WO2021243328A1 - Methods of using hsv-2 single cycle virus delta-gd and hsv-2 recombinant glycoprotein d - Google Patents

Methods of using hsv-2 single cycle virus delta-gd and hsv-2 recombinant glycoprotein d Download PDF

Info

Publication number
WO2021243328A1
WO2021243328A1 PCT/US2021/035168 US2021035168W WO2021243328A1 WO 2021243328 A1 WO2021243328 A1 WO 2021243328A1 US 2021035168 W US2021035168 W US 2021035168W WO 2021243328 A1 WO2021243328 A1 WO 2021243328A1
Authority
WO
WIPO (PCT)
Prior art keywords
hsv
infection
glycoprotein
subject
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/035168
Other languages
French (fr)
Inventor
Betsy C. Herold
Clare Burn ASCHNER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Albert Einstein College of Medicine
Original Assignee
Albert Einstein College of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Albert Einstein College of Medicine filed Critical Albert Einstein College of Medicine
Priority to IL298288A priority Critical patent/IL298288B2/en
Priority to KR1020227045772A priority patent/KR20230044365A/en
Priority to CA3184459A priority patent/CA3184459A1/en
Priority to AU2021281314A priority patent/AU2021281314A1/en
Priority to JP2022573260A priority patent/JP7840572B2/en
Publication of WO2021243328A1 publication Critical patent/WO2021243328A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/245—Herpetoviridae, e.g. herpes simplex virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5254—Virus avirulent or attenuated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505—Inorganic adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55572—Lipopolysaccharides; Lipid A; Monophosphoryl lipid A
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16621—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16634—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16671—Demonstrated in vivo effect

