WO2021237292A1 - Methods of assessing risk of developing a severe response to coronavirus infection - Google Patents

Methods of assessing risk of developing a severe response to coronavirus infection Download PDF

Info

Publication number
WO2021237292A1
WO2021237292A1 PCT/AU2021/050507 AU2021050507W WO2021237292A1 WO 2021237292 A1 WO2021237292 A1 WO 2021237292A1 AU 2021050507 W AU2021050507 W AU 2021050507W WO 2021237292 A1 WO2021237292 A1 WO 2021237292A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
human
risk
coefficient
assigned
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2021/050507
Other languages
French (fr)
Inventor
Gillian Sue Dite
Nicholas Mark Murphy
Richard Allman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetic Technologies Ltd
Original Assignee
Genetic Technologies Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2020901739A external-priority patent/AU2020901739A0/en
Priority to IL298097A priority Critical patent/IL298097A/en
Priority to AU2021281702A priority patent/AU2021281702A1/en
Priority to EP21813074.8A priority patent/EP4158067A4/en
Priority to CN202180048201.7A priority patent/CN116134152A/en
Priority to JP2022572759A priority patent/JP2023527834A/en
Application filed by Genetic Technologies Ltd filed Critical Genetic Technologies Ltd
Priority to KR1020227045938A priority patent/KR20230019872A/en
Priority to MX2022014931A priority patent/MX2022014931A/en
Priority to CA3179313A priority patent/CA3179313A1/en
Priority to US17/368,471 priority patent/US11257569B1/en
Publication of WO2021237292A1 publication Critical patent/WO2021237292A1/en
Priority to US17/667,282 priority patent/US20220246242A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/20Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/40Population genetics; Linkage disequilibrium
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16HHEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
    • G16H10/00ICT specially adapted for the handling or processing of patient-related medical or healthcare data
    • G16H10/40ICT specially adapted for the handling or processing of patient-related medical or healthcare data for data related to laboratory analysis, e.g. patient specimen analysis
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16HHEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
    • G16H10/00ICT specially adapted for the handling or processing of patient-related medical or healthcare data
    • G16H10/60ICT specially adapted for the handling or processing of patient-related medical or healthcare data for patient-specific data, e.g. for electronic patient records
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16HHEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
    • G16H50/00ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
    • G16H50/30ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indices; for individual health risk assessment
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16HHEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
    • G16H50/00ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
    • G16H50/70ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/12Pulmonary diseases
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/26Infectious diseases, e.g. generalised sepsis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/50Determining the risk of developing a disease
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/56Staging of a disease; Further complications associated with the disease

Definitions

  • the present disclosure relates to methods and systems for assessing the risk of a human subject developing a severe response to a coronavirus infection such as a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) viral infection.
  • a coronavirus infection such as a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) viral infection.
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
  • viral infections are complex multifactorial diseases like many cancers, cardiovascular disease and diabetes.
  • the Coronavirus is an Alphacoronavirus, Betacoronavirus, Gammacoronavirus or an Deltacoronavirus.
  • the Coronavirus is a Betacoronavirus.
  • the Coronavirus is Severe acute respiratory syndrome-related coronavirus (SARS-CoV or SARS-CoV-2), Middle East respiratory syndrome-related coronavirus (MERS), Human coronavirus OC43 or Human coronavirus HKU 1.
  • the Coronavirus is Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
  • the method comprises detecting the presence of at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection.
  • the polymorphisms are selected from Tables 1 to 6, 8, 19 or 22 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the method at least comprises detecting polymorphisms at one or more or all of rs10755709, rs112317747, rs112641600, rs118072448, rs2034831, rs7027911 and rs71481792, or a polymorphism in linkage disequilibrium with one or more thereof.
  • the polymorphisms are selected from Table 1, Table 6a, Table 6b or a polymorphism in linkage disequilibrium with one or more thereof.
  • the polymorphisms are selected from Table 3 or a polymorphism in linkage disequilibrium with one or more thereof. In an embodiment, at least three polymorphisms are analysed.
  • polymorphisms are selected from Table 2 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the polymorphisms are selected from Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the clinical risk assessment is based only on one or more or all of age, body mass index, loss of taste, loss of smell and smoking status.
  • the clinical risk assessment includes obtaining information from the subject on one or more or all of: age, gender, race/ethnicity, blood type, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
  • the autoimmune disease is rheumatoid arthritis, lupus or psoriasis.
  • the clinical risk assessment includes obtaining information from the subject on one or more or all of: age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus, the method comprising detecting, in a biological sample derived from the human subject, the presence of a polymorphism provided in any one of Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium therewith.
  • the polymorphism is provided in Table 19 and/or 22 or is a polymorphism in linkage disequilibrium therewith.
  • the polymorphism is provided in Table 3, Table 6, is rs2274122, is rs1868132, is rs11729561, is rs1984162, is rs8105499 or is a polymorphism in linkage disequilibrium therewith.
  • the present invention provides a method of determining the identity of the alleles of fewer than 100,000 polymorphisms in a human subject selected from the group of subjects consisting of humans in need of assessment for the risk of developing a severe response to a Coronavirus infection to produce a polymorphic profile of the subject, comprising
  • step (iii) producing the polymorphic profile of the subject screening based on the identity of the alleles analysed in step (ii), wherein fewer than 100,000 polymorphisms are selected for allelic identity analysis in step (i) and the same fewer than 100,000 polymorphisms are analysed in step (ii).
  • the human subject can be Caucasian, African American, Hispanic, Asian, Indian, or Latino. In a preferred embodiment, the human subject is Caucasian.
  • the method further comprises obtaining the biological sample.
  • the polymorphism(s) in linkage disequilibrium has linkage disequilibrium above 0.9. In another embodiment, the polymorphism(s) in linkage disequilibrium has linkage disequilibrium of 1.
  • the method comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • the method comprises obtaining information from the subject on one or more of all of age, gender, race/ethnicity, blood type, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
  • the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising i) performing a genetic risk assessment of the human subject, wherein the genetic risk assessment involves detecting, in a biological sample derived from the human subject, polymorphisms at rs10755709, rs112317747, rs112641600, rs118072448, rs2034831, rs7027911 and rs71481792, ii) performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the
  • the subject is between 18 and 49 years of age and a) a ⁇ coefficient of - 1.3111 is assigned if the subject is between 18 and 29 years of age; b) a ⁇ coefficient of -0.8348 is assigned if the subject is between 30 and 39 years of age; c) a ⁇ coefficient of -0.4038 is assigned if the subject is between 40 and 49 years of age; d) a ⁇ coefficient of 0.2444891 is assigned if the subject is male; e) a ⁇ coefficient of 0.29311 is assigned if the subject is an ethnicity other than Caucasian; f) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m 2 ) divided by kg, which is multiplied by -1.602056 to provide the ⁇ coefficient to be assigned; g) a ⁇ coefficient of 0.4041337 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; h) a ⁇ coefficient of 0.
  • step iii) the genetic risk assessment is combined with the clinical risk assessment using the following formula:
  • a ⁇ coefficient of 0.3950113 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; i) a ⁇ coefficient of 0.6650257 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; j) a ⁇ coefficient of 0.4126633 is assigned if the subject has ever been diagnosed as having diabetes; k) a ⁇ coefficient of 1.001079 is assigned if the subject has ever been diagnosed as having haematological cancer; l) a ⁇ coefficient of 0.2640989 is assigned if the subject has ever been diagnosed as having hypertension; m) a ⁇ coefficient of 0.2381579 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; n) a ⁇ coefficient of 1.148496 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma); o) a ⁇ coefficient of -0.229737 is assigned if the subject has
  • step iii) the genetic risk assessment is combined with the clinical risk assessment using the following formula:
  • a method of the invention further comprises determining the probability the subject would require hospitalisation if infected with a Coronavirus using the following formula: e LO /(1+e LO ), which is then multiplied by 100 to obtain a percent chance of hospitalisation being required.
  • the present invention provides a method for determining the need for routine diagnostic testing of a human subject for a Coronavirus infection comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using a method of the invention.
  • the present invention provides a method for preventing or reducing the risk of a severe response to a Coronavirus infection in a human subject, the method comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using a method of the invention, and if they are assessed as having a risk for developing a severe response to a Coronavirus infection
  • the present invention provides an anti-Coronavirus infection therapy for use in preventing a severe response to a Coronavirus infection in a human subject at risk thereof, wherein the subject is assessed as having a risk for developing a severe response to a Coronavirus infection using a method of the invention.
  • anti-Coronavirus therapies such as anti-SARS-CoV-2 virus therapies
  • any therapy shown to be successful can be used in the above methods.
  • Possible examples include, but are not limited to, intubation to assist breathing, an anti-Coronavirus - such as anti- SARS-CoV-2 virus - vaccine, convalescent plasma (plasma from people who have been infected, developed antibodies to the virus, and have then recovered), chloroquine, hydroxychloroquine (with or without zinc), Favipiravir, Remdesivir, Ivermectin, Quercetin, Kaletra (lopinavir/ritonavir), Arbidol, Baricitinib, CM4620-IE, an IL-6 inhibitor, Tocilizumab and stem cells such as mesenchymal stem cells.
  • the therapy is Vitamin D.
  • Other examples of therapy include, Dexamethasone (or other corticosteroids such as prednisone, methylprednisolone, or hydrocortisone), Baricitinib in combination with remdesivir, anticoagulation drugs ("blood thinners"), bamlanivimab and etesevimab, convalescent plasma, tocilizumab with corticosteroids, Casirivimab and Imdevimab, Atorvastatin, GRP78 and siRNA- nanoparticle formulations.
  • Dexamethasone or other corticosteroids such as prednisone, methylprednisolone, or hydrocortisone
  • Baricitinib in combination with remdesivir anticoagulation drugs ("blood thinners")
  • bamlanivimab and etesevimab convalescent plasma
  • tocilizumab with corticosteroids Casirivimab and Imdev
  • the present invention can thus be used to determine who is at most risk, and the anti-Coronavirus therapy (such as a vaccine) first administered to people assessed as likely to develop a severe response to a Coronavirus infection.
  • the vaccine is an mRNA vaccine. In an embodiment, the vaccine is a protein vaccine.
  • vaccines that can be administered include, but are not limited to, the Pfizer-BioNTech vaccine, the Modema vaccine, the Johnson & Johnson vaccine, the Oxford-AstraZeneca vaccine and the Novavax vaccine (see, for example, Katella, 2021).
  • the present invention provides a method for stratifying a group of human subjects for a clinical trial of a candidate therapy, the method comprising assessing the individual risk of the subjects for developing a severe response to a Coronavirus infection using a method of the invention, and using the results of the assessment to select subjects more likely to be responsive to the therapy.
  • a kit comprising at least two sets of primers for amplifying two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from any one of Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
  • the present invention provides a genetic array comprising at least two sets of probes for hybridising to two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from any one of Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
  • the array comprises probes hybridising to nucleic acids comprising each of the polymorphisms provided in Table 4, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
  • the present invention provides a computer implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving genetic risk data for the human subject, wherein the genetic risk data was obtained by a method of the invention; processing the data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
  • the present invention provides a computer implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving clinical risk data and genetic risk data for the human subject, wherein the clinical risk data and genetic risk data were obtained by a method of the invention; processing the data to combine the clinical risk data with the genetic risk data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
  • the present invention provides a computer-implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving at least one clinical variable associated with the human subject, wherein at least one clinical variable was obtained by a method of the invention; processing the data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
  • processing the data is performed using a risk assessment model, where the risk assessment model has been trained using a training dataset comprising data relating to Coronavirus infection response severity and the genetic data and/or clinical data.
  • the method further comprises displaying or communicating the risk to a user.
  • the present invention provides a system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a genetic risk assessment of the human subject according to a method of the invention; and system instructions to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
  • the present invention provides a system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a clinical risk assessment and a genetic risk assessment of the human subject according to a method of the invention; and system instructions for combining the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
  • the present invention provides a system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a clinical risk assessment of the human subject using the method according to any one of claims 20 to 26 or 36 to 39; and system instructions to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
  • the risk data for the subject is received from a user interface coupled to the computing system. In another embodiment, the risk data for the subject is received from a remote device across a wireless communications network. In another embodiment, the user interface or remote device is a SNP array platform. In another embodiment, outputting comprises outputting information to a user interface coupled to the computing system. In another embodiment, outputting comprises transmitting information to a remote device across a wireless communications network.
  • composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
  • Receiver operating characteristic curves for models with different amounts of information were 0.786 for the combined model, 0.723 for the clinical model, 0.680 for the SNP score, and 0.635 for the age and sex model.
  • Coronavirus is a group of related RNA viruses that typically cause diseases in mammals and birds, such as respiratory tract infections in humans. Coronaviruses constitute the subfamily Orthocoronavirinae in the family Coronaviridae . Coronaviruses are enveloped viruses with a positive-sense single -stranded RNA genome and a nucleocapsid of helical symmetry. Coronaviruses have characteristic club-shaped spikes that project from their surface.
  • Coronaviruses which cause disease in humans include, but are not necessarily limited to, Severe acute respiratory syndrome-related coronavirus (SARS-CoV or SARS-CoV-2), Middle East respiratory syndrome-related coronavirus (MERS), Human coronavirus OC43, Human coronavirus HKU1, Human coronavirus 229E and Human coronavirus NL63.
  • SARS-CoV or SARS-CoV-2 Severe acute respiratory syndrome-related coronavirus
  • MERS Middle East respiratory syndrome-related coronavirus
  • Human coronavirus OC43 Human coronavirus HKU1
  • Human coronavirus 229E Human coronavirus NL63.
  • the SARS-CoV-2 the strain is selected from, but not limited to, the L strain, the S strain, the V strain, the G strain, the GR strain, the GH strain, hCoV- 19/Australia/VIC01/2020, BetaCoV/Wuhan/WIV04/2019, B.l.1.7 variant, B.1.351 variant, B.1.427 variant, B.1.429 variant and P.l variant.
  • a severe response to a Coronavirus infection encompasses any factor, or a symptom thereof, considered by a medical practitioner that would warrant the subject being hospitalised, the subject’s life being at risk, or the subject requiring assistance to breath.
  • symptoms of a severe response to a Coronavirus infection include, but are not limited to, difficulty breathing or shortness of breath, chest pain or pressure, loss of speech or loss of movement.
  • a phenotype that displays a predisposition for a severe response to a Coronavirus infection can, for example, show a higher likelihood that a severe response to a Coronavirus infection will develop in an individual with the phenotype than in members of a relevant general population under a given set of environmental conditions (diet, physical activity regime, geographic location, etc.).
  • biological sample refers to any sample comprising nucleic acids, especially DNA, from or derived from a human patient, e.g., bodily fluids (blood, saliva, urine etc.), biopsy, tissue, and/or waste from the patient.
  • tissue biopsies, stool, sputum, saliva, blood, lymph, or the like can easily be screened for polymorphisms, as can essentially any tissue of interest that contains the appropriate nucleic acids.
  • the biological sample is a cheek cell sample. These samples are typically taken, following informed consent, from a patient by standard medical laboratory methods.
  • the sample may be in a form taken directly from the patient, or may be at least partially processed (purified) to remove at least some non- nucleic acid material.
  • gender and “sex” are used interchangeably and refer to an individual’s biological reproductive anatomy. In an embodiment, an individual’s gender/sex is self-identified.
  • human subject As used herein, “human subject”, “human” and subject” are used interchangeably and refer to the individual being assessed for risk of developing a severe response to a coronavirus infection.
  • a "polymorphism” is a locus that is variable; that is, within a population, the nucleotide sequence at a polymorphism has more than one version or allele.
  • One example of a polymorphism is a "single nucleotide polymorphism” (SNP), which is a polymorphism at a single nucleotide position in a genome (the nucleotide at the specified position varies between individuals or populations).
  • SNP single nucleotide polymorphism
  • Other examples include a deletion or insertion of one or more base pairs at the polymorphism locus.
  • allele refers to one of two or more different nucleotide sequences that occur or are encoded at a specific locus, or two or more different polypeptide sequences encoded by such a locus. For example, a first allele can occur on one chromosome, while a second allele occurs on a second homologous chromosome, e.g., as occurs for different chromosomes of a heterozygous individual, or between different homozygous or heterozygous individuals in a population.
  • An allele "positively” correlates with a trait when it is linked to it and when presence of the allele is an indicator that the trait or trait form will occur in an individual comprising the allele.
  • An allele “negatively” correlates with a trait when it is linked to it and when presence of the allele is an indicator that a trait or trait form will not occur in an individual comprising the allele.
  • a marker polymorphism or allele is "correlated" or "associated” with a specified phenotype (a severe response to a Coronavirus infection susceptibility, etc.) when it can be statistically linked (positively or negatively) to the phenotype.
  • Methods for determining whether a polymorphism or allele is statistically linked are known to those in the art. That is, the specified polymorphism occurs more commonly in a case population (e.g., a severe response to a Coronavirus infection patients) than in a control population (e.g., individuals that do not have a severe response to a Coronavirus infection). This correlation is often inferred as being causal in nature, but it need not be, simple genetic linkage to (association with) a locus for a trait that underlies the phenotype is sufficient for correlation/association to occur.
  • LD linkage disequilibrium
  • D' Lewontin's parameter of association
  • r Pearson correlation coefficient
  • Linkage disequilibrium is calculated following the application of the expectation maximization algorithm (EM) for the estimation of haplotype frequencies (Slatkin and Excoffier, 1996).
  • LD (r 2 ) values according to the present disclosure for neighbouring genotypes/loci are selected above 0.1, preferably, above 0.2, more preferable above 0.5, more preferably, above 0.6, still more preferably, above 0.7, preferably, above 0.8, more preferably above 0.9, ideally about 1.0.
  • LOD stands for "logarithm of the odds”, a statistical estimate of whether two genes, or a gene and a disease gene, are likely to be located near each other on a chromosome and are therefore likely to be inherited.
  • a LOD score of between about 2 - 3 or higher is generally understood to mean that two genes are located close to each other on the chromosome.
  • polymorphisms in linkage disequilibrium with the polymorphisms of the present disclosure can have a specified genetic recombination distance of less than or equal to about 20 centimorgan (cM) or less. For example, 15 cM or less, 10 cM or less, 9 cM or less, 8 cM or less, 7 cM or less, 6 cM or less, 5 cM or less, 4 cM or less, 3 cM or less, 2 cM or less, 1 cM or less, 0.75 cM or less, 0.5 cM or less, 0.25 cM or less, or 0.1 cM or less.
  • centimorgan centimorgan
  • two linked loci within a single chromosome segment can undergo recombination during meiosis with each other at a frequency of less than or equal to about 20%, about 19%, about 18%, about 17%, about 16%, about 15%, about 14%, about 13%, about 12%, about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, about 0.75%, about 0.5%, about 0.25%, or about 0.1% or less.
  • polymorphisms in linkage disequilibrium with the polymorphisms of the present disclosure are within at least 100 kb (which correlates in humans to about 0.1 cM, depending on local recombination rate), at least 50 kb, at least 20 kb or less of each other.
  • surrogate markers for a particular polymorphism involves a simple strategy that presumes that polymorphisms surrounding the target polymorphism are in linkage disequilibrium and can therefore provide information about disease susceptibility.
  • surrogate markers can therefore be identified from publicly available databases, such as HAPMAP, by searching for polymorphisms fulfilling certain criteria which have been found in the scientific community to be suitable for the selection of surrogate marker candidates (see, for example, Table 6a which provides surrogates of the polymorphisms in Table 3, and Table 6b which provides surrogates of the polymorphisms in Table 4).
  • Allele frequency refers to the frequency (proportion or percentage) at which an allele is present at a locus within an individual, within a line or within a population of lines. For example, for an allele “A,” diploid individuals of genotype “AA,””Aa,” or “aa” have allele frequencies of 1.0, 0.5, or 0.0, respectively. One can estimate the allele frequency within a line or population (e.g., cases or controls) by averaging the allele frequencies of a sample of individuals from that line or population. Similarly, one can calculate the allele frequency within a population of lines by averaging the allele frequencies of lines that make up the population. In an embodiment, the term “allele frequency” is used to define the minor allele frequency (MAF). MAF refers to the frequency at which the least common allele occurs in a given population.
  • MAF refers to the frequency at which the least common allele occurs in a given population.
  • An individual is “homozygous” if the individual has only one type of allele at a given locus (e.g., a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes).
  • An individual is “heterozygous” if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles).
  • the term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.
  • locus is a chromosomal position or region.
  • a polymorphic locus is a position or region where a polymorphic nucleic acid, trait determinant, gene or marker is located.
  • a "gene locus” is a specific chromosome location (region) in the genome of a species where a specific gene can be found.
  • a marker locus can be used to monitor segregation of alleles at a locus, such as a quantitative trait locus (QTL), that are genetically or physically linked to the marker locus.
  • QTL quantitative trait locus
  • a "marker allele,” alternatively an “allele of a marker locus” is one of a plurality of polymorphic nucleotide sequences found at a marker locus in a population that is polymorphic for the marker locus.
  • Each of the identified markers is expected to be in close physical and genetic proximity (resulting in physical and/or genetic linkage) to a genetic element, e.g., a QTL, that contributes to the relevant phenotype.
  • Markers corresponding to genetic polymorphisms between members of a population can be detected by methods well-established in the art. These include, e.g., DNA sequencing, PCR-based sequence specific amplification methods, detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, detection of allele specific hybridization (ASH), detection of single nucleotide extension, detection of amplified variable sequences of the genome, detection of self- sustained sequence replication, detection of simple sequence repeats (SSRs), detection of single nucleotide polymorphisms (SNPs), or detection of amplified fragment length polymorphisms (AFLPs).
  • DNA sequencing PCR-based sequence specific amplification methods
  • RFLP restriction fragment length polymorphisms
  • ASH allele specific hybridization
  • SSRs simple sequence repeats
  • SNPs single nucleotide polymorphisms
  • AFLPs amplified fragment length polymorphisms
  • a “gene” is one or more sequence(s) of nucleotides in a genome that together encode one or more expressed molecules, e.g., an RNA, or polypeptide.
  • the gene can include coding sequences that are transcribed into RNA which may then be translated into a polypeptide sequence, and can include associated structural or regulatory sequences that aid in replication or expression of the gene.
  • Genotype is the genetic constitution of an individual (or group of individuals) at one or more genetic loci. Genotype is defined by the allele(s) of one or more known loci of the individual, typically, the compilation of alleles inherited from its parents.
  • haplotype is the genotype of an individual at a plurality of genetic loci on a single DNA strand.
  • the genetic loci described by a haplotype are physically and genetically linked, i.e., on the same chromosome strand.
  • a "set" of markers (polymorphisms), probes or primers refers to a collection or group of markers probes, primers, or the data derived therefrom, used for a common purpose, e.g., identifying an individual with a specified genotype (e.g., risk of developing a severe response to a Coronavirus infection).
  • data corresponding to the markers, probes or primers, or derived from their use is stored in an electronic medium. While each of the members of a set possess utility with respect to the specified purpose, individual markers selected from the set as well as subsets including some, but not all of the markers, are also effective in achieving the specified purpose.
  • polymorphisms and genes, and corresponding marker probes, amplicons or primers described above can be embodied in any system herein, either in the form of physical nucleic acids, or in the form of system instructions that include sequence information for the nucleic acids.
  • the system can include primers or amplicons corresponding to (or that amplify a portion of) a gene or polymorphism described herein.
  • the set of marker probes or primers optionally detects a plurality of polymorphisms in a plurality of said genes or genetic loci.
  • the set of marker probes or primers detects at least one polymorphism in each of these polymorphisms or genes, or any other polymorphism, gene or locus defined herein.
  • Any such probe or primer can include a nucleotide sequence of any such polymorphism or gene, or a complementary nucleic acid thereof, or a transcribed product thereof (e.g., a nRNA or mRNA form produced from a genomic sequence, e.g., by transcription or splicing).
  • ROC Receiveiver operating characteristic curves
  • TPR true positive rate
  • FPR false positive rate
  • the phrase “combining the first clinical risk assessment and the genetic risk assessment” refers to any suitable mathematical analysis relying on the results of the assessments.
  • the results of the first clinical risk assessment and the genetic risk assessment may be added, more preferably multiplied.
  • routinely screening for a severe response to a Coronavirus infection and “more frequent screening” are relative terms, and are based on a comparison to the level of screening recommended to a subject who has no identified risk of developing a severe response to a Coronavirus infection.
  • a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection of the invention involves detecting the presence of a polymorphism provided in any one of Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium therewith.
  • a method of the invention involves a genetic risk assessment performed by analysing the genotype of the subject at two or more loci for polymorphisms associated with a severe response to a Coronavirus infection.
  • Various exemplary polymorphisms associated with a severe response to a Coronavirus infection are discussed in the present disclosure. These polymorphisms vary in terms of penetrance and many would be understood by those of skill in the art to be low penetrance polymorphisms.
  • the odds ratio is greater than 1.02.
  • Each polymorphism which decreases the risk of developing a severe response to a Coronavirus infection has an odds ratio of association with a severe response to a Coronavirus infection of less than 1.0. In an embodiment, the odds ratio is less than 0.98.
  • Examples of such polymorphisms include, but are not limited to, those provided in Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium with one or more thereof.
  • the genetic risk assessment involves assessing polymorphisms associated with increased risk of developing a severe response to a Coronavirus infection.
  • the genetic risk assessment involves assessing polymorphisms associated with decreased risk of developing a severe response to a Coronavirus infection. In another embodiment, the genetic risk assessment involves assessing polymorphisms associated with an increased risk of developing a severe response to a Coronavirus infection and polymorphisms associated with a decreased risk of developing a severe response to a Coronavirus infection. Table 1 - Informative polymorphisms of the invention. osome Position Alleles p-value for
  • Table 4 - Informative polymorphisms used in genetic risk assessment of Example 5 - 64 polymorphism panel. All SNPs are from the COVID-19 Host Genetics Initiative meta-analysis of hospitalisation vs non-hospitalisation except for rs 11385942 and rs657152, which are from Ellinghaus et al. (2020).
  • Part B provides surrogate markers for rs115492982.
  • At least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are analysed.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided in Tables 1 to 3, 5a or 6, Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium with one or more thereof.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided Table 1 and Table 6a or a polymorphism in linkage disequilibrium with one or more thereof.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 polymorphisms or at least 306 associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided Table 1 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided Table 2 and Table 6a or a polymorphism in linkage disequilibrium with one or more thereof.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 2 or Table 6a or a polymorphism in linkage disequilibrium with one or more thereof.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 2 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50 or at least 60 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 4 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 2 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 19 or a polymorphism in linkage disequilibrium with one or more thereof.
  • the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 22 or a polymorphism in linkage disequilibrium with one or more thereof.
  • Table 6a provides examples of linked loci for the polymorphisms listed in Table 3.
  • Table 6b provides examples of linked loci for the polymorphisms listed in Table 4 which are not provided in Table 6a.
  • Such linked polymorphisms for the other polymorphisms listed in Table 1 can very easily be identified by the skilled person using the HAPMAP database.
  • the A1 or Allele 1 is the risk (minor allele) associated allele.
  • the risk allele may be associated with a decreased or increased risk as described herein.
  • the terms “A1” and “Allele 1” are used interchangeably.
  • the terms “A2” and “Allele 2” are used interchangeably.
  • the method further comprises detecting at least one other polymorphism provided in any one of Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium therewith.
  • genotype relative risk can be defined as the product of genotype relative risk values for each polymorphism assessed.
  • a log-additive risk model can then be used to define three genotypes AA, AB and BB for a polymorphism having relative risk values of 1, OR, and OR 2 , under a rare disease model, where OR is the previously reported disease odds ratio for the high-risk allele, B, vs the low-risk allele, A. If the B allele has frequency (p), then these genotypes have population frequencies of (1 - p) 2 , 2p(l - p), and p 2 , assuming Hardy-Weinberg equilibrium. The genotype relative risk values for each polymorphism can then be scaled so that based on these frequencies the average relative risk in the population is 1. Specifically, given the unsealed population average relative risk for each SNP:
  • PRS ⁇ 1 x ⁇ 2 x 2 + . . . . ⁇ K x K + ⁇ n x n
  • ⁇ k is the per-allele log odds ratio (OR) for the minor allele for SNP ⁇
  • x K the number of alleles for the same SNP (0, 1 or 2)
  • n is the total number of SNPs
  • PRS is the polygenic risk score (which can also be referred to as composite SNP risk). Similar calculations can be performed for non-SNP polymorphisms or a combination thereof.
  • the magnitude of effect of each risk allele is not used when calculating the genetic risk score. More specifically, allele counting as generally described in WO 2005/086770 is used. For example, in one embodiment if the subject was homozygous for the risk allele they were scored as 2, if they were heterozygous for the risk allele they were scored as 1, and if they were homozygous for the risk allele they were scored as 0. As the skilled person would appreciate, alternate values such as 1, 0.5 and 0 respectively, could be used.
  • the percent of risk alleles present out of the total possible number of loci analysed is used to produce the genetic risk score.
  • the subject may have at most 128 risk alleles. If a subject had 64 out of these 128 alleles, they would have 50% of the total possible alleles which can be expressed as 0.5.
  • the ⁇ coefficient (model intercept) is between -10.06391 to - 6.926615, or -9.5 to -7.5, or -9 to -8.
  • the adjustment of the starting (ln_risk) for the percentage of risk alleles is 0.1237336 to 0.1755347, or 0.16 to 0.14.
  • the genetic risk is the SNP Risk Factor (SNF).
  • SNF SNP Risk Factor
  • SNF ⁇ (No of Risk Alleles x SNP ⁇ coefficien)t.
  • the “risk” of a human subject developing a severe response to a Coronavirus infection can be provided as a relative risk (or risk ratio).
  • the genetic risk assessment obtains the “relative risk” of a human subject developing a severe response to a Coronavirus infection.
  • Relative risk or risk ratio
  • Relative risk ratio measured as the incidence of a disease in individuals with a particular characteristic (or exposure) divided by the incidence of the disease in individuals without the characteristic, indicates whether that particular exposure increases or decreases risk.
  • Relative risk is helpful to identify characteristics that are associated with a disease, but by itself is not particularly helpful in guiding screening decisions because the frequency of the risk (incidence) is cancelled out.
  • a threshold value(s) is set for determining a particular action such as the need for routine diagnostic testing, the need for prophylactic anti- Coronavirus therapy, selection of a person for a vaccine or the need to administer an anti-Coronavirus therapy. For example, a score determined using a method of the invention is compared to a pre-determined threshold, and if the score is higher than the threshold a recommendation is made to take the pre-determined action. Methods of setting such thresholds have now become widely used in the art and are described in, for example, US 20140018258.
  • the method further comprises performing a clinical risk assessment of the human subject; and combining the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
  • the clinical risk assessment procedure can include obtaining clinical information from a human subject. In other embodiments, these details have already been determined (such as in the subject’s medical records).
  • factors which can be used to produce the clinical risk assessment include, but are not limited to, obtaining information from the human on one or more of the following: age, family history of a severe response to a Coronavirus infection, race/ethnicity, gender, body mass index, total cholesterol level, systolic and/or diastolic blood pressure, smoking status, does the human have diabetes, does the human have a cardiovascular disease, is the subject on hypertension medication, loss of taste, loss of smell and white blood cell count.
  • the clinical risk assessment is based only one or more or all of age, body mass index, loss of taste, loss of smell and smoking status.
  • the clinical risk assessment is based only one or more or all of age, loss of taste, loss of smell and smoking status.
  • the clinical risk assessment includes obtaining information from the subject on one or more or all of age, gender, race/ethnicity, blood type, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
  • the clinical risk assessment at least includes age and gender.
  • a severe response to a Coronavirus infection risk model that relies solely on clinical factors provides useful risk discrimination for assessing a subject’s risk of developing a severe response to a Coronavirus infection such as a SARS-CoV-2 infection.
  • Such a test may be particularly useful in circumstances where a rapid decision needs to be made and/or when genetic testing is not readily available.
  • the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject on two, three, four, five or more or all of age, gender, race/ethnicity, height, weight, blood type, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an immunocompromised disease, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had liver disease, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
  • the clinical risk assessment comprises obtaining information from the subject on two, three, four, five or more or all of age, gender, race/ethnicity, height,
  • the method comprises obtaining information from the subject on age and gender.
  • the method comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • the method comprises obtaining information from the subject on age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • respiratory diseases which are included in the test are chronic obstructive pulmonary disease, chronic bronchitis and emphysema.
  • the diabetes can be any type of diabetes.
  • the clinical risk assessment is conducted using the following formula:
  • risk e ln(nsk)
  • the starting In(risk) (model intercept) is-0.5284 to 1.5509, or -0.16 to -0.36.
  • the adjustment of the starting ln(risk) forages 18 to 29 is -1 .5 to -1, or -1 .4 to -1 .2.
  • the adjustment of the starting In(risk) for ages 30 to 39 is -1 to -0.7, or -0.9 to -0.8.
  • the adjustment of the starting In(risk) for ages 40 to 49 is -0.6 to -0.2, or -0.45 to -0.35.
  • the adjustment of the starting In(risk) for ages 60 to 69 is -0.4021263 to 0.2075385, or -0.19 to 0.09.
  • Substitute Sheet (Rule 26) RO/AU In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 70+ is 0.1504677 to 0.73339, or 0.34 to 0.54.
  • the adjustment of the starting In(risk) for males is -0.140599 to 0.3115929, or -0.3 to 0.19.
  • the adjustment of the starting In(risk) for non-Caucasians is -0.3029713 to 0.3837958, or -0.06 to 0.14.
  • the adjustment of the starting In(risk) for A blood type is -0.3018427 to 0.1791056, or -0.16 to 0.04.
  • the adjustment of the starting In(risk) for B blood type is -0.1817567 to 0.5895909, or 0.1 to 0.3.
  • the adjustment of the starting In(risk) for AB blood type is -1.172319 to 0.0641862, or -0.45 to -0.65.
  • the adjustment of the starting In(risk) for a human who has, or has had, rheumatoid arthritis, lupus or psoriasis is -0.0309265 to 1.115784, or 0.44 to 0.64.
  • the adjustment of the starting In(risk) for a human who has, or has had, a haematological cancer is 0.1211918 to 1.899663, or 0.9 to 1.1.
  • the adjustment of the starting In(risk) for a human who has, or has had, a non-haematological cancer is -0.0625866 to 0.5498824, or 0.14 to 0.34.
  • the adjustment of the starting In(risk) for a human who has, or has had, diabetes is 0.0624018 to 0.7101834, or 0.28 to 0.48.
  • the adjustment of the starting In(risk) for a human who has, or has had, hypertension is 0.0504567 to 0.5623362, or 0.1 to 0.3.
  • the adjustment of the starting In(risk) for a human who has, or has had, a respiratory disease is 0.9775684 to 1.550944, or 1.16 to 1.36.
  • the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a clinical risk assessment of the human subject, wherein the clinical risk assessment involves determining at least the age and sex of the subject and producing a score.
  • the method further comprises comparing the score to a predetermined threshold, wherein if the score is at, or above, the threshold the subject is assessed at being at risk of developing a severe response to a Coronavirus infection.
  • the subject is between 50 and 84 years of age and is asked their age and their sex.
  • the method comprises determining the Log odds (LO).
  • the LO can be calculated using the formula:
  • X is -2.25 to -1.25 or -2 or -1.5. In an embodiment, X is -1.749562.
  • the probability obtained by the above formula is multiplied by 100 to obtain a percent chance of a severe response to a Coronavirus infection such as hospitalisation being required.
  • the subject is between 50 and 64 years of age they are assigned a ⁇ coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0.
  • the subject is between 65 and 69 years of age they are assigned a ⁇ coefficient of 0 to 1, or 0.25 to 0.75 or 0.4694892.
  • the subject is between 70 and 74 years of age they are assigned a ⁇ coefficient of 0.5 to 1.5, or 0.75 to 1.25 or 1.006561.
  • the subject is between 75 and 79 years of age they are assigned a ⁇ coefficient of 0.9 to 1.9, or 1.15 to 1.65 or 1.435318.
  • the subject is between 80 and 84 years of age they are assigned a ⁇ coefficient of 1.1 to 2.1, or 1.35 to 1.85 or 1.599188.
  • ⁇ coefficient - 0.5 to 0.5, or -0.25 to 0.25 or 0.
  • ⁇ coefficient if the subject is male they are assigned a ⁇ coefficient of -0.1 to 0.9, or 0.15 to 0.65 or 0.3911169.
  • the last value provided above in each criteria is used.
  • the clinical risk assessment includes obtaining information from the subject on one or more or all of age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • each of the above factors are assessed and
  • the last value provided above in each criteria is used.
  • the clinical risk assessment includes obtaining information from the subject on one or more or all of age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • each of the above factors are assessed and
  • the last value provided above in each criteria is used.
  • the subject’s body mass index is determined using their height and weight. In an embodiment, if any of the clinical factors are unknown, or the subject is unwilling to supply the relevant details, that factor(s) is assigned a ⁇ coefficient of 0.
  • one or more or all of the clinical factors are self-assessed (self-reported).
  • the race/ethnicity is self-assessed (self-reported).
  • one or more or all of current or previous disease status such as an autoimmune disease, an haematological cancer, an non-haematological cancer, diabetes, hypertension or a respiratory disease, is self-assessed (self-reported).
  • the clinical assessment comprises determining the blood type of the subject. This will typically comprise obtaining a sample comprising blood from the subject.
  • the detection method used can any be any suitable method known in the art.
  • a genetic test as described in the Examples is used, preferably concurrently with a genetic analysis for assessing the risk of a human subject developing a severe response to a coronavirus infection.
  • ABO blood type can be imputed using three SNPs, namely rs505922, rs8176719 and rs8176746) in the ABO gene on chromosome 9q34.2.
  • An rs8176719 deletion (or for those with no result for rs8176719, a T allele at rs505922) indicates haplotype O.
  • haplotype A is indicated by the presence of the G allele
  • haplotype B is indicated by the presence of the T allele (see Table 7).
  • the disease is classified using the international Classification of Disease (ICD) system.
  • ICD international Classification of Disease
  • an autoimmune is as per ICD9 (954, 696*, 7100, 714, 7140* and 7142* and ICD10 (J990, L40*, L41*, M05*-M07* and M32*),
  • a haematological cancer is as per ICD9 (200*-208*) and ICD10 (C81*-C86*, C88* and C90*-C96*),
  • a non-haematological cancer is as per ICD9 (140*— 165*, 169*— 175*, 179*— 195* and 196*-199*) and ICD10 (C00*-C26*, C30*-C34*, C37*-C58*, C60*-C80*, C97*),
  • a cerebrovascular disease is as per ICD9 (430*-438*) and ICD10 (G46* and I60*-I69*),
  • heart disease is as per ICD9 (413 *-416*, V422, V432-V434) and ICD 10 (120*- 125*, 148*, Z95*),
  • hypertension is as per ICD9 (401*, 405*, 6420-6422) and ICD 10 (110*, 115*,
  • an immunocompromised disease is as per ICD9 (V420, V421, V426, V427, V429, 042, 043, 044, 279, 2790*) and ICD10 (B20*-B24, D80*-D84*, Z940- Z944, Z949),
  • a kidney disease is as per ICD9 (585*) and ICD10 (N18*)
  • ⁇ liver disease is as per ICD9 (571*) and ICD10 (K70*-K77*)
  • a respiratory disease (excluding asthma) is as per ICD9 (494*-496*, 500*, 501*-508*, 491*, 492*, 496*) and ICD10 (J60*-J70*, J80*-J82, J84*-J86*, J90-J96*, J98*, J41*-J44*). Table 7 - SNPS and ABO Imputation.
  • ln(risk) Model Intercept
  • In(risk) Model Intercept
  • risk e ln(risk)
  • Substitute Sheet (Rule 26) RO/AU
  • In(risk) -10.7657
  • risk e ln (risk)
  • the starting ln (risk) (model intercept) is -12.5559 to -8.9755, or -12 to -8, or -11 to -10.5.
  • the adjustment of the starting ln (risk) for the percentage of risk alleles is 0.142 to 0.2006, or 0.16 to 0.18.
  • the adjustment of the starting ln (risk) for ages 18 to 29 is -1.5 to -1, or -1.4 to -1.2.
  • the adjustment of the starting ln(mA:) for ages 30 to 39 is -1 to -0.7, or -0.9 to -0.8. In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 40 to 49 is -0.6 to -0.2, or -0.45 to -0.35.
  • the adjustment of the starting ln (risk) for ages 60 to 69 is -0.3819 to 0.2619, or -0.1 to 0.1.
  • Substitute Sheet (Rule 26) RO/AU In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 70+ is 0.2213 to 0.8438, or 0.43 to 0.63.
  • the adjustment of the starting In(risk) for males is -0.1005 to 0.3779, or 0.03 to 0.23.
  • the adjustment of the starting In(risk) for non-Caucasians is -0.0084 to 0.7167, or 0.25 to 0.45.
  • the adjustment of the starting In(risk) for A blood type is -0.4726 to 0.0397, or -0.11 to -0.31.
  • the adjustment of the starting In(risk) for B blood type is -0.2348 to 0.5773, or 0.07 to 0.27.
  • the adjustment of the starting In(risk) for AB blood type is -1.5087 to -0.2404, or -0.77 to -0.97.
  • the adjustment of the starting In(risk) for a human who has, or has had, rheumatoid arthritis, lupus or psoriasis is 0.1832 to 1.3920, or 0.68 to 0.88.
  • the adjustment of the starting In(risk) for a human who has, or has had, a haematological cancer is 0.0994 to 1.9756, or 0.93 to 1.13.
  • the adjustment of the starting In(risk) for a human who has, or has had, a non-haematological cancer is 0.0401 to 0.6933, or 0.26 to 0.46.
  • the adjustment of the starting In(risk) for a human who has, or has had, diabetes is 0.1450 to 0.8330, or 0.39 to 0.59.
  • the adjustment of the starting In(risk) for a human who has, or has had, hypertension is 0.0313 to 0.5756, or 0.2 to 0.4.
  • the adjustment of the starting In(risk) for a human who has, or has had, a respiratory disease (excluding asthma) is 0.9317 to 0.1535, or 1.13 to 1.33.
  • the method comprises determining the Log odds (LO).
  • the LO can be calculated using the formula:
  • the SRF is the SNP Risk Factor which is: ⁇ (No of Risk Alleles x SNP ⁇ coefficient).
  • the probability obtained by the above formula is multiplied by 100 to obtain a percent chance of a severe response to a Coronavirus infection such as hospitalisation being required.
  • the genetic risk assessment involves the analysis of rs10755709, rs112317747, rs112641600, rs118072448, rs2034831, rs7027911 and rs71481792.
  • X is -1.8 to -0.8 or -1.6 or -1.15.
  • X is -1.36523.
  • the subject is assigned a ⁇ coefficient of -0.08 to 0.32, or 0.02 to 0.22 or 0.124239 for each G (risk) allele present at rs10755709.
  • the subject is homozygous for the risk allele they can be assigned a ⁇ coefficient of 0.248478, if they are heterozygous can be assigned a ⁇ coefficient of 0.124239, and if they is homozygous for the non-risk allele (C at rs10755709) they can be assigned a ⁇ coefficient of 0.248478.
  • the subject is assigned a ⁇ coefficient of 0.07 to 0.47, or 0.17 to 0.37 or 0.2737487 for each C (risk) allele present at rs112317747.
  • the subject is assigned a c ⁇ oefficient of -0.43 to - 0.03, or -0.33 to -0.13 or -0.2362513 for each T (risk) allele present at rs112641600.
  • the subject is assigned a ⁇ coefficient of -0.4 to 0, or -0.3 to -0.1 or - 0.1995879 for each C (risk) allele present at rs118072448.
  • the subject is assigned a ⁇ coefficient of 0.04 to 0.44, or 0.14 to 0.34 or 0.2371955 for each C (risk) allele present at rs2034831.
  • the subject is assigned a ⁇ coefficient of -0.1 to 0.3, or 0 to 0.2 or 0.1019074 for each A (risk) allele present at rs7027911. In an embodiment, the subject is assigned a ⁇ coefficient of -0.3 to 0.1, or - 0.2 to 0 or -0.1058025 for each T (risk) allele present at rs71481792.
  • the ⁇ Clinical ⁇ coefficients is determined as above such as factoring in ⁇ coefficients for each of age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • the genetic risk assessment involves the analysis of rs10755709, rs1 l2317747, rs1 l2641600, rs1 l8072448, rs2034831, rs7027911, rs71481792, rs115492982 and rs1984162.
  • X is -2 to -1.5 or -1.75 or -1.25.
  • X is -1.469939.
  • the subject is assigned a ⁇ coefficient of -0.08 to 0.32, or 0.02 to 0.22 or 0.1231766 for each G (risk) allele present at rs10755709.
  • the subject is homozygous for the risk allele they can be assigned a ⁇ coefficient of 0.2463532, if they are heterozygous can be assigned a ⁇ coefficient of 0.1231766, and if they is homozygous for the non-risk allele (C at rs10755709) they can be assigned a ⁇ coefficient of 0.248478.
  • the subject is assigned a ⁇ coefficient of 0.06 to 0.46, or 0.16 to 0.36 or 0.2576692 for each C (risk) allele present at rs112317747.
  • the subject is assigned a ⁇ coefficient of -0.43 to -0.03, or -0.33 to -0.13 or -0.2384001 for each T (risk) allele present at rs112641600. In an embodiment, the subject is assigned a ⁇ coefficient of -0.4 to 0, or -0.3 to -0.1 or -0.1965609 for each C (risk) allele present at rs118072448. In an embodiment, the subject is assigned a ⁇ coefficient of 0.04 to 0.44, or 0.14 to 0.34 or 0.2414792 for each C (risk) allele present at rs2034831.
  • the subject is assigned a ⁇ coefficient of -0.1 to 0.3, or 0 to 0.2 or 0.0998459 for each A (risk) allele present at rs7027911. In an embodiment, the subject is assigned a ⁇ coefficient of -0.3 to 0.1, or -0.2 to 0 or -0.1032044 for each T (risk) allele present at rs71481792. In an embodiment the subject is assigned a ⁇ coefficient of 0.21 to 0.61, or 0.31 to 0.51 or 0.4163575 for each A (risk) allele present at rs115492982.
  • the subject is assigned a ⁇ coefficient of -0.1 to 0.3, or 0 to 0.2 or 0.1034362 for each A (risk) allele present at rs1984162.
  • the ⁇ Clinical ⁇ coefficients is determined as above such as factoring in b coefficients for each of age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an haematological cancer, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
  • SNP 1 to SNP N are the relative risk for the individual SNPs, each scaled to have a population average of 1 as outlined above. Because the SNP risk values have been “centred” to have a population average risk of 1, if one assumes independence among the SNPs, then the population average risk across all genotypes for the combined value is consistent with the underlying Clinical Evaluation risk estimate.
  • the genetic risk assessment is combined with the clinical risk assessment to obtain the “relative risk” of a human subject developing a severe response to a Coronavirus infection.
  • a threshold(s) can be set as described above when genetic risk is assessed alone.
  • the threshold could be set to be at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10, when using the embodiment of the test described in Example 5. If set at 5 in this example, about 10% of the UK biobank population have a risk score over 5.0 resulting in the following performance characteristics for the test:

