WO2020227682A1 - Treating cancer - Google Patents
Treating cancer Download PDFInfo
- Publication number
- WO2020227682A1 WO2020227682A1 PCT/US2020/032222 US2020032222W WO2020227682A1 WO 2020227682 A1 WO2020227682 A1 WO 2020227682A1 US 2020032222 W US2020032222 W US 2020032222W WO 2020227682 A1 WO2020227682 A1 WO 2020227682A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mitochondria
- subject
- composition
- chemotherapeutic agent
- administered
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/243—Platinum; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/33—Fibroblasts
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- the disclosure relates to therapeutic use of mitochondria to increase efficacy of chemotherapeutic agents.
- Mitochondria are double membrane-bound organelles found in the cytoplasm of nucleated eukaryotic cells. They are found in almost every cell of the human body except red blood cells. They are the cell's primary site of energy metabolism and generate adenosine triphosphate (ATP) for different cell functions. Typically, more than 90% of a cell's requirement for ATP is supplied by the cell’s own mitochondria.
- ATP adenosine triphosphate
- Mitochondria are composed of two concentric membranes, which have specialized functions.
- the inner mitochondrial membrane contains proteins for ATP synthase.
- the outer mitochondrial membrane which contains large numbers of integral membrane proteins, encloses the entire organelle.
- mitochondria The structure of mitochondria has striking similarities to some modem prokaryotes. In fact, mitochondria are thought to have originated from an ancient symbiosis when a nucleated cell engulfed an aerobic prokaryote. In the symbiosis relationship, the host cell came to rely on the engulfed prokaryote for energy production, and the prokaryote cell began to rely on the protective environment provided by the host cell.
- the disclosure relates to therapeutic use of mitochondria to increase efficacy of chemotherapeutic agents.
- the disclosure provides methods for increasing efficacy of a
- the methods involve administering to a subject who is or will be undergoing treatment with a chemotherapeutic agent and a therapeutically effective amount of a composition comprising mitochondria, to thereby increase the efficacy of the chemotherapeutic agent in the subject.
- the mitochondria are respiration-competent mitochondria.
- the chemotherapeutic agent is administered to the subject before the composition comprising mitochondria is administered to the subject. In some embodiments, the
- chemotherapeutic agent is administered to the subject after the composition comprising mitochondria is administered to the subject.
- the chemotherapeutic agent and the composition comprising mitochondria are administered to the subject at about the same time.
- the mitochondria are delivered via the organ-specific vasculature.
- the organ to which the mitochondria are delivered is the lung, liver, kidney, prostate, heart, breast, ovary or pancreas. In some embodiments, the mitochondria are delivered via nebulization
- the method increases the efficacy of the chemotherapeutic agent by at least 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
- the therapeutically effective dose of the chemotherapeutic agent is at least 10% lower than an FDA-approved dose for the chemotherapeutic agent.
- the subject has cancer.
- the cancer is a solid tumor.
- the cancer is prostate cancer.
- the chemotherapeutic agent is cisplatin or docetaxel.
- lxlO 5 to lxlO 9 of mitochondria is administered to the subject.
- lxlO 3 , lxl04 3 , lxlO 5 , lxlO 6 , lxlO 7 , lxlO 8 , lxlO 9 , lxlO 10 , lxlO 11 , lxlO 12 , or lxlO 13 of mitochondria is administered to the subject
- the composition comprising mitochondria is administered to the subject by injection, through the subject’s respiratory tract, or through a blood vessel of the subject.
- the mitochondria are autogenic, allogeneic, or xenogeneic.
- the composition further comprises a pharmaceutically acceptable diluent, excipient, or carrier.
- the mitochondria are genetically modified. In some embodiments, the mitochondria comprise exogenous polypeptide. In some embodiments, the mitochondria comprise exogenous polynucleotide. In some embodiments, the mitochondria prior to administration to the subject are incubated with a composition comprising an enzyme.
- the disclosure provides methods for administering a chemotherapeutic agent to a subject.
- the methods involve:
- the chemotherapeutic agent is administered to the subject before the composition comprising mitochondria is administered to the subject. In some embodiments, the chemotherapeutic agent is administered to the subject after the composition comprising mitochondria is administered to the subject. In some embodiments, the chemotherapeutic agent is administered to the subject during administration of the composition comprising mitochondria.
- the dose is at least 10% lower than an FDA-approved dose for the chemotherapeutic agent. In some embodiments, the dose is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% lower than the FDA-approved dose for the chemotherapeutic agent .
- the subject has cancer.
- the cancer is prostate cancer.
- the chemotherapeutic agent is cisplatin, or docetaxel.
- lxlO 5 to lxlO 9 of mitochondria is administered to the subject.
- the composition comprising mitochondria is administered to the subject by injection, through the subject’s respiratory tract, or through a blood vessel in the subject.
- the mitochondria are autogenic, allogeneic, or xenogeneic. In some embodiments, the mitochondria are genetically modified. In some embodiments, the mitochondria comprise exogenous polypeptide. In some embodiments, the mitochondria comprise exogenous polynucleotide.
- the disclosure provides a composition comprising a therapeutically effective amount of mitochondria, and a therapeutically effective amount of a chemotherapeutic agent.
- the chemotherapeutic agent is not linked to the mitochondria.
- the chemotherapeutic agent is cisplatin, or docetaxel.
- the composition comprises lxlO 5 to lxlO 9 or about lxlO 3 , lxl04 3 , lxlO 5 , lxlO 6 , lxlO 7 , lxlO 8 , lxlO 9 , lxlO 10 , lxlO 11 , lxlO 12 , or lxlO 13 of mitochondria.
- the mitochondria are autogenic, allogeneic, or xenogeneic. In some embodiments, the mitochondria are genetically modified. In some embodiments, the mitochondria comprise exogenous polypeptide. In some embodiments, the mitochondria comprise exogenous polynucleotide.
- FIG. 1A is a 3D SR-SIM microscopy image of a DU145 cell showing DU145 mitochondria following incubation with red fluorescent protein (RFP) labelled HCF
- RFP red fluorescent protein
- FIG. IB is a 3D SR-SIM microscopy image of a DU145 cell showing HCF
- FIG. 1C is a 3D SR-SIM microscopy images of a DU145 cell showing DAPI-stained nucleus following incubation with red fluorescent protein (RFP) labelled HCF mitochondria.
- RFP red fluorescent protein
- FIG. ID is a 3D SR-SIM microscopy images of a DU145 cell showing overlay of DU145 mitochondria, HCF mitochondria, and DAPI-stained nucleus following incubation with red fluorescent protein (RFP) labelled HCF mitochondria.
- RFP red fluorescent protein
- FIG. 2A is a line graph showing cell growth results measured by MTT-assay for DU145 cells incubated with lxlO 7 exogenous mitochondria.
- FIG. 2B is a line graph showing cell growth results measured by MTT-assay for PC3 cells incubated with lxlO 7 exogenous mitochondria.
- FIG. 3A is a bar graph showing total ATP content measured by ATPlite luminescence ATP Detection Assay for DU145 cells incubated with various amounts of exogenous
- FIG. 3B is a bar graph showing total ATP content measured by ATPlite luminescence ATP Detection Assay for PC3 cells incubated with various amounts of exogenous mitochondria.
- FIG. 4A are bar graphs depicting the ratio of dead to live cells measured by LIVE/DEAD Viability/Cytotoxicity Kit for DU 145 cells incubated with either exogenous mitochondria, cisplatin, or the combination of exogenous mitochondria and cisplatin.
- FIG. 4B are bar graphs depicting the ratio of dead to live cells measured by LIVE/DEAD Viability/Cytotoxicity Kit for PC3 cells incubated with either exogenous mitochondria, cisplatin, or the combination of exogenous mitochondria and cisplatin.
- FIG. 5 is a representative graph depicting fluorescence-activated cell sorting (FACs) analysis of PC3 cells transfected with lentivirus CMV-GFP-Luc; 69.9% (denoted by black outlined region) of PC3 cells were GFP positive.
- FACs fluorescence-activated cell sorting
- FIG. 6A shows mitochondrial biodistribution and tissue uptake after vascular delivery into the lungs.
- 18 F-labeled rhodamine 6G mitochondria were injected to the lungs as a bolus antegrade via the pulmonary trunk using a tuberculin syringe with a 30-gauge needle.
- Labeled mitochondria red signal on the imaging
- radiolabeled mitochondria were not detectable in any other organ or region of the body
- FIG. 6B is an immunohistochemical image (xlOO) of human mitochondria delivered to the lungs of C57BL/6J male mice at the beginning of reperfusion following 2 h of ischemia that shows mitochondrial biodistribution and tissue uptake after vascular delivery into the lungs in mice receiving human mitochondria via the pulmonary artery; human mitochondria were injected to the lung as a bolus antegrade via the left pulmonary artery using a tuberculin syringe with a 40-gauge needle. Human mitochondria were detected using monoclonal anti-human mitochondrial antibody and visualized using Vectastain and AEC+ substrate chromogen. Human mitochondria indicated by black arrows were globally distributed throughout the lung and detected within and around lung alveoli (a) and connective tissue. pCT, microcomputed tomography.
- FIG. 6C shows mitochondrial biodistribution and tissue uptake via nebulization.
- 18 F- labeled rhodamine 6G labeled mitochondria were delivered as an aerosol to the lungs via the trachea via nebulization using the Aeroneb ultrasonic nebulizer connected to the FlexVent system.
- Wistar rats were allowed to recover for 10 min after mitochondrial delivery and were then euthanized in a CO2 chamber before imaging. Labeled mitochondria (red signal on the imaging) were detected only in the lungs; radiolabeled mitochondria were not detectable in any other organ or region of the body.
- FIG. 6D is an immunohistochemical image (xlOO) of human mitochondria delivered to the lungs of C57BL/6J male mice at the beginning of reperfusion following 2 h of ischemia that shows mitochondrial biodistribution and tissue uptake in mice receiving human mitochondria via nebulization; human mitochondria were delivered as an aerosol to the lungs via the trachea via nebulization using the Aeroneb ultrasonic nebulizer connected to the FlexVent system.
- C57BL/6J mice were allowed to recover for 30 min after mitochondrial delivery. Left lung tissue was then harvested for further immnohistological staining. Human mitochondria were detected using monoclonal anti-human mitochondrial antibody and visualized using Vectastain and AEC+ substrate chromogen. Human mitochondria indicated by black arrows were globally distributed throughout the lung and detected within and around lung alveoli (a) and connective tissue. pCT, microcomputed tomography.
- Cancer is a group of diseases involving abnormal cell growth with the potential to invade or spread to other parts of the body. It is the second leading cause of death globally, and is responsible for an estimated 9.6 million deaths in 2018. Globally, about 1 in 6 deaths is due to cancer.
- cancer cells often develop the ability to become resistant to chemotherapy, there is still no efficient cure for this type of disease especially in the later metastatic stages.
- Previous studies have demonstrated that cancer cells have a high rate of aerobic glycolysis. This phenomenon is unique to cancer cells and is termed the“Warburg effect”.
- glucose is converted to high energy phosphate (ATP) with most of the energy requirements of the cell being derived through the electron transport chain and oxidative phosphorylation a process requiring oxygen.
- ATP high energy phosphate
- the cancer cell converts glucose to lactic acid and downregulates mitochondrial oxidative phosphorylation despite the presence of oxygen.
- Aerobic glycolysis is a hallmark of cancer and is present in nearly all invasive human cancers and persists even under normoxic conditions and is correlated with tumor
- mitochondrial dysfunction may confer a significant proliferative advantage during somatic evolution of cancer and that this glycolytic phenotype can be a crucial component of the malignant phenotype.
- mitochondrial dysregulation is present in human tumors and that mitochondrial oxidative stress actively promotes tumor progression and increases the metastatic potential of cancer cells and significantly decreases sensitivity to chemotherapy. This suggests that targeting the mitochondria can provide a promising strategy for the development of anticancer therapy and that restoration of mitochondrial function to optimal levels can enhance sensitivity to anticancer agents for the treatment of aggressive tumors.
- the present disclosure provides a therapy based on mitochondrial transplantation.
- this approach uses replacement of native mitochondria with viable, respiration-competent mitochondria isolated from non-ischemic tissue (e.g., autologous tissue) to overcome the many deleterious effects of various disorders on native mitochondria.
- Mitochondrial transplantation is a revolutionary strategy that has been clinically demonstrated to enhance tissue ATP content and mitochondrial oxidative phosphorylation.
- healthy mitochondria can be harvested from non-ischemic skeletal muscle in the patient’s own body and are then transplanted into the tissue, where they restore normal cellular energetics.
- Autologous mitochondria are harvested with minimal processing in a procedure that requires a short time period (e.g., less than 30 min) and can be completed in the surgical suite.
- the mitochondrial transplantation can replace or augment the endogenous dysfunctional or damaged mitochondria in cancer cells and enhance the therapeutic efficacy of cancer chemotherapy.
- the ability to use autologous mitochondrial transplantation to treat prostate and lung cancer will significantly alter the current treatment protocols and significantly improve survival and significantly decrease morbidity.
- the present disclosure provides in vitro and in vivo studies to demonstrate the efficacy of mitochondrial transplantation for use in the treatment of cancer. It also shows possibility of the localized delivery of mitochondria into the target organ, e.g. lungs, either via the organ-specific vasculature or through aerosol delivery (nebulization).
- the methods described herein include methods for the treatment of cancers.
- the methods include administering a therapeutically effective amount of mitochondria and one or more anti-cancer drugs (e.g., chemotherapeutic agents), to a subject who is in need of, or who has been determined to be in need of, such treatment.
- anti-cancer drugs e.g., chemotherapeutic agents
- to“treat” means to ameliorate at least one symptom of the disorder associated with cancer.
- cancer is associated with abnormal cell growth with the potential to invade or spread to other parts of the body.
- a treatment can result in death of cancer cells, an inhibition in cell growth or reduce the potential to invade or spread to other parts of the body.
- mitochondria and the anti-cancer drugs can be administered separately.
- the mitochondria can be delivered to the cancer by direct injection, by intra-arterial delivery, by intra vascular delivery, or by aerosol delivery.
- the viable respiration-competent mitochondria can replace or augment the endogenous dysfunctional or damaged mitochondria in cancer cells and enhance the therapeutic efficacy of cancer chemotherapy.
- mitochondria can be also used as carriers for the anti-cancer drugs (e.g., chemotherapeutic agents).
- Cancer cells and tumor cells need a dedicated blood supply to provide the oxygen and other essential nutrients in order to grow beyond a certain size. They often induce blood vessel growth (angiogenesis) by secreting various growth factors (e.g., VEGF).
- VEGF blood vessel growth factor
- tumor blood vessels are dilated with an irregular shape and have more delicate vasculatures.
- mitochondria with therapeutic agents crosses the endothelium of the blood vessels, the extensive structure in tumor blood vessels provides a natural target site for drug delivery.
- mitochondria agents e.g., with or without anti-cancer drugs
- a blood vessel e.g., by intra arterial delivery or intra-vascular delivery
- cytotoxic agent can be delivered to the tumor to kill cancer cells.
- cancer refers to cells having the capacity for autonomous growth. Examples of such cells include cells having an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include cancerous growths, e.g., tumors;
- malignancies of the various organ systems such as respiratory, cardiovascular, renal, reproductive,
- Cancer that is "naturally arising” includes any cancer that is not experimentally induced by implantation of cancer cells into a subject, and includes, for example, spontaneously arising cancer, cancer caused by exposure of a patient to a carcinogen(s), cancer resulting from insertion of a transgenic oncogene or knockout of a tumor suppressor gene, and cancer caused by infections, e.g., viral infections.
- carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues.
- carcinosarcomas which include malignant tumors composed of carcinomatous and sarcomatous tissues.
- An "adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
- sarcoma is art recognized and refers to malignant tumors of mesenchymal derivation.
- hematopoietic neoplastic disorders includes diseases involving hyperplastic/neoplastic cells of hematopoietic origin. A hematopoietic neoplastic disorder can arise from myeloid, lymphoid or erythroid lineages, or precursor cells thereof.
- cancers that can be treated using the methods and/or compositions as described herein include, for example, cancers of the stomach, colon, rectum, mouth/pharynx, esophagus, larynx, liver, pancreas, lung, breast, cervix uteri, corpus uteri, ovary, prostate, testis, bladder, skin, bone, kidney, head, neck, and throat, Hodgkins disease, non-Hodgkins leukemia, sarcomas, choriocarcinoma, lymphoma, brain/central nervous system, and neuroblastoma (e.g., pediatric neuroblastoma), among others.
- the described methods can be used to treat pediatric neuroblastoma and prostate cancer.
- the cancers are resistant to the anti-cancer drug (e.g., a
- the cancers are not resistant to the anti-cancer drug (e.g., a chemotherapeutic agent).
- an antibody or an antigen-binding fragment can be linked or attached to mitochondria.
- linking the antibody or antigen binding fragment to mitochondria or combined mitochondrial agents can allow the mitochondria or combined mitochondrial agents to target specific sites, e.g., to target cells and/or tissues.
- the antibody or the antigen-binding fragment are designed to target specific cell types, for example, cancer cells.
- the anti-cancer drug is a cytostatic agent or cytotoxic agent. In some embodiments, the anti-cancer drug is a chemotherapeutic agent.
- the one or more anti-cancer drugs can comprise one or more inhibitors selected from the group consisting of an inhibitor of B-Raf, an EGFR inhibitor, an inhibitor of a MEK, an inhibitor of ERK, an inhibitor of K-Ras, an inhibitor of c-Met, an inhibitor of anaplastic lymphoma kinase (ALK), an inhibitor of a phosphatidylinositol 3-kinase (PI3K), an inhibitor of an Akt, an inhibitor of mTOR, a dual PI3K/mTOR inhibitor, an inhibitor of Bruton's tyrosine kinase (BTK), and an inhibitor of Isocitrate dehydrogenase 1 (IDH1) and/or Isocitrate dehydrogenase 2 (IDH2).
