WO2021181379A1 - Compositions and methods for treating osteolysis - Google Patents
Compositions and methods for treating osteolysis Download PDFInfo
- Publication number
- WO2021181379A1 WO2021181379A1 PCT/IL2021/050250 IL2021050250W WO2021181379A1 WO 2021181379 A1 WO2021181379 A1 WO 2021181379A1 IL 2021050250 W IL2021050250 W IL 2021050250W WO 2021181379 A1 WO2021181379 A1 WO 2021181379A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pharmaceutical composition
- peptide
- seq
- osteolysis
- nle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/57563—Vasoactive intestinal peptide [VIP]; Related peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/65—Tetracyclines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/22—Hormones
- A61K38/2278—Vasoactive intestinal peptide [VIP]; Related peptides (e.g. Exendin)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
Definitions
- the present invention relates to treatment of osteolysis.
- the invention relates to compositions and methods for preventing and treating osteolysis in periodontal or other diseases and conditions using analogs of vasoactive intestinal peptide (VIP) and pituitary adenylyl cyclase activating polypeptide (PACAP).
- VIP vasoactive intestinal peptide
- PACAP pituitary adenylyl cyclase activating polypeptide
- Osteolysis is a progressive condition where bone tissue is destroyed due to resorption of bone matrix by osteoclasts. In this process, bones lose minerals (mostly calcium), softens, degenerates and become weaker. Osteolysis may be caused by variety of pathologies like bone tumors, cysts, or chronic inflammation, and may be caused by the vicinity of implants or prosthesis.
- Periodontal-related diseases affect the tissues that surround and support the tooth.
- Periodontitis is an inflammatory lesion that is accompanied by soft tissue destruction and bone resorption in the tooth- supporting structures. It initiates by a biofilm that forms on the tooth surface and induces an inflammatory response in connective tissue leading to the stimulation of osteoclasts and periodontal bone loss.
- 2009-2012 46% of US adults had periodontitis, with 8.9% having severe periodontitis.
- Periodontitis prevalence was positively associated with increasing age and was higher among males (Eke et al, 2015, J Periodontol. 2015 May; 86(5): 611-622).
- Peri-implant infective diseases commonly include peri-implant mucositis which is restricted to the peri-implant mucosa and peri-implantitis which also affects implant- supporting bone. While the former is known to be reversible upon conventional treatment including utilization of different manual ablations, laser- supported systems as well as photodynamic therapy, which may be extended by local or systemic antibiotics, the latter is very difficult to eradicate thereby requiring surgical therapies to regain osseointegration (a direct connection between living bone and the surface of a load-bearing artificial implant). Currently, peri-implant infective diseases remain one of the most frequent complications affecting both the soft and hard tissues surrounding an implant that can even lead to implant loss (Smeets et al.
- a peri-implant tissue forms as a result of surgical trauma during wound repair, it is typically characterized by having a scarred nature, receded blood flow caused by poor vascularity, a deeper sulcus which allows for deeper penetration of bacteria, and lack of periodontal space.
- a fully integrated dental implant exhibits a space which is more susceptible to bacterial infection than periodontal tissues (Pokrowiecki et al. Ther. Clin. Risk Manag., 2017, 13:1529-1542).
- Vasoactive intestinal peptide is a peptide hormone that is vasoactive in the intestine.
- VIP is a peptide of 28 amino acid residues that belongs to a glucagon/secretin superfamily, the ligand of class II G protein-coupled receptors.
- VIP has a variety of functions and showed to regulates osteoclast activity via specific binding sites on both osteoclasts and osteoblasts.
- US patent No. 5972883 discloses methods for the treatment of neurodegenerative diseases comprising administering VIP and analogs thereof.
- WO 01/93889 discloses pharmaceutical compositions for the treatment of skin disorders comprising VIP-related peptides.
- Gurkan et al. discloses the therapeutic efficacy of VIP in Escherichia coli lipopolysaccharide-induced experimental Periodontitis in Rats. (Gurkan et al., J Periodontol, 2009 Oct;80(10): 1655-64).
- PACAP Pituitary adenylyl cyclase activating polypeptide
- the present invention provides pharmaceutical compositions and formulations comprising analogs of Vasoactive intestinal peptide (VIP) or Pituitary adenylyl cyclase activating polypeptide (PACAP), for use in treating osteolysis.
- VIP Vasoactive intestinal peptide
- PACAP Pituitary adenylyl cyclase activating polypeptide
- the present invention further provides in some embodiments, analogs and conjugates of VIP and PACAP for treating or preventing periodontal related diseases, such as periodontitis and peri-implantitis.
- VIP and PACAP described herein are highly efficient in treating and preventing periodontal-related diseases such as periodontitis and peri- implantitis. It is further disclosed that the analogs described herein are efficient in treating titanium particle-induced osteolysis.
- the VIP or PACAP analogs in some embodiments are lipophilic and able to penetrate skin and oral mucosa.
- the inventors of the present invention have developed formulations comprising the analogs which found to be highly efficient in treating osteolysis.
- the natural VIP peptide did not dissolve properly and found to be unsuitable for the indications described herein.
- SNV Stearyl-Norleucine analog of VIP, herein denoted SNV, was found to induce strong suppression of osteoclast differentiation. This activity might result from the combined effect on inflammation (e.g., decrease in IL1 b expression) as well as a direct effect on osteoclasts. This activity significantly exceeded VIP effect on osteoclast differentiation.
- VIP peptide was shown to increase bone resorption in an ex vivo organ culture which may be mediated by its actions on osteoblasts. Therefore, the SNV peptide, which blocks the two common denominators leading to osteolysis, osteoclastogenesis and the inflammation (mainly caused by bacteria and/or aseptic), is efficient and highly suitable for treating osteolysis, in particular, periodontal related diseases.
- the present invention provides a pharmaceutical composition
- a pharmaceutical composition comprising a peptide analog of VIP (SEQ ID NO: 2) for use in treating or preventing osteolysis, wherein the peptide analog consists of 25 to 50 amino acids comprising the sequence ZHS DX 1 X 2 FTDX 3 YX 4 RX 5 RKQX 6 A VKKYLX 7 L (SEQ ID NO: 1), wherein
- Xi is selected from A and G;
- X2 is a hydrophobic amino acid
- X3 is selected from N and S;
- X4 is selected from T and S;
- X5 is selected from L and Y ;
- Xe is a hydrophobic amino acid
- X7 is a stretch of 3 amino acid residues selected from NSI and AAV.
- Z is a permeability enhancing moiety, any amino acid, or absent.
- X2 and Xe are hydrophobic amino acids selected from the group consisting of leucine (L), isoleucinc (I), norleucine (Nle), valine (V), tryptophan (W), phenylalanine (F), methionine (M), octahydroindole-2-carboxylic acid (oic), cyclohexylglycine (chg) and cyclopentylglycine (cpg).
- X2 is selected from V and I.
- Xe is selected from Norleucine (Nle) or Met (M).
- the peptide length is up to 50 amino acids residues. According to certain embodiments, the peptide length is up to 45, 40, 35, 30, or 25 amino acid residues. Each possibility represents a separate embodiment of the invention.
- the peptide is 25-50 amino acid residues in length. According to some embodiments, the peptide is 26-40 amino acid residues in length. According to some embodiments, the peptide is 27-40 amino acid residues in length. According to some embodiments, the peptide is 25-30 amino acid residues in length. According to some embodiments, the peptide is 30-45 amino acid residues in length.
- a conjugate or multimer comprising the peptide described herein is provided according to certain embodiments of the invention.
- the peptide is conjugated with a permeability enhancing moiety.
- the peptide is conjugated to a lipophilic moiety.
- the N-terminus or C-terminus is conjugated to a lipophilic moiety.
- the N-terminus or C-terminus is conjugated to a lipophilic moiety selected from the group consisting of stearoyl, lauroyl, and caproyl.
- the N-terminus is modified. According to some embodiments, the N-terminus is modified with a permeability enhancing moiety. According to certain embodiments, the N-terminus is acetylated. According to some embodiments, the N- terminus is conjugated with a fatty acid. According to exemplary embodiments, the N-terminus is conjugated with a stearyl moiety.
- the C-terminus is modified. According to certain embodiments, the C-terminus is amidated. According to additional embodiments, the C- terminus is modified with a propyl-amide.
- the peptide comprises the sequence GKRYKQRVKNK (SEQ ID NO: 13) connected to C-terminus of the Leucine residue (L) of SEQ ID NO: 1.
- the peptide comprises a sequence selected from the group consisting of:
- the peptide analog consists of a sequence selected from the group consisting of:
- the peptide analog comprises the sequence HS D A VFTDN YTRLRKQ-Nle- A VKKYLN S ILN (SEQ ID NO: 26);
- the peptide analog consists of the sequence Stearyl- HS DA VFTDN YTRLRKQ-Nle- A VKKYLN S ILN-NEb (SEQ ID NO: 3).
- Analogs of the peptide or fragments described herein are peptides in which one or more amino acids has been added, deleted or replaced by any means known in the art.
- the analogs of the peptide which fall under the scope of the present invention are those which maintain the biological properties described herein.
- the peptide comprises at least one non-natural amino acid residue.
- the peptide comprises one or more D-amino acids.
- the analogs described herein are peptides having at least one amino that has been added, deleted or replaced, or having a modification compared to the peptide set forth in SEQ ID NO: 2.
- the pharmaceutical composition is for use in treating or preventing aseptic osteolysis.
- the pharmaceutical composition is for use in treating or preventing inflammation-induced osteolysis.
- the pharmaceutical composition is for use in treating or preventing inflammation-induced osteolysis in a periodontal-related disease or condition.
- the periodontal-related disease is periodontitis or peri- implantitis. According to certain embodiments, the periodontal-related disease is periodontitis. According to certain embodiments, the periodontal-related disease is peri-implantitis.
- the pharmaceutical composition is for use in treating or preventing periodontal bone loss.
- the pharmaceutical composition further comprises an acceptable carrier, excipients or diluent.
- the pharmaceutical composition is formulated for topical administration.
- the pharmaceutical composition is formulated in a dosage form selected from the group consisting of gels, suspensions, emulsions, powders, granules, elixirs, and tinctures.
- the pharmaceutical composition is formulated for injectable administration.
- the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 1 to 500 pg/mL. According to certain embodiments, the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 2 to 400 pg/mL. According to certain embodiments, the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 20 to 300 pg/mL. According to certain embodiments, the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 50 to 200 pg/mL.
- the pharmaceutical composition further comprises fibrinogen. According to certain embodiments, the pharmaceutical composition further comprises thrombin.
- the present invention provides a method of treating osteolysis, the method comprising administering to the subject a therapeutically effective amount of the peptides or conjugates described herein.
- the osteolysis is inflammation-related osteolysis. According to other embodiments, the osteolysis is aseptic osteolysis.
- the method comprises integrating an implant.
- the method comprises integrating a titanium implant.
- the inflammation-related osteolysis is a periodontal- related disease or disorder.
- the osteolysis is titanium particle-induced osteolysis.
- the amount is effective to enhance osseointegration of a dental implant. According to some embodiments, the amount is effective to enhance alveolar bone regeneration. According to some embodiments, the amount is effective to promote osteogenic differentiation. According to certain embodiments, the method comprises accelerating osteogenesis.
- the alveolar bone loss or periodontal bone loss is prevented, inhibited or treated.
- the method comprises a dental implant integration. According to further embodiments, the method comprises accelerating bone growth in the osseointegration procedure of a dental implant in jawbone.
- the method further comprising administering an antibiotic.
- the antibiotic is selected from the group consisting of arestin, doxycycline, tetracycline, minocycline and hydrochloride.
- the method further comprises administering a disinfectant or antiseptic agent.
- the disinfectant agent is chlorhexidine gluconate (CHG).
- the subject is a mammal. According to certain embodiments, the subject is a human subject.
- the pharmaceutical composition is administered at least twice a day, once a day, twice a week or once a week. According to some embodiments, the pharmaceutical composition is administered at least once a day. According to other embodiments the administration is limited to the surgical site during, before or after the surgical procedure.
- FIGs 1A-1C VIP (SEQ ID NO: 2) and SNV (SEQ ID NO: 3) display a partial anti inflammatory effect in LPS- stimulated macrophage cultures.
- Primary murine macrophages were treated with 10 6 M of VIP or SNV (or saline) and exposed to lpg/ml LPS for 24 hrs.
- Expression of IL1 b (Fig. 1A), IL6 (Fig. IB) and TNFa (Fig. 1C) mRNAs was examined using RT-qPCR and presented as fold from untreated controls (no EPS). n 5, # p ⁇ 0.05 vs. Control; *p ⁇ 0.05 vs. EPS, 1-way ANOVA.
- FIGs 2A-2B Expression of the receptors for VIP in bone marrow-derived macrophages and preosteoclasts.
- Fig. 2A VIP receptor VCAP1.
- Fig. 2B VIP receptor VCAP2.
- Expression is measured in M-CSF treated macrophages (Day 0) and M-CSF + RANKE treated pre osteoclasts (Day 2) using RT-qPCR.
- Data are Mean+SD, normalized to expression levels in macrophages, performed in triplicates in 2 independent experiments with similar results.
- FIGs 3A-3D VIP and SNV display an anti-osteoclastogenic effect in the presence of titanium (Ti) particles.
- FIGs 4A-4B SNV demonstrated a high transepithelial penetrability and stability using a model of vaginal delivery in rats.
- Radiolabeled SNV (7.0 mCi/rat, 15 million CPM, 100 Ci/mM) was delivered in the vagina of rats at time zero (TO). Each point on the chart represents at least two rats.
- Fig. 4A - Fevels of radioactivity were monitored over 250 min to assess the remaining amount of SNV in the vagina.
- Fig. 4B The radioactivity of SNV in the vagina versus its distribution in the indicated organs as a measure of its penetrability through the vaginal epithelium. Data are Mean +/- SD.
- FIGs 5A-5D Effect of topically-administered SNV on particle-induced osteolysis in vivo.
- Fibrin membranes including titanium particles, together with SNV (or saline as control) were implanted onto mouse calvaria. Mice were euthanized 5 weeks post-op for pCT analysis.
- Fig. 5A Pit resorption volume of bones (PRV, mm3)
- Fig. 5B Pit resorption volume to total volume (PRV/TV (%))
- Fig. 5C Calvarial thickness (pm).
- Fig. 5D Representative pCT images of the calvaria.
- the present invention provides methods of treating osteolysis.
- the present invention further provides in some embodiments methods of treating or preventing periodontal diseases, such as periodontitis and peri-implantitis associated bone loss.
- the typical treatments for periodontitis include localized therapy with controlled release antibiotics.