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medical Informatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Data Mining & Analysis (AREA)
  • Primary Health Care (AREA)
  • Pathology (AREA)
  • Databases & Information Systems (AREA)
  • Evolutionary Biology (AREA)
  • Theoretical Computer Science (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Computer Vision & Pattern Recognition (AREA)
  • Bioethics (AREA)
  • Artificial Intelligence (AREA)
  • Evolutionary Computation (AREA)
  • Software Systems (AREA)
  • Ecology (AREA)
  • Physiology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure relates to methods and systems for assessing the risk of a human subject developing a severe response to a Coronavirus infection, such as a severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) virus infection.

Description

METHODS OF ASSESSING RISK OF DEVELOPING A SEVERE RESPONSE TO CORONA VIRUS INFECTION
FIELD OF THE INVENTION
The present disclosure relates to methods and systems for assessing the risk of a human subject developing a severe response to a coronavirus infection such as a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) viral infection.
BACKGROUND OF THE INVENTION
In December 2019, there were a series of unexplained cases of pneumonia reported in Wuhan, China. On 12 January 2020, the World Health Organization (WHO) tentatively named this new virus as the 2019 novel coronavirus (2019-nCoV). On 11 February 2020, the WHO formally named the disease triggered by 2019-nCoV as coronavirus disease 2019 (COVID-19). The coronavirus study group of the International Committee on Taxonomy of Viruses named 2019-nCoV as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The WHO declared the virus a Public Health Emergency of International Concern on 30 January 2020. The WHO eventually declared a pandemic on 11 March 2020.
Like many complex diseases, there are a multitude of host factors that influence the severity of disease once infected with a virus. This means viral infections are complex multifactorial diseases like many cancers, cardiovascular disease and diabetes.
As global health systems try to manage resources and governments attempt to manage their respective economies there is a need to identify which people are at most risk of developing severe symptoms in response to the viral infection. Such a tool would enable earlier hospitalization and targeted treatments which may lead to the saving of lives. Of great importance to the economy, there is potential that lower risk individuals could be recommended to continue their normal employment given the lower risk of developing a life threatening disease should they contract a Coronavirus infection such as a SARS-Cov-2 viral infection.
SUMMARY OF THE INVENTION
The present inventors have found that a severe response to a Coronavirus infection risk model provides useful risk discrimination for assessing a subject’s risk of developing a severe response to a Coronavirus infection such as a SARS-CoV-2 infection. In an aspect, the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a genetic risk assessment of the human subject, wherein the genetic risk assessment involves detecting, in a biological sample derived from the human subject, the presence at least two polymorphisms associated with a severe response to a Coronavirus infection.
In an embodiment, the Coronavirus is an Alphacoronavirus, Betacoronavirus, Gammacoronavirus or an Deltacoronavirus.
In an embodiment, the Coronavirus is Alphacoronavirus 1, Human coronavirus 229E, Human coronavirus NL63, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Porcine epidemic diarrhea virus, Rhinolophus bat coronavirus HKU2, Scotophilus bat coronavirus 512, Betacoronavirus 1 (Bovine Coronavirus, Human coronavirus OC43), Hedgehog coronavirus 1, Human coronavirus HKU1, Middle East respiratory syndrome-related coronavirus (MERS), Murine coronavirus, Pipistrellus bat coronavirus HKU5, Rousettus bat coronavirus HKU9, Severe acute respiratory syndrome-related coronavirus (SARS-CoV or SARS-CoV-2), Tylonycteris bat coronavirus HKU4, Avian coronavirus, Beluga whale coronavirus SW1, Bulbul coronavirus HKU11 or Porcine coronavirus HKU15.
In an embodiment, the Coronavirus is Severe acute respiratory syndrome-related coronavirus (SARS-CoV or SARS-CoV-2), Middle East respiratory syndrome-related coronavirus (MERS), Human coronavirus OC43, Human coronavirus HKU1, Human coronavirus 229E or Human coronavirus NL63.
In an embodiment, the Coronavirus is a Betacoronavirus.
In an embodiment, the Betacoronavirus is Severe acute respiratory syndrome- related coronavirus (SARS-CoV or SARS-CoV-2), Middle East respiratory syndrome- related coronavirus (MERS), Human coronavirus OC43 or Human coronavirus HKU 1.
In an embodiment, the Coronavirus (Betacoronavirus) is Severe acute respiratory syndrome-related coronavirus (SARS-CoV or SARS-CoV-2), Middle East respiratory syndrome-related coronavirus (MERS), Human coronavirus OC43 or Human coronavirus HKU 1.
In an embodiment, the Coronavirus (Betacoronavirus) is Severe acute respiratory syndrome-related coronavirus (SARS-CoV or SARS-CoV-2) or Middle East respiratory syndrome-related coronavirus (MERS).
In a preferred embodiment, the Coronavirus (Betacoronavirus) is Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In an embodiment, the method comprises detecting the presence of at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection.
In an embodiment, the polymorphisms are selected from Tables 1 to 6, 8, 19 or 22 or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the method at least comprises detecting polymorphisms at one or more or all of rs10755709, rs112317747, rs112641600, rs118072448, rs2034831, rs7027911 and rs71481792, or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the method at least comprises detecting polymorphisms at one or more or all of rs10755709, rs112317747, rs112641600, rs115492982, rs118072448, rs1984162, rs2034831, rs7027911 and rs71481792, or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the polymorphisms are selected from Table 1, Table 6a, Table 6b or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the polymorphisms are selected from any one of Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the polymorphisms are selected from Table 3 or a polymorphism in linkage disequilibrium with one or more thereof. In an embodiment, at least three polymorphisms are analysed.
In an embodiment, the method comprises, or consists of, detecting the presence of at least 60, or each, of the polymorphisms provided in Table 4 or a polymorphism in linkage disequilibrium with one or more thereof.
In another embodiment, the polymorphisms are selected from Table 2 or a polymorphism in linkage disequilibrium with one or more thereof.
In a further embodiment, the polymorphisms are selected from Table 3 and/or Table 8 or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the polymorphisms are selected from Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the method comprises, or consists of, detecting the presence of each of the polymorphisms provided in Table 3 or a polymorphism in linkage disequilibrium with one or more thereof. The genetic risk assessment may be combined with clinical risk factors to further improve the risk analysis. Thus, in an embodiment, the method further comprises performing a clinical risk assessment of the human subject; and combining the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
In an embodiment, the clinical risk assessment includes obtaining information from the subject on, but not necessarily limited to, one or more of the following: age, family history of a severe response to a Coronavirus infection, race/ethnicity, gender, body mass index, total cholesterol level, systolic and/or diastolic blood pressure, smoking status, does the human have diabetes, does the human have a cardiovascular disease, is the subject on hypertension medication, loss of taste, loss of smell and white blood cell count.
In another embodiment, the clinical risk assessment is based only on one or more or all of age, body mass index, loss of taste, loss of smell and smoking status.
In a further embodiment, the clinical risk assessment is based only on one or more or all of age, loss of taste, loss of smell and smoking status.
In an embodiment, the clinical risk assessment includes obtaining information from the subject on one or more or all of: age, gender, race/ethnicity, blood type, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma). In an embodiment, the autoimmune disease is rheumatoid arthritis, lupus or psoriasis.
In an embodiment, the clinical risk assessment includes obtaining information from the subject on one or more or all of: age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
The skilled person would appreciate that numerous different procedures can be followed to combine the clinical and genetic risk assessments. In an embodiment, combining the clinical risk assessment and the genetic risk assessment comprises multiplying the risk assessments. In an embodiment, combining the clinical risk assessment and the genetic risk assessment comprises adding the risk assessments.
The inventors, for the first time, have identified numerous polymorphisms associated with a subject’s risk of developing a severe response to a Coronavirus infection. Thus, in another aspect, the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus, the method comprising detecting, in a biological sample derived from the human subject, the presence of a polymorphism provided in any one of Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium therewith.
In an embodiment, the polymorphism is provided in Table 19 and/or 22 or is a polymorphism in linkage disequilibrium therewith.
In an embodiment, the polymorphism is provided in Table 1 or Table 6a or is a polymorphism in linkage disequilibrium therewith.
In an embodiment, the polymorphism is provided in Table 3 or Table 6a or is a polymorphism in linkage disequilibrium therewith.
In an embodiment, the polymorphism is provided in Table 3, Table 6, is rs2274122, is rs1868132, is rs11729561, is rs1984162, is rs8105499 or is a polymorphism in linkage disequilibrium therewith.
In an embodiment, the polymorphism is provided in Table 3, is rs2274122, is rs1868132, is rs11729561, is rs1984162, is rs8105499 or is a polymorphism in linkage disequilibrium therewith.
In another aspect, the present invention provides a method of determining the identity of the alleles of fewer than 100,000 polymorphisms in a human subject selected from the group of subjects consisting of humans in need of assessment for the risk of developing a severe response to a Coronavirus infection to produce a polymorphic profile of the subject, comprising
(i) selecting for allelic identity analysis at least two polymorphisms provided in any one of Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium with one or more thereof,
(ii) detecting, in a biological sample derived from the human subject, the polymorphisms, and
(iii) producing the polymorphic profile of the subject screening based on the identity of the alleles analysed in step (ii), wherein fewer than 100,000 polymorphisms are selected for allelic identity analysis in step (i) and the same fewer than 100,000 polymorphisms are analysed in step (ii). In an embodiment of the above aspect, fewer than 100,000 polymorphisms, fewer than 50,000 polymorphisms, fewer than 40,000 polymorphisms, fewer than 30,000 polymorphisms, fewer than 20,000 polymorphisms, fewer than 10,000 polymorphisms, fewer than 7,500 polymorphisms, fewer than 5,000 polymorphisms, fewer than 4,000 polymorphisms, fewer than 3,000 polymorphisms, fewer than 2,000 polymorphisms, fewer than 1,000 polymorphisms, fewer than 900 polymorphisms, fewer than 800 polymorphisms, fewer than 700 polymorphisms, fewer than 600 polymorphisms, fewer than 500 polymorphisms, fewer than 400 polymorphisms, fewer than 300 polymorphisms, fewer than 200 polymorphisms, or fewer than 100 polymorphisms, are selected for allelic identity.
In an embodiment of each of the above aspects, the human subject can be Caucasian, African American, Hispanic, Asian, Indian, or Latino. In a preferred embodiment, the human subject is Caucasian.
In an embodiment of each of the above aspects, the method further comprises obtaining the biological sample.
In an embodiment, the polymorphism(s) in linkage disequilibrium has linkage disequilibrium above 0.9. In another embodiment, the polymorphism(s) in linkage disequilibrium has linkage disequilibrium of 1.
The present inventors have also found that a severe response to a Coronavirus infection risk model that relies solely on clinical factors provides useful risk discrimination for assessing a subject’s risk of developing a severe response to a Coronavirus infection such as a SARS-CoV-2 infection. Such a test may be particularly useful in circumstances where a rapid decision needs to be made and/or when genetic testing is not readily available. Thus, in another aspect the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject on two, three, four, five or more or all of age, gender, race/ethnicity, height, weight, blood type, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an immunocompromised disease, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had liver disease, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma). In an embodiment, the method comprises obtaining information from the subject on age and gender.
In an embodiment, the method comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
In an embodiment, the method comprises obtaining information from the subject on age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
In an embodiment, the method comprises obtaining information from the subject on one or more of all of age, gender, race/ethnicity, blood type, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
In another aspect, the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising i) performing a genetic risk assessment of the human subject, wherein the genetic risk assessment involves detecting, in a biological sample derived from the human subject, polymorphisms at rs10755709, rs112317747, rs112641600, rs118072448, rs2034831, rs7027911 and rs71481792, ii) performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma), and iii) combining the genetic risk assessment with the clinical risk assessment to determine the risk of a human subject developing a severe response to a Coronavirus infection.
In an embodiment, a) a β coefficient of 0.124239 is assigned for each G allele at rs10755709; b) a β coefficient of 0.2737487 is assigned for each C allele at rs112317747; c) a β coefficient of -0.2362513 is assigned for each T allele at rs112641600; d) a P coefficient of -0.1995879 is assigned for each C allele at rs118072448; e) a β coefficient of 0.2371955 is assigned for each C allele at rs2034831; f) a β coefficient of 0.1019074 is assigned for each A allele at rs7027911; and g) a β coefficient of -0.1058025 is assigned for each T allele at rs71481792.
In an embodiment, the subject is between 50 and 84 years of age and a) a β coefficient of 0.5747727 is assigned if the subject is between 70 and 74 years of age; b) a β coefficient of 0.8243711 is assigned if the subject is between 75 and 79 years of age; c) a β coefficient of 1.013973 is assigned if the subject is between 80 and 84 years of age; d) a β coefficient of 0.2444891 is assigned if the subject is male; e) a β coefficient of 0.29311 is assigned if the subject is an ethnicity other than Caucasian; f) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1.602056 to provide the β coefficient to be assigned; g) a β coefficient of 0.4041337 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; h) a β coefficient of 0.6938494 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; i) a β coefficient of 0.4297612 is assigned if the subject has ever been diagnosed as having diabetes; j) a β coefficient of 1.003877 is assigned if the subject has ever been diagnosed as having haematological cancer; k) a β coefficient of 0.2922307 is assigned if the subject has ever been diagnosed as having hypertension; l) a β coefficient of 0.2558464 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; and m) a β coefficient of 1.173753 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma).
In an embodiment, the subject is between 18 and 49 years of age and a) a β coefficient of - 1.3111 is assigned if the subject is between 18 and 29 years of age; b) a β coefficient of -0.8348 is assigned if the subject is between 30 and 39 years of age; c) a β coefficient of -0.4038 is assigned if the subject is between 40 and 49 years of age; d) a β coefficient of 0.2444891 is assigned if the subject is male; e) a β coefficient of 0.29311 is assigned if the subject is an ethnicity other than Caucasian; f) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1.602056 to provide the β coefficient to be assigned; g) a β coefficient of 0.4041337 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; h) a β coefficient of 0.6938494 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; i) a β coefficient of 0.4297612 is assigned if the subject has ever been diagnosed as having diabetes; j) a β coefficient of 1.003877 is assigned if the subject has ever been diagnosed as having haematological cancer; k) a β coefficient of 0.2922307 is assigned if the subject has ever been diagnosed as having hypertension; l) a β coefficient of 0.2558464 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; and m) a β coefficient of 1.173753 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma).
In an embodiment, the subject is between 18 and 84 years of age and a) a β coefficient of - 1.3111 is assigned if the subject is between 18 and 29 years of age; b) a β coefficient of -0.8348 is assigned if the subject is between 30 and 39 years of age; c) a β coefficient of -0.4038 is assigned if the subject is between 40 and 49 years of age; d) a β coefficient of 0.5747727 is assigned if the subject is between 70 and 74 years of age; e) a β coefficient of 0.8243711 is assigned if the subject is between 75 and 79 years of age; f) a β coefficient of 1.013973 is assigned if the subject is between 80 and 84 years of age; g) a β coefficient of 0.2444891 is assigned if the subject is male; h) a β coefficient of 0.29311 is assigned if the subject is an ethnicity other than Caucasian; i) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1.602056 to provide the β coefficient to be assigned; j) a β coefficient of 0.4041337 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; k) a β coefficient of 0.6938494 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; l) a β coefficient of 0.4297612 is assigned if the subject has ever been diagnosed as having diabetes; m) a β coefficient of 1.003877 is assigned if the subject has ever been diagnosed as having haematological cancer; n) a β coefficient of 0.2922307 is assigned if the subject has ever been diagnosed as having hypertension; o) a P coefficient of 0.2558464 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; and p) a β coefficient of 1.173753 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma).
In an embodiment, in step iii) the genetic risk assessment is combined with the clinical risk assessment using the following formula:
Long Odds (LO) = -1.36523 + SRF + ∑ Clinical P coefficients, and wherein SRF is the SNP Risk Factor which is determined using the following formula: ∑ (No of Risk Alleles x SNP β coefficient). In another aspect, the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising i) performing a genetic risk assessment of the human subject, wherein the genetic risk assessment involves detecting, in a biological sample derived from the human subject, polymorphisms at rs10755709, rs112317747, rs112641600, rs115492982, rs118072448, rs1984162, rs2034831, rs7027911 and rs71481792, ii) performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject of age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma), and iii) combining the genetic risk assessment with the clinical risk assessment to determine the risk of a human subject developing a severe response to a Coronavirus infection.
In an embodiment, a) a β coefficient of 0.1231766 is assigned for each G allele at rs10755709; b) a β coefficient of 0.2576692 is assigned for each C allele at rs112317747; c) a β coefficient of -0.2384001 is assigned for each T allele at rs112641600; d) a β coefficient of -0.1965609 is assigned for each C allele at rs118072448; e) a β coefficient of 0.2414792 is assigned for each C allele at rs2034831; f) a β coefficient of 0.0998459 is assigned for each A allele at rs7027911; g) a β coefficient of -0.1032044 is assigned for each T allele at rs71481792; h) a β coefficient of 0.4163575 is assigned for each A allele at rs115492982; and i) a β coefficient of 0.1034362 is assigned for each A allele at rs1984162.
In a further embodiment, the subject is between 50 and 84 years of age and a) a β coefficient of 0.1677566 is assigned if the subject is between 65 and 69 years of age; b) a β coefficient of 0.6352682 is assigned if the subject is between 70 and 74 years of age; c) a β coefficient of 0.8940548 is assigned if the subject is between 75 and 79 years of age; d) a β coefficient of 1.082477 is assigned if the subject is between 80 and 84 years of age; e) a β coefficient of 0.2418454 is assigned if the subject is male; f) a β coefficient of 0.2967777 is assigned if the subject is an ethnicity other than Caucasian; g) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1. 560943 to provide the β coefficient to be assigned; h) a β coefficient of 0.3950113 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; i) a β coefficient of 0.6650257 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; j) a β coefficient of 0.4126633 is assigned if the subject has ever been diagnosed as having diabetes; k) a β coefficient of 1.001079 is assigned if the subject has ever been diagnosed as having haematological cancer; l) a β coefficient of 0.2640989 is assigned if the subject has ever been diagnosed as having hypertension; m) a β coefficient of 0.2381579 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; n) a β coefficient of 1.148496 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma); o) a β coefficient of -0.229737 is assigned if the subject has an ABO blood type; p) a β coefficient of 0.6033541 is assigned if the subject has ever been diagnosed as having a immunocompromised disease; q) a β coefficient of 0.2301902 is assigned if the subject has ever been diagnosed as having liver disease.
In an embodiment, in step iii) the genetic risk assessment is combined with the clinical risk assessment using the following formula:
Long Odds (LO) = 1.469939 + SRF + ∑ Clinical P coefficients, and wherein SRF is the SNP Risk Factor which is determined using the following formula: ∑ (No of Risk Alleles x SNP β coefficient). In an embodiment, a method of the invention further comprises determining the probability the subject would require hospitalisation if infected with a Coronavirus using the following formula: eLO/(1+eLO), which is then multiplied by 100 to obtain a percent chance of hospitalisation being required.
In an embodiment of each of the above aspects, the risk assessment produces a score and the method further comprises comparing the score to a predetermined threshold, wherein if the score is at, or above, the threshold the subject is assessed at being at risk of developing a severe response to a Coronavirus infection.
In an embodiment, if it is determined the subject has a risk of developing a severe response to a Coronavirus infection, the subject is more likely than someone assessed as low risk, or when compared to the average risk in the population, to be admitted to hospital for intensive care.
In a further aspect, the present invention provides a method for determining the need for routine diagnostic testing of a human subject for a Coronavirus infection comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using a method of the invention.
In another aspect, the present invention provides a method of screening for a severe response to a Coronavirus infection in a human subject, the method comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using a method of the invention, and routinely screening for a Coronavirus infection in the subject if they are assessed as having a risk for developing a severe response to a Coronavirus infection.
In an embodiment of the above two aspects, the screening involves analysing the subject for the virus or a symptom thereof.
In a further aspect, the present invention provides a method for determining the need of a human subject for prophylactic anti-Coronavirus therapy comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using a method of the invention.
In yet another aspect, the present invention provides a method for preventing or reducing the risk of a severe response to a Coronavirus infection in a human subject, the method comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using a method of the invention, and if they are assessed as having a risk for developing a severe response to a Coronavirus infection
1) administering an anti-Coronavirus therapy and/or 2) isolating the subject.
In an aspect, the present invention provides an anti-Coronavirus infection therapy for use in preventing a severe response to a Coronavirus infection in a human subject at risk thereof, wherein the subject is assessed as having a risk for developing a severe response to a Coronavirus infection using a method of the invention.
Many anti-Coronavirus therapies, such as anti-SARS-CoV-2 virus therapies, are in development. The skilled person would appreciate that any therapy shown to be successful can be used in the above methods. Possible examples include, but are not limited to, intubation to assist breathing, an anti-Coronavirus - such as anti- SARS-CoV-2 virus - vaccine, convalescent plasma (plasma from people who have been infected, developed antibodies to the virus, and have then recovered), chloroquine, hydroxychloroquine (with or without zinc), Favipiravir, Remdesivir, Ivermectin, Quercetin, Kaletra (lopinavir/ritonavir), Arbidol, Baricitinib, CM4620-IE, an IL-6 inhibitor, Tocilizumab and stem cells such as mesenchymal stem cells. In another embodiment, the therapy is Vitamin D. Other examples of therapy include, Dexamethasone (or other corticosteroids such as prednisone, methylprednisolone, or hydrocortisone), Baricitinib in combination with remdesivir, anticoagulation drugs ("blood thinners"), bamlanivimab and etesevimab, convalescent plasma, tocilizumab with corticosteroids, Casirivimab and Imdevimab, Atorvastatin, GRP78 and siRNA- nanoparticle formulations.
Once a vaccine (or indeed possibly many different anti-Coronavirus therapies) is developed it is highly likely there will be supply issues and decisions will need to be made about why one person will receive the vaccine first when compared to another person. The present invention can thus be used to determine who is at most risk, and the anti-Coronavirus therapy (such as a vaccine) first administered to people assessed as likely to develop a severe response to a Coronavirus infection.
In an embodiment, the vaccine is an mRNA vaccine. In an embodiment, the vaccine is a protein vaccine. Examples of vaccines that can be administered include, but are not limited to, the Pfizer-BioNTech vaccine, the Modema vaccine, the Johnson & Johnson vaccine, the Oxford-AstraZeneca vaccine and the Novavax vaccine (see, for example, Katella, 2021).
In another embodiment, the present invention provides a method for stratifying a group of human subjects for a clinical trial of a candidate therapy, the method comprising assessing the individual risk of the subjects for developing a severe response to a Coronavirus infection using a method of the invention, and using the results of the assessment to select subjects more likely to be responsive to the therapy. Also provided is a kit comprising at least two sets of primers for amplifying two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from any one of Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises sets of primers for amplifying nucleic acids comprising each of the polymorphisms provided in Table 4, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In another aspect, the present invention provides a genetic array comprising at least two sets of probes for hybridising to two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from any one of Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the array comprises probes hybridising to nucleic acids comprising each of the polymorphisms provided in Table 4, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an aspect, the present invention provides a computer implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving genetic risk data for the human subject, wherein the genetic risk data was obtained by a method of the invention; processing the data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
In an aspect, the present invention provides a computer implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving clinical risk data and genetic risk data for the human subject, wherein the clinical risk data and genetic risk data were obtained by a method of the invention; processing the data to combine the clinical risk data with the genetic risk data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection. In a further aspect, the present invention provides a computer-implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving at least one clinical variable associated with the human subject, wherein at least one clinical variable was obtained by a method of the invention; processing the data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
In an embodiment of the three above aspects, processing the data is performed using a risk assessment model, where the risk assessment model has been trained using a training dataset comprising data relating to Coronavirus infection response severity and the genetic data and/or clinical data. In another embodiment, the method further comprises displaying or communicating the risk to a user.
In an aspect, the present invention provides a system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a genetic risk assessment of the human subject according to a method of the invention; and system instructions to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
In an aspect, the present invention provides a system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a clinical risk assessment and a genetic risk assessment of the human subject according to a method of the invention; and system instructions for combining the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
In an aspect, the present invention provides a system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a clinical risk assessment of the human subject using the method according to any one of claims 20 to 26 or 36 to 39; and system instructions to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
In an embodiment, the risk data for the subject is received from a user interface coupled to the computing system. In another embodiment, the risk data for the subject is received from a remote device across a wireless communications network. In another embodiment, the user interface or remote device is a SNP array platform. In another embodiment, outputting comprises outputting information to a user interface coupled to the computing system. In another embodiment, outputting comprises transmitting information to a remote device across a wireless communications network.
Any embodiment herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise.
The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.
Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS Figure 1. Receiver operating characteristic curves for models with different amounts of information. The area under the receiver operating characteristic curve was 0.786 for the combined model, 0.723 for the clinical model, 0.680 for the SNP score, and 0.635 for the age and sex model.
Figure 2. Distribution of COVID risk score for (a) cases and (b) controls. Note that 130 (13%) cases and 6 (1%) controls with scores over 15 have been omitted to facilitate the display of the distribution.
Figure 3. Distribution of COVID-19 risk score in UK Biobank. Note that 7,769 (1.8%) scores over 15 have been omitted to facilitate the display of the distribution.
Figure 4. Receiver operating characteristic curves for the age and sex model and the “full model” in the 30% validation dataset. The new model has an area under the curve (AUC) of 0.732 (95% 0=0.708, 0.756) and the age and sex model has an AUC of 0.671 (95% 0=0.646, 0.696). Figure 5. Calibration plots for the (A) age and sex model and (B) “full model” in the validation dataset. Figure 6. Distribution of probability of severe COVID-19 in all of UK Biobank for (A) age and sex model and (B) the full model.
DETAILED DESCRIPTION OF THE INVENTION
General Techniques and Definitions Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., epidemiological analysis, molecular genetics, risk assessment and clinical studies).
Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
It is to be understood that this disclosure is not limited to particular embodiments, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, terms in the singular and the singular forms "a," "an" and "the," for example, optionally include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a probe" optionally includes a plurality of probe molecules; similarly, depending on the context, use of the term "a nucleic acid" optionally includes, as a practical matter, many copies of that nucleic acid molecule. The term “and/or”, e.g., “X and/or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.
As used herein, the term “about”, unless stated to the contrary, refers to +/- 10%, more preferably +/- 5%, more preferably +/- 1%, of the designated value.
Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
“Coronavirus” is a group of related RNA viruses that typically cause diseases in mammals and birds, such as respiratory tract infections in humans. Coronaviruses constitute the subfamily Orthocoronavirinae in the family Coronaviridae . Coronaviruses are enveloped viruses with a positive-sense single -stranded RNA genome and a nucleocapsid of helical symmetry. Coronaviruses have characteristic club-shaped spikes that project from their surface. Examples of Coronaviruses which cause disease in humans include, but are not necessarily limited to, Severe acute respiratory syndrome-related coronavirus (SARS-CoV or SARS-CoV-2), Middle East respiratory syndrome-related coronavirus (MERS), Human coronavirus OC43, Human coronavirus HKU1, Human coronavirus 229E and Human coronavirus NL63. In some embodiments, the SARS-CoV-2 the strain is selected from, but not limited to, the L strain, the S strain, the V strain, the G strain, the GR strain, the GH strain, hCoV- 19/Australia/VIC01/2020, BetaCoV/Wuhan/WIV04/2019, B.l.1.7 variant, B.1.351 variant, B.1.427 variant, B.1.429 variant and P.l variant.
As used herein, “risk assessment” refers to a process by which a subject’s risk of developing a severe response to a Coronavirus infection can be assessed. A risk assessment will typically involve obtaining information relevant to the subject’s risk of developing a severe response to a Coronavirus infection, assessing that information, and quantifying the subject’s risk of developing a severe response to a Coronavirus infection, for example, by producing a risk score.
As used herein, the term “a severe response to a Coronavirus infection” encompasses any factor, or a symptom thereof, considered by a medical practitioner that would warrant the subject being hospitalised, the subject’s life being at risk, or the subject requiring assistance to breath. Examples of symptoms of a severe response to a Coronavirus infection include, but are not limited to, difficulty breathing or shortness of breath, chest pain or pressure, loss of speech or loss of movement. A phenotype that displays a predisposition for a severe response to a Coronavirus infection, can, for example, show a higher likelihood that a severe response to a Coronavirus infection will develop in an individual with the phenotype than in members of a relevant general population under a given set of environmental conditions (diet, physical activity regime, geographic location, etc.).
