WO2021216028A1 - Plant inoculant - Google Patents

Plant inoculant Download PDF

Info

Publication number
WO2021216028A1
WO2021216028A1 PCT/UA2021/000040 UA2021000040W WO2021216028A1 WO 2021216028 A1 WO2021216028 A1 WO 2021216028A1 UA 2021000040 W UA2021000040 W UA 2021000040W WO 2021216028 A1 WO2021216028 A1 WO 2021216028A1
Authority
WO
WIPO (PCT)
Prior art keywords
inoculant
plants
glauconite
bacteria
plant
Prior art date
Application number
PCT/UA2021/000040
Other languages
French (fr)
Russian (ru)
Inventor
Сергей АБРАМОВ
Марина АБРАМОВА-КАЛУЖСКИХ
Original Assignee
Abramov Sergey
Abramova Kaluzhskih Marina
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Abramov Sergey, Abramova Kaluzhskih Marina filed Critical Abramov Sergey
Priority to DE112021002422.1T priority Critical patent/DE112021002422T5/en
Publication of WO2021216028A1 publication Critical patent/WO2021216028A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C05—FERTILISERS; MANUFACTURE THEREOF
    • C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
    • C05F11/00—Other organic fertilisers
    • C05F11/08—Organic fertilisers containing added bacterial cultures, mycelia or the like
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N25/00—Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application; Substances for reducing the noxious effect of the active ingredients to organisms other than pests
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
    • A01N63/22—Bacillus
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
    • A01N63/25—Paenibacillus
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
    • A01N63/27—Pseudomonas
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
    • A01P21/00—Plant growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the invention relates to agricultural microbiology and biotechnology, namely, to new inoculant compositions designed to stimulate plant development, protect against diseases, increase the productivity of agricultural crops, as well as to improve soil quality
  • mineral fertilizers containing compounds of nitrogen, potassium, phosphorus, and trace elements available to plants is widespread.
  • Long-term use of mineral fertilizers is associated with negative environmental consequences, such as soil and groundwater pollution, as well as emissions of harmful substances into the atmosphere, such as ammonia and nitrous oxide.
  • microbiological inoculants - biological products containing live cultures of microorganisms useful for plants, providing favorable conditions for plant development, protecting plants from pests and diseases, increasing plant productivity
  • microorganisms that contribute to an increase in soil fertility by increasing the concentration and / or bioavailability of nutrients, for example, nitrogen-fixing microorganisms, phosphate-mobilizing bacteria and other microorganisms that promote the assimilation of macro and microelements necessary for a plant;
  • a well-known inoculant for increasing the productivity of soybeans (patent of Ukraine N ° 85089, IPC C05F 11/08, C12N 1/20, C12R 1/01, filing date 14 11.2005), containing homologous strains of Bradyrhizobium japonicum 694 or Bradyrhizobium japonicum 10k ( species of nodule bacteria, saprophytic nitrogen-fixing symbionts of soybeans)
  • These bacterial cultures are complementary to a wide range of modern soybean varieties and are characterized by:
  • the general features of the analogue and the proposed solution are: an inoculant for plants containing a nutrient medium with a bacterial culture.
  • a liquid inoculant containing an aqueous nutrient medium with a bacterial culture was selected as a prototype (Ukrainian patent Ne 94389, IPC ⁇ 01 ⁇ 1/06, C05F 11/08, C12N 1/04, filing date 14 12 2006)
  • the bacterial culture is bacteria of one or more genera from: - Rhizobium (a genus of bacteria capable of fixing nitrogen);
  • Bradyrhizobium (a genus of bacteria capable of fixing nitrogen);
  • Pseudomonas a genus of bacteria that prevents the growth of plant pathogens
  • Bacillus (a genus of bacteria used in plant biosecurity as an alternative to synthetic insecticides)
  • Paenibacillus (a genus of bacteria that produce antimicrobial substances that exhibit bactericidal and fungicidal effects)
  • Azotobacter a genus of soil bacteria capable of converting gaseous nitrogen into a soluble form available for assimilation by plants
  • Azospirillum a genus of bacteria that promote nitrogen fixation by plant roots, increase the ability of the roots to retain water and enhance the growth of the root system as a whole;
  • the liquid nutrient medium into which the bacteria are introduced can be any known nutrient medium compatible with the selected bacteria, for example, the medium of the following composition: yeast extract - 0.50 g / l; mannitol - 10.0 g / l; K 2 HP0 4 - 0.50 g / l; MgS0 4 7H 2 0 - 0.2 g / l; NaCl - 0.1 g / l; water - 1 l; PH - 6.8.
  • a desiccant is added to the liquid inoculant as a dehydrating additive.
  • a desiccant one or more compounds selected from non-renewable sugars and alcohols belonging to the sugar group are used, for example, a desiccant comprising a mixture of two or more compounds selected from trehalose, sucrose, glycerol, triethylene glycol and mannitol.
  • the stationary phase is the phase in which bacterial growth stops.
  • the stationary phase is usually reached when the liquid culture medium is completely consumed.
  • the incubation of the inoculant is carried out for 2-7 days.
  • the inoculant can be packaged in polyethylene containers. Storage conditions include temperatures below 35 ° C and relative humidity below 80%.
  • the inoculant can be applied to peat, clay, or other dry media to produce a free-flowing inoculant.
  • the inoculant can be applied to the seed of the plant or applied in the furrow just before the seed is planted.
  • microbiological inoculant for plants containing a carrier with microbiological cultures.
  • bacteria microorganisms
  • bacteria microorganisms
  • Each genus of bacteria performs only its own functions.
  • bacteria of the genera Rhizobium, Bradyrhizobium, Azotobacter are nitrogen fixers
  • bacteria of the genus Bacillus exhibit the properties of insecticides
  • bacteria of the genus Paenibacillus exhibit bactericidal and fungicidal action, etc.
  • microorganisms of the archaea domain are used as microbiological cultures, which are characterized by one of the following specific markers of the nucleotide sequences of the diagnostic fragment of the 16S rRNA gene:
  • Archaea with the indicated specific nucleotide sequence markers of the diagnostic fragment of the 16S rRNA gene were found in glauconite ores, as well as in water sources of glauconite ore deposits.
  • each of the discovered archaea has its own specific marker - the nucleotide sequence of the diagnostic fragment of the 16S rRNA gene, by which it can always be identified, for example, when isolated from other samples or, for example, in the future, when a related organism will be studied, named and analyzed by gene 16S rRNA.
  • the closest relatives in terms of the degree of similarity are microorganisms of the following types: Crenarchaeota, Euryarchaeota.
  • the identified archaea are uncultivated unicellular microorganisms, which excludes the loss of their properties during generational change. They are extremophiles, that is, they are able to survive in extreme environmental conditions (extremely high or low temperatures, pressures, acidity, alkalinity, oxygen content, etc.), which determines the survival and stability of microorganisms of the inoculant during storage and use. pathogens. They are resistant to antibiotics, which guarantees their survival when using preparations containing antibiotics in crop production.
  • the identified archaea are not saprotrophs, nitrogen fixers, phosphate mobilizers, etc. That is, they do not directly perform the functions inherent in the representatives of the soil microflora.
  • field and micro-field tests of the bioculant with the indicated archaea on various agricultural crops have shown its high efficiency. The test results are shown in the following sections of the description.
  • the authors of the invention explain the effectiveness of the claimed inoculant by the interaction of the identified archaea with representatives of the natural soil microflora at a certain information level by means of the known horizontal gene transfer, which enhances their useful functions, as well as interaction with plants at the genetic level. inoculant, retain the acquired properties at the genetic level.
  • Glauconite is a mineral, aqueous aluminosilicate of iron, silica and potassium oxide of variable composition Contains potassium oxide (K 2 0) 4, 4-9, 4%, sodium oxide (Na 2 0) up to 3.5%, aluminum oxide (A1 2 0 3 ) 5.5-22.6%, iron oxide (Fe 2 0 3 ) 6.1-27%, iron oxide (FeO) 0.8-8.6 %, magnesium oxide (MgO) 2,4-4, 5%, silicon dioxide (Si0 2) 47,6-52,9%, water (H 2 0) 4,9-13,5%.
  • the variety of inorganic substances in glauconite provides a satisfactory habitat for the identified archaea.
  • the preparation of the inoculant includes a simple introduction of a given number of microorganisms into powdered glauconite or into an aqueous suspension of powdered glauconite; further incubation (fermentation) is not required, which simplifies the production technology and reduces the cost of the inoculant
  • Photo 1 - Inoculant for plants an example of growing tomatoes, inoculated plant.
  • Photo 2 - Inoculant for plants example of growing tomatoes, control sample.
  • Photo 3 - Inoculant for plants an example of growing wheat
  • Photo 4 - Inoculant for plants an example of sunflower cultivation, the results of seed germination as of the beginning of June
  • Photo 5 - Inoculant for plants an example of sunflower cultivation, vegetation as of mid-July.
  • Photo 6 - Inoculant for plants an example of sunflower cultivation, vegetation as of early August.
  • Photo 7 - Plant inoculant example of sunflower cultivation, seed ripening period as of early September.
  • Stated inoculant for plants comprises a carrier with microbial cultures, wherein the microbial cultures used Archaea domain microorganisms which are characterized by one of the following nucleotide sequences specific markers diagnostic gene fragment 16S rRNA: - ggttgatcctgccggagatcgctgctattagagttcgactaagccatgcaagtcatctcgcaagagaggc gacaggctcagtaacatgtcgttaatctaccctttcgcccagaataccctcgggaaactgaggttaatac tggatatgaagatattctggaaagaattttttctttaaggcaacacgaaaggatgagacggcaccagat taggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggggatgaaag
  • Archaea with the specified specific markers can be isolated from glauconite ores, as well as from water sources of glauconite ore deposits.
  • Powdered glauconite or an aqueous suspension of powdered glauconite was used as a carrier.
  • Glauconite containing a variety of inorganic substances, provides a satisfactory environment for the existence of these archaea.
  • the inoculant is prepared as follows.
  • a carrier is prepared by grinding glauconite to a fine-grained state, or an aqueous suspension of glauconite powder is prepared.
  • the content of glauconite in the aqueous suspension is 0.5 to 50 weight percent.
  • Archaea are introduced into the prepared carrier in an amount of 102-106 microorganisms per 1 cm 3 of the carrier.
  • the result is a free-flowing inoculant (when using glauconite powder as a carrier) or a liquid inoculant (when using an aqueous suspension of glauconite powder as a carrier).
  • the inoculant is packaged in an appropriate, for example, plastic container and sent to storage. Storage is carried out at a temperature not exceeding 70 ° C with a humidity not lower than 5%.
  • the shelf life of the inoculant is not limited
  • An inoculant is applied by pre-sowing seed treatment (soaking, inlaying, pelleting according to known technologies), soaking cuttings or the root system of seedlings, introducing into the soil when planting (sowing) plants, treating the aerial part of plants and feeding during the growing season, using an effective the amount of bioculant depending on the type of plant, nature and soil condition.
  • the "effective amount" can be determined by one of ordinary skill in the art using routine experimentation.
  • Example 1 Growing tomatoes.
  • the variety "Mikado yellow (undersized)” was chosen, which is characterized by increased demands on growing conditions.
  • the experiment was carried out in the Brovarsky district of the Kiev region, Ukraine, on poor sandy loam soils with low fertility, typical of the eastern part of the Kiev region.
  • the area of the experimental site is 0.1 hectares
  • the root system of the planted tomato seedlings was pre-soaked in a liquid inoculant (the carrier is an aqueous 1% suspension of glauconite powder).
  • the control seedlings were soaked in plain water. Soaking conditions (time, temperature) were the same. The watering conditions for the test and control plants during the growing season were equal. During the growing season, four root dressings were carried out, the feeding of the test samples was carried out with the addition of an inoculant.
  • Example 2 Growing wheat.
  • the winter cultivar "Akratos" German cultivar was chosen for the experiment. The experiment was carried out in the Baryshevsky district of Kiev region, Ukraine. The area of the experimental plot is 10 hectares - 5 hectares with the use of the declared inoculant and 5 hectares without the inoculant (control plot)
  • sowing winter wheat It is known that the main task of sowing winter wheat is the formation of the root system of plants, which makes it possible to endure unfavorable wintering conditions and ensure spring vegetation with minimal losses, which is of decisive importance in realizing the potential productivity of the crop.
  • Wheat seeds were pretreated with the declared inoculant before sowing.
  • a liquid inoculant was used (the carrier was an aqueous 1% suspension of glauconite powder). Control seeds were not subjected to pre-sowing treatment
  • the treated wheat was sown next to untreated (control) in the same volume using the same technique and sowing technology
  • Inoculated samples (photo 3, left) are characterized by a large number of shoots, high bushiness, developed root system with secondary roots, which compares favorably with control samples (photo 3, right).
  • Example 3 Growing sunflower.
  • a variety of a domestic manufacturer was selected. The experiment was carried out in the Brovarsky district of the Kiev region, Ukraine, on a sandy loamy soddy-weakly podzolic soil Plot size 2.5 mx 6 m; plot area 15 m 2 ; distance between rows 0.7 m; the distance between plants in a row is 0.3 m.
  • Sunflower seeds were pre-soaked before sowing in the declared inoculant.
  • a liquid inoculant was used (the carrier was an aqueous 1% suspension of glauconite powder).
  • Control seeds were pre-soaked in ordinary water before sowing. All work on the micro-field experiment (marking and digging the site, sowing sunflower, weeding, harvesting) was carried out manually. During the period of micro-field work, no additional fertilizing and processing was carried out, no mineral fertilizers were used.
  • Micro-field work was carried out in the period May - September: seed soaking, planting in the ground - early May, harvesting - mid September. The results of phenological observations during the growing season are shown in Photos 4-7. These photos show significant differences in the growth and development of sunflower plants, the seeds of which were soaked in the claimed inoculant, in comparison with plants, the seeds of which were soaked in ordinary water (control).
  • Photo 4 shows the results of seed germination as of early June.
  • the germination capacity of seeds soaked in the declared inoculant was 20 out of 20
  • the germination capacity of seeds soaked in ordinary water was 18 out of 20.
  • the middle part of the stem much more in comparison with the control.
  • Photo 5 shows the development of plants as of mid-July. On the left side of the photo are control plants. Inoculated plants are deep green, tall, with thick stems and broad leaves. Control plants lag behind in growth and development, are low, the number and size of leaves are less
  • Photo 6 shows the development of plants as of early August.
  • the baskets are much larger, do not have deformations, the seeds are evenly distributed in the baskets, the plants look healthy.
  • small specks are present on the leaves, in some places there is a brown spot, the inflorescences are reduced in size, deformed or absent.
  • Photo 7 shows the plants during the seed ripening period as of early September.
  • Control plant samples practically do not contain active leaves, small basket sizes
  • MTS masses of one thousand seeds
  • the baskets are large, present on all plants, have no deformations and are fully open.
  • the diameter of the baskets reaches 20 cm.
  • the yield of inoculated sunflower is 2.6 times higher than the yield of the control one.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Pest Control & Pesticides (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Plant Pathology (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Toxicology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to agricultural microbiology and biotechnology, and more particularly to a plant inoculant containing a glauconite carrier and microbiological cultures, wherein the microbiological cultures used are microorganisms of the Archaea domain which are characterized by one of 12 specific markers comprised of nucleotide sequences of a diagnostic fragment of the 16S rRNA gene.