- the anti-cancer drug is an inhibitor of indoleamine 2,3 -di oxygenase- 1) (IDOl
- the anti-cancer drug is Abemaciclib, Abiraterone Acetate, Abraxane , Acalabrutinib, Actemra (Tocilizumab), Adcetris (Brentuximab Vedotin), Ado- Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Afatinib Dimaleate, Afmitor (Everolimus), Akynzeo (Netupitant and Palonosetron Hydrochloride), Aldara (Imiquimod), Aldesleukin, Alecensa (Alectinib), Alectinib, Alemtuzumab, Alimta (Pemetrexed Disodium), Aliqopa (Copanlisib Hydrochloride), Alkeran , Aloxi (Palonosetron Hydrochloride), Alunbrig (Brigatinib), Ameluz (Aminolevuliniclib), Abi
- Besponsa (Inotuzumab Ozogamicin), Bevacizumab, Bexarotene, Bicalutamide, BiCNU (Carmustine), Binimetinib, Bleomycin Sulfate, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Braftovi (Encorafenib),
- Calaspargase Pegol-mknl Calquence (Acalabrutinib), Campath (Alemtuzumab), Camptosar (Irinotecan Hydrochloride), Capecitabine, Caplacizumab-yhdp, Carac (Fluorouracil— Topical), Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Carmustine, Carmustine Implant, Casodex (Bicalutamide), Cemiplimab-rwlc, Ceritinib, Cerubidine (Daunorubicin Hydrochloride),
- Denosumab DepoCyt (Cytarabine Liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin
- GEMCITABINE-CISPLATIN GEMCITABINE-OXALIPLATIN
- Gemtuzumab Ozogamicin Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gilteritinib Fumarate, Glasdegib Maleate, Gleevec (Imatinib Mesylate), Gliadel Wafer (Carmustine Implant),
- Glucarpidase Goserelin Acetate, Granisetron, Granisetron Hydrochloride, Granix (Filgrastim), Halaven (Eribulin Mesylate), Hemangeol (Propranolol Hydrochloride), Herceptin Hylecta (Trastuzumab and Hyaluronidase-oysk), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine,
- Hycamtin Topotecan Hydrochloride
- Hydrea Hydrea
- Hydroxyurea Hydroxyurea
- Hyper-CVAD Ibrance (Palbociclib)
- Ibritumomab Tiuxetan Ibrutinib
- Iclusig Ponatinib Hydrochloride
- Idarubicin Hydrochloride Idelalisib, Idhifa (Enasidenib Mesylate), Ifex (Ifosfamide), Ifosfamide, IL-2 (Aldesleukin), Imatinib Mesylate, Imbruvica (Ibrutinib), Imfinzi (Durvalumab), Imiquimod, Imlygic (Talimogene Laherparepvec), Inlyta (Axitinib), Inotuzumab Ozogamicin, Interferon Alfa-2b, Recombinant, Interleukin-2 (Aldesleukin), Intron A
- Ixabepilone Ixazomib Citrate, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), Jevtana (Cabazitaxel), Kadcyla (Ado-Trastuzumab Emtansine), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kisqali (Ribociclib), Kymriah (Tisagenlecleucel), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Larotrectinib Sulfate, Lartruvo (Olaratumab),
- Lenalidomide Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Levulan Kerastik (Aminolevulinic Acid Hydrochloride), Libtayo (Cemiplimab-rwlc), LipoDox (Doxorubicin Hydrochloride Liposome), Lomustine, Lonsurf (Trifluridine and Tipiracil Hydrochloride), Lorbrena (Lorlatinib), Lorlatinib, Lumoxiti (Moxetumomab Pasudotox-tdfk), Lupron (Leuprolide Acetate), Lupron Depot
- Pomalidomide Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Portrazza (Necitumumab), Poteligeo (Mogamulizumab-kpkc), Pralatrexate, Prednisone, Procarbazine Hydrochloride,
- Procrit Epoetin Alfa
- Proleukin Aldesleukin
- Prolia Denosumab
- Promacta Eltrombopag Olamine
- Propranolol Hydrochloride Provenge (Sipuleucel-T)
- Purinethol Mercaptopurine
- Purixan Mercaptopurine
- Radium 223 Dichloride Raloxifene Hydrochloride
- Ramucirumab Rasburicase
- Ravulizumab-cwvz Recombinant Human Papillomavirus
- HPV Bivalent Vaccine
- Recombinant Human Papillomavirus HPV
- Nonavalent Vaccine Recombinant Human Papillomavirus
- Papillomavirus HPV Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, Relistor (Methylnaltrexone Bromide), Retacrit (Epoetin Alfa), Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Ribociclib, Rituxan (Rituximab), Rituxan Hycela (Rituximab and Hyaluronidase Human), Rituximab, Rituximab and Hyaluronidase Human, Rolapitant
- Trifluridine and Tipiracil Hydrochloride Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Ultomiris (Ravulizumab-cwvz), Unituxin (Dinutuximab), Uridine Triacetate, Valrubicin, Valstar (Valrubicin), Vandetanib, VAMP, Varubi (Rolapitant Hydrochloride), Vectibix (Panitumumab), VelP, Velcade (Bortezomib), Vemurafenib, Venclexta (Venetoclax), Venetoclax, Verzenio (Abemaciclib), Vidaza (Azacitidine), Vinblastine Sulfate, Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, Vismodegib, Vistogard (Uridine Triacetate), Vitrakvi (Larotrectinib S
- Xofigo (Radium 223 Dichloride), Xospata (Gilteritinib Fumarate), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Yescarta (Axicabtagene Ciloleucel), Yondelis (Trabectedin), Zaltrap (Ziv- Aflibercept), Zarxio (Filgrastim), Zejula (Niraparib Tosylate Monohydrate), Zelboraf
- the chemotherapeutic agent is 5-fluorouracil, bleomycin, capecitabine, cisplatin, cyclophosphamide, dacarbazine, doxorubicin, etoposide, folinic acid, methotrexate, oxaliplatin, prednisolone, procarbazine, vinblastine, vinorelbine, docetaxel, epirubicin, or mustine.
- the method as described herein can increase the efficacy of the anti-cancer drug by at least 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds (e.g., as compared to the efficacy when only the anti-cancer drug is administered to the subject at the same dose). Because the efficacy of the anti-cancer drug has been improved, in some embodiments
- the therapeutically effective dose of the anti-cancer drug is about or at least 10%, 20%, 30%, 40%, or 50% lower than a typical dose (e.g., an FDA- approved dose) for the anti-cancer drug, thereby minimizing side effects.
- a typical dose e.g., an FDA- approved dose
- the therapeutically effective dose of the anti-cancer drug can be administered to the subject less frequently.
- the interval between administrations can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds than the administration interval in an FDA-approved treatment plan for the anti-cancer drug.
- the total number of administrations can be reduced in a treatment period.
- the total number of administrations can be reduced by about or at least 10%, 20%, 30%, 40%, or 50%.
- the length of the treatment period can be shortened, e.g., by about or at least 10%, 20%, 30%, 40%, or 50% than the length of an FDA-approved treatment plan.
- a FDA approved drug regimen for hormone-refractory metastatic prostate cancer includes docetaxel (Taxotere ® ) injection 75 mg/m 2 every 3 weeks as a 1 hour intravenous infusion and prednisone 5 mg orally twice daily.
- docetaxel When docetaxel is administered to the patient in combination with mitochondria, the dosage of docetaxel 75 mg/m 2 can be reduced by at least 10%, 20%, 30%, 40%, or 50%.
- the frequency of administration e.g., every 3 weeks
- the interval between administrations e.g., 3 weeks
- the interval between administrations can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
- a FDA approved drug regimen for metastatic testicular tumors, metastatic ovarian tumors, and advanced bladder cancer includes cisplatin injection 20 mg/m 2 daily for 5 days per cycle, 75 to 100 mg/m 2 per cycle once every four weeks, and 100 mg/m 2 per cycle once every four weeks, respectively.
- the dosage of cisplatin e.g., 20 mg/m 2 for metastatic testicular tumors, 75 to 100 mg/m 2 for metastatic ovarian tumors, or 100 mg/m 2 for advanced bladder cancer
- the frequency of administration per cycle can be reduced.
- the interval between administrations (e.g., 5 days, or four weeks) can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
- a Phase 2 clinical trail (NCT00658697) was conducted to test efficacy of a drug regimen for prostate cancer, wherein the drug regimen comprised: docetaxel (Taxotere ® ) intravenously given at 75 mg/m 2 on day 1 of every 3 weeks for 4 cycles;
- bevacizumab intravenously given at (15 mg/kg) on day 1 of every 3 weeks for 8 cycles; ADT or Luteinizing hormone-releasing hormone agonist (LHRH) either subcutaneously or
- the dosage of the therapeutic agents can be reduced by at least 10%, 20%, 30%, 40%, or 50%.
- the frequency of administration of therapeutic agents e.g., every 3 weeks
- the interval between administrations of therapeutic agents can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
- a clinical trial (NCT00089609) was conducted to test efficacy of a drug regimen for prostate cancer, wherein the drug regimen comprised: docetaxel (Taxotere ® ) 75 mg/m 2 intravenously over 60 minutes on cycle 1 day 1 repeated every 21 days; thalidomide 200 mg by mouth daily throughout the cycle; prednisone 10 mg by mouth daily throughout the cycle; and bevacizumab 15 mg/kg intravenously on cycle 1 day 1 every 21 days.
- the dosage of therapeutic agents e.g., thalidomide 200 mg
- the frequency of administration of thalidomide can be reduced.
- a FDA approved drug regimen for castration-resistant prostate cancer includes 160 mg (four 40 mg capsules) enzalutamide (XTANDI ® ) administered orally once daily.
- the dosage of therapeutic agents e.g., enzalutamide 160 mg
- the frequency of administration e.g., once daily
- the interval between administrations can be increased to at least or about 2, 3, 4, or 5 days.
- a FDA approved drug regimen for castration resistant prostate cancer includes 55 kBq (1.49 microcurie) of Radium 223 Dichloride (XOFIGO ® )per kg body weight, given at 4 week intervals for 6 injections.
- the dosage of radiotherapy e.g., 55 kBq (1.49 microcurie) of Radium 223 Dichloride (XOFIGO®) per kg body weight
- the frequency of administration e.g., every 4 weeks
- the interval between administrations e.g., 4 weeks
- the subject is also treated by surgery and/or radiotherapy.
- Mitochondria for use in the presently described methods can be isolated or provided from any source, e.g., isolated from cultured cells or tissues.
- Exemplary cells include, but are not limited to, muscle tissue cells, cardiac fibroblasts, cultured cells, HeLa cells, prostate cancer cells, yeast, blood cells, cultured cells, and among others, and any mixture thereof.
- Exemplary tissues include, but are not limited to, liver tissue, skeletal muscle, heart, brain, blood, and adipose tissue (e.g., brown adipose tissue).
- Mitochondria can be isolated from cells of an autogenous source, an allogeneic source, and/or a xenogeneic source.
- mitochondria are isolated from cells with a genetic modification, e.g., cells with modified mtDNA or modified nuclear DNA.
- Mitochondria can be isolated from cells or tissues by methods known to those of skill in the art. In some embodiments, tissue samples or cell samples are collected and then homogenized. Following homogenization, mitochondria are isolated by repetitive centrifugation. Alternatively, the cell homogenate can be filtered through nylon mesh filters. Typical methods of isolating mitochondria are described, for example, in McCully et al., Injection of isolated mitochondria during early reperfusion for cardioprotection, Am J Physiol 296, H94-H105.
- the mitochondria for the treatment can be isolated from cells or tissues of an autogenous source, an allogeneic source, and a xenogeneic source. In some instances, mitochondria are collected from cultured cells or tissues of a subject, and these mitochondria are administered back to the same subject. In some other cases, mitochondria are collected from cultured cells or tissues of a second subject, and these mitochondria are administered to a first subject. In some cases, mitochondria are collected from cultured cells or tissues from a different species (e.g., mice, swine, yeast).
- a different species e.g., mice, swine, yeast
- the present disclosure also provides a composition comprising combined mitochondrial agent.
- the combined mitochondrial agents include e.g., mitochondria that are physically associated with an agent, such as a therapeutic agent, a diagnostic agent, and/or an imaging agent.
- a therapeutic agent can be any agent that has a therapeutic or prophylactic use.
- Exemplary therapeutic agents include, e.g., cytotoxic agents for treating cancer.
- mitochondria can deliver therapeutic agents to specific cells, for example, tumor cells.
- the therapeutic agent may be, e.g., an intracellular inhibitor, deactivator, toxin, arresting substance and/or cytostatic/cytotoxic substance that, once inside a cell, inhibits, destroys, arrests, modifies and/or alters the cell such that it can no longer function normally and/or survive.
- the therapeutic agent can be an agent to restore a cell’s proper function, for example, a DNA vector for gene therapy.
- a therapeutic agent can be, e.g., an inorganic or organic compound; a small molecule (less than 500 daltons) or a large molecule; a proteinaceous molecule, such as a peptide, polypeptide, protein, post-translationally modified protein, or antibody; or a nucleic acid molecule, such as a double-stranded DNA, single-stranded DNA, double-stranded RNA, single- stranded RNA, or a triple helix nucleic acid molecule.
- a therapeutic agent can be a natural product derived from any known organism (e.g., from an animal, plant, bacterium, fungus, protist, or virus) or from a library of synthetic molecules.
- a therapeutic agent can be a monomeric or a polymeric compound.
- Some exemplary therapeutic agents include cytotoxic agents, DNA vectors, small interfering RNAs (siRNA), micro RNAs (miRNA), reactive peptides, nanoparticles, microspheres, and fluorescent molecules.
- a diagnostic agent is an agent that has diagnostic use. As mitochondria carry a diagnostic agent into a cell, in some embodiments, the diagnostic agent can be designed to determine the condition within a cell, for example pH and oxidative stress within a cell.
- An imaging agent is an agent that is employed for use in imaging techniques.
- the techniques or modalities include, but are not limited to, X-rays, computed tomography (CT), magnetic resonance imaging (MRI), scintigraphy, fluorescence, ultrasound, etc.
- CT computed tomography
- MRI magnetic resonance imaging
- scintigraphy fluorescence, ultrasound, etc.
- the imaging agent can be florescent and/or radioactive. In some embodiments, an imaging agent can also be a diagnostic agent.
- imaging agents include, but are not limited to, MitoTracker fluorophores (Thermo Fisher Scientific Inc.), CellLight® RFP, BacMam 2.0 (Thermo Fisher Scientific Inc.), pH-sensitive pHrodo fluorescent dyes (Thermo Fisher Scientific Inc.), 18 F- Rhodamine 6G, 18 F-labeled rhodamine B, magnetic iron oxide nanoparticles, and gold- and platinum-based nanoparticles.
- a combined mitochondrial agent comprises a mitochondria and an agent that are in direct and/or indirect physical contact with each other.
- an agent can be linked to mitochondria, attached to mitochondria, embedded in the mitochondrial membrane, or completely or partially enclosed in mitochondria.
- a pharmaceutical agent can be linked to mitochondria covalently.
- the agent is linked to constituents of mitochondrial membrane directly through a covalent bond (e.g., a carboxamide bond and a disulfide bond), or indirectly through a linker (e.g., a peptide linker) or another covalently bonded agent.
- an agent can be linked to mitochondria non- covalently, for example, through hydrophobic interaction, Van der Waals interaction, and/or electrostatic interaction, etc.
- a combined mitochondrial agent can comprise two or more different types of agents, for example, two different kinds of therapeutic agents, three different kinds of imaging agents, one therapeutic agent and one imaging agent, a therapeutic agent and a diagnostic agent, etc. Skilled practitioner will appreciate that any variation is possible.
- One particularly useful linker to link mitochondria and an agent provides a sustained release of the agent upon injection. This can be accomplished, for example, using a hydrazone functional group. For example, a hydrazone is formed to covalently bind an agent to constituents on the mitochondrial membrane. Once this combined mitochondrial agent is taken up by cells, the change in pH will result in hydrolysis of the hydrazone, releasing the bound agent inside the cell.
- a therapeutic agent, a diagnostic agent, and/or an imaging agent can be linked to the outer mitochondrial membrane using functionalized surface chemistry.
- heterobifunctional chemistries can link a therapeutic agent, a diagnostic agent, and/or an imaging agent to the mitochondrial surface, and once they are internalized, these agents can be released through interactions with intercellular esterases (e.g. via interaction with an acetoxymethyl ester) or through a UV-light activation or Near-Infrared light activation strategy.
- UV-light activation and Near-Infrared light activation strategies are described, e.g., in Zhou et al., "Progress in the Field of Constructing Near-Infrared Light-Responsive Drug Delivery Platforms," Journal of Nanoscience and Nanotechnology 16.3 (2016): 2111-2125; Bansal et al., “Photocontrolled nanoparticle delivery systems for biomedical applications,” Accounts of chemical research 47.10 (2014): 3052-3060; Barhoumi et al., “Ultraviolet light- mediated drug delivery: Principles, applications, and challenges," Journal of Controlled Release 219 (2015): 31-42; and US20180057610A1. Each of them is incorporated by reference in its entirety.
- compositions described herein may include more than one type of combined mitochondrial agent.
- compositions comprising mitochondria wherein essentially each mitochondrion is associated with multiple types of agents are also included.
- an agent can be linked to mitochondria in any number of ways, e.g., by attaching to mitochondria, embedding partially or completely in the mitochondrial membrane, enclosing in mitochondria, or encapsulating within the mitochondria. While not intending to be bound by any theory or any particular approach, it is believed that the outer membrane of mitochondria is adherent and thus particularly amenable to combination with various agents. In some embodiments, pharmaceutical agents can be attached to the outer membrane of mitochondria simply by incubation.
- an effective amount of pharmaceutic agents can be fully mixed with isolated mitochondria in a buffer, e.g., respiration buffer, at a temperature favorable to isolated mitochondria, e.g., from 0 °C to 26 °C, from 0 °C to 4 °C, or about 0 °C, 4°C, 26 °C.
- a buffer e.g., respiration buffer
- This procedure is useful to attach an effective amount of pharmaceutic agents (e.g., nanoparticles, DNA vectors, RNA vectors) to
- organic cations e.g., rhodamine and tetramethylrosamine
- rhodamine and tetramethylrosamine are readily sequestered by functioning mitochondria because of the electric potential on
- mitochondrial membrane Healthy mitochondrial membranes maintain a difference in electric potential between the interior and exterior of the organelle, referred to as the membrane potential. This membrane potential is a direct result of mitochondrial functional processes, and can be lost if the mitochondria are not working properly. Lipid-soluble cations are sequestered by mitochondria as a consequence of their positive charge and of their solubility in both the inner membrane lipids and the matrix aqueous space. Similarly, in some other embodiments, anions can be attached to the outer membrane of mitochondria because of its negative charge.
- an effective amount of pharmaceutic agents should be fully mixed with isolated mitochondria in a buffer, e.g., respiration buffer, at a temperature favorable to isolated mitochondria, e.g., about 0°C or 4°C.
- the therapeutic, diagnostic, and/or imaging agent can be linked to phospholipids, peptides, or proteins on the mitochondrial membrane through a chemical bond.
- molecules including fluorophores pHrodo Red (Thermo Fisher Scientific, Inc.)
- metallic particles e.g., 30 nm magnetic iron oxide nanoparticles (Sigma)
- These reactive reagents react with non- protonated aliphatic amine groups, including the amine terminus of proteins and the e-amino group of lysine residues, which creates a stable carboxamide bond.
- the pharmaceutic agent e.g., MitoTracker® Orange CMTMRos (Invitrogen, Carlsbad, CA, now Thermo-Fisher Scientific, Cambridge, MA)
- MitoTracker® Orange CMTMRos Invitrogen, Carlsbad, CA, now Thermo-Fisher Scientific, Cambridge, MA
- Agents can be attached via protein bonding, amine bonding or other attachment methods either to the outer or inner mitochondrial membrane.
- an agent can be attached to the mitochondria membrane through hydrophobic interaction, Van der Waals interaction, and/or electrostatic interaction.
- therapeutic agents, diagnostic agents and imaging agents may simply be mixed with isolated mitochondria, and incubated in a buffer (e.g., respiration buffer) for a sufficient period of time (e.g., a few minutes, 5 minutes, 10 minutes, or 1 hour) at favorable conditions (e.g., from 0 °C to 26 °C, from 0 °C to 4 °C, or about 0 °C, 4°C, 26 °C, pH 7.2-8.0).
- a buffer e.g., respiration buffer
- a sufficient period of time e.g., a few minutes, 5 minutes, 10 minutes, or 1 hour
- favorable conditions e.g., from 0 °C to 26 °C, from 0 °C to 4 °C, or about 0 °C, 4°C, 26 °C, pH 7.2-8.0.
- Isolated mitochondria and combined mitochondrial agents can be mixed with a pharmaceutically acceptable carrier to make a pharmaceutic composition.
- a pharmaceutically acceptable carrier includes any compound or composition useful in facilitating storage, stability, administration, cell targeting and/or delivery of the mitochondria and/or combined mitochondrial agent, including, without limitation, suitable vehicles, diluents, solvents, excipients, pH modifiers, salts, colorants, rheology modifiers, lubricants, coatings, fillers, antifoaming agents, polymers, hydrogels, surfactants, emulsifiers, adjuvants, preservatives, phospholipids, fatty acids, mono-, di- and tri-glycerides and derivatives thereof, waxes, oils and water.
- isolated mitochondria and/or the combined mitochondrial agents are suspended in water, saline, buffer, respiration buffer, or sterile mitochondria buffer for delivery in vivo.
- compositions described herein Pharmaceutically acceptable salts, buffers or buffer systems, including, without limitation, saline, phosphate buffer, phosphate buffered saline (PBS) or respiration buffer can be included in a composition described herein.
- Vehicles having the ability to facilitate delivery to a cell in vivo, such as liposomes, may be utilized to facilitate delivery of the combined mitochondrial agents to the target cells.
- compositions e.g., liquid, semi-solid, and solid compositions (e.g., liquids, creams, lotions, ointments, oils, among others), are well-known in the art. Skilled practitioners will appreciate that such known methods can be modified to add one or more steps to add mitochondria and/or combined mitochondrial agents and form a composition described herein. Skilled practitioners will appreciate that in some instances a composition described herein may include more than one type of combined mitochondrial agent. For example, included are compositions comprising mitochondria wherein essentially each mitochondrion is associated with multiple types of agents. Also included are compositions comprising mitochondria wherein each mitochondrion is paired with only one type of agent but wherein the composition comprises a mixture of mitochondria/agent pairings.
- compositions including a pharmaceutically acceptable carrier along with a therapeutically effective amount of the mitochondria and/or one or more anticancer drugs.
- the pharmaceutical composition comprises mitochondria, one or more anti-cancer drugs, or both mitochondria and anti-cancer drugs.
- Pharmaceutically acceptable carrier means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use.
- excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
- the pharmaceutical compositions can be formulated for delivery via any route of administration.
- Route of administration can refer to any administration pathway known in the art, including but not limited to aerosol, nasal, transmucosal, transdermal, or parenteral.
- Parenteral refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal.
- the compositions can be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders.
- the pharmaceutical compositions can also contain any pharmaceutically acceptable carrier.
- “Pharmaceutically acceptable carrier” as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body.
- the carrier can be a liquid or solid tiller, diluent, excipient, solvent, or encapsulating material, or a combination thereof.
- Each component of the carrier must be“pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
- the pharmaceutical compositions can be delivered in a therapeutically effective amount.
- the precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic agent (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of
- composition as describe herein e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs
- the composition as describe herein can be delivered by direct injection or by vascular infusion.
- mitochondria Once mitochondria are injected into a tissue, mitochondria will be taken up by cells around the site of injection. Therefore, in some embodiments, the site of injection is the target site. In some other embodiments, mitochondria are injected to a blood vessel which carries the blood to the target site, for example, an organ, a tissue, or a tumor site. While not intending to be bound by any theory, evidence suggests that mitochondria delivered by direct injection are internalized by cells through actin-dependent endocytosis. However, mitochondrial uptake by vascular delivery appears to be more complicated. The rapid and widespread uptake of mitochondria when delivered by vascular infusion would suggest that mechanisms allowing for the rapid passage of mitochondria through the vascular wall are involved. Some studies support the concept that cells can routinely escape from the circulation.
- Angiopellosis as an Alternative Mechanism of Cell Extravasation. Stem Cells. 35,170-180). Transmigration of stem cells through the vascular wall requires extensive remodeling of the endothelium. Mitochondria may use a similar remodeling mechanism to pass through the vascular wall. Another possible mechanism for mitochondrial uptake may be diapedesis- like. Some cells routinely escape from the circulation. For example, leukocyte extravasation (i.e. diapedesis) between venous endothelial cells is a well-understood process that involves cell adhesion proteins. Further, it is also possible that infused mitochondria extravasate through the capillary wall through the space between the endothelium cells.
- compositions as describe herein can be administered to a subject as a singular, one-time treatment, or alternatively, multiple treatments, e.g., a treatment course that continues intermittently or continuously for about 1, 2, 5, 8, 10, 20, 30, 50, or 60 days, one year, indefinitely, or until a physician determines that administration of the mitochondria or combined mitochondrial agent is no longer necessary.
- the composition as describe herein e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs
- the composition as describe herein is injected into organ tissue directly.
- the injection is repeated several times at different sites of the organ.
- a sterile 1-ml insulin syringe with a small needle e.g., 28-gauge
- each injection site can receive, e.g., about 1.2 c 10 6 of mitochondria.
- composition as describe herein e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs
- cancer e.g., focal cancer or solid tumor
- composition as describe herein e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs
- nodules e.g., by intra-arterial delivery.
- the composition as describe herein e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs
- aerosolized e.g., in the form or aerosol
- the composition as describe herein can be aerosolized (e.g., in the form or aerosol), and delivered to lungs, nasal passage, rectum, intestine, skin, and eyes to treat cancers in these sites.
- mitochondria and/or combined mitochondrial agents e.g., compositions comprising mitochondria and/or combined
- mitochondrial agents that should be administered to a patient will vary depending upon, e.g., the type of disorder being treated, the route of administration, the duration of the treatment, the size of an area to be treated, and/or the location of the treatment site in the patent, among others. Skilled practitioners will be able to determine dosages to be administered depending on these and other variables. For example, a total of about 1 c 10 7 of mitochondria can be administered into a blood vessel of a subject, e.g., to treat the disorder. As another example, in the case of larger organs or affected areas, greater numbers of mitochondria, e.g., 1 x 10 10 to 1 x 10 14
- an effective amount of mitochondria or combined mitochondrial agents is the total amount of mitochondria or combined mitochondrial agents sufficient to bring about a desired therapeutic effect.
- An effective amount can be, e.g., at least or about 1 x 10 2
- mitochondria or combined mitochondrial agents e.g., from about 1 x 10 3 to about 1 x 10 14 , about 1 x 10 4 to about 1 x 10 13 , about 1 x 10 5 to about 1 x 10 12 , about 1 x 10 6 to about 1 x 10 11 , about 1 x 10 7 to about 1 x 10 10 , about 1 x 10 3 to about 1 x 10 7 , about 1 x 10 4 to about 1 x 10 6 , about 1 x 10 7 to about 1 x 10 14 , or about 1 x 10 8 to about 1 x 10 13 , about 1 x 10 9 to about 1 x 10 12 , about 1 x 10 5 to about 1 x 10 8 or at least or about 1 x 10 3 , 1 x 10 4 , 1 x 10 5 , 1 x 10 6 , 1 x 10 7 , 1 x 10 8 , 1 x 10 9 , 1 x 10 10 , 1 x 10 u , 1 x 10 12 , 1
- the term“total amount” in the context of administration to a patient can refer to the total amount of mitochondria or combined mitochondrial agents in a single administration (e.g., one injection, one dose administered in an infusion) or in multiple administrations (e.g., multiple injections), depending on the dosing regimen being performed.
- composition as describe herein can be administered to a subject every 12-24 hours by various routes, e.g., direct injection, vascular delivery.
- isolated mitochondria or combined mitochondrial agents can be administered to a subject every 5-10 minutes (e.g., every 5 minutes, every 10 minutes) by various routes, e.g., direct injection, vascular infusion.
- isolated mitochondria or combined mitochondrial agents can be directly injected into tissues or organs by Gauge 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, and 34 needles. In some other cases, isolated mitochondria, or combined mitochondrial agents can be delivered to a target site by a catheter.
- the effects of mitochondria depend on the length of the time period between the time of isolation and the time of use.
- the mitochondria are freshly isolated and viable.
- the mitochondria or combined mitochondrial agents can be administered to a subject within about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, about 70 minutes, about 80 minutes, about 90 minutes, about 100 minutes, about 110 minutes, about 120 minutes after the mitochondria are isolated.
- the mitochondria or combined mitochondrial agents are administered to a subject within about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, about 70 minutes, about 80 minutes, about 90 minutes, about 100 minutes, about 110 minutes, about 120 minutes after starting the mitochondria isolating process.
- Mitochondria and/or combined mitochondrial agents may in some instances be stored for a short period of time (e.g., about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, or about 60 minutes) before use.
- frozen-thawed mitochondria are not viable and not effective for certain treatments described herein, e.g., treatment of ischemia/reperfusion injuries or treatment of cancer.
- the mitochondria are not frozen and thawed after isolation from tissues and/or cells.
- the mitochondria for the treatment can be isolated from cells or tissues of an autogenous source, an allogeneic source, and a xenogeneic source. In some instances, mitochondria are collected from cultured cells or tissues of a subject, and these mitochondria are administered back to the same subject. In some other cases, mitochondria are collected from cultured cells or tissues of a second subject, and these mitochondria are administered to a first subject. In some cases, mitochondria are collected from cultured cells or tissues from a different species (e.g., mice, swine, yeast).
- a different species e.g., mice, swine, yeast
- the mitochondria or combined mitochondrial agents can be administered to a subject before, during, or after the anti-cancer drug is administered to a subject.
- an“effective amount” is an amount sufficient to effect beneficial or desired results.
- a therapeutically effective amount is one that achieves the desired therapeutic effect.
- An effective amount can be administered in one or more administrations, applications or dosages.
- a therapeutically effective amount of a therapeutic compound typically depends on the therapeutic compounds selected.
- the compositions can be administered one from one or more times per day to one or more times per week; including once every other day.
- certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
- treatment of a subject with a therapeutically effective amount of the therapeutic compounds described herein can include a single treatment or a series of treatments.
- Dosage, toxicity and therapeutic efficacy of the therapeutic compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such
- the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
- the route of administration utilized for any compound used in the method of the invention.
- therapeutically effective dose can be estimated initially from cell culture assays.
- a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
- IC50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
- levels in plasma can be measured, for example, by high performance liquid chromatography.
- Example 1 Exogenous mitochondria that were administered extracellularly were transported into the human cancer cells.
- human prostate cancer cell lines DU145 ATCC HTB81
- PC3 ATCC CRL1435
- human normal prostate epithelium cell line RWPE (ATCC CRLl 1609) obtained from the (American Type Culture Collection,
- the human cardiac fibroblast (HCF) cell line was obtained from ScienCell Research Laboratories, Carlsbad, CA.
- the DU-145 and PC-3 prostate cancer cell lines are androgen receptor negative and harbor non-functional p53, and have been extensively studied for chemotherapy sensitivity.
- RWPE cells were maintained in keratinocyte serum free medium, supplemented with 0.05 mg/ml bovine pituitary extract (BPE) and 5 ng/ml EGF according to the supplier’s directions (GIBICO, 17005-042, Grand Island, NY).
- PC3 and DU145 cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA, USA), supplemented with 10% fetal bovine serum (FBS) (Gibco, ThermoFisher Scientific), 100 U/ml penicillin, 100 pg/ml streptomycin and 1 mmol/1 glutamine (Sigma-Aldrich, St. Louis, MO).
- FBS fetal bovine serum
- HCF Human cardiac fibroblasts
- Fibroblast Medium-2 containing fetal bovine serum, fibroblast growth supplement-2, and antibiotic (penicillin/streptomycin) solution according to the supplier’s directions (ScienCell, Carlsbad, CA). All cells were maintained as a monolayer at 37 °C in humidified atmosphere of 5% CO2 and were passaged when 80% confluence was reached.
- GFP green fluorescent protein
- HCF human cardiac fibroblast cell
- RFP red fluorescent protein
- GFP-labelled DU145 and PC3 human prostate cancer cell lines were seeded on cover slips in a flat-bottomed 24-well plate (10,000 cells per well). Mitochondria were isolated from RFP-labelled HCF cells. Isolated HCF-RFP labelled mitochondria (1 x 10 7 ) resuspended in 500 pL cell DMEM media were co-incubated with GFP-labelled PC3 or GFP labelled DU145 human prostate cancer cell lines for 4 hours.
- FIGS. 1A-1D contain a representative set of images obtained by 3-D SR-SIM.
- the RFP- labeled HCF mitochondria in the DU145 cancer cells are shown in red (FIG. 1A, FIG. ID), while the GFP-labeled HCF exogenous mitochondria are shown in green (FIG. IB, FIG. ID).
- the DAPI-stained nucleus of the cancer cells is shown in blue (FIG.1C).
- This representative set of images demonstrates that the exogenous mitochondria were transported into the cancer cells and are not localized to a specific area within the cell, rather the exogenous mitochondria are dispersed throughout the cell. The results show that human cancer cells can uptake exogenous mitochondria that are administered extracellularly.
- Example 2 Mitochondrial transplantation does not increase proliferation rate of human cancer cells.
- DU145 and PC3 human prostate cancer cell lines were seeded on a flat-bottomed 96-well plate at 10,000 cells per well and left to attach overnight at 37°C in 5% CO2 atmosphere. DU145 and PC3 cells were then washed twice with 37°C PBS and then incubated with 500 uL fresh DMEM (Vehicle) or DMEM containing lxlO 7 , freshly isolated HCF mitochondria
- Mitochondria for 4 hours. Mitochondria were isolated from HCF cells. Following 4 hours incubation the DU145 and PC3 cells received a further 500 uL fresh DMEM (total volume 1 mL). MTT Cell Proliferation Assay
- Cell proliferation was assessed at 24 hours, 48 hours, 72 hours and 96 hours using the MTT Cell Proliferation Assay according to the manufacturer’s protocol (American Type Culture Collection, Manassas, VA). Cell proliferation in DU145 and PC3 human prostate cancer cells receiving either vehicle or mitochondria was determined. Each experiment was conducted in sextuplicate and repeated three times for both cell lines.
- FIGS. 2A-2B show results from proliferation assays for DU145 cells (FIG. 2A) and PC3 cells (FIG. 2B).
- Example 3 The effects of mitochondrial transplantation on cell cycle distribution of human cancer cells.
- RWPE and DU145 and PC3 human prostate cancer cell lines were seeded, separately on a flat-bottomed 96-well plate (10,000 cells per well) and left to attach overnight at 37°C in 5% CO2 atmosphere for 24 hours.
- RWPE (Control) DU145 and PC3 cells were washed twice with 37°C PBS and then incubated with 500 uL fresh DMEM (Vehicle) or DMEM containing lxlO 7 , freshly isolated HCF mitochondria
- Mitochondria for 4 hours. Mitochondria were isolated from HCF cells. RWPE cells received vehicle only. Flow Cytometry to Quantify Cell Cycle Distributions
- the percentages of cells in the sub-Gl, G0/G1, S, and G2/M phases of the cell cycle were analyzed.
- the percentage of total cells in the sub-Gl phase, the G1 phase, the S phase and G2/M phase were determined for the human normal prostate epithelium cell line, RWPE (Control Group) and for DU145 and PC3 human cancer cells receiving either Vehicle or Mitochondria. Experiments were repeated three times, in triplicate for all cell lines.
- Example 4 The effects of mitochondrial transplantation on the oxygen consumption and ATP content of human cancer cells
- DU145 and PC3 human prostate cancer cell lines were seeded and cultured separately on a flat-bottomed 96-well plate (10,000 cells per well). DU145 and PC3 cells were washed twice with 37°C PBS and then incubated with 500 pL fresh DMEM or DMEM containing either 1 x 10 5 , or 1 x 10 6 or 1 x 10 7 freshly isolated HCF mitochondria for 4 hours. Mitochondria were isolated from HCF cells.
- FIGS. 3A-3B show quantified total ATP content in DU145 and PC3 cell lines that were co-incubated with different concentrations of exogenous mitochondria for 4 hours.
- DU145 FIG. 3A
- PC-3 FIGG. 3B
- 10,000 cells per well were seeded in a 24-well plate. Following 24 hours, cells were co-incubated with vehicle only or with vehicle containing 1c10 ? or lxlO 6 or
- ATP content was significantly increased with 1 x 10 7 mitochondria in both DU145 and PC3 human prostate cancer cell lines as compared to Vehicle treated cells (shown in black). No significant difference between 1c10 ? or 1 x 1 o’ or lxl0 ? was evident.
- the results indicate that co incubation of the cancer cell lines with mitochondria was sufficient to increase total ATP content in the cancer cells.
- the results also indicate that the aforementioned effect is dose-dependent given that increasing amounts of exogenous mitochondria correlate with higher levels of total ATP content within the cancer cell lines. This result suggests that this effect is mediated by mitochondria that have been internalized by the cancer cells and that co-incubation with higher levels of exogenous mitochondria results in higher levels of internalized exogenous mitochondria within the cancer cells.
- internalized exogenous mitochondria can increase other mitochondria-dependent functions in DU145 and PC3 human prostate cancer cell lines.
- internalized exogenous mitochondria will confer increases rates of oxygen uptake. To quantify this, the following oxygen uptake assay can be performed.
- DU145 and PC3 human prostate cancer cell lines can be seeded and cultured, separately on a flat-bottomed 96-well plate (10,000 cells per well).
- DU145 and PC3 cells can be washed twice with 37 °C PBS and then incubated with 500 pL fresh DMEM or DMEM containing either 1 x 10 5 , or 1 x 10 6 or 1 x 10 7 freshly isolated HCF mitochondria for 4 hours.
- Mitochondria can be isolated from HCF cells.
- the media can be removed, the cells can be washed with PBS and the cells can collected by trypsinization. The cells are collected in fresh DMEM (1 mL, 37°C) and cellular oxygen uptake can be determined.
- Example 5 Mitochondrial transplantation alters chemotherapy sensitivity in human cancer cell lines.
- Cisplatin is a commonly employed compound that exerts clinical activity against numerous solid tumors and was also shown to have potential in the management of metastatic castration-resistant prostate cancer.
- the biochemical mechanisms of cisplatin cytotoxicity involve cell cycle arrest and increased apoptosis by inhibition of anti-apoptotic Bcl-2.
- Cisplatin s chemotherapeutic activity is known to require functioning mitochondria for optimal cytotoxic effect.
- Docetaxel is a first-line chemotherapy, shown to improve prostate cancer patient survival by months. Both drugs improve prostate cancer patient survival, but tumor resistance to these therapeutic agents inevitably develops.
- DU145 and PC3 human prostate cancer cell lines were seeded on a flat-bottomed 96-well plate (10,000 cells per well) and then incubated with Vehicle or Mitochondria. Mitochondria were isolated from HCF cells. Following 4 hours incubation, the DU145 and PC3 cells received a further 500 pL fresh DMEM (total volume 1 mL) containing either a sub-lethal dose of cisplatin (10 pmol/'l) or docetaxel 5 nmol/1. The cells were incubated for 24 hours or 48 hours, after which points cell death, apoptosis, and cell cycle inhibition were quantified.
- DMEM total volume 1 mL
- DU145 and PC3 human prostate cancer cell lines were seeded on cover slips in a flat-bottomed 24-well plate (10,000 cells per well) and received exogenous mitochondria or vehicle and further treated with cisplatin or docetaxel.
- a separate group of DU145 and PC3 cells received a lethal dose of cisplatin (25 or 50 umol/l) or docetaxel 10 or 20 nmol/1.
- cell death was determined using the LIVE/DEAD Viability/Cytotoxicity Kit (Molecular Probes Inc., Eugene, OR, USA) according to the manufacturer’s directions. Each experiment was conducted in sextuplicate and repeated three times for both cell lines.
- FIGS. 4A-4B show results from cell viability assays of DU145 and PC3 human prostate cancer cells treated with exogenous mitochondria and with cisplatin or docetaxel.
- DU145 FIG. 4A
- PC-3 FIGG. 4B
- 10,000 cells per well were seeded in a 24-well plate.
- DU145 and PC3 were co-incubated, separately with either vehicle only or with lxlO 7 mitochondria for 4 hours and then the media was removed and fresh DMEM media was added.
- fresh media containing cisplatin at a sub-lethal dosage (10 uMol) was added to the cells. The cells were incubated for 24 and 48 hours.
- mitochondrial transplantation can increase other metrics of chemotherapy sensitivity in moderately chemotherapy resistant DU145 and the highly chemotherapy resistant PC3 prostate cancer cells. For example, it is hypothesized that apoptosis will increase in DU145 and PC3 cells treated with exogenous mitochondria and further treated with cisplatin or docetaxel. To quantify this, the following assays, listed below, can be performed.
- Apoptosis can detected using the ApopTag detection system (Intergen, Gaithersburg, MD) according to the manufacturer’s protocol.
- Apoptosis can be quantified by counting the positive cells (brown-stained), and total number of cells in five randomly selected fields at c 400 magnification. The percentage of positive cells (apoptotic index) can be calculated as the number of positive cells/total number of nucleated cells c 100%. Experiments can be repeated three times, in triplicate. Flow Cytometry to Quantify Cell Cycle Distributions
- Cell cycle distributions can be determined by utilizing propidium iodide according to the manufacturer’s protocol (PI; Sigma-Aldrich, St. Louis, MO) and then analyzed by flow cytometry.
- PI propidium iodide according to the manufacturer’s protocol (PI; Sigma-Aldrich, St. Louis, MO) and then analyzed by flow cytometry.
- Caspase-3 enzyme activity is determined using the Caspase 3 Assay Kit 3 activity assay kit (Abeam, Cambridge, MA) according to the manufacturer’s protocol. Experiments are repeated three times, in triplicate for all cell lines.
- Formalin-fixed, paraffin-embedded tumor cells will be prepared for
- HRP sc- 517582 HRP can be purchased from Santa Cruz Biotechnology. Bax, Bcl-2 and Ki-67 monoclonal antibodies; anti-rabbit and anti-mouse HRP-conjugated secondary antibodies can be purchased from Sigma-Aldrich Company (St. Louis, MO). For the negative control, the primary antibody can be replaced with PBS.
- Staining intensity will be estimated on a four-step scale as follows: negative (no staining at all); weak (1+ staining regardless of positive cell percentages or 2+ staining of ⁇ 30% of cells); moderate (2+ staining of > 30% of cells or 3+ staining of ⁇ 50% of cells); and strong (3+ staining of > 50% of cells).
- the moderately positive and strongly positive are calculated into the positive group; the negative and weakly positive are calculated into the negative group. All data will be analyzed by two blinded observers.
- RNA will be isolated and quality and purity can be assessed by spectrophotometric analysis and agarose gel electrophoresis. Cell protein are isolated.