As used herein, “biological sample” refers to any sample comprising nucleic acids, especially DNA, from or derived from a human patient, e.g., bodily fluids (blood, saliva, urine etc.), biopsy, tissue, and/or waste from the patient. Thus, tissue biopsies, stool, sputum, saliva, blood, lymph, or the like can easily be screened for polymorphisms, as can essentially any tissue of interest that contains the appropriate nucleic acids. In one embodiment, the biological sample is a cheek cell sample. These samples are typically taken, following informed consent, from a patient by standard medical laboratory methods. The sample may be in a form taken directly from the patient, or may be at least partially processed (purified) to remove at least some non- nucleic acid material.
As used herein, “gender” and “sex” are used interchangeably and refer to an individual’s biological reproductive anatomy. In an embodiment, an individual’s gender/sex is self-identified.
As used herein, “human subject”, “human” and subject” are used interchangeably and refer to the individual being assessed for risk of developing a severe response to a coronavirus infection.
A "polymorphism" is a locus that is variable; that is, within a population, the nucleotide sequence at a polymorphism has more than one version or allele. One example of a polymorphism is a "single nucleotide polymorphism" (SNP), which is a polymorphism at a single nucleotide position in a genome (the nucleotide at the specified position varies between individuals or populations). Other examples include a deletion or insertion of one or more base pairs at the polymorphism locus.
As used herein, the term "SNP" or "single nucleotide polymorphism" refers to a genetic variation between individuals; e.g., a single nitrogenous base position in the DNA of organisms that is variable. As used herein, "SNPs" is the plural of SNP. Of course, when one refers to DNA herein, such reference may include derivatives of the DNA such as amplicons, RNA transcripts thereof, etc.
The term "allele" refers to one of two or more different nucleotide sequences that occur or are encoded at a specific locus, or two or more different polypeptide sequences encoded by such a locus. For example, a first allele can occur on one chromosome, while a second allele occurs on a second homologous chromosome, e.g., as occurs for different chromosomes of a heterozygous individual, or between different homozygous or heterozygous individuals in a population. An allele "positively" correlates with a trait when it is linked to it and when presence of the allele is an indicator that the trait or trait form will occur in an individual comprising the allele. An allele "negatively" correlates with a trait when it is linked to it and when presence of the allele is an indicator that a trait or trait form will not occur in an individual comprising the allele.
A marker polymorphism or allele is "correlated" or "associated" with a specified phenotype (a severe response to a Coronavirus infection susceptibility, etc.) when it can be statistically linked (positively or negatively) to the phenotype. Methods for determining whether a polymorphism or allele is statistically linked are known to those in the art. That is, the specified polymorphism occurs more commonly in a case population (e.g., a severe response to a Coronavirus infection patients) than in a control population (e.g., individuals that do not have a severe response to a Coronavirus infection). This correlation is often inferred as being causal in nature, but it need not be, simple genetic linkage to (association with) a locus for a trait that underlies the phenotype is sufficient for correlation/association to occur.
The phrase "linkage disequilibrium" (LD) is used to describe the statistical correlation between two neighbouring polymorphic genotypes. Typically, LD refers to the correlation between the alleles of a random gamete at the two loci, assuming Hardy- Weinberg equilibrium (statistical independence) between gametes. LD is quantified with either Lewontin's parameter of association (D') or with Pearson correlation coefficient (r) (Devlin and Risch, 1995). Two loci with a LD value of 1 are said to be in complete LD. At the other extreme, two loci with a LD value of 0 are termed to be in linkage equilibrium. Linkage disequilibrium is calculated following the application of the expectation maximization algorithm (EM) for the estimation of haplotype frequencies (Slatkin and Excoffier, 1996). LD (r2) values according to the present disclosure for neighbouring genotypes/loci are selected above 0.1, preferably, above 0.2, more preferable above 0.5, more preferably, above 0.6, still more preferably, above 0.7, preferably, above 0.8, more preferably above 0.9, ideally about 1.0.
Another way one of skill in the art can readily identify polymorphisms in linkage disequilibrium with the polymorphisms of the present disclosure is determining the LOD score for two loci. LOD stands for "logarithm of the odds”, a statistical estimate of whether two genes, or a gene and a disease gene, are likely to be located near each other on a chromosome and are therefore likely to be inherited. A LOD score of between about 2 - 3 or higher is generally understood to mean that two genes are located close to each other on the chromosome. Various examples of polymorphisms in linkage disequilibrium with the polymorphisms of the present disclosure are shown in Tables 1 to 6, 8, 19 or 22. The present inventors have found that many of the polymorphisms in linkage disequilibrium with the polymorphisms of the present disclosure have a LOD score of between about 2 - 50. Accordingly, in an embodiment, LOD values according to the present disclosure for neighbouring genotypes/loci are selected at least above 2, at least above 3, at least above 4, at least above 5, at least above 6, at least above 7, at least above 8, at least above 9, at least above 10, at least above 20 at least above 30, at least above 40, at least above 50.
In another embodiment, polymorphisms in linkage disequilibrium with the polymorphisms of the present disclosure can have a specified genetic recombination distance of less than or equal to about 20 centimorgan (cM) or less. For example, 15 cM or less, 10 cM or less, 9 cM or less, 8 cM or less, 7 cM or less, 6 cM or less, 5 cM or less, 4 cM or less, 3 cM or less, 2 cM or less, 1 cM or less, 0.75 cM or less, 0.5 cM or less, 0.25 cM or less, or 0.1 cM or less. For example, two linked loci within a single chromosome segment can undergo recombination during meiosis with each other at a frequency of less than or equal to about 20%, about 19%, about 18%, about 17%, about 16%, about 15%, about 14%, about 13%, about 12%, about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, about 0.75%, about 0.5%, about 0.25%, or about 0.1% or less.
In another embodiment, polymorphisms in linkage disequilibrium with the polymorphisms of the present disclosure are within at least 100 kb (which correlates in humans to about 0.1 cM, depending on local recombination rate), at least 50 kb, at least 20 kb or less of each other.
For example, one approach for the identification of surrogate markers for a particular polymorphism involves a simple strategy that presumes that polymorphisms surrounding the target polymorphism are in linkage disequilibrium and can therefore provide information about disease susceptibility. Thus, as described herein, surrogate markers can therefore be identified from publicly available databases, such as HAPMAP, by searching for polymorphisms fulfilling certain criteria which have been found in the scientific community to be suitable for the selection of surrogate marker candidates (see, for example, Table 6a which provides surrogates of the polymorphisms in Table 3, and Table 6b which provides surrogates of the polymorphisms in Table 4).
"Allele frequency" refers to the frequency (proportion or percentage) at which an allele is present at a locus within an individual, within a line or within a population of lines. For example, for an allele "A," diploid individuals of genotype "AA,""Aa," or "aa" have allele frequencies of 1.0, 0.5, or 0.0, respectively. One can estimate the allele frequency within a line or population (e.g., cases or controls) by averaging the allele frequencies of a sample of individuals from that line or population. Similarly, one can calculate the allele frequency within a population of lines by averaging the allele frequencies of lines that make up the population. In an embodiment, the term “allele frequency” is used to define the minor allele frequency (MAF). MAF refers to the frequency at which the least common allele occurs in a given population.
An individual is "homozygous" if the individual has only one type of allele at a given locus (e.g., a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes). An individual is "heterozygous" if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles). The term "homogeneity" indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term "heterogeneity" is used to indicate that individuals within the group differ in genotype at one or more specific loci.
A "locus" is a chromosomal position or region. For example, a polymorphic locus is a position or region where a polymorphic nucleic acid, trait determinant, gene or marker is located. In a further example, a "gene locus" is a specific chromosome location (region) in the genome of a species where a specific gene can be found.
A "marker," "molecular marker" or "marker nucleic acid" refers to a nucleotide sequence or encoded product thereof (e.g., a protein) used as a point of reference when identifying a locus or a linked locus. A marker can be derived from genomic nucleotide sequence or from expressed nucleotide sequences (e.g., from an RNA, nRNA, mRNA, a cDNA, etc.), or from an encoded polypeptide. The term also refers to nucleic acid sequences complementary to or flanking the marker sequences, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence. A "marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence. Nucleic acids are "complementary" when they specifically hybridize in solution, e.g., according to Watson-Crick base pairing rules. A "marker locus" is a locus that can be used to track the presence of a second linked locus, e.g., a linked or correlated locus that encodes or contributes to the population variation of a phenotypic trait. For example, a marker locus can be used to monitor segregation of alleles at a locus, such as a quantitative trait locus (QTL), that are genetically or physically linked to the marker locus. Thus, a "marker allele," alternatively an "allele of a marker locus" is one of a plurality of polymorphic nucleotide sequences found at a marker locus in a population that is polymorphic for the marker locus. Each of the identified markers is expected to be in close physical and genetic proximity (resulting in physical and/or genetic linkage) to a genetic element, e.g., a QTL, that contributes to the relevant phenotype. Markers corresponding to genetic polymorphisms between members of a population can be detected by methods well-established in the art. These include, e.g., DNA sequencing, PCR-based sequence specific amplification methods, detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, detection of allele specific hybridization (ASH), detection of single nucleotide extension, detection of amplified variable sequences of the genome, detection of self- sustained sequence replication, detection of simple sequence repeats (SSRs), detection of single nucleotide polymorphisms (SNPs), or detection of amplified fragment length polymorphisms (AFLPs).
The term "amplifying" in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. Typical amplification methods include various polymerase based replication methods, including the polymerase chain reaction (PCR), ligase mediated methods such as the ligase chain reaction (LCR) and RNA polymerase based amplification (e.g., by transcription) methods.
An "amplicon" is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, or the like).
A "gene" is one or more sequence(s) of nucleotides in a genome that together encode one or more expressed molecules, e.g., an RNA, or polypeptide. The gene can include coding sequences that are transcribed into RNA which may then be translated into a polypeptide sequence, and can include associated structural or regulatory sequences that aid in replication or expression of the gene.
A "genotype" is the genetic constitution of an individual (or group of individuals) at one or more genetic loci. Genotype is defined by the allele(s) of one or more known loci of the individual, typically, the compilation of alleles inherited from its parents.
A "haplotype" is the genotype of an individual at a plurality of genetic loci on a single DNA strand. Typically, the genetic loci described by a haplotype are physically and genetically linked, i.e., on the same chromosome strand.
A "set" of markers (polymorphisms), probes or primers refers to a collection or group of markers probes, primers, or the data derived therefrom, used for a common purpose, e.g., identifying an individual with a specified genotype (e.g., risk of developing a severe response to a Coronavirus infection). Frequently, data corresponding to the markers, probes or primers, or derived from their use, is stored in an electronic medium. While each of the members of a set possess utility with respect to the specified purpose, individual markers selected from the set as well as subsets including some, but not all of the markers, are also effective in achieving the specified purpose.
The polymorphisms and genes, and corresponding marker probes, amplicons or primers described above can be embodied in any system herein, either in the form of physical nucleic acids, or in the form of system instructions that include sequence information for the nucleic acids. For example, the system can include primers or amplicons corresponding to (or that amplify a portion of) a gene or polymorphism described herein. As in the methods above, the set of marker probes or primers optionally detects a plurality of polymorphisms in a plurality of said genes or genetic loci. Thus, for example, the set of marker probes or primers detects at least one polymorphism in each of these polymorphisms or genes, or any other polymorphism, gene or locus defined herein. Any such probe or primer can include a nucleotide sequence of any such polymorphism or gene, or a complementary nucleic acid thereof, or a transcribed product thereof (e.g., a nRNA or mRNA form produced from a genomic sequence, e.g., by transcription or splicing).
As used herein, “Receiver operating characteristic curves” (ROC) refer to a graphical plot of the sensitivity vs. (1 - specificity) for a binary classifier system as its discrimination threshold is varied. The ROC can also be represented equivalently by plotting the fraction of true positives (TPR = true positive rate) vs. the fraction of false positives (FPR = false positive rate). Also known as a Relative Operating Characteristic curve, because it is a comparison of two operating characteristics (TPR & FPR) as the criterion changes. ROC analysis provides tools to select possibly optimal models and to discard suboptimal ones independently from (and prior to specifying) the cost context or the class distribution. Methods of using in the context of the disclosure will be clear to those skilled in the art.
As used herein, the phrase “combining the first clinical risk assessment and the genetic risk assessment” refers to any suitable mathematical analysis relying on the results of the assessments. For example, the results of the first clinical risk assessment and the genetic risk assessment may be added, more preferably multiplied.
As used herein, the terms “routinely screening for a severe response to a Coronavirus infection” and “more frequent screening” are relative terms, and are based on a comparison to the level of screening recommended to a subject who has no identified risk of developing a severe response to a Coronavirus infection. Genetic Risk Assessment
In an aspect, a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection of the invention involves detecting the presence of a polymorphism provided in any one of Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium therewith. In another aspect, a method of the invention involves a genetic risk assessment performed by analysing the genotype of the subject at two or more loci for polymorphisms associated with a severe response to a Coronavirus infection. Various exemplary polymorphisms associated with a severe response to a Coronavirus infection are discussed in the present disclosure. These polymorphisms vary in terms of penetrance and many would be understood by those of skill in the art to be low penetrance polymorphisms.
The term “penetrance” is used in the context of the present disclosure to refer to the frequency at which a particular polymorphism manifests itself within human subjects with a severe response to a Coronavirus infection. “High penetrance” polymorphisms will almost always be apparent in a human subject with a severe response to a Coronavirus infection while “low penetrance” polymorphisms will only sometimes be apparent. In an embodiment polymorphisms assessed as part of a genetic risk assessment according to the present disclosure are low penetrance polymorphisms. As the skilled addressee will appreciate, each polymorphism which increases the risk of developing a severe response to a Coronavirus infection has an odds ratio of association with a severe response to a Coronavirus infection of greater than 1.0. In an embodiment, the odds ratio is greater than 1.02. Each polymorphism which decreases the risk of developing a severe response to a Coronavirus infection has an odds ratio of association with a severe response to a Coronavirus infection of less than 1.0. In an embodiment, the odds ratio is less than 0.98. Examples of such polymorphisms include, but are not limited to, those provided in Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium with one or more thereof. In an embodiment, the genetic risk assessment involves assessing polymorphisms associated with increased risk of developing a severe response to a Coronavirus infection. In another embodiment, the genetic risk assessment involves assessing polymorphisms associated with decreased risk of developing a severe response to a Coronavirus infection. In another embodiment, the genetic risk assessment involves assessing polymorphisms associated with an increased risk of developing a severe response to a Coronavirus infection and polymorphisms associated with a decreased risk of developing a severe response to a Coronavirus infection. Table 1 - Informative polymorphisms of the invention. osome Position Alleles p-value for
Chrom SNP ID association 1 31624029 rs 12083278 G,C 0.00000243 1 87628173 rs10873821 C,T 0.0000228 1 63766718 rs112728381 C,T 0.0000252 1 2998313 rs12745140 G,A 0.0000317 1 36374101 rs2765013 C,T 0.000039 1 36549664 rs2274122 G,A 0.000107 1 186287454 rs1830344 T,C 0.000127 1 187364290 rs7517532 G,C 0.000136 1 114893146 rs574339 T,C 0.000169 1 222722631 rs61825527 A,C 0.000194 1 31380174 rs4303117 A,C 0.000199 1 88237749 rs72714531 T,C 0.000223 1 101661978 rs11166552 C,T 0.000257 1 37147203 rs219007 C,T 0.000271 1 184803508 rs630030 A,G 0.000271 1 60210649 rs 1004772 T,C 0.000289 1 83665753 rs9432945 C,T 0.000293 1 36172029 rs6664663 C,G 0.000304 1 161229986 rs5778200 A, AC 0.000326 1 107941708 rs17018870 G,A 0.000328 1 14216150 rs17350970 C,T 0.000346 1 55046392 rs300269 G,A 0.000355 1 230906775 rs3790971 A,G 0.000357 1 60214250 rs3990361 A,G 0.000386 1 208388679 rs78771609 A,G 0.000395 1 3680362 rs146866117 T,C 3.21516E-05 1 10993680 rs75721992 C,T 8.03153E-09 1 15698556 rs12562412 G,C 7.34872E-05 1 15758944 rs117338853 A,G 9.31685E-05 1 16109212 rs72647169 G,C 1.72286E-05 1 17295659 rs199765517 T,C 6.47434E-05 1 20072025 rs199727655 A,G 3.41489E-05 1 22538788 rs78360109 A,G 1.32276E-06 1 34829829 rs79955780 G,A 8.74145E-05 1 38661814 rs61778695 C,A 4.43093E-05 1 67804320 rs578200723 GTTA.G 0.000020482 1 72488455 rs 116544454 T,G 1.85829E-05 1 109823418 rs144022094 T,C 3.57493E-05 1 109933450 rs56072034 A,G 4.12342E-05 1 168696733 rs76129265 T,G 7.51539E-05 204092087 rs201772428 A,G 4.301 IE-06
206776460 rs35252702 A,G 1.56671E-07
207610967 rs61821114 T,C 3.00757E-05
210901242 rs1934624 A,T 5.48665E-05
218938774 rs76354174 A,G 7.54499E-05
230907829 rs143186556 A,G 5.46536E-05
231133014 rs200114138 A,G 3.96515E-06
46618634 rs17102023 G,A 0.5
150271556 rs115492982 A,G 0.01
152684866 rs2224986 T,C 0.8
192526317 rs74508649 T,C 0.9
239197542 rs 112317747 C,T 0.05
36905013 rs6714112 C,A 0.00000781
217524986 rs2270360 A,C 0.0000245
11239618 rs62120103 C,T 0.000116
42181679 rs6740960 A,T 0.00012
137073048 rs6430625 A,G 0.000144
75788396 rs759255 C,A 0.000181
11694251 rs4313952 A,G 0.000194
140976470 rs9941558 A,G 0.000196
13900135 rs61101702 TAATA,T 0.0002
182396974 rs6760007 T,C 0.0002
46584059 rs34136947 T,G 0.000222
6948980 rs 55900661 G,A 0.000235
175367762 rs4972443 T,C 0.000237
217553774 rs3755137 T,A 0.000263
2965401 rs 1729903 C,T 0.000271
182359592 rs16867434 T,C 0.000275
50825372 rs116302817 C,T 0.000322
217701606 rs 111437052 A,G 0.000343
52551249 rs115352379 T,C 0.000344
45503541 rs6749256 G,C 0.000397
11662023 rs62120186 C,T 0.000403
52998723 rs62127009 A,G 0.000408
22958939 rs59447738 G,T 8.21388E-05
23005876 rs73918088 A,C 7.50922E-05
25861939 rs189303418 T,C 0.000040202
34108876 rs1718746 C,G 8.52475E-05
34119632 rs 1705143 A,G 8.08594E-05
64630299 rs872241 G,A 7.17367E-05
64641736 rs 11676644 C,T 0.000032141
115258481 rs56735442 A,G 3.59163E-05
122952399 rs75945051 G,A 4.38486E-05 126726522 rs76187206 C,G 5.74668E-05
160721407 chr2_160721407 A, AC 4.45501E-05
179428061 rs11896637 T,C 1.81846E-06
179441917 rs72646881 C,T 1.59099E-05
179612315 rs145581345 C,T 8.45307E-05
181910717 rs78593095 A,G 2.26398E-05
191278341 rs6725814 G,A 1.88302E-05
79895332 rs183569214 G,T 0.7
80029580 rs77764981 T,G 0.6
182353446 rs2034831 A,G 0.02
141408691 rs6440031 A,G 0.0000714
1093795 rs1504061 C,G 0.0000716
125837737 rs1868132 C,T 0.000102
125649876 rs6438947 T,C 0.000126
38759465 rs9990137 A,G 0.000148
155736888 rs4680228 C,T 0.000157
24759067 rs71328493 C,G 0.000213
46628726 rs1829538 G,T 0.000257
71238088 rs111 323182 T,A 0.00027
143909347 rs13089585 T,C 0.000302
2357581 rs56035150 A,G 0.000318
5893097 rs74827709 G,T 0.000342
21751839 rs1080021 A,G 0.000366
25519583 rs1864903 A,G 0.000366
173319456 rs6800283 T,C 0.000366
195949310 rs35516030 AG, A 0.000375
170214459 rs2008829 G,T 0.000376
38736230 rs12639182 C,T 0.000395
18486173 rs62240975 G,A 0.000405
170266664 rs139670481 AAATT,A 0.000406
170961913 rs115037737 G,A 0.000407
2748191 rs80225140 G,A 8.74289E-06
34944013 rs17032477 G,A 3.63638E-05
65100060 rs2128405 C,A 1.71219E-05
70783491 rs6766000 T,C 2.0003 IE-05
81810551 rs35196441 T,G 3.53506E-05
154812638 rs2196521 G,A 3.73634E-05
160379672 rs4679910 G,A 1.90222E-05
171853417 rs73167212 G,A 0.00002702
27188298 rs17317135 A,G 0.0000641
177796194 rs74911757 T,C 1.43291E-05
3184653 rs1705826 G,C 0.5
45841938 rs35896106 T,C 0.04 45900634 rs76374459 C,G 0.03
45908514 rs35652899 G,C 0.04
45916222 rs12639224 T,C 0.7
45916786 rs34901975 A,G 0.09
46018781 rs71615437 G,A 0.1
46049765 rs13433997 C,T 0.1
46180416 rs10510749 T,C 0.9
46222037 rs115102354 G,A 0.7
62936766 rs13062942 G,A 0.09
148718087 rs76488148 T,G 0.03
69705994 rs115162070 G,A 0.00000356
44418592 rs35540967 T,C 0.0000289
5821922 rs3774882 C,G 0.0000349
5821877 rs3774881 T,C 0.0000459
112613026 rs112641600 C,T 0.000058
106943200 rs 11729561 T,C 0.000104
163076494 rs62331317 G,A 0.000113
5820342 rs28426993 C,T 0.000114
35945837 rs111 866232 G,C 0.000157
106909473 rs78699658 A,G 0.000213
99439788 rs7668981 C,T 0.000273
187239747 rs7687352 A,G 0.000288
60236874 rs12498396 G,A 0.000292
60147523 rs13126577 T,C 0.000293
24316054 rs28735003 T,C 0.000295
96348686 rs4277782 T,C 0.000314
162009814 rs35850287 C,T 0.00033
39943691 rs115509062 G,C 6.54964E-05
45117625 rs75072424 A,G 2.80438E-05
69795670 rs144454074 A,G 4.19779E-05
73555556 rs28616128 G,A 3.02015E-06
75191300 rs115044024 C,T 4.15557E-05
84216649 rs144185023 A,G 3.72469E-05
87939942 rs76456240 C,T 9.48747E-05
121958473 rs202221151 C,T 1.61977E-06
142326546 rs76589765 G,A 4.20983E-06
151724769 rs116015734 T,C 9.26679E-05
153821201 rs62319956 C,A 2.01266E-06
170238293 rs76519323 A,C 2.30315E-05
170498270 rs74557505 C,T 6.57926E-05
181162752 rs17069033 T,G 1.35337E-05
185567903 rs4647611 C,G 2.72675E-05
27383278 rs6810404 A,C 0.0000988 173989338 rs2220543 T,A 0.0000187
180216905 rs 10577599 CAT,C 0.000025
142252549 rs10039856 C,T 0.0000585
123950404 rs4240376 G,T 0.000065
122832716 rs62377777 T,C 0.0000653
59077872 rs62370540 T,C 0.000116
122559297 rs72787582 C,T 0.000117
124143238 rs71594388 C,T 0.000136
159258092 rs78045322 G,C 0.000172
135351183 rs72794907 G,A 0.000174
135435801 rs7720483 C,T 0.000174
122958050 rs70988587 ATTC.A 0.000215
176737309 rs7732626 A,G 0.000256
59191612 rs159616 C,T 0.000259
135360738 rs35901765 C,T 0.000275
106396918 rs6864971 C,T 0.000373
6471344 rs507971 C,T 0.00038
161475413 rs17548653 C,T 0.00041
6826973 rs275444 C,G 3.53004E-05
19993490 rs4466171 A,T 3.08251E-06
43280480 rs55770078 A,G 1.16965E-05
99815379 rs115319054 A,C 8.88589E-05
133519273 rs79601653 G,A 9.89897E-05
155405405 rs958444 T,C 2.01272E-05
160448591 rs11749317 C,T 0.000080983
180237828 rs113791144 T,C 0.000144
169590905 rs4478338 G,T 0.3
171480160 rs111265173 T,C 1
106326754 rs9386484 T,A 0.00000617
45704813 rs16873740 T,A 0.0000296
12216966 rs10755709 A,G 0.00003
18015447 rs140247774 C,T 0.000047
6925195 rs6933436 A,C 0.0000983
151433505 rs6928557 A,C 0.000121
170445103 rs9366129 C,T 0.000133
148557644 rs9390548 G,A 0.000149
137545805 rs11759276 A,T 0.000183
54128003 rs12193921 T,C 0.000184
54353221 rs76378690 G,A 0.000206
20013937 rs13213659 A,G 0.000233
148522455 rs117687499 G,A 0.000262
154813083 rs6935885 G,C 0.000306
18739469 rs2328283 A,C 0.000333 18271083 rs10949488 C,T 0.000355
20044587 rs594259 A,G 0.000375
44184719 rs2297393 T,C 0.000409
2885791 rs318470 C,A 9.76222E-05
16217762 rs149442766 A,G 3.42524E-05
26408145 rs144114619 A,T 4.57681E-05
33156845 rs41268014 G,C 1.61406E-05
36976747 rs140572234 C,G 6.20165E-08
36999980 rs114925152 G,C 0.000019845
37139030 rs35760989 C,G 2.15792E-05
101279459 rs9485415 T,C 2.95345E-05
147885588 rs140643252 A,G 0.000080315
27604726 rs61611950 T,C 0.8
114940068 rs7800941 G,A 0.000199
138401542 rs3778698 T,C 0.0002
99987236 rs7798226 T,G 0.000222
154700565 rs882469 G,A 0.000222
105125204 rs111283303 G,A 0.000232
11301277 rs7807069 G,A 0.000271
11362820 rs76731008 G,A 0.000277
9397414 rs13238693 T,G 0.000286
52994281 rs7804465 T,C 0.000342
36662714 rs58016731 AGTCTT.A 0.000391
6687563 rs55944391 C,A 0.000395
45244259 rs1294888 T,C 0.000395
14862658 rs2109498 A,T 0.000419
21730647 rs7790948 G,T 3.13489E-05
35720134 rs79496619 T,G 3.21712E-05
38677134 rs78966608 A,C 7.06676E-05
100483400 rs200675508 A,G 7.25535E-05
104782689 rs55743527 G,T 1.36022E-06
122122078 rs73431600 A,G 5.15467E-05
122196872 rs73433754 A,C 3.4801 IE-05
154926067 rs117164958 C,G 7.61301E-06
158928541 rs13225056 A,G 1.53596E-05
152960930 rs6967210 C,T 0.3
16790149 rs118072448 T,C 0.0000235
74268198 rs2010843 T,C 0.0000556
38897470 rs13282163 A,C 0.0000739
40181978 rs11779911 C,A 0.0000841
38821327 rs10808999 A,G 0.0000884
12850333 rs2947375 A,G 0.000162
143261211 rs72685583 T,C 0.000218 55488334 rs74458553 C,T 0.000254
32590598 rs4351382 T,A 0.000273
61303777 rs147353244 G,GA 0.000327
2044114 rs147776183 T,C 8.64871E-06
9478274 rs78876374 T,C 8.85355E-05
19218826 rs145746072 A,G 1.91735E-05
20354600 rs13249119 G,A 1.33633E-05
20447019 rs73626732 A,G 1.40229E-05
20460661 rs35258926 G,T 9.04111E-06
39799765 rs7845003 T,C 9.39614E-05
125839433 rs118040942 T,C 0.000059504
130677813 rs57557483 A,G 8.17573E-06
130694201 rs75572486 A,G 2.53314E-05
8730488 rs332040 A,G 0.9
4329170 rs3895472 T,C 0.0000235
21131627 rs12236000 G,C 0.0000452 75127404 rs35460846 A, AT 0.0000819
81158113 rs7027911 A,G 0.0000905
81158443 rs3009696 C,T 0.00013
140227646 rs11523787 C,T 0.000137
75061917 rs11143296 C,T 0.00014 78174461 rs13298924 T,C 0.00021
23650820 rs4584238 G,C 0.00022
35490636 rs10814241 C,G 0.00022
138202418 rs7032559 C,T 0.00025
122045518 rs487545 T,C 0.000269
139024232 rs7021573 G,A 0.000309
75136789 rs7022441 G,A 0.000343
139047766 rs10858230 G,A 0.000367
138006474 rs61018036 G,A 0.000373
116468053 rs75260470 C,T 0.000402
10276812 rs 10959000 A,G 7.85152E-05 22080363 rs16905613 G,A 5.78633E-06
38669062 rs2993177 A,G 7.37838E-05
79453107 rs7853555 T,C 5.2571 IE-05
83032179 rs72744937 G,A 6.92799E-05
100137855 rs200908751 A,G 6.57652E-05
101874496 rs76094400 A,G 3.95481E-08
125704675 rs76670825 A,G 5.01185E-05
125903047 rs77089732 A,G 0.00005145
128794405 rs62570501 T,C 7.35517E-05
131771551 rs17455482 A,G 5.2118E-06
27121456 rs71480372 T,A 0.7 29688719 rs74790577 T,A 0.9
44015051 rs10793436 G,T 0.0000302
54100345 rs1441121 A,T 0.0000322
37454397 rs1892429 A,G 0.0000335
37277870 rs2091431 A,G 0.0000935
68576077 rs12218365 T,C 0.000113
54088932 rs75242872 C,G 0.000117
37370440 rs1794410 G,A 0.000118
90464714 rs303509 T,G 0.000118
43942080 rs12355127 G,A 0.000182
6079344 rs11256442 T,C 0.000183
6042472 rs17322780 A,G 0.000185
63303879 rs79189092 GA,G 0.000234
43563260 rs3026716 A,G 0.000246
109569850 rs12570947 T,C 0.000269
27204531 rs1815323 T,C 0.000276
6128547 rs7078273 G,T 0.000303
115225859 rs10430681 T,A 0.000303
63420128 rs11595927 C,T 0.000333
8109274 rs520236 C,G 0.000349
27929163 rs12774308 G,A 0.000354
31913890 rs 11008551 G,T 0.000366
57401482 rs2463950 C,T 0.000366
72532238 rs2253801 T,C 0.000387
72223789 rs 10740349 C,G 0.000394
3096047 rs12241312 C,A 0.000403
50140588 rs2940708 G,A 0.000404
67680203 rs41313840 G,A 7.19977E-08
127258691 rs7084502 A,G 7.81329E-05
9030308 rs71481792 A,T 0.0000223
131456440 rs79858702 T,C 0.000070971
123000638 rs5016035 G,T 0.9
2893867 rs 10766439 A,G 0.0000937
2897875 rs4929952 C,T 0.00011
10531548 rs142012992 CTTAG.C 0.000111
69896252 rs4980753 A,G 0.000199
2902105 rs3864883 C,T 0.000222
126061372 rs35747384 G,T 0.000237
270987 rs7396066 C,T 0.000245
117755082 rs491292 C,T 0.000246
130323805 rs7109513 C,T 0.000256
120784855 rs2852238 G,C 0.000274
119248855 rs76560104 T,C 0.000279 1795214 rs79194907 6.83674E-05
5146083 rs12365149 3.11673E-05
44547746 rs12275504 1.40655E-05 46727333 rs149066130 7.98651E-05
57982229 rs1966836 6.87681E-05
65414949 rs199717374 1.05822E-05
78904266 rs75970706 0.000040305
94665002 rs76360689 1.05432E-06
133713033 rs75786498 3.13102E-05
8760610 rs11613792 0.00000256
106624953 rs12823094 0.0000633
25427178 rs140584644 0.000107
50375477 rs7979554 0.000158
76404693 rs1433362 0.000196
95127606 rs6538530 0.000207
77114964 rs12827237 0.000227
7606158 rs11611785 0.000234
126551205 rs11058488 0.000239
58267346 rs112976255 0.000259
129567952 rs58003804 0.000265
130254478 rs73160210 0.000267
68010614 rs1904551 0.000272
116784113 rs1732329 0.000287
25159263 rs859134 0.000368
129563020 rs2002553 0.000387
130242016 rs73436164 0.000389
125537439 rs145578156 0.000402
67821215 rs7955453 0.000403
41970164 rs970970 0.000405
2144357 rs75442877 0.000407
2174748 rs117821007 4.86991E-05 25681286 rs58907459 6.07118E-05
57589676 rs143285614 2.69071E-05
125302200 rs143093152 6.62377E-06
56084466 rs7397549 0.9
74558505 rs12871414 0.000094
23658838 rs1984162 0.000103
99778655 rs35784338 0.000199
102622688 rs7339161 0.000203
101425653 rs9585503 0.00025
74804797 rs2039342 0.000345
98753461 rs545096 0.000349
71296869 rs2249209
Figure imgf000036_0001
0.000385 28230642 rs10712355 AT, A 0.000415
39433574 rs138539682 A,G 3.32149E-05
68302925 rs75022796 T,C 7.24669E-05
63178476 rs2649134 T,C 0.5
72908102 rs2238187 A,G 0.00000821
72934229 rs12587980 C,T 0.0000933
76011690 rs2734265 G,A 0.000178
72891494 rs2238191 C,A 0.000196
65225452 rs58725048 G,C 0.000269
41523312 rs111 57189 A,G 0.000314
35857405 rs61988300 A,G 0.000315
97526363 rs75607541 T,A 0.000337
52276643 rs117852779 C,T 2.89233E-06
80405359 rs111 59425 T,G 4.36025E-07
80570671 rs114463019 G,T 3.85403E-05
87813714 rs28450466 A,G 9.45754E-05
93016441 rs57851052 C,T 5.53318E-05
104863663 rs80083325 A,G 0.000073746
77692036 rs144114696 A,G 0.3
33908103 rs12593288 C,T 0.000023
33916053 rs2229117 G,C 0.0000561
27274425 rs149380649 CT,C 0.000112
81412674 rs2683240 C,T 0.000184
89165665 rs73451724 G,A 0.000235
33407307 rs17816808 A,G 0.000295
46666881 rs1994195 A,C 0.000295
33914240 rs16973353 A,T 0.000307
53279291 rs719715 G,A 0.000321
89162709 rs112248718 G,A 0.000406
22845849 rs150408740 G,A 1.76793E-05
34498314 rs75915717 T,C 1.0293E-06
41047777 rs35673728 C,T 6.67895E-05
41254865 rs12915860 C,A 1.01336E-05
41712936 rs62001419 A,C 9.84979E-05
52689631 rs1724577 T,G 2.42041E-05
58047086 rs77910305 G,C 1.30369E-05
65851028 rs200531541 A,G 3.83063E-06
78471034 rs34921279 T,C 2.40367E-05
84063245 rs12591031 G,A 1.16687E-05
91452594 rs142925505 T,C 6.04339E-07
45858905 rs77055952 G,A 0.5
48984345 rs74750712 G,T 0.4
78624025 rs72803978 A,G 0.0000612 4065412 rs12448453 A,G 0.000148
84006469 rs2250573 C,A 0.000148
6653119 rs12934582 T,C 0.000264
27040235 rs2063839 G,A 0.000272
6081670 rs8053942 C,T 0.000304
31404502 rs2454907 G,A 0.000304
85992829 rs111 17428 T,C 0.000318
31392047 rs 11574646 C,T 0.000358
78865144 rs68020681 T,G 0.000404
5898969 rs11647387 A,C 0.000406
49391921 rs62029091 A,G 7.11949E-05
49394276 rs8057939 C,T 1.12522E-05
60671279 rs118097562 T,A 1.90641E-05
61851413 rs151208133 T,C 6.3915E-06
81194912 rs 11642802 C,A 4.32104E-06
90075827 rs201800670 T,C 1.60067E-05
10579876 rs72779789 C,G 0.9
49311043 rs145643452 A,G 0.9
9170408 rs34761447 C,T 0.0000262
29737612 rs178840 G,A 0.0000753
29740894 rs35054028 G,T 0.00025
18671675 rs55828488 G,A 0.000284
31676083 rs59341815 T,C 0.000294
3110572 rs34259120 C,A 0.00032
15548222 rs55821658 C,T 0.000365
1462712 rs73298816 G,A 5.44207E-05
3844344 rs144535413 T,C 1.11488E-05
36485146 rs 147966258 A,G 1.64933E-05
39240563 rs193005959 A,C 3.72836E-05
55803083 rs72841559 C,G 2.26086E-05
56329775 rs368901060 ACCAT.A 4.70507E-06
63919929 rs7220318 G,A 2.39945E-05
72890474 rs689992 T,A 8.97907E-05
78215658 rs117140258 A,G 4.15567E-05
80443309 rs9890316 A,G 0.9
67208392 rs12958013 T,C 0.0000319
10016417 rs618909 C,A 0.000193
649311 rs9966612 A,G 0.00021
3899729 rs2667396 C,T 0.000259
59747387 rs652473 C,T 0.000338
9095227 rs16954792 T,C 0.000368
76506592 rs35409638 C,T 0.00039
67209524 rs34527658 A, AT 0.000391 4610215 rs76902871 G,T 2.95635E-05
13501162 rs2298530 C,T 6.48889E-05
14310187 rs117505121 G,A 3.59448E-05
49288587 rs117781678 A,C 4.32852E-05
76650871 rs7240086 G,A 6.95487E-06
30006171 rs142257532 C,T 1
44492164 rs60744406 A,G 0.000019
32023957 rs8105499 C,A 0.000103
3058098 rs3217064 C,CT 0.000188
50693096 rs648691 T,C 0.000229
6533402 rs3097296 T,C 0.000306
55500034 rs76616660 T,C 0.000312
15565046 rs 9646651 G,A 0.000323
44436733 rs8100011 G,A 0.000334
57133633 rs35011777 C,T 0.000365
36018109 rs74726174 C,T 1.82372E-05
53333975 rs10411226 G,A 0.0000923
38867031 rs200403794 A,G 8.36021E-05
20344377 rs7270923 A,C 0.000159
53043792 rs6023232 G,T 0.000186
38792298 rs6016275 C,T 0.000192
45355986 rs2076293 A,G 0.000217
52985158 rs6097944 T,G 0.000284
8782776 rs138434221 A,C 4.80296E-06
15632993 rs6110707 C,T 1.31264E-05
55021575 rs6069749 T,C 2.92257E-05
55111747 rs6014757 A,G 6.44584E-05
39389409 rs56259900 G,A 0.6
60473717 rs76253189 G,C 1
43080428 rs2252109 A,T 0.0000428
43086264 rs2849697 T,C 0.000144
46991937 rs76902403 G,A 0.000155
41321695 rs11701006 G,A 0.000196
39963301 rs 975846 A,G 0.000268
35423390 rs 1986076 C,T 0.000297
39962001 rs9789875 C,T 0.000299
20402128 rs62216866 A,G 0.000367
19045795 rs73200561 A,T 9.40896E-05
37444937 rs2230191 A,G 3.4537E-07
44424444 rs75994231 T,C 0.7
22564734 rs5757427 A,T 0.00000237
49677464 rs62220604 G,A 0.0000355
24407483 rs 11090305 T,C 0.0000377 44341300 rs17494724 G,A 0.000157 47986266 rs56813510 C,A 0.000189 44323597 rs139049 C,T 0.000306 28016883 rs1885362 A,C 4.65803E-05 40056937 rs113038998 T,C 1.37758E-05 44285118 rs117421847 A,G 6.60782E-05 22724951 rs7290963 T,G 0.0000716
Table 2 - Informative polymorphisms of the invention - 306 polymorphism panel.
Chromsome Position SNP ID Allele 1 Allele 2 Frequency Allele 1 Frequency Allele 2 p-value for association OR