- the repetitive and lengthy use of certain antibiotics enhance the risk of bacterial resistance.
- the treatments known so far, i.e., antibiotics do not specifically targets the inflammation nor osteoclasts, and are therefore not indicated for the prevention of titanium particles-induced osteolysis, which can progress even in the complete absence of bacteria.
- the peptides described herein provides an efficient treatment that reduces bacterial (LPS) or aseptic (TiP) inflammation and the associated bone loss.
- the present invention provides a pharmaceutical composition
- a pharmaceutical composition comprising a peptide analog of VIP (SEQ ID NO: 2) for use in treating or preventing osteolysis, wherein the peptide analog consists of 25 to 50 amino acids comprising the sequence ZHS DX 1 X 2 FTDX 3 YX 4 RX 5 RKQX 6 A VKKYLX 7 L (SEQ ID NO: 1), wherein
- Xi is selected from A and G;
- X 2 is a hydrophobic amino acid
- X 3 is selected from N and S;
- X 4 is selected from T and S;
- X 5 is selected from L and Y ;
- Xe is a hydrophobic amino acid
- X 7 is a stretch of 3 amino acid residues selected from NSI and AAV.
- the present invention provides a method of treating or preventing osteolysis in a subject, comprising the step of administering to the subject a pharmaceutical composition comprising a peptide analog of VIP or PACAP, wherein said peptide analog comprises SEQ ID NO: 1: ZHSDX 1 X 2 FTDX 3 YX 4 RX 5 RKQX 6 AVKKYLX 7 L, wherein
- Xi is selected from A and G;
- X 2 is a hydrophobic amino acid
- X3 is selected from N and S;
- X4 is selected from T and S;
- X5 is selected from L and Y ;
- Xe is a hydrophobic amino acid
- X7 is a stretch of 3 amino acid residues selected from NSI and AAV.
- Z is a permeability enhancing moiety, any amino acid, or absent, with the proviso that the amino acid sequence does not include the complete, exact SEQ ID NO: 2.
- the method is for treating osteolysis in periodontitis or peri-implantitis.
- a conjugate or a multimer comprising the peptide described herein is provided according to certain embodiments of the invention.
- the peptide is conjugated with a permeability enhancing moiety.
- the peptide is conjugated to a lipophilic moiety.
- the N-terminus or C-terminus is conjugated to a lipophilic moiety.
- the N-terminus or C-terminus is conjugated to a lipophilic moiety selected from the group consisting of stearoyl, lauroyl, and caproyl.
- the N-terminus is modified. According to some embodiments, the N-terminus is modified with a permeability enhancing moiety. According to certain embodiments, the N-terminus is acetylated. According to some embodiments, the N- terminus is conjugated with a fatty acid. According to exemplary embodiments, the N-terminus is conjugated with a stearyl moiety. According to some embodiments, the C-terminus is modified. According to certain embodiments, the C-terminus is amidated. According to additional embodiments, the C- terminus is modified with a propyl-amide.
- the peptide comprises sequence GKRYKQRVKNK (SEQ ID NO: 13) connected to C-terminus of the Leucine residue (L) of SEQ ID NO: 1.
- the peptide comprises a sequence selected from the group consisting of: Stearyl -HS D A VFTDNYTRLRKQ-Nle- A VKK YLN S ILN - NH 2 (SEQ ID NO: 3); HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVL (SEQ ID NO: 4);
- HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK SEQ ID NO: 5
- Acetyl-HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK-NH 2 SEQ ID NO: 6
- the peptide consists of a sequence selected from the group consisting of: S teary 1-HS DA VFTDNYTRLRKQ-Nle- A VKK YLN S ILN -NH 2 (SEQ ID NO: 3); HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVL (SEQ ID NO: 4);
- HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK SEQ ID NO: 5
- Acetyl-HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK-NH 2 SEQ ID NO: 6
- the peptide consists of the sequence Stearyl- HS DA VFTDNYTRLRKQ-Nle- A VKKYLN S ILN-NH 2 (SEQ ID NO: 3).
- the peptide length is up to 50 amino acids residues. According to certain embodiments, the peptide length is up to 45, 40, 35, 30, or 25 amino acid residues. Each possibility represents a separate embodiment of the invention. According to some embodiments, the peptide is 10-50 amino acid residues in length. According to some embodiments, the peptide is 15-40 amino acid residues in length. According to some embodiments, the peptide is 20-40 amino acid residues in length. According to some embodiments, the peptide is 10-30 amino acid residues in length. According to some embodiments, the peptide is 30-40 amino acid residues in length.
- the peptide fragment comprises at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 amino acids. Each possibility represents a separate embodiment of the invention.
- the peptide fragment comprises 4 amino acids.
- the peptide fragment comprises 11 amino acids.
- the peptide fragment comprises at least 10 amino acids.
- the peptide fragment consists of 15-20 amino acids.
- the peptide fragment consists of 10-15 amino acids.
- the peptide consists of 12 amino acids.
- the peptide fragment sequence is KKYL.
- the analog is stearyl-KKYL-NPb (SEQ ID NO: 10).
- the peptide fragment is St-VIPis-28 (Stearyl- AVKKYLNSILN-amide) (SEQ ID NO: 11). According to some embodiments, the peptide fragment is St-VIPi-i 4 (Stearyl-HSDAVFTDNYTRLR-amide) (SEQ ID NO: 12).
- the present invention provides a pharmaceutical composition comprising a peptide for use in treating or preventing osteolysis, the peptide is selected from the group consisting of stearyl-KKYL-NPh (SEQ ID NO: 10), Stearyl-AVKKYLNSILN-amide (SEQ ID NO: 11), and Stearyl-HSDAVFTDNYTRLR-amide (SEQ ID NO: 12).
- the peptide described herein is modified. Modifications can be made directly to the peptide, such as by glycosylation, side chain oxidation, phosphorylation, addition of a linker molecule, addition of a fatty acid, nucleic acid, amino acid substitution and the like.
- Amino acid substitution to produce peptide functional variants preferably involves conservative amino acid substitution i.e., replacing one amino acid residue with another that is biologically and/or chemically similar, e.g., a hydrophobic residue for another, or a polar residue for another.
- Modifications also encompass introduction of one or more non-natural amino acids, introduced so as to render a peptide non-hydrolysable or less susceptible to hydrolysis or proteolysis, as compared to the original peptide.
- the peptides may contain one or more D- amino acids or one or more non-hydrolysable peptide bonds linking amino acids.
- one may modify the peptides in order to reduce the potential for hydrolysis by proteases.
- peptides may be labeled and incubated with cell extracts or purified proteases and then isolated to determine which peptide bonds are susceptible to proteolysis.
- potentially susceptible peptide bonds can be identified by comparing the amino acid sequence of a peptide with the known cleavage site specificity of a panel of proteases. Based on the results of such assays, individual peptide bonds which are susceptible to proteolysis can be replaced with non-hydrolysable peptide bonds.
- Non-hydrolysable peptide bonds are known in the art, along with procedures for synthesis of peptides containing such bonds.
- Non-hydrolysable bonds include, but are not limited to, psifCFhNH] - reduced amide peptide bonds, psifCOCFh] - ketomethylene peptide bonds, psi[CH(CN)NH] - (cyanomethylene)amino peptide bonds, psi [CFhCHlOH)] hydroxyethylene peptide bonds, psifCFhO] - peptide bonds, and psifCFhS] - thiomethylene peptide bonds.
- the peptide comprises a permeability-enhancing moiety.
- the permeability-enhancing moiety may be connected to any position in the peptide moiety, directly or through a spacer or linker.
- the pharmaceutical composition further comprises an acceptable carrier, excipients or diluent.
- compositions of the present invention are selected from but not limited to the group of excipients generally known to persons skilled in the art e.g. vehicles, bulking agents, stabilizers, preservatives, surfactants, hydrophilic polymers, solubility enhancing agents such as glycerin, various grades of polyethylene oxides, beta-cyclodextrins like sulfobutylether-beta-cyclodextrin, transcutol and glycofurol, tonicity adjusting agents, local anesthetics, pH adjusting agents, antioxidants, osmotic agents, chelating agents, viscosifying agents, wetting agents, emulsifying agents, acids, sugar alcohol, reducing sugars, non-reducing sugars and the like, or mixtures thereof.
- excipients generally known to persons skilled in the art e.g. vehicles, bulking agents, stabilizers, preservatives, surfactants, hydrophilic polymers, solubility enhancing agents such as glycerin,
- the pharmaceutical composition can further comprise pharmaceutical excipients including, but not limited to, sodium chloride, potassium chloride, magnesium chloride, sodium gluconate, sodium acetate, calcium chloride, sodium lactate, and the like.
- the composition can also contain minor amounts of sugar alcohols, wetting or emulsifying agents, and pH adjusting agents.
- Antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and agents for the adjustment of tonicity such as sodium chloride or dextrose are also envisioned.
- composition refers to any composition comprising at least one pharmaceutically active ingredient, formulated such that it facilitates accessibility of the active ingredient to the target organ.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U. S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- carrier indicates an inactive substance that serves as mechanisms to improve the delivery and the effectiveness of drugs and can be identified by a skilled person in view of the route of administration and related composition formulation.
- excipient indicates an inactive substance that can be used any of various media acting usually as solvents, binders or diluents to bulk up formulations that contain active ingredients (thus often referred to as “bulking agents,” “fillers,” or “diluents”), to allow convenient and accurate dispensation of a drug substance when producing a dosage form.
- Suitable excipients can include any substance that can be used to bulk up formulations with the peptide analogs to allow for convenient and accurate dosage.
- the method further comprises a step of administering antibiotics.
- the antibiotic is selected from the group consisting of arestin, doxycycline, tetracycline hydrochloride,
- the method further comprises a disinfectant or antiseptic agent.
- the disinfectant agent is chlorhexidine gluconate (CHG).
- the method further comprises administering of Periochip ® , Atridox ® , Actisite ® , or Chlo-site.
- the peptide analog is administered using a delivery vehicle.
- Delivery vehicles for the peptide analogs in the pharmaceutical compositions include in non-limiting examples, naturally occurring polymers, microparticles, nanoparticles, and other macromolecular complexes capable of mediating delivery of the peptide to a tissue and/or a host cell. Vehicles can also comprise other components or functionalities that further modulate, or that otherwise provide beneficial properties.
- the delivery vehicle is a naturally occurring polymer, e.g., formed of materials including but not limited to albumin, collagen, fibrin, alginate, extracellular matrix (ECM), e.g., xenogeneic ECM, hyaluronan (hyaluronic acid), chitosan, gelatin, keratin, or agarose.
- ECM extracellular matrix
- the delivery vehicle comprises a hydrogel.
- Natural materials useful in hydrogels include natural polymers, which are biocompatible, biodegradable, support cellular activities, and include proteins like fibrin, collagen and gelatin, and polysaccharides like starch, alginate and agarose.
- the pharmaceutical composition is in the form of a gel or salve. In this form, it is usually introduced into the gingival pockets, where it releases the active agent to the surroundings.
- terapéuticaally effective amount of the compound is that amount of a composition containing the peptide analog according to the present invention which is sufficient to provide a beneficial effect to the subject to which the compound is administered.
- An effective amount of the compound may vary according to factors such as the disease state, age, sex, and weight of the individual.
- the term “effective amount” as used herein refers to a sufficient amount of the compositions comprising the peptide analogs described herein to prevent or reduce bone loss.
- the compositions are used for bone growth acceleration in dental implants osseointegration.
- the implants may include a variety of biocompatible structures, including specifically dental implants.
- the administration of the compositions may be started before an implant surgery. Alternatively, the administration of the compositions may be started on the same day of an implant surgery. In other embodiments, the administration is started at least one day following the surgery. In alternative embodiments, the compositions are administered starting two, five, ten, fifteen or twenty days from the implant surgery. Each possibility represents a separate embodiment of the invention.
- the compositions disclosed herein may be administered locally. According to some embodiments, the composition having the peptide is administered to a site of bone loss. According to some embodiments, the pharmaceutical composition is formed into a dosage form suitable for transmucosal, topical, or subcutaneous administration.
- the pharmaceutical composition is administered orally or parentally, by intravenous, intramuscular, topical, local, or subcutaneous routes.
- the pharmaceutical composition is formulated for an injectable use. According to other embodiments the pharmaceutical composition is formulated for a topical use.
- the compositions are administered at least one time a day. In other embodiments, the compositions are administered 1-4 times a day.
- compositions of the present invention may be administered in combination with other medications for treatment of bone osteolysis.
- said compositions are administered in combination with minerals.
- the minerals are selected from Zinc, Copper, Calcium, Phosphorus, and Silicon.
- the compositions described herein may further be administered in combination with vitamins.
- the vitamins are selected from, but not limited to, Vitamin C, Vitamin D, Vitamin E or Vitamin K.
- Vitamin D may comprise Vitamin Di, Vitamin D2, Vitamin D3, Vitamin D4, Vitamin D5 or a combination thereof .
- Separate dosage forms may be administered simultaneously or sequentially or on entirely independent separate regimens.
- the composition has a pH in the range of about 5 to about 7, including each value within the specified range.
- the composition disclosed herein further comprises a thickening agent.
- the thickening agent comprises at least one of hydroxypropyl methylcellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxymethyl cellulose, carboxy methyl cellulose, polyvinylpyrrolidone, and polyvinyl alcohol. Each possibility represents a separate embodiment.
- the composition disclosed herein further comprises an inorganic mineral.
- the inorganic mineral comprises at least one of hydroxyapatite, calcium phosphate, calcium carbonate, calcium gluconate, calcium oxalate, calcium sulfate, calcium chloride, magnesium phosphate, magnesium carbonate, magnesium gluconate magnesium oxalate, magnesium sulfate, magnesium chloride, zinc phosphate, zinc carbonate, zinc gluconate, zinc oxalate, zinc sulfate, zinc chloride, and sodium bicarbonate.
- the inorganic mineral is a calcium phosphate mineral selected from the group consisting of amorphous calcium phosphate, tricalcium phosphate and hydroxyapatite. Each possibility represents a separate embodiment of the invention.
- the composition disclosed herein further comprises at least one anti-oxidant comprising NAC or a derivative or salt thereof.
- the NAC or a derivative or salt thereof comprises at least one of N-acetylcysteine, S-(2-(l- carboxy-2-methylpropyl)isoindole-l-yl)-N-acetylcysteine, N- acetylcysteine lysinate; S-phenyl-N-acetylcysteine, N-acetyl-S-(N- methylcarbamoyl)cysteine, N-acetyl-S- pentachloro-1,3- butadienylcysteine, adamantyl-N-acety Icy stein, N-acetylcysteinamide, S-(l- (4'-methoxyphenyl)-2- hydroxypropyl)-N-acetylcysteine,
- the composition disclosed herein further comprises at least one active pharmaceutical ingredient (API).