- qRT-PCR To quantify gene expression changes of select genes encoding proteins with roles in apoptosis qRT-PCR will be performed using an Eppendorf Realplex Mastercycler and software package (Eppendorf North America, Westbury, NY). The iScript One-Step RT-PCR Kit with SYBR Green solution (Bio-Rad, Hercules, CA) will be used according to manufacturer’s instructions. Control reactions without reverse transcriptase will be performed for each reaction. Gene specific primers for qRT-PCR are :
- Fold changes in gene expression can be calculated using the delta delta CT (ddCT) method. qRT-PCR product sizes will be verified by agarose gel and electrophoresis.
- Example 6 Determine efficacy of mitochondrial transplantation in subcutaneous tumors containing PC3 or DU145 prostate cancer cell lines in the athymic mouse model.
- PC-3 and DU145 prostate cancer cells will be stably infected with the Lentivirus CMV-GFP-Luc according to the manufacturer’s protocol (SBI Systems Biosciences, Mountain View, CA). This vector allows for the selection of cells containing the firefly luciferase based on GFP expression.
- FIG. 5 shows FACS analysis of PC3 human prostate cancer cells transfected with the Lentivirus CMV-GFP-Luc (red) compared to non-transfected PC3 cells (black). FACS results demonstrate that 69.9% of PC3 cells are GFP positive and contain the firefly luciferase gene. Transfection efficiency in RWPE-1 cells was 63.3% and 61.4% in DU145 cells. Previous studies have demonstrated that luciferase expression and bioluminescence does not affect tumor cell growth in vitro or in vivo. .
- mice (6-8 weeks in age, 20-25 g) will be anesthetized using isoflurane at 1-4% in a flow of oxygen.
- PC3 or DU145 human prostate GFP positive cancer cells transfected the Lentivirus CMV-GFP-Luc are sorted by FACS prior to use in BLI studies. Cell viability will be >95% by Trypan blue exclusion at the time of injection.
- the cells (5 xlO 6 ) are suspended in 0.2 mL PBS and then injected subcutaneously with or without Matrigel (1 : 1 ratio of cell volume to Matrigel) into left and right flanks of the same mouse and the mouse is allowed to recover for 24 hours.
- HCF mitochondria will be isolated as described by us.
- the mitochondria will be labelled with 18 F-rhodamine 6G and iron oxide nanoparticles.
- the labelled HCF mitochondria (lxlO 5 , lxlO 6 , lxlO 7 ) in a total volume of 50 pL of PBS will be injected at 5 different sites (10 pL per injection) in the tumor using a tuberculin syringe with a 28 G needle.
- Mitochondrial uptake and bio-distribution will be determined using an Albira
- PET/SPECT/CT Preclinical Imaging System (Bruker, Billerica, MA). Following imaging the mouse will be sacrificed by CO2 inhalation overdose and the tumor removed for histochemical analysis. Mitochondrial uptake in tumor cells will be determined by Prussian Blue staining and co-staining with MitoTracker Red CMXRos.
- Tumors will be inoculated on both flanks of the mouse with either PC3 or DU145 human prostate GFP positive cancer cells transfected with the Lentivirus CMV-GFP-Luc.
- One of the tumors will be treated with vehicle only (50 uL PBS) and the other will receive vehicle containing HCF mitochondria (lx 10 5 , lxlO 6 , lxlO 7 ) in 50uL PBS.
- Mitochondria or Vehicle will be injected at 5 different sites (10 pL per injection) in the tumor using a tuberculin syringe with a 28 G needle. The mice will be allowed to recover for 4 hours. Mice will then be treated with either cisplatin or docetaxel.
- Cisplatin a chemotherapeutic known to require functioning mitochondria for optimal cytotoxic effect, will be made up fresh in 0.9% saline.
- Mice will be treated with cisplatin, (0.5 or 1.0 or 1.5 mg/kg. i.p.) 2 x week, for 3 weeks.
- Other groups of mice will be treated with docetaxel, a first line chemotherapeutic in prostate cancer treatment.
- Mice will be treated with docetaxel at (10 or 12.5 or 15 mg/kg i.p.) 1 x week for 3 weeks. Tumor growth will be monitored every 3-4 days (twice a week for 3 weeks), and tumors will be measured using calipers.
- Tumor growth and therapy effect will also be measured using bioluminescence using D-Luciferin (2.9 mg in 100 uL PBS, ip, Promega, Madison, WI) and imaging using the IVIS imaging system (Perkin Elmer, Waltham, MA). Mean tumor luminescence (counts/s) and mean tumor volume (mm3) will be collected for each tumor in each mouse and chemotherapy sensitivity to cisplatin or docetaxel will be determined. Cell migration and proliferation will be determined. Body weight change and blood cell analysis will be performed on all animals in all groups.
- mice Immediately following final imaging session (3 weeks) the mice will be euthanized using CO2 inhalation overdose. Euthanized animals will be dissected and tissues (heart, lung, liver, spleen, kidney, stomach, bowel, muscle, femur (bone), skin, and tumor) will be collected, weighed for BLI ex vivo organ analysis. Within and between group comparisons will be performed to determine effect.
- the mean ⁇ the standard error of the mean for all data is calculated for all variables. Simple pre- vs. post-interventional comparisons are made using a paired two tailed Student's T- test, if the data is normally distributed, or a Wilcoxon Signed Rank test for other continuous data.
- MM-ANOVA mixed model analysis of variance
- AR (1) autoregressive correlation
- transformations to normalize the data e.g., log transformations
- model the data using generalized estimating equations e.g., log transformations
- a P ⁇ 0.05 indicates statistical significance. Post hoc comparisons between groups are adjusted for multiple comparisons using a Bonferroni correction. Efficacy will be compared using Fisher's exact test. Randomization will be performed using the R software package based on a 1 : 1 allocation using a Uniform (0,1) number generator. Statistical analysis will be conducted using SAS version 9.3 (SAS Institute, Cary, NC). Two-tailed P ⁇ 0.05 will be considered statistically significant. Within and between group comparisons will be performed using Kruskal-Wallis and Dunn post hoc tests or Mann-Whitney test. Outcome value changes from baseline or, where lacking, average baseline will be calculated compared to zero by Wilcoxon rank sum test. Statistical significance will be set at P ⁇ 0.05.
- Example 7 Biodistribution and tissue uptake of mitochondria delivered into the lungs either via vascular delivery or via nebulization
- Vascular delivery Vascular delivery of mitochondria to the left lung was achieved by injection of mitochondria in buffer directly into the left pulmonary artery at the beginning of reperfusion.
- nebulization Aerosol delivery of mitochondria was achieved by nebulization using the FlexiVent nebulizer system (FlexiVent FX2, SCIREQ, Montreal, Quebec, Canada).
- FlexiVent was equipped with the Aeroneb ultrasonic nebulizer and Y-tubing to deliver the aerosol containing vehicle alone (Vehicle Neb) or buffer containing mitochondria (Mito Neb).
- the nebulization mouse default template was selected from the operating software and the FlexiVent system was calibrated according to the manufacturer’s directions.
- the oral endotracheal 20-gauge plastic catheter was connected to the FlexiVent system and mechanical ventilation was initiated at 130-140 breaths/min and 10 mL/kg tidal volume.
- Aeroneb ultrasonic nebulizer was primed with 18 F-labeled rhodamine 6G mitochondria (1 x 10 9 in 0.3 mL buffer) and the mitochondria were delivered using the following protocol: 10 s nebulization followed by 1 min of regular mechanical ventilation, repeated 6 times.
- mice Ten minutes after delivery of mitochondria, the animals were euthanized in a CO2 chamber and imaged by positron emission tomography (PET) and microcomputed tomography using an Albira Si SPECT/CT/PET System (Bruker Corporation, Billerica, MA).
- PET positron emission tomography
- Albira Si SPECT/CT/PET System Bruker Corporation, Billerica, MA.
- mice were anesthetized with intraperitoneal injection of sodium pentobarbital (100 mg/kg) and maintained during surgery on 0.5% inhaled isoflurane and were mechanically ventilated with tidal volume 10 mL/kg and respiratory rate 130-140 breaths/min. Left thoracotomy was performed in third intercostal space and the left pulmonary hilum was exposed.
- Transient ischemia of the left lung was induced by occluding the left hilum at the end of expiration for 2 h using a microvascular clamp (Roboz Surgical Instrument) and tidal volume was reduced to 7.5 mL/kg.
- human mitochondria were delivered either by vascular delivery or by delivery via nebulization.
- mice were ventilated with FlexiVent equipped with the Aeroneb ultrasonic nebulizer.
- Human mitochondria were delivered over 40 s using the following protocol: 10 s nebulization followed by 1 min of regular mechanical ventilation, repeated 4 times. After delivery of human mitochondria, animals were allowed to recover for 30 min, and left lung tissue was then harvested for further histological analysis.
- 18 F-Labeled rhodamine 6G radiolabeled mitochondria delivered either via vascular delivery (“Mito V”; FIG. 6A) or via nebulization (“Mito Neb”; FIG. 6C) were taken up diffusely by the lungs.
- 18 F -Rhodamine 6G radiolabeled mitochondria were not detected in any other region of the body.
- mitochondria isolated from human adult cardiac fibroblasts were used.
- the use of human mitochondria in a murine model allows identification of the transplanted mitochondria based on immuno-reactivity to a human-specific mitochondrial antibody.
- Exogenous mitochondria were isolated from human cardiac fibroblasts and delivered either via vascular delivery (“Mito V”; FIG. 6B) or via nebulization (“Mito Neb”; FIG. 6D).
- Analysis of mitochondrial uptake showed the majority of mitochondria based on signal intensity were globally distributed throughout the lung in Mito V and in Mito Neb (FIG. 6B and FIG. 6D).
- Immunohistochemical analysis showed that the transplanted mitochondria were detected in alveoli and in connective tissue in both Mito V and Mito Neb (FIG. 6B and FIG. 6D).
- the transplanted mitochondria were found throughout the lung tissue, demonstrating that mitochondria delivered by either infusion into pulmonary artery or by aerosol delivery via the trachea via nebulization were effectively taken up in the lung.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Developmental Biology & Embryology (AREA)
- Engineering & Computer Science (AREA)
- Virology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Inorganic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Abstract
The disclosure relates to therapeutic use of mitochondria to increase efficacy of chemotherapeutic agents.
Description
TREATING CANCER
CLAIM OF PRIORITY
This application claims the benefit of U.S. Provisional Application Serial No.
62/845,064, filed on May 8, 2019. The entire contents of the foregoing are incorporated herein by reference.
TECHNICAL FIELD
The disclosure relates to therapeutic use of mitochondria to increase efficacy of chemotherapeutic agents.
BACKGROUND
Mitochondria are double membrane-bound organelles found in the cytoplasm of nucleated eukaryotic cells. They are found in almost every cell of the human body except red blood cells. They are the cell's primary site of energy metabolism and generate adenosine triphosphate (ATP) for different cell functions. Typically, more than 90% of a cell's requirement for ATP is supplied by the cell’s own mitochondria.
Mitochondria are composed of two concentric membranes, which have specialized functions. The inner mitochondrial membrane contains proteins for ATP synthase. The outer mitochondrial membrane, which contains large numbers of integral membrane proteins, encloses the entire organelle.
The structure of mitochondria has striking similarities to some modem prokaryotes. In fact, mitochondria are thought to have originated from an ancient symbiosis when a nucleated cell engulfed an aerobic prokaryote. In the symbiosis relationship, the host cell came to rely on the engulfed prokaryote for energy production, and the prokaryote cell began to rely on the protective environment provided by the host cell.
SUMMARY
The disclosure relates to therapeutic use of mitochondria to increase efficacy of chemotherapeutic agents.
In one aspect, the disclosure provides methods for increasing efficacy of a
chemotherapeutic agent in a subject. The methods involve administering to a subject who is or
will be undergoing treatment with a chemotherapeutic agent and a therapeutically effective amount of a composition comprising mitochondria, to thereby increase the efficacy of the chemotherapeutic agent in the subject.
In some embodiments, the mitochondria are respiration-competent mitochondria. In some embodiments, the chemotherapeutic agent is administered to the subject before the composition comprising mitochondria is administered to the subject. In some embodiments, the
chemotherapeutic agent is administered to the subject after the composition comprising mitochondria is administered to the subject. In some embodiments, the chemotherapeutic agent and the composition comprising mitochondria are administered to the subject at about the same time. In some embodiments, the mitochondria are delivered via the organ-specific vasculature.
In some embodiments, the organ to which the mitochondria are delivered is the lung, liver, kidney, prostate, heart, breast, ovary or pancreas. In some embodiments, the mitochondria are delivered via nebulization
In some embodiments, the method increases the efficacy of the chemotherapeutic agent by at least 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds. In some embodiments, the therapeutically effective dose of the chemotherapeutic agent is at least 10% lower than an FDA-approved dose for the chemotherapeutic agent.
In some embodiments, the subject has cancer. In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is prostate cancer.
In some embodiments, the chemotherapeutic agent is cisplatin or docetaxel.
In some embodiments, lxlO5 to lxlO9 of mitochondria is administered to the subject.
In some embodiments, about lxlO3, lxl043, lxlO5, lxlO6, lxlO7, lxlO8, lxlO9, lxlO10, lxlO11, lxlO12, or lxlO13 of mitochondria is administered to the subject
In some embodiments, the composition comprising mitochondria is administered to the subject by injection, through the subject’s respiratory tract, or through a blood vessel of the subject.
In some embodiments, the mitochondria are autogenic, allogeneic, or xenogeneic.
In some embodiments, the composition further comprises a pharmaceutically acceptable diluent, excipient, or carrier.
In some embodiments, the mitochondria are genetically modified. In some embodiments, the mitochondria comprise exogenous polypeptide. In some embodiments, the mitochondria
comprise exogenous polynucleotide. In some embodiments, the mitochondria prior to administration to the subject are incubated with a composition comprising an enzyme.
In one aspect, the disclosure provides methods for administering a chemotherapeutic agent to a subject. The methods involve:
(a) administering to the subject a therapeutically effective amount of a composition comprising mitochondria; and
(b) before, during, or after (a), administering to the subject at least one dose of a chemotherapeutic agent
In some embodiments, the chemotherapeutic agent is administered to the subject before the composition comprising mitochondria is administered to the subject. In some embodiments, the chemotherapeutic agent is administered to the subject after the composition comprising mitochondria is administered to the subject. In some embodiments, the chemotherapeutic agent is administered to the subject during administration of the composition comprising mitochondria.
In some embodiments, the dose is at least 10% lower than an FDA-approved dose for the chemotherapeutic agent. In some embodiments, the dose is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% lower than the FDA-approved dose for the chemotherapeutic agent .
In some embodiments, the subject has cancer. In some embodiments, the cancer is prostate cancer.
In some embodiments, the chemotherapeutic agent is cisplatin, or docetaxel.
In some embodiments, lxlO5 to lxlO9 of mitochondria is administered to the subject.
In some embodiments, the composition comprising mitochondria is administered to the subject by injection, through the subject’s respiratory tract, or through a blood vessel in the subject.
In some embodiments, the mitochondria are autogenic, allogeneic, or xenogeneic. In some embodiments, the mitochondria are genetically modified. In some embodiments, the mitochondria comprise exogenous polypeptide. In some embodiments, the mitochondria comprise exogenous polynucleotide.
In one aspect, the disclosure provides a composition comprising a therapeutically effective amount of mitochondria, and a therapeutically effective amount of a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent is not linked to the mitochondria.
In some embodiments, the chemotherapeutic agent is cisplatin, or docetaxel.
In some embodiments of any of the methods described herein, the composition comprises lxlO5 to lxlO9 or about lxlO3, lxl043, lxlO5, lxlO6, lxlO7, lxlO8, lxlO9, lxlO10, lxlO11, lxlO12, or lxlO13 of mitochondria.
In some embodiments, the mitochondria are autogenic, allogeneic, or xenogeneic. In some embodiments, the mitochondria are genetically modified. In some embodiments, the mitochondria comprise exogenous polypeptide. In some embodiments, the mitochondria comprise exogenous polynucleotide.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1A is a 3D SR-SIM microscopy image of a DU145 cell showing DU145 mitochondria following incubation with red fluorescent protein (RFP) labelled HCF
mitochondria.
FIG. IB is a 3D SR-SIM microscopy image of a DU145 cell showing HCF
mitochondria.
FIG. 1C is a 3D SR-SIM microscopy images of a DU145 cell showing DAPI-stained nucleus following incubation with red fluorescent protein (RFP) labelled HCF mitochondria.
FIG. ID is a 3D SR-SIM microscopy images of a DU145 cell showing overlay of DU145 mitochondria, HCF mitochondria, and DAPI-stained nucleus following incubation with red fluorescent protein (RFP) labelled HCF mitochondria.
FIG. 2A is a line graph showing cell growth results measured by MTT-assay for DU145 cells incubated with lxlO7 exogenous mitochondria.
FIG. 2B is a line graph showing cell growth results measured by MTT-assay for PC3 cells incubated with lxlO7 exogenous mitochondria.
FIG. 3A is a bar graph showing total ATP content measured by ATPlite luminescence ATP Detection Assay for DU145 cells incubated with various amounts of exogenous
mitochondria.
FIG. 3B is a bar graph showing total ATP content measured by ATPlite luminescence ATP Detection Assay for PC3 cells incubated with various amounts of exogenous mitochondria.
FIG. 4A are bar graphs depicting the ratio of dead to live cells measured by LIVE/DEAD Viability/Cytotoxicity Kit for DU 145 cells incubated with either exogenous mitochondria, cisplatin, or the combination of exogenous mitochondria and cisplatin.
FIG. 4B are bar graphs depicting the ratio of dead to live cells measured by LIVE/DEAD Viability/Cytotoxicity Kit for PC3 cells incubated with either exogenous mitochondria, cisplatin, or the combination of exogenous mitochondria and cisplatin.
FIG. 5 is a representative graph depicting fluorescence-activated cell sorting (FACs) analysis of PC3 cells transfected with lentivirus CMV-GFP-Luc; 69.9% (denoted by black outlined region) of PC3 cells were GFP positive.
FIG. 6A shows mitochondrial biodistribution and tissue uptake after vascular delivery into the lungs. PET-microcomputed tomography imaging of 18F-labeled rhodamine 6G-labeled mitochondria (1 x 109, red) delivered to the lungs of Wistar male rats receiving mitochondria via the pulmonary artery. 18F-labeled rhodamine 6G mitochondria were injected to the lungs as a bolus antegrade via the pulmonary trunk using a tuberculin syringe with a 30-gauge needle. Labeled mitochondria (red signal on the imaging) were detected only in the lungs; radiolabeled mitochondria were not detectable in any other organ or region of the body
FIG. 6B is an immunohistochemical image (xlOO) of human mitochondria delivered to the lungs of C57BL/6J male mice at the beginning of reperfusion following 2 h of ischemia that shows mitochondrial biodistribution and tissue uptake after vascular delivery into the lungs in mice receiving human mitochondria via the pulmonary artery; human mitochondria were injected to the lung as a bolus antegrade via the left pulmonary artery using a tuberculin syringe with a 40-gauge needle. Human mitochondria were detected using monoclonal anti-human mitochondrial antibody and visualized using Vectastain and AEC+ substrate chromogen. Human mitochondria indicated by black arrows were globally distributed throughout the lung and
detected within and around lung alveoli (a) and connective tissue. pCT, microcomputed tomography.
FIG. 6C shows mitochondrial biodistribution and tissue uptake via nebulization. PET- microcomputed tomography imaging of 18F-labeled rhodamine 6G-labeled mitochondria (l x 109, red) delivered to the lungs of Wistar male rats receiving mitochondria via nebulization. 18F- labeled rhodamine 6G labeled mitochondria were delivered as an aerosol to the lungs via the trachea via nebulization using the Aeroneb ultrasonic nebulizer connected to the FlexVent system. Wistar rats were allowed to recover for 10 min after mitochondrial delivery and were then euthanized in a CO2 chamber before imaging. Labeled mitochondria (red signal on the imaging) were detected only in the lungs; radiolabeled mitochondria were not detectable in any other organ or region of the body.
FIG. 6D is an immunohistochemical image (xlOO) of human mitochondria delivered to the lungs of C57BL/6J male mice at the beginning of reperfusion following 2 h of ischemia that shows mitochondrial biodistribution and tissue uptake in mice receiving human mitochondria via nebulization; human mitochondria were delivered as an aerosol to the lungs via the trachea via nebulization using the Aeroneb ultrasonic nebulizer connected to the FlexVent system.