Description

Инокулянт для растений Inoculant for plants
Изобретение относится к сельскохозяйственной микробиологии и биотехнологии, а именно, к новым инокулянтным композициям, предназначенным для стимулирования развития растений, защиты от заболеваний, повышения продуктивности сельскохозяйственных культур, а также для улучшения качества почвы The invention relates to agricultural microbiology and biotechnology, namely, to new inoculant compositions designed to stimulate plant development, protect against diseases, increase the productivity of agricultural crops, as well as to improve soil quality
Для повышения эффективности растениеводства широко распространено использование минеральных удобрений, содержащих доступные для растений соединения азота, калия, фосфора, микроэлементы. Длительное использование минеральных удобрений связано с негативными экологическими последствиями, такими как загрязнение почвы и грунтовых вод, а также с выбросами в атмосферу вредных веществ, например аммиака и закиси азота. To increase the efficiency of crop production, the use of mineral fertilizers containing compounds of nitrogen, potassium, phosphorus, and trace elements available to plants is widespread. Long-term use of mineral fertilizers is associated with negative environmental consequences, such as soil and groundwater pollution, as well as emissions of harmful substances into the atmosphere, such as ammonia and nitrous oxide.
Альтернативой минеральным удобрениям являются микробиологические инокулянты - биопрепараты, содержащие живые культуры полезных для растений микроорганизмов, обеспечивающих благоприятные условия для развития растений, защиту растений от вредителей и заболеваний, увеличение продуктивности растений An alternative to mineral fertilizers are microbiological inoculants - biological products containing live cultures of microorganisms useful for plants, providing favorable conditions for plant development, protecting plants from pests and diseases, increasing plant productivity
Инокулянты могут проявлять себя как Inoculants can manifest themselves as
- бактериальные удобрения, содержащие микроорганизмы, которые способствуют увеличению плодородия почвы за счет повышения концентрации и/или биодоступности питательных веществ, например, азотфиксирующие микроорганизмы, фосфатмобилизирующие бактерии и другие микроорганизмы, способствующие усвоению необходимых для растения макро и микроэлементов; - bacterial fertilizers containing microorganisms that contribute to an increase in soil fertility by increasing the concentration and / or bioavailability of nutrients, for example, nitrogen-fixing microorganisms, phosphate-mobilizing bacteria and other microorganisms that promote the assimilation of macro and microelements necessary for a plant;
- стимуляторы развития растений, способствующие быстрому росту и формированию корневой системы и надземных органов растений; - stimulants of plant development, contributing to the rapid growth and formation of the root system and aboveground plant organs;
- микоризные препараты, создающие благоприятную ризосферу в почве, которая способствует формированию корневой системы, увеличивает всасывающую поверхность корневой системы растения; - mycorrhizal preparations that create a favorable rhizosphere in the soil, which promotes the formation of the root system, increases the absorbing surface of the plant root system;
- средства биозащиты, используемые для профилактики инфекционных заболеваний и защиты растений от вредителей, - biosecurity products used to prevent infectious diseases and protect plants from pests,
- средства улучшения (стабилизации) качества почвы за счет увеличения количества и/или доступности необходимых питательных веществ, а также уменьшения или минимизации количества веществ, вредных для развития растений - means of improving (stabilizing) soil quality by increasing the amount and / or availability of necessary nutrients, as well as reducing or minimizing the amount of substances harmful to plant development
Известный инокулянт для повышения производительности сои (патент Украины N° 85089, МПК C05F 11/08, C12N 1/20, C12R 1/01 , дата подачи заявки 14 11.2005), содержащий в качестве биоагентов гомологичные штаммы Bradyrhizobium japonicum 694 или Bradyrhizobium japonicum 10к (виды клубеньковых бактерий, сапрофитные азотфиксирующие симбионты сои) Указанные бактериальные культуры являются комплементарными к широкому спектру современных сортов сои и характеризуются: A well-known inoculant for increasing the productivity of soybeans (patent of Ukraine N ° 85089, IPC C05F 11/08, C12N 1/20, C12R 1/01, filing date 14 11.2005), containing homologous strains of Bradyrhizobium japonicum 694 or Bradyrhizobium japonicum 10k ( species of nodule bacteria, saprophytic nitrogen-fixing symbionts of soybeans) These bacterial cultures are complementary to a wide range of modern soybean varieties and are characterized by:
- нечувствительностью к антибактериальному действию экстрактивных веществ, содержащихся в оболочках семян ряда сортов сои; - высокой пектиназной активностью при контакте с семенами сои; - insensitivity to the antibacterial action of extractive substances contained in the seed shells of a number of soybean varieties; - high pectinase activity upon contact with soybean seeds;
- способностью переносить условия недостаточного увлажнения; - the ability to tolerate conditions of insufficient moisture;
- устойчивостью к засолению почв NaCL, Na2S04, NaHC03; - resistance to soil salinity NaCL, Na 2 S0 4, NaHC0 3 ;
- устойчивостью к загрязнению тяжелыми металлами Pb, Cd, Си, Zn и их смесями- resistance to pollution by heavy metals Pb, Cd, Cu, Zn and their mixtures
Используется в виде жидкого или сыпучего инокулянта для предпосевной инокуляции семян сои. It is used as a liquid or free-flowing inoculant for presowing inoculation of soybean seeds.
Общими признаками аналога и заявляемого решения являются: инокулянт для растений, содержащий питательную среду с бактериальной культурой. The general features of the analogue and the proposed solution are: an inoculant for plants containing a nutrient medium with a bacterial culture.
Комплементарность указанного инокулянта преимущественно к сортам сои ограничивает возможности его применения для других культур. В качестве прототипа выбрано жидкий инокулянт, содержащий водную питательную среду с бактериальной культурой (патент Украины Ne 94389, МПК А01 С 1/06, C05F 11/08, C12N 1/04, дата подачи заявки 14 12 2006) The complementarity of the specified inoculant mainly to soybean varieties limits the possibilities of its use for other crops. A liquid inoculant containing an aqueous nutrient medium with a bacterial culture was selected as a prototype (Ukrainian patent Ne 94389, IPC А01 С 1/06, C05F 11/08, C12N 1/04, filing date 14 12 2006)
Бактериальная культура представляет собой бактерии одного или нескольких родов из: - Rhizobium (род бактерий, способных к фиксации азота); The bacterial culture is bacteria of one or more genera from: - Rhizobium (a genus of bacteria capable of fixing nitrogen);
- Bradyrhizobium (род бактерий, способных к фиксации азота); - Bradyrhizobium (a genus of bacteria capable of fixing nitrogen);
- Pseudomonas (род бактерий, предупреждающий рост патогенов растений); - Pseudomonas (a genus of bacteria that prevents the growth of plant pathogens);
- Serratia (род бактерий патогенов) - Serratia (genus of bacteria pathogens)
- Bacillus (род бактерий, используемых в биозащите растений в качестве альтернативы синтетическим инсектицидам) - Bacillus (a genus of bacteria used in plant biosecurity as an alternative to synthetic insecticides)
- Paenibacillus (род бактерий, продуцирующих антимикробные вещества, которые проявляют бактерицидное и фунгицидное действие) - Paenibacillus (a genus of bacteria that produce antimicrobial substances that exhibit bactericidal and fungicidal effects)
- Pasteuria (род бактерий, являющихся облигатными паразитами нематод) - Pasteuria (a genus of bacteria that are obligate parasites of nematodes)
- Azotobacter (род почвенных бактерий, способных переводить газообразный азот в растворимую форму, доступную для усвоения растениями) - Azotobacter (a genus of soil bacteria capable of converting gaseous nitrogen into a soluble form available for assimilation by plants)
- Azospirillum (род бактерий, способствующих фиксации азота корнями растений, повышающих способность корней удерживать воду и усиливающих рост корневой системы в целом); - Azospirillum (a genus of bacteria that promote nitrogen fixation by plant roots, increase the ability of the roots to retain water and enhance the growth of the root system as a whole);
- Methylobacterium (симбионты растений, стимулирующие развитие растений); - Cyanobacteria (род бактерий, стабилизирующих почву, предотвращающих эрозию и удерживание воды). Жидкая питательная среда, в которую вводят бактерии, может быть любой известной питательной средой, совместимой с выбранными бактериями, например, среда следующего состава: дрожжевой экстракт - 0,50 г/л; маннит - 10,0 г/л; К2НР04 - 0,50 г/л; MgS047H20 - 0,2 г/л; NaCI - 0,1 г/л; вода - 1 л; PH - 6,8. Для получения частично обезвоженного инокулянта к жидкому инокулянту добавляют десикант, как обезвоживающую добавку. Как десикант используют одно или несколько соединений, выбранных из не возобновляемых сахаров и спиртов относящихся к группе сахара, например, десикант, включающий смесь двух или более соединений выбранных из трегалозы, сахарозы, глицерина, триэтиленгликоля и маннита. После добавления бактерий в жидкую питательную среду инокулянт инкубируют- Methylobacterium (plant symbionts that stimulate plant development); - Cyanobacteria (a genus of bacteria that stabilize soil, prevent erosion and retain water). The liquid nutrient medium into which the bacteria are introduced can be any known nutrient medium compatible with the selected bacteria, for example, the medium of the following composition: yeast extract - 0.50 g / l; mannitol - 10.0 g / l; K 2 HP0 4 - 0.50 g / l; MgS0 4 7H 2 0 - 0.2 g / l; NaCl - 0.1 g / l; water - 1 l; PH - 6.8. To obtain a partially dehydrated inoculant, a desiccant is added to the liquid inoculant as a dehydrating additive. As a desiccant, one or more compounds selected from non-renewable sugars and alcohols belonging to the sugar group are used, for example, a desiccant comprising a mixture of two or more compounds selected from trehalose, sucrose, glycerol, triethylene glycol and mannitol. After adding bacteria to the liquid nutrient medium, the inoculant is incubated
(ферментируют) для предоставления бактериям возможности роста до стационарной фазы. Стационарная фаза представляет собой фазу, на которой рост бактерии прекращается. Стационарная фаза обычно достигается, когда жидкая питательная среда полностью расходуется. Инкубирование инокулянта проводят в течение 2-7 дней. Инокулянт может расфасовываться в полиэтиленовые емкости. Условия хранения предусматривают температуру ниже 35 °С и относительную влажность ниже 80 %. (fermented) to allow bacteria to grow to a stationary phase. The stationary phase is the phase in which bacterial growth stops. The stationary phase is usually reached when the liquid culture medium is completely consumed. The incubation of the inoculant is carried out for 2-7 days. The inoculant can be packaged in polyethylene containers. Storage conditions include temperatures below 35 ° C and relative humidity below 80%.
Инокулянт может наноситься на торф, глину или другие сухие носители для получения сыпучего инокулянта. The inoculant can be applied to peat, clay, or other dry media to produce a free-flowing inoculant.
Инокулянт может наноситься на семена растений или вноситься в борозду непосредственно перед посадкой семян The inoculant can be applied to the seed of the plant or applied in the furrow just before the seed is planted.
Общими признаками прототипа и заявляемого решения, являются: микробиологический инокулянт для растений, содержащий носитель с микробиологическими культурами. The common features of the prototype and the proposed solution are: a microbiological inoculant for plants containing a carrier with microbiological cultures.