- active pharmaceutical ingredients within the scope of the present invention include, but are not limited to, an antibacterial drug, an antiresorptive agent, and an anti-inflammatory agent. Each possibility represents a separate embodiment of the invention.
- the antibacterial drug comprises at least one antibiotic selected from penicillins, cephalosporins, tetracyclines, aminoglycozides, glycopeptides, chloramphenicol, quinolones, sulphonamides, and macrolides.
- the antibacterial drug is a tetracycline antibiotic.
- the tetracycline antibiotic is selected from the group consisting of doxycycline, minocycline, sarecycline, omadecycline or a pharmaceutically acceptable salt thereof. Each possibility represents a separate embodiment.
- the antiresorptive agent is a bisphosphonate selected from the group consisting of zoledronic acid, pamidronate, alendronate, etidronate, clodronate, risedronate, tiludronate, ibandronate, incadronate, minodronate, olpadronate, neridronate, and EB-1053, or a pharmaceutically acceptable salt thereof.
- zoledronic acid pamidronate
- alendronate etidronate
- clodronate risedronate
- ibandronate ibandronate
- ibandronate ibandronate
- ibandronate ibandronate
- EB-1053 a pharmaceutically acceptable salt thereof.
- the anti-inflammatory agent is a non-steroidal anti inflammatory drug (NSAID).
- NSAID non-steroidal anti inflammatory drug
- the NSAID is selected from the group consisting of ibuprofen, flurbiprofen, diclofenac, and naproxen, or a pharmaceutically acceptable salt thereof.
- the pharmaceutical composition disclosed herein further comprises a tissue adhesive.
- the tissue adhesive is selected from the group consisting of fibrin(ogen), gelatin, collagen, chitosan, cyanoacrylate, and combinations thereof. Each possibility represents a separate embodiment of the invention.
- the composition disclosed herein is in a liquid or semi solid form.
- the composition is in a form of a hydrogel.
- the composition disclosed herein is in a form selected from the group consisting of a cream, a paste, a solution, a putty, an emulsion, a suspension, and a powder.
- a cream, a paste, a solution, a putty, an emulsion, a suspension, and a powder is selected from the group consisting of a cream, a paste, a solution, a putty, an emulsion, a suspension, and a powder.
- compositions for parenteral administration can also be formulated as suspensions of the active compounds.
- suspensions may be prepared as oily injection suspensions or aqueous injection suspensions.
- suitable lipophilic solvents or vehicles can be used including fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes.
- the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds, to allow for the preparation of highly concentrated solutions.
- the pharmaceutical composition comprises a phosphate buffer. According to some embodiments, the pharmaceutical composition comprises HEPES.
- the composition is used as a coating on peri-implants.
- the composition is administered in proximity to a peri-implant via injection to the soft tissue surrounding a peri-implant.
- the composition is topically spread in an open crevice (for example a periodontal pocket) in proximity to a peri-implant.
- open crevice for example a periodontal pocket
- BMDMs Primary bone marrow-derived macrophages
- aMEM alpha-modified Eagle’s medium
- FBS fetal bovine serum
- the non-adherent fraction was cultured in 10-cm non-culture-treated dishes containing standard medium and 100 ng/ml macrophage colony stimulating factor (M-CSF).
- M-CSF macrophage colony stimulating factor
- TiP Ti particles
- TiC Ti particles
- TiC Ti particles
- TiC Ti particles
- TiC Ti particles
- each disc was subjected to US scaling for 60 seconds in distilled water (ddH20), then cleaned twice with ethanol, and finally resuspended in distilled water. It was previously shown that each 6 mm diameter disc generates -2.54 million particles on average. In all the in vitro assays and for the preparation of the fibrinogen-thrombin membranes, a particle density of 1293 particles/mm 2 were used.
- MTT assay For proliferation assay macrophages were plated (4000 cell/ well) into 96-well plate with standard medium supplemented with lOOng of MCSF. Cells were treated as indicated with either TiP/ 10 6 M SNV/ VIP at first day of incubation. Cells viability was determined using dimethylthiazol-diphenyl-tetrazolium-bromide (MTT) after 1, 3 or 5 days. MTT was added to a final concentration of 5 mg/ml and incubated for 4 hours at 37°C. After complete solubilization of the die in DMSO, plates were read at 450 nm in an ELISA reader.
- MTT dimethylthiazol-diphenyl-tetrazolium-bromide
- RNA isolation and RT-qPCR.
- macrophages were washed with sterile PBS, and RNA was extracted using Tri-RNA Reagent (Favorgen Biotech Corp, Kaohsiung, Taiwan). The 260/280 absorbance ratio was measured to verify the RNA purity and concentration.
- cDNA was produced using a high-capacity cDNA reverse transcription kit (Invitrogen, Grand Island, NY, USA), and real-time PCR was performed using Kapa SYBR Fast qPCR (Kapa Biosystems, Wilmington, MA, USA) on a StepOne real-time PCR machine (Applied Biosystems, Grand Island, NY, USA).
- TTGGTCCTTAGCCACTCCTTC (SEQ ID NO: 17) for mouse IL6; F- TCTTCTCATTCCTGCTTGTGG (SEQ ID NO: 18) and R-GGT CT GGGCC AT AG A ACT G A (SEQ ID NO: 19) for mouse TNFa; F-CCGTAACTGCACTGAAGAAG (SEQ ID NO: 20) and R-CTGTTGCTGCTCATCCATAC (SEQ ID NO: 21) for VPAC1; F- C AGC AG ACC AGG A A AC AT A A (SEQ ID NO: 22) and R-GCCACACGCATCTATGAA (SEQ ID NO: 23) for VPAC2 and F - ACCC AG A AG ACT GT GG AT GG (SEQ ID NO: 24) and R-CACATTGGGGGTAGGAACAC (SEQ ID NO: 25) for Gapdh.
- the reaction was subjected to 40 cycles of amplification using the following program: 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 25 s.
- the relative mRNA expression levels of the selected genes were normalized to the level of Gapdh.
- Peptide synthesis Peptides are typically synthesized using solid phase synthesis or other methods known in the art.
- the VIP peptide analog Stearyl-Nlel7-VIP (SNV) having the sequence Stearyl -HS D A VFTDN YTRLRKQ-Nle- A VKKYLN S ILN -NH 2 (SEQ ID NO: 3), was synthesized as before (Gozes, I. et al. Proc Natl Acad Sci U S A 93, 427-432 (1996); Gozes, I. et al. Endocrinology 134, 2121-2125 (1994). Osteoclastogenesis assay.
- Preosteoclasts prepared like the BMDMs, were plated in 96-well plates (7,000 cells per well, for TRAP staining, see below) or in 6-well plates (200,000 cells per well, for RNA) in standard medium supplemented with 20 ng/ml M-CSF and 50 ng/ml RANKL (R&D Systems, Minneapolis, MN, USA). After 48 hrs, the medium was replaced by the CM of BMDM, supplemented with RANKL and M-CSF. Where indicated, 10 6 M SNV/ VIP were added. After 30 hours, cells were stained using a TRAP kit (Sigma- Aldrich, St.
- TRAP-positive cells were defined as osteoclasts. Images were acquired at an original magnification of x4 (Evos FLC, Life Technologies, MS, USA). The number of osteoclasts and the total osteoclast area were measured using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
- Toxicology A preliminary toxicology study was performed for SNV that consisted of acute intravenous toxicity in rats, acute oral toxicity in rabbits, skin sensitization using adjuvant and patch test in guinea pigs, and single dose and repeated (for 13 weeks) dose toxicity studies in rats (study number - 004-1). The latter was a 90-day repeated dose toxicity study, consisting of SNV once a day at three different doses to the penis and vagina of male and female rats, respectively. The compound was tested for the treatment of erectile dysfunction. The active dose (7pg SNV) was chosen as the lowest dose for the study. The highest dosage group received 3500 pg.
- Wistar rats at the estrus phase received 50 pi (7.0 mCi/rat, 15 million CPM, 100 Ci/mM specific activity) of 125 I-SNV dissolved in 5% Sefsol (1-monocapryloyl-rac-glycerol), applied directly in the vagina, using a P100 micro pipettor.
- the rats were anesthetized with chloral hydrate and collected blood before cervical dislocation.
- the uterus, liver, lungs, heart, intestine, kidneys and vagina were then harvested (duplicate samples were taken from each organ). Organs were weighed and radioactivity levels were measured using a gamma counter. Each point on the chart represents at least two rats.
- All groups comprised 6 animals. Animals were euthanized 5 weeks post insertion, and the skull of each mouse was removed, fixed for 24hr in 4% phosphate-buffered formalin, followed by 70% ethanol. All specimens were scanned and analyzed using a pCT system (pCT 50, Scanco Medical AG, Switzerland). Scans were performed at a 10-pm resolution in all three spatial dimensions, with 90 kV energy, 88 mA intensity, and 1000 projections at a 1000 mSec integration time. The region of interest (ROI) was defined as two 3.7-mm circles in the center of the parietal bones.
- a custom-made algorithm based on Image-Processing Language (IPL, Scanco Medical), was developed to isolate the resorption pits, defined as unmineralized pits that were 10 to 40-pm deep on the bone surface. Morphometric parameters were determined at the 3D level inside a fixed ROI total volume (TV) and included the total volume of the bone resorption pits (Pit Resorption Volume, PRV, mm 3 ), and the calculated PRV/TV ratio. To differentiate between resorption pits and irregular bone thickening, we also measured the mean calvarial plate thickness.
- IPL Image-Processing Language
- ILip, IL6 and TNFa are the main mediators of Ti particle-mediated inflammation and osteolysis and the immuno-modulating role of VIP is well established.
- the effect of both VIP and its analog SNV, on the expression of these pro-inflammatory cytokines in macrophages was first examined. Bone marrow-derived macrophages were treated with 10 6 M VIP or SNV (or saline control) 1 hour before adding LPS (lpg/ml). Control cultures were left untreated (M- CSF only). After 24hrs, RNA was extracted and as shown in Fig. 1, a significant increase in the expression levels of the three cytokines in the LPS -treated versus control macrophage cultures was observed.
- VIP demonstrated a mixed immunomodulation, decreasing the levels of IL1 b but increasing the levels of IL6 expression (by 40% and 90%, respectively, p ⁇ 0.05).
- VIP did not affect TNFa expression.
- SNV had no effect on IL6 and TNFa expression levels but it significantly reduced the expression levels of IL1 b (by 35%, p ⁇ 0.05), showing a net anti inflammatory effect.
- VCAP1 and VCAP2 the classical receptors for VIP and its analog SNV, are expressed in preosteoclasts during the differentiation process.
- Bone marrow-derived macrophages (BMDM) which are osteoclasts precursors in vitro, were cultured in the presence of M-CSF and RANKL to induce osteoclast differentiation.
- VCAP1 and VCAP2 were both expressed in BMDM before the addition of RANKL (Day 0) and these levels declined by 58% and 92%, respectively, during osteoclastogenesis (Fig. 2).
- the osteoclastogenesis assay attributed a significant anti-osteoclastogenic effect to VIP and mainly to SNV (Fig. 3A-C).
- VIP treatment resulted in a reduced osteoclast area and SNV attenuated both osteoclast area and number, displaying a stronger inhibitory effect on osteoclasts than VIP.
- This inhibitory effect was not attributable to cytotoxicity as neither VIP nor SNV affected the viability of the cells in the culture over 5 days of treatment (MTT assay, Fig. 3D).
- the therapeutic applications of VIP have been hampered by its very short half-life and low penetration through lipidic barriers (skin and epithelium).
- the potent VIP analog SNV was elected as a potential therapeutic agent in the treatment of inflammation-induced osteolysis.
- a prerequisite for such a treatment modality is high penetrability through tissues and epithelium. Therefore, a transepithelial penetrability assay was conducted in a rat model. In this assay, a bolus of radiolabeled SNV was delivered to the vagina and the local levels of SNV showed a decline over time (Fig. 4A).
- the levels of SNV in the blood, heart, lungs, liver, gut, uterus and kidneys steadily increased (Fig. 4B), indicating the high penetrability of SNV through the vaginal epithelium, and further tissue stability. The integrity of the radioactive SNV was previously shown.
- EXAMPLE 4 SNV is nontoxic in-vivo Several toxicology studies were also conducted in rabbits, guinea pigs and rats as detailed in the method section, and all showed a clean toxicology profile, as detailed below. The study named 004-1, was the most protracted and detailed toxicology study. It was carried out in rats as a repeated dose toxicity study on target external organs, the penis and the vagina. The structure of the study included a detailed pathological study of all body organs.
- Treatment groups As in study 001-1, but injection was intravenous. Reactions - Necrotic reaction was observed at the site of injection in 55% group 2, 58% in group 3 and 100% in group 4. Most of surviving rats displayed normal body weight, and some weight loss observed initially was recovered during the study.
- Model - N 8 Albino female rabbits, 2.38-2.75 Kg, (Weizmann Institute of Science). Hair was removed from the back, sterile gauze was applied and test material injected into the gauze.
- Treatment groups - 1. Vehicle**; 2. SNV - (1000X) 7mg/animal**; 3. Positive control - l%-chloro-2, 4-dinitrobenzene in dibutyl-phthalate Daily applications for 3 days.
- Treatment group - Solution tested was 0.3-312.5pg/standard bacterial plate.
- Ti particles (TiP)-induced osteolysis assay was conducted using a mouse calvarial model (Eger, M., ibid).
- the topical effect of SNV was tested by incorporating SNV into membranes that were also loaded with Ti particles.
- SNV was assumed to penetrate the tissues and suppress the inflammation and osteoclastogenesis on the calvarial surface.
- a severe osteolysis on the calvarial surface, beneath the TiP-loaded membrane was observed (Fig. 5).
- Topically-administered SNV significantly suppressed the TiP-induced osteolysis leading to a 60% significantly lower pit resorption volume and pit resorption volume as percentage of the total tissue volume (Fig. 5A-5B).
- Fig. 5C There were no significant differences in the calvaria thickness (Fig. 5C), supporting the idea that SNV suppressed pit resorption rather than stimulated irregular bone apposition.
- VIP increases IL6 expression in LPS-activated macrophages, whereas SNV is not (Fig.l), supporting the notion of a distinct mechanism between VIP and SNV.
- the superior anti-osteoclastogenic effect of SNV over VIP may therefore result from either its inhibitory effect on IL1 b with no stimulation of IL6, a distinct internal signaling pathway or its longer half-life.
- Another advantage of SNV is that its chemical properties allowed its incorporation in the thrombin-fibrinogen membrane whereas VIP and its solvent perturbed the formation of the membrane (data not shown).