C57BL/6J mice were allowed to recover for 30 min after mitochondrial delivery. Left lung tissue was then harvested for further immnohistological staining. Human mitochondria were detected using monoclonal anti-human mitochondrial antibody and visualized using Vectastain and AEC+ substrate chromogen. Human mitochondria indicated by black arrows were globally distributed throughout the lung and detected within and around lung alveoli (a) and connective tissue. pCT, microcomputed tomography.
DETAILED DESCRIPTION
Cancer is a group of diseases involving abnormal cell growth with the potential to invade or spread to other parts of the body. It is the second leading cause of death globally, and is responsible for an estimated 9.6 million deaths in 2018. Globally, about 1 in 6 deaths is due to cancer.
Currently available treatments for cancer involve surgery, radiation therapy, hormonal therapy (androgen ablation) or chemotherapy. However, cancer cells often develop the ability to become resistant to chemotherapy, there is still no efficient cure for this type of disease especially in the later metastatic stages.
Previous studies have demonstrated that cancer cells have a high rate of aerobic glycolysis. This phenomenon is unique to cancer cells and is termed the“Warburg effect”. In normal cells glucose is converted to high energy phosphate (ATP) with most of the energy requirements of the cell being derived through the electron transport chain and oxidative phosphorylation a process requiring oxygen. The cancer cell converts glucose to lactic acid and downregulates mitochondrial oxidative phosphorylation despite the presence of oxygen.
Aerobic glycolysis is a hallmark of cancer and is present in nearly all invasive human cancers and persists even under normoxic conditions and is correlated with tumor
aggressiveness. These data suggest that mitochondrial dysfunction may confer a significant proliferative advantage during somatic evolution of cancer and that this glycolytic phenotype can be a crucial component of the malignant phenotype.
Furthermore, mitochondrial dysregulation is present in human tumors and that mitochondrial oxidative stress actively promotes tumor progression and increases the metastatic potential of cancer cells and significantly decreases sensitivity to chemotherapy. This suggests that targeting the mitochondria can provide a promising strategy for the development of anticancer therapy and that restoration of mitochondrial function to optimal levels can enhance sensitivity to anticancer agents for the treatment of aggressive tumors.
The present disclosure provides a therapy based on mitochondrial transplantation. In one aspect, this approach uses replacement of native mitochondria with viable, respiration-competent mitochondria isolated from non-ischemic tissue (e.g., autologous tissue) to overcome the many deleterious effects of various disorders on native mitochondria. Mitochondrial transplantation is a revolutionary strategy that has been clinically demonstrated to enhance tissue ATP content and mitochondrial oxidative phosphorylation. In some embodiments, healthy mitochondria can be harvested from non-ischemic skeletal muscle in the patient’s own body and are then transplanted into the tissue, where they restore normal cellular energetics. Autologous mitochondria are harvested with minimal processing in a procedure that requires a short time period (e.g., less than 30 min) and can be completed in the surgical suite.
The mitochondrial transplantation can replace or augment the endogenous dysfunctional or damaged mitochondria in cancer cells and enhance the therapeutic efficacy of cancer chemotherapy.
The ability to use autologous mitochondrial transplantation to treat prostate and lung cancer will significantly alter the current treatment protocols and significantly improve survival and significantly decrease morbidity. The present disclosure provides in vitro and in vivo studies to demonstrate the efficacy of mitochondrial transplantation for use in the treatment of cancer. It also shows possibility of the localized delivery of mitochondria into the target organ, e.g. lungs, either via the organ-specific vasculature or through aerosol delivery (nebulization).
Treatment of Cancer
The methods described herein include methods for the treatment of cancers. Generally, the methods include administering a therapeutically effective amount of mitochondria and one or more anti-cancer drugs (e.g., chemotherapeutic agents), to a subject who is in need of, or who has been determined to be in need of, such treatment.
As used in this context, to“treat” means to ameliorate at least one symptom of the disorder associated with cancer. Often, cancer is associated with abnormal cell growth with the potential to invade or spread to other parts of the body. Thus, in some embodiments, a treatment can result in death of cancer cells, an inhibition in cell growth or reduce the potential to invade or spread to other parts of the body.
In some embodiments, mitochondria and the anti-cancer drugs (e.g., chemotherapeutic agents) can be administered separately. The mitochondria can be delivered to the cancer by direct injection, by intra-arterial delivery, by intra vascular delivery, or by aerosol delivery. The viable respiration-competent mitochondria can replace or augment the endogenous dysfunctional or damaged mitochondria in cancer cells and enhance the therapeutic efficacy of cancer chemotherapy.
In some embodiments, mitochondria can be also used as carriers for the anti-cancer drugs (e.g., chemotherapeutic agents). Cancer cells and tumor cells need a dedicated blood supply to provide the oxygen and other essential nutrients in order to grow beyond a certain size. They often induce blood vessel growth (angiogenesis) by secreting various growth factors (e.g., VEGF). Unlike normal blood vessels, tumor blood vessels are dilated with an irregular shape and have more delicate vasculatures. As mitochondria with therapeutic agents crosses the endothelium of the blood vessels, the extensive structure in tumor blood vessels provides a natural target site for drug delivery. After combined mitochondria agents (e.g., with or without
anti-cancer drugs) are injected directly into the cancer or into a blood vessel (e.g., by intra arterial delivery or intra-vascular delivery) or administered to the subject by aerosol delivery, they can be delivered to and taken up by tumor tissues. In some embodiments, a cytostatic agent or cytotoxic agent can be delivered to the tumor to kill cancer cells.
The term "cancer" refers to cells having the capacity for autonomous growth. Examples of such cells include cells having an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include cancerous growths, e.g., tumors;
oncogenic processes, metastatic tissues, and malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. Also included are malignancies of the various organ systems, such as respiratory, cardiovascular, renal, reproductive,
hematological, neurological, hepatic, gastrointestinal, and endocrine systems; as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine, and cancer of the esophagus. Cancer that is "naturally arising" includes any cancer that is not experimentally induced by implantation of cancer cells into a subject, and includes, for example, spontaneously arising cancer, cancer caused by exposure of a patient to a carcinogen(s), cancer resulting from insertion of a transgenic oncogene or knockout of a tumor suppressor gene, and cancer caused by infections, e.g., viral infections. The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues. The term also includes carcinosarcomas, which include malignant tumors composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term "sarcoma" is art recognized and refers to malignant tumors of mesenchymal derivation. The term "hematopoietic neoplastic disorders" includes diseases involving hyperplastic/neoplastic cells of hematopoietic origin. A hematopoietic neoplastic disorder can arise from myeloid, lymphoid or erythroid lineages, or precursor cells thereof.
In some embodiments, cancers that can be treated using the methods and/or compositions as described herein include, for example, cancers of the stomach, colon, rectum, mouth/pharynx, esophagus, larynx, liver, pancreas, lung, breast, cervix uteri, corpus uteri, ovary, prostate, testis, bladder, skin, bone, kidney, head, neck, and throat, Hodgkins disease, non-Hodgkins leukemia, sarcomas, choriocarcinoma, lymphoma, brain/central nervous system, and neuroblastoma (e.g.,
pediatric neuroblastoma), among others. In one particularly useful embodiment, the described methods can be used to treat pediatric neuroblastoma and prostate cancer.
In some embodiments, the cancers are resistant to the anti-cancer drug (e.g., a
chemotherapeutic agent). In some embodiments, the cancers are not resistant to the anti-cancer drug (e.g., a chemotherapeutic agent).
Furthermore, an antibody or an antigen-binding fragment can be linked or attached to mitochondria. Skilled practitioners will appreciate that linking the antibody or antigen binding fragment to mitochondria or combined mitochondrial agents can allow the mitochondria or combined mitochondrial agents to target specific sites, e.g., to target cells and/or tissues. In some instances, the antibody or the antigen-binding fragment are designed to target specific cell types, for example, cancer cells.
In some embodiments, the anti-cancer drug is a cytostatic agent or cytotoxic agent. In some embodiments, the anti-cancer drug is a chemotherapeutic agent.
In some embodiments, the one or more anti-cancer drugs (e.g., chemotherapeutic agents) can comprise one or more inhibitors selected from the group consisting of an inhibitor of B-Raf, an EGFR inhibitor, an inhibitor of a MEK, an inhibitor of ERK, an inhibitor of K-Ras, an inhibitor of c-Met, an inhibitor of anaplastic lymphoma kinase (ALK), an inhibitor of a phosphatidylinositol 3-kinase (PI3K), an inhibitor of an Akt, an inhibitor of mTOR, a dual PI3K/mTOR inhibitor, an inhibitor of Bruton's tyrosine kinase (BTK), and an inhibitor of Isocitrate dehydrogenase 1 (IDH1) and/or Isocitrate dehydrogenase 2 (IDH2). In some embodiments, the anti-cancer drug is an inhibitor of indoleamine 2,3 -di oxygenase- 1) (IDOl) (e.g., epacadostat).
In some embodiments, the anti-cancer drug is Abemaciclib, Abiraterone Acetate, Abraxane , Acalabrutinib, Actemra (Tocilizumab), Adcetris (Brentuximab Vedotin), Ado- Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Afatinib Dimaleate, Afmitor (Everolimus), Akynzeo (Netupitant and Palonosetron Hydrochloride), Aldara (Imiquimod), Aldesleukin, Alecensa (Alectinib), Alectinib, Alemtuzumab, Alimta (Pemetrexed Disodium), Aliqopa (Copanlisib Hydrochloride), Alkeran , Aloxi (Palonosetron Hydrochloride), Alunbrig (Brigatinib), Ameluz (Aminolevulinic Acid Hydrochloride), Amifostine, Aminolevulinic Acid Hydrochloride, Anastrozole, Apalutamide, Aprepitant, Aranesp (Darbepoetin Alfa), Aredia (Pamidronate Disodium), Arimidex (Anastrozole), Aromasin (Exemestane), Arranon
(Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Asparlas (Calaspargase Pegol-mknl), Atezolizumab, Avastin (Bevacizumab), Avelumab, Axicabtagene Ciloleucel, Axitinib, Azacitidine, Azedra (Iobenguane I 131), Bavencio
(Avelumab), Beleodaq (Belinostat), Belinostat, Bendamustine Hydrochloride, Bendeka
(Bendamustine Hydrochloride), Besponsa (Inotuzumab Ozogamicin), Bevacizumab, Bexarotene, Bicalutamide, BiCNU (Carmustine), Binimetinib, Bleomycin Sulfate, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Braftovi (Encorafenib),
Brentuximab Vedotin, Brigatinib, BuMel, Busulfan, Busulfex (Busulfan), Cabazitaxel, Cablivi (Caplacizumab-yhdp), Cabometyx (Cabozantinib-S-Malate), Cabozantinib-S-Malate,
Calaspargase Pegol-mknl, Calquence (Acalabrutinib), Campath (Alemtuzumab), Camptosar (Irinotecan Hydrochloride), Capecitabine, Caplacizumab-yhdp, Carac (Fluorouracil— Topical), Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Carmustine, Carmustine Implant, Casodex (Bicalutamide), Cemiplimab-rwlc, Ceritinib, Cerubidine (Daunorubicin Hydrochloride),
Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, Chlorambucil, CHLORAMBUCIL- PREDNISONE, Cisplatin, Cladribine, Clofarabine, Clolar (Clofarabine), Cobimetinib, Cometriq (Cabozantinib-S-Malate), Copanlisib Hydrochloride, Copiktra (Duvelisib), Cosmegen
(Dactinomycin), Cotellic (Cobimetinib), Crizotinib, Cyclophosphamide, Cyramza
(Ramucirumab), Cytarabine, Cytarabine Liposome, Cytosar-U (Cytarabine), Dabrafenib, Dacarbazine, Dacogen (Decitabine), Dacomitinib, Dactinomycin, Daratumumab, Darbepoetin Alfa, Darzalex (Daratumumab), Dasatinib, Daunorubicin Hydrochloride, Daunorubicin
Hydrochloride and Cytarabine Liposome, Daurismo (Glasdegib Maleate), Decitabine,
Defibrotide Sodium, Defitelio (Defibrotide Sodium), Degarelix, Denileukin Diftitox,
Denosumab, DepoCyt (Cytarabine Liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin
Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), Durvalumab, Duvelisib, Efudex (Fluorouracil— Topical), Eligard (Leuprolide Acetate), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Elotuzumab, Eloxatin (Oxaliplatin), Eltrombopag Olamine, Elzonris (Tagraxofusp-erzs), Emapalumab-lzsg, Emend (Aprepitant), Empliciti (Elotuzumab), Enasidenib Mesylate, Encorafenib, Enzalutamide, Epirubicin Hydrochloride, Epoetin Alfa, Epogen (Epoetin Alfa), Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erleada (Apalutamide), Erlotinib Hydrochloride, Erwinaze
(Asparaginase Erwinia chrysanthemi), Ethyol (Amifostine), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista (Raloxifene Hydrochloride), Evomela (Melphalan Hydrochloride), Exemestane, 5-FU (Fluorouracil), Fareston (Toremifene), Farydak (Panobinostat), Faslodex (Fulvestrant), Femara (Letrozole), Filgrastim, Firmagon (Degarelix), Fludarabine Phosphate, Fluoroplex (Fluorouracil- -Topical), Fluorouracil Injection, Fluorouracil— Topical, Flutamide, Folotyn (Pralatrexate), Fostamatinib Disodium, Fulvestrant, Fusilev (Leucovorin Calcium), Gamifant (Emapalumab- lzsg), Gardasil (Recombinant HPV Quadrivalent Vaccine), Gardasil 9 (Recombinant HPV Nonavalent Vaccine), Gazyva (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride,
GEMCITABINE-CISPLATIN, GEMCITABINE-OXALIPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gilteritinib Fumarate, Glasdegib Maleate, Gleevec (Imatinib Mesylate), Gliadel Wafer (Carmustine Implant),
Glucarpidase, Goserelin Acetate, Granisetron, Granisetron Hydrochloride, Granix (Filgrastim), Halaven (Eribulin Mesylate), Hemangeol (Propranolol Hydrochloride), Herceptin Hylecta (Trastuzumab and Hyaluronidase-oysk), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine,
Recombinant, Hycamtin (Topotecan Hydrochloride), Hydrea (Hydroxyurea), Hydroxyurea, Hyper-CVAD, Ibrance (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, Iclusig (Ponatinib Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Idhifa (Enasidenib Mesylate), Ifex (Ifosfamide), Ifosfamide, IL-2 (Aldesleukin), Imatinib Mesylate, Imbruvica (Ibrutinib), Imfinzi (Durvalumab), Imiquimod, Imlygic (Talimogene Laherparepvec), Inlyta (Axitinib), Inotuzumab Ozogamicin, Interferon Alfa-2b, Recombinant, Interleukin-2 (Aldesleukin), Intron A
(Recombinant Interferon Alfa-2b), Iobenguane I 131, Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Irinotecan Hydrochloride Liposome, Istodax (Romidepsin), Ivosidenib,
Ixabepilone, Ixazomib Citrate, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), Jevtana (Cabazitaxel), Kadcyla (Ado-Trastuzumab Emtansine), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kisqali (Ribociclib), Kymriah (Tisagenlecleucel), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Larotrectinib Sulfate, Lartruvo (Olaratumab),
Lenalidomide, Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Levulan Kerastik (Aminolevulinic Acid Hydrochloride), Libtayo (Cemiplimab-rwlc), LipoDox (Doxorubicin Hydrochloride Liposome),
Lomustine, Lonsurf (Trifluridine and Tipiracil Hydrochloride), Lorbrena (Lorlatinib), Lorlatinib, Lumoxiti (Moxetumomab Pasudotox-tdfk), Lupron (Leuprolide Acetate), Lupron Depot
(Leuprolide Acetate), Lutathera (Lutetium Lu 177-Dotatate), Lutetium (Lu 177-Dotatate), Lynparza (Olaparib), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine
Hydrochloride), Mechlorethamine Hydrochloride, Megestrol Acetate, Mekinist (Trametinib), Mektovi (Binimetinib), Melphalan, Melphalan Hydrochloride, Mercaptopurine, Mesna, Mesnex (Mesna), Methotrexate, Methylnaltrexone Bromide, Midostaurin, Mitomycin C, Mitoxantrone Hydrochloride, Mogamulizumab-kpkc, Moxetumomab Pasudotox-tdfk, Mozobil (Plerixafor), Mustargen (Mechlorethamine Hydrochloride), Myleran (Busulfan), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Necitumumab, Nelarabine, Neratinib Maleate, Nerlynx (Neratinib Maleate), Netupitant and Palonosetron Hydrochloride, Neulasta (Pegfilgrastim), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilandron (Nilutamide), Nilotinib, Nilutamide, Ninlaro (Ixazomib Citrate), Niraparib Tosylate Monohydrate, Nivolumab, Nplate (Romiplostim), Obinutuzumab, Odomzo (Sonidegib), Ofatumumab, Olaparib, Olaratumab, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ondansetron Hydrochloride, Onivyde (Irinotecan Hydrochloride Liposome), Ontak (Denileukin Diftitox), Opdivo (Nivolumab), Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, Palbociclib, Palifermin, Palonosetron Hydrochloride, Palonosetron Hydrochloride and
Netupitant, Pamidronate Disodium, Panitumumab, Panobinostat, Pazopanib Hydrochloride, Pegaspargase, Pegfilgrastim, Peginterferon Alfa-2b, PEG-Intron (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Plerixafor,
Pomalidomide, Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Portrazza (Necitumumab), Poteligeo (Mogamulizumab-kpkc), Pralatrexate, Prednisone, Procarbazine Hydrochloride,
Procrit (Epoetin Alfa), Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Propranolol Hydrochloride, Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, Ravulizumab-cwvz, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human
Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, Relistor (Methylnaltrexone Bromide), Retacrit (Epoetin Alfa), Revlimid (Lenalidomide),
Rheumatrex (Methotrexate), Ribociclib, Rituxan (Rituximab), Rituxan Hycela (Rituximab and Hyaluronidase Human), Rituximab, Rituximab and Hyaluronidase Human, Rolapitant
Hydrochloride, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Rubraca (Rucaparib Camsylate), Rucaparib Camsylate, Ruxolitinib Phosphate, Rydapt
(Midostaurin), Sancuso (Granisetron), Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, Somatuline Depot (Lanreotide Acetate), Sonidegib, Sorafenib Tosylate, Spry cel (Dasatinib), Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sustol (Granisetron), Sutent (Sunitinib Malate), Sylatron (Peginterferon Alfa-2b), Sylvant (Siltuximab), Synribo (Omacetaxine Mepesuccinate), Tabloid (Thioguanine), Tafmlar (Dabrafenib), Tagraxofusp-erzs, Tagrisso (Osimertinib), Talazoparib Tosylate, Talimogene Laherparepvec, Talzenna (Talazoparib Tosylate), Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Tavalisse (Fostamatinib Disodium), Taxol (Paclitaxel), Taxotere (Docetaxel), Tecentriq (Atezolizumab), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid
(Thalidomide), Thioguanine, Thiotepa, Tibsovo (Ivosidenib), Tisagenlecleucel, Tocilizumab, Tolak (Fluorouracil— Topical), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Totect (Dexrazoxane Hydrochloride), Trabectedin, Trametinib, Trastuzumab, Trastuzumab and Hyaluronidase-oysk, Treanda (Bendamustine Hydrochloride), Trexall (Methotrexate),
Trifluridine and Tipiracil Hydrochloride, Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Ultomiris (Ravulizumab-cwvz), Unituxin (Dinutuximab), Uridine Triacetate, Valrubicin, Valstar (Valrubicin), Vandetanib, VAMP, Varubi (Rolapitant Hydrochloride), Vectibix (Panitumumab), VelP, Velcade (Bortezomib), Vemurafenib, Venclexta (Venetoclax), Venetoclax, Verzenio (Abemaciclib), Vidaza (Azacitidine), Vinblastine Sulfate, Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, Vismodegib, Vistogard (Uridine Triacetate), Vitrakvi (Larotrectinib Sulfate), Vizimpro (Dacomitinib), Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Vyxeos (Daunorubicin Hydrochloride and Cytarabine Liposome), Xalkori (Crizotinib), Xeloda (Capecitabine), Xgeva (Denosumab),
Xofigo (Radium 223 Dichloride), Xospata (Gilteritinib Fumarate), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Yescarta (Axicabtagene Ciloleucel), Yondelis (Trabectedin), Zaltrap (Ziv- Aflibercept), Zarxio (Filgrastim), Zejula (Niraparib Tosylate Monohydrate), Zelboraf
(Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-
Aflibercept, Zofran (Ondansetron Hydrochloride), Zoladex (Goserelin Acetate), Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), Zydelig (Idelalisib), Zykadia (Ceritinib), or Zytiga (Abiraterone Acetate). Many of these anti-cancer drugs, including their dosage information, are described on the National Cancer Institute website, which is incorporated by reference in their entirety.