Definitions

  • HSV-1 Herpes simplex vims 1
  • HSV-2 herpes simplex virus 2
  • HSV- 1 infects approximately 67% of the population by 49 years of age and is the primary cause of oral and ocular disease, a leading cause of infectious comeal blindness and fatal infectious encephalitis, and has emerged as the more common cause of genital disease in the developed world (Looker, K. J. et al., PLoS ONE 2015, 10, el 14989-23; Lafferty, W. E. et al, Journal of Infectious Diseases 2000, 181, 1454-1457; Roberts, C. M.
  • HSV-2 is estimated to over 400 million people worldwide, is the primary cause of genital disease in the developing world and a major risk factor for HIV acquisition and transmission (Looker, K. J. et al., PLoS ONE 2015, 10, el 14989-23).
  • nAbs neutralizing antibodies
  • gD-2 protein vaccine formulated with a proprietary aluminum hydroxide (alum) and monophosphoryl lipid A adjuvant, gD-2- AS04 (GlaxoSmithKline).
  • HSV-2 replication- defective HSV-2 strain deleted in two genes involved in viral replication (UL5 and UL29), designated dl5-29 (HSV529, Sanofi Pasteur) (Dropulic, L. K., et al, Journal of Infectious Diseases 2019, 220, 990-1000).
  • the vaccine was safe, induced nAb and T cell responses and reduced the establishment of latency in the peripheral nerves (Da Costa, X. J. E. A., et ah, J. Virol. 2000, 74, 7963-7971; Da Costa, X. J. E.
  • the Phase I study also found that the vaccine was safe and elicited a >4-fold increase in nAb responses in HSV seronegative participants, but no sustained increase in nAb responses in seropositive participants. Moreover, only a subset of participants elicited significant CD4 and even fewer CD8 T cell responses (Dropulic, L. K., et ah, Journal of Infectious Diseases 2019, 220, 990-1000).
  • a single-cycle HSV-2 strain deleted in glycoprotein D has been developed to generate a single-cycle candidate HSV-2 vaccine strain designated ⁇ gD-2.
  • this vaccine strain ⁇ gD-2, elicited high-titer non-neutralizing Abs that activate Fc gamma receptors (FcyRs) to induce antibody-dependent cell-mediated cytotoxicity (ADCC).
  • FcyRs Fc gamma receptors
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • ⁇ gD-2 boosted the total and the ADCC Ab responses in HSV-1 seropositive mice and prevented subsequent lethal HSV-2 superinfection (Bum Aschner, C., et ah, npj Vaccines 2020, 1-33).
  • a method of vaccinating a subject against a herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprising administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to vaccinate the subject for the HSV-2 infection or the disease caused by the HSV-2 infection, wherein the HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • a method of immunizing a subject against herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprising administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to immunize the subject for the HSV-2 infection or the disease caused by the HSV-2 infection, wherein the HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • a method of treating or preventing an HSV-2 infection in a subject or treating or preventing a disease caused by an HSV-2 infection in a subject comprising administering to the subject an effective amount of an HSV- single-cycle virus 2 and an effective amount of a recombinant HSV-2 glycoprotein D to treat or prevent the HSV-2 infection or the disease caused by the HSV-2 infection in the subject, wherein the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • FIGs 1 A- II Immunogenicity of viral and adjuvanted subunit HSV vaccines is modulated by vaccination route.
  • Female C57BL/6 mice were vaccinated twice, three weeks apart with 5 x 10 4 , 5 x 10 5 or 5 x 10 6 pfu/mouse of dl5-29 or ⁇ gD-2 or 5 ⁇ g gD-2-Alum/MPL subcutaneously (sc), intramuscularly (im) or intradermally (id).
  • mice were retro-orbitally bled and serum was tested for (Figs. 1A-C) total HSV- specific IgG by ELISA, (Figs.
  • Asterisks denote significance, * p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001, **** p ⁇ 0.0001 by ANOVA.
  • FIG. 2A-2J Differences in immunogenicity based on vaccine dose and route translate to differences in protection.
  • Female C57BL/6 mice were vaccinated twice, three weeks apart with 5 x 10 4 , 5 x 10 5 or 5 x 10 6 pfu/mouse of d.15-29 or ⁇ gD-2 or 5 ⁇ g gD-2-Alum/MPL subcutaneously (sc), intramuscularly (im) or intradermally (id).
  • mice were challenged on the skin with 10 x LD90 HSV-2 SD90. Disease scores over time are shown for gD-2-Alum/MPL (Fig. 2A), dl5-29 (Figs.
  • Figs. 2D-2J Percentage survival is shown in Figs. 2D-2J.
  • FIG. 3A-3C HSV DNA detection in the sacral nerve parallels survival data.
  • Female C57BL/6 mice vaccinated with 5 ⁇ g rgD-2-Alum/MPL, or 5 x 10 5 pfu/mouse of dl5-29 or ⁇ gD-2 by the sc, im or id routes were challenged in the skin with 10 x LD90 HSV-2 SD90. Following challenge, mice were monitored daily for fourteen days and sacral nerve tissue was harvested at the time of death for mice that succumbed to challenge, or at D14 post challenge for surviving animals.
  • HSV DNA in the sacral ganglia was assessed by qPCR and the number of copies of HSV-2 DNA per 10 ng of DNA is shown in (Fig.
  • FIGs 4A-4D Kinetics of the T cell response following HSV vaccination.
  • Female C57BL/6 mice were vaccinated i.m. twice, three weeks apart, with 5 x 10 5 pfu/mouse of ⁇ gD-2 or 5 ⁇ g gD-2-alum/MPL.
  • mice were retro-orbitally bled and assessed for CDlla + CD49d + activated CD4 and CD8 T cells.
  • FIGs. 4C-D Gating strategy is shown for the assessment of CD4 and CD8 T cell activation (Figs. 4A-B).
  • FIG. 5A-5G Figures 5A-5G.
  • ⁇ gD-2 vaccination induces polyfunctional CD4 and CD8 T cells that produce IFN-g, TNF and IL-2 in response to HSV-2 stimulation.
  • Female C57BL/6 mice were vaccinated i.m twice, three weeks apart, with 5 x 10 5 pfu/mouse of ⁇ gD-2 and 5 ⁇ g gD-2- alum/MPL.
  • Splenocytes from vaccinated mice were collected two weeks following boost vaccination and stimulated with PHA or UV-inactivated HSV-2 SD90 for 18 hours with Brefeldin A treatment before staining and flow cytometric analysis for the production of IFN-g, TNF and IL-2.
  • Gating strategy is shown in (Fig.
  • FIGs 6A-6D The generation of neutralizing antibody enhances protection by low-dose ⁇ gD-2.
  • Female C57BL/6 mice were subcutaneously vaccinated twice, three weeks apart with 5 x 10 4 pfu/mouse of ⁇ gD-2, 5 ⁇ g gD-2-Alum/MPL or a combination of both vaccines delivered on opposite flanks (opposite) or at the same site (same).
  • mice were retro-orbitally bled and serum was assessed for total HSV- specific IgG by ELISA (Fig. 6A), neutralizing titer (Fig. 6B), and FcyRIV activation (Fig. 6C).
  • A-C *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001 by ANOVA. For survival curves, * p ⁇ 0.05, *** p ⁇ 0.001 by Gehan Breslow Wilcoxon test.
  • Vaccine immunogenicity is impacted by how the viral antigens are presented by the vaccine (attenuated, replication-defective, single-cycle, inactivated vims, or adjuvanted subunit protein), as well as the dose and route of administration.
  • the immunization route is often based on pragmatic rather than immunologic considerations.
  • ⁇ gD-2 co-administration of ⁇ gD-2 and recombinant HSV-2 glycoprotein D (rgD-2) does not interfere with the immunogenicity of either vaccine.
  • administration of adjuvanted rgD-2 and a relatively low dose of ⁇ gD-2 delivered simultaneously to the same or opposite flank does not interfere with the immunogenicity of either vaccine and is more protective than the adjuvanted rgD-2 alone.
  • the combination of low dose ⁇ gD-2 with rgD-2 provides additive protection.
  • terapéuticaally effective amount or “effective amount” or “amount effective” refers to a quantity of a specific substance sufficient to achieve a desired effect in a subject.
  • “Treat” or “treating,” means to administer a vaccine of the disclosure or a product of the disclosure to a subject or patient having one or more disease symptoms, or being suspected of having a disease, for which the vaccine or product has therapeutic activity or prophylactic activity.
  • the vaccine or product can be administered in an amount effective to alleviate one or more disease symptoms in the treated subject, whether by inducing the regression of or inhibiting the progression of such symptom(s) by any clinically measurable degree.
  • the terms further includes a postponement of development of the symptoms associated with a disorder and/or a reduction in the severity of the symptoms of such disorder.
  • the terms further include ameliorating existing uncontrolled or unwanted symptoms, preventing additional symptoms, and ameliorating or preventing the underlying causes of such symptoms.
  • Preventing means administering an amount of a vaccine of the disclosure or a product of the disclosure sufficient to significantly reduce the likelihood of a disease from occurring in a subject who may be predisposed to the disease but who does not have it.
  • preventing includes administering an amount of the vaccine or an immune product resulting from administration of the vaccine to a subject known to be at enhanced risk of viral infection.
  • adjuvant means any component added to a vaccine that augments, enhances and/or boosts the immune response to an antigen, but when the administered alone does not generate an immune response.
  • HSV infection is a herpes simplex virus-2 (HSV-2) infection, a herpes simplex virus- 1 (HSV-1) infection, or a HSV-1 and HSV-2 co-infection.
  • HSV infection is a herpes simplex virus-2 (HSV-2) infection.
  • the disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection includes herpes, oral herpes, herpes whitlow, genital herpes (genital ulcer), eczema herpeticum, herpes gladiatorum, HSV keratitis, HSV retinitis, HSV encephalitis or HSV meningitis.
  • the disease caused by the HSV infection is a genital ulcer.
  • the methods disclosed herein comprise administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D (rgD-2).
  • the HSV-2 single-cycle vims is an HSV-2 having a deletion of the HSV-2 glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • the HSV-2 glycoprotein D-encoding gene is the Us6 gene of HSV-2, and is either fully or partially deleted in the HSV-2 genome. In an aspect, the HSV-2 glycoprotein D-encoding gene is fully deleted in the HSV-2 genome.
  • the HSV-1 glycoprotein D is not encoded for by the HSV-2 genome.
  • the HSV-2 having the deletion of HSV-2 glycoprotein D is phenotypically complemented with the HSV-1 glycoprotein D by propagating the HSV-2 having the deletion of the HSV-2 glycoprotein D-encoding gene in a cell which has been transfected to express the HSV-1 gD.
  • a complete description of the HSV-2 single-cycle virus is found in WO 2015/134368, which is incorporated herein by reference.
  • HSV-2 single-cycle virus having a deletion of the HSV-2 glycoprotein D- encoding gene in the genome of the HSV-2, and which is phenotypically complemented with the HSV-1 glycoprotein D by propagating the HSV-2 in a complementing cell expressing the HSV-
  • HSV-2 ⁇ gD-2 or “ ⁇ gD-2” or “HSV-
  • rgD-2 The recombinant HSV-2 glycoprotein D is referred to herein interchangeably as “rgD-2” or “recombinant HSV-2 gD” or “recombinant gD-2.”
  • the recombinant HSV-2 gD is combined with an adjuvant, and the adjuvanted recombinant HSV-2 gD is administered to the subject.
  • the type of adjuvant is not limited, and can be any adjuvant capable of augmenting, enhancing, and/or boosting the immune response of the subject to the recombinant HSV-2 gD relative to administration of non- adjuvanted recombinant HSV-2 gD (e.g., soluble recombinant HSV-2 gD).
  • Non-limiting examples of an adjuvant include alum, potassium aluminum sulfate, aluminum hydroxide, aluminum hydroxy phosphate sulfate (AAHS), aluminum phosphate, calcium phosphate hydroxide, squalene, plant saponins from Quillaja (e.g., Quil ATM), soybean, or Polygala senega , monophosphoryl lipid A (MPL), Freund's adjuvant (complete or incomplete), an oil in water emulsion containing a non-metabolizable oil, paraffin oil (e.g., EMULSIGENTM, MVP Laboratories, Ralston, Nebr.), mineral oil, plant or vegetable oil, squalane or squalene (e.g.
  • Adjuvants can be used with or without other specific immunostimulating agents such as 3-DMP, polymeric or monomeric amino acids such as poly glutamic acid or poly lysine, or other immunopotentiating agents.
  • HSV-1 herpes simplex virus-1
  • HSV-2 herpes simplex virus-2
  • HSV-1 and HSV-2 co-infection methods of vaccinating a subject against a disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection.
  • a method of vaccinating a subject against an HSV-1 infection, an HSV-2 infection, or an HSV-1 and HSV-2 co-infection or a disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection comprises administering to the subject an effective amount of the recombinant HSV-2 singlecycle vims and an effective amount of the recombinant HSV-2 glycoprotein D to vaccinate the subject for the HSV-2 infection, the HSV-1 infection, or the HSV-1 and HSV-2 co-infection.
  • the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • a method of vaccinating a subject against herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 gD to vaccinate the subject for the HSV-2 infection or the disease caused by the HSV-2 infection.
  • HSV-2 herpes simplex virus-2
  • a method of vaccinating a subject against HSV-1 infection or a disease caused by the HSV-1 infection comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 gD to vaccinate the subject for the HSV-1 infection or the disease caused by the HSV-1 infection.
  • a method of vaccinating a subject against an HSV-1 and HSV-2 co- infection or a disease caused by HSV-1 and HSV-2 co-infection comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 gD effective to vaccinate the subject for the HSV-1 and HSV-2 coinfection or the disease caused by the HSV-1 and HSV-2 co-infection.
  • HSV-1 heipes simplex virus-1
  • HSV-2 herpes simplex virus-2
  • a method of immunizing a subject against a herpes simplex virus-1 (HSV-1) infection, a herpes simplex virus-2 (HSV-2) infection, or an HSV-1 and HSV-2 co-infection or a disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection comprises administering to the subject an effective amount of the recombinant HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 glycoprotein D to immunize the subject for the HSV-2 infection, the HSV-1 infection, or the HSV-1 and HSV-2 co-infection or the disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection.
  • the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • a method of immunizing a subject against HSV-2 infection or a disease caused by the HSV-2 infection comprises administering to the subject an effective amount of the recombinant HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 glycoprotein D to immunize the subject for the HSV-2 infection or the disease caused by the HSV-2 infection.
  • Disclosed herein also are methods of preventing or treating an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject. Also disclosed are methods of preventing or treating a disease caused by an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject.
  • a method of preventing or treating an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject comprises administering to the subject an effective amount of the HSV-2 single-cycle vims and an effective amount of the recombinant HSV-2 glycoprotein D to treat the subject for the HSV-2 infection, the HSV-1 infection, or the HSV-2 and HSV-1 co-infection.
  • a method of preventing or treating a disease caused by an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject comprises administering to the subject an amount of the HSV-2 single-cycle virus and an amount of the recombinant HSV-2 glycoprotein D effective to treat the subject for the HSV-2 disease caused by the HSV-2 infection, the HSV-1 infection, or the HSV-2 and HSV-1 co- infection.
  • the HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D- encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
  • a method of treating or preventing a herpes simplex virus-2 (HSV-2) infection in a subject or treating a disease caused by an HSV-2 infection in a subject comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to treat the subject for the HSV-2 infection.
  • HSV-2 herpes simplex virus-2
  • the disclosed methods of vaccinating, immunizing, and/or treating a subject comprise administering an effective amount of a composition, a pharmaceutical formulation, or a vaccine comprising the HSV-2 single-cycle virus and administering an effective amount of a composition, a pharmaceutical formulation or a vaccine comprising the recombinant HSV-2 gD.
  • the administering of the HSV-2 single-cycle virus and the recombinant HSV-2 glycoprotein D occurs at substantially the same time.
  • substantially the same time refers to administration of the HSV-2 single-cycle virus and the recombinant HSV-2 gD within a short period of time of one another, for example, 1 second to 24 hours, 1 second to 12 hours, 1 second to 8 hours, 1 second to 4 hours, 1 second to 2 hours (120 minutes), 1 second to one hour (60 minutes), or 1 second to 30 minutes.
  • the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes before the administering of the recombinant glycoprotein D.
  • the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes after the administering of the recombinant glycoprotein D.
  • the administering of the HSV-2 single-cycle vims and the recombinant HSV-2 gD occurs simultaneously, e.g., at the same time.
  • simultaneous administration or administering simultaneously refer to instances in which there is no discernible time between the administering of the HSV-2 single-cycle virus and the recombinant HSV-2 gD.
  • a composition or pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus and a composition or pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD can be administered to the subject.
  • the composition or pharmaceutical composition or vaccine comprising the HSV-2 single-cycle virus and/or the recombinant HSV-2 gD are formulated for administration to the subject.
  • the HSV-2 single-cycle virus and the recombinant HSV-2 gD are present in different compositions, pharmaceutical formulations or vaccines for separate administration to the subject.
  • the HSV-2 single-cycle virus and the recombinant HSV-2 gD are not present in the same composition, pharmaceutical formulation or vaccine.
  • the disclosure is not necessarily limited thereto, and a composition, pharmaceutical formulation or vaccine including both the HSV-2 single-cycle virus and the recombinant HSV-2 gD may be used as long as the viability of the HSV-2 single-cycle virus is not compromised by any of the materials present therein.
  • the HSV-2 single-cycle virus and the recombinant HSV-2 gD are formulated for separate administration to the subject and are administered to the subject at substantially the same time.
  • the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes before the administering of the recombinant gD.
  • the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes after the administering of the recombinant gD.
  • the HSV-2 single-cycle virus and the recombinant HSV-2 gD are formulated for separate administration to the subject and are administered to the subject simultaneously.
  • a composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus and a composition, pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD can be combined together prior to administration to the subject and administered simultaneously.
  • a composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus and a composition, pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD can be administered to the subject by separate means (e.g., different syringes) at the same time.
  • a composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus or the recombinant HSV-2 gD is formulated so that it is suitable for administration to a human subject.
  • the composition or pharmaceutical formulation or vaccine is formulated to be suitable for the intended route of administration to a subject.