- the observed impact of VIP on osteoclast differentiation is likely a direct anti-osteoclastogenic effect, that slightly supersedes the pro- osteoclastogenic increase in IL6.
- the therapeutic potential of VIP has been tested in a rat model of periodontitis and displayed a partial effect on the inflammatory status and osteoclastogenic signals but no significant positive outcome on bone loss (Gozes, I. et al. Proc Natl Acad Sci U S A 96, 4143-4148, (1999)).
- the strong suppression of osteoclast differentiation by the peptide analog SNV might result from the combined effect on the inflammation (decrease in ILip, Fig. 1) as well as a direct effect on osteoclasts (Fig. 3).
- the osteoclastogenic assay was performed in the presence of conditioned medium from TiP-exposed macrophages, containing a host of pro-inflammatory and pro-osteoclastogenic signals, and SNV blocked or supplanted these signals, supporting the notion of a strong inhibitory effect on osteoclast differentiation.
- inflammation-induced osteolysis is the common pathological outcome of various conditions including periodontitis, oral peri-implantitis and orthopedic implant loosening.
- the peptide analog SNV blocked the two common denominators leading to osteolysis, i.e., inflammation and osteoclastogenesis, notwithstanding the cause of the inflammation, i.e., bacterial (LPS) or aseptic (TiP).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Endocrinology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Vascular Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Toxicology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Physical Education & Sports Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to methods for treating inflammation-induced and/or aseptic osteolysis. In particular, the methods comprise the use of analogs of vasoactive intestinal peptide (VIP) and pituitary adenylyl cyclase activating polypeptide (PACAP) in osteolysis in periodontal or other diseases and conditions.
Description
COMPOSITIONS AND METHODS FOR TREATING OSTEOLYSIS
FIELD OF THE INVENTION
The present invention relates to treatment of osteolysis. In particular, the invention relates to compositions and methods for preventing and treating osteolysis in periodontal or other diseases and conditions using analogs of vasoactive intestinal peptide (VIP) and pituitary adenylyl cyclase activating polypeptide (PACAP).
BACKGROUND
Osteolysis is a progressive condition where bone tissue is destroyed due to resorption of bone matrix by osteoclasts. In this process, bones lose minerals (mostly calcium), softens, degenerates and become weaker. Osteolysis may be caused by variety of pathologies like bone tumors, cysts, or chronic inflammation, and may be caused by the vicinity of implants or prosthesis.
Periodontal-related diseases affect the tissues that surround and support the tooth. Periodontitis is an inflammatory lesion that is accompanied by soft tissue destruction and bone resorption in the tooth- supporting structures. It initiates by a biofilm that forms on the tooth surface and induces an inflammatory response in connective tissue leading to the stimulation of osteoclasts and periodontal bone loss. In 2009-2012, 46% of US adults had periodontitis, with 8.9% having severe periodontitis. Periodontitis prevalence was positively associated with increasing age and was higher among males (Eke et al, 2015, J Periodontol. 2015 May; 86(5): 611-622).
Peri-implant infective diseases commonly include peri-implant mucositis which is restricted to the peri-implant mucosa and peri-implantitis which also affects implant- supporting bone. While the former is known to be reversible upon conventional treatment including utilization of different manual ablations, laser- supported systems as well as photodynamic therapy, which may be extended by local or systemic antibiotics, the latter is very difficult to eradicate thereby requiring surgical therapies to regain osseointegration (a direct connection between living bone and the surface of a load-bearing artificial implant). Currently, peri-implant infective diseases remain one of the most frequent complications affecting both the soft and hard tissues surrounding an implant that can even lead to implant loss (Smeets et al. Head & Face Med. 2014, 10:34). In addition, the increasing use of titanium implants in dentistry is
associated with an increased concern regarding inflammation-induced or even aseptic bone loss due to small titanium dust around implants. In particular, biomolecules including lipopolysaccharide (LPS), a component of Gram-negative bacterial cell walls and cause of inflammation have been shown to interact strongly with Titanum (Ti) and modify its corrosion resistance. Gram-negative microbes are abundant in biofilms which form on dental implants.
Since a peri-implant tissue forms as a result of surgical trauma during wound repair, it is typically characterized by having a scarred nature, receded blood flow caused by poor vascularity, a deeper sulcus which allows for deeper penetration of bacteria, and lack of periodontal space. Thus, even a fully integrated dental implant exhibits a space which is more susceptible to bacterial infection than periodontal tissues (Pokrowiecki et al. Ther. Clin. Risk Manag., 2017, 13:1529-1542).
Vasoactive intestinal peptide (VIP), is a peptide hormone that is vasoactive in the intestine. VIP is a peptide of 28 amino acid residues that belongs to a glucagon/secretin superfamily, the ligand of class II G protein-coupled receptors. VIP has a variety of functions and showed to regulates osteoclast activity via specific binding sites on both osteoclasts and osteoblasts.
US patent No. 5972883 discloses methods for the treatment of neurodegenerative diseases comprising administering VIP and analogs thereof.
WO 01/93889 discloses pharmaceutical compositions for the treatment of skin disorders comprising VIP-related peptides.
Gurkan et al. discloses the therapeutic efficacy of VIP in Escherichia coli lipopolysaccharide-induced experimental Periodontitis in Rats. (Gurkan et al., J Periodontol, 2009 Oct;80(10): 1655-64).
Pituitary adenylyl cyclase activating polypeptide (PACAP) is a potent activator of the AC/PKA pathway. Mediated by adenylate cyclase-activating polypeptide 1 receptors, this polypeptide stimulates adenylate cyclase and subsequently increases the cAMP level in target cells. A recent study has shown that PACAP-38 analogs may have a therapeutic effect on X- linked neuromuscular disease spinobulbar muscular atrophy (SBMA) (Polanco et al. Sci. Transl. Med. 8, 370ral81 (2016)).
There remains a yet unmet need for compositions useful in treating osteolysis, in particular, periodontal-related diseases that would obviate the need for invasive surgical procedures.
SUMMARY OF THE INVENTION
The present invention provides pharmaceutical compositions and formulations comprising analogs of Vasoactive intestinal peptide (VIP) or Pituitary adenylyl cyclase activating polypeptide (PACAP), for use in treating osteolysis. The VIP and PACAP are short peptides having a significant sequence homology. The present invention further provides in some embodiments, analogs and conjugates of VIP and PACAP for treating or preventing periodontal related diseases, such as periodontitis and peri-implantitis.
It is now disclosed that certain analogs of VIP and PACAP described herein are highly efficient in treating and preventing periodontal-related diseases such as periodontitis and peri- implantitis. It is further disclosed that the analogs described herein are efficient in treating titanium particle-induced osteolysis. The VIP or PACAP analogs in some embodiments are lipophilic and able to penetrate skin and oral mucosa. The inventors of the present invention have developed formulations comprising the analogs which found to be highly efficient in treating osteolysis. The natural VIP peptide did not dissolve properly and found to be unsuitable for the indications described herein.
Unexpectedly, a Stearyl-Norleucine analog of VIP, herein denoted SNV, was found to induce strong suppression of osteoclast differentiation. This activity might result from the combined effect on inflammation (e.g., decrease in IL1 b expression) as well as a direct effect on osteoclasts. This activity significantly exceeded VIP effect on osteoclast differentiation. Moreover, VIP peptide was shown to increase bone resorption in an ex vivo organ culture which may be mediated by its actions on osteoblasts. Therefore, the SNV peptide, which blocks the two common denominators leading to osteolysis, osteoclastogenesis and the inflammation (mainly caused by bacteria and/or aseptic), is efficient and highly suitable for treating osteolysis, in particular, periodontal related diseases.
According to one aspect, the present invention provides a pharmaceutical composition comprising a peptide analog of VIP (SEQ ID NO: 2) for use in treating or preventing osteolysis, wherein the peptide analog consists of 25 to 50 amino acids comprising the sequence ZHS DX 1 X2FTDX3 YX4RX5RKQX6 A VKKYLX7L (SEQ ID NO: 1), wherein
Xi is selected from A and G;
X2 is a hydrophobic amino acid;
X3 is selected from N and S;
X4 is selected from T and S;
X5 is selected from L and Y ;
Xe is a hydrophobic amino acid;
X7 is a stretch of 3 amino acid residues selected from NSI and AAV; and
Z is a permeability enhancing moiety, any amino acid, or absent.
According to some embodiments, X2 and Xe are hydrophobic amino acids selected from the group consisting of leucine (L), isoleucinc (I), norleucine (Nle), valine (V), tryptophan (W), phenylalanine (F), methionine (M), octahydroindole-2-carboxylic acid (oic), cyclohexylglycine (chg) and cyclopentylglycine (cpg). According to some embodiments, X2 is selected from V and I. According to additional embodiments, Xe is selected from Norleucine (Nle) or Met (M).
According to some embodiments, the peptide length is up to 50 amino acids residues. According to certain embodiments, the peptide length is up to 45, 40, 35, 30, or 25 amino acid residues. Each possibility represents a separate embodiment of the invention.
According to some embodiments, the peptide is 25-50 amino acid residues in length. According to some embodiments, the peptide is 26-40 amino acid residues in length. According to some embodiments, the peptide is 27-40 amino acid residues in length. According to some embodiments, the peptide is 25-30 amino acid residues in length. According to some embodiments, the peptide is 30-45 amino acid residues in length.
A conjugate or multimer comprising the peptide described herein is provided according to certain embodiments of the invention.
According to some embodiments, the peptide is conjugated with a permeability enhancing moiety. According to some embodiment, the peptide is conjugated to a lipophilic moiety. According to additional embodiment, the N-terminus or C-terminus is conjugated to a lipophilic moiety. According to specific embodiments, the N-terminus or C-terminus is conjugated to a lipophilic moiety selected from the group consisting of stearoyl, lauroyl, and caproyl.
According to some embodiments, the N-terminus is modified. According to some embodiments, the N-terminus is modified with a permeability enhancing moiety. According to certain embodiments, the N-terminus is acetylated. According to some embodiments, the N-
terminus is conjugated with a fatty acid. According to exemplary embodiments, the N-terminus is conjugated with a stearyl moiety.
According to some embodiments, the C-terminus is modified. According to certain embodiments, the C-terminus is amidated. According to additional embodiments, the C- terminus is modified with a propyl-amide.
According to some embodiments, the peptide comprises the sequence GKRYKQRVKNK (SEQ ID NO: 13) connected to C-terminus of the Leucine residue (L) of SEQ ID NO: 1.
According to some embodiments, the peptide comprises a sequence selected from the group consisting of:
S teary 1-HS D A VFTDN YTRLRKQ-Nle- A VKKYLN S ILN -NH2 (SEQ ID NO: 3);
HS DGIFTDS Y S RYRKQ-Nle- A VKKYL A A VL (SEQ ID NO: 4);
HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK (SEQ ID
NO: 5);
Acetyl-HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK-NH2 (SEQ
ID NO: 6);
Acety 1-HS DGIFTDS Y S RYRAQM A V AKYLA A VLGKRYKQRVKNK-Propy lamide
(SEQ ID NO: 7);
Acety 1-HS DGIFTDS Y S RYRAQM A V AKYLA A VLGKRYKQRVKNK (SEQ ID NO:
8); HSDGIFTDSYSRYRKQMAVKKYLAA VLGKRYKQRVKNK (SEQ ID NO: 9); and HS DA VFTDN YTRLRKQ-Nle- A VKKYLN S ILN (SEQ ID NO: 26).
Each possibility represents a separate embodiment of the invention.
According to some embodiments, the peptide analog consists of a sequence selected from the group consisting of:
Stearyl -HS DA VFTDN YTRLRKQ-Nle- A VKKYLN S ILN -NH2 (SEQ ID NO: 3);
HS DGIFTDS Y S RYRKQ-Nle- A VKKYL AAVL (SEQ ID NO: 4);
HSDGIFTDSYSRYRKQ-Nle-AVKKYLAA VLGKRYKQRVKNK (SEQ ID NO: 5);
Acetyl-HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK-NH2 (SEQ
ID NO: 6);
Acety 1-HS DGIFTDS Y S RYRAQM A V AKYLA A VLGKRYKQRVKNK-Propy lamide
(SEQ ID NO: 7); and
Acetyl-HSDGIFTDS YS RYRAQM A V AKYLA A VLGKRYKQRVKNK (SEQ ID NO:
8).
Each possibility represents a separate embodiment of the invention.
According to some embodiments, the peptide analog comprises the sequence HS D A VFTDN YTRLRKQ-Nle- A VKKYLN S ILN (SEQ ID NO: 26);
According to some embodiments, the peptide analog consists of the sequence Stearyl- HS DA VFTDN YTRLRKQ-Nle- A VKKYLN S ILN-NEb (SEQ ID NO: 3).
Analogs of the peptide or fragments described herein are peptides in which one or more amino acids has been added, deleted or replaced by any means known in the art. The analogs of the peptide which fall under the scope of the present invention are those which maintain the biological properties described herein. According to some embodiments, the peptide comprises at least one non-natural amino acid residue. According to some embodiments, the peptide comprises one or more D-amino acids. The analogs described herein are peptides having at least one amino that has been added, deleted or replaced, or having a modification compared to the peptide set forth in SEQ ID NO: 2.
According to some embodiments, the pharmaceutical composition is for use in treating or preventing aseptic osteolysis.
According to some embodiments, the pharmaceutical composition is for use in treating or preventing inflammation-induced osteolysis.
According to some embodiments, the pharmaceutical composition is for use in treating or preventing inflammation-induced osteolysis in a periodontal-related disease or condition.
According to some embodiments, the periodontal-related disease is periodontitis or peri- implantitis. According to certain embodiments, the periodontal-related disease is periodontitis. According to certain embodiments, the periodontal-related disease is peri-implantitis.
According to some embodiments, the pharmaceutical composition is for use in treating or preventing periodontal bone loss.
According to some embodiments, the pharmaceutical composition further comprises an acceptable carrier, excipients or diluent.
According to some embodiments, the pharmaceutical composition is formulated for topical administration. According to some embodiments, the pharmaceutical composition is formulated in a dosage form selected from the group consisting of gels, suspensions, emulsions, powders, granules, elixirs, and tinctures. According to other embodiments, the pharmaceutical composition is formulated for injectable administration.
According to some embodiments, the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 1 to 500 pg/mL. According to certain embodiments, the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 2 to 400 pg/mL. According to certain embodiments, the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 20 to 300 pg/mL. According to certain embodiments, the pharmaceutical composition comprises the peptide or analog described herein in a concentration of 50 to 200 pg/mL.
According to some embodiments, the pharmaceutical composition further comprises fibrinogen. According to certain embodiments, the pharmaceutical composition further comprises thrombin.