Применение описанного инокулянта направлено на увеличение содержания полезных для растений микроорганизмов (бактерий) в почве. Каждый род бактерий выполняет только свойственные ему функции. Например, бактерии родов Rhizobium, Bradyrhizobium, Azotobacter являются азотфиксаторами, бактерии рода Bacillus проявляют свойства инсектицидов, бактерии рода Paenibacillus проявляют бактерицидное и фунгицидное действие и т. д При этом синергетическое взаимодействие родов бактерий, при котором эффект оказывается большим, чем сумма эффектов от действия отдельных родов бактерий, не проявляется, что ограничивает эффективность инокулянта Для получения комплексного воздействия инокулянта он должен содержать множество родов бактерий что усложняет технологию получения и повышает стоимость инокулянта Кроме того, возможны проблемы комплементарности (биоценоза) различных родов бактерий в композиции В основу изобретения поставлена задача повышения эффективности, упрощения технологии получения и снижения стоимости инокулянта. Поставленная задача решается тем, что в инокулянте для растений, содержащем носитель с микробиологическими культурами, согласно изобретению, в качестве микробиологических культур использованы микроорганизмы домена археи, которые характеризуются одним из следующих специфических маркеров нуклеотидных последовательностей диагностического фрагмента гена 16S рРНК: The use of the described inoculant is aimed at increasing the content of microorganisms (bacteria) useful for plants in the soil. Each genus of bacteria performs only its own functions. For example, bacteria of the genera Rhizobium, Bradyrhizobium, Azotobacter are nitrogen fixers, bacteria of the genus Bacillus exhibit the properties of insecticides, bacteria of the genus Paenibacillus exhibit bactericidal and fungicidal action, etc. genera of bacteria, does not manifest itself, which limits the effectiveness of the inoculant To obtain a complex effect of the inoculant, it must contain many genera of bacteria, which complicates the production technology and increases the cost of the inoculant In addition, problems of complementarity (biocenosis) of various genera of bacteria in the composition are possible. , simplifying the technology of obtaining and reducing the cost of the inoculant. The problem is solved by the fact that in the inoculant for plants containing a carrier with microbiological cultures, according to the invention, microorganisms of the archaea domain are used as microbiological cultures, which are characterized by one of the following specific markers of the nucleotide sequences of the diagnostic fragment of the 16S rRNA gene:
- ggttgatcctgccggagatcgctgctattagagttcgactaagccatgcaagtcatctcgcaagagaggc gacaggctcagtaacatgtcgttaatctaccctttcgcccagaataccctcgggaaactgaggttaatac tggatatgaaagatattctggaaagaattttttcttaaaggcaacacgaaaggatgagacggcaccagat taggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtcctagcccggag aggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatgcacgaaag tgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttcggagaata agtggtgggtaagactggtgccagccgccgcggtanccccagcgccacaagtggggatcacgtttatttg gtctaaagcgttcgtaccagg ; - ggttgatcctgccggagatcgctgctattagagttcgactaagccatgcaagtcatctcgcaagagaggc gacaggctcagtaacatgtcgttaatctaccctttcgcccagaataccctcgggaaactgaggttaatac tggatatgaaagatattctggaaagaattttttcttaaaggcaacacgaaaggatgagacggcaccagat taggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtcctagcccggag aggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatgcacgaaag tgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttcggagaata agtggtgggtaagactggtgccagccgccgcggtanccccagcgccacaagtggggatcacgtttatttg gtctaaagcgttcgtaccagg;
- attccggttgatcctgccggacctgactgctatcggattgatactaatnnccatgcgagtcattgtagca atacaaggcagacggctcagtagcgcgtagtcaatctaccctatggacgggaataacctcgggaaactga gaataatgcccgatagaacattatgcctggaatggtttatgtttcaaatgatttatcgccataggatggg actgcggcctatcagtttgttggtgaggtaatggcccaccaagactattacaggtacgggctctgagagg agtggcccggagatgggtactgagacacggacccaggccctatggggcgcagcaggcgggaaaactttgc aatgtgcgaaagcacgacnaaggttaatccgagtggtttctgctaaagaaaccttttgtcagtcctagaa accactaaacgaataagggggtgggncaagttctggntgtnngcccgcccgcgggtaaaaacccagcaac cctcaagntgggttcagggnattg; - tccggtgatcctgccggacctgactgctatcggattggtactaagcncatgtgagtcgttgcagcaatg- attccggttgatcctgccggacctgactgctatcggattgatactaatnnccatgcgagtcattgtagca atacaaggcagacggctcagtagcgcgtagtcaatctaccctatggacgggaataacctcgggaaactga gaataatgcccgatagaacattatgcctggaatggtttatgtttcaaatgatttatcgccataggatggg actgcggcctatcagtttgttggtgaggtaatggcccaccaagactattacaggtacgggctctgagagg agtggcccggagatgggtactgagacacggacccaggccctatggggcgcagcaggcgggaaaactttgc aatgtgcgaaagcacgacnaaggttaatccgagtggtttctgctaaagaaaccttttgtcagtcctagaa accactaaacgaataagggggtgggncaagttctggntgtnngcccgcccgcgggtaaaaacccagcaac cctcaagntgggttcagggnattg; - tccggtgatcctgccggacctgactgctatcggattggtactaagcncatgtgagtcgttgcagcaatg
Caaggcagacggctcagtaacacgtagtcaacctaacctatggacggggataacctcgggaaactgagaa taatacccgatagatcatgatacctggaacggtttatggtccaaatgatttatcgccataggatggggct gcggtctatcagcttgttggtgaggtaatggcccaccaaggctataacagatacgggctctgagaggagg ggcccggagatgggtactgagacacggacccaggtcctatggggcgcagcaggcgagaaacctttgcaat gtgcgaaagcacgacaaggttaatccgagtgattccctgctaaaggaatcttttgttagtcataaaaacc cactgatgaataaggagtgggcaagttctggtgtcagccgccgcggtaaaacccaagcaccctcaagtgg; Caaggcagacggctcagtaacacgtagtcaacctaacctatggacggggataacctcgggaaactgagaa taatacccgatagatcatgatacctggaacggtttatggtccaaatgatttatcgccataggatggggct gcggtctatcagcttgttggtgaggtaatggcccaccaaggctataacagatacgggctctgagaggagg ggcccggagatgggtactgagacacggacccaggtcctatggggcgcagcaggcgagaaacctttgcaat gtgcgaaagcacgacaaggttaatccgagtgattccctgctaaaggaatcttttgttagtcataaaaacc cactgatgaataaggagtgggcaagttctggtgtcagccgccgcggtaaaacccaagcaccctcaagtgg;
- attccggttgatcctgccggagatcgctgctattagagttcgactaanntcncatgcaagttatctcgca agagaagcgacaggctcagtaacatgtcgttaatctaccctttcgcctggaataccctcgggaaactgag gttagcaccggatatgaaagatattctggaaagaattttttcttaaaggcatcacgaaaggatgagacgg caccagattgggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtccta gcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatg cacgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttc ggagaataagtggtgggtaaagactggtgccagccgccgcgggtaaccccancgccacaagtggggatca cgt; - attccggttgatcctgccggagatcgctgctattagagttcgactaanntcncatgcaagttatctcgca agagaagcgacaggctcagtaacatgtcgttaatctaccctttcgcctggaataccctcgggaaactgag gttagcaccggatatgaaagatattctggaaagaattttttcttaaaggcatcacgaaaggatgagacgg caccagattgggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtccta gcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatg cacgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggcctaaatacttc ggagaataagtacggaggtgtaaagcc
- ttccggttgatcctgccggaggctgctgctatctggtttgcaattagacatgcaagtctttttgtttttt cggaaatgaaaggcgaactgctcagtaacacgtagctaacctgccctaacgacggaaataatgtcgggaa actgactctaacatccgatagaagaagacaactggaatgtgttttctttcaagtcaggatggggctgcgg ctgattagcttgttggcggggtaatagcccaccaaggcgtannatcagtaagggctcttagcggagaagc cctgagaggggatctgagacactatccccagccctacggggtgcagcagtcgggaaacttctgcaatgta cgcaagtatgacagagcaagccagagtgattctctaataattgagcatctcttataatatgtaaaaagta ttatgaataaggactgggtaagactggtgccagccgccgcggtantaccagcagtccaagtagcagccgc; - ttccggttgatcctgccggaggctgctgctatctggtttgcaattagacatgcaagtctttttgtttttt cggaaatgaaaggcgaactgctcagtaacacgtagctaacctgccctaacgacggaaataatgtcgggaa actgactctaacatccgatagaagaagacaactggaatgtgttttctttcaagtcaggatggggctgcgg ctgattagcttgttggcggggtaatagcccaccaaggcgtannatcagtaagggctcttagcggagaagc cctgagaggggatctgagacactatccccagccctacggggtgcagcagtcgggaaacttctgcaatgta cgcaagtatgacagagcaagccagagtgattctctaataattgagcatctcttataatatgtaaaaagta ttatgaataaggactgggtaagactggtgccagccgccgcggtantaccagcagtccaagtagcagccgc;
- cccgccaattcctttaagtttcagtcttgcgaccgtacttcccaggcggcaaacttaacggcttccctgc ggcactgcactggccataagccagtgcatcaccgagtttgcatcgtttacagctgggactacccgggtat ctaatccggtttgctcccccagctttcatccctcaccgtcgaacgcgttctggtagaccgccttcgccac tggtggtcctcaatggatcagaggattttacccctacccaccgaataccgtctacctctcccgctcccta gctatgtagtatctccggcagcccatctgttaagcagatggatttaaccggagacttgcagagccggcta cggatgctttaggcccaataaacctcctaaccactcgaggtgctggtattaccgcggcggctgacaccag acttgcccaccccttattcaccagtagatttagaactgacaaaagatttcttcagcagaaatcactcgga ttaaacctagtcgtgctttcgcacattgctaaggtttcctcgcctgctgcgccnccataggg; - cccgccaattcctttaagtttcagtcttgcgaccgtacttcccaggcggcaaacttaacggcttccctgc ggcactgcactggccataagccagtgcatcaccgagtttgcatcgtttacagctgggactacccgggtat ctaatccggtttgctcccccagctttcatccctcaccgtcgaacgcgttctggtagaccgccttcgccac tggtggtcctcaatggatcagaggattttacccctacccaccgaataccgtctacctctcccgctcccta gctatgtagtatctccggcagcccatctgttaagcagatggatttaaccggagacttgcagagccggcta cggatgctttaggcccaataaacctcctaaccactcgaggtgctggtattaccgcggcggctgacaccag acttgcccaccccttattcaccagtagatttagaactgacaaaagatttcttcagcagaaatcactcgga ttaaacctagtcgtgctttcgcacattgctaaggtttcctcgcctgctgcgccnccataggg;
- gaatgctctagattttccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgaggataaaccgcgataggtcataatatctggaatgatttatggtttaaatctatatggcc tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggttattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcgggacgattattgggcctaaagcatccgt; - gaatgctctagattttccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgaggataaaccgcgataggtcataatatctggaatgatttatggtttaaatctatatggcc tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggttattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcgggacgattattgggcctaaagcatccgt;
- gtgaatcagctcggtacctcgcgatgctgntagatncccgccattcctttaagtntcagtcttgcgaccg tactccccangcngcagacttaacggcttccctgcggcactgggccggcatgaagccggcccatcaccga gtctgcatcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctca ccgtcgagcgcgttctgacaagccgccttcgccactggtggtcttcaatggatcagaggattttacccct acccactgagtaccgcttgcctctcccgcctcclagtcttgtagtatcttccgcagcccatctgttaage agctggatttaacggaagacttgcaagaccggctacggatgcttnaggcccaataatcgtcccgaccact cggggtgctggtattaccgcggcggctgacaccagacttgcccaccccttattctgcatcgtttttagag atgccaaaagatncccttagcgggaatcactcagagtaaccctgtcaggctttcgcctatttnagaggtt tcgcgcctgctgcgccccatagg ; - gtgaatcagctcggtacctcgcgatgctgntagatncccgccattcctttaagtntcagtcttgcgaccg tactccccangcngcagacttaacggcttccctgcggcactgggccggcatgaagccggcccatcaccga gtctgcatcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctca ccgtcgagcgcgttctgacaagccgccttcgccactggtggtcttcaatggatcagaggattttacccct acccactgagtaccgcttgcctctcccgcctcclagtcttgtagtatcttccgcagcccatctgttaage agctggatttaacggaagacttgcaagaccggctacggatgcttnaggcccaataatcgtcccgaccact cggggtgctggtatta cc g c ggcggctgaca cc aga c ttg cccacccc ttatt c tg ca t c gtttttagag atgccaaaagatncccttagcgggaatcactcagagtaaccctgtcaggctttcgcctatttnagaggtt tcgcgcctgctgcgccccatagg;
- agctcggtacctcgcgaatgctctagattcccgccaattcctttaagttcagtcttgcgaccgtactccc caggcggcagacttaacggcttccctgcggcactgggttggctcgaagccaacccatcaccgagtctgca tcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctcaccgtcga gcgcgttctggcaaaccgccttcgccactggtggtcttcagtagatcaatggattttacccctacccact gagtaccgtttgcctctcccgcctcctagctctgcggtatcctccgcagcccatccgttgagcaggtgga tttaacggaggacttgcagaacaagctacggatgctttaggcccaataatcgtcccgacaactcggggtg ctggtattaccgcggcggctgacaccagacttgcccaccccttattctgcaccatttttagaggtgccaa aagatacccttagcgggcatcactcagagtaaccctgtcaggctttcgcctattgcagaggtttcgcgcc tgctgcgccccatagggcctgggcccttgtctcagtgcccatctccgggctccttctctcaaagcccgta ccggtaaca; - agctcggtacctcgcgaatgctctagattcccgccaattcctttaagttcagtcttgcgaccgtactccc caggcggcagacttaacggcttccctgcggcactgggttggctcgaagccaacccatcaccgagtctgca tcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctcaccgtcga gcgcgttctggcaaaccgccttcgccactggtggtcttcagtagatcaatggattttacccctacccact gagtaccgtttgcctctcccgcctcctagctctgcggtatcctccgcagcccatccgttgagcaggtgga tttaacggaggacttgcagaacaagctacggatgctttaggcccaataatcgtcccgacaactcggggtg ctggtattaccgcggcggctgacaccagacttgcccaccccttattctgcaccatttttagaggtgccaa aagatacccttagcgggcatcactcagagtaaccctgtcaggctttcgcctattgcagaggtttcgcgcc tgctgcgccccatagggcctgggcccttgtctcagtgcccatctccgggctccttctctcaaagcccgta ccggtaaca;
- tgcntctagatttccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcg agtggctcagccaatacgagccacggcatacagctcagtaacacgtggctaatctgcccttaggacgaga acaaccccgggaaactggggctaactctcgataggcgaagaactctggaatgagtcttcacctaaatagt tcagcgttatgctcgttgaaccgcctaaggatgaggccgcgaccgatcaggttgttggtgaggtaatggc tcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagacaagggccca ggccctacggggcgcagcagtcgcgaaaactttgcaatacacgaaagtgtgacagggctatcccgagtgc catccgctgaggaaggcttttacccagtctagaaagctgggagaataaggagagggcaagtctggtgtca gccgccgcnggtaataccagctctcccgagtggtgtggatgtttaattgggccctaaa; - tgcntctagatttccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcg agtggctcagccaatacgagccacggcatacagctcagtaacacgtggctaatctgcccttaggacgaga acaaccccgggaaactggggctaactctcgataggcgaagaactctggaatgagtcttcacctaaatagt tcagcgttatgctcgttgaaccgcctaaggatgaggccgcgaccgatcaggttgttggtgaggtaatggc tcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagacaagggccca ggccctacggggcgcagcagtcgcgaaaactttgcaatacacgaaagtgtgacagggctatcccgagtgc catccgctgaggaaggcttttacccagtctagaaagctgggagaataaggagagggcaagtctggtgtca gccgccgcnggtaataccagctctcccgagtggtgtggatgtttaattgggccctaaa;
- aatgctgctagatatgccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgaggataaaccgcgataggtcataatatctggaatgatttatggtttaaatctatatggcc tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggtnattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcnggacgattattgggcctagagcatccgtagccngttctacaagtcttccgttaaatccacc tgcttaacagatgggctgcggaggatactatggagctaggaggcgggaga; - aatgctgctagatatgccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgaggataaaccgcgataggtcataatatctggaatgatttatggtttaaatctatatggcc tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggtnattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcnggacgattattgggcctagagcatccgtagccngttctacaagtcttccgttaaatccacc tgcttaacagatgggctgcggaggatactatggagctaggaggcgggaga;
- cgaatgcatctagatnattccggttgatcctgccggaccccactgctatcgggataggactaagacatgc tagtcgcgtgcctcagctaaaacgaggcacggcatacagctcagtaacacgtggctaatctgcccttggg ataggaacaaccccgggaaactggggctaattcccaataggcgaagaactctggaatgagtcttcaccag aaacgaacctacgttatgctcgtagaattcgcccaaggatgaggccgcgaccgatcaggttgttggtgag gtaatggctcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagaca agggcccaggccctacggggcgcagcagtcgcgaaaactttgcaataagcgaaagcttgacagggctatc ccgagtgccatccgctgaggaangcttttacccagtctagaacgctgggggaataaaggagagggcaagt ctggtgtcngccgccgcggtaaatac, - cgaatgcatctagatnattccggttgatcctgccggaccccactgctatcgggataggactaagacatgc tagtcgcgtgcctcagctaaaacgaggcacggcatacagctcagtaacacgtggctaatctgcccttggg ataggaacaaccccgggaaactggggctaattcccaataggcgaagaactctggaatgagtcttcaccag aaacgaacctacgttatgctcgtagaattcgcccaaggatgaggccgcgaccgatcaggttgttggtgag gtaatggctcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagaca agggcccaggccctacggggcgcagcagtcgcgaaaactttgcaataagcgaaagcttgacagggctatc ccgagtgccatccgctgaggaangcttttacccagtctagaacgctgggggaataaaggagagggcaagt ctggtgtcngccgccgcggtaaatac,