1 2998313 rs12745140 A G 0.088689 0.911311 0.000032 1.832076
14216150 rs17350970 T C 0.077425 0.922575 0.000346 0.7217155
31380174 rs4303117 A C 0.308602 0.691398 0.000199 0.725645
31624029 rs12083278 G C 0.295029 0.704971 0.000002 0.751250
36172029 rs6664663 G C 0.134612 0.865388 0.000304 0.816236
36374101 rs2765013 T C 0.086283 0.913717 0.000039 0.749941
36549664 rs2274122 G A 0.185863 0.814137 0.000107 0.810774
37147203 rs219007 T C 0.373057 0.626943 0.000271 1.161837
55046392 rs300269 G A 0.475448 0.524552 0.000355 1.118490
60210649 rs1004772 T C 0.156424 0.843576 0.000289 1.537451
60214250 rs3990361 G A 0.314799 0.685201 0.000386 0.880359
63766718 rs112728381 T C 0.310873 0.689127 0.000025 0.829006
83665753 rs9432945 T C 0.195772 0.804228 0.000293 1.244035
87628173 rs10873821 T C 0.247509 0.752491 0.000023 0.654805
88237749 rs72714531 C T 0.061964 0.938036 0.000223 0.615057
101661978 rs11166552 T c 0.338277 0.661723 0.000257 0.740338
107941708 rs17018870 A G 0.123982 0.876018 0.000328 1.316821
114893146 rs574339 C T 0.292471 0.707529 0.000169 0.838798
161229986 rs5778200 AC A 0.166927 0.833073 0.000326 1.100723
184803508 rs630030 A G 0.459053 0.540947 0.000271 0.776025
186287454 rs1830344 C T 0.099058 0.900942 0.000127 0.715555
187364290 rs7517532 C G 0.277242 0.722758 0.000136 1.274559
208388679 rs78771609 G A 0.057479 0.942521 0.000395 0.682444
222722631 rs61825527 C A 0.055134 0.944866 0.000194 0.684243
230906775 rs3790971 A G 0.296911 0.703089 0.000357 0.809538
2965401 rs1729903 T C 0.431488 0.568512 0.000271 1.363332
6948980 rs55900661 A G 0.069029 0.930971 0.000235 1.467029
11239618 rs62120103 T C 0.447468 0.552532 0.000116 0.728192
11662023 rs62120186 T C 0.141992 0.858008 0.000403 0.679629
11694251 rs4313952 G A 0.128053 0.871947 0.000194 0.692882
13900135 rs61101702 T TAATA 0.200010 0.799990 0.000200 0.686034
36905013 rs6714112 A C 0.138077 0.861923 0.000008 0.702041
42181679 rs6740960 A T 0.484269 0.515731 0.000120 0.838653
45503541 rs6749256 C G 0.125856 0.874144 0.000397 0.698683
46584059 rs34136947 G T 0.150999 0.849001 0.000222 0.764697
50825372 rs116302817 T C 0.055823 0.944177 0.000322 0.502987
52551249 rs115352379 C T 0.052932 0.947068 0.000344 0.802121
52998723 rs62127009 G A 0.146798 0.853202 0.000408 1.315507
2 75788396 rs759255 A C 0.179965 0.820035 0.000181 0.785823
2 137073048 rs6430625 G A 0.377976 0.622024 0.000144 0.874221 140976470 rs9941558 G A 0.215540 0.784460 0.000196 0.758804
175367762 rs4972443 C T 0.185607 0.814393 0.000237 0.755393
182359592 rs16867434 C T 0.086231 0.913769 0.000275 1.665760
182396974 rs6760007 C T 0.202409 0.797591 0.000200 1.303906
217524986 rs2270360 C A 0.265435 0.734565 0.000025 0.806294
217553774 rs3755137 A T 0.167060 0.832940 0.000263 0.869056
217701606 rs111437052 G A 0.045066 0.954934 0.000343 0.658309
1093795 rs1504061 G C 0.050105 0.949895 0.000072 1.878863
2357581 rs56035150 G A 0.051997 0.948003 0.000318 1.203568
5893097 rs74827709 T G 0.109834 0.890166 0.000342 0.744145
18486173 rs62240975 A G 0.238497 0.761503 0.000405 1.236323
21751839 rs1080021 G A 0.456598 0.543402 0.000366 1.189673
24759067 rs71328493 G C 0.121505 0.878495 0.000213 1.301830
25519583 rs1864903 G A 0.403176 0.596824 0.000366 1.057886
27188298 rs17317135 A G 0.048133 0.951867 0.000064 0.653752
38736230 rs12639182 T C 0.198184 0.801816 0.000395 0.806524
38759465 rs9990137 G A 0.341528 0.658472 0.000148 0.765458
46628726 rs1829538 G T 0.129451 0.870549 0.000257 0.757119
71238088 rs111323182 A T 0.044740 0.955260 0.000270 0.902081
125649876 rs6438947 C T 0.235079 0.764921 0.000126 1.208900
125837737 rs1868132 T C 0.111588 0.888412 0.000102 1.421540
141408691 rs6440031 A G 0.084557 0.915443 0.000071 0.730686
143909347 rs13089585 C T 0.050473 0.949527 0.000302 0.600404
155736888 rs4680228 T C 0.443082 0.556918 0.000157 1.248159
170214459 rs2008829 T G 0.285307 0.714693 0.000376 1.093430
170266664 rs139670481 A AAATT 0.141898 0.858102 0.000406 1.502990
170961913 rs115037737 A G 0.057828 0.942172 0.000407 0.607395
173319456 rs6800283 C T 0.089864 0.910136 0.000366 0.789994
195949310 rs35516030 A AG 0.263765 0.736235 0.000375 1.315177
5820342 rs28426993 T C 0.099661 0.900339 0.000114 0.575494
5821877 rs3774881 C T 0.151611 0.848389 0.000046 0.647570
5821922 rs3774882 G C 0.075890 0.924110 0.000035 0.573686
24316054 rs28735003 C T 0.144258 0.855742 0.000295 0.658173
27383278 rs6810404 A C 0.490985 0.509015 0.000099 0.776925
35945837 rs111866232 C G 0.039927 0.960073 0.000157 0.541922
44418592 rs35540967 C T 0.074931 0.925069 0.000029 1.777837
60147523 rs13126577 C T 0.497288 0.502712 0.000293 1.301281
60236874 rs12498396 A G 0.359748 0.640252 0.000292 0.875135
69705994 rs115162070 A G 0.069851 0.930149 0.000004 0.566347
96348686 rs4277782 T C 0.253317 0.746683 0.000314 1.099665
99439788 rs7668981 T C 0.434271 0.565729 0.000273 0.750526
106909473 rs78699658 G A 0.076853 0.923147 0.000213 0.769933
106943200 rs11729561 C T 0.080734 0.919266 0.000104 0.776444 112613026 rs112641600 T C 0.104676 0.895324 0.000058 0.646736 162009814 rs35850287 C T 0.469632 0.530368 0.000330 0.786370 163076494 rs62331317 A G 0.108942 0.891058 0.000113 1.821384 187239747 rs7687352 A G 0.486412 0.513588 0.000288 1.144337 6471344 rs507971 C T 0.210730 0.789270 0.000380 0.795710 59077872 rs62370540 C T 0.105859 0.894141 0.000116 0.634414 59191612 rs159616 C T 0.390352 0.609648 0.000259 0.881079 106396918 rs6864971 C T 0.379226 0.620774 0.000373 1.309747 122559297 rs72787582 T C 0.040661 0.959339 0.000117 0.495005 122832716 rs62377777 C T 0.219393 0.780607 0.000065 0.697966 122958050 rs70988587 A ATTC 0.192984 0.807016 0.000215 0.864676 123950404 rs4240376 T G 0.201643 0.798357 0.000065 0.798894 124143238 rs71594388 T C 0.074401 0.925599 0.000136 0.816311 135351183 rs72794907 A G 0.311611 0.688389 0.000174 0.907778 135360738 rs35901765 T C 0.455190 0.544810 0.000275 0.872551 135435801 rs7720483 T C 0.474933 0.525067 0.000174 0.778409 142252549 rs10039856 T C 0.097202 0.902798 0.000059 0.722279 159258092 rs78045322 C G 0.058813 0.941187 0.000172 0.665840 161475413 rs17548653 T C 0.051060 0.948940 0.000410 0.694777 173989338 rs2220543 A T 0.289838 0.710162 0.000019 0.753959 176737309 rs7732626 G A 0.075159 0.924841 0.000256 0.621750 180216905 rs10577599 C CAT 0.060491 0.939509 0.000025 1.117455 180237828 rs113791144 T C 0.066435 0.933565 0.000144 1.437219 6925195 rs6933436 C A 0.283852 0.716148 0.000098 1.259040 12216966 rs10755709 G A 0.300795 0.699205 0.000030 0.798524 18015447 rs140247774 T C 0.066938 0.933062 0.000047 1.795184 18271083 rs10949488 T C 0.058632 0.941368 0.000355 1.420327 18739469 rs2328283 C A 0.439080 0.560920 0.000333 1.340607 20013937 rs13213659 G A 0.356283 0.643717 0.000233 1.432682 20044587 rs594259 G A 0.405796 0.594204 0.000375 1.066926 44184719 rs2297393 C T 0.428032 0.571968 0.000409 0.802643 45704813 rs 16873740 A T 0.118789 0.881211 0.000030 1.293166 54128003 rs12193921 C T 0.055659 0.944341 0.000184 1.567508 54353221 rs76378690 A G 0.133523 0.866477 0.000206 0.703482 106326754 rs9386484 A T 0.236292 0.763708 0.000006 0.700394 137545805 rs11759276 T A 0.066107 0.933893 0.000183 0.633909 148522455 rs117687499 A G 0.080216 0.919784 0.000262 0.638077 148557644 rs9390548 A G 0.172941 0.827059 0.000149 0.785698 151433505 rs6928557 A C 0.177199 0.822801 0.000121 0.662379 154813083 rs6935885 C G 0.146378 0.853622 0.000306 1.227099 170445103 rs9366129 T C 0.377194 0.622806 0.000133 1.169297 6687563 rs55944391 A C 0.287309 0.712691 0.000395 1.259924 9397414 rs13238693 T G 0.426972 0.573028 0.000286 1.212542 11301277 rs7807069 G A 0.485509 0.514491 0.000271 0.780193 11362820 rs76731008 A G 0.141480 0.858520 0.000277 1.500773 14862658 rs2109498 A T 0.153107 0.846893 0.000419 0.865912 36662714 rs58016731 A AGTCTT 0.095719 0.904281 0.000391 0.677730 45244259 rs1294888 T C 0.263570 0.736430 0.000395 0.684875 52994281 rs7804465 C T 0.374660 0.625340 0.000342 1.187107 99987236 rs7798226 G T 0.386582 0.613418 0.000222 1.238744 105125204 rs111283303 A G 0.157476 0.842524 0.000232 0.876698 114940068 rs7800941 A G 0.161413 0.838587 0.000199 1.305293 138401542 rs3778698 T C 0.254384 0.745616 0.000200 0.835206 154700565 rs882469 A G 0.238270 0.761730 0.000222 0.861757 12850333 rs2947375 A G 0.218314 0.781686 0.000162 0.682120 16790149 rs118072448 C T 0.076838 0.923162 0.000024 0.567696 32590598 rs4351382 A T 0.151498 0.848502 0.000273 1.643539 38821327 rs10808999 A G 0.133668 0.866332 0.000088 0.781512 38897470 rs13282163 C A 0.083088 0.916912 0.000074 0.697853 40181978 rs11779911 A C 0.334674 0.665326 0.000084 0.759358 55488334 rs74458553 T C 0.055479 0.944521 0.000254 0.734023 61303777 rs147353244 GA G 0.126562 0.873438 0.000327 0.753803 74268198 rs2010843 T C 0.468438 0.531562 0.000056 0.764239 143261211 rs72685583 C T 0.068522 0.931478 0.000218 1.571550 4329170 rs3895472 T C 0.073518 0.926482 0.000024 0.662754 21131627 rs12236000 C G 0.076624 0.923376 0.000045 0.668847 23650820 rs4584238 G C 0.319618 0.680382 0.000220 1.216505 35490636 rs10814241 G C 0.093586 0.906414 0.000220 1.562150 75061917 rs11143296 T C 0.451371 0.548629 0.000140 0.795898 75127404 rs35460846 A AT 0.481894 0.518106 0.000082 1.428832 75136789 rs7022441 A G 0.473267 0.526733 0.000343 0.709246 78174461 rs13298924 C T 0.237835 0.762165 0.000210 1.184631 81158113 rs7027911 A G 0.428022 0.571978 0.000091 1.184363 81158443 rs3009696 T C 0.260891 0.739109 0.000130 1.413299 116468053 rs75260470 T C 0.062434 0.937566 0.000402 0.657867 122045518 rs487545 C T 0.108712 0.891288 0.000269 0.816792 138006474 rs61018036 A G 0.178813 0.821187 0.000373 1.346902 138202418 rs7032559 T C 0.368961 0.631039 0.000250 1.228892 139024232 rs7021573 A G 0.438519 0.561481 0.000309 0.777563 139047766 rs10858230 A G 0.201935 0.798065 0.000367 1.208077 140227646 rs11523787 T C 0.469081 0.530919 0.000137 1.450898 3096047 rs12241312 C A 0.348689 0.651311 0.000403 0.798146 6042472 rs17322780 G A 0.096814 0.903186 0.000185 0.735578 6079344 rs11256442 T C 0.287927 0.712073 0.000183 0.767768 6128547 rs7078273 T G 0.405064 0.594936 0.000303 1.159191 8109274 rs520236 G C 0.219884 0.780116 0.000349 0.756563 9030308 rs71481792 A T 0.381127 0.618873 0.000022 1.192942 27204531 rs1815323 C T 0.111020 0.888980 0.000276 0.660612 27929163 rs12774308 A G 0.130100 0.869900 0.000354 0.718834 31913890 rs11008551 T G 0.195413 0.804587 0.000366 1.331756 37277870 rs2091431 A G 0.291382 0.708618 0.000094 0.746109 37370440 rs1794410 A G 0.411272 0.588728 0.000118 0.857482 37454397 rs1892429 G A 0.160418 0.839582 0.000034 0.745569 43563260 rs3026716 G A 0.253344 0.746656 0.000246 1.269510 43942080 rs12355127 A G 0.121879 0.878121 0.000182 1.223674 44015051 rs10793436 T G 0.317755 0.682245 0.000030 0.691022 50140588 rs2940708 G A 0.076009 0.923991 0.000404 0.667254 54088932 rs75242872 G C 0.064881 0.935119 0.000117 0.492357 54100345 rs1441121 A T 0.438240 0.561760 0.000032 0.821531 57401482 rs2463950 T C 0.076162 0.923838 0.000366 1.827848 63303879 rs79189092 G GA 0.170880 0.829120 0.000234 1.297045 63420128 rs11595927 T C 0.290509 0.709491 0.000333 1.236769 68576077 rs12218365 C T 0.138063 0.861937 0.000113 0.607017 72223789 rs10740349 C G 0.082859 0.917141 0.000394 1.272646 72532238 rs2253801 C T 0.423564 0.576436 0.000387 0.810933 90464714 rs303509 G T 0.275512 0.724488 0.000118 0.899337 109569850 rs12570947 C T 0.149219 0.850781 0.000269 1.403835 115225859 rs10430681 A T 0.074066 0.925934 0.000303 0.678792 270987 rs7396066 C T 0.187477 0.812523 0.000245 0.833428 2893867 rs10766439 A G 0.362551 0.637449 0.000094 1.423212 2897875 rs4929952 T C 0.202575 0.797425 0.000110 0.619703 2902105 rs3864883 T C 0.111433 0.888567 0.000222 0.576303 10531548 rs142012992 C CTTAG 0.325845 0.674155 0.000111 0.697824 69896252 rs4980753 A G 0.376448 0.623552 0.000199 1.158722 117755082 rs491292 T C 0.207093 0.792907 0.000246 1.437101 119248855 rs76560104 C T 0.102744 0.897256 0.000279 1.664471 120784855 rs2852238 G C 0.278141 0.721859 0.000274 1.343841 126061372 rs35747384 T G 0.105597 0.894403 0.000237 0.743710 130323805 rs7109513 T C 0.402800 0.597200 0.000256 0.770364 2144357 rs75442877 C T 0.065950 0.934050 0.000407 0.685377 7606158 rs11611785 C T 0.429591 0.570409 0.000234 1.060466 8760610 rs11613792 G A 0.138548 0.861452 0.000003 0.809562 25159263 rs859134 A G 0.496130 0.503870 0.000368 1.187565 25427178 rs140584644 T C 0.253790 0.746210 0.000107 1.424311 41970164 rs970970 G A 0.384510 0.615490 0.000405 1.165447 50375477 rs7979554 A G 0.280549 0.719451 0.000158 1.204227 58267346 rs112976255 A C 0.072297 0.927703 0.000259 0.688523 67821215 rs7955453 A C 0.099287 0.900713 0.000403 1.272926 68010614 rs1904551 C T 0.412363 0.587637 0.000272 0.880242 76404693 rs1433362 G T 0.097993 0.902007 0.000196 0.868310 77114964 rs12827237 G A 0.163516 0.836484 0.000227 0.712866 95127606 rs6538530 T C 0.208557 0.791443 0.000207 1.316565 106624953 rs12823094 A T 0.244075 0.755925 0.000063 1.166247 116784113 rs1732329 A G 0.350353 0.649647 0.000287 1.418587 125537439 rs145578156 A AATTTTTT 0.126772 0.873228 0.000402 1.346757 126551205 rs11058488 T C 0.042023 0.957977 0.000239 1.581584 129563020 rs2002553 A G 0.122964 0.877036 0.000387 0.901839 129567952 rs58003804 G A 0.091258 0.908742 0.000265 0.798624 130242016 rs73436164 G A 0.168624 0.831376 0.000389 0.655603 130254478 rs73160210 T G 0.081785 0.918215 0.000267 1.744820 23658838 rs1984162 G A 0.258794 0.741206 0.000103 1.255399 28230642 rs10712355 A AT 0.211941 0.788059 0.000415 0.841463 71296869 rs2249209 A G 0.409982 0.590018 0.000385 1.243197 74558505 rs12871414 T C 0.265293 0.734707 0.000094 0.752194 74804797 rs2039342 T C 0.110526 0.889474 0.000345 1.761241 98753461 rs545096 G C 0.465548 0.534452 0.000349 1.268761 99778655 rs35784338 CT C 0.199852 0.800148 0.000199 0.777428 101425653 rs9585503 G T 0.079322 0.920678 0.000250 0.503729 102622688 rs7339161 G T 0.306514 0.693486 0.000203 0.859200 35857405 rs61988300 G A 0.189617 0.810383 0.000315 0.790426 41523312 rs11157189 G A 0.498534 0.501466 0.000314 0.893382 65225452 rs58725048 C G 0.056880 0.943120 0.000269 1.285578 72891494 rs2238191 A C 0.428866 0.571134 0.000196 1.256746 72908102 rs2238187 G A 0.352272 0.647728 0.000008 1.442188 72934229 rs12587980 T C 0.374816 0.625184 0.000093 1.277281 76011690 rs2734265 G A 0.480501 0.519499 0.000178 1.168686 97526363 rs75607541 A T 0.050779 0.949221 0.000337 0.566281 27274425 rs149380649 C CT 0.065191 0.934809 0.000112 0.738484 33407307 rs17816808 G A 0.096916 0.903084 0.000295 1.377528 33908103 rs12593288 T C 0.206252 0.793748 0.000023 0.839689 33914240 rs16973353 A T 0.425332 0.574668 0.000307 1.140667 33916053 rs2229117 C G 0.133455 0.866545 0.000056 0.753496 46666881 rs1994195 C A 0.270838 0.729162 0.000295 0.880898 53279291 rs719715 G A 0.181209 0.818791 0.000321 0.711192 81412674 rs2683240 C T 0.237678 0.762322 0.000184 1.164944 89162709 rs112248718 A G 0.105913 0.894087 0.000406 1.241798 89165665 rs73451724 A G 0.038001 0.961999 0.000235 1.633115 4065412 rs12448453 G A 0.079483 0.920517 0.000148 1.385477 5898969 rs11647387 C A 0.250999 0.749001 0.000406 0.804925 6081670 rs8053942 T C 0.473297 0.526703 0.000304 1.121533 6653119 rs12934582 C T 0.096462 0.903538 0.000264 1.562484 27040235 rs2063839 A G 0.077891 0.922109 0.000272 0.703891 31392047 rs11574646 T C 0.219875 0.780125 0.000358 0.816824 31404502 rs2454907 A G 0.149476 0.850524 0.000304 0.758433 78624025 rs72803978 G A 0.065596 0.934404 0.000061 0.651614 78865144 rs68020681 G T 0.093881 0.906119 0.000404 0.750446 84006469 rs2250573 A C 0.112712 0.887288 0.000148 0.614458 85992829 rs111l7428 C T 0.233426 0.766574 0.000318 0.861041 3110572 rs34259120 C A 0.446158 0.553842 0.000320 1.312096 9170408 rs34761447 T C 0.093770 0.906230 0.000026 0.766580 15548222 rs55821658 T C 0.054679 0.945321 0.000365 0.615661 18671675 rs55828488 A G 0.419792 0.580208 0.000284 1.241867 29737612 rs178840 A G 0.245600 0.754400 0.000075 0.704646 29740894 rs35054028 T G 0.087438 0.912562 0.000250 0.638460 31676083 rs59341815 C T 0.290909 0.709091 0.000294 1.271254 649311 rs9966612 A G 0.283148 0.716852 0.000210 0.827402 3899729 rs2667396 C T 0.468088 0.531912 0.000259 1.228547 9095227 rs16954792 C T 0.153181 0.846819 0.000368 0.711941 10016417 rs618909 A C 0.182016 0.817984 0.000193 1.375523 59747387 rs652473 C T 0.491954 0.508046 0.000338 1.348178 67208392 rs12958013 C T 0.135816 0.864184 0.000032 0.755900 67209524 rs34527658 AT A 0.237574 0.762426 0.000391 0.839220 76506592 rs35409638 T C 0.254573 0.745427 0.000390 1.430958 3058098 rs3217064 CT C 0.211726 0.788274 0.000188 0.784584 6533402 rs3097296 T C 0.364959 0.635041 0.000306 0.775131 15565046 rs9646651 A G 0.074145 0.925855 0.000323 0.642400 32023957 rs8105499 A C 0.304119 0.695881 0.000103 0.763075 44436733 rs8100011 G A 0.475911 0.524089 0.000334 0.832135 44492164 rs60744406 A G 0.415555 0.584445 0.000019 0.783341 50693096 rs648691 C T 0.434267 0.565733 0.000229 0.865794 53333975 rs10411226 G A 0.248705 0.751295 0.000092 1.246091 55500034 rs76616660 C T 0.114844 0.885156 0.000312 0.714110 57133633 rs35011777 T C 0.041190 0.958810 0.000365 2.311258 20344377 rs7270923 C A 0.100555 0.899445 0.000159 1.632986 38792298 rs6016275 T C 0.386489 0.613511 0.000192 1.294481 45355986 rs2076293 G A 0.465760 0.534240 0.000217 1.088991 52985158 rs6097944 G T 0.113465 0.886535 0.000284 0.798795 53043792 rs6023232 T G 0.191508 0.808492 0.000186 0.862778 20402128 rs62216866 G A 0.097434 0.902566 0.000367 0.853945 35423390 rs1986076 C T 0.368991 0.631009 0.000297 0.895966 39962001 rs9789875 T C 0.489381 0.510619 0.000299 0.852266 39963301 rs975846 A G 0.323369 0.676631 0.000268 1.326863 41321695 rs11701006 A G 0.233935 0.766065 0.000196 0.842328 43080428 rs2252109 A T 0.481328 0.518672 0.000043 1.207556 43086264 rs2849697 T C 0.458596 0.541404 0.000144 1.228411 46991937 rs76902403 A G 0.100782 0.899218 0.000155 0.578181 22564734 rs5757427 A T 0.351595 0.648405 0.000002 0.764406 22724951 rs7290963 T G 0.448669 0.551331 0.000072 1.306623 24407483 rs11090305 C T 0.186359 0.813641 0.000038 1.155463 44323597 rs139049 T C 0.410270 0.589730 0.000306 1.377674 44341300 rs17494724 A G 0.069631 0.930369 0.000157 1.803635 47986266 rs56813510 A C 0.165988 0.834012 0.000189 0.838987 49677464 rs62220604 A G 0.276036 0.723964 0.000036 0.908008
Table 3 - Informative polymorphisms of the invention - 58 polymorphism panel.
Allele Allele Frequency Frequency p-value for
Chromsome Position SNP ID 1 2 Allele 1 Allele 2 association OR
1 2998313 rs12745140 A G 0.088688543 0.911311457 0.0000317 2.2144
1 31624029 rs12083278 G C 0.295029481 0.704970519 0.00000243 1.8349
1 36374101 rs2765013 T C 0.086283231 0.913716769 0.000039 0.4296
1 63766718 rs112728381 T C 0.310873133 0.689126867 0.0000252 0.6017
1 87628173 rs10873821 T C 0.247508766 0.752491234 0.0000228 0.5706
2 36905013 rs6714112 A C 0.138077241 0.861922759 0.00000781 0.457
2 217524986 rs2270360 C A 0.265435195 0.734564805 0.0000245 0.5804
3 1093795 rs1504061 G C 0.050105352 0.949894648 0.0000716 2.5193
3 27188298 rs17317135 A G 0.048132554 0.951867446 0.0000641 0.3776
3 141408691 rs6440031 A G 0.084557 0.915443 0.0000714 2.188
4 5821877 rs3774881 C T 0.151610603 0.848389397 0.0000459 0.5358
4 5821922 rs3774882 G C 0.075889692 0.924110308 0.0000349 0.4206
4 27383278 rs6810404 A C 0.49098462 0.50901538 0.0000988 0.6344
4 44418592 rs35540967 C T 0.074930921 0.925069079 0.0000289 2.4621
4 69705994 rs115162070 A G 0.069850883 0.930149117 0.00000356 0.3716
4 112613026 rs112641600 T C 0.10467637 0.89532363 0.000058 0.4607
5 122832716 rs62377777 C T 0.219392587 0.780607413 0.0000653 0.5724
5 123950404 rs4240376 T G 0.201642654 0.798357346 0.000065 0.5706
5 142252549 rs10039856 T C 0.097201508 0.902798492 0.0000585 0.4621
5 173989338 rs2220543 A T 0.28983847 0.71016153 0.0000187 0.5793
5 180237828 rs113791144 T C 0.066435175 0.933564825 0.000144 2.2728
6 6925195 rs6933436 C A 0.283851708 0.716148292 0.0000983 1.6177
6 12216966 rs10755709 G A 0.300794985 0.699205015 0.00003 0.6017
6 18015447 rs140247774 T C 0.066938299 0.933061701 0.000047 2.5961
6 45704813 rs16873740 A T 0.118789191 0.881210809 0.0000296 2.0401
6 106326754 rs9386484 A T 0.236291943 0.763708057 0.00000617 0.5385
8 16790149 rs118072448 C T 0.076837933 0.923162067 0.0000235 0.4194
8 38821327 rs10808999 A G 0.133667804 0.866332196 0.0000884 1.8927
8 38897470 rs13282163 C A 0.083088415 0.916911585 0.0000739 0.4185
8 40181978 rs11779911 A C 0.334673592 0.665326408 0.0000841 0.6126
8 74268198 rs2010843 T C 0.468438061 0.531561939 0.0000556 1.5904
9 4329170 rs3895472 T C 0.0735178 0.9264822 0.0000235 2.4181
9 21131627 rs12236000 C G 0.076624262 0.923375738 0.0000452 0.409
9 81158113 rs7027911 A G 0.428022077 0.571977923 0.0000905 0.6281
10 9030308 rs71481792 A T 0.38112705 0.61887295 0.0000223 0.5863
10 37277870 rs2091431 A G 0.29138208 0.70861792 0.0000935 1.6209
10 37454397 rs1892429 G A 0.160418285 0.839581715 0.0000335 0.5273
10 44015051 rs10793436 T G 0.317754779 0.682245221 0.0000302 0.5969
10 54100345 rs1441121 A T 0.438240499 0.561759501 0.0000322 1.5904
11 2893867 rs10766439 A G 0.362550753 0.637449247 0.0000937 0.6376
12 8760610 rs1 l613792 G A 0.138547884 0.861452116 0.00000256 0.4686 106624953 rs12823094 A T 0.244075133 0.755924867 0.0000633 1.7006 74558505 rs12871414 T C 0.265293174 0.734706826 0.000094 0.6108 72908102 rs2238187 G A 0.352271894 0.647728106 0.00000821 1.7023 72934229 rs12587980 T C 0.374815784 0.625184216 0.0000933 1.573 33908103 rs12593288 T C 0.206251661 0.793748339 0.000023 0.5599 33916053 rs2229117 C G 0.133454893 0.866545107 0.0000561 0.5184 78624025 rs72803978 G A 0.065595834 0.934404166 0.0000612 0.3727 9170408 rs34761447 T C 0.093769913 0.906230087 0.0000262 0.4612 29737612 rs178840 A G 0.245600067 0.754399933 0.0000753 0.5886 67208392 rs12958013 C T 0.135815591 0.864184409 0.0000319 0.5148 44492164 rs60744406 A G 0.415555399 0.584444601 0.000019 1.6389 53333975 rs10411226 G A 0.248705364 0.751294636 0.0000923 0.5644 43080428 rs2252109 A T 0.481327711 0.518672289 0.0000428 0.6269 22564734 rs5757427 A T 0.351595363 0.648404637 0.00000237 1.804 22724951 rs7290963 T G 0.448668942 0.551331058 0.0000716 1.5872 24407483 rs1 l090305 C T 0.18635889 0.81364111 0.0000377 1.8386 49677464 rs62220604 A G 0.276036142 0.723963858 0.0000355 0.5927
Table 4 - Informative polymorphisms used in genetic risk assessment of Example 5 - 64 polymorphism panel. All SNPs are from the COVID-19 Host Genetics Initiative meta-analysis of hospitalisation vs non-hospitalisation except for rs 11385942 and rs657152, which are from Ellinghaus et al. (2020).
Reference Risk allele Risk allele Risk allele
Chromosome ID allele (A1 allele) odds ratio frequency
1 rs12745140 G A 2.21 0.1
1 rs12083278 G C 1.83 0.70
1 rs2765013 T C 2.33 0.92
1 rs2274122 G A 1.78 0.80
1 rs10873821 T C 1.75 0.77
2 rs6714112 A C 2.19 0.86
2 rs2270360 C A 1.72 0.71
3 rs1504061 C G 2.52 0.06
3 rs17317135 A G 2.65 0.94
3 rs1868132 C T 1.97 0.10
3 rs6440031 A G 2.19 0.89
4 rs3774881 C T 1.87 0.85 4 rs3774882 G C 2.38 0.92 4 rs6810404 A C 1.58 0.51 4 rs35540967 T C 2.46 0.07 4 rs115162070 A G 2.69 0.92 4 rs11729561 C T 2.25 0.92
4 rs112641600 T C 2.17 0.90
5 rs62377777 C T 1.75 0.79 5 rs4240376 T G 1.75 0.80 5 rs10039856 T C 2.16 0.91 5 rs2220543 A T 1.73 0.71
5 rs113791144 C T 2.27 0.06
6 rs6933436 A C 1.62 0.28 6 rs10755709 G A 1.66 0.69 6 rs140247774 C T 2.60 0.06 6 rs16873740 T A 2.04 0.12 6 rs9386484 A T 1.86 0.75 8 rs118072448 C T 2.38 0.91 8 rs10808999 A G 1.89 0.86 8 rs13282163 C A 2.39 0.93 8 rs11779911 A C 1.63 0.66 8 rs2010843 T C 1.59 0.55 9 rs3895472 T C 2.42 0.91 9 rs12236000 C G 2.44 0.93 9 rs7027911 G A 1.59 0.44 Reference Risk allele Risk allele Risk allele
Chromosome ID allele (A1 allele) odds ratio frequency
10 rs71481792 T A 1.7 0.38
10 rs2091431 A G 1.62 0.71
10 rs1892429 G A 1.90 0.79
10 rs10793436 T G 1.68 0.68
10 rs1441121 A T 1.59 0.56
11 rs10766439 G A 1.57 0.39
12 rs11613792 G A 2.13 0.84
12 rs12823094 T A 1.70 0.26
13 rs1984162 A G 1.65 0.26
13 rs12871414 T C 1.64 0.72
14 rs2238187 A G 1.70 0.36
14 rs12587980 C T 1.54 0.39
15 rs12593288 T C 1.79 0.78
15 rs2229117 C G 1.93 0.87
16 rs72803978 G A 2.68 0.94 17 rs34761447 T C 2.17 0.89
17 rs178840 A G 1.70 0.75
18 rs12958013 C T 1.94 0.85 19 rs8105499 A C 1.62 0.69 19 rs60744406 A G 1.64 0.61 19 rs10411226 A G 1.77 0.24 21 rs2252109 T A 1.60 0.49 22 rs5757427 A T 1.80 0.63 22 rs7290963 G T 1.59 0.45 22 rs11090305 T C 1.84 0.18 22 rs62220604 A G 1.69 0.71 3 rs11385942 G GA 1.77 0.09 9 rs657152 C A 1.32 0.35
Table 5 - New informative polymorphisms used in the development of the models described in Example 6.
Figure imgf000053_0001
Figure imgf000054_0001
Table 6 - Surrogate markers for polymorphism provided in Table 3 (Part
A) and additional polymorphisms used in Table 4 (Part B). Part C provides surrogate markers for rs115492982.
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
In an embodiment, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are analysed.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided in Tables 1 to 3, 5a or 6, Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided Table 1 and Table 6a or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 polymorphisms or at least 306 associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided Table 1 or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection are selected from the polymorphisms provided Table 2 and Table 6a or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 2 or Table 6a or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 2 or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50 or at least 60 polymorphisms associated with a severe response to a Coronavirus infection are selected from polymorphisms provided in Table 4 or a polymorphism in linkage disequilibrium with one or more thereof.
In embodiment, the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 2 or a polymorphism in linkage disequilibrium with one or more thereof.
In embodiment, the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
In embodiment, the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 4 or a polymorphism in linkage disequilibrium with one or more thereof.
In embodiment, the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 19 or a polymorphism in linkage disequilibrium with one or more thereof.
In embodiment, the method of the invention involves detecting the presence of each of the polymorphisms provided in Table 22 or a polymorphism in linkage disequilibrium with one or more thereof.
Polymorphisms in linkage disequilibrium with those specifically mentioned herein are easily identified by those of skill in the art. Table 6a provides examples of linked loci for the polymorphisms listed in Table 3. Table 6b provides examples of linked loci for the polymorphisms listed in Table 4 which are not provided in Table 6a. Such linked polymorphisms for the other polymorphisms listed in Table 1 can very easily be identified by the skilled person using the HAPMAP database.
Where relevant in each Table, the A1 or Allele 1 is the risk (minor allele) associated allele. The risk allele may be associated with a decreased or increased risk as described herein. As used herein, the terms “A1” and “Allele 1” are used interchangeably. As used herein, the terms “A2” and “Allele 2” are used interchangeably.
In an embodiment, if the method includes the analysis of rs11385942 and/or rs657152 the method further comprises detecting at least one other polymorphism provided in any one of Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium therewith.
Calculating Composite Relative Risk “Genetic Risk”
An individual’s “genetic risk” can be defined as the product of genotype relative risk values for each polymorphism assessed. A log-additive risk model can then be used to define three genotypes AA, AB and BB for a polymorphism having relative risk values of 1, OR, and OR2, under a rare disease model, where OR is the previously reported disease odds ratio for the high-risk allele, B, vs the low-risk allele, A. If the B allele has frequency (p), then these genotypes have population frequencies of (1 - p)2, 2p(l - p), and p2, assuming Hardy-Weinberg equilibrium. The genotype relative risk values for each polymorphism can then be scaled so that based on these frequencies the average relative risk in the population is 1. Specifically, given the unsealed population average relative risk for each SNP:
(m) = (1 - p)2 + 2p(1 - p)OR + p2OR2
Adjusted risk values 1/μ, OR/μ, and OR2/μ are used for AA, AB, and BB genotypes for each SNP. Missing genotypes are assigned a relative risk of 1. The following formula can be used to define the genetic risk:
SNP1 x SNP2 x SNP3 x SNP4 x SNP5 x SNP6 x SNP7,x SNP8, etc.
Similar calculations can be performed for non-SNP polymorphisms or a combination thereof.
An alternate method for calculating the composite risk is described in Mavaddat et al. (2015). In this example, the following formula is used;
PRS = β1 x β2x 2+ . . . . βK x Knx n where βk is the per-allele log odds ratio (OR) for the minor allele for SNP Κ, and xK the number of alleles for the same SNP (0, 1 or 2), n is the total number of SNPs and PRS is the polygenic risk score (which can also be referred to as composite SNP risk). Similar calculations can be performed for non-SNP polymorphisms or a combination thereof.
In an alternate embodiment, the magnitude of effect of each risk allele is not used when calculating the genetic risk score. More specifically, allele counting as generally described in WO 2005/086770 is used. For example, in one embodiment if the subject was homozygous for the risk allele they were scored as 2, if they were heterozygous for the risk allele they were scored as 1, and if they were homozygous for the risk allele they were scored as 0. As the skilled person would appreciate, alternate values such as 1, 0.5 and 0 respectively, could be used.
In an embodiment, the percent of risk alleles present out of the total possible number of loci analysed is used to produce the genetic risk score. For example, in the 64 allele panel described in Example 5 the subject may have at most 128 risk alleles. If a subject had 64 out of these 128 alleles, they would have 50% of the total possible alleles which can be expressed as 0.5.
The genetic risk score can be expressed as: ln_risk = -8.4953 (i.e. the model intercept) + 0.1496 x SNP%. Then, risk=exp(ln_risk) .
In this example, the risk is the relative risk for severe disease (e.g. a person with risk=3.5 is at 3.5 times increased risk compared with a person with the average number of risk alleles), exp(β) is the odds ratio for an increase of 1% in risk alleles. So, exp(0.1496)=1.16, which means that risk increases by 16% for a 1% increase in SNP%. In an embodiment, the β coefficient (model intercept) is between -10.06391 to - 6.926615, or -9.5 to -7.5, or -9 to -8. In an embodiment of the above formula, the adjustment of the starting (ln_risk) for the percentage of risk alleles is 0.1237336 to 0.1755347, or 0.16 to 0.14.
In an embodiment, the genetic risk is the SNP Risk Factor (SNF). In one embodiment, SNF = ∑ (No of Risk Alleles x SNP β coefficien)t.
The “risk” of a human subject developing a severe response to a Coronavirus infection can be provided as a relative risk (or risk ratio).
In an embodiment, the genetic risk assessment obtains the “relative risk” of a human subject developing a severe response to a Coronavirus infection. Relative risk (or risk ratio), measured as the incidence of a disease in individuals with a particular characteristic (or exposure) divided by the incidence of the disease in individuals without the characteristic, indicates whether that particular exposure increases or decreases risk. Relative risk is helpful to identify characteristics that are associated with a disease, but by itself is not particularly helpful in guiding screening decisions because the frequency of the risk (incidence) is cancelled out.
In an embodiment, a threshold value(s) is set for determining a particular action such as the need for routine diagnostic testing, the need for prophylactic anti- Coronavirus therapy, selection of a person for a vaccine or the need to administer an anti-Coronavirus therapy. For example, a score determined using a method of the invention is compared to a pre-determined threshold, and if the score is higher than the threshold a recommendation is made to take the pre-determined action. Methods of setting such thresholds have now become widely used in the art and are described in, for example, US 20140018258.
Clinical Risk Assessment
In an embodiment, the method further comprises performing a clinical risk assessment of the human subject; and combining the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection. The clinical risk assessment procedure can include obtaining clinical information from a human subject. In other embodiments, these details have already been determined (such as in the subject’s medical records).
Examples of factors which can be used to produce the clinical risk assessment include, but are not limited to, obtaining information from the human on one or more of the following: age, family history of a severe response to a Coronavirus infection, race/ethnicity, gender, body mass index, total cholesterol level, systolic and/or diastolic blood pressure, smoking status, does the human have diabetes, does the human have a cardiovascular disease, is the subject on hypertension medication, loss of taste, loss of smell and white blood cell count.
In an embodiment, the clinical risk assessment is based only one or more or all of age, body mass index, loss of taste, loss of smell and smoking status.
In another embodiment, the clinical risk assessment is based only one or more or all of age, loss of taste, loss of smell and smoking status.
In an embodiment, the clinical risk assessment includes obtaining information from the subject on one or more or all of age, gender, race/ethnicity, blood type, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
In an embodiment, the clinical risk assessment at least includes age and gender.
The present inventors have also found that a severe response to a Coronavirus infection risk model that relies solely on clinical factors provides useful risk discrimination for assessing a subject’s risk of developing a severe response to a Coronavirus infection such as a SARS-CoV-2 infection. Such a test may be particularly useful in circumstances where a rapid decision needs to be made and/or when genetic testing is not readily available. Thus, in another aspect the present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject on two, three, four, five or more or all of age, gender, race/ethnicity, height, weight, blood type, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an immunocompromised disease, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had liver disease, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
In an embodiment, the method comprises obtaining information from the subject on age and gender.
In an embodiment, the method comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
In an embodiment, the method comprises obtaining information from the subject on age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma). Examples of respiratory diseases which are included in the test are chronic obstructive pulmonary disease, chronic bronchitis and emphysema.
The diabetes can be any type of diabetes.
In an embodiment, the clinical risk assessment is conducted using the following formula: ln(risk) = Model Intercept
+ OR if clinical factor one applies + OR if clinical factor two applies + OR if clinical factor three applies
+ OR if clinical factor n applies.
Where OR = Odds Ratio.
In an embodiment, the clinical risk assessment is conducted using the following formula:
In(risk) = Model Intercept
OR if age group = 18-29 years or
Figure imgf000076_0001
OR if age group = 30-39 years or
Figure imgf000076_0002
OR if age group = 40-49 years or
Figure imgf000076_0003
OR if age group = 60-69 years or
Figure imgf000076_0004
OR if age group = 70+ years
Figure imgf000076_0005
OR if gender = male
Figure imgf000076_0006
OR if ethnicity = non-Caucasian
Figure imgf000076_0007
OR if ABO blood type = A or
Figure imgf000076_0008
OR if ABO blood type = B or
Figure imgf000076_0009
OR if ABO blood type = AB
OR if has/had autoimmune disease (namely, rheumatoid arthritis, lupus or psoriasis) = yes
OR if has/had cancer, haematological = yes
Figure imgf000076_0010
OR if has/had cancer, non-haematological = yes
Figure imgf000076_0011
OR if has/had diabetes = yes
Figure imgf000076_0012