According to an additional aspect, the present invention provides a method of treating osteolysis, the method comprising administering to the subject a therapeutically effective amount of the peptides or conjugates described herein.
According to some embodiments, the osteolysis is inflammation-related osteolysis. According to other embodiments, the osteolysis is aseptic osteolysis.
According to some embodiments, the method comprises integrating an implant. According to specific embodiments, the method comprises integrating a titanium implant.
According to certain embodiments, the inflammation-related osteolysis is a periodontal- related disease or disorder.
According to some embodiments, the osteolysis is titanium particle-induced osteolysis.
According to some embodiments, the amount is effective to enhance osseointegration of a dental implant. According to some embodiments, the amount is effective to enhance alveolar
bone regeneration. According to some embodiments, the amount is effective to promote osteogenic differentiation. According to certain embodiments, the method comprises accelerating osteogenesis.
According to some embodiments, the alveolar bone loss or periodontal bone loss is prevented, inhibited or treated.
According to some embodiments, the method comprises a dental implant integration. According to further embodiments, the method comprises accelerating bone growth in the osseointegration procedure of a dental implant in jawbone.
According to some embodiments, the method further comprising administering an antibiotic. According to certain embodiments, the antibiotic is selected from the group consisting of arestin, doxycycline, tetracycline, minocycline and hydrochloride.
According to some embodiments, the method further comprises administering a disinfectant or antiseptic agent. According to certain embodiments, the disinfectant agent is chlorhexidine gluconate (CHG).
According to some embodiments, the subject is a mammal. According to certain embodiments, the subject is a human subject.
According to some embodiments, the pharmaceutical composition is administered at least twice a day, once a day, twice a week or once a week. According to some embodiments, the pharmaceutical composition is administered at least once a day. According to other embodiments the administration is limited to the surgical site during, before or after the surgical procedure.
Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGs 1A-1C. VIP (SEQ ID NO: 2) and SNV (SEQ ID NO: 3) display a partial anti inflammatory effect in LPS- stimulated macrophage cultures. Primary murine macrophages
were treated with 106M of VIP or SNV (or saline) and exposed to lpg/ml LPS for 24 hrs. Expression of IL1 b (Fig. 1A), IL6 (Fig. IB) and TNFa (Fig. 1C) mRNAs was examined using RT-qPCR and presented as fold from untreated controls (no EPS). n=5, # p<0.05 vs. Control; *p<0.05 vs. EPS, 1-way ANOVA.
FIGs 2A-2B. Expression of the receptors for VIP in bone marrow-derived macrophages and preosteoclasts. Fig. 2A - VIP receptor VCAP1. Fig. 2B - VIP receptor VCAP2. Expression is measured in M-CSF treated macrophages (Day 0) and M-CSF + RANKE treated pre osteoclasts (Day 2) using RT-qPCR. Data are Mean+SD, normalized to expression levels in macrophages, performed in triplicates in 2 independent experiments with similar results.
FIGs 3A-3D. VIP and SNV display an anti-osteoclastogenic effect in the presence of titanium (Ti) particles. Figs. 3A-3C - Primary murine preosteoclasts were cultured in 20 ng/ml M-CSF and 50 ng/ml RANKE for 48 hrs. Conditioned medium from macrophages exposed to Ti particles (Ti) was then added together with 106M of VIP or SNV (or saline) for 48 hrs before TRAP staining. Data are Mean ± SEM for osteoclast % surface area (Fig. 3A) and number per well (Fig. 3B). Fig. 3C - representative images at x4 original magnification. n=8, #p<0.05 vs. Control; *p<0.05 vs. Ti, ANOVA. Fig. 3D - Primary murine macrophages/preosteoclasts were cultured in 20 ng/ml M-CSF and Ti particles, 106M of VIP or SNV, or saline only. MTT viability assay was performed after 1, 3 and 5 days and presented as optical density values. N=5, no statistical differences were found between the treatment groups. Data are Mean+SD in arbitrary OD units.
FIGs 4A-4B. SNV demonstrated a high transepithelial penetrability and stability using a model of vaginal delivery in rats. Radiolabeled SNV (7.0 mCi/rat, 15 million CPM, 100 Ci/mM) was delivered in the vagina of rats at time zero (TO). Each point on the chart represents at least two rats. Fig. 4A - Fevels of radioactivity were monitored over 250 min to assess the remaining amount of SNV in the vagina. Fig. 4B. The radioactivity of SNV in the vagina versus its distribution in the indicated organs as a measure of its penetrability through the vaginal epithelium. Data are Mean +/- SD.
FIGs 5A-5D. Effect of topically-administered SNV on particle-induced osteolysis in vivo. Fibrin membranes including titanium particles, together with SNV (or saline as control) were implanted onto mouse calvaria. Mice were euthanized 5 weeks post-op for pCT analysis. Fig. 5A - Pit resorption volume of bones (PRV, mm3), Fig. 5B - Pit resorption volume to total volume (PRV/TV (%)), Fig. 5C - Calvarial thickness (pm). Data are expressed as mean+SD,
n=6, *p<0.05 vs. Ti, ANOVA. Fig. 5D - Representative pCT images of the calvaria. The region of interest (ROI) is represented in dark gray, and the resorption pits are denoted in red. Bar = 1 mm.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides methods of treating osteolysis. The present invention further provides in some embodiments methods of treating or preventing periodontal diseases, such as periodontitis and peri-implantitis associated bone loss.
The typical treatments for periodontitis include localized therapy with controlled release antibiotics. The repetitive and lengthy use of certain antibiotics enhance the risk of bacterial resistance. Moreover, the treatments known so far, i.e., antibiotics, do not specifically targets the inflammation nor osteoclasts, and are therefore not indicated for the prevention of titanium particles-induced osteolysis, which can progress even in the complete absence of bacteria. The peptides described herein provides an efficient treatment that reduces bacterial (LPS) or aseptic (TiP) inflammation and the associated bone loss.
According to one aspect, the present invention provides a pharmaceutical composition comprising a peptide analog of VIP (SEQ ID NO: 2) for use in treating or preventing osteolysis, wherein the peptide analog consists of 25 to 50 amino acids comprising the sequence ZHS DX 1 X2FTDX3 YX4RX5RKQX6 A VKKYLX7L (SEQ ID NO: 1), wherein
Xi is selected from A and G;
X2 is a hydrophobic amino acid;
X3 is selected from N and S;
X4 is selected from T and S;
X5 is selected from L and Y ;
Xe is a hydrophobic amino acid;
X7 is a stretch of 3 amino acid residues selected from NSI and AAV; and
Z is a permeability enhancing moiety, any amino acid, or absent.
According to an additional aspect, the present invention provides a method of treating or preventing osteolysis in a subject, comprising the step of administering to the subject a pharmaceutical composition comprising a peptide analog of VIP or PACAP, wherein said peptide analog comprises SEQ ID NO: 1: ZHSDX1X2FTDX3YX4RX5RKQX6AVKKYLX7L, wherein
Xi is selected from A and G;
X2 is a hydrophobic amino acid;
X3 is selected from N and S;
X4 is selected from T and S;
X5 is selected from L and Y ;
Xe is a hydrophobic amino acid;
X7 is a stretch of 3 amino acid residues selected from NSI and AAV; and
Z is a permeability enhancing moiety, any amino acid, or absent, with the proviso that the amino acid sequence does not include the complete, exact SEQ ID NO: 2.
According to specific embodiments, the method is for treating osteolysis in periodontitis or peri-implantitis.
A conjugate or a multimer comprising the peptide described herein is provided according to certain embodiments of the invention.
According to some embodiments, the peptide is conjugated with a permeability enhancing moiety. According to some embodiment, the peptide is conjugated to a lipophilic moiety. According to additional embodiment, the N-terminus or C-terminus is conjugated to a lipophilic moiety. According to specific embodiments, the N-terminus or C-terminus is conjugated to a lipophilic moiety selected from the group consisting of stearoyl, lauroyl, and caproyl.
According to some embodiments, the N-terminus is modified. According to some embodiments, the N-terminus is modified with a permeability enhancing moiety. According to certain embodiments, the N-terminus is acetylated. According to some embodiments, the N- terminus is conjugated with a fatty acid. According to exemplary embodiments, the N-terminus is conjugated with a stearyl moiety.
According to some embodiments, the C-terminus is modified. According to certain embodiments, the C-terminus is amidated. According to additional embodiments, the C- terminus is modified with a propyl-amide.
According to some embodiments, the peptide comprises sequence GKRYKQRVKNK (SEQ ID NO: 13) connected to C-terminus of the Leucine residue (L) of SEQ ID NO: 1.
According to some embodiments, the peptide comprises a sequence selected from the group consisting of: Stearyl -HS D A VFTDNYTRLRKQ-Nle- A VKK YLN S ILN - NH2 (SEQ ID NO: 3); HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVL (SEQ ID NO: 4);
HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK (SEQ ID NO: 5); Acetyl-HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK-NH2 (SEQ ID NO: 6); Acety 1-HS DGIFTDS Y S RYRAQM A V AKYLA A VLGKRYKQRVKNK-
Propylamide (SEQ ID NO: 7); Acetyl-HSDGIFTDS
Y S RYRAQM A V AKYL A A VLGKRYKQR VKNK (SEQ ID NO: 8);
HS DGIFTDS Y S RYRKQM A VKKYL A A VLGKR YKQRVKNK (SEQ ID NO: 9); and HS DA VFTDNYTRLRKQ-Nle- A VKKYLN S ILN (SEQ ID NO: 26). Each possibility represents a separate embodiment of the invention.
According to some embodiments, the peptide consists of a sequence selected from the group consisting of: S teary 1-HS DA VFTDNYTRLRKQ-Nle- A VKK YLN S ILN -NH2 (SEQ ID NO: 3); HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVL (SEQ ID NO: 4);
HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK (SEQ ID NO: 5); Acetyl-HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK-NH2 (SEQ ID NO: 6); Acety 1-HS DGIFTDS Y S RYRAQM A V AKYLA A VLGKRYKQRVKNK-
Propylamide (SEQ ID NO: 7); and Acetyl-HSDGIFTDS
Y S RYRAQM A V AKYL A A VLGKRYKQR VKNK (SEQ ID NO: 8). Each possibility represents a separate embodiment of the invention.
According to some embodiments, the peptide consists of the sequence Stearyl- HS DA VFTDNYTRLRKQ-Nle- A VKKYLN S ILN-NH2 (SEQ ID NO: 3).
According to some embodiments, the peptide length is up to 50 amino acids residues. According to certain embodiments, the peptide length is up to 45, 40, 35, 30, or 25 amino acid residues. Each possibility represents a separate embodiment of the invention.
According to some embodiments, the peptide is 10-50 amino acid residues in length. According to some embodiments, the peptide is 15-40 amino acid residues in length. According to some embodiments, the peptide is 20-40 amino acid residues in length. According to some embodiments, the peptide is 10-30 amino acid residues in length. According to some embodiments, the peptide is 30-40 amino acid residues in length.
According to some embodiments, the peptide fragment comprises at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 amino acids. Each possibility represents a separate embodiment of the invention. According to certain embodiments, the peptide fragment comprises 4 amino acids. According to certain embodiments, the peptide fragment comprises 11 amino acids. According to certain embodiments, the peptide fragment comprises at least 10 amino acids. According to certain embodiments, the peptide fragment consists of 15-20 amino acids. According to certain embodiments, the peptide fragment consists of 10-15 amino acids. According to additional embodiments, the peptide consists of 12 amino acids.
According to some embodiments, the peptide fragment sequence is KKYL. According to some embodiments, the analog is stearyl-KKYL-NPb (SEQ ID NO: 10).
According to some embodiments, the peptide fragment is St-VIPis-28 (Stearyl- AVKKYLNSILN-amide) (SEQ ID NO: 11). According to some embodiments, the peptide fragment is St-VIPi-i4(Stearyl-HSDAVFTDNYTRLR-amide) (SEQ ID NO: 12).
According to an aspect the present invention provides a pharmaceutical composition comprising a peptide for use in treating or preventing osteolysis, the peptide is selected from the group consisting of stearyl-KKYL-NPh (SEQ ID NO: 10), Stearyl-AVKKYLNSILN-amide (SEQ ID NO: 11), and Stearyl-HSDAVFTDNYTRLR-amide (SEQ ID NO: 12).
According to some embodiments, the peptide described herein is modified. Modifications can be made directly to the peptide, such as by glycosylation, side chain oxidation, phosphorylation, addition of a linker molecule, addition of a fatty acid, nucleic acid, amino acid substitution and the like.
Amino acid substitution to produce peptide functional variants preferably involves conservative amino acid substitution i.e., replacing one amino acid residue with another that is biologically and/or chemically similar, e.g., a hydrophobic residue for another, or a polar residue for another.
Modifications also encompass introduction of one or more non-natural amino acids, introduced so as to render a peptide non-hydrolysable or less susceptible to hydrolysis or proteolysis, as compared to the original peptide. The peptides may contain one or more D- amino acids or one or more non-hydrolysable peptide bonds linking amino acids. Alternatively, one may modify the peptides in order to reduce the potential for hydrolysis by proteases. For example, to determine the susceptibility to proteolytic cleavage, peptides may be labeled and incubated with cell extracts or purified proteases and then isolated to determine which peptide bonds are susceptible to proteolysis. Alternatively, potentially susceptible peptide bonds can be identified by comparing the amino acid sequence of a peptide with the known cleavage site specificity of a panel of proteases. Based on the results of such assays, individual peptide bonds which are susceptible to proteolysis can be replaced with non-hydrolysable peptide bonds.
Non-hydrolysable peptide bonds are known in the art, along with procedures for synthesis of peptides containing such bonds. Non-hydrolysable bonds include, but are not limited to, psifCFhNH] - reduced amide peptide bonds, psifCOCFh] - ketomethylene peptide bonds, psi[CH(CN)NH] - (cyanomethylene)amino peptide bonds, psi [CFhCHlOH)] hydroxyethylene peptide bonds, psifCFhO] - peptide bonds, and psifCFhS] - thiomethylene peptide bonds.
According to some embodiments, the peptide comprises a permeability-enhancing moiety. The permeability-enhancing moiety may be connected to any position in the peptide moiety, directly or through a spacer or linker.
According to some embodiments, the pharmaceutical composition further comprises an acceptable carrier, excipients or diluent.
Pharmaceutically acceptable excipients used in the composition of the present invention are selected from but not limited to the group of excipients generally known to persons skilled in the art e.g. vehicles, bulking agents, stabilizers, preservatives, surfactants, hydrophilic polymers, solubility enhancing agents such as glycerin, various grades of polyethylene oxides, beta-cyclodextrins like sulfobutylether-beta-cyclodextrin, transcutol and glycofurol, tonicity adjusting agents, local anesthetics, pH adjusting agents, antioxidants, osmotic agents, chelating agents, viscosifying agents, wetting agents, emulsifying agents, acids, sugar alcohol, reducing sugars, non-reducing sugars and the like, or mixtures thereof.
