12), pages 127 - 144, XP055883810 * |
| DATABASE PubChem Compounds 15 September 2005 (2005-09-15), "4-(4-(benzo[d][1,3]dioxol-5-yl)-5-(pyridin-2-yl)-1H-imidazol-2-yl)benzamide", XP055883816, retrieved from ncbi Database accession no. CID 4521392 * |
| YANG SHENGJIE, LI XINYE, YANG FAN, ZHAO RAN, PAN XIANDU, LIANG JIAQI, TIAN LI, LI XIAOYA, LIU LONGTAO, XING YANWEI, WU MIN: "Gut Microbiota-Dependent Marker TMAO in Promoting Cardiovascular Disease: Inflammation Mechanism, Clinical Prognostic, and Potential as a Therapeutic Target", FRONTIERS IN PHARMACOLOGY, FRONTIERS RESEARCH FOUNDATION, CH, vol. 10, 19 November 2019 (2019-11-19), CH , XP055882084, ISSN: 1663-9812, DOI: 10.3389/fphar.2019.01360 * |
| ZHAO XINGANG, JOHN M.NICHOLLS, YE-GUANGCHEN: "Severe Acute Respiratory Syndrome-associated Coronavirus Nucleocapsid Protein Interacts with Smad3 and Modulates Transforming Growth Factor-beta Signaling", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 283, no. 6, 1 February 2018 (2018-02-01), pages 3272 - 3280, XP055883806 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210308110A1 (en) * | 2020-03-30 | 2021-10-07 | Senhwa Biosciences, Inc. | Antiviral compounds and method for treating rna viral infection, particularly covid-19 |
| US11696911B2 (en) * | 2020-03-30 | 2023-07-11 | Senhwa Biosciences, Inc. | Antiviral compounds and method for treating RNA viral infection, particularly COVID-19 |
| JP2023147179A (en) * | 2022-03-29 | 2023-10-12 | 大日精化工業株式会社 | Antiviral agent, antiviral resin composition, and antiviral article |
| JP7793505B2 (en) | 2022-03-29 | 2026-01-05 | 大日精化工業株式会社 | Antiviral agent, antiviral resin composition, and antiviral article |
| WO2023195509A1 (en) * | 2022-04-08 | 2023-10-12 | 国立大学法人京都大学 | Vascular endothelial barrier failure inhibitor and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wei et al. | Genome-wide CRISPR screens reveal host factors critical for SARS-CoV-2 infection | |
| Nilsson-Payant et al. | The NF-κB transcriptional footprint is essential for SARS-CoV-2 replication | |
| Comar et al. | Antagonism of dsRNA-induced innate immune pathways by NS4a and NS4b accessory proteins during MERS coronavirus infection | |
| Frolova et al. | Functional Sindbis virus replicative complexes are formed at the plasma membrane | |
| Bergant et al. | Attenuation of SARS‐CoV‐2 replication and associated inflammation by concomitant targeting of viral and host cap 2'‐O‐ribose methyltransferases | |
| JP2024515348A (en) | Therapeutic interfering particles against coronaviruses | |
| JP7203682B2 (en) | Methods of treating intracellular infections | |
| Salter et al. | Regulation of antiviral innate immunity through APOBEC ribonucleoprotein complexes | |
| Yanai et al. | ADAR2 is involved in self and nonself recognition of Borna disease virus genomic RNA in the nucleus | |
| Ohlson et al. | Genome-scale CRISPR screening reveals host factors required for ribosome formation and viral replication | |
| Karousis et al. | Coronavirus takeover of host cell translation and intracellular antiviral response: a molecular perspective | |
| Wang et al. | Inhibition of lysosome-tethered Ragulator-Rag-3D complex restricts the replication of Enterovirus 71 and Coxsackie A16 | |
| Fan et al. | Coronavirus S protein alters dsRNA accumulation and stress granule formation through regulation of ADAR1-p150 expression | |
| Razzaq et al. | Stabilization of RNA G-quadruplexes in the SARS-CoV-2 genome inhibits viral infection via translational suppression | |
| JP2025072454A (en) | Method for inhibiting viral infection and activity | |
| Moshiri et al. | A targeted computational screen of the SWEETLEAD database reveals FDA-approved compounds with anti-dengue viral activity | |
| Davies et al. | Alternative splicing broadens antiviral diversity at the human OAS2 locus | |
| Real-Hohn et al. | Targeting G-quadruplexes in the rhinovirus genome by Pyridostatin inhibits uncoating and highlights a critical role for sodium ions. | |
| Hao et al. | NSUN2‑mediated epitranscriptomic and ubiquitin modulation of Nipah virus matrix protein reveals a dual-targeting antiviral strategy | |
| Khanlari et al. | HCV NS3 blocking effect on IFN induced ISGs like Viperin and IL28 with and without NS4A | |
| Fausto et al. | Human alphacoronavirus replication and innate immune induction in airway culture systems | |
| Sáenz Altamirano et al. | Coronavirus NSP14 Drives Internal m7G Modification to Rewire Host Splicing and Promote Viral Replication | |
| Verma et al. | TGF-β inhibitor SB431542 suppresses SARS-CoV-2 replication through multistep inhibition | |
| Lin et al. | Involvement of L polymerase and heat shock proteins in the biogenesis of viral circular RNAs derived from respiratory syncytial virus | |
| Richardson | Characterization of the Antiviral Effector IFI6 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21818463 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 21818463 Country of ref document: EP Kind code of ref document: A1 |



