  • the intended route of administration of the composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus can be the same as or different from the intended route of administration of the composition, pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD.
  • the HSV-2 single-cycle virus and the recombinant HSV-2 gD are independently formulated for the same route of administration.
  • the HSV-2 single-cycle virus and the recombinant HSV-2 gD are formulated for the different routes of administration ⁇
  • the composition, pharmaceutical formulation or vaccine is formulated so that it is suitable for subcutaneous, intramuscular, intradermal, or intravaginal administration to a subject.
  • administration can be auricular, buccal, conjunctival, cutaneous, subcutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, via hemodialysis, interstitial, intrabdominal, intraamnio tic, intra-arterial, intra- articular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebral, intracisternal, intracorneal, intracoronary, intradermal, intradiscal, intraductal, intraepidermal, intraesophagus, intragastric, intravaginal, intr
  • the composition, pharmaceutical formulation or vaccine including the HSV-2 single-cycle virus and the composition, pharmaceutical formulation or vaccine including the recombinant HSV-2 gD are formulated for subcutaneous, intramuscular or intradermal administration by injection.
  • the composition, pharmaceutical formulation or vaccine including the HSV-2 single-cycle virus can be administered in a same region or a different region as the composition, pharmaceutical formulation or vaccine including the recombinant HSV-2 gD.
  • the HSV-2 single-cycle virus and the recombinant HSV-2 gD can be each be administered to the same or different limbs.
  • compositions, pharmaceutical formulations, or vaccines disclosed herein can comprise an adjuvant.
  • a composition, pharmaceutical formulation, or vaccine comprising the HSV-2 single cycle virus or the recombinant HSV-2 gD comprises an adjuvant.
  • the compositions, pharmaceutical formulations, or vaccines disclosed herein can also include a pharmaceutically acceptable carrier.
  • “pharmaceutically acceptable” means a substance approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia, other generally recognized pharmacopoeia in addition to other formulations that are safe for use in animals, and more particularly in humans and/or non-human mammals.
  • pharmaceutically acceptable carrier refers to an excipient, diluent, preservative, solubilizer, emulsifier, adjuvant (also referred to as immunological adjuvant), and/or vehicle with which the present antibody or fragment is administered.
  • Examples of pharmaceutically acceptable carriers include, but are not limited to, phosphate buffered saline solution, sterile water (including water for injection USP), emulsions such as oil/water emulsion, and various types of wetting agents.
  • Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline, for example 0.9% sodium chloride solution, USP.
  • Compositions comprising such carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990; and Remington, The Science and Practice of Pharmacy 20th Ed.
  • the carrier comprises one or more of dibasic sodium phosphate, potassium chloride, monobasic potassium phosphate, polysorbate 80 (e.g. 2- [2- [3 ,5 -bis(2- hydroxyethoxy)oxolan-2-yl]-2-(2-hydroxyethoxy)ethoxy]ethyl (E)-octadec-9-enoate), disodium edetate dehydrate, sucrose, monobasic sodium phosphate monohydrate, and dibasic sodium phosphate dihydrate.
  • the pharmaceutically acceptable carrier is not limited as long as it is not incompatible with the viability of the HSV-2 single cycle virus or the stability and/or conformation of the recombinant HSV-2 gD.
  • a composition, pharmaceutical formulation, or vaccine comprising the recombinant HSV-2 gD can comprise a stabilizer to prevent loss of activity or structural integrity of the protein due to the effects of denaturation, oxidation or aggregation over a period of time during storage and transportation prior to use.
  • the composition, pharmaceutical formulation, or vaccine can further comprise a salt, a surfactant, a pH and/or tonicity agent, or a combination thereof.
  • a pH value is in an approximately neutral pH range (a pH or 6.8 to 7.4).
  • the composition, pharmaceutical formulation, or vaccine is in liquid form.
  • the composition or pharmaceutical composition is isotonic.
  • the subject is a subject in need of treatment or prevention of an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection.
  • the subject can also be a subject in need of treatment or prevention of a disease caused by an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection.
  • the subject is a mammalian subject.
  • the subject is a human subject.
  • the HSV-2 single cycle virus and recombinant HSV-2 gD can be formulated for administration to a human subject.
  • the methods disclosed herein induce an immune response in the subject, which elicits antibodies, cellular immune responses, and/or other immune factors (e.g., complement) that minimize and/or prevent viral dissemination and/or viral infection in the subject.
  • the immune response comprises the production of antibodies that activate Fc receptors (FcR-activating antibody) to mediate an antibody-dependent cellular cytotoxicity (ADCC) response.
  • FcR-activating antibody activate Fc receptors
  • ADCC antibody-dependent cellular cytotoxicity
  • the administration of an effective amount of the HSV-2 singlecycle virus elicits the production of FcR-activating antibody (also referred to as antibody dependent cellular cytotoxicity (ADCC) antibody).
  • the effective amount of HSV-2 single-cycle virus is an amount of plaque forming units (pfu) of the HSV-2 single-cycle virus which achieves the stated aim.
  • Vero Green Monkey Kidney cells line, ATCC
  • VD60 Limitotic Cell Line
  • V5-29 V5-29
  • DMEM Invitrogen, Carlsbad, CA
  • FBS Hyclone, Logan, UT
  • penicillin- streptomycin Invitrogen
  • HSV-2 strain 4674 was obtained from the Montefiore Clinical Virology Lab (Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Burn, C., et al, Journal of Infectious Diseases 2017, 1- 5). The viral isolates were propagated and titered on Vero cells (Petro, C. D., et al., JCI Insight 2016, 1, 1- 15).
  • ⁇ gD-2 was propagated in complementing VD60 cells, and titered both on the VD60 and Vero cells (Petro, C., et al., eLife 2015; Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5; Kao, C. M., et al., Journal of Infectious Diseases 2019, 42, 47-10). D/5-29 was propagated on complementing V5-29 cells (Da Costa, X. J. E. A., et al., J. Virol.
  • Recombinant gD-2 protein (5 ⁇ g) was provided by the Einstein Macromolecular Therapeutics Development Facility and adjuvanted with 150 ⁇ g alum (Imject Alum, Pierce Biotechnology, Rockland, IL) and 12.5 ⁇ g MPL (Invivogen, San Diego, CA) (rgD- 2/Alum-MPL) (Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5).
  • the recombinant gD- 2 is substantially the same as the recombinant gD-2 used in the AS04 vaccine (GlaxoSmithKline).
  • mice Female C57BL/6 mice were vaccinated subcutaneously, intramuscularly or intradermally (two doses administered at three-week intervals) with 5 x 10 4 , 5 x 10 5 or 5 x 10 6 pfu ⁇ gD-2 or d 15-29 (based on viral titer on complementing cell line); 5 ⁇ g of rgD-2/Alum- MPL; or a combination of 5 x fO 4 pfu ⁇ gD-2 and 5 ⁇ g of rgD-2/Alum-MPL.
  • a specialist intradermal microneedle designed for use in mice was used (Nanopass, Nes Ziona, ISR).
  • mice were challenged on the skin with a 10 x lethal dose for 90% of animals (LD90) of HSV-2 SD90 (Petro, C., et al., eLife 2015). Mice were monitored daily for epithelial and neurological disease and scored as described. For skin disease: 1) erythema at inoculation site; 2) spread to distant site, zosteriform lesions, edema; 3) ulceration, epidermal spread, limb paresis; 4) hind limb paralysis and 5) death. Mice were euthanized at a score of 4 and assigned a score of 5 the following day.
  • Total or isotype-specific HSV-binding IgG was measured by ELISA using recombinant monoclonal antibodies or serum collected one week following the second dose of vaccine.
  • ELISA plates were coated with lysates of Vero cells infected with HSV-2 (G) at an MOI of 0.1 for 24 hours or uninfected Vero cell lysates as control.
  • Serial dilutions of serum in duplicate were incubated with coated plates overnight at 4°C, and bound IgG was quantified using biotin-labeled secondary Abs (BD Pharmingen, CA). Background binding to uninfected Vero cell lysates was subtracted from binding to HSV-infected Vero cell lysates to quantify HSV- specific binding.
  • Fc-receptor activation was determined using the murine FcyR IV ADCC Reporter Bioassay (Promega, Madison, WI) (Petro, C. D., et al, J Cl Insight 2016, 1, 1-15; Bum, C., et al., Journal of Infectious Diseases 2017, 1- 5).
  • Target Vero cells were infected with HSV-2 (SD90) at an MOI of 0.1 for 12 hours.
  • Infected or uninfected control cells were transferred to white, flat-bottomed 96-well plates and incubated with heat-inactivated serum from vaccinated or control immunized mice; or human serum samples (see below) (1:5 dilution in DMEM) for 15 minutes at room temperature.
  • Murine FcyR IV were added for 6 hours at 37 °C 5% CO2 and FcyRIV activation was detected by the addition of luciferin substrate. Plates were read in a SpectraMax M5 e (Molecular Devices). Fold induction was calculated relative to luciferase activity in the absence of serum
  • Neutralizing titers were determined by plaque reduction assay (Petro, C., et al, eLife 2015; Petro, C. D., et al, J Cl Insight 2016, 1, 1-15; Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5). Serial 2-fold dilutions of heat-inactivated serum in duplicate were incubated with vims (50 pfu/well) for 1 hour at 37°C and then applied to Vero cell monolayers for 1 hour at 37°C. Cells were fixed with methanol and stained with Giemsa after a 48-h incubation. Plaques were counted and the neutralization titer was defined as the highest dilution to result in a 50% reduction in plaque numbers.
  • HSV-2 forward primer SEQ ID NO: 1
  • HSV-2 reverse primer sequence 5’ - AGCTTGCGGGCCTCGTT -3’
  • HSV-2 probe sequence 5’- CGCCCCAGCATGTCGTTCACGT - 3’ SEQ ID NO: 3 (Namvar, L., et al., Journal of Clinical Microbiology 2005, 43, 2058-2064).
  • Mouse b actin was used as a loading control (Applied Biosystems, Foster City, CA), and qPCR was run in an Applied Biosystems QuantStudio 7 Flex. Based on a standard curve, this assay consistently detected copy numbers greater than or equal to 4. Samples with fewer than 4 copies detected were considered negative (Petro, C., et al, eLife 2015; Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5).
  • Peripheral blood was collected by retro-orbital bleed, pipetted into 5ml prewarmed ACK lysing buffer (Lonza Bio Whittaker) and incubated for 7 minutes at 37°C. Following lysis, cells were washed 2x in PBS without calcium and magnesium. For splenocyte isolation, spleens were isolated from vaccinated animals and mechanically digested by pressing through a 70 pm cell strainer. Cells were pelleted by centrifugation and resuspended in 2ml ACK lysing buffer. After 7 minutes at 37°C, RPMI was added and cells were pelleted by centrifugation. Cells were subsequently washed and resuspended in RPMI for further processing.
  • splenocytes per 200 pL of RPMI + 10% FBS were plated in a U-bottom 96-well plate.
  • Cells were treated with PHA (5 ⁇ g/mL) or lxlO 6 PFU UV- inactivated HSV-2 SD90 and incubated at 37°C for 18 hours.
  • Brefeldin A BioLegend, San Diego, CA
  • HSV-2 SD90 was diluted in RPMI in a 24-well dish and exposed to a hand-held UV light positioned 4 inches above the plate for 30 minutes. Cells were then processed for extra- and intracellular staining for flow cytometry.
  • mice were prime-boost immunized with increasing doses of ⁇ gD-2 or dl5-29 (5 xlO 4 , 5 xlO 5 or 5x10 6 pfu/dose based on titer on complementing cell lines) or with 5 ⁇ g of gD protein adjuvanted with alum and MPL via the sc, im or id route.
  • the total HSV-specific (ELISA), neutralizing and ADCC response were quantified in serum obtained one-week post-boost.
  • the adjuvanted gD protein vaccine elicited a significantly higher total HSV ELISA antibody response when delivered id compared to im or sc (p ⁇ 0.001).
  • the total HSV-specific Ab response to dl-5-29 and ⁇ gD-2 increased with escalation of the dose, but there were few differences comparing route of administration at each dose; the im route induced a significantly higher response compared to sc for dl-5-29 at a dose of 5x10 4 pfu/mouse (p ⁇ 0.05) and the id route induced a higher Ab response compared to im for ⁇ gD-2 at a dose of 5x10 6 pfu/mouse (p ⁇ 0.01, ANOVA) (Figs. 1A-C)
  • the adjuvanted gD protein vaccine induced no ADCC response relative to control serum regardless of route of administration.
  • the dl5-29 vaccine induced an intermediate ADCC response, which was highest following id administration of 5x10 6 pfu (median 15-fold) compared to the 30-fold FcyRIV activation elicited by 5x10 6 pfu of ⁇ gD-2 administered im or id. (Figs. 1G-I).
  • mice were challenged on the skin with a 10 x LD90 dose of the clinical isolate of HSV-2, SD90, which has been previously shown to be consistently lethal in murine models (Dudek, T. E., et ah, Journal of Infectious Diseases 2011, 203, 1434— 1441). Mice were monitored for two weeks for signs of disease and were euthanized if signs of severe skin or neurologic disease were observed as previously described (Figs. 2A-J) (Petro, C., et al, eLife 2015; Petro, C.
  • HSV viral DNA was quantified in ganglia at the time of death or on day 14 post-challenge. Despite the increase in Ab response following id vaccination with adjuvanted gD protein, there was no reduction in viral DNA recovered from ganglia following any route of immunization. The results with dl5-29 and ⁇ gD-2 at the 5x10 5 dose paralleled the disease scores and survival data. Only 1/5 mice immunized im or id compared to 4/5 mice immunized sc with dl5-29 had HSV DNA detected in the ganglia. No viral DNA was recovered in mice vaccinated by any route with the same dose of ⁇ gD-2 (Figs. 3A-C).
  • mice were prime-boost vaccinated i.m with 5 x 10 5 pfu/mouse of ⁇ gD-2 or 5 ⁇ g gD-2-alum/MPL at three week intervals and T cell responses were assessed in the peripheral blood prior to vaccination (Day -1) and at the indicated times post prime and boost.
  • ⁇ gD-2 induced activated CD4 and CD8 T cells following both prime and boost vaccination as measured by quantifying CDlla+CD49+ CD4 and CD8 T cells.
  • there was little detectable T cell response to the adjuvanted protein vaccine (Figs. 4C-D).
  • mice The splenocytes from these mice were harvested on Day 42 and stimulated with UV-inactivated SD90 or phytohemagglutinin (PHA) as a viability control to assess cytokine responses.
  • PHA phytohemagglutinin
  • IFN- ⁇ , TNF and IL-2 producing CD4+ T cells were observed when splenocytes isolated from ⁇ gD-2, but not rgD-2/alum-MPL vaccinated mice were stimulated with inactivated virus compared to unstimulated cells (Figs. 5B-D).
  • the response was greater than observed with the PHA mitogen.
  • mice were vaccinated sc with a dose of ⁇ gD-2 that is not fully protective (5 x 10 4 pfu/mouse), 5 ⁇ g of gD-2-Alum/MPL, or a combination of both vaccines delivered on opposite or the same flank.
  • ⁇ gD-2 that is not fully protective
  • 5 ⁇ g of gD-2-Alum/MPL 5 ⁇ g of both vaccines delivered on opposite or the same flank.
  • Both combinations significantly increased the total HSV-specific antibody response compared to either vaccine alone (Fig. 6A).
  • the combinations had no additive or antagonistic effect on the nAb response to rgD-2/ Alum-MPL (Fig. 6B) or the ADCC response to ⁇ gD-2 (Fig.
  • ADCC provides a more predictive correlate of immune protection compared to neutralizing responses in mice.
  • the increase in protection observed by increasing the dose and route of delivery of dl5-29 was associated with a significant increase in the ADCC, but not the neutralizing response.
  • the only dose and route of vaccination with ⁇ gD-2 that did not provide 100% protection against a 10xLD90 challenge with SD90, sc immunization with 10 4 pfu, elicited a mean ADCC response of 2.8-fold (FcyRIV) activation.
  • FcyRIV 2.8-fold
  • intradermal rabies vaccination has been a standard since the World Health Organization recommendation in 1992 because a lower dose achieves comparable immunogenicity (Dubois, B., et al, Journal of Leukocyte Biology 1999, 66, 224-230). Intradermal vaccination is presumed to activate a stronger dendritic cell- mediated response thus requiring a lower antigenic dose (Peng, S. L., et al., Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 5545— 5550).
  • the vaccine composition In addition to dose and delivery route, the vaccine composition also influence immunogenicity as evidenced by the exclusive neutralizing response to the gD subunit vaccine, non-neutralizing, FcyR-mediated response to ⁇ gD-2, and a combination of both neutralizing and non-neutralizing responses elicited by dl5-29.
  • the absence of any neutralizing Ab following AgD- 2 immunization likely reflects the absence of the dominant target of nAbs in mice.
  • a combination of adjuvanted rgD-2 and a low dose of ⁇ gD-2 delivered simultaneously at the same or opposite flank did not interfere with the immunogenicity of either vaccine and was more protective than rgD-2-Alum/MPL alone. This is consistent with our superinfection murine studies, which showed that pre-existing gD neutralizing Abs did not interfere with the immunogenicity of ⁇ gD-2.
  • Vaccination of HSV-1 seropositive mice with AgD- 2 boosted the ADCC (but not the neutralizing) Ab response and resulted in complete protection if the mice were subsequently challenge with a lethal dose of HSV-2 (Burn Aschner, C., et al, npj Vaccines 2020, 1-33).
  • nAbs to gD alone are not sufficient to protect mice (or to date, humans), a combination of both types of responses could be beneficial.
  • one reason for the incomplete protection mediated by nAbs may be the ability of HSV to evade neutralization by spreading directly from cell-to cell.
  • delivering recombinant gD protein at the same time as ⁇ gD-2 is different from having gD present in the viral envelope.
  • envelope gD interferes with the generation of IgG2 subclass switched Abs through interactions with herpesvirus entry mediator (HVEM), also known as tumor necrosis factor receptor superfamily member 14 (Bum Aschner and Herold, mspt under review).
  • HVEM herpesvirus entry mediator
  • ADCC is an important correlate of immune protection. Although we initially hypothesized that the intradermal route of delivery would prove more immunogenic for all three vaccines, this was only observed with the gD protein subunit vaccine. Both im and id routes provided similar antibody responses and protection with ⁇ gD-2 and dl-5-29 . Overall, ⁇ gD-2 induced the highest ADCC responses and the most potent protection against lethal challenge and latency.
  • compositions, methods, and articles can alternatively comprise, consist of, or consist essentially of, any appropriate materials, steps, or components herein disclosed.
  • the compositions, methods, and articles can additionally, or alternatively, be formulated so as to be devoid, or substantially free, of any materials (or species), steps, or components, that are otherwise not necessary to the achievement of the function or objectives of the compositions, methods, and articles.
  • test standards are the most recent standard in effect as of the filing date of this application, or, if priority is claimed, the filing date of the earliest priority application in which the test standard appears.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Dermatology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Methods of vaccinating, immunizing and/or treating a subject against a herpes simplex virus infection or a disease caused by a herpes simplex virus infection comprise administering to the subject an effective amount of a HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D, wherein the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.