The pharmaceutical composition can further comprise pharmaceutical excipients including, but not limited to, sodium chloride, potassium chloride, magnesium chloride, sodium
gluconate, sodium acetate, calcium chloride, sodium lactate, and the like. The composition, if desired, can also contain minor amounts of sugar alcohols, wetting or emulsifying agents, and pH adjusting agents. Antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and agents for the adjustment of tonicity such as sodium chloride or dextrose are also envisioned.
The term “pharmaceutical composition” as used herein refers to any composition comprising at least one pharmaceutically active ingredient, formulated such that it facilitates accessibility of the active ingredient to the target organ.
The term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U. S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
The term “carrier” as used herein indicates an inactive substance that serves as mechanisms to improve the delivery and the effectiveness of drugs and can be identified by a skilled person in view of the route of administration and related composition formulation.
The term “excipient” as used herein indicates an inactive substance that can be used any of various media acting usually as solvents, binders or diluents to bulk up formulations that contain active ingredients (thus often referred to as “bulking agents,” “fillers,” or “diluents”), to allow convenient and accurate dispensation of a drug substance when producing a dosage form. Suitable excipients can include any substance that can be used to bulk up formulations with the peptide analogs to allow for convenient and accurate dosage.
The singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.
According to some embodiments, the method further comprises a step of administering antibiotics. According to certain embodiments, the antibiotic is selected from the group consisting of arestin, doxycycline, tetracycline hydrochloride,
According to some embodiments, the method further comprises a disinfectant or antiseptic agent. According to certain embodiments, the disinfectant agent is chlorhexidine gluconate (CHG).
According to some embodiments, the method further comprises administering of Periochip®, Atridox®, Actisite®, or Chlo-site.
According to some embodiments, the peptide analog is administered using a delivery vehicle. Delivery vehicles for the peptide analogs in the pharmaceutical compositions include in non-limiting examples, naturally occurring polymers, microparticles, nanoparticles, and other macromolecular complexes capable of mediating delivery of the peptide to a tissue and/or a host cell. Vehicles can also comprise other components or functionalities that further modulate, or that otherwise provide beneficial properties.
According to some embodiments, the delivery vehicle is a naturally occurring polymer, e.g., formed of materials including but not limited to albumin, collagen, fibrin, alginate, extracellular matrix (ECM), e.g., xenogeneic ECM, hyaluronan (hyaluronic acid), chitosan, gelatin, keratin, or agarose. According to some embodiment, the delivery vehicle comprises a hydrogel. Natural materials useful in hydrogels include natural polymers, which are biocompatible, biodegradable, support cellular activities, and include proteins like fibrin, collagen and gelatin, and polysaccharides like starch, alginate and agarose.
According to certain embodiments, the pharmaceutical composition is in the form of a gel or salve. In this form, it is usually introduced into the gingival pockets, where it releases the active agent to the surroundings.
The term "therapeutically effective amount" of the compound is that amount of a composition containing the peptide analog according to the present invention which is sufficient to provide a beneficial effect to the subject to which the compound is administered. An effective amount of the compound may vary according to factors such as the disease state, age, sex, and weight of the individual.
The term “effective amount” as used herein refers to a sufficient amount of the compositions comprising the peptide analogs described herein to prevent or reduce bone loss.
According to some embodiments, the compositions are used for bone growth acceleration in dental implants osseointegration. The implants may include a variety of biocompatible structures, including specifically dental implants.
The administration of the compositions may be started before an implant surgery. Alternatively, the administration of the compositions may be started on the same day of an implant surgery. In other embodiments, the administration is started at least one day following the surgery. In alternative embodiments, the compositions are administered starting two, five, ten, fifteen or twenty days from the implant surgery. Each possibility represents a separate embodiment of the invention.
The compositions disclosed herein may be administered locally. According to some embodiments, the composition having the peptide is administered to a site of bone loss. According to some embodiments, the pharmaceutical composition is formed into a dosage form suitable for transmucosal, topical, or subcutaneous administration.
According to additional embodiments, the pharmaceutical composition is administered orally or parentally, by intravenous, intramuscular, topical, local, or subcutaneous routes.
According to certain embodiments the pharmaceutical composition is formulated for an injectable use. According to other embodiments the pharmaceutical composition is formulated for a topical use.
According to some embodiments, the compositions are administered at least one time a day. In other embodiments, the compositions are administered 1-4 times a day.
The compositions of the present invention may be administered in combination with other medications for treatment of bone osteolysis. According to some embodiments, said compositions are administered in combination with minerals. The minerals are selected from Zinc, Copper, Calcium, Phosphorus, and Silicon. The compositions described herein may further be administered in combination with vitamins. The vitamins are selected from, but not limited to, Vitamin C, Vitamin D, Vitamin E or Vitamin K. Vitamin D may comprise Vitamin Di, Vitamin D2, Vitamin D3, Vitamin D4, Vitamin D5 or a combination thereof. Separate dosage forms may be administered simultaneously or sequentially or on entirely independent separate regimens.
According to some embodiments, the composition has a pH in the range of about 5 to about 7, including each value within the specified range.
According to other embodiments, the composition disclosed herein further comprises a thickening agent. In various embodiments, the thickening agent comprises at least one of hydroxypropyl methylcellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxymethyl cellulose, carboxy methyl cellulose, polyvinylpyrrolidone, and polyvinyl alcohol. Each possibility represents a separate embodiment.
According to some embodiments, the composition disclosed herein further comprises an inorganic mineral. In several embodiments, the inorganic mineral comprises at least one of hydroxyapatite, calcium phosphate, calcium carbonate, calcium gluconate, calcium oxalate, calcium sulfate, calcium chloride, magnesium phosphate, magnesium carbonate, magnesium gluconate magnesium oxalate, magnesium sulfate, magnesium chloride, zinc phosphate, zinc
carbonate, zinc gluconate, zinc oxalate, zinc sulfate, zinc chloride, and sodium bicarbonate. Each possibility represents a separate embodiment. In currently preferred embodiments, the inorganic mineral is a calcium phosphate mineral selected from the group consisting of amorphous calcium phosphate, tricalcium phosphate and hydroxyapatite. Each possibility represents a separate embodiment of the invention.
According to some embodiments, the composition disclosed herein further comprises at least one anti-oxidant comprising NAC or a derivative or salt thereof. In particular embodiments, the NAC or a derivative or salt thereof comprises at least one of N-acetylcysteine, S-(2-(l- carboxy-2-methylpropyl)isoindole-l-yl)-N-acetylcysteine, N- acetylcysteine lysinate; S-phenyl-N-acetylcysteine, N-acetyl-S-(N- methylcarbamoyl)cysteine, N-acetyl-S- pentachloro-1,3- butadienylcysteine, adamantyl-N-acety Icy stein, N-acetylcysteinamide, S-(l- (4'-methoxyphenyl)-2- hydroxypropyl)-N-acetylcysteine, S-(N,N-diethyldithiocarbamoyl)-N- acetylcysteine, S-(6-purinyl)-N- acetylcysteine, S-(3-oxopropyl)-N-acetylcysteine, S-(2- carboxyethyl)-N- acetylcysteine, S-(3-hydroxy-3-carboxy-n-propyl)-N-acetylcysteine, N- acetylcysteine-6,7-dihydro-7-hydroxy-l-hydroxymethyl-5H-pyrrolizine, S-(2-(N(7)- guanyl)ethyl)-N-acetylcysteine, S-trichlorovinyl-N-acetylcysteine, S-(2- methylbenzyl)-N- acetylcysteine, S-l,2-dichlorovinyl-N-acetylcysteine, S-(2-((l-methylethyl)phenylamino)-2- oxoethyl)-L-cysteine, and S-nitroso-N-acetylcysteine. Each possibility represents a separate embodiment of the invention.
According to some embodiments, the composition disclosed herein further comprises at least one active pharmaceutical ingredient (API). Suitable active pharmaceutical ingredients within the scope of the present invention include, but are not limited to, an antibacterial drug, an antiresorptive agent, and an anti-inflammatory agent. Each possibility represents a separate embodiment of the invention.
According to some embodiments, the antibacterial drug comprises at least one antibiotic selected from penicillins, cephalosporins, tetracyclines, aminoglycozides, glycopeptides, chloramphenicol, quinolones, sulphonamides, and macrolides. Each possibility represents a separate embodiment. According to some embodiment, the antibacterial drug is a tetracycline antibiotic. In specific embodiments, the tetracycline antibiotic is selected from the group consisting of doxycycline, minocycline, sarecycline, omadecycline or a pharmaceutically acceptable salt thereof. Each possibility represents a separate embodiment.
According to some embodiments, the antiresorptive agent is a bisphosphonate selected from the group consisting of zoledronic acid, pamidronate, alendronate, etidronate, clodronate, risedronate, tiludronate, ibandronate, incadronate, minodronate, olpadronate, neridronate, and EB-1053, or a pharmaceutically acceptable salt thereof. Each possibility represents a separate embodiment.
In additional embodiments, the anti-inflammatory agent is a non-steroidal anti inflammatory drug (NSAID). In one embodiment, the NSAID is selected from the group consisting of ibuprofen, flurbiprofen, diclofenac, and naproxen, or a pharmaceutically acceptable salt thereof.
According to some embodiments, the pharmaceutical composition disclosed herein further comprises a tissue adhesive. According to certain embodiments, the tissue adhesive is selected from the group consisting of fibrin(ogen), gelatin, collagen, chitosan, cyanoacrylate, and combinations thereof. Each possibility represents a separate embodiment of the invention.
According to some embodiments, the composition disclosed herein is in a liquid or semi solid form. Each possibility represents a separate embodiment. In particular embodiments, the composition is in a form of a hydrogel. In other embodiments, the composition disclosed herein is in a form selected from the group consisting of a cream, a paste, a solution, a putty, an emulsion, a suspension, and a powder. Each possibility represents a separate embodiment.
Pharmaceutical compositions for parenteral administration can also be formulated as suspensions of the active compounds. Such suspensions may be prepared as oily injection suspensions or aqueous injection suspensions. For oily suspension injections, suitable lipophilic solvents or vehicles can be used including fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds, to allow for the preparation of highly concentrated solutions.
According to some embodiments, the pharmaceutical composition comprises a phosphate buffer. According to some embodiments, the pharmaceutical composition comprises HEPES.
According to some embodiments, the composition is used as a coating on peri-implants. In other embodiments, the composition is administered in proximity to a peri-implant via injection to the soft tissue surrounding a peri-implant. In yet other embodiments, the composition is topically spread in an open crevice (for example a periodontal pocket) in proximity to a peri-implant.
As used herein the term “about” in reference to a numerical value stated herein is to be understood as the stated value +/- 10%.
EXAMPLES Materials and Methods
All procedures involving animals were carried out in accordance with the guidelines of Tel Aviv University and were approved by the Institutional Animal Care and Use Committee (permit number M-015-047).
Cell culture. Primary bone marrow-derived macrophages (BMDMs) were isolated from the femora and tibiae of adult C57BL/6J mice (Envigo, Israel), as previously described (Hiram- Bab, S. et al. FASEB J 29, 1890-1900). Briefly, cells were cultured overnight at 37°C in a humidified atmosphere with 5% CO2 in our ‘standard medium’ consisting of alpha-modified Eagle’s medium (aMEM, Life Science Technology, NY, USA) and 10% fetal bovine serum (FBS, Rhenium, Ltd, Modi’in, Israel). After 24 hours, the non-adherent fraction was cultured in 10-cm non-culture-treated dishes containing standard medium and 100 ng/ml macrophage colony stimulating factor (M-CSF). The resulting adherent BMDMs were collected after 3 days for the specific assays described below.
Particle generation. To obtain Ti particles (TiP) that correspond to the particles shedding from oral implants during routine scaling, Ti discs that were made from Ti6A14V (AlphaBio Tec., Petah-Tikva, Israel) were subjected to ultrasonic scaling (Newtron Led, Satelec, Acteon, Marignac, France), adjusted to a frequency of 32 kHz. Particles were obtained from discs with a machined (M), sand-blasted and acid-etched (SLA) or sand-blasted (SB) surface topography. When not specified, SLA-derived particles were used. All particles were generated in a sterile environment. Each disc was subjected to US scaling for 60 seconds in distilled water (ddH20), then cleaned twice with ethanol, and finally resuspended in distilled water. It was previously shown that each 6 mm diameter disc generates -2.54 million particles on average. In all the in vitro assays and for the preparation of the fibrinogen-thrombin membranes, a particle density of 1293 particles/mm2 were used.
MTT assay. For proliferation assay macrophages were plated (4000 cell/ well) into 96-well plate with standard medium supplemented with lOOng of MCSF. Cells were treated as
indicated with either TiP/ 106M SNV/ VIP at first day of incubation. Cells viability was determined using dimethylthiazol-diphenyl-tetrazolium-bromide (MTT) after 1, 3 or 5 days. MTT was added to a final concentration of 5 mg/ml and incubated for 4 hours at 37°C. After complete solubilization of the die in DMSO, plates were read at 450 nm in an ELISA reader.
RNA isolation, and RT-qPCR. Following a 24hr incubation with Ti particles (or LPS/ vehicle only/ SNV/VIP in addition to Ti particles), macrophages were washed with sterile PBS, and RNA was extracted using Tri-RNA Reagent (Favorgen Biotech Corp, Kaohsiung, Taiwan). The 260/280 absorbance ratio was measured to verify the RNA purity and concentration. cDNA was produced using a high-capacity cDNA reverse transcription kit (Invitrogen, Grand Island, NY, USA), and real-time PCR was performed using Kapa SYBR Fast qPCR (Kapa Biosystems, Wilmington, MA, USA) on a StepOne real-time PCR machine (Applied Biosystems, Grand Island, NY, USA).
The following primers were used: F-GAAATGCCACCTTTTGACAGTG (SEQ ID NO: 14) and R-TGGATGCTCTCATCAGGACAG (SEQ ID NO: 15) for mouse ILlp; F- TAGTCCTTCCTACCCCAATTTCC (SEQ ID NO: 16) and R-
TTGGTCCTTAGCCACTCCTTC (SEQ ID NO: 17) for mouse IL6; F- TCTTCTCATTCCTGCTTGTGG (SEQ ID NO: 18) and R-GGT CT GGGCC AT AG A ACT G A (SEQ ID NO: 19) for mouse TNFa; F-CCGTAACTGCACTGAAGAAG (SEQ ID NO: 20) and R-CTGTTGCTGCTCATCCATAC (SEQ ID NO: 21) for VPAC1; F- C AGC AG ACC AGG A A AC AT A A (SEQ ID NO: 22) and R-GCCACACGCATCTATGAA (SEQ ID NO: 23) for VPAC2 and F - ACCC AG A AG ACT GT GG AT GG (SEQ ID NO: 24) and R-CACATTGGGGGTAGGAACAC (SEQ ID NO: 25) for Gapdh.