OR if has/had hypertension = yes + OR if has/had respiratory disease (other than asthma) = yes Where OR = Odds Ratio.
Using the above formulae the relative risk of a human subject developing a severe response to a Coronavirus infection is: risk = e ln(nsk)
In one example, the clinical risk assessment is conducted using the following formula: In(risk) - —0.2645 + —1 3111 if age group = 18-29 years
+ -0.8348 if age group = 30-39 years
+ -0.4038 if age group = 40-49 years
+ -0.0973 if age group = 60-69 years
+ 0.4419 if age group - 70+ years + 0.0855 if gender = male
Figure imgf000077_0001
0.0404 if ethnicity = non-Caucasian
Figure imgf000077_0002
-0.0614 if ABO blood type = A
+ 0.2039 if ABO blood type = B
+ -0.5541 if ABO blood type = AB + 0.5424 if has/had autoimmune disease (namely, rheumatoid arthritis, lupus or psoriasis) = yes
+ 1.0104 if has/had cancer, haematological = yes
+ 0.2436 if has/had cancer, non-haematological = yes
+ 0.3863 if has/had diabetes = yes + 0.3064 if has/had hypertension = yes
+ 1.2642 if has/had respiratory disease (other than asthma) = yes
In an embodiment of the above formula, the starting In(risk) (model intercept) is-0.5284 to 1.5509, or -0.16 to -0.36. In an embodiment of the above formula, the adjustment of the starting ln(risk) forages 18 to 29 is -1 .5 to -1, or -1 .4 to -1 .2.
In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 30 to 39 is -1 to -0.7, or -0.9 to -0.8.
In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 40 to 49 is -0.6 to -0.2, or -0.45 to -0.35.
In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 60 to 69 is -0.4021263 to 0.2075385, or -0.19 to 0.09.
Substitute Sheet (Rule 26) RO/AU In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 70+ is 0.1504677 to 0.73339, or 0.34 to 0.54.
In an embodiment of the above formula, the adjustment of the starting In(risk) for males is -0.140599 to 0.3115929, or -0.3 to 0.19.
In an embodiment of the above formula, the adjustment of the starting In(risk) for non-Caucasians is -0.3029713 to 0.3837958, or -0.06 to 0.14.
In an embodiment of the above formula, the adjustment of the starting In(risk) for A blood type is -0.3018427 to 0.1791056, or -0.16 to 0.04.
In an embodiment of the above formula, the adjustment of the starting In(risk) for B blood type is -0.1817567 to 0.5895909, or 0.1 to 0.3.
In an embodiment of the above formula, the adjustment of the starting In(risk) for AB blood type is -1.172319 to 0.0641862, or -0.45 to -0.65.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, rheumatoid arthritis, lupus or psoriasis is -0.0309265 to 1.115784, or 0.44 to 0.64.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, a haematological cancer is 0.1211918 to 1.899663, or 0.9 to 1.1.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, a non-haematological cancer is -0.0625866 to 0.5498824, or 0.14 to 0.34.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, diabetes is 0.0624018 to 0.7101834, or 0.28 to 0.48.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, hypertension is 0.0504567 to 0.5623362, or 0.1 to 0.3.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, a respiratory disease (excluding asthma) is 0.9775684 to 1.550944, or 1.16 to 1.36.
The present invention provides a method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a clinical risk assessment of the human subject, wherein the clinical risk assessment involves determining at least the age and sex of the subject and producing a score. In an embodiment, the method further comprises comparing the score to a predetermined threshold, wherein if the score is at, or above, the threshold the subject is assessed at being at risk of developing a severe response to a Coronavirus infection.
In one embodiment, the subject is between 50 and 84 years of age and is asked their age and their sex.
In an embodiment, the method comprises determining the Log odds (LO). For example, the LO can be calculated using the formula:
LO = X+ ∑ Clinical β coefficients
In an embodiment, X is -2.25 to -1.25 or -2 or -1.5. In an embodiment, X is -1.749562.
In an embodiment, the relative risk is determined. In an embodiment, the relative risk is determined using the formula: relative risk = eLO
In an embodiment, the probability is determined. In an embodiment, the probability is determined using the formula: probability = eLO/(1+eLO)
“e” is the mathematical constant that is the base of the natural logarithm.
In an embodiment, the probability obtained by the above formula is multiplied by 100 to obtain a percent chance of a severe response to a Coronavirus infection such as hospitalisation being required.
In an embodiment, if the subject is between 50 and 64 years of age they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0.
In an embodiment, if the subject is between 65 and 69 years of age they are assigned a β coefficient of 0 to 1, or 0.25 to 0.75 or 0.4694892.
In an embodiment, if the subject is between 70 and 74 years of age they are assigned a β coefficient of 0.5 to 1.5, or 0.75 to 1.25 or 1.006561.
In an embodiment, if the subject is between 75 and 79 years of age they are assigned a β coefficient of 0.9 to 1.9, or 1.15 to 1.65 or 1.435318.
In an embodiment, if the subject is between 80 and 84 years of age they are assigned a β coefficient of 1.1 to 2.1, or 1.35 to 1.85 or 1.599188.
In an embodiment, if the subject is female they are assigned a β coefficient of - 0.5 to 0.5, or -0.25 to 0.25 or 0.
In an embodiment, if the subject is male they are assigned a β coefficient of -0.1 to 0.9, or 0.15 to 0.65 or 0.3911169.
In an embodiment, the last value provided above in each criteria is used.
In an embodiment, the clinical risk assessment includes obtaining information from the subject on one or more or all of age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
In an embodiment, each of the above factors are assessed and
• LO = X+ ∑ Clinical β coefficients, where X is -1.8 to -0.8 or -1.6 or -1.15 or - 1.36523;
• if the subject is between 50 and 69 years of age they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject is between 70 and 74 years of age they are assigned a β coefficient of .1 to 1.1, or 0.35 to 0.85 or 0.5747727;
• if the subject is between 75 and 79 years of age they are assigned a β coefficient of 0.3 to 1.3, or-0.55 to 1.05 or 0.8243711;
• if the subject is between 18 and 29 years of age they are assigned a β coefficient of -2.3 to -0.3, or -0.18 to -0.8 or -1.3111;
• if the subject is between 30 and 39 years of age they are assigned a β coefficient of -1.8 to 0.2, or -1.23 to -0.3 or -0.8348;
• if the subject is between 40 and 49 years of age they are assigned a β coefficient of -1.4 to 0.6, or -0.9 to -0.1 or -0.4038;
• if the subject is between 80 and 84 years of age they are assigned a β coefficient of 0.5 to 1.5, or 0.25 to 1.25 or 1.013973;
• if the subject is female they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject is male they are assigned a β coefficient of -0.25 to 0.75, or 0 to 0.5 or 0.2444891;
• if the subject is Caucasian they are assigned a β coefficient of -0.5 to 0.5, or - 0.25 to 0.25 or 0;
• if the subject is an ethnicity other than Caucasian they are assigned a β coefficient of -0.2 to 0.8, or 0.05 to 1.55 or 0.29311;
• the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1.1 to 2.1, or - 1.35 to -1.85, or -1.602056 to provide the β coefficient to be assigned;
• if the subject has ever been diagnosed as having a cerebrovascular disease they are assigned a β coefficient of -0.1 to 0.9, or 0.15 to 0.65 or 0.4041337; • if the subject has not ever been diagnosed as having a cerebrovascular disease they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having a chronic kidney disease they are assigned a β coefficient of 0.2 to 1.2, or 0.55 to 0.95 or 0.6938494;
• if the subject has not ever been diagnosed as having a chronic kidney disease they are assigned a β coefficient of-0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having diabetes they are assigned a b coefficient of -0.1 to 0.9, or 0.15 to 0.65 or 0.4297612;
• if the subject has not ever been diagnosed as having diabetes they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having haematological cancer they are assigned a β coefficient of 0.5 to 1.5, or 0.75 to 1.25 or 1.003877;
• if the subject has not ever been diagnosed as having haematological cancer they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having hypertension they are assigned a β coefficient of -0.2 to 0.8, or 0.05 to 1.55 or 0.2922307;
• if the subject has not ever been diagnosed as having hypertension they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having a non-haematological cancer they are assigned a β coefficient of -0.25 to 1, or 0 to 0.5 or 0.2558464;
• if the subject has not ever been diagnosed as having a non-haematological cancer they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having a respiratory disease (other than asthma) they are assigned a β coefficient of 0.7 to 1.7, or 0.95 to 1.45 or 1.173753; and
• if the subject has ever been diagnosed as having a respiratory disease (other than asthma) they are assigned a β coefficient of-0.5 to 0.5, or -0.25 to 0.25 or 0.
In an embodiment, the last value provided above in each criteria is used.
In an embodiment, the clinical risk assessment includes obtaining information from the subject on one or more or all of age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
In an embodiment, each of the above factors are assessed and
• LO = X+ ∑ Clinical β coefficients, where X is -2 to -1.5 or -1.75 or -1.25 or - 1.469939;
• if the subject is between 50 and 64 years of age they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject is between 65 and 69 years of age they are assigned a β coefficient of -0.3 to 0.7, or -0.05 to 0.45 or 0.1677566;
• if the subject is between 70 and 74 years of age they are assigned a β coefficient of 0.1 to 1.1, or 0.35 to 1.85 or 0.6352682;
• if the subject is between 75 and 79 years of age they are assigned a β coefficient of 0.4 to 1.4, or 0.65 to 1.15 or 0.8940548;
• if the subject is between 80 and 84 years of age they are assigned a β coefficient of 0.5 to 1.5, or 0.25 to 1.25 or 1.082477;
• if the subject is female they are assigned a β coefficien otf -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject is male they are assigned a β coefficient of -0.25 to 0.75, or 0 to 0.5 or 0.2418454;
• if the subject is Caucasian they are assigned a β coefficient of -0.5 to 0.5, or - 0.25 to 0.25 or 0;
• if the subject is an ethnicity other than Caucasian they are assigned a β coefficient of -0.2 to 0.8, or 0.05 to 1.55 or 0.2967777;
• if the subject has a blood type other than ABO they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has an ABO blood type they are assigned a β coefficient of -0.25 to 0.75, or 0 to 0.5 or -0.229737;
• the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1.1 to 2.1, or - 1.35 to -1.85, or -1. 560943 to provide the co βefficient to be assigned;
• if the subject has ever been diagnosed as having a cerebrovascular disease they are assigned a β coefficient of -0.1 to 0.9, or 0.15 to 0.65 or 0.3950113;
• if the subject has not ever been diagnosed as having a cerebrovascular disease they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having a chronic kidney disease they are assigned a β coefficient of 0.2 to 1.2, or 0.55 to 0.95 or 0.6650257; • if the subject has not ever been diagnosed as having a chronic kidney disease they are assigned a β coefficient of-0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having diabetes they are assigned a β coefficient of -0.1 to 0.9, or 0.15 to 0.65 or 0.4126633;
• if the subject has not ever been diagnosed as having diabetes they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having haematological cancer they are assigned a β coefficient of 0.5 to 1.5, or 0.75 to 1.25 or 1.001079;
• if the subject has not ever been diagnosed as having haematological cancer they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having hypertension they are assigned a β coefficient of -0.2 to 0.8, or 0.05 to 1.55 or 0.2640989;
• if the subject has not ever been diagnosed as having hypertension they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having an immunocompromised disease they are assigned a β coefficient of 0.1 to 1.1, or 0.35 to 0.85 or 0.6033541;
• if the subject has not ever been diagnosed as having an immunocompromised disease they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having liver disease they are assigned a β coefficient of -0.2 to 0.8, or 0.05 to 1.55 or 0.2301902;
• if the subject has not ever been diagnosed as having liver disease they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having a non-haematological cancer they are assigned a β coefficient of -0.25 to 1, or 0 to 0.5 or 0.2381579;
• if the subject has not ever been diagnosed as having a non-haematological cancer they are assigned a β coefficient of -0.5 to 0.5, or -0.25 to 0.25 or 0;
• if the subject has ever been diagnosed as having a respiratory disease (other than asthma) they are assigned a β coefficient of 0.7 to 1.7, or 0.95 to 1.45 or 1.148496; and
• if the subject has ever been diagnosed as having a respiratory disease (other than asthma) they are assigned a β coefficient of-0.5 to 0.5, or -0.25 to 0.25 or 0.
In an embodiment, the last value provided above in each criteria is used.
In an embodiment, the subject’s body mass index is determined using their height and weight.
Figure imgf000083_0001
In an embodiment, if any of the clinical factors are unknown, or the subject is unwilling to supply the relevant details, that factor(s) is assigned a β coefficient of 0.
In an embodiment, one or more or all of the clinical factors are self-assessed (self-reported). In an embodiment, the race/ethnicity is self-assessed (self-reported). In an embodiment, one or more or all of current or previous disease status, such as an autoimmune disease, an haematological cancer, an non-haematological cancer, diabetes, hypertension or a respiratory disease, is self-assessed (self-reported).
In an embodiment, the clinical assessment comprises determining the blood type of the subject. This will typically comprise obtaining a sample comprising blood from the subject. The detection method used can any be any suitable method known in the art. In embodiment, a genetic test as described in the Examples is used, preferably concurrently with a genetic analysis for assessing the risk of a human subject developing a severe response to a coronavirus infection.
For instance, ABO blood type can be imputed using three SNPs, namely rs505922, rs8176719 and rs8176746) in the ABO gene on chromosome 9q34.2. An rs8176719 deletion (or for those with no result for rs8176719, a T allele at rs505922) indicates haplotype O. At rs8176746, haplotype A is indicated by the presence of the G allele and haplotype B is indicated by the presence of the T allele (see Table 7).
In an embodiment, whether a subject has or has had (also referred to herein as “has ever been diagnosed”) with a particular disease state, the disease is classified using the international Classification of Disease (ICD) system. Thus,
• asthma is as per ICD9 (493*) and ICD 10 (J45* and J46),
• an autoimmune (rheumatoid/lupus/psoriasis) is as per ICD9 (954, 696*, 7100, 714, 7140* and 7142* and ICD10 (J990, L40*, L41*, M05*-M07* and M32*),
• a haematological cancer is as per ICD9 (200*-208*) and ICD10 (C81*-C86*, C88* and C90*-C96*),
• a non-haematological cancer is as per ICD9 (140*— 165*, 169*— 175*, 179*— 195* and 196*-199*) and ICD10 (C00*-C26*, C30*-C34*, C37*-C58*, C60*-C80*, C97*),
• a cerebrovascular disease is as per ICD9 (430*-438*) and ICD10 (G46* and I60*-I69*),
• diabetes is as per ICD9 (250*) and ICD10 (E10*-E14*),
• heart disease is as per ICD9 (413 *-416*, V422, V432-V434) and ICD 10 (120*- 125*, 148*, Z95*),
• hypertension is as per ICD9 (401*, 405*, 6420-6422) and ICD 10 (110*, 115*,
O10*), • an immunocompromised disease is as per ICD9 (V420, V421, V426, V427, V429, 042, 043, 044, 279, 2790*) and ICD10 (B20*-B24, D80*-D84*, Z940- Z944, Z949),
• a kidney disease is as per ICD9 (585*) and ICD10 (N18*), · liver disease is as per ICD9 (571*) and ICD10 (K70*-K77*), and
• a respiratory disease (excluding asthma) is as per ICD9 (494*-496*, 500*, 501*-508*, 491*, 492*, 496*) and ICD10 (J60*-J70*, J80*-J82, J84*-J86*, J90-J96*, J98*, J41*-J44*). Table 7 - SNPS and ABO Imputation.
Figure imgf000085_0001
Combined Clinical Assessment and Genetic Assessment
In an embodiment, to obtain the “risk” of a human subject developing a severe response to a Coronavirus infection, the following formula can be used: ln(risk) = Model Intercept
+ OR x percentage of the number of risk alleles
+ OR if clinical factor one applies + OR if clinical factor two applies
+ OR if clinical factor three applies
+ OR if clinical factor n applies. Where OR = Odds Ratio .
In an embodiment, to obtain the “risk” of a human subject developing a severe response to a Coronavirus infection, the following formula can be used: In(risk) = Model Intercept
+ OR x percentage of the number of risk alleles
+ OR if age group = 18-29 years or
+ OR if age group = 30-39 years or
+ OR if age group = 40 49 years or
+ OR if age group = 60-69 years or
+ OR if age group = 70+ years
+ OR if gender = male
+ OR if ethnicity = non-Caucasian
+ OR if ABO blood type = A or
Figure imgf000086_0001
OR if ABO blood type = B or
Figure imgf000086_0002
OR if ABO blood type = AB
ORif has/had autoimmune disease (namely, rheumatoid arthritis, lupus or psoriasis) = yes
ORif has/had cancer, haematological = yes
Figure imgf000086_0003
ORif has/had cancer, non-haematological = yes
Figure imgf000086_0004
ORif has/had diabetes = yes + ORif has/had hypertension = yes
+ ORif has/had respiratory disease (other than asthma) = yes Where OR = Odds Ratio
Using the above formulae the relative risk of a human subject developing a severe response to a Coronavirus infection is: risk = e ln(risk)
Substitute Sheet (Rule 26) RO/AU In one example, lo obtain the “risk” of a human subject developing a severe response to a Coronavirus infection, the following formula can be used: In(risk) = -10.7657
+ 0.1717 x percentage of the number of risk alleles
+ —1.3111 if age group = 18-29 years
+ -0.8348 if age group = 30-39 years
Figure imgf000087_0001
-0.4038 if age group = 40-49 years
Figure imgf000087_0002
-0.0600 if age group = 60-69 years
Figure imgf000087_0003
0.5325 if age group = 70+ years
Figure imgf000087_0004
0.1387 if gender = male
+ 0.3542 if ethnicity = non-Caucasian
+ -0.2164 if ABO blood type = A
+ -0.1712 if ABO blood type = B
+ —0.8746 if ABO blood type = AB
+ 0.7876 if has/had autoimmune disease (namely, rheumatoid arthritis, lupus or psoriasis) = yes
+ 1 .0375 if has/had cancer, haematological = yes
+ 0.3667 if has/had cancer, non-haematological = yes
+ 0.4890 if has/had diabetes = yes
+ 0.3034 if has/had hypertension = yes
+ 1.2331 if has/had respiratory disease (other than asthma) = yes Using this formula the relative risk of a human subject developing a severe response to a Coronavirus infection is: risk = e ln (risk)
In an embodiment of the above formula, the starting ln (risk) (model intercept) is -12.5559 to -8.9755, or -12 to -8, or -11 to -10.5.
In an embodiment of the above formula, the adjustment of the starting ln (risk) for the percentage of risk alleles is 0.142 to 0.2006, or 0.16 to 0.18.
In an embodiment of the above formula, the adjustment of the starting ln (risk) for ages 18 to 29 is -1.5 to -1, or -1.4 to -1.2.
In an embodiment of the above formula, the adjustment of the starting ln(mA:) for ages 30 to 39 is -1 to -0.7, or -0.9 to -0.8. In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 40 to 49 is -0.6 to -0.2, or -0.45 to -0.35.
In an embodiment of the above formula, the adjustment of the starting ln (risk) for ages 60 to 69 is -0.3819 to 0.2619, or -0.1 to 0.1.
Substitute Sheet (Rule 26) RO/AU In an embodiment of the above formula, the adjustment of the starting In(risk) for ages 70+ is 0.2213 to 0.8438, or 0.43 to 0.63.
In an embodiment of the above formula, the adjustment of the starting In(risk) for males is -0.1005 to 0.3779, or 0.03 to 0.23.
In an embodiment of the above formula, the adjustment of the starting In(risk) for non-Caucasians is -0.0084 to 0.7167, or 0.25 to 0.45.
In an embodiment of the above formula, the adjustment of the starting In(risk) for A blood type is -0.4726 to 0.0397, or -0.11 to -0.31.
In an embodiment of the above formula, the adjustment of the starting In(risk) for B blood type is -0.2348 to 0.5773, or 0.07 to 0.27.
In an embodiment of the above formula, the adjustment of the starting In(risk) for AB blood type is -1.5087 to -0.2404, or -0.77 to -0.97.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, rheumatoid arthritis, lupus or psoriasis is 0.1832 to 1.3920, or 0.68 to 0.88.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, a haematological cancer is 0.0994 to 1.9756, or 0.93 to 1.13.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, a non-haematological cancer is 0.0401 to 0.6933, or 0.26 to 0.46.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, diabetes is 0.1450 to 0.8330, or 0.39 to 0.59.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, hypertension is 0.0313 to 0.5756, or 0.2 to 0.4.
In an embodiment of the above formula, the adjustment of the starting In(risk) for a human who has, or has had, a respiratory disease (excluding asthma) is 0.9317 to 0.1535, or 1.13 to 1.33.
In an alternate embodiment, and as outlined above, the method comprises determining the Log odds (LO). For example, the LO can be calculated using the formula:
LO = X+ SRF + ∑ Clinical β coefficients
In an embodiment, the SRF is the SNP Risk Factor which is: ∑ (No of Risk Alleles x SNP β coefficient).
In an embodiment, the relative risk is determined. In an embodiment, the relative risk is determined using the formula: relative risk = eLO
In an embodiment, the probability is determined. In an embodiment, the probability is determined using the formula: probability = eLO/(1+eLO) “e” is the mathematical constant that is the base of the natural logarithm.
In an embodiment, the probability obtained by the above formula is multiplied by 100 to obtain a percent chance of a severe response to a Coronavirus infection such as hospitalisation being required.
In an embodiment, the genetic risk assessment involves the analysis of rs10755709, rs112317747, rs112641600, rs118072448, rs2034831, rs7027911 and rs71481792. In an embodiment, X is -1.8 to -0.8 or -1.6 or -1.15. In an embodiment, X is -1.36523. In an embodiment, the subject is assigned a β coefficient of -0.08 to 0.32, or 0.02 to 0.22 or 0.124239 for each G (risk) allele present at rs10755709. Thus, for example, if the subject is homozygous for the risk allele they can be assigned a β coefficient of 0.248478, if they are heterozygous can be assigned a β coefficient of 0.124239, and if they is homozygous for the non-risk allele (C at rs10755709) they can be assigned a β coefficient of 0.248478. In an embodiment, the subject is assigned a β coefficient of 0.07 to 0.47, or 0.17 to 0.37 or 0.2737487 for each C (risk) allele present at rs112317747. In an embodiment, the subject is assigned a c βoefficient of -0.43 to - 0.03, or -0.33 to -0.13 or -0.2362513 for each T (risk) allele present at rs112641600. In an embodiment, the subject is assigned a β coefficient of -0.4 to 0, or -0.3 to -0.1 or - 0.1995879 for each C (risk) allele present at rs118072448. In an embodiment, the subject is assigned a β coefficient of 0.04 to 0.44, or 0.14 to 0.34 or 0.2371955 for each C (risk) allele present at rs2034831. In an embodiment, the subject is assigned a β coefficient of -0.1 to 0.3, or 0 to 0.2 or 0.1019074 for each A (risk) allele present at rs7027911. In an embodiment, the subject is assigned a β coefficient of -0.3 to 0.1, or - 0.2 to 0 or -0.1058025 for each T (risk) allele present at rs71481792. In an embodiment, the ∑ Clinical β coefficients is determined as above such as factoring in β coefficients for each of age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma). In an embodiment, the genetic risk assessment involves the analysis of rs10755709, rs1 l2317747, rs1 l2641600, rs1 l8072448, rs2034831, rs7027911, rs71481792, rs115492982 and rs1984162. In an embodiment, X is -2 to -1.5 or -1.75 or -1.25. In an embodiment, X is -1.469939. In an embodiment, the subject is assigned a β coefficient of -0.08 to 0.32, or 0.02 to 0.22 or 0.1231766 for each G (risk) allele present at rs10755709. Thus, for example, if the subject is homozygous for the risk allele they can be assigned a β coefficient of 0.2463532, if they are heterozygous can be assigned a β coefficient of 0.1231766, and if they is homozygous for the non-risk allele (C at rs10755709) they can be assigned a β coefficient of 0.248478. In an embodiment, the subject is assigned a β coefficient of 0.06 to 0.46, or 0.16 to 0.36 or 0.2576692 for each C (risk) allele present at rs112317747. In an embodiment, the subject is assigned a β coefficient of -0.43 to -0.03, or -0.33 to -0.13 or -0.2384001 for each T (risk) allele present at rs112641600. In an embodiment, the subject is assigned a β coefficient of -0.4 to 0, or -0.3 to -0.1 or -0.1965609 for each C (risk) allele present at rs118072448. In an embodiment, the subject is assigned a β coefficient of 0.04 to 0.44, or 0.14 to 0.34 or 0.2414792 for each C (risk) allele present at rs2034831. In an embodiment, the subject is assigned a β coefficient of -0.1 to 0.3, or 0 to 0.2 or 0.0998459 for each A (risk) allele present at rs7027911. In an embodiment, the subject is assigned a β coefficient of -0.3 to 0.1, or -0.2 to 0 or -0.1032044 for each T (risk) allele present at rs71481792. In an embodiment the subject is assigned a β coefficient of 0.21 to 0.61, or 0.31 to 0.51 or 0.4163575 for each A (risk) allele present at rs115492982. In an embodiment the subject is assigned a β coefficient of -0.1 to 0.3, or 0 to 0.2 or 0.1034362 for each A (risk) allele present at rs1984162. In an embodiment, the ∑ Clinical β coefficients is determined as above such as factoring in b coefficients for each of age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an haematological cancer, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
Any of the above calculations can be performed for non-SNP polymorphisms or a combination thereof.
In another embodiment, when combining the clinical risk assessment with the genetic risk assessment to obtain the “risk” of a human subject developing a severe response to a Coronavirus infection, the following formula can be used: [Risk (i.e. Clinical Evaluation x SNP risk)] = [Clinical Evaluation risk] x SNP1 x SNP2 x SNP3 x SNP4 x SNP5 x SNP6 x SNP7,x SNP8, . . . x SNPN etc.
Where Clinical Evaluation is the risk provided by the clinical evaluation, and SNP1 to SNPN are the relative risk for the individual SNPs, each scaled to have a population average of 1 as outlined above. Because the SNP risk values have been “centred” to have a population average risk of 1, if one assumes independence among the SNPs, then the population average risk across all genotypes for the combined value is consistent with the underlying Clinical Evaluation risk estimate.
In an embodiment, the genetic risk assessment is combined with the clinical risk assessment to obtain the “relative risk” of a human subject developing a severe response to a Coronavirus infection.
A threshold(s) can be set as described above when genetic risk is assessed alone. In one example, the threshold could be set to be at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10, when using the embodiment of the test described in Example 5. If set at 5 in this example, about 10% of the UK biobank population have a risk score over 5.0 resulting in the following performance characteristics for the test:
Sensitivity 38.41%
Specificity 93.79%
Positive predictive value 91.78%
Negative predictive value 45.76%
As the skilled person would understand, various different thresholds could be set altering performance depending on the level of risk the entity conducting the test is willing accept.
Depending upon the end-usage of the test, a threshold may be altered to the most appropriate values.
Marker Detection Strategies
Amplification primers for amplifying markers (e.g., marker loci) and suitable probes to detect such markers or to genotype a sample with respect to multiple marker alleles, can be used in the disclosure. For example, primer selection for long-range PCR is described in US 10/042,406 and US 10/236,480; for short-range PCR, US 10/341,832 provides guidance with respect to primer selection. Also, there are publicly available programs such as "Oligo" available for primer design. With such available primer selection and design software, the publicly available human genome sequence and the polymorphism locations, one of skill can construct primers to amplify the polymorphisms to practice the disclosure. Further, it will be appreciated that the precise probe to be used for detection of a nucleic acid comprising a polymorphism (e.g., an amplicon comprising the polymorphism) can vary, e.g., any probe that can identify the region of a marker amplicon to be detected can be used in conjunction with the present disclosure. Further, the configuration of the detection probes can, of course, vary. Thus, the disclosure is not limited to the sequences recited herein.
Examples of primer pairs for detecting some of the SNP’s disclosed herein include: rs11549298 (ACCTGGTATCAGTGAAGAGGATCAG (SEQ ID NO:1) and TCTTGATACAACTGTAAGAAGTGGT (SEQ ID NO: 2)), rs112317747
(TATTTCTTTGTTGCCCTCTATCTCT (SEQ ID NO:3) and GAAAGAGATGGGTTGGCATTATTAT (SEQ ID NO:4)), rs2034831
(TAAAATTAGAACTGGAGGGCTGGGT (SEQ ID NO:5) and
TGGCATTATAAACACTCACTGAAGT (SEQ ID NO:6)), rs112641600
(AATGCCATCTGATGAGAGAAGTTTT (SEQ ID NO: 7) and
TACAGTTTTAAAAATGGGCGTTTCT (SEQ ID NO:8)), rs10755709
(TATAATAACACGTGGAAGTGAAAAT (SEQ ID NO: 9) and
TTGTTTGTATGTGTGAAATGATTCT (SEQ ID NO: 10)), rs118072448 (AAGCAAACTATTCTTCAGGAATCCA (SEQ ID NO: 11) and
ATTTCTGCATTTCACTTTGTGTGGT (SEQ ID NO: 12)), rs7027911
(GTAAATGCTGCTAACAGAGCTCTTT (SEQ ID NO: 13) and
GAAGAGAGTTTATTAGCAAGGCCTC (SEQ ID NO: 14)), rs71481792
(CATTTGGGAAAAGCCACTGAATGGA (SEQ ID NO: 15) and
AGATTGACTAGCCGTTGAGAGTAGA (SEQ ID NO: 16)), and rs1984162 (ACTGACTCCTGACACTCTTGAAGCG (SEQ ID NO: 17) and
GACTCTTCTCTGGCATCTTCTCATG (SEQ ID NO: 18)).
Indeed, it will be appreciated that amplification is not a requirement for marker detection, for example one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA.
Typically, molecular markers are detected by any established method available in the art, including, without limitation, allele specific hybridization (ASH), detection of extension, array hybridization (optionally including ASH), or other methods for detecting polymorphisms, amplified fragment length polymorphism (AFLP) detection, amplified variable sequence detection, randomly amplified polymorphic DNA (RAPD) detection, restriction fragment length polymorphism (RFLP) detection, self-sustained sequence replication detection, simple sequence repeat (SSR) detection, and singlestrand conformation polymorphisms (SSCP) detection.
Some techniques for detecting genetic markers utilize hybridization of a probe nucleic acid to nucleic acids corresponding to the genetic marker (e.g., amplified nucleic acids produced using genomic DNA as a template). Hybridization formats, including, but not limited to: solution phase, solid phase, mixed phase, or in situ hybridization assays are useful for allele detection. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes Elsevier, New York, as well as in Sambrook et al. (supra).
PCR detection using dual-labelled fluorogenic oligonucleotide probes, commonly referred to as "TaqMan™" probes, can also be performed according to the present disclosure. These probes are composed of short (e.g., 20-25 base) oligodeoxynucleotides that are labelled with two different fluorescent dyes. On the 5' terminus of each probe is a reporter dye, and on the 3' terminus of each probe a quenching dye is found. The oligonucleotide probe sequence is complementary to an internal target sequence present in a PCR amplicon. When the probe is intact, energy transfer occurs between the two fluorophores and emission from the reporter is quenched by the quencher by FRET. During the extension phase of PCR, the probe is cleaved by 5' nuclease activity of the polymerase used in the reaction, thereby releasing the reporter from the oligonucleotide-quencher and producing an increase in reporter emission intensity. Accordingly, TaqMan™ probes are oligonucleotides that have a label and a quencher, where the label is released during amplification by the exonuclease action of the polymerase used in amplification. This provides a real time measure of amplification during synthesis. A variety of TaqMan™ reagents are commercially available, e.g., from Applied Biosystems (Division Headquarters in Foster City, Calif.) as well as from a variety of specialty vendors such as Biosearch Technologies (e.g., black hole quencher probes). Further details regarding dual-label probe strategies can be found, e.g., in WO 92/02638.
Other similar methods include e.g. fluorescence resonance energy transfer between two adjacently hybridized probes, e.g., using the "FightCycler®" format described in US 6,174,670.
Array-based detection can be performed using commercially available arrays, e.g., from Affymetrix (Santa Clara, Calif.) or other manufacturers. Reviews regarding the operation of nucleic acid arrays include Sapolsky et al. (1999); Fockhart (1998); Fodor (1997a); Fodor (1997b) and Chee et al. (1996). Array based detection is one preferred method for identification markers of the disclosure in samples, due to the inherently high-throughput nature of array based detection.
The nucleic acid sample to be analysed is isolated, amplified and, typically, labelled with biotin and/or a fluorescent reporter group. The labelled nucleic acid sample is then incubated with the array using a fluidics station and hybridization oven. The array can be washed and or stained or counter-stained, as appropriate to the detection method. After hybridization, washing and staining, the array is inserted into a scanner, where patterns of hybridization are detected. The hybridization data are collected as light emitted from the fluorescent reporter groups already incorporated into the labelled nucleic acid, which is now bound to the probe array. Probes that most clearly match the labelled nucleic acid produce stronger signals than those that have mismatches. Since the sequence and position of each probe on the array are known, by complementarity, the identity of the nucleic acid sample applied to the probe array can be identified.
Markers and polymorphisms can also be detected using DNA sequencing. DNA sequencing methods are well known in the art and can be found for example in Ausubel et al, eds., Short Protocols in Molecular Biology, 3rd ed., Wiley, (1995) and Sambrook et al, Molecular Cloning, 2nd ed., Chap. 13, Cold Spring Harbor Laboratory Press, (1989). Sequencing can be carried out by any suitable method, for example, dideoxy sequencing, chemical sequencing, or variations thereof.
Suitable sequencing methods also include Second Generation, Third Generation, or Fourth Generation sequencing technologies, all referred to herein as “next generation sequencing”, including, but not limited to, pyrosequencing, sequencing-by-ligation, single molecule sequencing, sequence-by-synthesis (SBS), massive parallel clonal, massive parallel single molecule SBS, massive parallel single molecule real-time, massive parallel single molecule real-time nanopore technology, etc. A review of some such technologies can be found in (Morozova and Marra, 2008), herein incorporated by reference. Accordingly, in some embodiments, performing a genetic risk assessment as described herein involves detecting the at least two polymorphisms by DNA sequencing. In an embodiment, the at least two polymorphisms are detected by next generation sequencing.