Description

METHODS OF USING HSV-2 SINGLE CYCLE VIRUS DELTA-gD AND HSV-2 RECOMBINANT GLYCOPROTEIN D
CROSS-REFERENCE TO RELATED APPLICATION
This application claims the benefit of U.S. Provisional Application No. 63/031,816 filed on May 29, 2020, which is incorporated herein in its entirety.
FEDERAL RESEARCH STATEMENT
[0001] This invention was made with government support under grant numbers R01 AI17321-01 and AI057552 awarded by the National Institutes of Health, NIAID. The government has certain rights in the invention.
BACKGROUND
[0002] Herpes simplex vims 1 (HSV-1) and herpes simplex virus 2 (HSV-2) are prevalent human pathogens. HSV- 1 infects approximately 67% of the population by 49 years of age and is the primary cause of oral and ocular disease, a leading cause of infectious comeal blindness and fatal infectious encephalitis, and has emerged as the more common cause of genital disease in the developed world (Looker, K. J. et al., PLoS ONE 2015, 10, el 14989-23; Lafferty, W. E. et al, Journal of Infectious Diseases 2000, 181, 1454-1457; Roberts, C. M. et al, Sexually Transmitted Diseases 2003, 30, 797-800; Xu, F. et al., JAMA 2006, 296, 964-973). HSV-2 is estimated to over 400 million people worldwide, is the primary cause of genital disease in the developing world and a major risk factor for HIV acquisition and transmission (Looker, K. J. et al., PLoS ONE 2015, 10, el 14989-23).
[0003] The enormous global health burden of these two related viruses has resulted in extensive vaccine development efforts, which have primarily focused on the generation of neutralizing antibodies (nAbs) targeting the viral envelope glycoproteins D (gD) as the correlate of immune protection. One such vaccine was a recombinant gD-2 protein vaccine formulated with a proprietary aluminum hydroxide (alum) and monophosphoryl lipid A adjuvant, gD-2- AS04 (GlaxoSmithKline). Despite promising preclinical studies and a Phase 3 clinical trial of serodiscordant couples demonstrating protection in HSV-1 and HSV-2 doubly seronegative women (but not men), a subsequent field trial found no protection against HSV-2 infection or disease in doubly-seronegative women (Stanberry, L. R, et al, N Engl J Med 2002, 347, 1652— 1661; Belshe, R. B., et al, N Engl J Med 2012, 366, 34-43). The vaccine was administered intramuscularly at 0, 1 and 6 months. Another vaccine that has recently completed Phase I clinical trials is a replication- defective HSV-2 strain deleted in two genes involved in viral replication (UL5 and UL29), designated dl5-29 (HSV529, Sanofi Pasteur) (Dropulic, L. K., et al, Journal of Infectious Diseases 2019, 220, 990-1000). In preclinical studies, the vaccine was safe, induced nAb and T cell responses and reduced the establishment of latency in the peripheral nerves (Da Costa, X. J. E. A., et ah, J. Virol. 2000, 74, 7963-7971; Da Costa, X. J. E. A., et ah, Virology 2001, 288, 256-263; Hoshino, Y., et ah, Vaccine 2008, 26, 4034^4-040; Hoshino, Y., et ah, J. Virol. 2004, 79, 410^418; Hoshino, Y., et al. Journal of Infectious Diseases 2009, 200, 1088— 1095; Bernard, M.-C., et al., PLoS ONE 2015, 10, e0121518-21). The Phase I study also found that the vaccine was safe and elicited a >4-fold increase in nAb responses in HSV seronegative participants, but no sustained increase in nAb responses in seropositive participants. Moreover, only a subset of participants elicited significant CD4 and even fewer CD8 T cell responses (Dropulic, L. K., et ah, Journal of Infectious Diseases 2019, 220, 990-1000).
[0004] A single-cycle HSV-2 strain deleted in glycoprotein D (ΔgD-2) has been developed to generate a single-cycle candidate HSV-2 vaccine strain designated \gD-2. In preclinical murine studies, this vaccine strain, ΔgD-2, elicited high-titer non-neutralizing Abs that activate Fc gamma receptors (FcyRs) to induce antibody-dependent cell-mediated cytotoxicity (ADCC). Two doses administered subcutaneously completely protected female and/or male mice against lethal vaginal or skin challenge with clinical isolates of HSV-1 and HSV-2 and prevented the establishment of latency (Petro, C., et al., eLife 2015; Petro, C. D., et al, J Cl Insight 2016, 1, 1-15; Burn, C., et ah, Journal of Infectious Diseases 2017, 1- 5; Kao, C. M., et ah, Journal of Infectious Diseases 2019, 42, 47-10). Moreover, vaccination of female mice protected their pups from subsequent HSV challenge in the first week of life (Kao, C. M., et ah, Journal of Infectious Diseases 2019, 42, 47-10). In contrast to adjuvanted recombinant gD, ΔgD-2 boosted the total and the ADCC Ab responses in HSV-1 seropositive mice and prevented subsequent lethal HSV-2 superinfection (Bum Aschner, C., et ah, npj Vaccines 2020, 1-33).
[0005] Additional strategies for preventing and treating infection and disease caused by HSV-1 and/or HSV-2 would be beneficial.
BRIEF DESCRIPTION
[0006] A method of vaccinating a subject against a herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprising administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to vaccinate the subject for the HSV-2 infection or the disease caused by the HSV-2 infection, wherein the HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
[0007] A method of immunizing a subject against herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprising administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to immunize the subject for the HSV-2 infection or the disease caused by the HSV-2 infection, wherein the HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
[0008] A method of treating or preventing an HSV-2 infection in a subject or treating or preventing a disease caused by an HSV-2 infection in a subject, comprising administering to the subject an effective amount of an HSV- single-cycle virus 2 and an effective amount of a recombinant HSV-2 glycoprotein D to treat or prevent the HSV-2 infection or the disease caused by the HSV-2 infection in the subject, wherein the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
[0009] The above described and other features are exemplified by the following figures and detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] The following figures are exemplary embodiments wherein the like elements are numbered alike.
[0011] Figures 1 A- II. Immunogenicity of viral and adjuvanted subunit HSV vaccines is modulated by vaccination route. Female C57BL/6 mice were vaccinated twice, three weeks apart with 5 x 104, 5 x 105 or 5 x 106 pfu/mouse of dl5-29 or ΔgD-2 or 5 μg gD-2-Alum/MPL subcutaneously (sc), intramuscularly (im) or intradermally (id). One week following the second immunization, mice were retro-orbitally bled and serum was tested for (Figs. 1A-C) total HSV- specific IgG by ELISA, (Figs. 1D-F) neutralization titer and (Figs. 1G-I) FcyRIV activation by NFAT-luciferase reporter assay. N = 5 mice per group for gD-2-Alum/MPL and dl-5-29 in a single experiment; n = 5 mice per group, two independent experiments for ΔgD-2. Asterisks denote significance, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001 by ANOVA.
[0012] Figures 2A-2J. Differences in immunogenicity based on vaccine dose and route translate to differences in protection. Female C57BL/6 mice were vaccinated twice, three weeks apart with 5 x 104, 5 x 105 or 5 x 106 pfu/mouse of d.15-29 or ΔgD-2 or 5 μg gD-2-Alum/MPL subcutaneously (sc), intramuscularly (im) or intradermally (id). Three weeks following the second vaccination, mice were challenged on the skin with 10 x LD90 HSV-2 SD90. Disease scores over time are shown for gD-2-Alum/MPL (Fig. 2A), dl5-29 (Figs. 2B) and ΔgD-2 (Fig. 2C). Percentage survival is shown in Figs. 2D-2J. N = 5 mice per group for gD-2-Alum/MPL and (i/5-29 in a single experiment; n = 5 mice per group, two independent experiments for AgD- 2. For survival curves, ** p<0.01 by Gehan Breslow Wilcoxon test.
[0013] Figures 3A-3C. HSV DNA detection in the sacral nerve parallels survival data. Female C57BL/6 mice vaccinated with 5 μg rgD-2-Alum/MPL, or 5 x 105 pfu/mouse of dl5-29 or ΔgD-2 by the sc, im or id routes were challenged in the skin with 10 x LD90 HSV-2 SD90. Following challenge, mice were monitored daily for fourteen days and sacral nerve tissue was harvested at the time of death for mice that succumbed to challenge, or at D14 post challenge for surviving animals. HSV DNA in the sacral ganglia was assessed by qPCR and the number of copies of HSV-2 DNA per 10 ng of DNA is shown in (Fig. 3A) for rgD-2-Alum/MPL, (Fig. 3B) dl5-29 and (Fig. 3C) ΔgD-2. Mice that succumbed to challenge are indicated by a crossed through symbol. There were no significant differences based on vaccine route (ANOVA).
[0014] Figures 4A-4D. Kinetics of the T cell response following HSV vaccination. Female C57BL/6 mice were vaccinated i.m. twice, three weeks apart, with 5 x 105 pfu/mouse of ΔgD-2 or 5 μg gD-2-alum/MPL. Before vaccination (day-1) and at week 1 and 2 following prime and boost, mice were retro-orbitally bled and assessed for CDlla+ CD49d+ activated CD4 and CD8 T cells. (Figs. 4C-D) Gating strategy is shown for the assessment of CD4 and CD8 T cell activation (Figs. 4A-B). Data was analyzed by Mixed Effects Analysis, *p<0.5, **p<0.01, ***p<0.001, ****p<0.0001; n = 5 mice pergroup.
[0015] Figures 5A-5G. ΔgD-2 vaccination induces polyfunctional CD4 and CD8 T cells that produce IFN-g, TNF and IL-2 in response to HSV-2 stimulation. Female C57BL/6 mice were vaccinated i.m twice, three weeks apart, with 5 x 105 pfu/mouse of ΔgD-2 and 5 μg gD-2- alum/MPL. Splenocytes from vaccinated mice were collected two weeks following boost vaccination and stimulated with PHA or UV-inactivated HSV-2 SD90 for 18 hours with Brefeldin A treatment before staining and flow cytometric analysis for the production of IFN-g, TNF and IL-2. Gating strategy is shown in (Fig. 5A), and cytokine responses for CD4 (Figs. 5B-D) and CD8 (Figs. 5E-G) T cells. Data was analyzed by Mixed Effects Analysis, *p<0.5, **p<0.01, ***p<0.001; n = 5 mice pergroup.
[0016] Figures 6A-6D. The generation of neutralizing antibody enhances protection by low-dose ΔgD-2. Female C57BL/6 mice were subcutaneously vaccinated twice, three weeks apart with 5 x 104 pfu/mouse of ΔgD-2, 5 μg gD-2-Alum/MPL or a combination of both vaccines delivered on opposite flanks (opposite) or at the same site (same). One week after the second vaccination, mice were retro-orbitally bled and serum was assessed for total HSV- specific IgG by ELISA (Fig. 6A), neutralizing titer (Fig. 6B), and FcyRIV activation (Fig. 6C). Three weeks after the second vaccination, mice were challenged on the skin with a 10 x LD90 dose of HSV-2 (SD90). Percentage survival is shown (Fig. 6D). N = 5 mice per group, two independent experiments. (A-C) *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 by ANOVA. For survival curves, * p<0.05, *** p<0.001 by Gehan Breslow Wilcoxon test.
DETAIFED DESCRIPTION
[0017] Vaccine immunogenicity is impacted by how the viral antigens are presented by the vaccine (attenuated, replication-defective, single-cycle, inactivated vims, or adjuvanted subunit protein), as well as the dose and route of administration. The immunization route is often based on pragmatic rather than immunologic considerations.
[0018] The immunogenicity and efficacy of the genetically modified, single-cycle, herpes simplex virus-2 (HSV-2) having a deletion of glycoprotein D in the genome (ΔgD-2), using different routes and vaccine doses was studied and compared with dl5 -29 and recombinant HSV-2 glycoprotein D (rgD-2) adjuvanted with alum and monophosphoryl lipid A (MPL) (rgD- 2-Alum/MPL), which is similar to the gD-2-AS04 vaccine (GlaxoSmithKline). The immunogenicity and efficacy of simultaneous administration of ΔgD-2 and the rgD-2 was also evaluated. It has been surprisingly discovered that co-administration of ΔgD-2 and recombinant HSV-2 glycoprotein D (rgD-2) does not interfere with the immunogenicity of either vaccine. In particular, administration of adjuvanted rgD-2 and a relatively low dose of ΔgD-2 delivered simultaneously to the same or opposite flank does not interfere with the immunogenicity of either vaccine and is more protective than the adjuvanted rgD-2 alone. Further, it has been shown that the combination of low dose ΔgD-2 with rgD-2 provides additive protection.
[0019] As used herein, "therapeutically effective amount" or “effective amount” or “amount effective” refers to a quantity of a specific substance sufficient to achieve a desired effect in a subject.
[0020] “Treat” or “treating,” means to administer a vaccine of the disclosure or a product of the disclosure to a subject or patient having one or more disease symptoms, or being suspected of having a disease, for which the vaccine or product has therapeutic activity or prophylactic activity. The vaccine or product can be administered in an amount effective to alleviate one or more disease symptoms in the treated subject, whether by inducing the regression of or inhibiting the progression of such symptom(s) by any clinically measurable degree. The terms further includes a postponement of development of the symptoms associated with a disorder and/or a reduction in the severity of the symptoms of such disorder. The terms further include ameliorating existing uncontrolled or unwanted symptoms, preventing additional symptoms, and ameliorating or preventing the underlying causes of such symptoms.
[0021] “Preventing” means administering an amount of a vaccine of the disclosure or a product of the disclosure sufficient to significantly reduce the likelihood of a disease from occurring in a subject who may be predisposed to the disease but who does not have it. In the context of viral infection “preventing” includes administering an amount of the vaccine or an immune product resulting from administration of the vaccine to a subject known to be at enhanced risk of viral infection.
[0022] The term "adjuvant" as used herein means any component added to a vaccine that augments, enhances and/or boosts the immune response to an antigen, but when the administered alone does not generate an immune response.
[0023] Disclosed herein are methods of vaccinating, immunizing and/or treating a subject against a herpes simplex virus (HSV) infection. Disclosed herein also are methods of vaccinating, immunizing, and/or treating a subject against a disease caused by an HSV infection. The HSV infection is a herpes simplex virus-2 (HSV-2) infection, a herpes simplex virus- 1 (HSV-1) infection, or a HSV-1 and HSV-2 co-infection. In an aspect, the HSV infection is a herpes simplex virus-2 (HSV-2) infection. The disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection includes herpes, oral herpes, herpes whitlow, genital herpes (genital ulcer), eczema herpeticum, herpes gladiatorum, HSV keratitis, HSV retinitis, HSV encephalitis or HSV meningitis. In an aspect, the disease caused by the HSV infection is a genital ulcer.