The reaction was subjected to 40 cycles of amplification using the following program: 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 25 s. The relative mRNA expression levels of the selected genes were normalized to the level of Gapdh.
Peptide synthesis. Peptides are typically synthesized using solid phase synthesis or other methods known in the art. The VIP peptide analog Stearyl-Nlel7-VIP (SNV) having the sequence Stearyl -HS D A VFTDN YTRLRKQ-Nle- A VKKYLN S ILN -NH2 (SEQ ID NO: 3), was synthesized as before (Gozes, I. et al. Proc Natl Acad Sci U S A 93, 427-432 (1996); Gozes, I. et al. Endocrinology 134, 2121-2125 (1994).
Osteoclastogenesis assay. Preosteoclasts, prepared like the BMDMs, were plated in 96-well plates (7,000 cells per well, for TRAP staining, see below) or in 6-well plates (200,000 cells per well, for RNA) in standard medium supplemented with 20 ng/ml M-CSF and 50 ng/ml RANKL (R&D Systems, Minneapolis, MN, USA). After 48 hrs, the medium was replaced by the CM of BMDM, supplemented with RANKL and M-CSF. Where indicated, 106M SNV/ VIP were added. After 30 hours, cells were stained using a TRAP kit (Sigma- Aldrich, St. Louis, MO, USA), and multinucleated (>3 nuclei) TRAP-positive cells were defined as osteoclasts. Images were acquired at an original magnification of x4 (Evos FLC, Life Technologies, MS, USA). The number of osteoclasts and the total osteoclast area were measured using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Toxicology. A preliminary toxicology study was performed for SNV that consisted of acute intravenous toxicity in rats, acute oral toxicity in rabbits, skin sensitization using adjuvant and patch test in guinea pigs, and single dose and repeated (for 13 weeks) dose toxicity studies in rats (study number - 004-1). The latter was a 90-day repeated dose toxicity study, consisting of SNV once a day at three different doses to the penis and vagina of male and female rats, respectively. The compound was tested for the treatment of erectile dysfunction. The active dose (7pg SNV) was chosen as the lowest dose for the study. The highest dosage group received 3500 pg.
Rat model of transepithelial penetrability. Because of the high hydrophobicity of SNV, an iodination labeling protocol was used based on the Chloramine T method (Markwell, M. A. Anal Biochem 125, 427-432 (1982)) using 1 mCi Na125I with a few modifications that included (i) the dissolution of SNV in dimethylformamide (DMF), (ii) replacement of the phosphate buffer with 0.2 M HEPES (pH=7.6), a more compatible buffer, and (iii) reaction termination by the addition of sodium metabisulfite and KI. The pharmacokinetic profile of 125I-SNV absorption and distribution was evaluated following vaginal delivery of the compound to rats. Wistar rats at the estrus phase received 50 pi (7.0 mCi/rat, 15 million CPM, 100 Ci/mM specific activity) of 125I-SNV dissolved in 5% Sefsol (1-monocapryloyl-rac-glycerol), applied directly in the vagina, using a P100 micro pipettor. At the indicated time points, the rats were anesthetized with chloral hydrate and collected blood before cervical dislocation. The uterus, liver, lungs, heart, intestine, kidneys and vagina were then harvested (duplicate samples were taken from each organ). Organs were weighed and radioactivity levels were measured using a gamma counter. Each point on the chart represents at least two rats.
Animal model and micro-computed tomography (pCT). A calvarial model, as described previously was used (Eger, M., et al. Sci Rep 7, 39612 (2017)). Briefly, US-released Ti particles (from SLA-treated discs) were incorporated into a fibrinogen-thrombin degradable membrane used as a scaffold to localize the Ti particles. Membranes with no particles were prepared as positive and negative controls. As indicated, 2xl08 mol SNV (or saline as control) were incorporated into the membrane together with the Ti particles. The parietal bones of the 10- week-old C57B1/6J female mice were exposed, and the periosteum was removed before inserting the fibrinogen-thrombin membranes to cover both parietal bones. In the control group an empty fibrinogen-thrombin membrane was inserted (with no Ti particles).
All groups comprised 6 animals. Animals were euthanized 5 weeks post insertion, and the skull of each mouse was removed, fixed for 24hr in 4% phosphate-buffered formalin, followed by 70% ethanol. All specimens were scanned and analyzed using a pCT system (pCT 50, Scanco Medical AG, Switzerland). Scans were performed at a 10-pm resolution in all three spatial dimensions, with 90 kV energy, 88 mA intensity, and 1000 projections at a 1000 mSec integration time. The region of interest (ROI) was defined as two 3.7-mm circles in the center of the parietal bones. A custom-made algorithm, based on Image-Processing Language (IPL, Scanco Medical), was developed to isolate the resorption pits, defined as unmineralized pits that were 10 to 40-pm deep on the bone surface. Morphometric parameters were determined at the 3D level inside a fixed ROI total volume (TV) and included the total volume of the bone resorption pits (Pit Resorption Volume, PRV, mm3), and the calculated PRV/TV ratio. To differentiate between resorption pits and irregular bone thickening, we also measured the mean calvarial plate thickness.
EXAMPLE 1. SNV presents anti-inflammatory effects in cell cultures
ILip, IL6 and TNFa are the main mediators of Ti particle-mediated inflammation and osteolysis and the immuno-modulating role of VIP is well established. The effect of both VIP and its analog SNV, on the expression of these pro-inflammatory cytokines in macrophages was first examined. Bone marrow-derived macrophages were treated with 106M VIP or SNV (or saline control) 1 hour before adding LPS (lpg/ml). Control cultures were left untreated (M- CSF only). After 24hrs, RNA was extracted and as shown in Fig. 1, a significant increase in the expression levels of the three cytokines in the LPS -treated versus control macrophage cultures was observed. VIP demonstrated a mixed immunomodulation, decreasing the levels of IL1 b
but increasing the levels of IL6 expression (by 40% and 90%, respectively, p<0.05). VIP did not affect TNFa expression. SNV had no effect on IL6 and TNFa expression levels but it significantly reduced the expression levels of IL1 b (by 35%, p<0.05), showing a net anti inflammatory effect.
EXAMPLE 2. SNV suppresses osteoclastogenesis
To examine the direct effect of VIP and SNV on osteoclastogenesis, it was first asked whether VCAP1 and VCAP2, the classical receptors for VIP and its analog SNV, are expressed in preosteoclasts during the differentiation process. Bone marrow-derived macrophages (BMDM), which are osteoclasts precursors in vitro, were cultured in the presence of M-CSF and RANKL to induce osteoclast differentiation. VCAP1 and VCAP2 were both expressed in BMDM before the addition of RANKL (Day 0) and these levels declined by 58% and 92%, respectively, during osteoclastogenesis (Fig. 2). These results suggested that VPAC-1 is more likely than VCAP-2 to mediate the effects of VIP and SNV on preosteoclasts.
The osteoclastogenesis assay attributed a significant anti-osteoclastogenic effect to VIP and mainly to SNV (Fig. 3A-C). VIP treatment resulted in a reduced osteoclast area and SNV attenuated both osteoclast area and number, displaying a stronger inhibitory effect on osteoclasts than VIP. This inhibitory effect was not attributable to cytotoxicity as neither VIP nor SNV affected the viability of the cells in the culture over 5 days of treatment (MTT assay, Fig. 3D).
EXAMPLE 3. SNV is skin bioavailable
The therapeutic applications of VIP have been hampered by its very short half-life and low penetration through lipidic barriers (skin and epithelium). The potent VIP analog SNV was elected as a potential therapeutic agent in the treatment of inflammation-induced osteolysis. A prerequisite for such a treatment modality is high penetrability through tissues and epithelium. Therefore, a transepithelial penetrability assay was conducted in a rat model. In this assay, a bolus of radiolabeled SNV was delivered to the vagina and the local levels of SNV showed a decline over time (Fig. 4A). In parallel, the levels of SNV in the blood, heart, lungs, liver, gut, uterus and kidneys steadily increased (Fig. 4B), indicating the high penetrability of SNV through the vaginal epithelium, and further tissue stability. The integrity of the radioactive SNV was previously shown.
EXAMPLE 4. SNV is nontoxic in-vivo
Several toxicology studies were also conducted in rabbits, guinea pigs and rats as detailed in the method section, and all showed a clean toxicology profile, as detailed below. The study named 004-1, was the most protracted and detailed toxicology study. It was carried out in rats as a repeated dose toxicity study on target external organs, the penis and the vagina. The structure of the study included a detailed pathological study of all body organs.
No drug-related macroscopic or microscopic changes were detected in any of the dosages used. All changes reported by the pathologist were regarded as spontaneous incidental pathological findings similar to those not infrequently found in rats of the same strain and age used as controls.
Further Toxicology studies:
001-1 Acute subcutaneous toxicity in rats:
Model - Rats (Sprague Dawley, S.D., Levinstein, Yokneam, Israel). N=6 males (225- 275g), N=6 females (150-210g) in each group. Injection close to penile of vaginal tissue. Study duration: 7 acclimation days, 14 observation days.
Treatment groups - 1. Saline; 2. Vehicle*; 3. SNV - active dose- IX 7pg/rat* ; 4. SNV (1000X) 7mg/rat*, *Preparation + vehicle: 0.5 mg SNV + 3.55 ml 10% Sefsol (glycerin monocaprylate) + 3.55 ml isopropanol - IOOmI/animal (rat 200-300 g = IX dose). 91 mg SNV + 0.65 ml 10% Sefsol + 0.65 ml isopropanol - IOOmI/animal = 1000X dose.
Reactions: Necrosis of abdominal (male only) or penile skin on day 13-14 after injection. Diarrhea in 2 males of group 4 (1000X) 5-24 after injection, lasting for 2 days. The same group showed significant weight loss until 8th day, returning to original weight on day 12-14.
Mortality - None.
Conclusion: Under the conditions of this study, the acute median lethal subcutaneous dose of SNV was found to be greater the 7mg/rat, which is the maximal practical dose.
001-2 - Acute intravenous toxicity in rats:
Model - As in study 001-1, but injection was intravenous (tail vein); N=6 males (160- 350g); N=6 females (155-285g), for each of the experimental groups.
Treatment groups - As in study 001-1, but injection was intravenous.
Reactions - Necrotic reaction was observed at the site of injection in 55% group 2, 58% in group 3 and 100% in group 4. Most of surviving rats displayed normal body weight, and some weight loss observed initially was recovered during the study.
Mortality - 7 rats (3 males and 4 females) out of 12 died within 3 hrs after administration in group 4 (SNV -1000X). One rat died in group 2 within 5-24 hrs after administration. No mortality occurred in groups 1 and 3.
Conclusions: Under the conditions of this study, the acute intravenous median lethal dose of SNV was estimated to be 7mg/male rat, and due to the higher mortality in females, it was estimated to be less than 7mg for males and females combined. In view of necrotic reactions in group 2 - vehicle, isopropanol was reduced from 50% to 20% in the other studies (002-004). -3 Acute oral toxicity in rats:
Model - As in study 001-1, N=6 males (195-275g), N=6 females (155-290g), per each of the experimental groups.
Treatment groups - As in study 001-1, only test substances were administered orally using a metal catheter.
Reactions - None.
Mortality - None.
Conclusions: Under the conditions of this study, the acute median oral lethal dose of SNV was found to be greater the 7mg/rat, which is the maximal practical dose. Acute dermal toxicity in rabbits:
Model - N=8 Albino female rabbits, 2.38-2.75 Kg, (Weizmann Institute of Science). Hair was removed from the back, sterile gauze was applied and test material injected into the gauze.
Treatment groups - 1. Saline (0.5 ml/site) (N=2); 2. Vehicle** (N=2); 3. SNV (1000X) (N=4) 7mg/site**, ** Test material + vehicle was prepared as follows (studies 002- 004, 0.25ml 10% Sefsol + 0.25ml 40% isopropanol).
Reactions - The 1000X dose of SNV caused slight barely perceptible erythema in 50% of the rabbits, which disappeared within 72 hours following application.
Mortality - None.
Conclusions: Under the conditions of this study, single dermal application of the vehicle did not cause irritation. The 1000X dose transient effect was barely perceptible. Skin sensitization: adjuvant and patch test
Model - Guinea pigs (Hartley, Levinstein, Yokneam, Israel), Time of dosing: N=3 males (325-352g); N=3 females (250-310g)/ per each of the 3 test groups.
Treatment groups - 1. Vehicle**; 2. SNV - (1000X) 7mg/animal**; 3. Positive control - l%-chloro-2, 4-dinitrobenzene in dibutyl-phthalate Daily applications for 3 days.
Reactions - The positive control group developed severe erythema, edema and necrosis, which covered most of the shaved area and beyond it. In contrast, the vehicle and test substance groups showed only slight erythema and edema within the application site.
Mortality - None.
Conclusions: The study was designed to assess the degree of skin sensitization resulting from intradermal Freund’s complete adjuvant and patch application of SNV. The study showed that both SNV and vehicle alone have no skin sensitization properties -1 Repeated dose toxicity in rats: a 13-week study:
Model - The repeated daily dose toxicity of SNV administered topically on the sex organs was investigated in 80 specific pathogen free (SPF) S.D. rats divided in 4 groups of 10 males and 10 females (Harlan, Olac, England, UK).
Treatment group - 1. SNV - active dose- IX 7pg/rat**; 2. SNV - 0.7mg/rat**; 3. SNV - 3.5mg/rat** ; 4. Vehicle only**
Reactions: No related adverse effects were detected throughout the study. Clinical signed seen were: penile edema and erythema, yellow staining of the penis, bleeding from the preputium or vagina, abscessation in the abdominal area close to the sex organ. Most of these signs were transient/ One male developed transient diarrhea, which disappeared after a week. Penile edema, erythema and staining were seen only in the treatment groups, without any dose relationship. The incidence and severity of the clinical signs were not dose related and may relate to the repeated handling of the rats.
Mortality - None. Only one death took place in a male from the low dose group due to massive abdominal hemorrhage caused by a nephroblastoma.
Conclusions: No dose related or sex related biologically meaningful treatment effects were detected for any of the hematology or clinical chemistry parameters tested. Under the conditions of this study, daily topical application of SNV for 13 weeks did not cause any serious adverse effects at any of the doses tested.