In some embodiments, the chemotherapeutic agent is 5-fluorouracil, bleomycin, capecitabine, cisplatin, cyclophosphamide, dacarbazine, doxorubicin, etoposide, folinic acid, methotrexate, oxaliplatin, prednisolone, procarbazine, vinblastine, vinorelbine, docetaxel, epirubicin, or mustine.
In some embodiments, the method as described herein can increase the efficacy of the anti-cancer drug by at least 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds (e.g., as compared to the efficacy when only the anti-cancer drug is administered to the subject at the same dose). Because the efficacy of the anti-cancer drug has been improved, in some
embodiments, the therapeutically effective dose of the anti-cancer drug (e.g., chemotherapeutic agent) is about or at least 10%, 20%, 30%, 40%, or 50% lower than a typical dose (e.g., an FDA- approved dose) for the anti-cancer drug, thereby minimizing side effects. In addition, because the efficacy of the anti-cancer drug has been improved, in some embodiments, the therapeutically effective dose of the anti-cancer drug can be administered to the subject less frequently. For example, during a treatment period, the interval between administrations can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds than the administration interval in an FDA-approved treatment plan for the anti-cancer drug. In some embodiments, the total number of administrations can be reduced in a treatment period. For example, the total number of administrations can be reduced by about or at least 10%, 20%, 30%, 40%, or 50%. In some embodiments, because of the improved efficacy, the length of the treatment period can be shortened, e.g., by about or at least 10%, 20%, 30%, 40%, or 50% than the length of an FDA-approved treatment plan.
For example, a FDA approved drug regimen for hormone-refractory metastatic prostate cancer includes docetaxel (Taxotere®) injection 75 mg/m2 every 3 weeks as a 1 hour intravenous infusion and prednisone 5 mg orally twice daily. When docetaxel is administered to the patient in combination with mitochondria, the dosage of docetaxel 75 mg/m2 can be reduced by at least 10%, 20%, 30%, 40%, or 50%. In addition, the frequency of administration (e.g., every 3 weeks)
can be reduced. The interval between administrations (e.g., 3 weeks) can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
As a second example, a FDA approved drug regimen for metastatic testicular tumors, metastatic ovarian tumors, and advanced bladder cancer includes cisplatin injection 20 mg/m2 daily for 5 days per cycle, 75 to 100 mg/m2 per cycle once every four weeks, and 100 mg/m2 per cycle once every four weeks, respectively. When cisplatin is administered to the patient in combination with mitochondria, the dosage of cisplatin (e.g., 20 mg/m2 for metastatic testicular tumors, 75 to 100 mg/m2 for metastatic ovarian tumors, or 100 mg/m2 for advanced bladder cancer) can be reduced by at least 10%, 20%, 30%, 40%, or 50%. In addition, the frequency of administration per cycle can be reduced. The interval between administrations (e.g., 5 days, or four weeks) can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
As a third example, a Phase 2 clinical trail (NCT00658697) was conducted to test efficacy of a drug regimen for prostate cancer, wherein the drug regimen comprised: docetaxel (Taxotere®) intravenously given at 75 mg/m2 on day 1 of every 3 weeks for 4 cycles;
bevacizumab intravenously given at (15 mg/kg) on day 1 of every 3 weeks for 8 cycles; ADT or Luteinizing hormone-releasing hormone agonist (LHRH) either subcutaneously or
intramuscularly every three months for a total of 6 doses (total of 18 months); oral bicalutamide on day 84 once daily (after completing docetaxel, at 3 month) at dose of 50 mg for a total 15 months (4-18 months). When this drug regimen is administered to the patient in combination with mitochondria, the dosage of the therapeutic agents (e.g., 15 mg/kg of bevacizumab) can be reduced by at least 10%, 20%, 30%, 40%, or 50%. In addition, the frequency of administration of therapeutic agents (e.g., every 3 weeks) can be reduced. The interval between administrations of therapeutic agents (e.g., 3 weeks) can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
As a fourth example, a clinical trial (NCT00089609) was conducted to test efficacy of a drug regimen for prostate cancer, wherein the drug regimen comprised: docetaxel (Taxotere®) 75 mg/m2 intravenously over 60 minutes on cycle 1 day 1 repeated every 21 days; thalidomide 200 mg by mouth daily throughout the cycle; prednisone 10 mg by mouth daily throughout the cycle; and bevacizumab 15 mg/kg intravenously on cycle 1 day 1 every 21 days. When the drug regimen is administered to the patient in combination with mitochondria, the dosage of
therapeutic agents (e.g., thalidomide 200 mg) can be reduced by at least 10%, 20%, 30%, 40%, or 50%. In addition, the frequency of administration of thalidomide can be reduced.
As a fifth example, a FDA approved drug regimen for castration-resistant prostate cancer includes 160 mg (four 40 mg capsules) enzalutamide (XTANDI®) administered orally once daily. When the drug is administered to the patient in combination with mitochondria, the dosage of therapeutic agents (e.g., enzalutamide 160 mg) can be reduced by at least 10%, 20%, 30%, 40%, or 50%. In addition, the frequency of administration (e.g., once daily) can be reduced. The interval between administrations (e.g., once daily) can be increased to at least or about 2, 3, 4, or 5 days.
As a sixth example, a FDA approved drug regimen for castration resistant prostate cancer includes 55 kBq (1.49 microcurie) of Radium 223 Dichloride (XOFIGO®)per kg body weight, given at 4 week intervals for 6 injections. When radiotherapy is administered to the patient in combination with mitochondria, the dosage of radiotherapy (e.g., 55 kBq (1.49 microcurie) of Radium 223 Dichloride (XOFIGO®) per kg body weight) can be reduced by at least 10%, 20%, 30%, 40%, or 50%. In addition, the frequency of administration (e.g., every 4 weeks) can be reduced. The interval between administrations (e.g., 4 weeks) can be increased by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
In some embodiments, the subject is also treated by surgery and/or radiotherapy.
Isolating mitochondria
Mitochondria for use in the presently described methods can be isolated or provided from any source, e.g., isolated from cultured cells or tissues. Exemplary cells include, but are not limited to, muscle tissue cells, cardiac fibroblasts, cultured cells, HeLa cells, prostate cancer cells, yeast, blood cells, cultured cells, and among others, and any mixture thereof. Exemplary tissues include, but are not limited to, liver tissue, skeletal muscle, heart, brain, blood, and adipose tissue (e.g., brown adipose tissue). Mitochondria can be isolated from cells of an autogenous source, an allogeneic source, and/or a xenogeneic source. In some instances, mitochondria are isolated from cells with a genetic modification, e.g., cells with modified mtDNA or modified nuclear DNA.
Mitochondria can be isolated from cells or tissues by methods known to those of skill in the art. In some embodiments, tissue samples or cell samples are collected and then
homogenized. Following homogenization, mitochondria are isolated by repetitive centrifugation. Alternatively, the cell homogenate can be filtered through nylon mesh filters. Typical methods of isolating mitochondria are described, for example, in McCully et al., Injection of isolated mitochondria during early reperfusion for cardioprotection, Am J Physiol 296, H94-H105.
PMC2637784 (2009); Frezza et al., Organelle isolation: functional mitochondria from mouse liver, muscle and cultured fibroblasts. Nature protocols, 2(2), 287-295 (2007); US20180057610; and US20180057610A1; each of which is incorporated by reference.
The mitochondria for the treatment can be isolated from cells or tissues of an autogenous source, an allogeneic source, and a xenogeneic source. In some instances, mitochondria are collected from cultured cells or tissues of a subject, and these mitochondria are administered back to the same subject. In some other cases, mitochondria are collected from cultured cells or tissues of a second subject, and these mitochondria are administered to a first subject. In some cases, mitochondria are collected from cultured cells or tissues from a different species (e.g., mice, swine, yeast).
The present disclosure also provides a composition comprising combined mitochondrial agent. The combined mitochondrial agents include e.g., mitochondria that are physically associated with an agent, such as a therapeutic agent, a diagnostic agent, and/or an imaging agent.
A therapeutic agent can be any agent that has a therapeutic or prophylactic use.
Exemplary therapeutic agents include, e.g., cytotoxic agents for treating cancer. In some instances, mitochondria can deliver therapeutic agents to specific cells, for example, tumor cells. The therapeutic agent may be, e.g., an intracellular inhibitor, deactivator, toxin, arresting substance and/or cytostatic/cytotoxic substance that, once inside a cell, inhibits, destroys, arrests, modifies and/or alters the cell such that it can no longer function normally and/or survive. The therapeutic agent can be an agent to restore a cell’s proper function, for example, a DNA vector for gene therapy. A therapeutic agent can be, e.g., an inorganic or organic compound; a small molecule (less than 500 daltons) or a large molecule; a proteinaceous molecule, such as a peptide, polypeptide, protein, post-translationally modified protein, or antibody; or a nucleic acid molecule, such as a double-stranded DNA, single-stranded DNA, double-stranded RNA, single- stranded RNA, or a triple helix nucleic acid molecule. In some embodiments, a therapeutic agent can be a natural product derived from any known organism (e.g., from an animal, plant,
bacterium, fungus, protist, or virus) or from a library of synthetic molecules. In some embodiments, a therapeutic agent can be a monomeric or a polymeric compound. Some exemplary therapeutic agents include cytotoxic agents, DNA vectors, small interfering RNAs (siRNA), micro RNAs (miRNA), reactive peptides, nanoparticles, microspheres, and fluorescent molecules.
A diagnostic agent is an agent that has diagnostic use. As mitochondria carry a diagnostic agent into a cell, in some embodiments, the diagnostic agent can be designed to determine the condition within a cell, for example pH and oxidative stress within a cell.
An imaging agent is an agent that is employed for use in imaging techniques. The techniques or modalities include, but are not limited to, X-rays, computed tomography (CT), magnetic resonance imaging (MRI), scintigraphy, fluorescence, ultrasound, etc. The imaging agent can be florescent and/or radioactive. In some embodiments, an imaging agent can also be a diagnostic agent. Exemplary imaging agents include, but are not limited to, MitoTracker fluorophores (Thermo Fisher Scientific Inc.), CellLight® RFP, BacMam 2.0 (Thermo Fisher Scientific Inc.), pH-sensitive pHrodo fluorescent dyes (Thermo Fisher Scientific Inc.), 18F- Rhodamine 6G, 18F-labeled rhodamine B, magnetic iron oxide nanoparticles, and gold- and platinum-based nanoparticles.
As discussed above, a combined mitochondrial agent comprises a mitochondria and an agent that are in direct and/or indirect physical contact with each other. For example, an agent can be linked to mitochondria, attached to mitochondria, embedded in the mitochondrial membrane, or completely or partially enclosed in mitochondria. In some instances, a pharmaceutical agent can be linked to mitochondria covalently. In some instances, the agent is linked to constituents of mitochondrial membrane directly through a covalent bond (e.g., a carboxamide bond and a disulfide bond), or indirectly through a linker (e.g., a peptide linker) or another covalently bonded agent. In other instances, an agent can be linked to mitochondria non- covalently, for example, through hydrophobic interaction, Van der Waals interaction, and/or electrostatic interaction, etc.
In some embodiments, a combined mitochondrial agent can comprise two or more different types of agents, for example, two different kinds of therapeutic agents, three different kinds of imaging agents, one therapeutic agent and one imaging agent, a therapeutic agent and a diagnostic agent, etc. Skilled practitioner will appreciate that any variation is possible.
One particularly useful linker to link mitochondria and an agent provides a sustained release of the agent upon injection. This can be accomplished, for example, using a hydrazone functional group. For example, a hydrazone is formed to covalently bind an agent to constituents on the mitochondrial membrane. Once this combined mitochondrial agent is taken up by cells, the change in pH will result in hydrolysis of the hydrazone, releasing the bound agent inside the cell.
In some embodiments, a therapeutic agent, a diagnostic agent, and/or an imaging agent can be linked to the outer mitochondrial membrane using functionalized surface chemistry. In some cases, heterobifunctional chemistries can link a therapeutic agent, a diagnostic agent, and/or an imaging agent to the mitochondrial surface, and once they are internalized, these agents can be released through interactions with intercellular esterases (e.g. via interaction with an acetoxymethyl ester) or through a UV-light activation or Near-Infrared light activation strategy. The UV-light activation and Near-Infrared light activation strategies are described, e.g., in Zhou et al., "Progress in the Field of Constructing Near-Infrared Light-Responsive Drug Delivery Platforms," Journal of Nanoscience and Nanotechnology 16.3 (2016): 2111-2125; Bansal et al., "Photocontrolled nanoparticle delivery systems for biomedical applications," Accounts of chemical research 47.10 (2014): 3052-3060; Barhoumi et al., "Ultraviolet light- mediated drug delivery: Principles, applications, and challenges," Journal of Controlled Release 219 (2015): 31-42; and US20180057610A1. Each of them is incorporated by reference in its entirety.
Skilled practitioners will appreciate that in some instances a composition described herein may include more than one type of combined mitochondrial agent. For example, included are compositions comprising mitochondria wherein essentially each mitochondrion is associated with multiple types of agents. Also included are compositions comprising mitochondria wherein each mitochondrion is paired with only one type of agent but wherein the composition comprises a mixture of mitochondria/agent pairings.
Methods of making combined mitochondrial agents
Skilled practitioners will appreciate that an agent can be linked to mitochondria in any number of ways, e.g., by attaching to mitochondria, embedding partially or completely in the mitochondrial membrane, enclosing in mitochondria, or encapsulating within the mitochondria.
While not intending to be bound by any theory or any particular approach, it is believed that the outer membrane of mitochondria is adherent and thus particularly amenable to combination with various agents. In some embodiments, pharmaceutical agents can be attached to the outer membrane of mitochondria simply by incubation. For example, an effective amount of pharmaceutic agents can be fully mixed with isolated mitochondria in a buffer, e.g., respiration buffer, at a temperature favorable to isolated mitochondria, e.g., from 0 °C to 26 °C, from 0 °C to 4 °C, or about 0 °C, 4°C, 26 °C. This procedure is useful to attach an effective amount of pharmaceutic agents (e.g., nanoparticles, DNA vectors, RNA vectors) to
mitochondria.
In some embodiments, organic cations (e.g., rhodamine and tetramethylrosamine) are readily sequestered by functioning mitochondria because of the electric potential on
mitochondrial membrane. Healthy mitochondrial membranes maintain a difference in electric potential between the interior and exterior of the organelle, referred to as the membrane potential. This membrane potential is a direct result of mitochondrial functional processes, and can be lost if the mitochondria are not working properly. Lipid-soluble cations are sequestered by mitochondria as a consequence of their positive charge and of their solubility in both the inner membrane lipids and the matrix aqueous space. Similarly, in some other embodiments, anions can be attached to the outer membrane of mitochondria because of its negative charge. To link mitochondria with these pharmaceutical agents, an effective amount of pharmaceutic agents should be fully mixed with isolated mitochondria in a buffer, e.g., respiration buffer, at a temperature favorable to isolated mitochondria, e.g., about 0°C or 4°C.
The therapeutic, diagnostic, and/or imaging agent can be linked to phospholipids, peptides, or proteins on the mitochondrial membrane through a chemical bond. For example, molecules including fluorophores (pHrodo Red (Thermo Fisher Scientific, Inc.)) and metallic particles (e.g., 30 nm magnetic iron oxide nanoparticles (Sigma)) can be covalently linked to exposed amine groups on proteins and peptides exposed on the outside membrane of intact mitochondria using succinimidyl ester conjugates. These reactive reagents react with non- protonated aliphatic amine groups, including the amine terminus of proteins and the e-amino group of lysine residues, which creates a stable carboxamide bond. In another example, when the pharmaceutic agent, e.g., MitoTracker® Orange CMTMRos (Invitrogen, Carlsbad, CA, now
Thermo-Fisher Scientific, Cambridge, MA), are mixed with functional mitochondria, they are oxidized and then react with thiols on proteins and peptides on mitochondria to form conjugates.
There are numerous reactive chemical moieties available for attaching therapeutic, diagnostic, and/or imaging agents to the surface of mitochondria (e.g. carboxylic acid, amine functionalized, etc.).
Agents can be attached via protein bonding, amine bonding or other attachment methods either to the outer or inner mitochondrial membrane. Alternatively, or in addition, an agent can be attached to the mitochondria membrane through hydrophobic interaction, Van der Waals interaction, and/or electrostatic interaction.
In many instances, therapeutic agents, diagnostic agents and imaging agents may simply be mixed with isolated mitochondria, and incubated in a buffer (e.g., respiration buffer) for a sufficient period of time (e.g., a few minutes, 5 minutes, 10 minutes, or 1 hour) at favorable conditions (e.g., from 0 °C to 26 °C, from 0 °C to 4 °C, or about 0 °C, 4°C, 26 °C, pH 7.2-8.0).
Exemplary methods of preparing combined mitochondrial agents are described in McCully et al, Injection of isolated mitochondria during early reperfusion for cardioprotection, Am J Physiol 296, H94-H105. PMC2637784 (2009); and Masuzawa et al, Transplantation of autologously derived mitochondria protects the heart from ischemia-reperfusion injury, Am J Physiol 304, H966-982. PMC3625892 (2013); and US20180057610A1. Each of the foregoing are incorporated by reference in its entirety.
Methods of Preparing Compositions Comprising Mitochondria and/or Combined
Mitochondrial Agents
Isolated mitochondria and combined mitochondrial agents can be mixed with a pharmaceutically acceptable carrier to make a pharmaceutic composition. A pharmaceutically acceptable carrier includes any compound or composition useful in facilitating storage, stability, administration, cell targeting and/or delivery of the mitochondria and/or combined mitochondrial agent, including, without limitation, suitable vehicles, diluents, solvents, excipients, pH modifiers, salts, colorants, rheology modifiers, lubricants, coatings, fillers, antifoaming agents, polymers, hydrogels, surfactants, emulsifiers, adjuvants, preservatives, phospholipids, fatty acids, mono-, di- and tri-glycerides and derivatives thereof, waxes, oils and water. In some embodiments, isolated mitochondria and/or the combined mitochondrial agents are suspended in
water, saline, buffer, respiration buffer, or sterile mitochondria buffer for delivery in vivo.
Pharmaceutically acceptable salts, buffers or buffer systems, including, without limitation, saline, phosphate buffer, phosphate buffered saline (PBS) or respiration buffer can be included in a composition described herein. Vehicles having the ability to facilitate delivery to a cell in vivo, such as liposomes, may be utilized to facilitate delivery of the combined mitochondrial agents to the target cells.
Methods of making compositions, e.g., liquid, semi-solid, and solid compositions (e.g., liquids, creams, lotions, ointments, oils, among others), are well-known in the art. Skilled practitioners will appreciate that such known methods can be modified to add one or more steps to add mitochondria and/or combined mitochondrial agents and form a composition described herein. Skilled practitioners will appreciate that in some instances a composition described herein may include more than one type of combined mitochondrial agent. For example, included are compositions comprising mitochondria wherein essentially each mitochondrion is associated with multiple types of agents. Also included are compositions comprising mitochondria wherein each mitochondrion is paired with only one type of agent but wherein the composition comprises a mixture of mitochondria/agent pairings.
Pharmaceutical Compositions
The disclosure provides pharmaceutical compositions including a pharmaceutically acceptable carrier along with a therapeutically effective amount of the mitochondria and/or one or more anticancer drugs. In some embodiments, the pharmaceutical composition comprises mitochondria, one or more anti-cancer drugs, or both mitochondria and anti-cancer drugs.
Pharmaceutically acceptable carrier (e.g., pharmaceutically acceptable excipient) means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
In various embodiments, the pharmaceutical compositions can be formulated for delivery via any route of administration.“Route of administration” can refer to any administration pathway known in the art, including but not limited to aerosol, nasal, transmucosal, transdermal, or parenteral. “Parenteral” refers to a route of administration that is generally associated with
injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. Via the parenteral route, the compositions can be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders.