Указанные признаки являются существенными признаками изобретения, так как в своей совокупности обеспечивают достижение технического результата - повышение эффективности, упрощение технологии получения и снижения стоимости инокулянта. These features are essential features of the invention, since in their totality they ensure the achievement of a technical result - an increase in efficiency, a simplification of the production technology and a reduction in the cost of the inoculant.
Археи с указанными специфическими маркерами нуклеотидных последовательностей диагностического фрагмента гена 16S рРНК были обнаружены в глауконитовых рудах, а также в водных источниках месторождений глауконитовых руд Archaea with the indicated specific nucleotide sequence markers of the diagnostic fragment of the 16S rRNA gene were found in glauconite ores, as well as in water sources of glauconite ore deposits.
Исследование выявленных архей были выполнены в «Всероссийском научно- исследовательском институте сельскохозяйственной микробиологии» (г Санкт-Петербург). По результатам исследований установлено, что обнаруженные авторами изобретения микроорганизмы, которые являются микробиологической основой заявленного биокулянта, представляют собой микроорганизмы домена археи по трехдоменной системе биологической классификации. Таксономический анализ показал, что данные археи не имеют сходства с известными науке археями и точно идентифицировать их не удалось. Фактически, каждая из обнаруженных архей является новым видом микроорганизмов. Однако, каждая из обнаруженных архей имеет свой специфический маркер - нуклеотидную последовательность диагностического фрагмента гена 16S рРНК, по которой ее всегда можно идентифицировать, например, при выделении из других образцов или, например, в будущем, когда родственный организм будет изучен, наименован и проанализирован по гену 16S рРНК. The study of the identified archaea was carried out at the All-Russian Research Institute of Agricultural Microbiology (St. Petersburg). According to the research results, it was established that the microorganisms discovered by the authors of the invention, which are the microbiological basis of the claimed bioculant, are microorganisms of the archaea domain according to the three-domain biological classification system. Taxonomic analysis showed that the Archaean data have no similarity with the archaea known to science, and it was not possible to accurately identify them. In fact, each of the discovered archaea is a new type of microorganism. However, each of the discovered archaea has its own specific marker - the nucleotide sequence of the diagnostic fragment of the 16S rRNA gene, by which it can always be identified, for example, when isolated from other samples or, for example, in the future, when a related organism will be studied, named and analyzed by gene 16S rRNA.
Ближайшими родственниками по степени сходства являются микроорганизмы типов: Кренархеоты (Crenarchaeota), Эвриархеоты (Euryarchaeota). The closest relatives in terms of the degree of similarity are microorganisms of the following types: Crenarchaeota, Euryarchaeota.
Выявленные археи являются некультивируемыми одноклеточными микроорганизмами, что исключает потерю их свойств при смене поколений. Являются экстремофилами, то есть, способны выживать в экстремальных условиях окружающей среды (экстремально высокие или низкие температуры, давления, кислотность, щелочность, содержание кислорода и т. д ), что определяет выживаемость и стабильность микроорганизмов инокулянта в процессе хранения и использования Не являются патогенами. Устойчивы к антибиотикам, что гарантирует их выживание при использовании в растениеводстве препаратов, содержащих антибиотики. The identified archaea are uncultivated unicellular microorganisms, which excludes the loss of their properties during generational change. They are extremophiles, that is, they are able to survive in extreme environmental conditions (extremely high or low temperatures, pressures, acidity, alkalinity, oxygen content, etc.), which determines the survival and stability of microorganisms of the inoculant during storage and use. pathogens. They are resistant to antibiotics, which guarantees their survival when using preparations containing antibiotics in crop production.
В отличие от известных почвенных микроорганизмов (микроорганизмов ризосферы) вывяленные археи не являются сапротрофами, азотфиксаторами, фосфатмобилизаторами и т. д. То есть, они не выполняют непосредственно функции, присущие представителям почвенной микрофлоры. В то же время полевые и микро полевые испытания биокулянта с указанными археями на различных сельскохозяйственных культурах показали его высокую эффективность. Результаты испытаний приведены в следующих разделах описания. Unlike the known soil microorganisms (microorganisms of the rhizosphere), the identified archaea are not saprotrophs, nitrogen fixers, phosphate mobilizers, etc. That is, they do not directly perform the functions inherent in the representatives of the soil microflora. At the same time, field and micro-field tests of the bioculant with the indicated archaea on various agricultural crops have shown its high efficiency. The test results are shown in the following sections of the description.
Авторы изобретения объясняют эффективность заявляемого инокулянта взаимодействием выявленных архей с представителями естественной почвенной микрофлоры на некотором информационном уровне путем известного горизонтального переноса генов, что обеспечивает усиление их полезных функций, а также взаимодействием с растениями на генном уровне Установлено, что следующие поколения растений, выращенных с применением заявляемого инокулянта, сохраняют приобретенные свойства на генном уровне. The authors of the invention explain the effectiveness of the claimed inoculant by the interaction of the identified archaea with representatives of the natural soil microflora at a certain information level by means of the known horizontal gene transfer, which enhances their useful functions, as well as interaction with plants at the genetic level. inoculant, retain the acquired properties at the genetic level.
В качестве носителя целесообразно использовать порошкообразный глауконит или водную суспензию порошкообразного глауконита Глауконит - минерал, водный алюмосиликат железа, кремнезема и оксида калия непостоянного состава Содержит окись калия (К20) 4, 4-9, 4 %, окись натрия (Na20) до 3,5 %, окись алюминия (А1203) 5,5-22,6 %, окись железа (Fe203) 6,1-27 %, закись железа (FeO) 0,8-8, 6 %, окись магния (МдО) 2,4-4, 5 %, двуокись кремния (Si02) 47,6-52,9 %, вода (Н20) 4,9-13,5%. Разнообразие неорганических веществ в глауконите обеспечивает удовлетворительное среду обитания для выявленных архей. As a carrier, it is advisable to use powdered glauconite or an aqueous suspension of powdered glauconite Glauconite is a mineral, aqueous aluminosilicate of iron, silica and potassium oxide of variable composition Contains potassium oxide (K 2 0) 4, 4-9, 4%, sodium oxide (Na 2 0) up to 3.5%, aluminum oxide (A1 2 0 3 ) 5.5-22.6%, iron oxide (Fe 2 0 3 ) 6.1-27%, iron oxide (FeO) 0.8-8.6 %, magnesium oxide (MgO) 2,4-4, 5%, silicon dioxide (Si0 2) 47,6-52,9%, water (H 2 0) 4,9-13,5%. The variety of inorganic substances in glauconite provides a satisfactory habitat for the identified archaea.
Приготовление инокулянта включает простое введение заданного количества микроорганизмов в порошкообразный глауконит или в водную суспензию порошкообразного глауконита, дальнейшее инкубирование (ферментация) не требуется, что упрощает технологию получения и снижает стоимость инокулянта The preparation of the inoculant includes a simple introduction of a given number of microorganisms into powdered glauconite or into an aqueous suspension of powdered glauconite; further incubation (fermentation) is not required, which simplifies the production technology and reduces the cost of the inoculant
Ниже приводится описание заявляемого инокулянта для растений, особенностей его применения и полученных результатов со ссылками на изображения (фотографии), на которых показано: Below is a description of the claimed inoculant for plants, the features of its use and the results obtained with links to images (photographs), which show:
Фото 1 - Инокулянт для растений, пример выращивания томатов, инокулированное растение. Photo 1 - Inoculant for plants, an example of growing tomatoes, inoculated plant.
Фото 2 - Инокулянт для растений, пример выращивания томатов, контрольный образец. Photo 2 - Inoculant for plants, example of growing tomatoes, control sample.
Фото 3 - Инокулянт для растений, пример выращивания пшеницы Фото 4 - Инокулянт для растений, пример выращивания подсолнечника, результаты всхожести семян по состоянию на начало июня Photo 3 - Inoculant for plants, an example of growing wheat Photo 4 - Inoculant for plants, an example of sunflower cultivation, the results of seed germination as of the beginning of June
Фото 5 - Инокулянт для растений, пример выращивания подсолнечника, вегетация по состоянию на середину июля. Фото 6 - Инокулянт для растений, пример выращивания подсолнечника, вегетация по состоянию на начало августа. Photo 5 - Inoculant for plants, an example of sunflower cultivation, vegetation as of mid-July. Photo 6 - Inoculant for plants, an example of sunflower cultivation, vegetation as of early August.
Фото 7 - Инокулянт для растений, пример выращивания подсолнечника, период созревания семян по состоянию на начало сентября. Photo 7 - Plant inoculant, example of sunflower cultivation, seed ripening period as of early September.
Заявленный инокулянт для растений содержит носитель с микробиологическими культурами, в котором в качестве микробиологических культур использованы микроорганизмы домена археи, которые характеризуются одним из следующих специфических маркеров нуклеотидных последовательностей диагностического фрагмента гена 16S рРНК: - ggttgatcctgccggagatcgctgctattagagttcgactaagccatgcaagtcatctcgcaagagaggc gacaggctcagtaacatgtcgttaatctaccctttcgcccagaataccctcgggaaactgaggttaatac tggatatgaaagatattctggaaagaattttttcttaaaggcaacacgaaaggatgagacggcaccagat taggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtcctagcccggag aggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatgcacgaaag tgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttcggagaata agtggtgggtaagactggtgccagccgccgcggtanccccagcgccacaagtggggatcacgtttatttg gtctaaagcgttcgtaccagg ; Stated inoculant for plants comprises a carrier with microbial cultures, wherein the microbial cultures used Archaea domain microorganisms which are characterized by one of the following nucleotide sequences specific markers diagnostic gene fragment 16S rRNA: - ggttgatcctgccggagatcgctgctattagagttcgactaagccatgcaagtcatctcgcaagagaggc gacaggctcagtaacatgtcgttaatctaccctttcgcccagaataccctcgggaaactgaggttaatac tggatatgaaagatattctggaaagaattttttcttaaaggcaacacgaaaggatgagacggcaccagat taggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtcctagcccggag aggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatgcacgaaag tgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttcggagaata agtggtgggtaagactggtgccagccgccgcggtanccccagcgccacaagtggggatcacgtttatttg gtctaaagcgttcgtaccagg;
- attccggttgatcctgccggacctgactgctatcggattgatactaatnnccatgcgagtcattgtagca atacaaggcagacggctcagtagcgcgtagtcaatctaccctatggacgggaataacctcgggaaactga gaataatgcccgatagaacattatgcctggaatggtttatgtttcaaatgatttatcgccataggatggg actgcggcctatcagtttgttggtgaggtaatggcccaccaagactattacaggtacgggctctgagagg agtggcccggagatgggtactgagacacggacccaggccctatggggcgcagcaggcgggaaaactttgc aatgtgcgaaagcacgacnaaggttaatccgagtggtttctgctaaagaaaccttttgtcagtcctagaa accactaaacgaataagggggtgggncaagttctggntgtnngcccgcccgcgggtaaaaacccagcaac cctcaagntgggttcagggnattg; - attccggttgatcctgccggacctgactgctatcggattgatactaatnnccatgcgagtcattgtagca atacaaggcagacggctcagtagcgcgtagtcaatctaccctatggacgggaataacctcgggaaactga gaataatgcccgatagaacattatgcctggaatggtttatgtttcaaatgatttatcgccataggatggg actgcggcctatcagtttgttggtgaggtaatggcccaccaagactattacaggtacgggctctgagagg agtggcccggagatgggtactgagacacggacccaggccctatggggcgcagcaggcgggaaaactttgc aatgtgcgaaagcacgacnaaggttaatccgagtggtttctgctaaagaaaccttttgtcagtcctagaa accactaaacgaataagggggtgggncaagttctggntgtnngcccgcccgcgggtaaaaacccagcaac cctcaagntgggttcagggnattg;
- tccggttgatcctgccggacctgactgctatcggattggtactaagcncatgtgagtcgttgcagcaatg Caaggcagacggctcagtaacacgtagtcaacctaacctatggacggggataacctcgggaaactgagaa taatacccgatagatcatgatacctggaacggtttatggtccaaatgatttatcgccataggatggggct gcggtctatcagcttgttggtgaggtaatggcccaccaaggctataacagatacgggctctgagaggagg ggcccggagatgggtactgagacacggacccaggtcctatggggcgcagcaggcgagaaacctttgcaat gtgcgaaagcacgacaaggttaatccgagtgattccctgctaaaggaatcttttgttagtcataaaaacc cactgatgaataaggagtgggcaagttctggtgtcagccgccgcggtaaaacccaagcaccctcaagtgg; - tccggttgatcctgccggacctgactgctatcggattggtactaagcncatgtgagtcgttgcagcaatg Caaggcagacggctcagtaacacgtagtcaacctaacctatggacggggataacctcgggaaactgagaa taatacccgatagatcatgatacctggaacggtttatggtccaaatgatttatcgccataggatggggct gcggtctatcagcttgttggtgaggtaatggcccaccaaggctataacagatacgggctctgagaggagg ggcccggagatgggtactgagacacggacccaggtcctatggggcgcagcaggcgagaaacctttgcaat gtgcgaaagcacgacaaggttaatccgagtgattccctgctaaaggaatcttttgttagtcataaaaggaatcttttgttagtcataaaaggaatcttttgttagtcataacccccctcataaaaaaccta cactaggatgagataag