Next generation sequencing (NGS) methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, Voelkerding et al., 2009; MacLean et al., 2009). A number of such DNA sequencing techniques are known in the art, including fluorescence-based sequencing methodologies. In some embodiments, automated sequencing techniques are used. In some embodiments, parallel sequencing of partitioned amplicons is used (W02006084132). In some embodiments, DNA sequencing is achieved by parallel oligonucleotide extension (See, e.g., US 5,750,341 and US 6,306,597). Additional examples of sequencing techniques include the Church polony technology (Mitra et al., 2003; Shendure et al., 2005; US 6,432,36; US 6,485,944; US 6,511,803), the 454 picotiter pyrosequencing technology (Margulies et al., 2005; US 20050130173), the Solexa single base addition technology (Bennett et al., 2005; US 6,787,308; US 6,833,246), the Lynx massively parallel signature sequencing technology (Brenner et al., 2000; US 5,695,934; US 5,714,330), and the Adessi PCR colony technology (Adessi et al., 2000).
Correlating Markers to Phenotypes
These correlations can be performed by any method that can identify a relationship between an allele and a phenotype, or a combination of alleles and a combination of phenotypes. For example, alleles defined herein can be correlated with a severe response to Coronavirus infection phenotypes. The methods can involve referencing a look up table that comprises correlations between alleles of the polymorphism and the phenotype. The table can include data for multiple allele- phenotype relationships and can take account of additive or other higher order effects of multiple allele-phenotype relationships, e.g., through the use of statistical tools such as principle component analysis, heuristic algorithms, etc.
Correlation of a marker to a phenotype optionally includes performing one or more statistical tests for correlation. Many statistical tests are known, and most are computer-implemented for ease of analysis. A variety of statistical methods of determining associations/correlations between phenotypic traits and biological markers are known and can be applied to the present disclosure (Hartl et al., 1981). A variety of appropriate statistical models are described in Lynch and Walsh (1998). These models can, for example, provide for correlations between genotypic and phenotypic values, characterize the influence of a locus on a phenotype, sort out the relationship between environment and genotype, determine dominance or penetrance of genes, determine maternal and other epigenetic effects, determine principle components in an analysis (via principle component analysis, or "PCA"), and the like. The references cited in these texts provides considerable further detail on statistical models for correlating markers and phenotype. In addition to standard statistical methods for determining correlation, other methods that determine correlations by pattern recognition and training, such as the use of genetic algorithms, can be used to determine correlations between markers and phenotypes. This is particularly useful when identifying higher order correlations between multiple alleles and multiple phenotypes. To illustrate, neural network approaches can be coupled to genetic algorithm-type programming for heuristic development of a structure-function data space model that determines correlations between genetic information and phenotypic outcomes.
In any case, essentially any statistical test can be applied in a computer implemented model, by standard programming methods, or using any of a variety of "off the shelf' software packages that perform such statistical analyses, including, for example, those noted above and those that are commercially available, e.g., from Partek Incorporated (St. Peters, Mo.; www.partek.com), e.g., that provide software for pattern recognition (e.g., which provide Partek Pro 2000 Pattern Recognition Software).
Systems for performing the above correlations are also a feature of the disclosure. Typically, the system will include system instructions that correlate the presence or absence of an allele (whether detected directly or, e.g., through expression levels) with a predicted phenotype.
Optionally, the system instructions can also include software that accepts diagnostic information associated with any detected allele information, e.g., a diagnosis that a subject with the relevant allele has a particular phenotype. This software can be heuristic in nature, using such inputted associations to improve the accuracy of the look up tables and/or interpretation of the look up tables by the system. A variety of such approaches, including neural networks, Markov modelling, and other statistical analysis are described above.
Polymorphic Profiling
The disclosure provides methods of determining the polymorphic profile of an individual at the polymorphisms outlined in the present disclosure (e.g. Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22) or polymorphisms in linkage disequilibrium with one or more thereof.
The polymorphic profile constitutes the polymorphic forms occupying the various polymorphic sites in an individual. In a diploid genome, two polymorphic forms, the same or different from each other, usually occupy each polymorphic site. Thus, the polymorphic profile at sites X and Y can be represented in the form X (xl, xl), and Y (y1, y2), wherein x1, xl1 represents two copies of allele xl occupying site X and y1, y2 represent heterozygous alleles occupying site Y.
The polymorphic provide of an individual can be scored by comparison with the polymorphic forms associated with resistance or susceptibility to a severe response to a Coronavirus infection occurring at each site. The comparison can be performed on at least, e.g., 1, 2, 5, 10, 25, 50, or all of the polymorphic sites, and optionally, others in linkage disequilibrium with them. The polymorphic sites can be analysed in combination with other polymorphic sites.
Polymorphic profding is useful, for example, in selecting agents to affect treatment or prophylaxis of a severe response to a Coronavirus infection in a given individual. Individuals having similar polymorphic profiles are likely to respond to agents in a similar way.
Polymorphic profiling is also useful for stratifying individuals in clinical trials of agents being tested for capacity to treat a severe response to a Coronavirus infection or related conditions. Such trials are performed on treated or control populations having similar or identical polymorphic profiles (see EP 99965095.5), for example, a polymorphic profile indicating an individual has an increased risk of developing a severe response to a Coronavirus infection. Use of genetically matched populations eliminates or reduces variation in treatment outcome due to genetic factors, leading to a more accurate assessment of the efficacy of a potential drug.
Polymorphic profiling is also useful for excluding individuals with no predisposition to a severe response to a Coronavirus infection from clinical trials. Including such individuals in the trial increases the size of the population needed to achieve a statistically significant result. Individuals with no predisposition to a severe response to a Coronavirus infection can be identified by determining the numbers of resistances and susceptibility alleles in a polymorphic profile as described above. For example, if a subject is genotyped at ten sites of the disclosure associated with a severe response to a Coronavirus infection, twenty alleles are determined in total. If over 50% and alternatively over 60% or 75% percent of these are resistance genes, the individual is unlikely to develop a severe response to a Coronavirus infection and can be excluded from the trial.
Computer Implemented Method
The methods of the present disclosure may be implemented by a system such as a computer implemented method. For example, the system may be a computer system comprising one or a plurality of processors which may operate together (referred to for convenience as “processor”) connected to a memory. The memory may be a non- transitory computer readable medium, such as a hard drive, a solid state disk or CD- ROM. Software, that is executable instructions or program code, such as program code grouped into code modules, may be stored on the memory, and may, when executed by the processor, cause the computer system to perform functions such as determining that a task is to be performed to assist a user to determine the risk of a human subject developing a severe response to a Coronavirus infection; receiving data indicating the clinical risk assessment and the genetic risk assessment of the human subject developing a severe response to a Coronavirus infection, wherein the genetic risk was derived by detecting at least two polymorphisms known to be associated with a severe response to a Coronavirus infection; processing the data to combine the clinical risk assessmentand the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection; outputting the risk of a human subject developing a severe response to a Coronavirus infection.
For example, the memory may comprise program code which when executed by the processor causes the system to determine at least two polymorphisms known to be associated with a severe response to a Coronavirus infection; process the data to combine the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection; report the risk of a human subject developing a severe response to a Coronavirus infection.
In another embodiment, the system may be coupled to a user interface to enable the system to receive information from a user and/or to output or display information. For example, the user interface may comprise a graphical user interface, a voice user interface or a touchscreen.
In an embodiment, the program code may causes the system to determine the “Polymorphism risk”.
In an embodiment, the program code may causes the system to determine CombinedClinical Risk x Genetic Risk (for example Polymorphism risk).
In an embodiment, the system may be configured to communicate with at least one remote device or server across a communications network such as a wireless communications network. For example, the system may be configured to receive information from the device or server across the communications network and to transmit information to the same or a different device or server across the communications network. In other embodiments, the system may be isolated from direct user interaction. In another embodiment, performing the methods of the present disclosure to assess the risk of a human subject developing a severe response to a Coronavirus infection, enables establishment of a diagnostic or prognostic rule based on the the clinical risk assessment and the genetic risk assessment of the human subject developing a severe response to a Coronavirus infection. For example, the diagnostic or prognostic rule can be based on the Combined Clinical Risk x Genetic Risk score relative to a control, standard or threshold level of risk.
In another embodiment, the diagnostic or prognostic rule is based on the application of a statistical and machine learning algorithm. Such an algorithm uses relationships between a population of polymorphisms and disease status observed in training data (with known disease status) to infer relationships which are then used to determine the risk of a human subject developing a severe response to a Coronavirus infection in subjects with an unknown risk. An algorithm is employed which provides an risk of a human subject developing a severe response to a Coronavirus infection. The algorithm performs a multivariate or univariate analysis function.
Kits and Products
In an embodiment, the present disclosure provides a kit comprising at least two sets of primers for amplifying two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from any one of Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 sets of the primers for amplifying nucleic acids comprising a polymorphism selected from any one of Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 sets sets of the primers for amplifying nucleic acids comprising a polymorphism selected from Table 2 and Table 3, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof. In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, or at least 60 sets of the primers for amplifying nucleic acids comprising a polymorphism selected from Table 4 or Table 6, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, or at least 60 sets of the primers for amplifying nucleic acids comprising a polymorphism selected from Table 4, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50, sets of the primers for amplifying nucleic acids comprising a polymorphism selected from Table 3 or Table 6a, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50, sets of the primers for amplifying nucleic acids comprising a polymorphism selected from Table 3, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises sets of primers for amplifying nucleic acids comprising one or more or all of the polymorphisms provided in Table 19, , or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises sets of primers for amplifying nucleic acids comprising one or more or all of the polymorphisms provided in Table 22, , or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
As would be appreciated by those of skill in the art, once a polymorphism is identified, primers can be designed to amplify the polymorphism as a matter of routine. Various software programs are freely available that can suggest suitable primers for amplifying polymorphisms of interest.
Again, it would be known to those of skill in the art that PCR primers of a PCR primer pair can be designed to specifically amplify a region of interest from human DNA. Each PCR primer of a PCR primer pair can be placed adjacent to a particular single-base variation on opposing sites of the DNA sequence variation. Furthermore, PCR primers can be designed to avoid any known DNA sequence variation and repetitive DNA sequences in their PCR primer binding sites. The kit may further comprise other reagents required to perform an amplification reaction such as a buffer, nucleotides and/or a polymerase, as well as reagents for extracting nucleic acids from a sample.
Array based detection is one preferred method for assessing the polymorphisms of the disclosure in samples, due to the inherently high-throughput nature of array based detection. A variety of probe arrays have been described in the literature and can be used in the context of the present disclosure for detection of polymorphisms that can be correlated to a severe response to a Coronavirus infection. For example, DNA probe array chips are used in one embodiment of the disclosure. The recognition of sample DNA by the set of DNA probes takes place through DNA hybridization. When a DNA sample hybridizes with an array of DNA probes, the sample binds to those probes that are complementary to the sample DNA sequence. By evaluating to which probes the sample DNA for an individual hybridizes more strongly, it is possible to determine whether a known sequence of nucleic acid is present or not in the sample, thereby determining whether a marker found in the nucleic acid is present.
Thus, in another embodiment, the present disclosure provides a genetic array comprising at least two sets of probes for hybridising to two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from any one of Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 sets of probes for hybridising a polymorphism selected from any one of Tables 1 to 3, 5a or 6, or Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 sets of probes for hybridising a polymorphism selected from Table 2 and Table 3, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, or at least 60 sets of probes for hybridising a polymorphism selected from Table 4 or Table 5, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, or at least 60 sets of probes for hybridising a polymorphism selected from Table 4, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50, sets of probes for hybridising a polymorphism selected from Table 3 or Table 6a, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40 or at least 50, sets of probes for hybridising a polymorphism selected from Table 3, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprises a probe(s) for hybridising one or more or all of the polymorphisms provided in Table 19, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
In an embodiment, the kit comprising a probe (s) for hybridising one or more or all of the polymorphisms provided in in Table 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
Primers and probes for other polymorphisms can be included with the above exemplified kits. For example, primers and/or probes may be included for detecting a Coronavirus, such as a SARS-CoV-2 viral, infection.
EXAMPLES
Example 1 - Polymorphisms associated with disease severity in Covid-19 infected patients
Approximately 11 million SNP results were analysed. These were sorted by p- value, from lowest to highest and the top one million of these were utilised for further pruning. This equated to all variants p<0.0969. A p-value threshold of p≤0.001 was then applied, as was a beta value window between -1 to 1 and an average pooled allele frequency of 0.01 - 0.99. These were then further pruned for linkage disequilibrium using the online tool LDLink, snpclip (https://ldlink.nci.nih.gov/?tab=snpclip) using the EUR populations as reference, set to threshold at R2 of <0.5. Non-single nucleotide variants were excluded if no linked surrogate/proxy SNP was available.
Informative polymorphisms derived from publicly available pooled genome- wide association study (GWAS) results from 716 cases (confirmed COVID-19 (severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)) diagnosis and hospitalised) and 616 controls (confirmed COVID-19 diagnosis and non-hospitalised are provided in Table 2.
Informative polymorphisms derived from 2,863 patients within the UK Biobank Study, of which 825 were hospitalized for severe response to the infection. GWAS results were sorted by p-value. A p-value threshold of p<0.00001 was applied, as was an allele frequency threshold set at a minor allele frequency >0.01. The identified polymorphisms are provided in Table 8.
Example 2 - Genetic risk assessment - 108 polymorphism panel
SNP -based (relative) risk score was calculated using estimates of the odds ratio (OR) per allele and risk allele frequency (p) assuming independent and additive risks on the log OR scale. For each SNP, the unsealed population average risk was calculated as μ = (1 - p)2 + 2p(1 - p) OR + p20R2. Adjusted risk values (with a population average risk equal to 1 were calculated as 1/μ, OR/μ and OR2/μ for the three genotypes defined by number of risk alleles (0, 1, or 2). The overall SNP -based risk score was then calculated by multiplying the adjusted risk values for each of the 108 SNPs (Tables 9 and 10).
Thus, a polygenic risk score can discriminate between patients with a confirmed Covid-19 infection who developed a severe response to that infection, requiring hospitalization, and those who did not require hospitalization.
Table 8 - Informative polymorphisms derived from 2,863 patients within the UK
Biobank Study.
Allele Frequency Frequency p-value for
Chromsome Position SNP ID Allele 1 2 Allele 1 Allele 2 association OR
1 3680362 rs146866117 T C 0.00042 0.99958 3.21516E-05 11.3818
1 10993680 rs75721992 C T 0.00091 0.99909 8.03153E-09 18.9971
1 15698556 rs12562412 G C 0.18020 0.81980 7.34872E-05 I.43641
1 15758944 rs117338853 A G 0.00125 0.99875 9.31685E-05 9.83042
1 16109212 rs72647169 G C 0.03574 0.96426 1.72286E-05 4.49562
1 17295659 rs199765517 T C 0.00045 0.99955 6.47434E-05 10.3168
1 20072025 rs199727655 A G 0.00003 0.99997 3.41489E-05 II.3655
1 22538788 rs78360109 A G 0.00727 0.99273 1.32276E-06 3.74574
1 34829829 rs79955780 G A 0.03884 0.96116 8.74145E-05 1.8346
1 38661814 rs61778695 C A 0.03148 0.96852 4.43093E-05 1.93677
1 67804320 rs578200723 GTTA G 0.00168 0.99832 0.000020482 5.75441
1 72488455 rs116544454 T G 0.01396 0.98604 1.85829E-05 2.48638
1 109823418 rs144022094 T C 0.00064 0.99936 3.57493E-05 6.50582
1 109933450 rs56072034 A G 0.02556 0.97444 4.12342E-05 2.10457
1 168696733 rs76129265 T G 0.05740 0.94260 7.51539E-05 1.68733
1 204092087 rs201772428 A G 0.00036 0.99964 4.3011E-06 14.8225
1 206776460 rs35252702 A G 0.00679 0.99321 1.56671E-07 8.81138
1 207610967 rs61821114 T C 0.01504 0.98496 3.00757E-05 2.42913
1 210901242 rs1934624 A T 0.02193 0.97807 5.48665E-05 2.16618
1 218938774 rs76354174 A G 0.02281 0.97719 7.54499E-05 2.10557
1 230907829 rs143186556 A G 0.00089 0.99911 5.46536E-05 7.7448
1 231133014 rs200114138 A G 0.00101 0.99899 3.96515E-06 8.13897
2 22958939 rs59447738 G T 0.10234 0.89766 8.21388E-05 1.5646
2 23005876 rs73918088 A C 0.05530 0.94470 7.50922E-05 1.7204
2 25861939 rs189303418 T C 0.00156 0.99844 0.000040202 5.43754
2 34108876 rs1718746 C G 0.15379 0.84621 8.52475E-05 0.678928
2 34119632 rs1705143 A G 0.15212 0.84788 8.08594E-05 0.676255
2 64630299 rs872241 G A 0.35970 0.64030 7.17367E-05 1.37043
2 64641736 rs1 1676644 C T 0.30746 0.69254 0.000032141 I.39753
2 115258481 rs56735442 A G 0.02150 0.97850 3.59163E-05 2.25221
2 122952399 rs75945051 G A 0.01208 0.98792 4.38486E-05 2.48027
2 126726522 rs76187206 C G 0.00948 0.99052 5.74668E-05 2.79499
2 160721407 chr2_160721407 A AC 0.00001 0.99999 4.45501E-05 10.9923
2 179428061 rs1 1896637 T C 0.00304 0.99696 1.81846E-06 II.2684
2 179441917 rs72646881 C T 0.00324 0.99676 1.59099E-05 8.89845
2 179612315 rs145581345 C T 0.00135 0.99865 8.45307E-05 5.91193
2 181910717 rs78593095 A G 0.01388 0.98612 2.26398E-05 2.66342
2 191278341 rs6725814 G A 0.37811 0.62189 1.88302E-05 0.714396
3 2748191 rs80225140 G A 0.03080 0.96920 8.74289E-06 2.11655
3 34944013 rs17032477 G A 0.01700 0.98300 3.63638E-05 2.54994 65100060 rs2128405 C A 0.07271 0.92729 1.71219E-05 1.69956 70783491 rs6766000 T C 0.13852 0.86148 2.00031E-05 1.53315 81810551 rs35196441 T G 0.00100 0.99900 3.53506E-05 11.2502 154812638 rs2196521 G A 0.12811 0.87189 3.73634E-05 0.662498 160379672 rs4679910 G A 0.38677 0.61323 1.90222E-05 1.4334 171853417 rs73167212 G A 0.11289 0.88711 0.00002702 1.5595 177796194 rs74911757 T C 0.01229 0.98771 1.43291E-05 2.6372 39943691 rs115509062 G C 0.03178 0.96822 6.54964E-05 1.90376 45117625 rs75072424 A G 0.11765 0.88235 2.80438E-05 1.54717 69795670 rs144454074 A G 0.00307 0.99693 4.19779E-05 4.35549 73555556 rs28616128 G A 0.06206 0.93794 3.02015E-06 1.78187 75191300 rs115044024 C T 0.01950 0.98050 4.15557E-05 2.18747 84216649 rs144185023 A G 0.00166 0.99834 3.72469E-05 5.50931 87939942 rs76456240 C T 0.02364 0.97636 9.48747E-05 2.09846 121958473 rs202221151 C T 0.00031 0.99969 1.61977E-06 16.7318 142326546 rs76589765 G A 0.01836 0.98164 4.20983E-06 2.39938 151724769 rs116015734 T C 0.01283 0.98717 9.26679E-05 2.44853 153821201 rs62319956 C A 0.00963 0.99037 2.01266E-06 3.02949 170238293 rs76519323 A C 0.03375 0.96625 2.30315E-05 1.98212 170498270 rs74557505 C T 0.03048 0.96952 6.57926E-05 2.01122 181162752 rs17069033 T G 0.00223 0.99777 1.35337E-05 9.07875 185567903 rs4647611 C G 0.00897 0.99103 2.72675E-05 6.07186 6826973 rs275444 C G 0.12706 0.87294 3.53004E-05 0.530803 19993490 rs4466171 A T 0.02086 0.97914 3.08251E-06 5.43862 43280480 rs55770078 A G 0.00266 0.99734 1.16965E-05 4.82309 99815379 rs115319054 A C 0.01396 0.98604 8.88589E-05 2.37898 133519273 rs79601653 G A 0.05445 0.94555 9.89897E-05 1.68817 155405405 rs958444 T C 0.04320 0.95680 2.01272E-05 0.540169 160448591 rs11749317 C T 0.01465 0.98535 0.000080983 2.31323 2885791 rs318470 C A 0.03985 0.96015 9.76222E-05 0.534104 16217762 rs149442766 A G 0.00598 0.99402 3.42524E-05 3.20428 26408145 rs144114619 A T 0.00298 0.99702 4.57681E-05 4.32309 33156845 rs41268014 G C 0.00111 0.99889 1.61406E-05 7.06085 36976747 rs140572234 C G 0.00360 0.99640 6.20165E-08 4.94704 36999980 rs114925152 G C 0.01045 0.98955 0.000019845 2.8117 37139030 rs35760989 C G 0.00316 0.99684 2.15792E-05 4.19015 101279459 rs9485415 T C 0.05955 0.94045 2.95345E-05 1.79563 147885588 rs140643252 A G 0.00080 0.99920 0.000080315 7.36219 21730647 rs7790948 G T 0.14286 0.85714 3.13489E-05 1.51436 35720134 rs79496619 T G 0.01734 0.98266 3.21712E-05 4.65324 38677134 rs78966608 A C 0.06041 0.93959 7.06676E-05 1.69619 100483400 rs200675508 A G 0.00165 0.99835 7.25535E-05 5.06219 104782689 rs55743527 G T 0.00060 0.99940 1.36022E-06 11.6143 122122078 rs73431600 A G 0.01909 0.98091 5.15467E-05 2.32846 122196872 rs73433754 A C 0.01639 0.98361 3.48011E-05 2.47199 154926067 rs117164958 C G 0.01908 0.98092 7.61301E-06 4.84386 158928541 rs13225056 A G 0.02825 0.97175 1.53596E-05 2.04944 2044114 rs147776183 T C 0.00025 0.99975 8.6487 IE-06 13.5674 9478274 rs78876374 T C 0.05327 0.94673 8.85355E-05 1.69943 19218826 rs145746072 A G 0.00063 0.99937 1.91735E-05 5.15347 20354600 rs13249119 G A 0.12835 0.87165 1.33633E-05 1.57795 20447019 rs73626732 A G 0.08816 0.91184 1.40229E-05 1.65522 20460661 rs35258926 G T 0.08444 0.91556 9.04111E-06 1.68733 39799765 rs7845003 T C 0.38763 0.61237 9.39614E-05 1.37383 125839433 rs118040942 T C 0.02098 0.97902 0.000059504 2.11631 130677813 rs57557483 A G 0.03911 0.96089 8.17573E-06 1.95465 130694201 rs75572486 A G 0.03949 0.96051 2.53314E-05 1.8823 10276812 rs10959000 A G 0.06996 0.93004 7.85152E-05 1.65945 22080363 rs16905613 G A 0.00861 0.99139 5.78633E-06 3.06828 38669062 rs2993177 A G 0.02733 0.97267 7.37838E-05 0.512648 79453107 rs7853555 T C 0.39843 0.60157 5.25711E-05 0.726342 83032179 rs72744937 G A 0.01117 0.98883 6.92799E-05 2.60258 100137855 rs200908751 A G 0.00074 0.99926 6.57652E-05 7.53882 101874496 rs76094400 A G 0.01217 0.98783 3.95481E-08 3.22873 125704675 rs76670825 A G 0.01316 0.98684 5.01185E-05 2.47436 125903047 rs77089732 A G 0.01284 0.98716 0.00005145 2.45902 128794405 rs62570501 T C 0.05704 0.94296 7.35517E-05 1.70643 131771551 rs17455482 A G 0.00240 0.99760 5.2118E-06 5.14273 67680203 rs41313840 G A 0.00029 0.99971 7.19977E-08 11.5573 127258691 rs7084502 A G 0.41534 0.58466 7.81329E-05 0.720431 131456440 rs79858702 T C 0.00885 0.99115 0.000070971 2.83622 1795214 rs79194907 G A 0.08673 0.91327 6.83674E-05 0.457071 5146083 rs12365149 T C 0.08312 0.91688 3.11673E-05 0.427618 44547746 rs12275504 G T 0.02803 0.97197 1.40655E-05 2.13659 46727333 rs149066130 A G 0.00042 0.99958 7.9865 IE-05 10.0401 57982229 rs1966836 A G 0.29483 0.70517 6.87681E-05 0.720184 65414949 rs199717374 T C 0.00021 0.99979 1.05822E-05 9.34606 78904266 rs75970706 T C 0.03718 0.96282 0.000040305 1.8614 94665002 rs76360689 A G 0.00749 0.99251 1.05432E-06 3.44965 133713033 rs75786498 A G 0.01903 0.98097 3.13102E-05 2.20737 2174748 rs117821007 C T 0.01160 0.98840 4.86991E-05 2.65265 25681286 rs58907459 T C 0.12688 0.87312 6.07118E-05 1.50994 57589676 rs143285614 A G 0.00041 0.99959 2.6907 IE-05 11.6706 125302200 rs143093152 G A 0.00050 0.99950 6.62377E-06 14.0613 39433574 rs138539682 A G 0.00073 0.99927 3.32149E-05 8.17464 68302925 rs75022796 T C 0.00560 0.99440 7.24669E-05 3.17997 52276643 rs117852779 C T 0.02739 0.97261 2.89233E-06 2.17106 80405359 rs11159425 T G 0.11363 0.88637 4.36025E-07 0.583 80570671 rs114463019 G T 0.01076 0.98924 3.85403E-05 2.71426 87813714 rs28450466 A G 0.37204 0.62796 9.45754E-05 1.35996 93016441 rs57851052 C T 0.32996 0.67004 5.53318E-05 1.37778 104863663 rs80083325 A G 0.05367 0.94633 0.000073746 1.71423 22845849 rs150408740 G A 0.00068 0.99932 1.76793E-05 8.79206 34498314 rs75915717 T C 0.08459 0.91541 1.0293E-06 1.74564 41047777 rs35673728 C T 0.06056 0.93944 6.67895E-05 1.67388 41254865 rs12915860 C A 0.06743 0.93257 1.01336E-05 1.72191 41712936 rs62001419 A C 0.05640 0.94360 9.84979E-05 1.68361 52689631 rs1724577 T G 0.00955 0.99045 2.4204 IE-05 0.197849 58047086 rs77910305 G C 0.00656 0.99344 1.30369E-05 3.14637 65851028 rs200531541 A G 0.00017 0.99983 3.83063E-06 13.9416 78471034 rs34921279 T C 0.00117 0.99883 2.40367E-05 8.48175 84063245 rs12591031 G A 0.21734 0.78266 1.16687E-05 1.46192 91452594 rs142925505 T C 0.00205 0.99795 6.04339E-07 5.95363 49391921 rs62029091 A G 0.11884 0.88116 7.11949E-05 1.52258 49394276 rs8057939 C T 0.12559 0.87441 1.12522E-05 1.57483 60671279 rs118097562 T A 0.00770 0.99230 1.90641E-05 6.63236 61851413 rs151208133 T C 0.00057 0.99943 6.3915E-06 9.86885 81194912 rs11642802 C A 0.26295 0.73705 4.32104E-06 1.45947 90075827 rs201800670 T C 0.00044 0.99956 1.60067E-05 12.5559 1462712 rs73298816 G A 0.29300 0.70700 5.44207E-05 0.682825 3844344 rs144535413 T C 0.00487 0.99513 1.11488E-05 3.62812 36485146 rs147966258 A G 0.00198 0.99802 1.64933E-05 5.06987 39240513 rs193005959 A C 0.00837 0.99163 3.72836E-05 2.98372 55803083 rs72841559 C G 0.01897 0.98103 2.26086E-05 2.2379 56329775 rs368901060 ACCAT A 0.00219 0.99781 4.70507E-06 5.18629 63919929 rs7220318 G A 0.00461 0.99539 2.39945E-05 10.9127 72890474 rs689992 T A 0.26539 0.73461 8.97907E-05 1.39123 78215658 rs117140258 A G 0.02691 0.97309 4.15567E-05 2.08397 4610215 rs76902871 G T 0.01267 0.98733 2.95635E-05 2.56921 13501162 rs2298530 C T 0.03718 0.96282 6.48889E-05 1.85512 14310187 rs117505121 G A 0.01057 0.98943 3.59448E-05 2.71447 49288587 rs117781678 A C 0.01002 0.98998 4.32852E-05 2.66495 76650871 rs7240086 G A 0.43336 0.56664 6.95487E-06 1.42281 36018109 rs74726174 C T 0.00069 0.99931 1.82372E-05 12.2885 38867031 rs200403794 A G 0.00019 0.99981 8.36021E-05 10.0252 8782776 rs138434221 A C 0.00031 0.99969 4.80296E-06 14.6291 15632993 rs6110707 C T 0.17779 0.82221 1.31264E-05 1.50802 55021575 rs6069749 T C 0.07845 0.92155 2.92257E-05 1.64645 55111747 rs6014757 A G 0.15160 0.84840 6.44584E-05 1.47163 19045795 rs73200561 A T 0.00879 0.99121 9.40896E-05 2.714 37444937 rs2230191 A G 0.00079 0.99921 3.4537E-07 13.3335 28016883 rs1885362 A C 0.15733 0.84267 4.65803E-05 1.70351 22 40056937 rs113038998 T C 0.06752 0.93248 1.37758E-05 1.73209
22 44285118 rs117421847 A G 0.01292 0.98708 6.60782E-05 2.4314
Example 3 - Genetic risk assessment - 58 polymorphism panel
The present inventors have found that a polygenic risk score can discriminate between patients with a confirmed Covid-19 infection who developed a severe response to that infection, requiring hospitalization, and those who did not require hospitalization.
The model has been developed using 2,863 patients within the UK Biobank Study, of which 825 were hospitalized for severe response to the infection. SNP -based (relative) risk score was calculated using estimates of the odds ratio
(OR) per allele and risk allele frequency (p) assuming independent and additive risks on the log OR scale. For each SNP, the unsealed population average risk was calculated as m = (1 - p)2 + 2p(1 - p) OR + p20R2. Adjusted risk values (with a population average risk equal to 1 were calculated as 1/μ, OR/μ and OR2/μ for the three genotypes defined by number of risk alleles (0, 1, or 2). The overall SNP -based risk score was then calculated by multiplying the adjusted risk values for each of the 58 SNPs (Table 11). The 58 SNPs analysed are provided in Table 3.
Thus, a polygenic risk score can discriminate between patients with a confirmed Covid-19 infection who developed a severe response to that infection, requiring hospitalization, and those who did not require hospitalization. Due to the higher OR, this panel performed better than the 108 SNP panel described in Example 2.
Table 9 - Informative polymorphisms used in genetic risk assessment of Example 2.
Allele Allele Frequency Frequency p-value for
Chromsome Position SNP ID 1 2 Allele 1 Allele 2 association OR
1 15698556 rs12562412 G C 0.180202869 0.819797131 7.34872E-05 1.43641
1 16109212 rs72647169 G C 0.035742611 0.964257389 1.72286E-05 4.49562
1 34829829 rs79955780 G A 0.038842122 0.961157878 8.74145E-05 1.8346
1 38661814 rs61778695 C A 0.031483826 0.968516174 4.43093E-05 1.93677
1 72488455 rs116544454 T G 0.013959529 0.986040471 1.85829E-05 2.48638
1 109933450 rs56072034 A G 0.02556272 0.97443728 4.12342E-05 2.10457
1 168696733 rs76129265 T G 0.05740251 0.94259749 7.51539E-05 1.68733
1 207610967 rs61821114 T C 0.015043834 0.984956166 3.00757E-05 2.42913
1 210901242 rs1934624 A T 0.021933325 0.978066675 5.48665E-05 2.16618
1 218938774 rs76354174 A G 0.022811438 0.977188562 7.54499E-05 2.10557
2 22958939 rs59447738 G T 0.102337052 0.897662948 8.21388E-05 1.5646
2 23005876 rs73918088 A C 0.055296476 0.944703524 7.50922E-05 1.7204
2 34108876 rs1718746 C G 0.153787681 0.846212319 8.52475E-05 0.678928
2 34119632 rs1705143 A G 0.152124807 0.847875193 8.08594E-05 0.676255
2 64630299 rs872241 G A 0.359695861 0.640304139 7.17367E-05 1.37043
2 64641736 rs11676644 C T 0.30746047 0.69253953 0.000032141 1.39753
2 115258481 rs56735442 A G 0.021502475 0.978497525 3.59163E-05 2.25221
2 122952399 rs75945051 G A 0.012078152 0.987921848 4.38486E-05 2.48027
2 181910717 rs78593095 A G 0.013875458 0.986124542 2.26398E-05 2.66342
2 191278341 rs6725814 G A 0.378106477 0.621893523 1.88302E-05 0.714396
3 2748191 rs80225140 G A 0.030803699 0.969196301 8.74289E-06 2.11655
3 34944013 rs17032477 G A 0.017000358 0.982999642 3.63638E-05 2.54994
3 65100060 rs2128405 C A 0.072712034 0.927287966 1.71219E-05 1.69956
3 70783491 rs6766000 T C 0.138522268 0.861477732 2.0003 IE-05 1.53315
3 81810551 rs2196521 G A 0.128112119 0.871887881 3.73634E-05 0.662498
3 160379672 rs4679910 G A 0.386771125 0.613228875 1.90222E-05 1.4334
3 171853417 rs73167212 G A 0.112891842 0.887108158 0.00002702 1.5595
3 177796194 rs74911757 T C 0.012287422 0.987712578 1.43291E-05 2.6372
4 39943691 rs115509062 G C 0.031782343 0.968217657 6.54964E-05 1.90376
4 45117625 rs75072424 A G 0.117654783 0.882345217 2.80438E-05 1.54717
4 73555556 rs28616128 G A 0.06205979 0.93794021 3.02015E-06 1.78187
4 75191300 rs115044024 C T 0.019501076 0.980498924 4.15557E-05 2.18747
4 87939942 rs76456240 C T 0.02364031 0.97635969 9.48747E-05 2.09846
4 142326546 rs76589765 G A 0.018356247 0.981643753 4.20983E-06 2.39938
4 151724769 rs1 l6015734 T C 0.012831113 0.987168887 9.26679E-05 2.44853
4 170238293 rs76519323 A C 0.033750916 0.966249084 2.30315E-05 1.98212
4 170498270 rs74557505 C T 0.030475432 0.969524568 6.57926E-05 2.01122
5 6826973 rs275444 C G 0.127064744 0.872935256 3.53004E-05 0.530803
5 19993490 rs4466171 A T 0.020864374 0.979135626 3.08251E-06 5.43862 99815379 rs115319054 A C 0.013956451 0.986043549 8.88589E-05 2.37898 133519273 rs79601653 G A 0.054445035 0.945554965 9.89897E-05 1.68817 155405405 rs958444 T C 0.043203962 0.956796038 2.01272E-05 0.540169 160448591 rs11749317 C T 0.014652992 0.985347008 0.000080983 2.31323 2885791 rs318470 C A 0.039851542 0.960148458 9.76222E-05 0.534104 36999980 rs114925152 G C 0.010452207 0.989547793 0.000019845 2.8117 101279459 rs9485415 T C 0.059550603 0.940449397 2.95345E-05 1.79563 21730647 rs7790948 G T 0.142864617 0.857135383 3.13489E-05 1.51436 35720134 rs79496619 T G 0.01734375 0.98265625 3.21712E-05 4.65324 38677134 rs78966608 A C 0.060412303 0.939587697 7.06676E-05 1.69619 122122078 rs73431600 A G 0.019090743 0.980909257 5.15467E-05 2.32846 122196872 rs73433754 A C 0.016394855 0.983605145 3.48011E-05 2.47199 154926067 rs117164958 C G 0.019077785 0.980922215 7.61301E-06 4.84386 158928541 rs13225056 A G 0.028246298 0.971753702 1.53596E-05 2.04944 9478274 rs78876374 T C 0.053269431 0.946730569 8.85355E-05 1.69943 20354600 rs13249119 G A 0.12835319 0.87164681 1.33633E-05 1.57795 20447019 rs73626732 A G 0.088162098 0.911837902 1.40229E-05 1.65522 20460661 rs35258926 G T 0.084440378 0.915559622 9.04111E-06 1.68733 39799765 rs7845003 T C 0.387630529 0.612369471 9.39614E-05 1.37383 125839433 rs118040942 T C 0.020977249 0.979022751 0.000059504 2.11631 130677813 rs57557483 A G 0.039111916 0.960888084 8.17573E-06 1.95465 130694201 rs75572486 A G 0.039487371 0.960512629 2.53314E-05 1.8823 10276812 rs10959000 A G 0.069955622 0.930044378 7.85152E-05 1.65945 38669062 rs2993177 A G 0.027325082 0.972674918 7.37838E-05 0.512648 79453107 rs7853555 T C 0.398429245 0.601570755 5.2571 IE-05 0.726342 83032179 rs72744937 G A 0.011167213 0.988832787 6.92799E-05 2.60258 101874496 rs76094400 A G 0.012165395 0.987834605 3.95481E-08 3.22873 125704675 rs76670825 A G 0.013160405 0.986839595 5.01185E-05 2.47436 125903047 rs77089732 A G 0.012843423 0.987156577 0.00005145 2.45902 128794405 rs62570501 T C 0.057035262 0.942964738 7.35517E-05 1.70643 127258691 rs7084502 A G 0.415343172 0.584656828 7.81329E-05 0.720431 1795214 rs79194907 G A 0.086733113 0.913266887 6.83674E-05 0.457071 5146083 rs12365149 T C 0.083117054 0.916882946 3.11673E-05 0.427618 44547746 rs12275504 G T 0.028028822 0.971971178 1.40655E-05 2.13659 57982229 rs1966836 A G 0.294826316 0.705173684 6.87681E-05 0.720184 78904266 rs75970706 T C 0.037184377 0.962815623 0.000040305 1.8614 133713033 rs75786498 A G 0.019027141 0.980972859 3.13102E-05 2.20737 2174748 rs117821007 C T 0.011596011 0.988403989 4.86991E-05 2.65265 25681286 rs58907459 T C 0.126878043 0.873121957 6.07118E-05 1.50994 52276643 rs117852779 C T 0.027392806 0.972607194 2.89233E-06 2.17106 80405359 rs11159425 T G 0.113626338 0.886373662 4.36025E-07 0.583 80570671 rs114463019 G T 0.010759957 0.989240043 3.85403E-05 2.71426 87813714 rs28450466 A G 0.372042781 0.627957219 9.45754E-05 1.35996 93016441 rs57851052 C T 0.329959028 0.670040972 5.53318E-05 1.37778 104863663 rs80083325 A G 0.053669505 0.946330495 0.000073746 1.71423 34498314 rs75915717 T C 0.084593227 0.915406773 1.0293E-06 1.74564 41047777 rs35673728 C T 0.060558997 0.939441003 6.67895E-05 1.67388 41254865 rs12915860 C A 0.06742592 0.93257408 1.01336E-05 1.72191 41712936 rs62001419 A C 0.056399246 0.943600754 9.84979E-05 1.68361 84063245 rs12591031 G A 0.217339031 0.782660969 1.16687E-05 1.46192 49391921 rs62029091 A G 0.118836542 0.881163458 7.11949E-05 1.52258 49394276 rs8057939 C T 0.125591649 0.874408351 1.12522E-05 1.57483 81194912 rs11642802 C A 0.262949597 0.737050403 4.32104E-06 1.45947 1462712 rs73298816 G A 0.292998283 0.707001717 5.44207E-05 0.682825 55803083 rs72841559 C G 0.018970721 0.981029279 2.26086E-05 2.2379 72890474 rs689992 T A 0.265385949 0.734614051 8.97907E-05 1.39123 78215658 rs117140258 A G 0.026907587 0.973092413 4.15567E-05 2.08397 4610215 rs76902871 G T 0.012668006 0.987331994 2.95635E-05 2.56921 13501162 rs2298530 C T 0.03717617 0.96282383 6.48889E-05 1.85512 14310187 rs117505121 G A 0.010569152 0.989430848 3.59448E-05 2.71447 49288587 rs117781678 A C 0.010023409 0.989976591 4.32852E-05 2.66495 76650871 rs7240086 G A 0.433358842 0.566641158 6.95487E-06 1.42281 15632993 rs6110707 C T 0.177787033 0.822212967 1.31264E-05 1.50802 55021575 rs6069749 T C 0.078451567 0.921548433 2.92257E-05 1.64645 55111747 rs6014757 A G 0.15160471 0.84839529 6.44584E-05 1.47163 28016883 rs1885362 A C 0.157331933 0.842668067 4.65803E-05 1.70351 40056937 rs113038998 T C 0.067518225 0.932481775 1.37758E-05 1.73209 44285118 rs117421847 A G 0.012916257 0.987083743 6.60782E-05 2.4314