The pharmaceutical compositions can also contain any pharmaceutically acceptable carrier.“Pharmaceutically acceptable carrier” as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. For example, the carrier can be a liquid or solid tiller, diluent, excipient, solvent, or encapsulating material, or a combination thereof. Each component of the carrier must be“pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
The pharmaceutical compositions can be delivered in a therapeutically effective amount. The precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic agent (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of
administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for instance, by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy (Gennaro ed. 20th edition, Williams & Wilkins PA, USA).
Administration
The composition as describe herein (e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs) can be administered to a patient by injection intravenously, intra-arterially, intraperitoneally, intra-muscularly, intraosseous and/or through aerosol infusion. In some embodiments, the composition as describe herein can be delivered by direct injection or by vascular infusion.
Once mitochondria are injected into a tissue, mitochondria will be taken up by cells around the site of injection. Therefore, in some embodiments, the site of injection is the target site. In some other embodiments, mitochondria are injected to a blood vessel which carries the blood to the target site, for example, an organ, a tissue, or a tumor site. While not intending to be bound by any theory, evidence suggests that mitochondria delivered by direct injection are internalized by cells through actin-dependent endocytosis. However, mitochondrial uptake by vascular delivery appears to be more complicated. The rapid and widespread uptake of mitochondria when delivered by vascular infusion would suggest that mechanisms allowing for the rapid passage of mitochondria through the vascular wall are involved. Some studies support the concept that cells can routinely escape from the circulation. It has been shown that certain cardiac and mesenchymal stem cells appear to be actively expelled from the vasculature in a process different from diapedesis (Cheng, K., Shen, D., Xie, Y., Cingolani, E., Malliaras, K., Marban, E., 2012, Brief report: Mechanism of extravasation of infused stem cells. Stem Cells.
30, 2835-2842.; Allen, T.A., Gracieux, D., Talib, M., Tokarz, D.A., Hensley, M.T., Cores, I, Vandergriff, A., Tang, T, de Andrade, J.B., Dinh, P.U., Yoder, J.A., Cheng, K., 2017.
Angiopellosis as an Alternative Mechanism of Cell Extravasation. Stem Cells. 35,170-180). Transmigration of stem cells through the vascular wall requires extensive remodeling of the endothelium. Mitochondria may use a similar remodeling mechanism to pass through the vascular wall. Another possible mechanism for mitochondrial uptake may be diapedesis- like. Some cells routinely escape from the circulation. For example, leukocyte extravasation (i.e. diapedesis) between venous endothelial cells is a well-understood process that involves cell adhesion proteins. Further, it is also possible that infused mitochondria extravasate through the capillary wall through the space between the endothelium cells. After mitochondria cross the endothelium of the blood vessels, mitochondria are taken up by tissue cells through an endosomal actin-dependent internalization process.
The composition as describe herein (e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs) can be administered to a subject as a singular, one-time treatment, or alternatively, multiple treatments, e.g., a treatment course that continues intermittently or continuously for about 1, 2, 5, 8, 10, 20, 30, 50, or 60 days, one year, indefinitely, or until a physician determines that administration of the mitochondria or combined mitochondrial agent is no longer necessary.
In one method of administration, the composition as describe herein (e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs) is injected into organ tissue directly. The injection is repeated several times at different sites of the organ. In such a method, a sterile 1-ml insulin syringe with a small needle (e.g., 28-gauge) can be used for the injection and each injection site can receive, e.g., about 1.2 c 106 of mitochondria.
In some embodiments, the composition as describe herein (e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs) can be directly injected into cancer (e.g., focal cancer or solid tumor).
In some embodiments, the composition as describe herein (e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs) can be delivered to nodules (e.g., by intra-arterial delivery).
In some embodiments, the composition as describe herein (e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs) can be aerosolized (e.g., in the form or aerosol), and delivered to lungs, nasal passage, rectum, intestine, skin, and eyes to treat cancers in these sites.
Skilled practitioners will appreciate that the amount of mitochondria and/or combined mitochondrial agents, e.g., compositions comprising mitochondria and/or combined
mitochondrial agents, that should be administered to a patient will vary depending upon, e.g., the type of disorder being treated, the route of administration, the duration of the treatment, the size of an area to be treated, and/or the location of the treatment site in the patent, among others. Skilled practitioners will be able to determine dosages to be administered depending on these and other variables. For example, a total of about 1 c 107 of mitochondria can be administered into a blood vessel of a subject, e.g., to treat the disorder. As another example, in the case of larger organs or affected areas, greater numbers of mitochondria, e.g., 1 x 10 10 to 1 x 10 14
mitochondria, can be injected into the blood vessel. Conversely, in the case of small focal
lesions, I x l0 3 to l x l0 6 mitochondria can be infused into the patient. Therefore, an effective amount of mitochondria or combined mitochondrial agents (or compositions comprising same) is the total amount of mitochondria or combined mitochondrial agents sufficient to bring about a desired therapeutic effect. An effective amount can be, e.g., at least or about 1 x 102
mitochondria or combined mitochondrial agents e.g., from about 1 x 103 to about 1 x 1014, about 1 x 104 to about 1 x 1013, about 1 x 105 to about 1 x 1012, about 1 x 106 to about 1 x 1011, about 1 x 107 to about 1 x 1010, about 1 x 103 to about 1 x 107, about 1 x 104 to about 1 x 106, about 1 x 107 to about 1 x 1014, or about 1 x 108 to about 1 x 1013, about 1 x 109 to about 1 x 1012, about 1 x 105 to about 1 x 108 or at least or about 1 x 103, 1 x 10 4, 1 x 10 5, 1 x 10 6, 1 x 10 7, 1 x 10 8, 1 x 10 9, 1 x 10 10, 1 x 10 u, 1 x 1012, 1 x 1013, or at least or about
1 x 1014, or e.g., an amount more than 1 x 10 14. As used herein, the term“total amount” in the context of administration to a patient can refer to the total amount of mitochondria or combined mitochondrial agents in a single administration (e.g., one injection, one dose administered in an infusion) or in multiple administrations (e.g., multiple injections), depending on the dosing regimen being performed.
The composition as describe herein (e.g., isolated mitochondria, combined mitochondrial agents, and/or anti-cancer drugs) can be administered to a subject every 12-24 hours by various routes, e.g., direct injection, vascular delivery. In some embodiments, isolated mitochondria or combined mitochondrial agents can be administered to a subject every 5-10 minutes (e.g., every 5 minutes, every 10 minutes) by various routes, e.g., direct injection, vascular infusion.
In some embodiments, isolated mitochondria or combined mitochondrial agents can be directly injected into tissues or organs by Gauge 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, and 34 needles. In some other cases, isolated mitochondria, or combined mitochondrial agents can be delivered to a target site by a catheter.
It is noted that in some cases, the effects of mitochondria depend on the length of the time period between the time of isolation and the time of use. Thus, in some instances, the mitochondria are freshly isolated and viable. The mitochondria or combined mitochondrial agents can be administered to a subject within about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, about 70 minutes, about 80 minutes, about 90 minutes, about 100 minutes, about 110 minutes, about 120 minutes after the mitochondria are isolated. In some instances, the mitochondria or combined
mitochondrial agents are administered to a subject within about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, about 70 minutes, about 80 minutes, about 90 minutes, about 100 minutes, about 110 minutes, about 120 minutes after starting the mitochondria isolating process. Mitochondria and/or combined mitochondrial agents may in some instances be stored for a short period of time (e.g., about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, or about 60 minutes) before use.
It is also noted that, in some cases, frozen-thawed mitochondria are not viable and not effective for certain treatments described herein, e.g., treatment of ischemia/reperfusion injuries or treatment of cancer. Thus, in some cases, the mitochondria are not frozen and thawed after isolation from tissues and/or cells.
The mitochondria for the treatment can be isolated from cells or tissues of an autogenous source, an allogeneic source, and a xenogeneic source. In some instances, mitochondria are collected from cultured cells or tissues of a subject, and these mitochondria are administered back to the same subject. In some other cases, mitochondria are collected from cultured cells or tissues of a second subject, and these mitochondria are administered to a first subject. In some cases, mitochondria are collected from cultured cells or tissues from a different species (e.g., mice, swine, yeast).
In some embodiments, the mitochondria or combined mitochondrial agents can be administered to a subject before, during, or after the anti-cancer drug is administered to a subject.
Dosage
An“effective amount” is an amount sufficient to effect beneficial or desired results. For example, a therapeutically effective amount is one that achieves the desired therapeutic effect.
An effective amount can be administered in one or more administrations, applications or dosages. A therapeutically effective amount of a therapeutic compound typically depends on the therapeutic compounds selected. The compositions can be administered one from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover,
treatment of a subject with a therapeutically effective amount of the therapeutic compounds described herein can include a single treatment or a series of treatments.
Dosage, toxicity and therapeutic efficacy of the therapeutic compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such
compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.
EXAMPLES
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Example 1: Exogenous mitochondria that were administered extracellularly were transported into the human cancer cells.
Experiments were performed to demonstrate that exogenous mitochondria can be taken up by human cancer cells. The localization of red fluorescent protein (RFP)-labeled
mitochondria administered extracellularly to green fluorescent protein (GFP)-labeled cancer cell lines PC3 and DU145 was determined by microscopy.
Materials and Methods
Cell Lines
The following cell lines were used for experiments: human prostate cancer cell lines DU145 (ATCC HTB81), PC3 (ATCC CRL1435) and human normal prostate epithelium cell line, RWPE (ATCC CRLl 1609) obtained from the (American Type Culture Collection,
(Manassas, VA). The human cardiac fibroblast (HCF) cell line was obtained from ScienCell Research Laboratories, Carlsbad, CA. The DU-145 and PC-3 prostate cancer cell lines are androgen receptor negative and harbor non-functional p53, and have been extensively studied for chemotherapy sensitivity. RWPE cells were maintained in keratinocyte serum free medium, supplemented with 0.05 mg/ml bovine pituitary extract (BPE) and 5 ng/ml EGF according to the supplier’s directions (GIBICO, 17005-042, Grand Island, NY). PC3 and DU145 cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA, USA), supplemented with 10% fetal bovine serum (FBS) (Gibco, ThermoFisher Scientific), 100 U/ml penicillin, 100 pg/ml streptomycin and 1 mmol/1 glutamine (Sigma-Aldrich, St. Louis, MO). Human cardiac fibroblasts (HCF) were maintained in Fibroblast Medium-2 containing fetal bovine serum, fibroblast growth supplement-2, and antibiotic (penicillin/streptomycin) solution according to the supplier’s directions (ScienCell, Carlsbad, CA). All cells were maintained as a monolayer at 37 °C in humidified atmosphere of 5% CO2 and were passaged when 80% confluence was reached.
Baculovirus Infection
DU145 and PC3 human prostate cancer cell lines were labelled with green fluorescent protein (GFP) and human cardiac fibroblast cell (HCF) mitochondria were labelled with red fluorescent protein (RFP) through baculovirus-mediated transfer of mammalian fusion genes.
For visualization GFP-labelled DU145 and PC3 human prostate cancer cell lines were seeded on cover slips in a flat-bottomed 24-well plate (10,000 cells per well). Mitochondria were isolated from RFP-labelled HCF cells. Isolated HCF-RFP labelled mitochondria (1 x 107) resuspended in
500 pL cell DMEM media were co-incubated with GFP-labelled PC3 or GFP labelled DU145 human prostate cancer cell lines for 4 hours.
3-D SR-SIM Microscopy
Uptake of RFP labelled HCF mitochondria in GFP labelled PC3 and GFP labelled DU145 cells was determined by 3-D Superresolution Structured Illumination Microscopy (SR- SIM).
Results
FIGS. 1A-1D contain a representative set of images obtained by 3-D SR-SIM. The RFP- labeled HCF mitochondria in the DU145 cancer cells are shown in red (FIG. 1A, FIG. ID), while the GFP-labeled HCF exogenous mitochondria are shown in green (FIG. IB, FIG. ID). The DAPI-stained nucleus of the cancer cells is shown in blue (FIG.1C). This representative set of images demonstrates that the exogenous mitochondria were transported into the cancer cells and are not localized to a specific area within the cell, rather the exogenous mitochondria are dispersed throughout the cell. The results show that human cancer cells can uptake exogenous mitochondria that are administered extracellularly.
Example 2: Mitochondrial transplantation does not increase proliferation rate of human cancer cells.
Experiments were performed to determine the effects of mitochondrial transplantation on the proliferation rate of human cancer cells.
Materials and Methods
Cell culture
DU145 and PC3 human prostate cancer cell lines were seeded on a flat-bottomed 96-well plate at 10,000 cells per well and left to attach overnight at 37°C in 5% CO2 atmosphere. DU145 and PC3 cells were then washed twice with 37°C PBS and then incubated with 500 uL fresh DMEM (Vehicle) or DMEM containing lxlO7, freshly isolated HCF mitochondria
(Mitochondria) for 4 hours. Mitochondria were isolated from HCF cells. Following 4 hours incubation the DU145 and PC3 cells received a further 500 uL fresh DMEM (total volume 1 mL).
MTT Cell Proliferation Assay
Cell proliferation was assessed at 24 hours, 48 hours, 72 hours and 96 hours using the MTT Cell Proliferation Assay according to the manufacturer’s protocol (American Type Culture Collection, Manassas, VA). Cell proliferation in DU145 and PC3 human prostate cancer cells receiving either vehicle or mitochondria was determined. Each experiment was conducted in sextuplicate and repeated three times for both cell lines.
Results
FIGS. 2A-2B show results from proliferation assays for DU145 cells (FIG. 2A) and PC3 cells (FIG. 2B). DU145+ mito and PC3 + mito were co-incubated with lxlO7 mitochondria for 4 hours and then the media was removed and fresh DMEM media was added. Following 24 hours, 48 hours, 72, hours and 96 hours cell growth was determined by the MTT-assay. Results are shown as mean ± SD for n=6 for each time point. The results indicate that mitochondrial transplantation does not increase cell proliferation of PC3 or DU145 human prostate cancer cells.
Example 3: The effects of mitochondrial transplantation on cell cycle distribution of human cancer cells.
Experiments were performed to determine the effects of mitochondrial transplantation on the cell cycle distribution of human cancer cells.
Materials and Methods
Cell Culture
Human normal prostate epithelium cells, RWPE and DU145 and PC3 human prostate cancer cell lines were seeded, separately on a flat-bottomed 96-well plate (10,000 cells per well) and left to attach overnight at 37°C in 5% CO2 atmosphere for 24 hours. RWPE (Control), DU145 and PC3 cells were washed twice with 37°C PBS and then incubated with 500 uL fresh DMEM (Vehicle) or DMEM containing lxlO7, freshly isolated HCF mitochondria
(Mitochondria) for 4 hours. Mitochondria were isolated from HCF cells. RWPE cells received vehicle only.
Flow Cytometry to Quantify Cell Cycle Distributions
Cell cycle distributions was determined utilizing propidium iodide according to the manufacturer’s protocol (PI; Sigma-Aldrich, St. Louis, MO) and analyzed by flow cytometry.
The percentages of cells in the sub-Gl, G0/G1, S, and G2/M phases of the cell cycle were analyzed. The percentage of total cells in the sub-Gl phase, the G1 phase, the S phase and G2/M phase were determined for the human normal prostate epithelium cell line, RWPE (Control Group) and for DU145 and PC3 human cancer cells receiving either Vehicle or Mitochondria. Experiments were repeated three times, in triplicate for all cell lines.
Results
The result show that mitochondrial transplantation did not alter cell cycle distribution or cell proliferation.
Example 4: The effects of mitochondrial transplantation on the oxygen consumption and ATP content of human cancer cells
Experiments were performed to determine the effects of mitochondrial transplantation on the oxygen consumption and ATP content of human cancer cells.
Methods
Cell Culture
DU145 and PC3 human prostate cancer cell lines were seeded and cultured separately on a flat-bottomed 96-well plate (10,000 cells per well). DU145 and PC3 cells were washed twice with 37°C PBS and then incubated with 500 pL fresh DMEM or DMEM containing either 1 x 105, or 1 x 106 or 1 x 107 freshly isolated HCF mitochondria for 4 hours. Mitochondria were isolated from HCF cells.
A TPlite Luminescence A TP Detection Assay
Following 4 hours of co-incubation, the media was removed, the cells were washed twice with PBS and the ATP content was determined by the ATPlite Luminescence ATP Detection Assay System (Perkin Elmer, Waltham, MA, USA) according to the manufacturer’s directions. Each experiment was conducted in sextuplicate and repeated three times.
Results
FIGS. 3A-3B show quantified total ATP content in DU145 and PC3 cell lines that were co-incubated with different concentrations of exogenous mitochondria for 4 hours. DU145 (FIG. 3A) and PC-3 (FIG. 3B) (10,000 cells per well) were seeded in a 24-well plate. Following 24 hours, cells were co-incubated with vehicle only or with vehicle containing 1c10? or lxlO6 or
7
1x10 mitochondria. Following 4 hours co-incubation the media was removed, and the cells were washed with PBS and ATP content was determined by the ATPlite luminescence assay (PerkinElmer). Results are shown as mean ± SD for n=4 for each time point for each group.
ATP content was significantly increased with 1 x 107 mitochondria in both DU145 and PC3 human prostate cancer cell lines as compared to Vehicle treated cells (shown in black). No significant difference between 1c10? or 1 x 1 o’ or lxl0? was evident. The results indicate that co incubation of the cancer cell lines with mitochondria was sufficient to increase total ATP content in the cancer cells. The results also indicate that the aforementioned effect is dose-dependent given that increasing amounts of exogenous mitochondria correlate with higher levels of total ATP content within the cancer cell lines. This result suggests that this effect is mediated by mitochondria that have been internalized by the cancer cells and that co-incubation with higher levels of exogenous mitochondria results in higher levels of internalized exogenous mitochondria within the cancer cells.
Cellular Oxygen Uptake Assay
It is further hypothesized that internalized exogenous mitochondria can increase other mitochondria-dependent functions in DU145 and PC3 human prostate cancer cell lines. For example, internalized exogenous mitochondria will confer increases rates of oxygen uptake. To quantify this, the following oxygen uptake assay can be performed.
DU145 and PC3 human prostate cancer cell lines can be seeded and cultured, separately on a flat-bottomed 96-well plate (10,000 cells per well). DU145 and PC3 cells can be washed twice with 37 °C PBS and then incubated with 500 pL fresh DMEM or DMEM containing either 1 x 105, or 1 x 106 or 1 x 107 freshly isolated HCF mitochondria for 4 hours. Mitochondria can be isolated from HCF cells. Following 4 hours of co-incubation, the media can be removed, the
cells can be washed with PBS and the cells can collected by trypsinization. The cells are collected in fresh DMEM (1 mL, 37°C) and cellular oxygen uptake can be determined.
Experiments can be repeated three times, in triplicate for all cell lines.
Example 5: Mitochondrial transplantation alters chemotherapy sensitivity in human cancer cell lines.
To demonstrate that mitochondrial transplantation can reduce tumor resistance to chemotherapy, in vitro experiments were designed with human prostate cancer cells treated with two drugs, cisplatin and docetaxel, whose cytotoxicity against target cells is known to require respiration-competent mitochondria within the target cells. Cisplatin is a commonly employed compound that exerts clinical activity against numerous solid tumors and was also shown to have potential in the management of metastatic castration-resistant prostate cancer. The biochemical mechanisms of cisplatin cytotoxicity involve cell cycle arrest and increased apoptosis by inhibition of anti-apoptotic Bcl-2. Cisplatin’ s chemotherapeutic activity is known to require functioning mitochondria for optimal cytotoxic effect. Docetaxel is a first-line chemotherapy, shown to improve prostate cancer patient survival by months. Both drugs improve prostate cancer patient survival, but tumor resistance to these therapeutic agents inevitably develops.
Previous studies have demonstrated DU145 human prostate cancer cells are resistant to cisplatin and that PC3 human prostate cancer cells are highly resistant to cisplatin. These differences in cisplatin sensitivity will allow for evaluation of the efficacy of mitochondrial transplantation in altering chemotherapy sensitivity.