- attccggttgatcctgccggagatcgctgctattagagttcgactaanntcncatgcaagttatctcgca agagaagcgacaggctcagtaacatgtcgttaatctaccctttcgcctggaataccctcgggaaactgag gttagcaccggatatgaaagatattctggaaagaattttttcttaaaggcatcacgaaaggatgagacgg caccagattgggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtccta gcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatg cacgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttc ggagaataagtggtgggtaaagactggtgccagccgccgcgggtaaccccancgccacaagtggggatca cgt; - attccggttgatcctgccggagatcgctgctattagagttcgactaanntcncatgcaagttatctcgca agagaagcgacaggctcagtaacatgtcgttaatctaccctttcgcctggaataccctcgggaaactgag gttagcaccggatatgaaagatattctggaaagaattttttcttaaaggcatcacgaaaggatgagacgg caccagattgggctgttggcggtgtaatggaccaccaaacctacgatctgtacgggggatgaaagtccta gcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatg cacgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttc ggagaataagtggtgggtaaagactggtgccagccgccgcgggtaaccccancgccacaagtggggatca cgt;
- ttccggttgatcctgccggaggctgctgctatctggtttgcaattagacatgcaagtctttttgtttttt cggaaatgaaaggcgaactgctcagtaacacgtagctaacctgccctaacgacggaaataatgtcgggaa actgactctaacatccgatagaagaagacaactggaatgtgttttctttcaagtcaggatggggctgcgg ctgattagcttgttggcggggtaatagcccaccaaggcgtannatcagtaagggctcttagcggagaagc cctgagaggggatctgagacactatccccagccctacggggtgcagcagtcgggaaacttctgcaatgta cgcaagtatgacagagcaagccagagtgattctctaataattgagcatctcttataatatgtaaaaagta ttatgaataaggactgggtaagactggtgccagccgccgcggtantaccagcagtccaagtagcagccgc; - ttccggttgatcctgccggaggctgctgctatctggtttgcaattagacatgcaagtctttttgtttttt cggaaatgaaaggcgaactgctcagtaacacgtagctaacctgccctaacgacggaaataatgtcgggaa actgactctaacatccgatagaagaagacaactggaatgtgttttctttcaagtcaggatggggctgcgg ctgattagcttgttggcggggtaatagcccaccaaggcgtannatcagtaagggctcttagcggagaagc cctgagaggggatctgagacactatccccagccctacggggtgcagcagtcgggaaacttctgcaatgta cgcaagtatgacagagcaagccagagtgattctctaataattgagcatctcttataatatgtaaaaagta ttatgaataaggactgggtaagactggtgccagccgccgcggtantaccagcagtccaagtagcagccgc;
- cccgccaattcctttaagtttcagtcttgcgaccgtacttcccaggcggcaaacttaacggcttccctgc ggcactgcactggccataagccagtgcatcaccgagtttgcatcgtttacagctgggactacccgggtat ctaatccggtttgctcccccagctttcatccctcaccgtcgaacgcgttctggtagaccgccttcgccac tggtggtcctcaatggatcagaggattttacccctacccaccgaataccgtctacctctcccgctcccta gctatgtagtatctccggcagcccatctgttaagcagatggatttaaccggagacttgcagagccggcta cggatgctttaggcccaataaacctcctaaccactcgaggtgctggtattaccgcggcggctgacaccag acttgcccaccccttattcaccagtagatttagaactgacaaaagatttcttcagcagaaatcactcgga ttaaacctagtcgtgctttcgcacattgctaaggtttcctcgcctgctgcgccnccataggg; - cccgccaattcctttaagtttcagtcttgcgaccgtacttcccaggcggcaaacttaacggcttccctgc ggcactgcactggccataagccagtgcatcaccgagtttgcatcgtttacagctgggactacccgggtat ctaatccggtttgctcccccagctttcatccctcaccgtcgaacgcgttctggtagaccgccttcgccac tggtggtcctcaatggatcagaggattttacccctacccaccgaataccgtctacctctcccgctcccta gctatgtagtatctccggcagcccatctgttaagcagatggatttaaccggagacttgcagagccggcta cggatgctttaggcccaataaacctcctaaccactcgaggtgctggtattaccgcggcggctgacaccag acttgcccaccccttattcaccagtagatttagaactgacaaaagatttcttcagcagaaatcactcgga ttaaacctagtcgtgctttcgcacattgctaaggtttcctcgcctgctgcgccnccataggg;
- gaatgctctagattttccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgaggataaaccgcgataggtcataatatctggaatgatttatggtttaaatctatatggcc tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggttattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcgggacgattattgggcctaaagcatccgt; - gaatgctctagattttccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgaggataaaccgcgataggtcataatatctggaatgatttatggtttaaatctatatggcc tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggttattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcgggacgattattgggcctaaagcatccgt;
- gtgaatcagctcggtacctcgcgatgctgntagatncccgccattcctttaagtntcagtcttgcgaccg tactccccangcngcagacttaacggcttccctgcggcactgggccggcatgaagccggcccatcaccga gtctgcatcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctca ccgtcgagcgcgttctgacaagccgccttcgccactggtggtcttcaatggatcagaggattttacccct acccactgagtaccgcttgcctctcccgcctcctagtcttgtagtatcttccgcagcccatctgttaage agctggatttaacggaagacttgcaagaccggctacggatgcttnaggcccaataatcgtcccgaccact cggggtgctggtattaccgcggcggctgacaccagacttgcccaccccttattctgcatcgtttttagag atgccaaaagatncccttagcgggaatcactcagagtaaccctgtcaggctttcgcctatttnagaggtt tcgcgcctgctgcgccccatagg; - gtgaatcagctcggtacctcgcgatgctgntagatncccgccattcctttaagtntcagtcttgcgaccg tactccccangcngcagacttaacggcttccctgcggcactgggccggcatgaagccggcccatcaccga gtctgcatcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctca ccgtcgagcgcgttctgacaagccgccttcgccactggtggtcttcaatggatcagaggattttacccct acccactgagtaccgcttgcctctcccgcctcctagtcttgtagtatcttccgcagcccatctgttaage agctggatttaacggaagacttgcaagaccggctacggatgcttnaggcccaataatcgtcccgaccact cggggtg c tggtattaccgcggcgg c tga c ac c agacttgcccaccccttattctgcatcgtttttagag atgccaaaagatncccttagcgggaatcactcagagtaaccctgtcaggctttcgcctatttnagaggtt tcgcgcctgctgcgccccatagg;
- agctcggtacctcgcgaatgctctagattcccgccaattcctttaagttcagtcttgcgaccgtactccc caggcggcagacttaacggcttccctgcggcactgggttggctcgaagccaacccatcaccgagtctgca tcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctcaccgtcga gcgcgttctggcaaaccgccttcgccactggtggtcttcagtagatcaatggattttacccctacccact gagtaccgtttgcctctcccgcctcctagctctgcggtatcctccgcagcccatccgttgagcaggtgga tttaacggaggacttgcagaacaagctacggatgctttaggcccaataatcgtcccgacaactcggggtg ctggtattaccgcggcggctgacaccagacttgcccaccccttattctgcaccatttttagaggtgccaa aagatacccttagcgggcatcactcagagtaaccctgtcaggctttcgcctattgcagaggtttcgcgcc tgctgcgccccatagggcctgggcccttgtctcagtgcccatctccgggctccttctctcaaagcccgta ccggtaaca; - agctcggtacctcgcgaatgctctagattcccgccaattcctttaagttcagtcttgcgaccgtactccc caggcggcagacttaacggcttccctgcggcactgggttggctcgaagccaacccatcaccgagtctgca tcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctcaccgtcga gcgcgttctggcaaaccgccttcgccactggtggtcttcagtagatcaatggattttacccctacccact gagtaccgtttgcctctcccgcctcctagctctgcggtatcctccgcagcccatccgttgagcaggtgga tttaacggaggacttgcagaacaagctacggatgctttaggcccaataatcgtcccgacaactcggggtg ctggtattaccgcggcggctgacaccagacttgcccaccccttattctgcaccatttttagaggtgccaa aagatacccttagcgggcatcactcagagtaaccctgtcaggctttcgcctattgcagaggtttcgcgcc tgctgcgccccatagggcctgggcccttgtctcagtgcccatctccgggctccttctctcaaagcccgta ccggtaaca;
- tgcntctagatttccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcg agtggctcagccaatacgagccacggcatacagctcagtaacacgtggctaatctgcccttaggacgaga acaaccccgggaaactggggctaactctcgataggcgaagaactctggaatgagtcttcacctaaatagt tcagcgttatgctcgttgaaccgcctaaggatgaggccgcgaccgatcaggttgttggtgaggtaatggc tcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagacaagggccca ggccctacggggcgcagcagtcgcgaaaactttgcaatacacgaaagtgtgacagggctatcccgagtgc catccgctgaggaaggcttttacccagtctagaaagctgggagaataaggagagggcaagtctggtgtca gccgccgcnggtaataccagctctcccgagtggtgtggatgtttaattgggccctaaa; - tgcntctagatttccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcg agtggctcagccaatacgagccacggcatacagctcagtaacacgtggctaatctgcccttaggacgaga acaaccccgggaaactggggctaactctcgataggcgaagaactctggaatgagtcttcacctaaatagt tcagcgttatgctcgttgaaccgcctaaggatgaggccgcgaccgatcaggttgttggtgaggtaatggc tcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagacaagggccca ggccctacggggcgcagcagtcgcgaaaactttgcaatacacgaaagtgtgacagggctatcccgagtgc catccgctgaggaaggcttttacccagtctagaaagctgggagaataaggagagggcaagtctggtgtca gccgccgcnggtaataccagctctcccgagtggtgtggatgtttaattgggccctaaa;
- aatgctgctagatatgccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgaggataaaccgcgataggtcataatatctggaatgatttatggtttaaatctatatggcc tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggtnattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcnggacgattattgggcctaaagcatccgtagccngttctacaagtcttccgttaaatccacc tgcttaacagatgggctgcggaggatactatggagctaggaggcgggaga; - aatgctgctagatatgccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgag tcaacgtagcaatacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacct cgggaaactgagatatatatagttaccgttcgtt tctggattggactgcggccgatcaggctgttggtgaggtaatggcccaccaaacctaaaaccggtacggg ctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgcagcaggcgcg aaaactctgcaataagcgaaagcttgacagggtnattctgagtgatttccgctaaggaaatcttttggca cctctaaaaatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcacccc gagtggtcnggacgattattgggcctaaagcatccgtagccngttctacaagtcttccgttaaatccacc tgcttaacagatgggctgcggaggatactatggagctaggaggcgggaga;
- cgaatgcatctagatnattccggttgatcctgccggaccccactgctatcgggataggactaagacatgc tagtcgcgtgcctcagctaaaacgaggcacggcatacagctcagtaacacgtggctaatctgcccttggg ataggaacaaccccgggaaactggggctaattcccaataggcgaagaactctggaatgagtcttcaccag aaacgaacctacgttatgctcgtagaattcgcccaaggatgaggccgcgaccgatcaggttgttggtgag gtaatggctcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagaca agggcccaggccctacggggcgcagcagtcgcgaaaactttgcaataagcgaaagcttgacagggctatc ccgagtgccatccgctgaggaangcttttacccagtctagaacgctgggggaataaaggagagggcaagt ctggtgtcngccgccgcggtaaatac, - cgaatgcatctagatnattccggttgatcctgccggaccccactgctatcgggataggactaagacatgc tagtcgcgtgcctcagctaaaacgaggcacggcatacagctcagtaacacgtggctaatctgcccttggg ataggaacaaccccgggaaactggggctaattcccaataggcgaagaactctggaatgagtcttcaccag aaacgaacctacgttatgctcgtagaattcgcccaaggatgaggccgcgaccgatcaggttgttggtgag gtaatggctcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagaca agggcccaggccctacggggcgcagcagtcgcgaaaactttgcaataagcgaaagcttgacagggctatc ccgagtgccatccgctgaggaangcttttacccagtctagaacgctgggggaataaaggagagggcaagt ctggtgtcngccgccgcggtaaatac,
Археи с указанными специфическими маркерами могут быть выделены из глауконитовых руд, а также из водных источников месторождений глауконитовых руд Archaea with the specified specific markers can be isolated from glauconite ores, as well as from water sources of glauconite ore deposits.
В качестве носителя использован порошкообразный глауконит или водная суспензия порошкообразного глауконита. Глауконит, содержащий многообразие неорганических веществ, обеспечивает удовлетворительную среду для существования данных архей. Инокулянт готовят следующим образом. Powdered glauconite or an aqueous suspension of powdered glauconite was used as a carrier. Glauconite, containing a variety of inorganic substances, provides a satisfactory environment for the existence of these archaea. The inoculant is prepared as follows.
Готовят носитель путем измельчения глауконита до мелкозернистого состояния или готовят водную суспензии глауконитового порошка. Содержание глауконита в водной суспензии составляет 0,5 - 50 весовых процентов. A carrier is prepared by grinding glauconite to a fine-grained state, or an aqueous suspension of glauconite powder is prepared. The content of glauconite in the aqueous suspension is 0.5 to 50 weight percent.
В приготовленный носитель вводят археи в количестве от 102-106 микроорганизмов на 1 см3 носителя. В результате получают сыпучий инокулянт (при использовании в качестве носителя порошка глауконита) или жидкий инокулянт (при использовании в качестве носителя водной суспензии порошка глауконита). Archaea are introduced into the prepared carrier in an amount of 102-106 microorganisms per 1 cm 3 of the carrier. The result is a free-flowing inoculant (when using glauconite powder as a carrier) or a liquid inoculant (when using an aqueous suspension of glauconite powder as a carrier).
Инокулянт расфасовывают в соответствующую, например полиэтиленовую тару и отправляют на хранение. Хранение осуществляют при температуре не выше 70 °С при влажности не ниже 5 %. Срок хранения инокулянта - не ограничен The inoculant is packaged in an appropriate, for example, plastic container and sent to storage. Storage is carried out at a temperature not exceeding 70 ° C with a humidity not lower than 5%. The shelf life of the inoculant is not limited
Применяют инокулянт путем предпосевной обработки семян (замачивание, инкрустация, дражирование по известным технологиям), замачивания черенков или корневой системы саженцев, введения в почву при посадке (посеве) растений, обработки надземной части растений и подкормки в период вегетации, используя эффективное количество биокулянта в зависимости от вида растения, природы и состояния почвы. Для любого конкретного случая «эффективное количество» может определить специалист в данной области, используя обычные эксперименты. An inoculant is applied by pre-sowing seed treatment (soaking, inlaying, pelleting according to known technologies), soaking cuttings or the root system of seedlings, introducing into the soil when planting (sowing) plants, treating the aerial part of plants and feeding during the growing season, using an effective the amount of bioculant depending on the type of plant, nature and soil condition. For any particular case, the "effective amount" can be determined by one of ordinary skill in the art using routine experimentation.
Применение заявленного инокулянта: - обеспечивает высокую приживаемость саженцев и рассады, Application of the declared inoculant: - ensures high survival rate of seedlings and seedlings,
- способствует быстрому укоренению черенков; - promotes the rapid rooting of cuttings;
- стимулирует образование корней, рост и развитие растений; - stimulates the formation of roots, growth and development of plants;