005 Assessment of mutagenic potential in histidine auxotrophs of salmonella typhimurium (the Ames test):
Study location Life Science Research Israel Ltd. Ness Ziona.
Treatment group - Solution tested was 0.3-312.5pg/standard bacterial plate.
Reactions - No significant increases in revertant colony numbers over control count were obtained with any of the test material at levels from 0.3-312.5 pg/plate. Conclusions: Under the conditions of this study, the test material, SNV was devoid of mutagenic activity.
EXAMPLE 5. SNV protects again TiP-induced osteolysis
Next, Ti particles (TiP)-induced osteolysis assay was conducted using a mouse calvarial model (Eger, M., ibid). The topical effect of SNV was tested by incorporating SNV into membranes that were also loaded with Ti particles. SNV was assumed to penetrate the tissues and suppress the inflammation and osteoclastogenesis on the calvarial surface. In this experiment, a severe osteolysis on the calvarial surface, beneath the TiP-loaded membrane was observed (Fig. 5). Topically-administered SNV significantly suppressed the TiP-induced osteolysis leading to a 60% significantly lower pit resorption volume and pit resorption volume as percentage of the total tissue volume (Fig. 5A-5B). There were no significant differences in the calvaria thickness (Fig. 5C), supporting the idea that SNV suppressed pit resorption rather than stimulated irregular bone apposition.
Overall, the results indicate that the peptide analog SNV has a stronger anti inflammatory and anti-osteoclastogenic effect than VIP; loading a single dose of SNV into a degradable membrane significantly inhibited inflammation-induced osteolysis in a mouse calvarial model. It is shown that VIP increases IL6 expression in LPS-activated macrophages, whereas SNV is not (Fig.l), supporting the notion of a distinct mechanism between VIP and
SNV. The superior anti-osteoclastogenic effect of SNV over VIP may therefore result from either its inhibitory effect on IL1 b with no stimulation of IL6, a distinct internal signaling pathway or its longer half-life. Another advantage of SNV is that its chemical properties allowed its incorporation in the thrombin-fibrinogen membrane whereas VIP and its solvent perturbed the formation of the membrane (data not shown).
Previous studies showed controversial data regarding the effect of VIP on osteoclastogenesis. VIP was shown to stimulate bone resorption in an ex vivo organ culture (Hohmann, E. L. et al., Endocrinology 112, 1233-1239, (1983)), but had no effect on basal osteoclastogenesis and even inhibited osteoclast formation in mouse bone marrow cultures (Mukohyama, H., et al. Biochem Biophys Res Commun 271, 158-163, (2000)). These opposing findings may be rooted in the fact that VIP has a pro-osteoclastogenic effect mediated by its actions on osteoblasts but also an anti-osteoclastogenic effect via its direct action on osteoclasts. In the inflammatory models described herein, the observed impact of VIP on osteoclast differentiation is likely a direct anti-osteoclastogenic effect, that slightly supersedes the pro- osteoclastogenic increase in IL6. The therapeutic potential of VIP has been tested in a rat model of periodontitis and displayed a partial effect on the inflammatory status and osteoclastogenic signals but no significant positive outcome on bone loss (Gozes, I. et al. Proc Natl Acad Sci U S A 96, 4143-4148, (1999)). However, the strong suppression of osteoclast differentiation by the peptide analog SNV might result from the combined effect on the inflammation (decrease in ILip, Fig. 1) as well as a direct effect on osteoclasts (Fig. 3). Notably, the osteoclastogenic assay was performed in the presence of conditioned medium from TiP-exposed macrophages, containing a host of pro-inflammatory and pro-osteoclastogenic signals, and SNV blocked or supplanted these signals, supporting the notion of a strong inhibitory effect on osteoclast differentiation. As discussed above, inflammation-induced osteolysis is the common pathological outcome of various conditions including periodontitis, oral peri-implantitis and orthopedic implant loosening. Here it is shown that the peptide analog SNV blocked the two common denominators leading to osteolysis, i.e., inflammation and osteoclastogenesis, notwithstanding the cause of the inflammation, i.e., bacterial (LPS) or aseptic (TiP).
The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and
without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.
Claims
1. A pharmaceutical composition comprising a peptide analog of VIP (SEQ ID NO: 2) for use in treating or preventing osteolysis, wherein the peptide analog consists of 25 to 50 amino acids comprising the sequence: ZHS DX 1 X2FTDX3 YX4RX5RKQX6 A VKKYLX7L (SEQ ID NO: 1), wherein
Xi is selected from A and G;
X2 is a hydrophobic amino acid;
X3 is selected from N and S;
X4 is selected from T and S;
X5 is selected from L and Y ;
Xe is a hydrophobic amino acid;
X7 is a stretch of 3 amino acid residues selected from NSI and AAV; and
Z is a permeability enhancing moiety, any amino acid, or absent.
2. The pharmaceutical composition for use of claim 1, for use in treating inflammation- induced osteolysis in a periodontal-related disease or condition.
3. The pharmaceutical composition for use of claim 1, for use in treating aseptic osteolysis.
4. The pharmaceutical composition for use of any one of claims 1 to 4, wherein X2 and Xe are hydrophobic amino acids selected from the group consisting of leucine, isoleucinc, norleucine, valine, tryptophan, phenylalanine, methionine, octahydroindole-2-carboxylic acid (oic), cyclohexylglycine (chg) and cyclopentylglycine (cpg).
5. The pharmaceutical composition for use of any one of claims 1 to 4, wherein X2 is selected from V and I.
6. The pharmaceutical composition for use of any one of claims 1 to 5, wherein Xe is selected from Norleucine (Nle) or M.
7. The pharmaceutical composition for use of any one of claims 1 to 6, wherein Xe is Norleucine (Nle).
8. The pharmaceutical composition for use of any one of claims 1 to 7, wherein the peptide is conjugated with a permeability enhancing moiety.
9. The pharmaceutical composition for use of any one of claims 1 to 8, wherein the peptide is conjugated with a lipophilic moiety.
10. The pharmaceutical composition for use of any one of claims 1 to 9, wherein the N- terminus or C-terminus of the peptide is conjugated to a lipophilic moiety selected from the group consisting of stearoyl, lauroyl, and caproyl.
11. The pharmaceutical composition for use of any one of claims 1 to 10, wherein the N- terminus of the peptide is conjugated with a stearyl moiety.
12. The pharmaceutical composition for use of any one of claims 1 to 11, wherein the N- terminus or C-terminus of the peptide is modified.
13. The pharmaceutical composition for use of any one of claims 1 to 12, wherein the C- terminus of the peptide is amidated.
14. The pharmaceutical composition for use of any one of claims 1 to 13, wherein the peptide comprises sequence GKRYKQRVKNK (SEQ ID NO: 13) connected to C-terminus of the Leucine residue (L) of SEQ ID NO: 1.
15. The pharmaceutical composition for use of claim 1, wherein the peptide comprises a sequence selected from the group consisting of: HSDAVFTDNYTRLRKQ-Nle- AVKKYLNSILN (SEQ ID NO: 26); HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVL (SEQ ID NO: 4); HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRVKNK (SEQ ID NO: 5); Acetyl-HSDGIFTDSYSRYRKQ-Nle-
AVKKYLAAVLGKRYKQRVKNK-NH2 (SEQ ID NO: 6); and
HS DGIFTDS Y S RYRAQM A V AKYL A A VLGKR YKQRVKNK (SEQ ID NO: 9).
16. The pharmaceutical composition for use of claim 1, wherein the peptide consists of a sequence selected from the group consisting of: Stearyl -HSDAVFTDNYTRLRKQ-Nle- A VKKYLN S ILN -NH2 (SEQ ID NO: 3); HSDGIFTDSYSRYRKQ-Nle-
AVKKYLAAVL (SEQ ID NO: 4); HSDGIFTDSYSRYRKQ-Nle-
AVKKYLAAVLGKRYKQRVKNK (SEQ ID NO: 5); Acetyl -
HSDGIFTDSYSRYRKQ-Nle-AVKKYLAAVLGKRYKQRV KNK-NH2 (SEQ ID NO: 6); Acetyl-HS DGIFTDS Y S RYRAQM A V AKYLA A VLGKR YKQRVKNK-
Propylamide (SEQ ID NO: 7); and Acetyl-
HS DGIFTDS Y S RYRAQM A V AKYL A A VLGKR YKQRVKNK (SEQ ID NO: 8).
17. The pharmaceutical composition for use of claim 16, wherein the peptide is Stearyl- HS D A VFTDN YTRLRKQ-Nle- A VKKYLN S ILN-NH2 (SEQ ID NO: 3).
18. The pharmaceutical composition for use of any one of claims 1 to 17, wherein the peptide analog has one addition, deletion, or substitution compared to the peptide.
19. The pharmaceutical composition for use of any one of claims 1 to 18, wherein the peptide comprises at least one non-natural amino acid residue.
20. The pharmaceutical composition for use of claim 2, wherein the periodontal-related disease is periodontitis or peri-implantitis.
21. The pharmaceutical composition for use of any one of claims 1 to 20, wherein the composition is for use in treating or preventing periodontal bone loss.
22. The pharmaceutical composition for use of any one of claims 1 to 21, wherein the pharmaceutical composition further comprises an acceptable carrier, excipients or diluent.
23. The pharmaceutical composition for use of any one of claims 1 to 22, wherein the pharmaceutical composition is formulated for topical administration.
24. The pharmaceutical composition for use of any one of claims 1 to 23, wherein the pharmaceutical composition is formulated in a dosage form selected from the group consisting of gels, suspensions, emulsions, powders, granules, elixirs, and tinctures.
25. A method of treating osteolysis in a subject, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition according to any one of claims 1 to 24.
26. The method of claim 25, wherein the osteolysis is aseptic osteolysis.
27. The method of claim 25, wherein the osteolysis is inflammation-related osteolysis.
28. The method of claim 27, wherein the osteolysis is inflammation-related osteolysis in a periodontal-related disease or disorder.
29. The method of claim 28, wherein the periodontal-related disease is periodontitis or peri- implantitis.
30. The method of claim 25, wherein the amount is effective to enhance osseointegration of an implant.
31. The method of claim 30, wherein the amount is effective to enhance osseointegration of a dental implant.
32. The method of claim 31, wherein the amount is effective to enhance alveolar bone regeneration.
33. The method of claim 25, wherein the method comprises integrating an implant.
34. The method of claim 33, wherein the method comprises integrating a titanium implant.
35. The method of claim 33, wherein the method comprises integrating a dental implant.
36. The method of claim 25, wherein the method further comprising administering antibiotics.
37. The method of claim 36, wherein the antibiotic is selected from the group consisting of arestin, doxycycline, tetracycline and hydrochloride.
38. The method of claim 25, wherein the subject is human.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202062986702P | 2020-03-08 | 2020-03-08 | |
| US62/986,702 | 2020-03-08 | ||
| US202063105370P | 2020-10-26 | 2020-10-26 | |
| US63/105,370 | 2020-10-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021181379A1 true WO2021181379A1 (en) | 2021-09-16 |
Family
ID=77670467
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2021/050250 Ceased WO2021181379A1 (en) | 2020-03-08 | 2021-03-08 | Compositions and methods for treating osteolysis |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2021181379A1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140142039A1 (en) * | 2009-07-10 | 2014-05-22 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Vasoactive lntestinal Peptide Release From Microparticles |
-
2021
- 2021-03-08 WO PCT/IL2021/050250 patent/WO2021181379A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140142039A1 (en) * | 2009-07-10 | 2014-05-22 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Vasoactive lntestinal Peptide Release From Microparticles |
Non-Patent Citations (1)
| Title |
|---|
| LUNDBERG, P, LIE A, BJURHOLM A, LEHENKARI P.P, HORTON M.A, LERNER U.H, RANSJÖ M: "Vasoactive intestinal peptide regulates osteoclast activity via specific binding sites on both osteoclasts and osteoblasts.", BONE, vol. 27, no. 6, 31 December 2000 (2000-12-31), pages 803 - 810, XP055854555, Retrieved from the Internet <URL:https://www.sciencedirect.com/science/article/pii/S875632820000394X> DOI: 10.1016/S8756-3282(00)00394-X * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2003287423B2 (en) | Methods and systems for enabling and stabilizing tooth movement | |
| US7875590B2 (en) | Injectable solid hyaluronic acid carriers for delivery of osteogenic proteins | |
| RU2493868C2 (en) | Pharmaceutical compositions containing hgh for oral administration | |
| EP2446878B1 (en) | Ketorolac tromethamine compositions for treating or preventing ocular pain | |
| Norowski Jr et al. | Biomaterial and antibiotic strategies for peri‐implantitis: A review | |
| US20050186526A1 (en) | Methods and systems for enabling and stabilizing tooth movement | |
| AU2016298951B2 (en) | Compositions for the treatment of cataracts | |
| WO2011094531A1 (en) | Solid pharmaceutical composition with enhancers and methods of preparing thereof | |
| JPWO2013133413A1 (en) | Mucosal protuberance | |
| KR20120014251A (en) | Bioactive Coating Compositions and Methods for Improving Bonding of Allografts | |
| WO1999004808A1 (en) | Dental remedies containing pth | |
| US20160243078A1 (en) | Ketorolac tromethamine compositions for treating or preventing ocular pain | |
| JP6595717B2 (en) | Composition comprising hydrophilized sulfasalazine and hyaluronic acid for the treatment of osteoarthritis and method for producing the same | |
| JPWO2003082321A1 (en) | Dental fission preparation containing basic fibroblast growth factor | |
| WO2021156857A1 (en) | Compositions comprising amelogenin and uses thereof | |
| JP2003095974A (en) | Pharmaceutical complex that promotes bone formation safely | |
| US20230130132A1 (en) | Pharmaceutical compositions comprising amphiphilic peptides and methods of use thereof | |
| US20240218017A1 (en) | Peptide amphiphiles with modified degrading sequences and methods of use thereof | |
| Madarina et al. | Chlorhexidine chip for periodontitis therapy: A short review on materials | |
| JPWO2006006674A1 (en) | Transmucosal administration agent containing PTH | |
| JP2006096751A (en) | Interleukin-11 sustained release pharmaceutical composition | |
| JPH08283177A (en) | Prophylactic / therapeutic agent for periodontal tissue destruction due to periodontal disease | |
| KR20050019075A (en) | Injectable solid hyaluronic acid carriers for delivery of osteogenic proteins | |
| JP2006225398A (en) | Dental viscous preparation containing basic fibroblast growth factor | |
| JPH0959177A (en) | Anti-inflammatory and / or painkillers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21767404 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 21767404 Country of ref document: EP Kind code of ref document: A1 |