[0024] The methods disclosed herein comprise administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D (rgD-2). The HSV-2 single-cycle vims is an HSV-2 having a deletion of the HSV-2 glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2. The HSV-2 glycoprotein D-encoding gene is the Us6 gene of HSV-2, and is either fully or partially deleted in the HSV-2 genome. In an aspect, the HSV-2 glycoprotein D-encoding gene is fully deleted in the HSV-2 genome.
[0025] The HSV-1 glycoprotein D is not encoded for by the HSV-2 genome. In particular, the HSV-2 having the deletion of HSV-2 glycoprotein D is phenotypically complemented with the HSV-1 glycoprotein D by propagating the HSV-2 having the deletion of the HSV-2 glycoprotein D-encoding gene in a cell which has been transfected to express the HSV-1 gD. A complete description of the HSV-2 single-cycle virus is found in WO 2015/134368, which is incorporated herein by reference.
[0026] The HSV-2 single-cycle virus having a deletion of the HSV-2 glycoprotein D- encoding gene in the genome of the HSV-2, and which is phenotypically complemented with the HSV-1 glycoprotein D by propagating the HSV-2 in a complementing cell expressing the HSV-
1 glycoprotein D, is referred to herein interchangeably as “HSV-2 \gD-2" or “ΔgD-2” or “HSV-
2 single-cycle vims”.
[0027] The recombinant HSV-2 glycoprotein D is referred to herein interchangeably as “rgD-2” or “recombinant HSV-2 gD” or “recombinant gD-2.”
[0028] In aspects, the recombinant HSV-2 gD is combined with an adjuvant, and the adjuvanted recombinant HSV-2 gD is administered to the subject.
[0029] The type of adjuvant is not limited, and can be any adjuvant capable of augmenting, enhancing, and/or boosting the immune response of the subject to the recombinant HSV-2 gD relative to administration of non- adjuvanted recombinant HSV-2 gD (e.g., soluble recombinant HSV-2 gD). Non-limiting examples of an adjuvant include alum, potassium aluminum sulfate, aluminum hydroxide, aluminum hydroxy phosphate sulfate (AAHS), aluminum phosphate, calcium phosphate hydroxide, squalene, plant saponins from Quillaja (e.g., Quil A™), soybean, or Polygala senega , monophosphoryl lipid A (MPL), Freund's adjuvant (complete or incomplete), an oil in water emulsion containing a non-metabolizable oil, paraffin oil (e.g., EMULSIGEN™, MVP Laboratories, Ralston, Nebr.), mineral oil, plant or vegetable oil, squalane or squalene (e.g. MF59™), and/or animal oil, CpG oligodeoxynucleotides (ODN), QS-21, or a combination thereof. Adjuvants can be used with or without other specific immunostimulating agents such as 3-DMP, polymeric or monomeric amino acids such as poly glutamic acid or poly lysine, or other immunopotentiating agents.
[0030] Disclosed herein are methods of vaccinating a subject against herpes simplex virus-1 (HSV-1) infection, herpes simplex virus-2 (HSV-2) infection, or an HSV-1 and HSV-2 co-infection. Also disclosed are methods of vaccinating a subject against a disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection. A method of vaccinating a subject against an HSV-1 infection, an HSV-2 infection, or an HSV-1 and HSV-2 co-infection or a disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection, comprises administering to the subject an effective amount of the recombinant HSV-2 singlecycle vims and an effective amount of the recombinant HSV-2 glycoprotein D to vaccinate the subject for the HSV-2 infection, the HSV-1 infection, or the HSV-1 and HSV-2 co-infection. The HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
[0031] In an aspect, a method of vaccinating a subject against herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 gD to vaccinate the subject for the HSV-2 infection or the disease caused by the HSV-2 infection.
[0032] In an aspect, a method of vaccinating a subject against HSV-1 infection or a disease caused by the HSV-1 infection comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 gD to vaccinate the subject for the HSV-1 infection or the disease caused by the HSV-1 infection.
[0033] In an aspect, a method of vaccinating a subject against an HSV-1 and HSV-2 co- infection or a disease caused by HSV-1 and HSV-2 co-infection comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 gD effective to vaccinate the subject for the HSV-1 and HSV-2 coinfection or the disease caused by the HSV-1 and HSV-2 co-infection.
[0034] Also disclosed herein are methods of immunizing a subject against heipes simplex virus-1 (HSV-1) infection, herpes simplex virus-2 (HSV-2) infection, or an HSV-1 and HSV-2 co-infection, as well as methods of immunizing a subject against a disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection. A method of immunizing a subject against a herpes simplex virus-1 (HSV-1) infection, a herpes simplex virus-2 (HSV-2) infection, or an HSV-1 and HSV-2 co-infection or a disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection, comprises administering to the subject an effective amount of the recombinant HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 glycoprotein D to immunize the subject for the HSV-2 infection, the HSV-1 infection, or the HSV-1 and HSV-2 co-infection or the disease caused by HSV-1 infection, HSV-2 infection, or HSV-1 and HSV-2 co-infection. The HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
[0035] In an aspect, a method of immunizing a subject against HSV-2 infection or a disease caused by the HSV-2 infection comprises administering to the subject an effective amount of the recombinant HSV-2 single-cycle virus and an effective amount of the recombinant HSV-2 glycoprotein D to immunize the subject for the HSV-2 infection or the disease caused by the HSV-2 infection. [0036] Disclosed herein also are methods of preventing or treating an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject. Also disclosed are methods of preventing or treating a disease caused by an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject.
[0037] A method of preventing or treating an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject comprises administering to the subject an effective amount of the HSV-2 single-cycle vims and an effective amount of the recombinant HSV-2 glycoprotein D to treat the subject for the HSV-2 infection, the HSV-1 infection, or the HSV-2 and HSV-1 co-infection. A method of preventing or treating a disease caused by an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection in a subject comprises administering to the subject an amount of the HSV-2 single-cycle virus and an amount of the recombinant HSV-2 glycoprotein D effective to treat the subject for the HSV-2 disease caused by the HSV-2 infection, the HSV-1 infection, or the HSV-2 and HSV-1 co- infection. The HSV-2 single-cycle vims comprises HSV-2 having a deletion of glycoprotein D- encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
[0038] In an aspect, a method of treating or preventing a herpes simplex virus-2 (HSV-2) infection in a subject or treating a disease caused by an HSV-2 infection in a subject, comprises administering to the subject an effective amount of the HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to treat the subject for the HSV-2 infection.
[0039] In aspects, the disclosed methods of vaccinating, immunizing, and/or treating a subject comprise administering an effective amount of a composition, a pharmaceutical formulation, or a vaccine comprising the HSV-2 single-cycle virus and administering an effective amount of a composition, a pharmaceutical formulation or a vaccine comprising the recombinant HSV-2 gD.
[0040] In aspects, the administering of the HSV-2 single-cycle virus and the recombinant HSV-2 glycoprotein D occurs at substantially the same time. As used herein, “substantially the same time” refers to administration of the HSV-2 single-cycle virus and the recombinant HSV-2 gD within a short period of time of one another, for example, 1 second to 24 hours, 1 second to 12 hours, 1 second to 8 hours, 1 second to 4 hours, 1 second to 2 hours (120 minutes), 1 second to one hour (60 minutes), or 1 second to 30 minutes.
[0041] In an aspect, the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes before the administering of the recombinant glycoprotein D. [0042] In an aspect, the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes after the administering of the recombinant glycoprotein D.
[0043] In an aspect, the administering of the HSV-2 single-cycle vims and the recombinant HSV-2 gD occurs simultaneously, e.g., at the same time. As used herein, simultaneous administration or administering simultaneously refer to instances in which there is no discernible time between the administering of the HSV-2 single-cycle virus and the recombinant HSV-2 gD.
[0044] A composition or pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus and a composition or pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD can be administered to the subject. The composition or pharmaceutical composition or vaccine comprising the HSV-2 single-cycle virus and/or the recombinant HSV-2 gD are formulated for administration to the subject.
[0045] In an aspect, the HSV-2 single-cycle virus and the recombinant HSV-2 gD are present in different compositions, pharmaceutical formulations or vaccines for separate administration to the subject. In other words, the HSV-2 single-cycle virus and the recombinant HSV-2 gD are not present in the same composition, pharmaceutical formulation or vaccine. However, the disclosure is not necessarily limited thereto, and a composition, pharmaceutical formulation or vaccine including both the HSV-2 single-cycle virus and the recombinant HSV-2 gD may be used as long as the viability of the HSV-2 single-cycle virus is not compromised by any of the materials present therein.
[0046] In an aspect of the present disclosure, the HSV-2 single-cycle virus and the recombinant HSV-2 gD are formulated for separate administration to the subject and are administered to the subject at substantially the same time. In an aspect, the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes before the administering of the recombinant gD. In an aspect, the administering of the HSV-2 single-cycle virus occurs 1 second to 60 minutes after the administering of the recombinant gD.
[0047] In an aspect, the HSV-2 single-cycle virus and the recombinant HSV-2 gD are formulated for separate administration to the subject and are administered to the subject simultaneously. For example, a composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus and a composition, pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD can be combined together prior to administration to the subject and administered simultaneously. Or for example, a composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus and a composition, pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD can be administered to the subject by separate means (e.g., different syringes) at the same time. [0048] In aspects, a composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus or the recombinant HSV-2 gD is formulated so that it is suitable for administration to a human subject. In particular, the composition or pharmaceutical formulation or vaccine is formulated to be suitable for the intended route of administration to a subject. The intended route of administration of the composition, pharmaceutical formulation or vaccine comprising the HSV-2 single-cycle virus can be the same as or different from the intended route of administration of the composition, pharmaceutical formulation or vaccine comprising the recombinant HSV-2 gD. In an aspect, the HSV-2 single-cycle virus and the recombinant HSV-2 gD are independently formulated for the same route of administration. In an aspect, the HSV-2 single-cycle virus and the recombinant HSV-2 gD are formulated for the different routes of administration·
[0049] In an aspect, the composition, pharmaceutical formulation or vaccine is formulated so that it is suitable for subcutaneous, intramuscular, intradermal, or intravaginal administration to a subject. In the methods disclosed herein, and in the compositions or pharmaceutical formulations or vaccines disclosed herein, administration can be auricular, buccal, conjunctival, cutaneous, subcutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, via hemodialysis, interstitial, intrabdominal, intraamnio tic, intra-arterial, intra- articular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebral, intracisternal, intracorneal, intracoronary, intradermal, intradiscal, intraductal, intraepidermal, intraesophagus, intragastric, intravaginal, intragingival, intraileal, intraluminal, intralesional, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intraepicardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathecal, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intraventricular, intravesical, intravitreal, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, rectal, inhalationally, retrobulbar, subarachnoid, subconjuctival, sublingual, submucosal, topically, transdermal, transmucosal, transplacental, transtracheal, ureteral, urethral, or vaginal. A combination comprising at least one of the foregoing routes of administration can also be used.
[0050] In an aspect, the composition, pharmaceutical formulation or vaccine including the HSV-2 single-cycle virus and the composition, pharmaceutical formulation or vaccine including the recombinant HSV-2 gD are formulated for subcutaneous, intramuscular or intradermal administration by injection. The composition, pharmaceutical formulation or vaccine including the HSV-2 single-cycle virus can be administered in a same region or a different region as the composition, pharmaceutical formulation or vaccine including the recombinant HSV-2 gD. For example, the HSV-2 single-cycle virus and the recombinant HSV-2 gD can be each be administered to the same or different limbs.
[0051] The compositions, pharmaceutical formulations, or vaccines disclosed herein can comprise an adjuvant. In an aspect, a composition, pharmaceutical formulation, or vaccine comprising the HSV-2 single cycle virus or the recombinant HSV-2 gD comprises an adjuvant. The compositions, pharmaceutical formulations, or vaccines disclosed herein can also include a pharmaceutically acceptable carrier.