- повышает иммунитет растений к стрессовым ситуациям и заболеваниям; - increases the immunity of plants to stressful situations and diseases;
- предупреждает поступление канцерогенов, радионуклидов и тяжелых металлов в растение; - prevents the entry of carcinogens, radionuclides and heavy metals into the plant;
- улучшает (стабилизирует) качество почвы; - improves (stabilizes) the quality of the soil;
- обеспечивает повышение продуктивности растений в широком смысле, то есть, повышение биомассы или урожайности листьев, стеблей, зерна, фруктов, овощей, цветов или других частей растения, которые используются для различных целей. Эффективность заявленного инокулянта подтверждена полевыми экспериментами.- provides an increase in the productivity of plants in a broad sense, that is, an increase in the biomass or yield of leaves, stems, grains, fruits, vegetables, flowers or other parts of the plant that are used for various purposes. The effectiveness of the claimed inoculant has been confirmed by field experiments.
Ниже приводятся примеры применения заявленного инокулянта и полученные результаты. Below are examples of the application of the claimed inoculant and the results obtained.
Пример 1 Выращивание томатов. Для эксперимента был выбран сорт «Микадо желтый (низкорослый)», характеризующийся повышенной требовательностью к условиям выращивания. Эксперимент проводился в Броварском районе Киевской области, Украина, на бедных супесчаных почвах с низким плодородием, характерных для восточной части Киевской области. Площадь экспериментального участка 0,1 га Example 1 Growing tomatoes. For the experiment, the variety "Mikado yellow (undersized)" was chosen, which is characterized by increased demands on growing conditions. The experiment was carried out in the Brovarsky district of the Kiev region, Ukraine, on poor sandy loam soils with low fertility, typical of the eastern part of the Kiev region. The area of the experimental site is 0.1 hectares
Корневая система высаженной рассады томатов была предварительно замочена в жидком инокулянте (носитель - водная одно процентная суспензия порошка глауконита). Контрольная рассада замачивалась в простой воде Условия замачивания (время, температура) были одинаковыми. Условия полива испытуемых и контрольных растений в период вегетации были равными В период вегетации выполнялось четыре корневые подкормки, подкормка испытуемых образцов выполнялось с добавлением инокулянта. The root system of the planted tomato seedlings was pre-soaked in a liquid inoculant (the carrier is an aqueous 1% suspension of glauconite powder). The control seedlings were soaked in plain water. Soaking conditions (time, temperature) were the same. The watering conditions for the test and control plants during the growing season were equal. During the growing season, four root dressings were carried out, the feeding of the test samples was carried out with the addition of an inoculant.
Результаты эксперимента показаны на фото 1 , 2. Фото 1 - с применением инокулянта (инокулированные растения), фото 2 - без применения инокулянта (контрольные растения). Инокулированные томаты (фото 1) имеют обширные здоровые кусты, количество плодов на кусте от 25 до 50 единиц Контрольные томаты (фото 2), как правило, имеют один стебель и немного плодов (от 10 до 16 плодов). То есть применение заявленного инокулянта повышает урожайность томатов не менее чем в два раза. The results of the experiment are shown in photos 1, 2. Photo 1 - with the use of an inoculant (inoculated plants), photo 2 - without the use of an inoculant (control plants). Inoculated tomatoes (photo 1) have extensive healthy bushes, the number of fruits per bush is from 25 to 50 units Control tomatoes (photo 2), as a rule, have one stem and few fruits (from 10 to 16 fruits). That is, the use of the declared inoculant increases the yield of tomatoes at least twice.
Пример 2. Выращивание пшеницы. Для эксперимента был выбран озимый сорт «Акратос» (немецкий сорт). Эксперимент проводился в Барышевском районе Киевской области, Украина. Площадь экспериментального участка 10 га - 5 га с применением заявленного инокулянта и 5 га без инокулянта (контрольная участок) Example 2. Growing wheat. The winter cultivar "Akratos" (German cultivar) was chosen for the experiment. The experiment was carried out in the Baryshevsky district of Kiev region, Ukraine. The area of the experimental plot is 10 hectares - 5 hectares with the use of the declared inoculant and 5 hectares without the inoculant (control plot)
Известно, что основной задачей посева озимой пшеницы является формирование корневой системы растений, позволяющее перенести неблагоприятные условия зимовки и обеспечить весеннюю вегетацию с минимальными потерями, что имеет решающее значение в реализации потенциальной продуктивности культуры It is known that the main task of sowing winter wheat is the formation of the root system of plants, which makes it possible to endure unfavorable wintering conditions and ensure spring vegetation with minimal losses, which is of decisive importance in realizing the potential productivity of the crop.
Семена пшеницы предварительно перед посевом были обработаны заявленным инокулянтом. Применялся жидкий инокулянт (носитель - водная одно процентная суспензия порошка глауконита). Контрольные семена предпосевной обработке не подвергались Для чистоты эксперимента обработанная пшеница была посеяна рядом с необработанной (контроль) в таком же объеме с использованием одинаковой техники и технологии посеваWheat seeds were pretreated with the declared inoculant before sowing. A liquid inoculant was used (the carrier was an aqueous 1% suspension of glauconite powder). Control seeds were not subjected to pre-sowing treatment For the purity of the experiment, the treated wheat was sown next to untreated (control) in the same volume using the same technique and sowing technology
Результаты показаны на фото 3. С левой стороны - образцы растений с предпосевной обработкой инокулянтом (инокулированные растения), с правой стороны - без обработки (контрольные растения). The results are shown in photo 3. On the left side - plant samples with pre-sowing treatment with an inoculant (inoculated plants), on the right side - without treatment (control plants).
Инокулированные образцы (фото 3, слева) характеризуются большим количеством побегов, высокой кустистостью, развитой корневой системой с вторичными корнями, чем выгодно отличаются от контрольных образцов (фото 3, справа). Inoculated samples (photo 3, left) are characterized by a large number of shoots, high bushiness, developed root system with secondary roots, which compares favorably with control samples (photo 3, right).
В период осенне-весенней вегетации выполнялось три внекорневые обработки, обработка испытуемых растений выполнялась с добавлением заявленного инокулянта. During the autumn-spring growing season, three foliar treatments were carried out, the treatment of the test plants was carried out with the addition of the declared inoculant.
Урожайность инокулированной пшеницы превысила урожайность контрольной наThe yield of inoculated wheat exceeded the yield of the control one by
50%. 50%.
Пример 3. Выращивание подсолнечника. Для микро-полевого эксперимента был выбран сорт отечественного производителя. Эксперимент проводился в Броварском районе Киевской области, Украина, на супесчаной дерново-слабоподзолистой почве Размер участка 2,5 м х 6 м; площадь участка 15 м2; расстояние между рядами 0,7 м; расстояние между растениями в ряду 0,3 м. Example 3. Growing sunflower. For the micro-field experiment, a variety of a domestic manufacturer was selected. The experiment was carried out in the Brovarsky district of the Kiev region, Ukraine, on a sandy loamy soddy-weakly podzolic soil Plot size 2.5 mx 6 m; plot area 15 m 2 ; distance between rows 0.7 m; the distance between plants in a row is 0.3 m.
Семена подсолнечника предварительно перед посевом были замочены в заявленном инокулянте. Применялся жидкий инокулянт (носитель - водная одно процентная суспензия порошка глауконита). Контрольные семена предварительно перед посевом замачивали в обычной воде. Все работы по проведению микро-полевого эксперимента (разметка и перекопка участка, посев подсолнечника, прополки, сбор урожая) выполнялись вручную. В период микро-полевых работ не проводилось никаких подкормок и обработок, не использовались минеральные удобрения. Микро-полевые работы проводились в период май - сентябрь: замачивание семян, высадка в грунт - начало мая, сбор урожая - середина сентября. Результаты фенологических наблюдений в течение вегетационного периода показаны на фото 4-7. На указанных фото видны существенные различия в росте и развитии растений подсолнечника, семена которого замачивали в заявленном инокулянте, в сравнении с растениями, семена которых замачивали в обычной воде (контроль). Sunflower seeds were pre-soaked before sowing in the declared inoculant. A liquid inoculant was used (the carrier was an aqueous 1% suspension of glauconite powder). Control seeds were pre-soaked in ordinary water before sowing. All work on the micro-field experiment (marking and digging the site, sowing sunflower, weeding, harvesting) was carried out manually. During the period of micro-field work, no additional fertilizing and processing was carried out, no mineral fertilizers were used. Micro-field work was carried out in the period May - September: seed soaking, planting in the ground - early May, harvesting - mid September. The results of phenological observations during the growing season are shown in Photos 4-7. These photos show significant differences in the growth and development of sunflower plants, the seeds of which were soaked in the claimed inoculant, in comparison with plants, the seeds of which were soaked in ordinary water (control).
На фото 4 показаны результаты всхожести семян по состоянию на начало июня. С левой стороны фото - контрольные растения. Всхожесть семян, замоченных в заявленном инокулянт, составила 20 из 20, всхожесть семян, замоченных в обычной воде - 18 из 20 Стебли инокулированных растений толще контрольных в 2-3 раза, они, как минимум, в 2 раза выше, их листья, находящиеся в средней части стебля, значительно больше в сравнении с контрольными. Photo 4 shows the results of seed germination as of early June. On the left side of the photo are control plants. The germination capacity of seeds soaked in the declared inoculant was 20 out of 20, the germination capacity of seeds soaked in ordinary water was 18 out of 20. the middle part of the stem, much more in comparison with the control.
На фото 5 показано развитие растений по состоянию на середину июля С левой стороны фото - контрольные растения. Инокулированные растения имеют насыщенный зеленый цвет, высокие, с толстыми стеблями и широкими листьями. Контрольные растения отстают в росте и развитии, низкие, количество и размер листьев меньше Photo 5 shows the development of plants as of mid-July. On the left side of the photo are control plants. Inoculated plants are deep green, tall, with thick stems and broad leaves. Control plants lag behind in growth and development, are low, the number and size of leaves are less
На фото 6 показано развитие растений по состоянию на начало августа. С левой стороны фото - контрольные растения. В инокулированных растениях корзины значительно больше, не имеют деформаций, семена расположены в корзинах равномерно, растения имеют здоровый вид. В контрольных растениях на листьях присутствуют мелкие пятнышки, местами имеется бурая пятнистость, соцветия уменьшены в размерах, деформированы или отсутствуют. Photo 6 shows the development of plants as of early August. On the left side of the photo are control plants. In the inoculated plants, the baskets are much larger, do not have deformations, the seeds are evenly distributed in the baskets, the plants look healthy. In the control plants, small specks are present on the leaves, in some places there is a brown spot, the inflorescences are reduced in size, deformed or absent.
На фото 7 показаны растения в период созревания семян по состоянию на начало сентября. С левой стороны фото - контрольные растения. Контрольные образцы растений практически не содержат активных листьев, малые размеры корзин В инокулированных растениях сохранена большая масса активных листьев, что непосредственно влияет на МТС (масса тысячи семян) и содержание масла в семенах. Корзины большие, присутствуют на всех растениях, не имеют деформаций и полностью раскрыты. Диаметр корзин достигает 20 см. Урожайность инокулированного подсолнечника в 2,6 раза превышает урожайность контрольного. Photo 7 shows the plants during the seed ripening period as of early September. On the left side of the photo are control plants. Control plant samples practically do not contain active leaves, small basket sizes In the inoculated plants, a large mass of active leaves is retained, which directly affects the MTS (mass of one thousand seeds) and the oil content in the seeds. The baskets are large, present on all plants, have no deformations and are fully open. The diameter of the baskets reaches 20 cm. The yield of inoculated sunflower is 2.6 times higher than the yield of the control one.