Example 4 - Combining genetic and clinical risk assessment
The present specification provides methods for a Covid-19 risk model which combines a clinical risk assessment and a genetic risk assessment which can be used discriminate between cases with a severe response to Covid-19 infection, versus controls without a severe response.
The clinical risk factors incorporated into a combined model are assigned a relative risk, which indicates the magnitude of association with the severity of a Covid- 19 infection, the clinical factors are combined with the polygenic risk score by multiplication. For example clinical risk factor A is assigned the relative risk RRa and clinical risk factor B is assigned the relative risk RRb. The full risk score is then calculated as Polygenic Risk Score x RRa x RRb = Combined Risk.
Table 10 - Performance characteristics of a 108 SNP polygenic risk score to discriminate between cases with a severe response to Covid-19 infection, versus controls without a severe response.
Figure imgf000112_0001
Table 11 - Performance characteristics of a 58 SNP polygenic risk score to discriminate between cases with a severe response to Covid-19 infection, versus controls without a severe response.
Figure imgf000112_0002
Example 5 - Combined genetic and clinical risk assessment - 64 polymorphism panel
Data and Eligibility
The inventors extracted COVID-19 testing and hospital records from the UK Biobank COVID-19 data portal on 15 September 2020. At the time of data extraction, primary care data was only available for just over half of the identified participants and was therefore not used in these analyses.
Eligible participants were those who had tested positive for COVID-19 and for whom SNP genotyping data and linked hospital records were available. Of the 18,221 participants with COVID-19 test results, 1,713 had tested positive and 1,582 of those had both SNP and hospital data available.
COVID-19 Severity
The inventors used source of test result as a proxy for severity of disease: outpatient representing non-severe disease and inpatient representing severe disease. For participants with multiple test results, the disease was considered to be severe if at least one result came from an inpatient setting.
Selection of SNPs for Risk of Severe COVID-19
The inventors identified 62 SNPs from the publicly available (release 2) results of the meta-analysis of non-hospitalised versus hospitalised cases of COVID-19 conducted by the COVID-19 Host Genetics Initiative consortium (COVID-19 Host Genetics Initiative (2020) and COVID-19 Host Genetics Initiative: results. 2020 accessed May 13, 2020, at www.covidl9hg.org/results). (). P<0.0001 was used as the threshold for loci selection and variants that were associated with hospitalisation in only one of the five studies included in the meta-analysis were removed. Variants that had a minor allele frequency of <0.01 and beta coefficients from -1 to 1 were then discarded (Dayem et al., 2018). Linkage disequilibrium pruning was performed using an r2 threshold of 0.5 against the 1000 Genomes European populations (CEU, TSI, FIN, GBR, IBS) representing the ethnicities of the submitted populations (Machiela et al., 2015). Where possible, SNP variants were chosen over insertion-deletion variants to facilitate laboratory validation testing.
The two lead SNPs from the loci found by Ellinghaus et al. (2020) that reached genome-wide significance were also included. Therefore, a panel of 64 SNPs for severe COVID-19 was used. Genetic Risk Score
For the SNPs identified from the COVID-19 Host Genetics Initiative, the odds ratios for severe disease ranged from 1.5 to 2.7 (Table 4). While the inventors would normally construct a SNP relative risk score by using published odds ratios and allele frequencies to calculate adjusted risk values (with a population average of 1) for each SNP and then multiplying the risks for each SNP (Mealiffe et al., 2010), the size of the odds ratios for each SNP meant that this approach could result in relative risk SNP scores of several orders of magnitude. Therefore, to construct the SNP score for this study, the inventors calculated the percentage of risk alleles present in the genotyped SNPs for each participant as generally described in WO 2005/086770. More specifically, for each of the 64 SNPs, if the subject was homozygous for the risk allele they were scored as 2, if they were heterozygous for the risk allele they were scored as 1, and if they we homozygous for the risk allele they were scored as 0. The total number was then converted to a percentage for use in determining risk. Percentage rather than a count was used because some of the eligible participants had missing data for some SNPs (9% had all SNPs genotyped, 82% were missing 1-5 SNPs and 9% were missing 6-15 SNPs).
Imputation of ABO Genotype Blood type was imputed for genotyped UK Biobank participants using three
SNPs (rs505922, rs8176719 and rs8176746) in the ABO gene on chromosome 9q34.2. A rs8176719 deletion (or for those with no result for rs8176719, a T allele at rs505922) was considered to indicate haplotype O. At rs8176746, haplotype A was indicated by the presence of the G allele and haplotype B was indicated by the presence of the T allele (Melzer et al., 2008; Wolpin et al., 2010).
Clinical Risk Factors
Risk factors for severe COVID-19 were identified from large epidemiological studies of electronic health records (Williamson et al., 2020; Petrilli et al., 2020) and advice posted on the Centers for Disease Control and Prevention website. Rare monogenic diseases (thalassemia, cystic fibrosis and sickle cell disease) were not considered in these analyses.
Age was classified as 50-59 years, 60-69 year and 70+ years. This was based on the participants’ approximate age at the peak of the first wave of infections (April 2020) and was calculated using the participants’ month and year of birth. Self-reported ethnicity was classified as white and other (including unknown). The Townsend deprivation score at baseline was classified into quintiles defined by the distribution of the score in the UK Biobank as a whole. Body mass index and smoking status were also obtained from the baseline assessment data. Body mass index was inverse transformed and then rescaled by multiplying by 10. Smoking status was defined as current versus past, never or unknown. The other clinical risk factors were extracted from hospital records by selecting records with ICD9 or ICD10 codes for the disease of interest.
Statistical Methods
Logistic regression was used to examine the association of risk factors with severity of COVID-19 disease. To develop the final model, the inventors began with a base model that included SNP score, age group and gender. They then included all of the candidate variables and used step-wise backwards selection to remove variables with p-values of >0.05. The final model was refined by considering the addition of the removed candidate variables one at a time. Model selection was informed by examination of the Akaike information criterion and the Bayesian information criterion, with a decrease of >2 indicating a statistically significant improvement.
Model calibration was assessed using the Pearson-Windmeijer goodness-of-fit test and model discrimination was measured using the area under the receiver operating characteristic curve (AUC). To compare the effect sizes of the variables in the final model, the inventors used the odds per adjusted standard deviation (Hopper, 2015) using dummy variables for age group and ABO blood type. The intercept and beta coefficients from the final model were used to calculate the COVID-19 risk score for all UK Biobank participants.
Stata (version 16.1) (StataCorp LLC: College Station, Texas, USA) was used for analyses; all statistical tests were two-sided, and p-values of less than 0.05 were considered nominally statistically significant.
Results
Of the 1,582 UK Biobank participants with a positive SARS-CoV-2 test result and hospital and SNP data available, 564 (35.7%) were from an outpatient setting and considered not to have severe disease (controls), while 1,018 (64.4%) were from an inpatient setting and considered to have severe disease (cases). Cases ranged in age from 51 to 82 years with a mean of 69.1 (standard deviation [SD] = 8.8) years. Controls ranged in age from 50 to 82 years with a mean of 65.0 (SD = 9.0) years. Mean body mass index was 29.0 kg/m2 (SD = 5.4) for cases and 28.5 (SD = 5.4) for controls. Body mass index was transformed to the inverse multiplied by 10 for all analyses and ranged from 0.2 to 0.6 for both cases and controls. The percentage of risk alleles in the SNP score ranged from 47.6 to 73.8 for cases and from 43.7 to 72.5 for controls. The distributions of the variables of interest for cases and controls and the unadjusted odd ratios and 95% confidence intervals (Cl) are shown in Table 12.
The model selected included SNP score, age group, gender, ethnicity, ABO blood type, and a history of autoimmune disease (rheumatoid arthritis, lupus or psoriasis), haematological cancer, non-haematological cancer, diabetes, hypertension or respiratory disease (excluding asthma) and was a good fit to the data (Windmeijer’s H = 0.02, p = 0.9) (Table 13). The SNP score was strongly associated with severity of disease, increasing risk by 19% per percentage increase in risk alleles. A negative impact of age was only evident in the group aged 70 years and over, and while gender was not statistically significant (p = 0.3), it was retained because it was one of the three variables considered the base model to which other variables were added. Ethnicity showed a 43% increase in risk for non-whites but was only marginally statistically significant (p = 0.06). The AB blood type was protective (p = 0.007), but the protective effect of blood type A and the increased risk for blood type B were not statistically significant (p = 0.1 and p = 0.4, respectively).
The SNP score was, by far, the strongest predictor followed by respiratory disease and age 70 years or older.
The receiver operating characteristic curves for the final model and for alternative models with clinical factors only; SNP score only; and age and gender are shown in Figure 1. The SNP score alone had an AUC of 0.680 (95% Cl = 0.652, 0.708). The model with age and gender had an AUC of 0.635 (95% Cl = 0.607, 0.662), while the model with clinical factors only had an AUC of 0.723 (95% Cl = 0.698, 0.749). Given that the minimum possible value for an AUC is 0.5, the model with clinical factors only was a 65% improvement over the model with age and gender (c2 = 57.97, df = 1, p < 0.001). The combined model had an AUC of 0.786 (95% Cl = 0.763, 0.808) and was an 28% improvement over the model with clinical factors only (c2 = 39.54, df = 1, p < 0.001) and a 111% improvement over the model with age and sex (c2 = 113.67, df = l, p < 0.001).
Figure imgf000117_0001
Figure imgf000118_0001
Figure imgf000119_0001
Figure imgf000120_0001
Figure imgf000121_0001
Figure 2 illustrates the difference in the distributions of the COVID-19 risk scores in cases and controls. The median score was 3.35 for cases and 0.90 for controls. Fifteen per cent of cases and 53% of controls had COVID-19 risk scores of less than 1, and 18% of cases and 25% of controls had scores >1 and <2. COVID-19 risk scores >2 were more common in cases than in controls, with 13% of cases and 9% of controls having scores >2 and <3, 8% of cases and 4% of controls having scores >3 and <4, and 38% of cases and 6% of controls having scores >4.
Figure 3 shows that the distribution of the COVID-19 risk score in the whole UK Biobank is similar to that for the controls in Figure 2b. The median risk score in the whole UK Biobank was 1.32. Thirty-eight per cent of the UK Biobank have COVID- 19 risk scores of less than 1, while 29% have scores >1 and <2, 13% have scores >2 and <3, 6% have scores >3 and <2, and 14% have scores of 4 or over.
Example 6 - Combined genetic and clinical risk assessment - 7 and 10 polymorphism panels
To further improve the method of the invention the inventors downloaded an updated results file on 8 January 2021 from the UK Biobank. Eligible participants were active UK Biobank participants with a positive SARS-CoV-2 test result and who had SNP and hospital data available. Of the 47,990 UK Biobank participants with a SARS-CoV-2 test result available, 8,672 (18.1%) had a positive test result, and of these, 7,621 met the eligibility criteria.
The inventors used source of test result as a proxy for severity of disease, where inpatient results were considered severe disease (cases) and outpatient results were considered non-severe disease (controls). If a participant had more than one test result, they were classified as having severe disease if at least one of their results was from an inpatient setting. Of the 7,621 eligible participants, 2,205 were cases and 5,416 were controls.
The inventors identified a further 40 SNPs from the publicly available (release 4) results of the meta-analysis of non-hospitalised versus hospitalised cases of COVID- 19 conducted by the COVID-19 Host Genetics Initiative consortium (COVID-19 Host Genetics Initiative (2020) and COVID-19 Host Genetics Initiative: results. 2020 accessed January 07, 2020, at www.covidl9hg.org/results). P<0.0001 was used as the threshold for loci selection and variants that were associated with hospitalisation in only one of the five studies included in the meta-analysis were removed. Variants that had a minor allele frequency of <0.01 and beta coefficients from -1 to 1 were then discarded (Dayem et al., 2018). Linkage disequilibrium pruning was performed using an r2 threshold of 0.5 against the 1000 Genomes European populations (CEU, TSI, FIN, GBR, IBS) representing the ethnicities of the submitted populations (Machiela et al., 2015). Where possible, SNP variants were chosen over insertion-deletion variants to facilitate laboratory validation testing. A further 12 SNPs were identified from publicly available meta-analysis of Covid-19 data (Pairo-Castineira et al., 2020).
The above identified SNPs were combined with the 64 identified in our original study to provide a test SNP panel of 116 SNPs.
To develop a new model to predict risk of severe COVID-19, the inventors used all of the available data and randomly divided it into a 70% training dataset and a 30% validation dataset (ensuring that it was balanced for origin of test result). Because the missing data is assumed to be missing at random (if not missing completely at random), a multiple imputation with 20 imputations was used to address the missing data for body mass index (linear regression) and the SNP data (predictive mean matching) for the development of the new model in the training dataset. To more closely reflect the availability of data in the real world, the inventors did not use imputed data in the validation dataset.
The clinical variables considered for inclusion in the new model were age, sex, BMI, ethnicity, ABO blood type and the following chronic health conditions: asthma, autoimmune disease (rheumatoid arthritis, lupus or psoriasis), haematological cancer, non-haematological cancer, cerebrovascular disease, diabetes, heart disease, hypertension, immunocompromised, kidney disease, liver disease and respiratory disease (excluding asthma). Dummy variables were used for the categorical classifications of age and ABO blood type.
The SNPs selected for the development of the new model came from three sources: (i) from Tables 2 to 4, (ii) the 40 SNPs newly selected from the (release 4) results of the COVID-19 Host Genetics Initiative meta-analysis of non-hospitalised versus hospitalised cases of COVID-191 2 and (iii) the 12 SNPs from the paper by Pairo-Castineira et al. (2020). The inventors used unadjusted logistic regression in the testing dataset to identify SNPS that were associated with risk of severe COVID-19 with P<0.05 (see Table 14).
Stata (version 16.1) was used for analyses; all statistical tests were two-sided and P<0.05 was considered nominally statistically significant. Table 14 - Informative polymorphisms assessed in Example 6.
Position Reference Effect
Chr SNP (GRCh37) Allele Frequency Allele Frequency OR 95% Cl P
1 rs10873821 87628173 C 0.75 T 0.25 0.92 0.84, 1.02 0.10
1 rs1 l2317747 239197542 T 0.97 C 0.03 1.26 1.00, 1.58 0.05
1 rs1 l5492982 150271556 G 1.00 A 0.00 2.46 1.23, 4.91 0.01
1 rs12083278 31624029 G 0.29 C 0.71 1.04 0.95, 1.15 0.40
1 rs12745140 2998313 G 0.91 A 0.09 0.90 0.77, 1.06 0.20
1 rs17102023 46618634 A 1.00 G 0.00 1.33 0.63, 2.81 0.50
1 rs2224986 152684866 C 0.91 T 0.09 0.98 0.85, 1.14 0.80
1 rs2274122 36549664 G 0.20 A 0.80 0.97 0.88, 1.07 0.50
1 rs2765013 36374101 C 0.91 T 0.09 1.01 0.96, 1.26 0.20
1 rs74508649 192526317 C 1.00 T 0.00 1.04 0.47, 2.32 0.90
2 rs183569214 79895332 G 1.00 A 0.00 0.72 0.15, 3.45 0.70
2 rs2034831 182353446 A 0.94 C 0.06 1.22 1.03, 1.46 0.02
2 rs2270360 217524986 A 0.74 C 0.26 0.94 0.85, 1.04 0.20
2 rs6714112 36905013 C 0.86 A 0.14 1.02 0.90, 1.16 0.70
2 rs77764981 80029580 T 1.00 C 0.00 1.29 0.54, 3.10 0.60
3 rs10510749 46180416 C 0.91 T 0.09 0.99 0.85, 1.15 0.90
3 rs1 l385942 45876459 G 0.92 GA 0.08 1.16 1.00, 1.34 0.05
3 rs1 l5102354 46222037 A 0.95 G 0.05 0.96 0.79, 1.16 0.70
3 rs12639224 45916222 C 0.73 T 0.27 1.02 0.93, 1.12 0.70
3 rs13062942 62936766 A 0.64 G 0.36 0.92 0.84, 1.01 0.09
3 rs13433997 46049765 T 0.88 C 0.12 1.10 0.97, 1.24 0.10
3 rs1504061 1093795 C 0.95 G 0.05 1.13 0.94, 1.36 0.20
3 rs1705826 3184653 c 0.63 G 0.37 1.03 0.94, 1.12 0.50
3 rs17317135 27188298 G 0.95 A 0.05 0.89 0.73, 1.09 0.30
3 rs1868132 125837737 C 0.90 T 0.10 1.02 0.89, 1.17 0.80
3 rs34901975 45916786 G 0.89 A 0.11 1.12 0.98, 1.27 0.09
3 rs35652899 45908514 C 0.93 G 0.07 1.17 1.00, 1.36 0.04
3 rs35896106 45841938 C 0.92 T 0.08 1.17 1.01, 1.35 0.04
3 rs6440031 141408691 A 0.08 G 0.92 0.94 0.80, 1.11 0.50
3 rs71325088 45862952 T 0.92 C 0.08 1.15 0.99, 1.33 0.07
3 rs71615437 46018781 A 0.92 G 0.08 1.12 0.97, 1.29 0.10
3 rs73064425 45901089 C 0.92 T 0.08 1.15 0.99, 1.33 0.07
3 rs76374459 45900634 G 0.94 C 0.06 1.20 1.02, 1.41 0.03
3 rs76488148 148718087 G 0.96 T 0.04 1.25 1.02, 1.52 0.03
4 rs1 l2641600 112613026 C 0.89 T 0.11 0.83 0.72, 0.96 0.01
4 rs1 l5162070 69705994 G 0.93 A 0.07 0.90 0.75, 1.07 0.20
4 rs1 l729561 106943200 T 0.92 C 0.08 0.96 0.82, 1.12 0.60
4 rs35540967 44418592 T 0.93 C 0.07 1.02 0.87, 1.19 0.80
4 rs3774881 5821877 T 0.84 C 0.16 0.91 0.81, 1.02 0.10
4 rs3774882 5821922 c 0.92 G 0.08 0.90 0.77, 1.06 0.20
4 rs6810404 27383278 c 0.51 A 0.49 0.97 0.89, 1.05 0.50
5 rs10039856 142252549 c 0.90 T 0.10 1.10 0.96, 1.26 0.20
5 rs1 ll265173 171480160 c 1.00 T 0.00 0.97 0.35, 2.66 1.00
5 rs1 l3791144 180237828 c 0.93 T 0.07 0.97 0.82, 1.15 0.70
5 rs2220543 173989338 T 0.71 A 0.29 1.04 0.94, 1.14 0.50
5 rs4240376 123950404 G 0.80 T 0.20 0.99 0.89, 1.10 0.80 rs4478338 169590905 T 0.92 G 0.08 1.08 0.93, 1.25 0.30 rs62377777 122832716 T 0.79 C 0.21 0.96 0.87, 1.07 0.50 rs10755709 12216966 A 0.70 G 0.30 1.11 1.01, 1.21 0.03 rs140247774 18015447 C 0.93 T 0.07 0.93 0.78, 1.10 0.40 rs143334143 31121426 G 0.93 A 0.07 1.00 0.85, 1.18 1.00 rs16873740 45704813 T 0.88 A 0.12 1.16 1.03, 1.32 0.02 rs3131294 32180146 A 0.13 G 0.87 1.00 0.88, 1.13 1.00 rs61611950 27604726 C 0.99 T 0.01 0.92 0.56, 1.51 0.80 rs6933436 6925195 A 0.71 C 0.29 1.01 0.92, 1.11 0.90 rs9380142 29798794 G 0.30 A 0.70 1.08 0.99, 1.19 0.09 rs9386484 106326754 T 0.76 A 0.24 0.95 0.85, 1.05 0.30 rs6967210 152960930 T 0.99 C 0.01 1.17 0.86, 1.59 0.30 rs10808999 38821327 A 0.13 G 0.87 1.01 0.89, 1.14 0.90 rs1 l779911 40181978 C 0.67 A 0.33 0.99 0.90, 1.09 0.90 rs1 l8072448 16790149 T 0.92 C 0.08 0.82 0.70, 0.97 0.02 rs13282163 38897470 A 0.92 C 0.08 0.93 0.80, 1.09 0.40 rs2010843 74268198 T 0.47 C 0.53 1.04 0.96, 1.13 0.40 rs332040 8730488 G 0.53 A 0.47 1.00 0.92, 1.09 0.90 rs12236000 21131627 G 0.92 C 0.08 0.95 0.81, 1.11 0.50 rs3895472 4329170 T 0.08 C 0.92 1.04 0.88, 1.22 0.70 rs657152 136139265 C 0.63 A 0.37 0.95 0.87, 1.03 0.20 rs7027911 81158113 G 0.57 A 0.43 1.11 1.01, 1.21 0.02 rs71480372 27121456 A 0.66 T 0.34 0.98 0.90, 1.08 0.70 rs74790577 29688719 A 1.00 T 0.00 1.05 0.27, 4.03 0.90 rs10793436 44015051 G 0.68 T 0.32 0.95 0.86, 1.04 0.20 rs1441121 54100345
Figure imgf000125_0001
0.57 A 0.43 0.95 0.87, 1.03 0.20 rs1892429 37454397
Figure imgf000125_0002
0.84 G 0.16 0.99 0.88, 1.11 0.80 rs2091431 37277870
Figure imgf000125_0003
0.28 G 0.72 1.03 0.94, 1.14 0.50 rs5016035 123000638
Figure imgf000125_0004
0.51 G 0.49 1.00 0.91, 1.10 0.90 rs71481792 9030308
Figure imgf000125_0005
0.38 T 0.62 0.89 0.82, 0.97 0.01 rs10766439 2893867 A 0.37 G 0.63 0.97 0.89, 1.05 0.40 rs10735079 113380008 G 0.36 A 0.64 0.98 0.90, 1.07 0.60 rs1 l613792 8760610 A 0.85 G 0.15 1.01 0.88, 1.14 0.90 rs12823094 106624953 T 0.76 A 0.24 1.08 0.98, 1.19 0.10 rs6489867 113363550 C 0.36 T 0.64 0.98 0.90, 1.07 0.70 rs7397549 56084466 T 0.59 C 0.41 0.99 0.90, 1.09 0.90 rs12871414 74558505 c 0.74 T 0.26 0.95 0.86, 1.05 0.30 rs1984162 23658838 A 0.75 G 0.25 1.10 1.00, 1.21 0.05 rs2649134 63178476 C 0.97 T 0.03 0.93 0.72, 1.19 0.50 rs12587980 72934229 C 0.63 T 0.37 1.03 0.95, 1.13 0.40 rs144114696 77692036 G 1.00 A 0.00 2.53 0.51,12.44 0.30 rs2238187 72908102 A 0.65 G 0.35 1.07 0.97, 1.17 0.20 rs12593288 33908103 C 0.80 T 0.20 0.91 0.82, 1.01 0.08 rs2229117 33916053 G 0.86 C 0.14 0.90 0.80, 1.02 0.10 rs74750712 48984345 T 1.00 G 0.00 1.33 0.65, 2.69 0.40 rs77055952 45858905 A 0.95 G 0.05 1.07 0.88, 1.29 0.50 rs145643452 49311043 G 0.99 A 0.01 1.03 0.61, 1.74 0.90 rs72779789 10579876 G 0.95 C 0.05 1.04 0.85, 1.26 0.70 rs72803978 78624025 A 0.94 G 0.06 0.88 0.74, 1.05 0.20 rs178840 29737612 G 0.75 A 0.25 0.93 0.84, 1.03 0.20 rs34761447 9170408 C 0.90 T 0.10 1.02 0.89, 1.18 0.80 rs9890316 80443309 G 0.69 A 0.31 1.01 0.92, 1.10 0.90 rs12958013 67208392 T 0.86 C 0.14 1.08 0.96, 1.22 0.20 rs142257532 30006171 T 0.97 C 0.03 1.01 0.78, 1.30 1.00 rs10411226 53333975 G 0.25 A 0.75 1.04 0.94, 1.16 0.40 rs1 l085727 10466123 C 0.72 T 0.28 1.06 0.96, 1.16 0.20 rs2109069 4719443 G 0.68 A 0.32 1.01 0.92, 1.10 0.80 rs60744406 44492164 A 0.41 G 0.59 1.02 0.94, 1.11 0.60 rs74956615 10427721 T 0.95 A 0.05 1.05 0.87, 1.27 0.60 rs8105499 32023957 C 0.70 A 0.30 0.98 0.90, 1.08 0.70 rs56259900 39389409 A 1.00 G 0.00 1.15 0.65, 2.04 0.60 rs76253189 60473717 C 0.99 G 0.01 1.01 0.72, 1.42 1.00 rs13050728 34615210 C 0.68 T 0.32 1.08 0.99, 1.18 0.10 rs2236757 34624917 G 0.70 A 0.30 1.06 0.97, 1.16 0.20 rs2252109 43080428 A 0.48 T 0.52 0.98 0.90, 1.07 0.70 rs75994231 44424444 C 0.98 T 0.02 1.06 0.79, 1.43 0.70 rs1 l090305 24407483 T 0.80 C 0.20 1.06 0.96, 1.18 0.20 rs5757427 22564734 T 0.65 A 0.35 0.96 0.88, 1.05 0.40 rs62220604 49677464 G 0.73 A 0.27 0.97 0.88, 1.07 0.50 rs7290963 22724951 G 0.55 T 0.45 1.00 0.92, 1.09 1.00
Development of New Model
The inventors used multivariable logistic regression in the multiple imputation training dataset to develop the new model to predict risk of severe COVID-19. The inventors began with a model that included all the clinical variables and the SNPs with unadjusted associations with severe COVID-19 and used backwards stepwise selection to develop the most parsimonious model. For the removed variables a final determination was made on their inclusion or exclusion by adding them one at a time to the parsimonious model. To directly compare the effect sizes of the variables in the final model, regardless of the scale on which they were measured, the odds per adjusted standard deviation was used. The intercept and beta coefficients from the new model to calculate the COVID-19 risk score was used for all eligible UK Biobank participants.
Model Performance The inventors assessed the performance of the new model in the imputed development dataset and in the non-imputed validation dataset. The association between the risk score and severe COVID-19 was assessed using logistic regression to estimate the odds ratio per quintile of risk score. It was assessed model discrimination using the area under the receiver operating characteristic curve (AUC). For models that showed good discrimination, calibration was assessed using logistic regression of the log of the risk score to estimate the intercept and the slope (beta coefficient). An intercept close to 0 indicated good calibration, while an intercept less than 0 indicated overall overestimation of risk and an intercept greater than 0 indicated overall underestimation of risk. A slope of close to 1 indicated good dispersion with a slope of less than 1 indicating over-dispersion and slope of greater than 1 indicating underdispersion.
The best performing tests are detailed below.
Risk Models Three models were developed for assessing the risk of a human subject developing a severe response to a Coronavirus infection. In particular, the methods can be used to determine the probability the subject would require hospitalisation if infected with a Coronavirus. The first model is based solely on sex and age (referred to herein as the “age and sex model”), the second model (referred to herein as the “full model”) includes numerous clinical factors and genetic factors, whereas the third model (referred to herein as the “expanded model”) includes additional clinical factors and genetic factors to those in the full model.
Age and Sex Model
5 Inputs of the age and sex model are provided in Table 15 and the b-coefficients provided in Table 16.
Table 15 - Age and Sex Model Product Inputs
Figure imgf000128_0001
10
Table 16 - Age and Sex Model Risk Factors
Figure imgf000128_0002
The long odds is calculated using: Log odds (LO) = -1.749562 + ∑ Clinical β 15 coefficients.
The age and sex relative risk = eLO.
Age and sex probability = eLO/(1+eLO).
If any of the clinical factors are unknown, or the subject is unwilling to supply the relevant details, that factor(s) is assigned a β coefficient of 0.
20
Full Model
Inputs of the full model are provided in Table 17 and the β-coefficients provided in Tables 18 and 19.
25 Table 17 - Full Model Product Inputs
Figure imgf000129_0002
Table 18 - Full Model Clinical Risk Factors
5
Figure imgf000129_0001
Figure imgf000130_0001
Table 19 - Full Model SNP Risk Alleles
Figure imgf000130_0002
5 The SNP risk factor (SRF) is determined using: (SRF) = ∑ (No of Risk Alleles x
SNP β coefficient).
The long odds is calculated using: Log odds (LO) = -1.36523 + SRF + ∑ Clinical β coefficients.
The age and sex relative risk = eLO.
Substitute Sheet (Rule 26) RO/AU Age and sex probability = eLO/(1+eLO).
If any of the clinical factors are unknown, or the subject is unwilling to supply the relevant details, that factor(s) is assigned a β coefficient of 0.
5 Expanded Model
Inputs of the expanded model are provided in Table 20 and the β-coefficients provided in Tables 21 and 22.
Table 20 - Expanded Model Product Inputs
10
Figure imgf000131_0001
Figure imgf000132_0002
Table 21 - Expanded Model Clinical and SNP Risk Factors
Figure imgf000132_0001
Substitute Sheet (Rule 26) RO/AU
Figure imgf000133_0001
Table 22 - Expanded Model SNP Risk Alleles
Figure imgf000133_0002
5 The SNP risk factor (SRF) is determined using: (SRF) = ∑ (No of Risk Alleles x SNP β coefficient).
The long odds is calculated using: Log odds (LO) = -1.469939 + SRF + ∑ Clinical β coefficients.
The age and sex relative risk = eLO.
10 Age and sex probability = eLO/( 1 +eLO) .
If any of the clinical factors are unknown, or the subject is unwilling to supply the relevant details, that factor(s) is assigned a co βefficient of 0.
Summary
15 In terms of discrimination between cases and controls, the age and sex model had an AUC of 0.671 (95% 0=0.646, 0.696) but the full model with an AUC of 0.732 (95% 0=0.708, 0.756) was a substantial improvement (c2=41.23, df=l, P<0.001). The receiver operating characteristic curves for both models are shown in Figure 4. The models were well calibrated with no evidence of overall overestimation or underestimation for the age and sex model (a=-0.02; 95% CI=-0.18, 0.13; P=0.7) or the full model (a=-0.08; 95% CI=-0.21, 0.05; P=0.3). There was also no evidence of under or over dispersion for the age and sex model (b=0.96, 95% 0=0.81, 1.10, P=0.6) and for the full model (b=0.90, 95% 0=0.80, 1.00, P=0.06). Calibration plots for both models are shown in Figure 5.
The inventors calculated the probability of severe COVID-19 for all UK Biobank participants who met our eligibility criteria for this study; the distributions are shown in Figure 6. Using the age and sex model, the mean probability was 0.32 (SD=0.13) and ranged from a minimum of 0.15 to a maximum of 0.56. Using the full model, the mean probability was 0.27 (SD=0.16) and the range was from 0.04 to 0.98, a much wider range than for the age and sex model.
The expanded model provided a slight improvement in discrimination in this dataset (Table 23).
Table 23 - Test Performances.
Figure imgf000134_0001
Example 7 - Combined genetic and clinical risk assessment - under 50 years of age
The algorithm to calculate the risk of developing severe Covid-19 has been modified to enable a risk calculation to be provided for patients aged 18-85 years (previously 50-85 years). More specifically, the look-up tables providing the age- related risk values have been modified to include three additional values for the following age ranges: 18-29, 30-39, 40-49 (Tables 24).
For people aged under 50 years, the probability of severe disease is adjusted using data on risk of hospitalization due to Covid-19 which were obtained from the United States Centers for Disease Control and Prevention (https://www.cdc.gov/coronavirus/2019-ncov/covid-data/covidview/index.html). The SNPs analysed, and the methods used for analysis, are the same as used in
Example 6. Table 24 - Test Performances
Figure imgf000135_0001
The present application claims priority from AU 2020901739 filed 27 May 2020, AU 2020902052 filed 19 June 2020, AU 2020903536 filed 30 September 2020, and AU 2021900392 filed 17 February 2021, the entire contents of each of which are incorporated herein by reference.
It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly
Substitute Sheet (Rule 26) RO/AU described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
All publications discussed and/or referenced herein are incorporated herein in their entirety. Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
REFERENCES
Adessi et al. (2000) Nucl. Acids Res. 28, E87.
Bennett et al. (2005) Pharmacogenomics 6: 373- 382.
Brenner et al. (2000) Nat. Biotechnol. 18:630-634.
Centres for Disease Control and Prevention. (2020) COVIDView: a weekly surveillance summary of U.S. COVID-19 activity. Available from https://www.cdc.gov/coronavirus/2019-ncov/covid-data/pdf/covidview-08-07-2020.pdf (accessed 14 August 2020).
Chee et al. (1996) Science 274:610-614.
COVID-19 Host Genetics Initiative. (2020) Eur J Hum Genet 28:715-718.
Dayem et al. (2018) Nucl. Acids Res. 46:W109-W113.
Devlin and Risch (1995) Genomics. 29: 311-322.
Ellinghaus et al. (2020) N. Engl. J. Med. doi: 10.1056/NEJMoa2020283.
Fodor (1997a) FASEB Journal 1 EA879.
Fodor (1997b) Science 277: 393-395.
Hard et al. (1981) A Primer of Population Genetics Washington University, Saint Louis.
Hopper (2015) J. Epidemiol. 182:863-867.
Katella (2021) Yale Medicine, 13 May 2021 (www.yalemedicine.org/news/covid-19- vaccine-comparison) .
Lockhart (1998) Nature Medicine 4: 1235-1236.
Lynch and Walsh (1998) Genetics and Analysis of Quantitative Traits, Sinauer Associates, Inc. Sunderland Mass. ISBN 0-87893-481-2.
Machiela et al. (2015) Bioinformatics 31:3555-3557.
MacLean et al. (2009) Nature Rev. Microbiol, 7:287-296.
Margulies et al. (2005) Nature 437: 376-380.
Mealiffe et al. (2010) J. Natl. Cancer Inst. 102: 1618-1627.
Melzer et al. (2008) PLoS Genect. 4:el000072.
Mitra et al. (2003) Analytical Biochemistry 320:55-65.
Morozova & Marra (2008) Genomics 92:255.
Pairo-Castineira et al. (2020) Nature https://doi.org/10.1038/s41586-020-03065-y. Petnlli et al. (2020) BMJ 369:ml966. doi: 10.1136/bmj.ml966.
Sapolsky et al. (1999) Genet Anal: Biomolec Engin 14: 187-192.
Shendure et al. (2005) Science 309: 1728- 1732.
Slatkin and Excoffier (1996) Heredity 76: 377-383. Voelkerding et al. (2009) Clinical Chem. 55: 641-658. Williamson et al. (2020) Nature 584:430436.
Wolpin et al. (2010) Cancer Res. 70:1015-1023.
SEQUENCE LISTING <110> Genetic Technologies Ltd
<120> METHODS OF ASSESSING RISK OF DEVELOPING A SEVERE RESPONSE TO CORONAVIRUS INFECTION
<130> 532228PCT
<150> AU 2020901739 <151> 2020-05-27
<150> AU 2020902052 <151> 2020-06-19
<150> AU 2020903536 <151> 2020-09-30
<150> AU 2021900392 <151> 2021-02-17
<160> 18
<170> Patentln version 3.5
<210> 1 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 1 acctggtatc agtgaagagg atcag 25
<210> 2 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 2 tcttgataca actgtaagaa gtggt 25
<210> 3
Substitute Sheet (Rule 26) RO/AU <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 3 tatttctttg ttgccctcta tctct 25
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 4 gaaagagatg ggttggcatt attat 25
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 5 taaaattaga actggagggc tgggt 25
<210> 6 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 6 tggcattata aacactcact gaagt 25
<210> 7
<211> 25
<212> DNA
Substitute Sheet (Rule 26) RO/AU <213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 7 aatgccatct gatgagagaa gtttt 25
<210> 8 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 8 tacagtttta aaaatgggcg tttct 25
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 9 tataataaca cgtggaagtg aaaat 25
<210> 10 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 10 ttgtttgtat gtgtgaaatg attct 25
<210> 11 <211> 25
<212> DNA
<213> Artificial Sequence
Substitute Sheet (Rule 26) RO/AU <220>
<223> Oligonucleotide primer <400> 11 aagcaaacta ttcttcagga atcca 25
<210> 12 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 12 atttctgcat ttcactttgt gtggt 25
<210> 13
<211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 13 gtaaatgctg ctaacagagc tcttt 25
<210> 14
<211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 14 gaagagagtt tattagcaag gcctc 25
<210> 15
<211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer
Substitute Sheet (Rule 26) RO/AU <400> 15 catttgggaa aagccactga atgga 25
<210> 16 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 16 agattgacta gccgttgaga gtaga 25
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 17 actgactcct gacactcttg aagcg 25
<210> 18 <211> 25
<212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 18 gactcttctc tggcatcttc tcatg 25
Substitute Sheet (Rule 26) RO/AU