[0052] As used herein, “pharmaceutically acceptable” means a substance approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia, other generally recognized pharmacopoeia in addition to other formulations that are safe for use in animals, and more particularly in humans and/or non-human mammals. The term “pharmaceutically acceptable carrier” refers to an excipient, diluent, preservative, solubilizer, emulsifier, adjuvant (also referred to as immunological adjuvant), and/or vehicle with which the present antibody or fragment is administered. Examples of pharmaceutically acceptable carriers include, but are not limited to, phosphate buffered saline solution, sterile water (including water for injection USP), emulsions such as oil/water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline, for example 0.9% sodium chloride solution, USP. Compositions comprising such carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990; and Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing, 2000, the content of each of which is hereby incorporated in its entirety). In nonlimiting examples, the carrier comprises one or more of dibasic sodium phosphate, potassium chloride, monobasic potassium phosphate, polysorbate 80 (e.g. 2- [2- [3 ,5 -bis(2- hydroxyethoxy)oxolan-2-yl]-2-(2-hydroxyethoxy)ethoxy]ethyl (E)-octadec-9-enoate), disodium edetate dehydrate, sucrose, monobasic sodium phosphate monohydrate, and dibasic sodium phosphate dihydrate. The pharmaceutically acceptable carrier is not limited as long as it is not incompatible with the viability of the HSV-2 single cycle virus or the stability and/or conformation of the recombinant HSV-2 gD.
[0053] In an aspect, a composition, pharmaceutical formulation, or vaccine comprising the recombinant HSV-2 gD can comprise a stabilizer to prevent loss of activity or structural integrity of the protein due to the effects of denaturation, oxidation or aggregation over a period of time during storage and transportation prior to use. The composition, pharmaceutical formulation, or vaccine can further comprise a salt, a surfactant, a pH and/or tonicity agent, or a combination thereof.
[0054] Where the composition, pharmaceutical formulation, or vaccine is used as an injection, a pH value is in an approximately neutral pH range (a pH or 6.8 to 7.4). In an aspect, the composition, pharmaceutical formulation, or vaccine is in liquid form. In an aspect, the composition or pharmaceutical composition is isotonic.
[0055] In the present disclosure, the subject is a subject in need of treatment or prevention of an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection. The subject can also be a subject in need of treatment or prevention of a disease caused by an HSV-2 infection, an HSV-1 infection, or an HSV-2 and HSV-1 co-infection. The subject is a mammalian subject. For example, the subject is a human subject. The HSV-2 single cycle virus and recombinant HSV-2 gD can be formulated for administration to a human subject.
[0056] The methods disclosed herein induce an immune response in the subject, which elicits antibodies, cellular immune responses, and/or other immune factors (e.g., complement) that minimize and/or prevent viral dissemination and/or viral infection in the subject. In particular, the immune response comprises the production of antibodies that activate Fc receptors (FcR-activating antibody) to mediate an antibody-dependent cellular cytotoxicity (ADCC) response. In an aspect, the administration of an effective amount of the HSV-2 singlecycle virus elicits the production of FcR-activating antibody (also referred to as antibody dependent cellular cytotoxicity (ADCC) antibody). The effective amount of HSV-2 single-cycle virus is an amount of plaque forming units (pfu) of the HSV-2 single-cycle virus which achieves the stated aim.
[0057] This disclosure is further illustrated by the following examples, which are nonlimiting.
EXAMPLES Materials and Methods
[0058] Age-matched female C57BL/6 (BL/6) mice were purchased from the Jackson Laboratory (JAX, Bar Harbor, ME).
[0059] Vero (Green Monkey Kidney cells line, ATCC), VD60 (Ligas, M. W., et al, J. Virol. 1988, 62, 1486-1494) and V5-29 (Da Costa, X. J. E. A., et al., Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 6994-6998) cells were grown in DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% FBS (Hyclone, Logan, UT) and 1% penicillin- streptomycin (Invitrogen). The clinical isolates used for viral challenges included HSV-2 (SD90) (Dudek, T. E., et al., Journal of Infectious Diseases 2011, 203, 1434-1441) and HSV-2 (4674). HSV-2 strain 4674 was obtained from the Montefiore Clinical Virology Lab (Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Burn, C., et al, Journal of Infectious Diseases 2017, 1- 5). The viral isolates were propagated and titered on Vero cells (Petro, C. D., et al., JCI Insight 2016, 1, 1- 15).
[0060] ΔgD-2 was propagated in complementing VD60 cells, and titered both on the VD60 and Vero cells (Petro, C., et al., eLife 2015; Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5; Kao, C. M., et al., Journal of Infectious Diseases 2019, 42, 47-10). D/5-29 was propagated on complementing V5-29 cells (Da Costa, X. J. E. A., et al., J. Virol. 2000, 74, 7963-7971) and was also titered on complementing and noncomplementing Vero cells. Recombinant gD-2 protein (5 μg) was provided by the Einstein Macromolecular Therapeutics Development Facility and adjuvanted with 150 μg alum (Imject Alum, Pierce Biotechnology, Rockland, IL) and 12.5 μg MPL (Invivogen, San Diego, CA) (rgD- 2/Alum-MPL) (Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5). The recombinant gD- 2 is substantially the same as the recombinant gD-2 used in the AS04 vaccine (GlaxoSmithKline).
Vaccination and challenge protocol
[0061] Female C57BL/6 mice were vaccinated subcutaneously, intramuscularly or intradermally (two doses administered at three-week intervals) with 5 x 104, 5 x 105 or 5 x 106 pfu ΔgD-2 or d 15-29 (based on viral titer on complementing cell line); 5 μg of rgD-2/Alum- MPL; or a combination of 5 x fO4 pfu ΔgD-2 and 5 μg of rgD-2/Alum-MPL. For intradermal vaccinations, a specialist intradermal microneedle designed for use in mice was used (Nanopass, Nes Ziona, ISR). Three weeks after the second vaccine dose, mice were challenged on the skin with a 10 x lethal dose for 90% of animals (LD90) of HSV-2 SD90 (Petro, C., et al., eLife 2015). Mice were monitored daily for epithelial and neurological disease and scored as described. For skin disease: 1) erythema at inoculation site; 2) spread to distant site, zosteriform lesions, edema; 3) ulceration, epidermal spread, limb paresis; 4) hind limb paralysis and 5) death. Mice were euthanized at a score of 4 and assigned a score of 5 the following day.
ELISA for HSV -specific antibodies
[0062] Total or isotype-specific HSV-binding IgG was measured by ELISA using recombinant monoclonal antibodies or serum collected one week following the second dose of vaccine. ELISA plates were coated with lysates of Vero cells infected with HSV-2 (G) at an MOI of 0.1 for 24 hours or uninfected Vero cell lysates as control. Serial dilutions of serum in duplicate were incubated with coated plates overnight at 4°C, and bound IgG was quantified using biotin-labeled secondary Abs (BD Pharmingen, CA). Background binding to uninfected Vero cell lysates was subtracted from binding to HSV-infected Vero cell lysates to quantify HSV- specific binding.
FcyR activation assay
[0063] Fc-receptor activation, and more specifically FcyRIV activation, was determined using the murine FcyR IV ADCC Reporter Bioassay (Promega, Madison, WI) (Petro, C. D., et al, J Cl Insight 2016, 1, 1-15; Bum, C., et al., Journal of Infectious Diseases 2017, 1- 5). Target Vero cells were infected with HSV-2 (SD90) at an MOI of 0.1 for 12 hours. Infected or uninfected control cells were transferred to white, flat-bottomed 96-well plates and incubated with heat-inactivated serum from vaccinated or control immunized mice; or human serum samples (see below) (1:5 dilution in DMEM) for 15 minutes at room temperature. Murine FcyR IV were added for 6 hours at 37 °C 5% CO2 and FcyRIV activation was detected by the addition of luciferin substrate. Plates were read in a SpectraMax M5e (Molecular Devices). Fold induction was calculated relative to luciferase activity in the absence of serum
Neutralization assay
[0064] Neutralizing titers were determined by plaque reduction assay (Petro, C., et al, eLife 2015; Petro, C. D., et al, J Cl Insight 2016, 1, 1-15; Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5). Serial 2-fold dilutions of heat-inactivated serum in duplicate were incubated with vims (50 pfu/well) for 1 hour at 37°C and then applied to Vero cell monolayers for 1 hour at 37°C. Cells were fixed with methanol and stained with Giemsa after a 48-h incubation. Plaques were counted and the neutralization titer was defined as the highest dilution to result in a 50% reduction in plaque numbers.
Quantification of viral DNA in neuronal tissue by quantitative PCR
[0065] At the time of euthanasia (when mice succumbed to disease or day 14 post- FIS V- 2 challenge); sacral nerve tissue was extracted and DNA was isolated using the Qiagen Blood and Tissue DNA isolation kit (Qiagen). 10 ng of DNA per sample was loaded and primers and probes specific for HSV-2 gB were used to quantify HSV DNA (HSV-2 forward primer (SEQ ID NO: 1) sequence 5’ - TGCAGTTTACGTATAACCACATACAGC - 3’ (SEQ ID NO: 1); HSV-2 reverse primer sequence 5’ - AGCTTGCGGGCCTCGTT -3’ (SEQ ID NO: 2); HSV-2 probe sequence 5’- CGCCCCAGCATGTCGTTCACGT - 3’ (SEQ ID NO: 3) (Namvar, L., et al., Journal of Clinical Microbiology 2005, 43, 2058-2064). Mouse b actin was used as a loading control (Applied Biosystems, Foster City, CA), and qPCR was run in an Applied Biosystems QuantStudio 7 Flex. Based on a standard curve, this assay consistently detected copy numbers greater than or equal to 4. Samples with fewer than 4 copies detected were considered negative (Petro, C., et al, eLife 2015; Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Burn, C., et al., Journal of Infectious Diseases 2017, 1- 5).
Cell Isolation and Flow Cytometry
[0066] Peripheral blood was collected by retro-orbital bleed, pipetted into 5ml prewarmed ACK lysing buffer (Lonza Bio Whittaker) and incubated for 7 minutes at 37°C. Following lysis, cells were washed 2x in PBS without calcium and magnesium. For splenocyte isolation, spleens were isolated from vaccinated animals and mechanically digested by pressing through a 70 pm cell strainer. Cells were pelleted by centrifugation and resuspended in 2ml ACK lysing buffer. After 7 minutes at 37°C, RPMI was added and cells were pelleted by centrifugation. Cells were subsequently washed and resuspended in RPMI for further processing.
[0067] For ex-vivo stimulation, 2x106 splenocytes per 200 pL of RPMI + 10% FBS were plated in a U-bottom 96-well plate. Cells were treated with PHA (5μg/mL) or lxlO6 PFU UV- inactivated HSV-2 SD90 and incubated at 37°C for 18 hours. Brefeldin A (BioLegend, San Diego, CA) was added for the final 5 hours of stimulation. For UV inactivation of virus, HSV-2 SD90 was diluted in RPMI in a 24-well dish and exposed to a hand-held UV light positioned 4 inches above the plate for 30 minutes. Cells were then processed for extra- and intracellular staining for flow cytometry.
[0068] For flow cytometry analysis, 1 xlO6 to 2x106 cells per 100 pL were incubated with Zombie Near-IR fixable viability dye and TruStain FcX (anti-mouse CD16/CD32) antibody for 10 minutes at room temperature. For surface staining, cells were stained with anti-CD90.2- BV510, CD4-BV785, CD8-BV711, CDlla-APC, CD49d-APC/Fire750, KLRG1-BV605, and CD62L-BV570 (all BioLegend, San Diego, CA) in a mixture of FACS Buffer and Brilliant Stain Buffer (BD Biosciences, Franklin Lakes, NJ) for 30 minutes at RT per the manufacturer’s instructions. Cells were then washed and fixed by incubating in 200ml 2% PFA for 20 minutes at room temperature, and subsequently permeabilized by incubating for 7 minutes in 0.3% Triton X- 100. For intracellular staining, cells were incubated in 100 pL of a cocktail of anti-IFN-g-RE, TNF-BV570, and IL-2- PerCP/Cy5.5 (BioLegend, San Diego, CA) for 30 minutes at 4C. Following staining, cells were washed and passed through a 40 pm cell strainer prior to analysis on a 5-laser Cytek Aurora flow cytometer. 50,000 live CD90.2+ cells were collected per sample, and data analysis was carried out using Flowlo (BD Biosciences, Franklin Lakes, NJ). Statistical analysis
[0069] Analyses were performed using GraphPad Prism version 8.2.1 software (GraphPad Software Inc. San Diego, CA). A P value of 0.05 was considered statistically significant. Survival curves were compared using the Gehan-Breslow-Wilcoxon test; other results were compared using ANOVA or Mixed Effects analyses as indicated.
Results
Dose and delivery route influence HSV vaccine immunogenicity
[0070] To determine whether the dose and/or route of delivery impacted immunogenicity, mice were prime-boost immunized with increasing doses of ΔgD-2 or dl5-29 (5 xlO4, 5 xlO5 or 5x106 pfu/dose based on titer on complementing cell lines) or with 5 μg of gD protein adjuvanted with alum and MPL via the sc, im or id route. The total HSV-specific (ELISA), neutralizing and ADCC response (measured using murine FcyRIV activation as a surrogate) were quantified in serum obtained one-week post-boost. The adjuvanted gD protein vaccine elicited a significantly higher total HSV ELISA antibody response when delivered id compared to im or sc (p< 0.001). The total HSV-specific Ab response to dl-5-29 and ΔgD-2 increased with escalation of the dose, but there were few differences comparing route of administration at each dose; the im route induced a significantly higher response compared to sc for dl-5-29 at a dose of 5x104 pfu/mouse (p< 0.05) and the id route induced a higher Ab response compared to im for ΔgD-2 at a dose of 5x106 pfu/mouse (p < 0.01, ANOVA) (Figs. 1A-C)
[0071] Consistent with the increase in total HSV-specific Abs, there was a nonsignificant increase in the neutralizing titer following id administration of rgD-2/Alum-MPL (Figs. 1D-F). The neutralizing response to dl5-29 increased with dose, but not when comparing the route of administration. AgD- 2, as anticipated from prior studies, induced little or no neutralizing Ab response regardless of dose or route of administration. In contrast, ΔgD-2 elicited the most potent ADCC response compared to the other vaccines, which increased with dose and was significantly greater at the 5x106 dose when comparing id or im to sc administration. The adjuvanted gD protein vaccine induced no ADCC response relative to control serum regardless of route of administration. The dl5-29 vaccine induced an intermediate ADCC response, which was highest following id administration of 5x106 pfu (median 15-fold) compared to the 30-fold FcyRIV activation elicited by 5x106 pfu of ΔgD-2 administered im or id. (Figs. 1G-I).