Claims

Формула изобретения Claim
1. Инокулянт для растений, содержащий носитель с микробиологическими культурами, отличающийся тем, что в качестве микробиологических культур использованы микроорганизмы домена археи, характеризующиеся одним из следующих специфических маркеров нуклеотидных последовательностей диагностического фрагмента гена 16S рРНК: ggttgatcctgccggagatcgctgctattagagttcgactaagccatgcaagtcatctcgcaagagaggcgacaggctcag taacatgtcgttaatctaccctttcgcccagaataccctcgggaaactgaggttaatactggatatgaaagatattctggaaagaatttttt cttaaaggcaacacgaaaggatgagacggcaccagattaggctgttggcggtgtaatggaccaccaaacctacgatctgtacggg ggatgaaagtcctagcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatgc acgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttcggagaataagtggtgggtaag actggtgccagccgccgcggtanccccagcgccacaagtggggatcacgtttatttggtctaaagcgttcgtaccagg; attccggttgatcctgccggacctgactgctatcggattgatactaatnnccatgcgagtcattgtagcaatacaaggcagac ggctcagtagcgcgtagtcaatctaccctatggacgggaataacctcgggaaactgagaataatgcccgatagaacattatgcctgg aatggtttatgtttcaaatgatttatcgccataggatgggactgcggcctatcagtttgttggtgaggtaatggcccaccaagactattaca ggtacgggctctgagaggagtggcccggagatgggtactgagacacggacccaggccctatggggcgcagcaggcgggaaaa ctttgcaatgtgcgaaagcacgacnaaggttaatccgagtggtttctgctaaagaaaccttttgtcagtcctagaaaccactaaacgaa taagggggtgggncaagttctggntgtnngcccgcccgcgggtaaaaacccagcaaccctcaagntgggttcagggnattg; tccggttgatcctgccggacctgactgctatcggattggtactaagcncatgtgagtcgttgcagcaatgcaaggcagacgg ctcagtaacacgtagtcaacctaacctatggacggggataacctcgggaaactgagaataatacccgatagatcatgatacctgga acggtttatggtccaaatgatttatcgccataggatggggctgcggtctatcagcttgttggtgaggtaatggcccaccaaggctataac agatacgggctctgagaggaggggcccggagatgggtactgagacacggacccaggtcctatggggcgcagcaggcgagaaa cctttgcaatgtgcgaaagcacgacaaggttaatccgagtgattccctgctaaaggaatcttttgttagtcataaaaacccactgatgaa taaggagtgggcaagttctggtgtcagccgccgcggtaaaacccaagcaccctcaagtgg; attccggttgatcctgccggagatcgctgctattagagttcgactaanntcncatgcaagttatctcgcaagagaagcgaca ggctcagtaacatgtcgttaatctaccctttcgcctggaataccctcgggaaactgaggttagcaccggatatgaaagatattctggaa agaattttttcttaaaggcatcacgaaaggatgagacggcaccagattgggctgttggcggtgtaatggaccaccaaacctacgatct gtacgggggatgaaagtcctagcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaaccttt acaatgcacgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttc; ggagaataagtggtgggtaaagactggtgccagccgccgcgggtaaccccancgccacaagtggggatcattccggttg atcctgccggaggctgctgctatctggtttgcaattagacatgcaagtctttttgttttttcggaaatgaaaggcgaactgctcagtaacac gtagctaacctgccctaacgacggaaataatgtcgggaaactgactctaacatccgatagaagaagacaactggaatgtgttttctttc aagtcaggatggggctgcggctgattagcttgttggcggggtaatagcccaccaaggcgtannatcagtaagggctcttagcggaga agccctgagaggggatctgagacactatccccagccctacggggtgcagcagtcgggaaacttctgcaatgtacgcaagtatgaca gagcaagccagagtgattctctaataattgagcatctcttataatatgtaaaaagtattatgaataaggactgggtaagactggtgccag ccgccgcggtantaccagcagtccaagtagcagccgccgt; cccgccaattcctttaagtttcagtcttgcgaccgtacttcccaggcggcaaacttaacggcttccctgcggcactgcactggc cataagccagtgcatcaccgagtttgcatcgtttacagctgggactacccgggtatctaatccggtttgctcccccagctttcatccctcac cgtcgaacgcgttctggtagaccgccttcgccactggtggtcctcaatggatcagaggattttacccctacccaccgaataccgtctacc tctcccgctccctagctatgtagtatctccggcagcccatctgttaagcagatggatttaaccggagacttgcagagccggctacggatg ctttaggcccaataaacctcctaaccactcgaggtgctggtattaccgcggcggctgacaccagacttgcccaccccttattcaccagt agatttagaactgacaaaagatttcttcagcagaaatcactcggattaaacctagtcgtgctttcgcacattgctaaggtttcctcgcctgc tgcgccnccataggg; gaatgctctagattttccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgagtcaacgtagcaa tacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacctcgggaaactgaggataaaccgcgatag gtcataatatctggaatgatttatggtttaaatctatatggcctctggattggactgcggccgatcaggctgttggtgaggtaatggcccac caaacctaaaaccggtacgggctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgca gcaggcgcgaaaactctgcaataagcgaaagcttgacagggttattctgagtgatttccgctaaggaaatcttttggcacctctaaaaa tggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcaccccgagtggtcgggacgattattgggcct aaagcatccgt; gtgaatcagctcggtacctcgcgatgctgntagatncccgccattcctttaagtntcagtcttgcgaccgtactccccangcn gcagacttaacggcttccctgcggcactgggccggcatgaagccggcccatcaccgagtctgcatcgtttacagctgggactacccg ggtatctaatccggtttgctcccccagctttcatccctcaccgtcgagcgcgttctgacaagccgccttcgccactggtggtcttcaatgga tcagaggattttacccctacccactgagtaccgcttgcctctcccgcctcctagtcttgtagtatcttccgcagcccatctgttaageagctg gatttaacggaagacttgcaagaccggctacggatgcttnaggcccaataatcgtcccgaccactcggggtgctggtattaccgcgg cggctgacaccagacttgcccaccccttattctgcatcgtttttagagatgccaaaagatncccttagcgggaatcactcagagtaacc ctgtcaggctttcgcctatttnagaggtttcgcgcctgctgcgccccatagg; agctcggtacctcgcgaatgctctagattcccgccaattcctttaagttcagtcttgcgaccgtactccccaggcggcagactt aacggcttccctgcggcactgggttggctcgaagccaacccatcaccgagtctgcatcgtttacagctgggactacccgggtatctaat ccggtttgctcccccagctttcatccctcaccgtcgagcgcgttctggcaaaccgccttcgccactggtggtcttcagtagatcaatggatt ttacccctacccactgagtaccgtttgcctctcccgcctcctagctctgcggtatcctccgcagcccatccgttgagcaggtggatttaac ggaggacttgcagaacaagctacggatgctttaggcccaataatcgtcccgacaactcggggtgctggtattaccgcggcggctgac accagacttgcccaccccttattctgcaccatttttagaggtgccaaaagatacccttagcgggcatcactcagagtaaccctgtcagg ctttcgcctattgcagaggtttcgcgcctgctgcgccccatagggcctgggcccttgictcagtgcccatctccgggctccttctctcaaag cccgtaccggtaaca; tgcntctagatttccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcgagtggctcagcc aatacgagccacggcatacagctcagtaacacgtggctaatctgcccttaggacgagaacaaccccgggaaactggggctaactc tcgataggcgaagaactctggaatgagtcttcacctaaatagttcagcgttatgctcgttgaaccgcctaaggatgaggccgcgaccg atcaggttgttggtgaggtaatggccaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagaca agggcccaggccctacggggcgcagcagtcgcgaaaactttgcaatacacgaaagtgtgacagggctatcccgagtgccatccgc tgaggaaggcttttacccagtctagaaagctgggagaataaggagagggcaagtctggtgtcagccgccgcnggtaataccagctc tcccg agtgg tgtg g atgttta attg g g cccta a a ; aatgctgctagatatgccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgagtcaacgtagca atacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacctcgggaaactgaggataaaccgcgata ggtcataatatctggaatgatttatggtttaaatctatatggcctctggattggactgcggccgatcaggctgttggtgaggtaatggccca ccaaacctaaaaccggtacgggctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgc agcaggcgcgaaaactctgcaataagcgaaagcttgacagggtnattctgagtgatttccgctaaggaaatcttttggcacctctaaa aatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcaccccgagtggtcnggacgattattggg cctaaagcatccgtagccngttctacaagtcttccgttaaatccacctgcttaacagatgggctgcggaggatactatggagctaggag gcgggaga; cgaatgcatctagatnattccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcgcgtgcc tcagctaaaacgaggcacggcatacagctcagtaacacgtggctaatctgcccttgggataggaacaaccccgggaaactggggc taattcccaataggcgaagaactctggaatgagtcttcaccagaaacgaacctacgttatgctcgtagaattcgcccaaggatgaggc cgcgaccgatcaggttgttggtgaggtaatggctcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggc actgagacaagggcccaggccctacggggcgcagcagtcgcgaaaactttgcaataagcgaaagcttgacagggctatcccgag tgccatccgctgaggaangcttttacccagtctagaacgctgggggaataaaggagagggcaagtctggtgtcngccgccgcggta aatac. 1. Inoculum for plants, comprising a carrier with microbiological cultures, characterized in that the microbiological cultures used Archaea domain microorganisms, characterized by one of the following nucleotide sequences specific markers diagnostic gene fragment 16S rRNA: ggttgatcctgccggagatcgctgctattagagttcgactaagccatgcaagtcatctcgcaagagaggcgacaggctcag taacatgtcgttaatctaccctttcgcccagaataccctcgggaaactgaggttaatactggatatgaaagatattctggaaagaatttttt cttaaaggcaacacgaaaggatgagacggcaccagattaggctgttggcggtgtaatggaccaccaaacctacgatctgtacggg ggatgaaagtcctagcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaacctttacaatgc acgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttcggagaataagtggtgggtaag actggtgccagccgccgcggtanccccagcgccacaagtggggatcacgtttatttggtctaaagcgttcgtaccagg; attccggttgatcctgccggacctgactgctatcggattgatactaatnnccatgcgagtcattgtagcaatacaaggcagac ggctcagtagcgcgtagtcaatctaccctatggacgggaataacctcgggaaactgagaataatgcccgatagaacattatgcctgg aatggtttatgtttcaaatgatttatcgccataggatgggactgcggcctatcagtttgttggtgaggtaatggcccaccaagactattaca ggtacgggctctgagaggagtggcccggagatgggtactgagacacggacccaggccctatggggcgcagcaggcgggaaaa ctttgcaatgtgcgaaagcacgacnaaggttaatccgagtggtttctgctaaagaaaccttttgtcagtcctagaaaccactaaacgaa taagggggtgggncaagttctggntgtnngcccgcccgcgggtaaaaacccagcaaccctcaagntgggttcagggnattg; tccggttgatcctgccggacctgactgctatcggattggtactaagcncatgtgagtcgttgcagcaatgcaaggcagacgg ctcagtaacacgtagtcaacctaacctatggacggggataacctcgggaaactgagaataatacccgatagatcatgatacctgga acggtttatggtccaaatgatttatcgccataggatggggctgcggtctatcagcttgttggtgaggtaatggcccaccaaggctataac agatacgggctctgagaggaggggcccggagatgggtactgagacacggacccaggtcctatggggcgcagcaggcgagaaa cctttgcaatgtgcgaaagcacgacaaggttaatccgagtgattccctgctaaaggaatcttttgttagtcataaaaacccactgatgaa taaggagtgggcaagttctggtgtcagccgccgcggtaaaacccaagcaccctcaagtgg; attccggttgatcctgccggagatcgctgctattagagttcgactaanntcncatgcaagttatctcgcaagagaagcgaca ggctcagtaacatgtcgttaatctaccctttcgcctggaataccctcgggaaactgaggttagcaccggatatgaaagatattctggaa agaattttttcttaaaggcatcacgaaaggatgagacggcaccagattgggctgttggcggtgtaatggaccaccaaacctacgatct gtacgggggatgaaagtcctagcccggagaggaacactgagatactggttccagccctacggggtgcagcaggcgcgaaaccttt acaatgcacgaaagtgtgataagggaactctaagtgcttatgttttacataggcttttgccgaaggtaaatacttc; ggagaataagtggtgggtaaagactggtgccagccgccgcgggtaaccccancgccacaagtggggatcattccggttg atcctgccggaggctgctgctatctggtttgcaattagacatgcaagtctttttgttttttcggaaatgaaaggcgaactgctcagtaacac gtagctaacctgccctaacgacggaaataatgtcgggaaactgactctaacatccgatagaagaagacaactggaatgtgttttctttc aagtcaggatggggctgcggctgattagcttgttggcggggtaatagcccaccaaggcgtannatcagtaagggctcttagcggaga agccctgagaggggatctgagacactatccccagccctacggggtgcagcagtcgggaaacttctgcaatgtacgcaagtatgaca gagcaagccagagtgattctctaataattgagcatctcttataatatgtaaaaagtattatgaataaggactgggtaagactggtgccag ccgccgcggtantaccagcagtccaagtagcagccgccgt; cccgccaattcctttaagtttcagtcttgcgaccgtacttcccaggcggcaaacttaacggcttccctgcggcactgcactggc cataagccagtgcatcaccgagtttgcatcgtttacagctgggactacccgggtatctaatcccggttctgctcatcccc cgtcgaacgcgttctggtagaccgccttcgccactggtggtcctcaatggatcagaggattttacccctacccaccgaataccgtctacc tctcccgctccctagctatgtagtatctccggcagcccatctgttaagcagatggatttaaccggagacttgcagagccggctacggatg ctttaggcccaataaacctcctaaccactcgaggtgctggtattaccgcggcggctgacaccagacttgcccaccccttattcaccagt agatttagaactgacaaaagatttcttcagcagaaatcactcggattaaacctagtcgtgctttcgcacattgctaaggtttcctcgcctgc tgcgccnccataggg; gaatgctctagattttccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgagtcaacgtagcaa tacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacctcgggaaactgaggataaaccgcgatag gtcataatatctggaatgatttatggtttaaatctatatggcctctggattggactgcggccgatcaggctgttggtgaggtaatggcccac caaacctaaaaccggtacgggctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgca gcaggcgcgaaaactctgcaataagcgaaagcttgacagggttattctgagtgatttccgctaaggaaatcttttggcacctctaaaaa tggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcaccccgagtggtcgggacgattattgggcct aaagcatccgt; gtgaatcagctcggtacctcgcgatgctgntagatncccgccattcctttaagtntcagtcttgcgaccgtactccccangcn gcagacttaacggcttccctgcggcactgggccggcatgaagccggcccatcaccgagtctgcatcgtttacagctgggactacccg ggtatctaatccggtttgctcccccagctttcatccctcaccgtcgagcgcgttctgacaagccgccttcgccactggtggtcttcaatgga tcagaggattttacccctacccactgagtaccgcttgcctctcccgcctcctagtcttgtagtatcttccgcagcccatctgttaageagctg gatttaacggaagacttgcaagaccggctacggatgcttnaggcccaataatcgtcccgaccactcggggtgctggtattaccgcgg cggctgacaccagacttgcccaccccttattctgcatcgtttttagagatgccaaaagatncccttagcgggaatcactcagagtaacc ctgtcaggctttcgcctatttnagaggtttcgcgcctgctgcgccccatagg; agctcggtacctcgcgaatgctctagattcccgccaattcctttaagttcagtcttgcgaccgtactccccaggcggcagactt aacggcttccctgcggcactgggttggctcgaagccaacccatcaccgagtctgcatcgtttacagctgggactacccgggtatctaat ccggtttgctcccccagctttcatccctcaccgtcgagcgcgttctggcaaaccgccttcgccactggtggtcttcagtagatcaatggatt ttacccctacccactgagtaccgtttgcctctcccgcctcctagctctgcggtatcctccgcagcccatccgttgagcaggtggatttaac ggaggacttgcagaacaagctacggatgctttaggcccaataatcgtcccgacaactcggggtgctggtattaccgcggcggctgac accagacttgcccaccccttattctgcaccatttttagaggtgccaaaagatacccttagcgggcatcactcagagtaaccctgtcagg ctttcgcctattgcagaggtttcgcgcctgctgcgccccatagggcctgggcccttgictcagtgcccatctccgggctccttctctcaaag cccgtaccggtaaca; tgcntctagatttccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcgagtggctcagcc aatacgagccacggcatacagctcagtaacacgtggctaatctgcccttaggacgagaacaaccccgggaaactggggctaactc tcgataggcgaagaactctggaatgagtcttcacctaaatagttcagcgttatgctcgttgaaccgcctaaggatgaggccgcgaccg atcaggttgttggtgaggtaatggccaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggcactgagaca agggcccaggccctacggggcgcagcagtcgcgaaaactttgcaatacacgaaagtgtgacagggctatcccgagtgccatccgc tgaggaaggcttttacccagtctagaaagctgggagaataaggagagggcaagtctggtgtcagccgccgcnggtaataccagctc tcccg agtgg tgtg g atgttta attg gg cccta aa; aatgctgctagatatgccggttgatcctgccggacccgactgctatcagaataggactaagccatgcgagtcaacgtagca atacgtggcatacggctcagtaacacgtagtcaacatgcccagaggacgtggataacctcgggaaactgaggataaaccgcgata ggtcataatatctggaatgatttatggtttaaatctatatggcctctggattggactgcggccgatcaggctgttggtgaggtaatggccca ccaaacctaaaaccggtacgggctctgagaggagaagcccggagatgggcactgagacaagggcccaggccctatggggcgc agcaggcgcgaaaactctgcaataagcgaaagcttgacagggtnattctgagtgatttccgctaaggaaatcttttggcacctctaaa aatggtgcagaataaggggtgggcaagcctggtgtcagccgccgcggtaataccagcaccccgagtggtcnggacgattattggg cctaaagcatccgtagccngttctacaagtcttccgttaaatccacctgcttaacagatgggctgcggaggatactatggagctaggag gcgggaga; cgaatgcatctagatnattccggttgatcctgccggaccccactgctatcgggataggactaagacatgctagtcgcgtgcc tcagctaaaacgaggcacggcatacagctcagtaacacgtggctaatctgcccttgggataggaacaaccccgggaaactggggc taattcccaataggcgaagaactctggaatgagtcttcaccagaaacgaacctacgttatgctcgtagaattcgcccaaggatgaggc cgcgaccgatcaggttgttggtgaggtaatggctcaccaagccttttaccggtgcgggccgtgagagcgggagcccggagatgggc actgagacaagggcccaggccctacggggcgcagcagtcgcgaaaactttgcaataagcgaaagcttgacagggctatcccgag tgccatccgctgaggaangcttttacccagtctagaacgctgggggaataaaggagagggcaagtctggtgtcngccgccgcggta aatac.
2. Инокулянт по п. 1 , отличающийся тем, что в качестве носителя использован порошкообразный глауконит или водная суспензия порошкообразного глауконита. 2. An inoculant according to claim 1, characterized in that powdered glauconite or an aqueous suspension of powdered glauconite is used as a carrier.
PCT/UA2021/000040 2020-04-21 2021-04-19 Plant inoculant WO2021216028A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE112021002422.1T DE112021002422T5 (en) 2020-04-21 2021-04-19 PLANT VACCINE