Claims

1. A method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a genetic risk assessment of the human subject, wherein the genetic risk assessment involves detecting, in a biological sample derived from the human subject, the presence at least two polymorphisms associated with a severe response to a Coronavirus infection
2. The method of claim 1 which comprises detecting the presence of at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300 or at least 306 polymorphisms associated with a severe response to a Coronavirus infection.
3. The method of claim 1 or claim 2, wherein the polymorphisms are selected from in any one of Tables 1 to 6, 8, 19 or 22 or a polymorphism in linkage disequilibrium with one or more thereof.
4. The method according to any one of claims 1 to 3 which at least comprises detecting polymorphisms at one or more or all of rs10755709, rs112317747, rs112641600, rs118072448, rs2034831, rs7027911 and rs71481792, or a polymorphism in linkage disequilibrium with one or more thereof.
5. The method according to any one of claims 1 to 3 which at least comprises detecting polymorphisms at one or more or all of rs10755709, rs112317747, rs112641600, rs115492982, rs118072448, rs1984162, rs2034831, rs7027911 and rs71481792, or a polymorphism in linkage disequilibrium with one or more thereof.
6. The method of claim 1 or claim 2, wherein the polymorphisms are selected from Table 1 and/or Table 6 or a polymorphism in linkage disequilibrium with one or more thereof.
7. The method of claim 1 or claim 2, wherein the polymorphisms are selected from Table 4 or a polymorphism in linkage disequilibrium with one or more thereof.
Substitute Sheet (Rule 26) RO/AU
8. The method of claim 7, wherein the method comprises, or consists of, detecting the presence of at least 60, or each, of the polymorphisms provided in Table 4 or a polymorphism in linkage disequilibrium with one or more thereof.
9. The method of claim 1 or claim 2, wherein the polymorphisms are selected from Table 2 or a polymorphism in linkage disequilibrium with one or more thereof.
10. The method of claim 1 or claim 2, wherein the polymorphisms are selected from Table 3 and/or Table 8 or a polymorphism in linkage disequilibrium with one or more thereof.
11. The method of claim 1 or claim 2, wherein the polymorphisms are selected from Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
12. The method of claim 1 1 which comprises detecting the presence of each of the polymorphisms provided in Table 3 or a polymorphism in linkage disequilibrium with one or more thereof.
13. The method according to any one of claims 1 to 12 which further comprises performing a clinical risk assessment of the human subject; and combining the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
14. The method of claim 13, wherein the clinical risk assessment includes obtaining information from the subject on one or more or all of: age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, does the human have or has had a respiratory disease (other than asthma), and does the human have or has had an autoimmune disease.
Substitute Sheet (Rule 26) RO/AU
15. The method according to any one of claims 1 to 14, wherein combining the clinical risk assessment and the genetic risk assessment comprises adding or multiplying the risk assessments.
16. A method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising detecting, in a biological sample derived from the human subject, the presence of a polymorphism provided in any one of Tables 1 to 6, 8, 19 or 22, or a polymorphism in linkage disequilibrium therewith.
17. The method of claim 16, wherein the polymorphism is provided in Table 19 and/or 22 or is a polymorphism in linkage disequilibrium therewith.
18. The method of claim 16, wherein the polymorphism is provided in Table 3, Table 6, is rs2274122, is rs1868132, is rs11729561, is rs1984162, is rs8105499 or is a polymorphism in linkage disequilibrium therewith.
19. The method of claim 146 wherein the polymorphism is provided in Table 3, is rs2274122, is rs1868132, is rs11729561, is rs1984162, is rs8105499 or is a polymorphism in linkage disequilibrium therewith.
20. A method of determining the identity of the alleles of fewer than 100,000 polymorphisms in a human subject selected from the group of subjects consisting of humans in need of assessment for the risk of developing a severe response to a Coronavirus infection to produce a polymorphic profile of the subject, comprising
(i) selecting for allelic identity analysis at least two polymorphisms provided in any one of Tables 1 to 6, 8, 19 or 22, or a poly morphism in linkage disequilibrium with one or more thereof,
(ii) detecting, in a biological sample derived from the human subject, the polymorphisms, and
(iii) producing the polymorphic profile of the subject screening based on the identity of the alleles analysed in step (ii), wherein fewer than 100,000 polymorphisms are selected for allelic identity analysis in step (i) and the same fewer than 100,000 polymorphisms are analysed in step (ii).
21. The method according to any one of claims 1 to 20, wherein the polymorphism(s) in linkage disequilibrium has a linkage disequilibrium above 0.9.
Substitute Sheet (Rule 26) RO/AU
22. The method according to any one of claims 1 to 21, wherein the polymorphism(s) in linkage disequilibrium has a linkage disequilibrium of 1.
23. A method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject on two, three, four, five or more or all of age, gender, race/ethnicity, height, weight, blood type, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had an autoimmune disease, does the human have or has had an haematological cancer, does the human have or has had an immunocompromised disease, does the human have or has had an non-haematological cancer, does the human have or has had diabetes, does the human have or has had liver disease, does the human have or has had hypertension and does the human have or has had a respiratory disease (other than asthma).
24. The method of claim 23 which comprises obtaining information from the subject on age and gender.
25. The method of claim 23 which comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
26. The method of claim 23 which comprises obtaining information from the subject on age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human
Substitute Sheet (Rule 26) RO/AU have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma).
27. A method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising i) performing a genetic risk assessment of the human subject, wherein the genetic risk assessment involves detecting, in a biological sample derived from the human subject, polymorphisms at rs10755709, rs112317747, rs112641600, rs 11 B072448, rs2034831 , rs7027911 and rs71481792, ii) performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject on age, gender, race/ethnicity, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, does the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma), and iii) combining the genetic risk assessment with the clinical risk assessment to determine the risk of a human subject developing a severe response to a Coronavirus infection.
28. The method of claim 27, wherein a) a β coefficient of 0.124239 is assigned for each G allele at rs10755709; b) a β coefficient of 0.2737487 is assigned for each C allele at rs112317747; c) a β coefficient of -0.2362513 is assigned for each T allele at rs112641600; d) a β coefficient of -0.1995879 is assigned for each C allele at rs118072448; e) a β coefficient of 0.2371955 is assigned for each C allele at rs2034831; f) a β coefficient of 0.1019074 is assigned for each A allele at rs7027911; and g) a β coefficient of -0.1058025 is assigned for each T allele at rs71481792.
29. The method of claim 27 or claim 28, wherein the subject is between 50 and 84 years of age and a) a β coefficient of 0.5747727 is assigned if the subject is between 70 and 74 years of age; b) a β coefficient of 0.8243711 is assigned if the subject is between 75 and 79 years of age;
Substitute Sheet (Rule 26) RO/AU c) a β coefficient of 1.013973 is assigned if the subject is between 80 and 84 years of age; d) a β coefficient of 0.2444891 is assigned if the subject is male; e) a β coefficient of 0.29311 is assigned if the subject is an ethnicity other than Caucasian; f) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1.602056 to provide the β coefficient to be assigned; g) a β coefficient of 0.4041337 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; h) a β coefficient of 0.6938494 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; i) a β coefficient of 0.4297612 is assigned if the subject has ever been diagnosed as having diabetes; j) a β coefficient of 1 .003877 is assigned if the subject has ever been diagnosed as having haematological cancer; k) a β coefficient of 0.2922307 is assigned if the subject has ever been diagnosed as having hypertension; l) a β coefficient of 0.2558464 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; and m) a β coefficient of 1.173753 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma).
30. The method of claim 27 or claim 28, wherein the subject is between 18 and 84 years of age and a) a β coefficient of -1.3111 is assigned if the subject is between 18 and 29 years of age, b) a β coefficient of -0.8348 is assigned if the subject is between 30 and 39 years of age; c) a β coefficient of -0.4038 is assigned if the subject is between 40 and 49 years of age; d) a β coefficient of 0.5747727 is assigned if the subject is between 70 and 74 years of age; e) a β coefficient of 0.8243711 is assigned if the subject is between 75 and 79 years of age;
Substitute Sheet (Rule 26) RO/AU f) a β coefficient of 1.013973 is assigned if the subject is between 80 and 84 years of age; g) a β coefficient of 0.2444891 is assigned if the subject is male; h) a β coefficient of 0.29311 is assigned if the subject is an ethnicity other than Caucasian; i) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1.602056 to provide the β coefficient to be assigned; j) a β coefficient of 0.4041337 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; k) a β coefficient of 0.6938494 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; l) a β coefficient of 0.4297612 is assigned if the subject has ever been diagnosed as having diabetes; m) a β coefficient of 1.003877 is assigned if the subject has ever been diagnosed as having haematological cancer; n) a β coefficient of 0.2922307 is assigned if the subject has ever been diagnosed as having hypertension; o) a β coefficient of 0.2558464 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; and p) a β coefficient of 1 173753 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma).
31. The method according to any one of claims 27 to 30, wherein in step iii) the genetic risk assessment is combined with the clinical risk assessment using the following formula:
Long Odds (LO) = -1.36523 + SRF + ∑ Clinical co βefficients, and wherein SRF is the SNP Risk Factor which is determined using the following formula: ∑ (No of Risk Alleles x SNP β coefficient).
32. A method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method comprising i) performing a genetic risk assessment of the human subject, wherein the genetic risk assessment involves detecting, in a biological sample derived from the
Substitute Sheet (Rule 26) RO/AU human subject, polymorphisms at rs10755709, rs112317747, rs112641600, rs115492982, rs118072448, rs1984162, rs2034831, rs7027911 and rs71481792, ii) performing a clinical risk assessment of the human subject, wherein the clinical risk assessment comprises obtaining information from the subject of age, gender, race/ethnicity, blood type, height, weight, does the human have or has had an cerebrovascular disease, does the human have or has had a chronic kidney disease, does the human have or has had diabetes, docs the human have or has had an haematological cancer, does the human have or has had hypertension, does the human have or has had an immunocompromised disease, does the human have or has had an haematological cancer, does the human have or has had liver disease, does the human have or has had an non-haematological cancer, and does the human have or has had a respiratory disease (other than asthma), and iii) combining the genetic risk assessment with the clinical risk assessment to determine the risk of a human subject developing a severe response to a Coronaviais infection.
33. The method of claim 32, wherein a) a β coefficient of 0.1231766 is assigned for each G allele at rs10755709; b) a β coefficient of 0.2576692 is assigned for each C allele at rs112317747; c) a β coefficient of -0.2384001 is assigned for each T allele at rs112641600; d) a β coefficient of -0.1965609 is assigned for each C allele at rs118072448; e) a β coefficient of 0.2414792 is assigned for each C allele at rs2034831; f) a β coefficient of 0.0998459 is assigned for each A allele at rs7027911; g) a β coefficient of -0.1032044 is assigned for each T allele at rs71481792; h) a β coefficient of 0.4163575 is assigned for each A allele at rs115492982; and i) a β coefficient of 0.1034362 is assigned for each A allele at rs1984162.
34. The method of claim 32 or claim 33, wherein the subject is between 50 and 84 years of age and a) a β coefficient of 0.1677566 is assigned if the subject is between 65 and 69 years of age; b) a β coefficient of 0.6352682 is assigned if the subject is between 70 and 74 years of age; c) a β coefficient of 0.8940548 is assigned if the subject is between 75 and 79 years of age;
Substitute Sheet (Rule 26) RO/AU d) a β coefficient of 1.082477 is assigned if the subject is between 80 and 84 years of age; e) a β coefficient of 0.2418454 is assigned if the subject is male; f) a β coefficient of 0.2967777 is assigned if the subject is an ethnicity other than Caucasian; g) the subjects height (in metres (m)) and weight (in kilograms (kg)) is applied to the formula: (10 times m2) divided by kg, which is multiplied by -1. 560943 to provide the β coefficient to be assigned; h) a β coefficient of 0.3950113 is assigned if the subject has ever been diagnosed as having a cerebrovascular disease; i) a β coefficient of 0.6650257 is assigned if the subject has ever been diagnosed as having a chronic kidney disease; j) a β coefficient of 0.4126633 is assigned if the subject has ever been diagnosed as having diabetes; k) a β coefficient of 1 .001079 is assigned if the subject has ever been diagnosed as having haematological cancer; l) a β coefficient of 0.2640989 is assigned if the subject has ever been diagnosed as having hypertension; m) a β coefficient of 0.2381579 is assigned if the subject has ever been diagnosed as having a non-haematological cancer; n) a β coefficient of 1 .148496 is assigned if the subject has ever been diagnosed as having a respiratory disease (other than asthma); o) a β coefficient of -0.229737 is assigned if the subject has an ABO blood type; p) a β coefficient of 0.6033541 is assigned if the subject has ever been diagnosed as having a immunocompromised disease; q) a β coefficient of 0.2301902 is assigned if the subject has ever been diagnosed as having liver disease.
35. The method according to any one of claims 32 to 34, wherein in step iii) the genetic risk assessment is combined with the clinical risk assessment using the following formula:
Long Odds (LO) = 1.469939 + SRF + ∑ Clinical β coefficients, and wherein SRF is the SNP Risk Factor which is determined using the following formula: ∑ (No of Risk Alleles x SNP β coefficient).
Substitute Sheet (Rule 26) RO/AU
36. The method according to any one of claims 27 to 35 which further comprises determining the probability the subject would require hospitalisation if infected with a Coronavirus using the following formula: eLO/(1+eLO), which is then multiplied by 100 to obtain a percent chance of hospitalisation being required.
37. The method according to any one of claims 1 to 36, wherein the risk assessment produces a score and the method further comprises comparing the score to a predetermined threshold, wherein if the score is at, or above, the threshold the subject is assessed at being at risk of developing a severe response to a Coronavirus infection.
38. The method according to any one of claims 1 to 37, wherein the Coronavirus is a Betacoronavirus.
39. The method of claim 38, wherein the Coronavirus (Betacoronavirus) is Severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2), Severe acute respiratory syndrome-related coronavirus (SARS-CoV), Middle East respiratory syndrome-related coronavirus (MERS), Human coronavirus OC43 or Human coronavirus HKU 1.
40. The method of claim 38 or claim 39, wherein the Coronavirus (Betacoronavirus) is Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
41. A method for determining the need for routine diagnostic testing of a human subject for a Coronavirus infection comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using the method according to any one of claims 1 to 40.
42. A method of screening for a severe response to a Coronavirus infection in a human subject, the method comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using the method according to any one of claims 1 to 40, and routinely screening for a Coronavirus infection in the subject if they are assessed as having a risk for developing a severe response to a Coronavirus infection.
Substitute Sheet (Rule 26) RO/AU
43. The method of claim 41 or claim 42, wherein the screening involves analysing the subject for the virus or a symptom thereof.
44. A method for determining the need of a human subject for prophylactic anti- Coronavirus therapy comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using the method according to any one of claims 1 to 40.
45. A method for preventing or reducing the risk of a severe response to a Coronavirus infection in a human subject, the method comprising assessing the risk of the subject for developing a severe response to a Coronavirus infection using the method according to any one of claims 1 to 40, and if they are assessed as having a risk for developing a severe response to a Coronavirus infection
1) administering an anti-Coronavirus therapy and/or
2) isolating the subject.
46. An anti-Coronavirus infection therapy for use in preventing a severe response to a Coronavirus infection in a human subject at risk thereof, wherein the subject is assessed as having a risk for developing a severe response to a Coronavirus infection using the method according to any one of claims 1 to 40.
47. The method according to any one of claims 44 to 46, wherein the therapy is selected from intubation to assist breathing, an anti-Coronavirus vaccine, convalescent plasma, chloroquine, hydroxychloroquine, Favipiravir, Remdesivir, Ivermectin, Quercetin, Kaletra (lopinavir/ritonavir), Arbidol, Baricitinib, CM4620-IE, an IL-6 inhibitor, Tocilizumab and stem cells such as mesenchymal stem cells.
48. A method for stratifying a group of human subjects for a clinical trial of a candidate therapy, the method comprising assessing the individual risk of the subjects for developing a severe response to a Coronavirus infection using the method according to any one of claims 1 to 40, and using the results of the assessment to select subjects more likely to be responsive to the therapy.
49. A kit comprising at least two sets of primers for amplifying two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from
Substitute Sheet (Rule 26) RO/AU any one of Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
50. A genetic array comprising at least two sets of probes for hybridising to two or more nucleic acids, wherein the two or more nucleic acids comprise a polymorphism selected from any one of Tables 1 to 6, 8, 19 or 22, or a single nucleotide polymorphism in linkage disequilibrium with one or more thereof.
51. A computer implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving genetic risk data for the human subject, wherein the genetic risk data was obtained by a method according to any one of claims 1 to 40; processing the data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
52. A computer implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving clinical risk data and genetic risk data for the human subject, wherein the clinical risk data and genetic risk data were obtained by a method according to any one of claims 13 to 15 or 27 to 40; processing the data to combine the clinical risk data with the genetic risk data to obtain the risk of a human subject developing a severe response to a Coronavirus infection, and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
53. A computer- implemented method for assessing the risk of a human subject developing a severe response to a Coronavirus infection, the method operable in a computing system comprising a processor and a memory, the method comprising: receiving at least one clinical variable associated with the human subject, wherein at least one clinical variable was obtained using a method according to any one of claims 20 to 26 or 36 to 40;
Substitute Sheet (Rule 26) RO/AU processing the data to obtain the risk of a human subject developing a severe response to a Coronavirus infection; and outputting the risk of a human subject developing a severe response to a Coronavirus infection.
54. A system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a genetic risk assessment of the human subject using the method according to any one of claims 1 to 40; and system instructions to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
55. A system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instructions for performing a clinical risk assessment and a genetic risk assessment of the human subject using the method according to any one of claims 13 to 15 or 27 to 40; and system instructions for combining the clinical risk assessment and the genetic risk assessment to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
56. A system for assessing the risk of a human subject developing a severe response to a Coronavirus infection comprising: system instmetions for performing a clinical risk assessment of the human subject using the method according to any one of claims 20 to 26 or 36 to 40; and system instructions to obtain the risk of a human subject developing a severe response to a Coronavirus infection.
Substitute Sheet (Rule 26) RO/AU
PCT/AU2021/050507 2020-05-27 2021-05-26 Methods of assessing risk of developing a severe response to coronavirus infection Ceased WO2021237292A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA3179313A CA3179313A1 (en) 2020-05-27 2021-05-26 Methods of assessing risk of developing a severe response to coronavirus infection
MX2022014931A MX2022014931A (en) 2020-05-27 2021-05-26 Methods of assessing risk of developing a severe response to coronavirus infection.
EP21813074.8A EP4158067A4 (en) 2020-05-27 2021-05-26 METHODS FOR ASSESSING THE RISK OF DEVELOPING A SERIOUS RESPONSE TO A CORONAVIRUS INFECTION
CN202180048201.7A CN116134152A (en) 2020-05-27 2021-05-26 Method for assessing risk of severe reaction to coronavirus infection
JP2022572759A JP2023527834A (en) 2020-05-27 2021-05-26 How to Assess Your Risk of Developing a Severe Response to Coronavirus Infection
IL298097A IL298097A (en) 2020-05-27 2021-05-26 Methods for assessing the risk of the development of an acute reaction to infection with the corona virus
KR1020227045938A KR20230019872A (en) 2020-05-27 2021-05-26 How to Assess Your Risk of Severe Reactions to Coronavirus Infection
AU2021281702A AU2021281702A1 (en) 2020-05-27 2021-05-26 Methods of assessing risk of developing a severe response to Coronavirus infection
US17/368,471 US11257569B1 (en) 2020-05-27 2021-07-06 Methods of assessing risk of developing a severe response to coronavirus infection
US17/667,282 US20220246242A1 (en) 2020-05-27 2022-02-08 Methods of assessing risk of developing a severe response to coronavirus infection

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
AU2020901739A AU2020901739A0 (en) 2020-05-27 Methods of assessing risk of developing a severe response to Coronavirus infection
AU2020901739 2020-05-27
AU2020902052 2020-06-19
AU2020902052A AU2020902052A0 (en) 2020-06-19 Methods of assessing risk of developing a severe response to Coronavirus infection
AU2020903536 2020-09-30
AU2020903536A AU2020903536A0 (en) 2020-09-30 Methods of assessing risk of developing a severe response to coronavirus infection
AU2021900392A AU2021900392A0 (en) 2021-02-17 Methods of assessing risk of developing a severe response to Coronavirus infection
AU2021900392 2021-02-17

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/368,471 Continuation US11257569B1 (en) 2020-05-27 2021-07-06 Methods of assessing risk of developing a severe response to coronavirus infection

Publications (1)

Publication Number Publication Date
WO2021237292A1 true WO2021237292A1 (en) 2021-12-02

Family

ID=78745661

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2021/050507 Ceased WO2021237292A1 (en) 2020-05-27 2021-05-26 Methods of assessing risk of developing a severe response to coronavirus infection

Country Status (10)

Country Link
US (2) US11257569B1 (en)
EP (1) EP4158067A4 (en)
JP (1) JP2023527834A (en)
KR (1) KR20230019872A (en)
CN (1) CN116134152A (en)
AU (1) AU2021281702A1 (en)
CA (1) CA3179313A1 (en)
IL (1) IL298097A (en)
MX (1) MX2022014931A (en)
WO (1) WO2021237292A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220177982A1 (en) * 2020-12-03 2022-06-09 Regeneron Pharmaceuticals, Inc. Methods Of Identifying Subjects Having An Increased Risk Of Developing A Coronavirus Infection And Treatment Thereof
RU2791487C1 (en) * 2022-07-18 2023-03-09 Федеральное государственное бюджетное учреждение "Центр стратегического планирования и управления медико-биологическими рисками здоровью" Федерального медико-биологического агентства Method for predicting the risk of severe covid-19 in a patient
WO2023166084A1 (en) * 2022-03-01 2023-09-07 Dnanudge Limited Multiplex cartridge for detection of viral and/or bacterial nucleic acids and human or animal single nucleotide polymorphisms
WO2023194369A1 (en) * 2022-04-08 2023-10-12 Fundació Institut Mar D'investigacions Mèdiques (Imim) Genetic markers for severe covid-19
WO2025080150A1 (en) * 2023-10-10 2025-04-17 Biolab Genetic Sp. Z O. O. Kit and method for determining by polymerase chain reaction the allele configuration at the rs143334143 locus and at the rs74956615 locus
WO2025080149A1 (en) * 2023-10-10 2025-04-17 Państwowy Instytut Medyczny Ministerstwa Spraw Wewnętrznych I Administracji Method for determining the level of risk of severe covid-19 disease in a patient

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117198517B (en) * 2023-06-27 2024-04-30 安徽省立医院(中国科学技术大学附属第一医院) Modeling method for motor reactivity assessment and prediction model based on machine learning
CN121458076B (en) * 2026-01-08 2026-04-03 山西唐讯科技有限公司 Intelligent analysis and early warning method for transmission line visual monitoring data

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190019760A1 (en) * 2017-07-14 2019-01-17 Taiwan Semiconductor Manufacturing Co., Ltd. Mini identification mark

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5714330A (en) 1994-04-04 1998-02-03 Lynx Therapeutics, Inc. DNA sequencing by stepwise ligation and cleavage
US5695934A (en) 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
US5750341A (en) 1995-04-17 1998-05-12 Lynx Therapeutics, Inc. DNA sequencing by parallel oligonucleotide extensions
EP1033411B1 (en) 1996-06-04 2006-02-22 University of Utah Research Foundation Fluorescent donor-acceptor pair
US6511803B1 (en) 1997-10-10 2003-01-28 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6485944B1 (en) 1997-10-10 2002-11-26 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6787308B2 (en) 1998-07-30 2004-09-07 Solexa Ltd. Arrayed biomolecules and their use in sequencing
WO2001023610A2 (en) 1999-09-29 2001-04-05 Solexa Ltd. Polynucleotide sequencing
US6898531B2 (en) 2001-09-05 2005-05-24 Perlegen Sciences, Inc. Algorithms for selection of primer pairs
US20030108919A1 (en) 2001-09-05 2003-06-12 Perlegen Sciences, Inc. Methods for amplification of nucleic acids
WO2005003375A2 (en) 2003-01-29 2005-01-13 454 Corporation Methods of amplifying and sequencing nucleic acids
CN1768074B (en) * 2003-03-24 2010-04-28 港大科桥有限公司 Diagnostic test for human virus causing Severe Acute Respiratory Syndrome (SARS)
US7127355B2 (en) 2004-03-05 2006-10-24 Perlegen Sciences, Inc. Methods for genetic analysis
ES2599816T3 (en) * 2006-07-21 2017-02-03 Epigenomics Ag Methods related to the GLI3 gene for the detection of colorectal cancer
US20110294681A1 (en) * 2009-06-01 2011-12-01 Hinds David A Methods for breast cancer risk assessment
US10920279B2 (en) * 2014-09-30 2021-02-16 Genetic Technologies Limited Method for modifying a treatment regimen of a human female subject
JP2020508643A (en) * 2017-01-24 2020-03-26 ジェネティック テクノロジーズ リミテッド Improved assessment of breast cancer risk
US12308128B2 (en) * 2019-07-23 2025-05-20 The Broad Institute, Inc. Health data aggregation and outbreak modeling
US20210340636A1 (en) * 2020-03-31 2021-11-04 Diasorin S.P.A. Assays for the Detection of SARS-CoV-2

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190019760A1 (en) * 2017-07-14 2019-01-17 Taiwan Semiconductor Manufacturing Co., Ltd. Mini identification mark

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BLOCH, E. M. ET AL.: "Deployment of convalescent plasma for the prevention and treatment of COVID-19", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 130, no. 6, 2020, pages 2757 - 2765, XP055815868, DOI: 10.1172/JCI138745 *
DITE GILLIAN S., MURPHY NICHOLAS M, ALLMAN RICHARD: "Development and validation of a clinical and genetic model for predicting risk of severe COVID-19", CAMBRIDGE UNIVERSITY PRESS, 12 March 2021 (2021-03-12), XP055879720, [retrieved on 20220117] *
DITE GILLIAN S., MURPHY NICHOLAS M., ALLMAN RICHARD: "An integrated clinical and genetic model for predicting risk of severe COVID-19: A population-based case–control study", PLOS ONE, vol. 16, no. 2, pages e0247205, XP055879724, DOI: 10.1371/journal.pone.0247205 *
ELLINGHAUS, D. ET AL.: "Genomewide association study of severe COVID-19 with respiratory failure", N. ENGL. J. MED., vol. 383, 2020, pages 1522 - 1534, XP055845288, DOI: 10.1056/NEJMoa2020283 *
KUO CHIA-LING, PILLING LUKE C, ATKINS JANICE L, MASOLI JANE A H, DELGADO JOÃO, KUCHEL GEORGE A, MELZER DAVID: "APOE e4 Genotype Predicts Severe COVID-19 in the UK Biobank Community Cohort", JOURNALS OF GERONTOLOGY, SERIES A, BIOLOGICAL SCIENCES ANDMEDICAL SCIENCES, OXFORD UNIV. PRESS, US, vol. 75, no. 11, 15 October 2020 (2020-10-15), US , pages 2231 - 2232, XP055879693, ISSN: 1079-5006, DOI: 10.1093/gerona/glaa131 *
OLESEN MORTEN SALLING, REFSGAARD LENA, HOLST ANDERS GAARSDAL, LARSEN ANDERS PETER, GRUBB SØREN, HAUNSØ STIG, SVENDSEN JESPER HASTR: "A novel KCND3 gain-of-function mutation associated with early-onset of persistent lone atrial fibrillation", CARDIOVASCULAR RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 98, no. 3, 1 June 2013 (2013-06-01), GB , pages 488 - 495, XP055879685, ISSN: 0008-6363, DOI: 10.1093/cvr/cvt028 *
PETRILLI CHRISTOPHER M, JONES SIMON A, YANG JIE, RAJAGOPALAN HARISH, O’DONNELL LUKE, CHERNYAK YELENA, TOBIN KATIE A, CERFOLIO ROBE: "Factors associated with hospital admission and critical illness among 5279 people with coronavirus disease 2019 in New York City: prospective cohort study", BMJ, 22 May 2020 (2020-05-22), XP055879711, DOI: 10.1136/bmj.m1966 *
See also references of EP4158067A4 *
VAN MOORSEL COLINE H.M., VAN DER VIS JOANNE J., BENSCHOP CLAUDIA, RUVEN HENK J.T., QUANJEL MARIAN, GRUTTERS JAN C.: "THE MUC5B PROMOTOR POLYMORPHISM ASSOCIATES WITH SEVERE COVID-19", MEDRXIV, 16 May 2020 (2020-05-16), XP055879705, Retrieved from the Internet <URL:https://www.medrxiv.org/content/10.1101/2020.05.12.20099333v1.full.pdf> [retrieved on 20220117], DOI: 10.1101/2020.05.12.20099333 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220177982A1 (en) * 2020-12-03 2022-06-09 Regeneron Pharmaceuticals, Inc. Methods Of Identifying Subjects Having An Increased Risk Of Developing A Coronavirus Infection And Treatment Thereof
WO2023166084A1 (en) * 2022-03-01 2023-09-07 Dnanudge Limited Multiplex cartridge for detection of viral and/or bacterial nucleic acids and human or animal single nucleotide polymorphisms
WO2023194369A1 (en) * 2022-04-08 2023-10-12 Fundació Institut Mar D'investigacions Mèdiques (Imim) Genetic markers for severe covid-19
RU2791487C1 (en) * 2022-07-18 2023-03-09 Федеральное государственное бюджетное учреждение "Центр стратегического планирования и управления медико-биологическими рисками здоровью" Федерального медико-биологического агентства Method for predicting the risk of severe covid-19 in a patient
WO2025080150A1 (en) * 2023-10-10 2025-04-17 Biolab Genetic Sp. Z O. O. Kit and method for determining by polymerase chain reaction the allele configuration at the rs143334143 locus and at the rs74956615 locus
WO2025080149A1 (en) * 2023-10-10 2025-04-17 Państwowy Instytut Medyczny Ministerstwa Spraw Wewnętrznych I Administracji Method for determining the level of risk of severe covid-19 disease in a patient

Also Published As

Publication number Publication date
KR20230019872A (en) 2023-02-09
CA3179313A1 (en) 2021-12-02
IL298097A (en) 2023-01-01
AU2021281702A1 (en) 2023-01-05
JP2023527834A (en) 2023-06-30
US20220246242A1 (en) 2022-08-04
MX2022014931A (en) 2023-01-30
EP4158067A4 (en) 2024-09-25
CN116134152A (en) 2023-05-16
US11257569B1 (en) 2022-02-22
EP4158067A1 (en) 2023-04-05

Similar Documents

Publication Publication Date Title
US11257569B1 (en) Methods of assessing risk of developing a severe response to coronavirus infection
AU2018202299B9 (en) Methods for assessing risk of developing breast cancer
AU2017212152B2 (en) Methods for assessing risk of developing colorectal cancer
US20200102617A1 (en) Improved Methods For Assessing Risk of Developing Breast Cancer
US20230383349A1 (en) Methods of assessing risk of developing a disease
AU2022279367A1 (en) Methods of assessing risk of developing breast cancer
JP7140707B2 (en) How to determine your risk of glaucoma
US20250046465A1 (en) Breast cancer risk assessment
JP2020178560A (en) Method for determining the risk of arteriosclerosis
HK40001097A (en) Methods for assessing risk of developing colorectal cancer
HK40001097B (en) Methods for assessing risk of developing colorectal cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21813074

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3179313

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022572759

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20227045938

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021281702

Country of ref document: AU

Date of ref document: 20210526

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021813074

Country of ref document: EP

Effective date: 20230102

WWW Wipo information: withdrawn in national office

Ref document number: 1020227045938

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 2021813074

Country of ref document: EP