Differences in immunogenicity translate to differences in protection following lethal skin challenge [0072] The prime-boost vaccinated mice were challenged on the skin with a 10 x LD90 dose of the clinical isolate of HSV-2, SD90, which has been previously shown to be consistently lethal in murine models (Dudek, T. E., et ah, Journal of Infectious Diseases 2011, 203, 1434— 1441). Mice were monitored for two weeks for signs of disease and were euthanized if signs of severe skin or neurologic disease were observed as previously described (Figs. 2A-J) (Petro, C., et al, eLife 2015; Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Bum, C., et ah, Journal of Infectious Diseases 2017, 1-5). There was a modest but not significant increase in protection afforded by the adjuvanted protein vaccine when administered id compared to im or sc (Figs. 2A- C), which parallels the increased EFISA and nAb responses (Figs. 1A,1D). Route of administration had no significant impact on survival following 5x104 dose of dl5-29 (Fig. 2E), which was not protective, but both the im and id routes provided greater protection than sc route following 5x105 dose of dl 5-29 (80% versus 20%)(Fig. 2F), which paralleled the significant increase in ADCC (Fig. 1H). All three routes were fully protective at the highest vaccine dose (Fig. 2G). The only breakthrough in survival with ΔgD-2 was observed with a dose of 5x104 administered sc (Fig. 2H). Complete protection against lethality was observed at all other doses and routes (Figs. 2I-J). When examining the association between ADCC and survival across the total population independent of dose, route or vaccine (n=145), 93/96 mice with a 4.5-fold increase in mFcyRIV activation survived compared to 14/49 with < 4.5-fold increase (p<0.0001, chi-square).
[0073] To assess whether the route of vaccination impacted the ability of vaccines to prevent the establishment of latency, HSV viral DNA was quantified in ganglia at the time of death or on day 14 post-challenge. Despite the increase in Ab response following id vaccination with adjuvanted gD protein, there was no reduction in viral DNA recovered from ganglia following any route of immunization. The results with dl5-29 and ΔgD-2 at the 5x105 dose paralleled the disease scores and survival data. Only 1/5 mice immunized im or id compared to 4/5 mice immunized sc with dl5-29 had HSV DNA detected in the ganglia. No viral DNA was recovered in mice vaccinated by any route with the same dose of ΔgD-2 (Figs. 3A-C).
AgD-2 vaccination induces robust CD4 and CD8 T cell memory responses
[0074] To further phenotype the immune response to ΔgD-2 and rgD-2/Alum-MPF which trigger functionally distinct Ab responses, mice were prime-boost vaccinated i.m with 5 x 105 pfu/mouse of ΔgD-2 or 5 μg gD-2-alum/MPL at three week intervals and T cell responses were assessed in the peripheral blood prior to vaccination (Day -1) and at the indicated times post prime and boost. ΔgD-2 induced activated CD4 and CD8 T cells following both prime and boost vaccination as measured by quantifying CDlla+CD49+ CD4 and CD8 T cells. In contrast, there was little detectable T cell response to the adjuvanted protein vaccine (Figs. 4C-D). The splenocytes from these mice were harvested on Day 42 and stimulated with UV-inactivated SD90 or phytohemagglutinin (PHA) as a viability control to assess cytokine responses. Significantly more IFN-γ, TNF and IL-2 producing CD4+ T cells were observed when splenocytes isolated from ΔgD-2, but not rgD-2/alum-MPL vaccinated mice were stimulated with inactivated virus compared to unstimulated cells (Figs. 5B-D). The response was greater than observed with the PHA mitogen. There was also a non-significant increase in cytokine- producing CD8 T cell responses to the AgD- 2 vaccine compared to unstimulated cells (Figs. 5E- G).
Combination of low dose AgD-2 with rgD-2 provides additive protection
[0075] To determine whether the combination of ΔgD-2 and rgD-2/Alum-MPL is beneficial or antagonistic, mice were vaccinated sc with a dose of ΔgD-2 that is not fully protective (5 x 104 pfu/mouse), 5 μg of gD-2-Alum/MPL, or a combination of both vaccines delivered on opposite or the same flank. We used the less efficient route of vaccination to accentuate any potential beneficial effects. Both combinations significantly increased the total HSV-specific antibody response compared to either vaccine alone (Fig. 6A). The combinations had no additive or antagonistic effect on the nAb response to rgD-2/ Alum-MPL (Fig. 6B) or the ADCC response to ΔgD-2 (Fig. 6C) and resulted in 100% protection against a 10 x LD90 skin challenge with HSV-2 (SD90), compared to the 20% and 60% protection observed with administration of rgD-2/ Alum- MPL or ΔgD-2, respectively (Fig. 6D). There was no difference when the combination was administered on opposite or the same flank.
Discussion
[0076] Clinical studies with HSV vaccine candidates have proven disappointing despite promising preclinical data with vaccines designed to elicit neutralizing antibody responses primarily targeting gD. Preclinical studies with ΔgD-2 have challenged the reliance on neutralizing Abs and have demonstrated that subcutaneous vaccination with 105 (or higher) pfu of ΔgD-2 reproducibly provides complete protection against lethal skin, vaginal or ocular challenge with clinical isolates of HSV-1 or HSV-2 (Petro, C, et al, eLife 2015; Petro, C. D., et al, JC1 Insight 2016, 1, 1-15; Bum, C., et al., Journal of Infectious Diseases 2017, 1- 5; Ramsey, N. L. M., et al., J. Virol. 2020). Protection is mediated by ADCC rather than neutralizing Abs, as evidenced by passive transfer studies. Immune serum from ΔgD-2, but not rgD-2/ Alum-MPL vaccinated mice completely protects naive wild-type, but not FcyRIV knockout mice from lethal challenge (Petro, C, et al, eLife 2015; Petro, C. D., et al, JCI Insight 2016, 1, 1-15; Burn, C, et al., Journal of Infectious Diseases 2017, 1- 5; Kao, C. M., et al., Journal of Infectious Diseases 2019, 42, 47-10; Bum Aschner, C., et al, npj Vaccines 2020, 1-33).
[0077] The current studies provide further evidence that ADCC provides a more predictive correlate of immune protection compared to neutralizing responses in mice. The increase in protection observed by increasing the dose and route of delivery of dl5-29 was associated with a significant increase in the ADCC, but not the neutralizing response. Moreover, the only dose and route of vaccination with ΔgD-2 that did not provide 100% protection against a 10xLD90 challenge with SD90, sc immunization with 104 pfu, elicited a mean ADCC response of 2.8-fold (FcyRIV) activation. Only 3 out of 96 mice with a FcyRIV fold increase > 4.5 succumbed to the high dose lethal challenge regardless of vaccine dose or delivery route.
[0078] Both the im and id routes of vaccination induced significantly higher total and/or ADCC responses compared to the sc route. The observation that im and id are more immunogenic than sc is consistent with studies with other vaccines, but a link between route of administration and Ab function (ADCC versus neutralizing) has not been previously described, Improved immunogenicity via the im or id routes could reflect longer antigen retention, differential exposure to antigen presenting cells resident in the dermis and/or greater access to lymphatic drainage (Wahl, M., et al., Scand. J. Infect. Dis. 1987, 19, 617-621; Bryan, J. P., et al., Clin. Infect. Dis. 1992, 14, 697-707; Rahman, F., et al., Hepatology 2000, 31, 521-527; Belshe, R. B„ et al, N Engl J Med 2004, 351, 2286-2294; Van Damme, P„ et al., Vaccine 2009, 27, 454- 459). For example, intramuscular administration of trivalent inactivated influenza vaccine resulted in higher antibody responses than subcutaneous vaccination in elderly subjects (Gillet, Y., et al, BMC Med 2009, 7, 16). However, similar Ab and T cell responses were reported with live attenuated measles, mumps and rubella vaccination delivered sc or im (Laurent, P. E., et al, Vaccine 2010, 28, 5850-5856). Despite technical difficulties delivering consistent doses via the intradermal route, intradermal rabies vaccination has been a standard since the World Health Organization recommendation in 1992 because a lower dose achieves comparable immunogenicity (Dubois, B., et al, Journal of Leukocyte Biology 1999, 66, 224-230). Intradermal vaccination is presumed to activate a stronger dendritic cell- mediated response thus requiring a lower antigenic dose (Peng, S. L., et al., Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 5545— 5550). However, we observed no significant difference in ADCC responses or vaccine protection comparing id or im immunization routes at any of the doses for dl5-29 or ΔgD-2, suggesting that the id route does not provide a dose advantage for these vaccines. We did however observe a statistically significant increase in total HSV-specific Ab responses to the subunit vaccine with the id route of administration, which resulted in a nonsignificant increase in neutralizing titer and in vaccine protection.
[0079] In addition to dose and delivery route, the vaccine composition also influence immunogenicity as evidenced by the exclusive neutralizing response to the gD subunit vaccine, non-neutralizing, FcyR-mediated response to ΔgD-2, and a combination of both neutralizing and non-neutralizing responses elicited by dl5-29. The absence of any neutralizing Ab following AgD- 2 immunization likely reflects the absence of the dominant target of nAbs in mice. In other studies, we found that depletion of the gD-specific Ab from d/5-29 immune serum resulted in a significant reduction in neutralizing, but not ADCC titers, indicating that gD is not a target of the ADCC response (Burn Aschner and Herold, mspt. submitted). IgG subclass switching to IgG2, which has the strongest affinity for mFcyRIV and is associated with ADCC in mice, requires interactions within the germinal center between antigen presenting cells, T cells and B cells (Sattentau, Q, et al, Nat Rev Micro 2008, 6, 815-826). Consistent with the requirement for T cells in the generation of potent ADCC responses, we documented robust activation of CD4 and CD8 T cells after prime and boost vaccination, while gD-2-alum/MPL elicited little T cell activation. Stimulation of the memory T cells harvested from the ΔgD-2, but not rgD-2/alum- MPL vaccinated mice, with inactivated virus result in IFN-g, TNF and IL-2 production, which was particularly robust for CD4+ T cells. These differences support the notion that vigorous T cell responses contribute to the generation of ADCC responses.
[0080] A combination of adjuvanted rgD-2 and a low dose of ΔgD-2 delivered simultaneously at the same or opposite flank did not interfere with the immunogenicity of either vaccine and was more protective than rgD-2-Alum/MPL alone. This is consistent with our superinfection murine studies, which showed that pre-existing gD neutralizing Abs did not interfere with the immunogenicity of ΔgD-2. Vaccination of HSV-1 seropositive mice with AgD- 2 boosted the ADCC (but not the neutralizing) Ab response and resulted in complete protection if the mice were subsequently challenge with a lethal dose of HSV-2 (Burn Aschner, C., et al, npj Vaccines 2020, 1-33). Thus, while nAbs to gD alone are not sufficient to protect mice (or to date, humans), a combination of both types of responses could be beneficial. Without being limited by theory, one reason for the incomplete protection mediated by nAbs may be the ability of HSV to evade neutralization by spreading directly from cell-to cell. However, it is important to note that delivering recombinant gD protein at the same time as ΔgD-2 is different from having gD present in the viral envelope. In other studies, we found that envelope gD interferes with the generation of IgG2 subclass switched Abs through interactions with herpesvirus entry mediator (HVEM), also known as tumor necrosis factor receptor superfamily member 14 (Bum Aschner and Herold, mspt under review). This likely contributes to the lower levels of ADCC generated by dl5-29 as shown in the current study as well as the low levels generated in response to sublethal infection (Kao, C. M., et al, Journal of Infectious Diseases 2019, 42, 47-10; Bum Aschner, C., et al, npj Vaccines 2020, 1-33.
[0081] Taken together, the current studies provide further evidence that ADCC is an important correlate of immune protection. Although we initially hypothesized that the intradermal route of delivery would prove more immunogenic for all three vaccines, this was only observed with the gD protein subunit vaccine. Both im and id routes provided similar antibody responses and protection with ΔgD-2 and dl-5-29 . Overall, ΔgD-2 induced the highest ADCC responses and the most potent protection against lethal challenge and latency.
[0082] The compositions, methods, and articles can alternatively comprise, consist of, or consist essentially of, any appropriate materials, steps, or components herein disclosed. The compositions, methods, and articles can additionally, or alternatively, be formulated so as to be devoid, or substantially free, of any materials (or species), steps, or components, that are otherwise not necessary to the achievement of the function or objectives of the compositions, methods, and articles.
[0083] The terms “first,” “second,” and the like, do not denote any order, quantity, or importance, but rather are used to distinguish one element from another. The terms “a” and “an” and “the” do not denote a limitation of quantity and are to be constmed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. “Or” means “and/or” unless clearly stated otherwise. Reference throughout the specification to “some embodiments”, “an embodiment”, and so forth, means that a particular element described in connection with the embodiment is included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it is to be understood that the described elements may be combined in any suitable manner in the various embodiments. A “combination thereof’ is open and includes any combination comprising at least one of the listed components or properties optionally together with a like or equivalent component or property not listed
[0084] Unless specified to the contrary herein, all test standards are the most recent standard in effect as of the filing date of this application, or, if priority is claimed, the filing date of the earliest priority application in which the test standard appears.
[0085] Unless defined otherwise, technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this application belongs. All cited patents, patent applications, and other references are incorporated herein by reference in their entirety. However, if a term in the present application contradicts or conflicts with a term in the incorporated reference, the term from the present application takes precedence over the conflicting term from the incorporated reference.
[0086] While particular embodiments have been described, alternatives, modifications, variations, improvements, and substantial equivalents that are or may be presently unforeseen may arise to applicants or others skilled in the art. Accordingly, the appended claims as filed and as they may be amended are intended to embrace all such alternatives, modifications variations, improvements, and substantial equivalents.