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
UAA202002481A UA125194C2 (en) 2020-04-21 2020-04-21 Plant inoculant
UAA202002481 2020-04-21

Publications (1)

Publication Number Publication Date
WO2021216028A1 true WO2021216028A1 (en) 2021-10-28

Family

ID=78269732

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/UA2021/000040 WO2021216028A1 (en) 2020-04-21 2021-04-19 Plant inoculant

Country Status (3)

Country Link
DE (1) DE112021002422T5 (en)
UA (1) UA125194C2 (en)
WO (1) WO2021216028A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA34132U (en) * 2008-03-21 2008-07-25 Общество С Ограниченой Ответсвтенностью «Экоагроальянс» Organomineral pastelike fertilizer
UA85089C2 (en) * 2006-12-14 2008-12-25 Институт Микробиологии И Вирусологии Им. Д.К. Заболотного Национальной Академии Наук Украины Subculture for the increasing of soya productivity
UA94389C2 (en) * 2004-12-23 2011-05-10 Бекер Андервуд Инк. Liquid bacterial inoculants with extended applicability and increased stability on seed
WO2016044085A1 (en) * 2014-09-18 2016-03-24 Taxon Biosciences Inc Plant growth-promoting microbes, compositions, and uses
WO2020076888A1 (en) * 2018-10-10 2020-04-16 Pioneer Hi-Bred International, Inc. Plant growth-promoting microbes, compositions, and uses

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA94389C2 (en) * 2004-12-23 2011-05-10 Бекер Андервуд Инк. Liquid bacterial inoculants with extended applicability and increased stability on seed
UA85089C2 (en) * 2006-12-14 2008-12-25 Институт Микробиологии И Вирусологии Им. Д.К. Заболотного Национальной Академии Наук Украины Subculture for the increasing of soya productivity
UA34132U (en) * 2008-03-21 2008-07-25 Общество С Ограниченой Ответсвтенностью «Экоагроальянс» Organomineral pastelike fertilizer
WO2016044085A1 (en) * 2014-09-18 2016-03-24 Taxon Biosciences Inc Plant growth-promoting microbes, compositions, and uses
WO2020076888A1 (en) * 2018-10-10 2020-04-16 Pioneer Hi-Bred International, Inc. Plant growth-promoting microbes, compositions, and uses

Also Published As

Publication number Publication date
DE112021002422T5 (en) 2023-02-16
UA125194C2 (en) 2022-01-26

Similar Documents

Publication Publication Date Title
Bhattacharjee et al. Biofertilizer, a way towards organic agriculture: A review
AU2002227228B2 (en) Bacterial inoculants for enhancing plant growth
RU2628411C2 (en) Microbial inoculants and fertilisers composition containing them
CN1315758C (en) Micro-organisms for the treatment of soil and process for obtaining them
CN106987541B (en) Efficient alfalfa rhizobium with stress resistance and growth promotion performance and application thereof
CN110577911B (en) Bacillus pumilus and application thereof
CN109810924B (en) Method for improving severe saline-alkali soil
CN102046778A (en) Bacterium capable of reducing heavy metal content in plant
AU2002227228A1 (en) Bacterial inoculants for enhancing plant growth
CN110616171B (en) Saline-alkali-resistant Pacific bacillus and viable bacteria preparation and application thereof
CN108034601B (en) Bacillus amyloliquefaciens and application thereof
US20120192605A1 (en) Fertilizer composition and method
WO2014042517A2 (en) Biofertilizer
KR102411304B1 (en) Bacillus zanthoxyli strain promoting tolerance of plants and use thereof
KR102000472B1 (en) Bacillus aryabhattai strain promoting resistance of plants against abiotic stress and use thereof
CN115612649A (en) Salt-tolerant growth-promoting disease-resistant bacillus of plant and application thereof
US11674118B2 (en) PGPR compositions and methods for improved cultivation of tomato and potato species
CN111778183A (en) Acidophilic nitrogen-producing pseudomonas strain and application thereof
KR102670981B1 (en) Development of a multifunctional biopesticide controlling anthracnose and bacterial diseases with plant growth stimulating effects
ARMENTA-BOJÓRQUEZ et al. Organic versus synthetic fertilisation of beans (Phaseolus vulgaris L.) in Mexico
WO2021216028A1 (en) Plant inoculant
JP7468842B2 (en) Pesticide composition for controlling plant diseases and method for controlling plant diseases using the same
KR20060021162A (en) Antifungal plant growth promoting rhizobacterium, bacillus amyloliquefaciens mj-3 and microbial bed soil using hereof
AU2017272860B2 (en) Composition and method for improving the development of plants
JPH0725717A (en) Streptomyces ncimb40277 being effective in original stimulation of agricultural production

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21792050

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 23.03.2023)

122 Ep: pct application non-entry in european phase

Ref document number: 21792050

Country of ref document: EP

Kind code of ref document: A1