Claims

CLAIMS: What is claimed is:
1. A method of vaccinating a subject against a herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprising administering to the subject an effective amount of a HSV-2 single-cycle virus and an effective amount of a recombinant HSV- 2 glycoprotein D to vaccinate the subject for the HSV-2 infection or the disease caused by the HSV-2 infection, wherein the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
2. A method of immunizing a subject against a herpes simplex virus-2 (HSV-2) infection or a disease caused by an HSV-2 infection comprising administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to immunize the subject for the HSV-2 infection or the disease caused by the HSV-2 infection, wherein the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
3. A method of treating or preventing a herpes simplex virus-2 (HSV-2) infection in a subject or treating or preventing a disease caused by an HSV-2 infection in a subject, comprising administering to the subject an effective amount of an HSV-2 single-cycle virus and an effective amount of a recombinant HSV-2 glycoprotein D to treat or prevent the HSV-2 infection in the subject or the disease caused by the HSV-2 infection in the subject, wherein the HSV-2 single-cycle virus comprises HSV-2 having a deletion of glycoprotein D-encoding gene in the genome and the HSV-2 is phenotypically complemented with an HSV-1 glycoprotein D on a lipid bilayer of the HSV-2.
4. The method of any one of claims 1-3, wherein the administering of the HSV-2 single-cycle virus and the recombinant HSV-2 glycoprotein D occurs at substantially the same time.
5. The method of any one of claims 1-4, wherein the HSV-2 single-cycle virus and the recombinant HSV-2 glycoprotein D are formulated for separate administration to the subject.
6. The method of any one of claims 1-5, wherein the HSV-2 single-cycle virus and the recombinant HSV-2 glycoprotein D are separately administered to the subject.
7. The method of any one of claims 1-6, wherein the recombinant HSV-2 is adjuvanted recombinant HSV-2 gD.
8. The method of any one of claims 1-7, wherein the administering of the HSV-2 single-cycle vims occurs 1 second to 60 minutes before the administering of the recombinant glycoprotein D.
9. The method of any one of claims 1-8, wherein the administering of the HSV-2 single-cycle vims occurs 1 second to 60 minutes after the administering of the recombinant glycoprotein D.
10. The method of any one of claims 1-9, wherein the HSV-2 single-cycle vims is formulated for subcutaneous, intramuscular, intradermal, or intravaginal administration.
11. The method of any one of claims 1-10, wherein the recombinant HSV-2 glycoprotein D is formulated for subcutaneous, intramuscular, or intradermal administration.
12. The method of any one of claims 1-11, wherein the HSV-2 single-cycle virus and the recombinant HSV-2 glycoprotein D are administered by injection in a same limb of the subject.
13. The method of any one of claims 1-12, wherein the HSV-1 glycoprotein D is not encoded for by the recombinant HSV-2 genome and the HSV-2 is phenotypically complemented with the HSV-1 glycoprotein D by propagating the HSV-2 in a complementing cell expressing the HSV-1 glycoprotein D.
PCT/US2021/035168 2020-05-29 2021-06-01 Methods of using hsv-2 single cycle virus delta-gd and hsv-2 recombinant glycoprotein d Ceased WO2021243328A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
IL298288A IL298288B2 (en) 2020-05-29 2021-06-01 Methods of using hsv-2 single cycle virus delta-gd and hsv-2 recombinant glycoprotein d
KR1020227045772A KR20230044365A (en) 2020-05-29 2021-06-01 Methods of using HSV-2 single cycle virus delta-gD and HSV-2 recombinant glycoprotein D
CA3184459A CA3184459A1 (en) 2020-05-29 2021-06-01 Methods of using hsv-2 single cycle virus delta-gd and hsv-2 recombinant glycoprotein d
AU2021281314A AU2021281314A1 (en) 2020-05-29 2021-06-01 Methods of using HSV-2 single cycle virus delta-gD and HSV-2 recombinant glycoprotein D
JP2022573260A JP7840572B2 (en) 2020-05-29 2021-06-01 Method for using HSV-2 single-cycle virus delta-gD and HSV-2 recombinant glycoprotein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063031816P 2020-05-29 2020-05-29
US63/031,816 2020-05-29

Publications (1)

Publication Number Publication Date
WO2021243328A1 true WO2021243328A1 (en) 2021-12-02

Family

ID=76601821

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/035168 Ceased WO2021243328A1 (en) 2020-05-29 2021-06-01 Methods of using hsv-2 single cycle virus delta-gd and hsv-2 recombinant glycoprotein d

Country Status (7)

Country Link
US (1) US11684670B2 (en)
JP (1) JP7840572B2 (en)
KR (1) KR20230044365A (en)
AU (1) AU2021281314A1 (en)
CA (1) CA3184459A1 (en)
IL (1) IL298288B2 (en)
WO (1) WO2021243328A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021207348A1 (en) * 2020-04-07 2021-10-14 Albert Einstein College Of Medicine Method of treating and preventing ocular disease with hsv-2 delta gd

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013173590A1 (en) * 2012-05-16 2013-11-21 Immune Design Corp. Vaccines for hsv-2
WO2015134368A2 (en) 2014-03-03 2015-09-11 Albert Einstein College Of Medicine Of Yeshiva University Recombinant herpes simplex virus 2 (hsv-2) vaccine vectors
CN104694553B (en) * 2013-12-05 2018-04-17 长春百克生物科技股份公司 Genital herpes vaccine
WO2020081820A1 (en) * 2018-10-17 2020-04-23 Albert Einstein College Of Medicine Method of enhancing antibody-dependent cell-mediated cytotoxicity (adcc)

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013173590A1 (en) * 2012-05-16 2013-11-21 Immune Design Corp. Vaccines for hsv-2
CN104694553B (en) * 2013-12-05 2018-04-17 长春百克生物科技股份公司 Genital herpes vaccine
WO2015134368A2 (en) 2014-03-03 2015-09-11 Albert Einstein College Of Medicine Of Yeshiva University Recombinant herpes simplex virus 2 (hsv-2) vaccine vectors
WO2020081820A1 (en) * 2018-10-17 2020-04-23 Albert Einstein College Of Medicine Method of enhancing antibody-dependent cell-mediated cytotoxicity (adcc)

Non-Patent Citations (35)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO.
BELSHE, R. B. ET AL., N ENGL J MED, vol. 351, 2004, pages 2286 - 2294
BELSHE, R. B. ET AL., N ENGL J MED, vol. 366, 2012, pages 34 - 43
BERNARD, M.-C. ET AL., PLOS ONE, vol. 10, 2015, pages e0121518 - 21
BRYAN, J. P. ET AL., CLIN. INFECT. DIS., vol. 14, 1992, pages 697 - 707
BURN ASCHNER, C. ET AL., NPJ VACCINES, 2020, pages 1 - 33
BURN, C. ET AL., JOURNAL OF INFECTIOUS DISEASES, 2017, pages 1 - 5
C. S. MORELLO ET AL: "Immunization with Herpes Simplex Virus 2 (HSV-2) Genes plus Inactivated HSV-2 Is Highly Protective against Acute and Recurrent HSV-2 Disease", JOURNAL OF VIROLOGY, vol. 85, no. 7, 26 January 2011 (2011-01-26), pages 3461 - 3472, XP055142132, ISSN: 0022-538X, DOI: 10.1128/JVI.02521-10 *
CHRISTOPHER PETRO: "Herpes simplex type 2 virus deleted in glycoprotein D protects against vaginal, skin and neural disease", ELIFE, vol. 4, 10 March 2015 (2015-03-10), pages 1 - 18, XP055682541, DOI: 10.7554/eLife.06054 *
DA COSTA, X. J. E. A. ET AL., J. VIROL., vol. 74, 2000, pages 7963 - 7971
DA COSTA, X. J. E. A. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 96, 1999, pages 6994 - 6998
DA COSTA, X. J. E. A. ET AL., VIROLOGY, vol. 288, 2001, pages 256 - 263
DROPULIC, L. K. ET AL., JOURNAL OF INFECTIOUS DISEASES, vol. 220, 2019, pages 990 - 1000
DUBOIS, B. ET AL., JOURNAL OF LEUKOCYTE BIOLOGY, vol. 66, 1999, pages 224 - 230
DUDEK, T. E. ET AL., JOURNAL OF INFECTIOUS DISEASES, vol. 203, 2011, pages 1434 - 1441
GILLET, Y. ET AL., BMC MED, vol. 7, 2009, pages 16
HOSHINO, Y. ET AL., J. VIROL., vol. 79, 2004, pages 410 - 418
HOSHINO, Y. ET AL., JOURNAL OF INFECTIOUS DISEASES, vol. 200, 2009, pages 1088 - 1095
HOSHINO, Y. ET AL., VACCINE, vol. 26, 2008, pages 4034 - 4040
LAFFERTY, W. E. ET AL., JOURNAL OF INFECTIOUS DISEASES, vol. 181, 2000, pages 1454 - 1457
LAURENT, P. E. ET AL., VACCINE, vol. 28, 2010, pages 5850 - 5856
LIGAS, M. W. ET AL., J. VIROL., vol. 62, 1988, pages 1486 - 1494
NAMVAR, L. ET AL., JOURNAL OF CLINICAL MICROBIOLOGY, vol. 43, 2005, pages 2058 - 2064
PENG, S. L. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 99, 2002, pages 5545 - 5550
PETRO, C. D. ET AL., JCI INSIGHT, vol. 1, 2016, pages 1 - 15
PETRO, C. ET AL., ELIFE, 2015
RAHMAN, F. ET AL., HEPATOLOGY, vol. 31, 2000, pages 521 - 527
RAMSEY, N. L. M. ET AL., J. VIROL., 2020
ROBERTS, C. M. ET AL., SEXUALLY TRANSMITTED DISEASES, vol. 30, 2003, pages 797 - 800
SATTENTAU, Q ET AL., NAT REV MICRO, vol. 6, 2008, pages 815 - 826
STANBERRY, L. R ET AL., N ENGL J MED, vol. 347, 2002, pages 1652 - 1661
VAN DAMME, P. ET AL., VACCINE, vol. 27, 2009, pages 454 - 459
WAHL, M. ET AL., SCAND. J. INFECT. DIS., vol. 19, 1987, pages 617 - 621
XU, F. ET AL., JAMA, vol. 296, 2006, pages 964 - 973
ZHANG PENGWEI ET AL: "A Herpes Simplex Virus 2 (HSV-2) Glycoprotein D expressing Nonreplicating Dominant-Negative HSV-2 Virus Vaccine Is Superior to a gD2 Subunit Vaccine against HSV-2 Genital Infection in Guinea Pigs", PLOS ONE, 30 June 2014 (2014-06-30), pages 1 - 9, XP055839731, Retrieved from the Internet <URL:https://storage.googleapis.com/plos-corpus-prod/10.1371/journal.pone.0101373/1/pone.0101373.pdf?X-Goog-Algorithm=GOOG4-RSA-SHA256&X-Goog-Credential=wombat-sa%40plos-prod.iam.gserviceaccount.com%2F20210909%2Fauto%2Fstorage%2Fgoog4_request&X-Goog-Date=20210909T152136Z&X-Goog-Expires=86400&X-Goog-Signe> [retrieved on 20210909], DOI: 10.1371/journal.pone *

Also Published As

Publication number Publication date
JP7840572B2 (en) 2026-04-06
IL298288B2 (en) 2025-03-01
US20210369838A1 (en) 2021-12-02
JP2023527546A (en) 2023-06-29
US11684670B2 (en) 2023-06-27
CA3184459A1 (en) 2021-12-02
AU2021281314A1 (en) 2022-12-22
IL298288A (en) 2023-01-01
IL298288B1 (en) 2024-11-01
KR20230044365A (en) 2023-04-04

Similar Documents

Publication Publication Date Title
AU2020217310B2 (en) Recombinant herpes simplex virus 2 (hsv-2) vaccine vectors
US8501194B2 (en) Vaccine for viruses that cause persistent or latent infections
JP6109165B2 (en) Herpesvirus vaccines and methods of use
Morello et al. Inactivated HSV-2 in MPL/alum adjuvant provides nearly complete protection against genital infection and shedding following long term challenge and rechallenge
US11229697B2 (en) Vaccines against genital herpes simplex infections
US11684670B2 (en) Methods of using HSV-2 single cycle virus delta-gD and HSV-2 recombinant glycoprotein D
US10918712B2 (en) Passive transfer of immunity using recombinant herpes simplex virus 2 (HSV-2) vaccine vectors
IL284448B2 (en) Passive transfer of immunity using recombinant herpes simplex virus 2 vectors
Bernstein et al. A vaccine containing highly purified virus particles in adjuvant provides high level protection against genital infection and disease in guinea pigs challenged intravaginally with homologous and heterologous strains of herpes simplex virus type 2
US20220088185A1 (en) Passive transfer of immunity using recombinant herpes simplex virus 2 (hsv-2) vaccine vectors
US20150147355A1 (en) Compositions and Methods of Vaccination
CA2942166C (en) Recombinant herpes simplex virus 2 (hsv-2) vaccine vectors
WO2021207348A1 (en) Method of treating and preventing ocular disease with hsv-2 delta gd
HK1229721B (en) Recombinant herpes simplex virus 2 (hsv-2) vaccine vectors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21734711

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3184459

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022573260

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021281314

Country of ref document: AU

Date of ref document: 20210601

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202217076413

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21734711

Country of ref document: EP

Kind code of ref document: A1