DU145 and PC3 human prostate cancer cell lines were seeded on a flat-bottomed 96-well plate (10,000 cells per well) and then incubated with Vehicle or Mitochondria. Mitochondria were isolated from HCF cells. Following 4 hours incubation, the DU145 and PC3 cells received a further 500 pL fresh DMEM (total volume 1 mL) containing either a sub-lethal dose of cisplatin (10 pmol/'l) or docetaxel 5 nmol/1. The cells were incubated for 24 hours or 48 hours, after which points cell death, apoptosis, and cell cycle inhibition were quantified. For TUNEL, cell cycle distributions, and immunohistochemistry DU145 and PC3 human prostate cancer cell lines were seeded on cover slips in a flat-bottomed 24-well plate (10,000 cells per well) and received exogenous mitochondria or vehicle and further treated with cisplatin or docetaxel. For comparison of efficacy, a separate group of DU145 and PC3 cells received a lethal dose of cisplatin (25 or 50 umol/l) or docetaxel 10 or 20 nmol/1.
After 24- and 48-hours incubation, cell death was determined using the LIVE/DEAD Viability/Cytotoxicity Kit (Molecular Probes Inc., Eugene, OR, USA) according to the manufacturer’s directions. Each experiment was conducted in sextuplicate and repeated three times for both cell lines.
FIGS. 4A-4B show results from cell viability assays of DU145 and PC3 human prostate cancer cells treated with exogenous mitochondria and with cisplatin or docetaxel. DU145 (FIG. 4A) and PC-3 (FIG. 4B) (10,000 cells per well) were seeded in a 24-well plate. DU145 and PC3 were co-incubated, separately with either vehicle only or with lxlO7 mitochondria for 4 hours and then the media was removed and fresh DMEM media was added. In the cisplatin groups, fresh media containing cisplatin at a sub-lethal dosage (10 uMol) was added to the cells. The cells were incubated for 24 and 48 hours. Following 24- and 48-hours cell death was determined as described above. Results are shown as mean ± SD for n=4 for each time point for each group. Results show that mitochondrial transplantation alone has no effect on cell death. Mitochondrial transplantation + cisplatin significantly increased cell death as compared to cisplatin alone at 24 hours and 2.5-fold at 48 hours. These results indicate that mitochondrial transplantation increases chemotherapy sensitivity in moderately chemotherapy resistant DU145 and the highly chemotherapy resistant PC3 prostate cancer cells.
It is further hypothesized that mitochondrial transplantation can increase other metrics of chemotherapy sensitivity in moderately chemotherapy resistant DU145 and the highly chemotherapy resistant PC3 prostate cancer cells. For example, it is hypothesized that apoptosis will increase in DU145 and PC3 cells treated with exogenous mitochondria and further treated with cisplatin or docetaxel. To quantify this, the following assays, listed below, can be performed.
TUNEL Apoptosis Assay
Apoptosis can detected using the ApopTag detection system (Intergen, Gaithersburg, MD) according to the manufacturer’s protocol. Apoptosis can be quantified by counting the positive cells (brown-stained), and total number of cells in five randomly selected fields at c 400 magnification. The percentage of positive cells (apoptotic index) can be calculated as the number of positive cells/total number of nucleated cells c 100%. Experiments can be repeated three times, in triplicate.
Flow Cytometry to Quantify Cell Cycle Distributions
Cell cycle distributions can be determined by utilizing propidium iodide according to the manufacturer’s protocol (PI; Sigma-Aldrich, St. Louis, MO) and then analyzed by flow cytometry.
Caspase-3 Enzymatic Activity Assay
Caspase-3 enzyme activity is determined using the Caspase 3 Assay Kit 3 activity assay kit (Abeam, Cambridge, MA) according to the manufacturer’s protocol. Experiments are repeated three times, in triplicate for all cell lines.
Immunohistochemistry
Formalin-fixed, paraffin-embedded tumor cells will be prepared for
immunohistochemistry. Total and cleaved PARP antibody and b-Actin antibody (2 A3) HRP sc- 517582 HRP can be purchased from Santa Cruz Biotechnology. Bax, Bcl-2 and Ki-67 monoclonal antibodies; anti-rabbit and anti-mouse HRP-conjugated secondary antibodies can be purchased from Sigma-Aldrich Company (St. Louis, MO). For the negative control, the primary antibody can be replaced with PBS. Staining intensity will be estimated on a four-step scale as follows: negative (no staining at all); weak (1+ staining regardless of positive cell percentages or 2+ staining of < 30% of cells); moderate (2+ staining of > 30% of cells or 3+ staining of < 50% of cells); and strong (3+ staining of > 50% of cells). The moderately positive and strongly positive are calculated into the positive group; the negative and weakly positive are calculated into the negative group. All data will be analyzed by two blinded observers.
RNA and Protein Isolation
To confirm apoptosis results, RNA will be isolated and quality and purity can be assessed by spectrophotometric analysis and agarose gel electrophoresis. Cell protein are isolated.
Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
To quantify gene expression changes of select genes encoding proteins with roles in apoptosis qRT-PCR will be performed using an Eppendorf Realplex Mastercycler and software
package (Eppendorf North America, Westbury, NY). The iScript One-Step RT-PCR Kit with SYBR Green solution (Bio-Rad, Hercules, CA) will be used according to manufacturer’s instructions. Control reactions without reverse transcriptase will be performed for each reaction. Gene specific primers for qRT-PCR are :
Bcl-2:
Forward ATGACTGAGTACCTGAACCGGC;
Reverse GAGAC AGCC AGGAGAAAT C AAAC ;
Bax:
Forward CCTTTTGCTTCAGGGTTTCAT;
Reverse CATCCTCTGCAGCTCCATGTTA; b -actin:
Forward AGGC ACC AGGGCGT GAT ;
Reverse GCCC AC AT AGGAATCCTTCTGAC .
Fold changes in gene expression can be calculated using the delta delta CT (ddCT) method. qRT-PCR product sizes will be verified by agarose gel and electrophoresis.
Western Blotting Analysis
Cells will be harvested, washed with ice-cold PBS, and cellular proteins are isolated, separated on 12% SDS-polyacrylamide gel, electrophoresed, and transferred. Anti-total and cleaved PARP antibody and b-Actin Antibody (Santa Cruz Biotechnology (Dallas, TX); anti- Bax, anti-Bcl-2 and anti-Ki-67 monoclonal antibodies(Sigma-Aldrich, St. Louis, MO) will be used to confirm apoptosis. Protein equivalency, transfer efficiency and membrane blocking will be performed. Blots can be detected using ECL-Plus (Sigma-Aldrich, St. Louis, MO) with species-appropriate secondary antibodies. Densitometry analysis can performed using the Image J analysis software (http://rsbweb.nih.gov/ij/). All Western blots will be performed three times. Detected protein levels will be normalized to b-Actin.
It is expected that results of the above in vitro studies will demonstrate that mitochondrial transplantation increases chemotherapy sensitivity in DU145 and PC3 human prostate cancer cell
lines. Additionally, cell death and apoptosis will increase in human prostate cancer cells receiving mitochondria and this increased cell death will be associated with upregulation of Bax, PARP cleavage and caspase 3 activity. Finally, it is expected that the effects will be associated with downregulation of Bcl-2, Ki-67 and increased number of cells in sub-Gl phase, indicating apoptosis.
Example 6: Determine efficacy of mitochondrial transplantation in subcutaneous tumors containing PC3 or DU145 prostate cancer cell lines in the athymic mouse model.
To demonstrate efficacy of mitochondrial transplantation in PC3 and DU145 luciferase- transfected human prostate cancer subcutaneous tumors experiments will be conducted using the established athymic mouse model. We will use in vivo bioluminescence imaging (BLI). This approach will allow for preclinical in vivo analysis of the efficacy of mitochondrial
transplantation to enhance chemotherapeutic activity. To perform BLI studies PC-3 and DU145 prostate cancer cells will be stably infected with the Lentivirus CMV-GFP-Luc according to the manufacturer’s protocol (SBI Systems Biosciences, Mountain View, CA). This vector allows for the selection of cells containing the firefly luciferase based on GFP expression.
Figure 5 shows FACS analysis of PC3 human prostate cancer cells transfected with the Lentivirus CMV-GFP-Luc (red) compared to non-transfected PC3 cells (black). FACS results demonstrate that 69.9% of PC3 cells are GFP positive and contain the firefly luciferase gene. Transfection efficiency in RWPE-1 cells was 63.3% and 61.4% in DU145 cells. Previous studies have demonstrated that luciferase expression and bioluminescence does not affect tumor cell growth in vitro or in vivo. .
Materials and methods
Mouse model
Athymic (nude) mice (6-8 weeks in age, 20-25 g) will be anesthetized using isoflurane at 1-4% in a flow of oxygen. PC3 or DU145 human prostate GFP positive cancer cells transfected the Lentivirus CMV-GFP-Luc are sorted by FACS prior to use in BLI studies. Cell viability will be >95% by Trypan blue exclusion at the time of injection. The cells (5 xlO6) are suspended in 0.2 mL PBS and then injected subcutaneously with or without Matrigel (1 : 1 ratio of cell volume
to Matrigel) into left and right flanks of the same mouse and the mouse is allowed to recover for 24 hours.
Mitochondrial Uptake and Bio-Distribution
To investigate mitochondrial uptake HCF mitochondria will be isolated as described by us. The mitochondria will be labelled with 18F-rhodamine 6G and iron oxide nanoparticles. The labelled HCF mitochondria (lxlO5, lxlO6, lxlO7) in a total volume of 50 pL of PBS will be injected at 5 different sites (10 pL per injection) in the tumor using a tuberculin syringe with a 28 G needle. Mitochondrial uptake and bio-distribution will be determined using an Albira
PET/SPECT/CT Preclinical Imaging System (Bruker, Billerica, MA). Following imaging the mouse will be sacrificed by CO2 inhalation overdose and the tumor removed for histochemical analysis. Mitochondrial uptake in tumor cells will be determined by Prussian Blue staining and co-staining with MitoTracker Red CMXRos.
Chemotherapy Response
Tumors will be inoculated on both flanks of the mouse with either PC3 or DU145 human prostate GFP positive cancer cells transfected with the Lentivirus CMV-GFP-Luc. One of the tumors will be treated with vehicle only (50 uL PBS) and the other will receive vehicle containing HCF mitochondria (lx 105, lxlO6, lxlO7) in 50uL PBS. Mitochondria or Vehicle will be injected at 5 different sites (10 pL per injection) in the tumor using a tuberculin syringe with a 28 G needle. The mice will be allowed to recover for 4 hours. Mice will then be treated with either cisplatin or docetaxel. Cisplatin, a chemotherapeutic known to require functioning mitochondria for optimal cytotoxic effect, will be made up fresh in 0.9% saline. Mice will be treated with cisplatin, (0.5 or 1.0 or 1.5 mg/kg. i.p.) 2 x week, for 3 weeks. Other groups of mice will be treated with docetaxel, a first line chemotherapeutic in prostate cancer treatment. Mice will be treated with docetaxel at (10 or 12.5 or 15 mg/kg i.p.) 1 x week for 3 weeks. Tumor growth will be monitored every 3-4 days (twice a week for 3 weeks), and tumors will be measured using calipers. Tumor growth and therapy effect will also be measured using bioluminescence using D-Luciferin (2.9 mg in 100 uL PBS, ip, Promega, Madison, WI) and imaging using the IVIS imaging system (Perkin Elmer, Waltham, MA). Mean tumor luminescence (counts/s) and mean tumor volume (mm3) will be collected for each tumor in each
mouse and chemotherapy sensitivity to cisplatin or docetaxel will be determined. Cell migration and proliferation will be determined. Body weight change and blood cell analysis will be performed on all animals in all groups.
Ex vivo Analysis
Immediately following final imaging session (3 weeks) the mice will be euthanized using CO2 inhalation overdose. Euthanized animals will be dissected and tissues (heart, lung, liver, spleen, kidney, stomach, bowel, muscle, femur (bone), skin, and tumor) will be collected, weighed for BLI ex vivo organ analysis. Within and between group comparisons will be performed to determine effect.
Power Analysis
Power Analysis indicated that a sample size of 6 per group provides over 85% power to detect a difference equal to twice the within group standard deviation (a=0.05, two-sided), and 82% to detect a difference equal to 2.5 times the within group standard deviation (a=0.0083, two-sided, the Bonferroni adjusted significance criterion for post hoc comparisons between 5 groups). For presence / absence of a finding, 6 per group would have 95% power to detect a factor occurring in at least 40% of the animals, while 10 per group would have 95% power to detect a factor occurring in at least 26% of the animals. A sample of 10 animals will provide 80% statistical power (2 -tailed a = 0.05, b = 0.20) to detect a mean difference of 10% or more between the treatment and control arms, assuming a pooled standard deviation of 10% (effect size = 1.0) with an independent groups Student t-test (Query Advisor version 7.0, Statistical Solutions, Cork, Ireland). Based on preliminary studies and animal mortality, typically each experimental group will consist of approximately 6 to 10 animals.
Statistical Plan and Data Analysis:
The mean ± the standard error of the mean for all data is calculated for all variables. Simple pre- vs. post-interventional comparisons are made using a paired two tailed Student's T- test, if the data is normally distributed, or a Wilcoxon Signed Rank test for other continuous data. When there is only a single normally distributed variable for an animal a one-way analysis of variance is used to compare groups, and extensions in the generalized linear model framework to
assess the effects of other variables. Where there are multiple measurements for an animal, we use mixed model analysis of variance (MM-ANOVA) to assess statistical significance with group and / or drug as fixed effects and incorporate repeated measurements over time as a within subject factor. Generally, we use autoregressive correlation (AR (1)) correlations to model the relationship between measurements over time. AR (1) is a standard method for modeling data over time and means that measurements close together are more correlated than measurements further apart. For variables which are not normally distributed, we either adopt data
transformations to normalize the data (e.g., log transformations), or model the data using generalized estimating equations.
Statistical Significance
A P < 0.05 indicates statistical significance. Post hoc comparisons between groups are adjusted for multiple comparisons using a Bonferroni correction. Efficacy will be compared using Fisher's exact test. Randomization will be performed using the R software package based on a 1 : 1 allocation using a Uniform (0,1) number generator. Statistical analysis will be conducted using SAS version 9.3 (SAS Institute, Cary, NC). Two-tailed P < 0.05 will be considered statistically significant. Within and between group comparisons will be performed using Kruskal-Wallis and Dunn post hoc tests or Mann-Whitney test. Outcome value changes from baseline or, where lacking, average baseline will be calculated compared to zero by Wilcoxon rank sum test. Statistical significance will be set at P < 0.05.
Expected Results
It is expected that the uptake and bio-distribution of mitochondria will be prostate tumor specific and will enhance prostate tumor sensitivity to chemotherapy - e.g. chemotherapy comprising treatment with cisplatin and/or doctaxel - in both PC3 and DU145 human prostate cancer cell tumors.
Example 7: Biodistribution and tissue uptake of mitochondria delivered into the lungs either via vascular delivery or via nebulization
Experiments were performed to compare mitochondrial biodistribution and tissue uptake after either vascular delivery into the lungs or via nebulization.
Methods
Delivery of Mitochondria
Vascular delivery. Vascular delivery of mitochondria to the left lung was achieved by injection of mitochondria in buffer directly into the left pulmonary artery at the beginning of reperfusion. In brief, vehicle alone (0.3 mL buffer, Vehicle V, n = 7) or vehicle-containing mitochondria (1 x 108 mitochondria suspended in 0.3 mL buffer, Mito V, n = 6) was injected as a bolus antegrade via the left pulmonary artery using a tuberculin syringe with a 40-gauge needle. The mice were allowed to recover for 24 h.
Nebulization. Aerosol delivery of mitochondria was achieved by nebulization using the FlexiVent nebulizer system (FlexiVent FX2, SCIREQ, Montreal, Quebec, Canada). In brief, the FlexiVent was equipped with the Aeroneb ultrasonic nebulizer and Y-tubing to deliver the aerosol containing vehicle alone (Vehicle Neb) or buffer containing mitochondria (Mito Neb). The nebulization mouse default template was selected from the operating software and the FlexiVent system was calibrated according to the manufacturer’s directions. At the beginning of reperfusion, the oral endotracheal 20-gauge plastic catheter was connected to the FlexiVent system and mechanical ventilation was initiated at 130-140 breaths/min and 10 mL/kg tidal volume. The Aeroneb ultrasonic nebulizer was primed with vehicle alone (90 pL buffer, Vehicle Neb, n = 6) or with mitochondria in vehicle (3 x 108 in 90 pL buffer, Mito Neb, n = 6). Vehicle or mitochondria were delivered over 40 s using the following protocol: 10 s nebulization followed by 1 min of regular mechanical ventilation, repeated 4 times. The mice were allowed to recover for 24 h. Sham control mice (Sham, n = 5) underwent thoracotomy without hilar clamping and were mechanically ventilated for 2 h before returning to the cage.
Mitochondrial Biodistribution
Male Wistar rats (200-250 g, n = 8, Charles River Laboratories, Worcester, MA) were used for visualization of mitochondrial uptake in the lung. Male donor Wistar rats (n = 2) were used for syngeneic mitochondria isolation and 18F-labeled rhodamine 6G mitochondrial labeling as previously described. Wistar rats were anesthetized and maintained on 2-3% inhaled isoflurane. In rats, receiving mitochondria (n = 3) via the pulmonary artery, a sternotomy was performed and the pulmonary trunk was exposed. 18F -labeled rhodamine 6G-labeled
mitochondria (1 x 109 in 0.5 mL buffer) were injected to the lungs as a bolus antegrade via injection to the pulmonary trunk using a tuberculin syringe with a 30-gauge needle.
A separate group of Wistar rats (n = 3), received 18F-labeled rhodamine 6G-labeled mitochondria (1 x 109 in 0.3 mL buffer) as an aerosol to the lungs via the trachea via nebulization. Nebulization was performed as described above with the following modification. The endotracheal tube was connected to the FlexiVent system and mechanical ventilation was initiated at 90 breaths/min and 10 mL/kg tidal volume. The Aeroneb ultrasonic nebulizer was primed with 18F-labeled rhodamine 6G mitochondria (1 x 109 in 0.3 mL buffer) and the mitochondria were delivered using the following protocol: 10 s nebulization followed by 1 min of regular mechanical ventilation, repeated 6 times.
Ten minutes after delivery of mitochondria, the animals were euthanized in a CO2 chamber and imaged by positron emission tomography (PET) and microcomputed tomography using an Albira Si SPECT/CT/PET System (Bruker Corporation, Billerica, MA).
Mitochondrial Tissue Uptake
In a separate set of C57BL/6J male mice (n = 6), mitochondria were isolated from the culture of human cardiac fibroblasts as previously described and delivered to mouse lung via pulmonary artery and via trachea via nebulization to assess mitochondrial tissue uptake in IRI model described above. In brief, mice were anesthetized with intraperitoneal injection of sodium pentobarbital (100 mg/kg) and maintained during surgery on 0.5% inhaled isoflurane and were mechanically ventilated with tidal volume 10 mL/kg and respiratory rate 130-140 breaths/min. Left thoracotomy was performed in third intercostal space and the left pulmonary hilum was exposed. Transient ischemia of the left lung was induced by occluding the left hilum at the end of expiration for 2 h using a microvascular clamp (Roboz Surgical Instrument) and tidal volume was reduced to 7.5 mL/kg. At the beginning of reperfusion, human mitochondria were delivered either by vascular delivery or by delivery via nebulization. In the mice receiving human mitochondria via vascular delivery, a vehicle-containing human mitochondria (1 x 108 mitochondria suspended in 0.3 mL buffer, n = 3) was injected as a bolus antegrade via the left pulmonary artery using a tuberculin syringe with a 40-gauge needle. In mice receiving human mitochondria via nebulization, mice were ventilated with FlexiVent equipped with the Aeroneb ultrasonic nebulizer. The Aeroneb ultrasonic nebulizer was primed with human mitochondria in
vehicle (3 x 108 in 90 pL buffer, n = 3). Human mitochondria were delivered over 40 s using the following protocol: 10 s nebulization followed by 1 min of regular mechanical ventilation, repeated 4 times. After delivery of human mitochondria, animals were allowed to recover for 30 min, and left lung tissue was then harvested for further histological analysis.
The use of human mitochondria allowed for differentiation between endogenous mouse mitochondria and transplanted human mitochondria based on immune reactivity to a monoclonal anti-human mitochondrial antibody (biotin-MTC02, Abeam, Cambridge, MA). Mitochondria were detected using the anti-human mitochondria antibody and visualized using Vectastain (Vector Laboratories, Burlingame, CA) and AEC+ substrate chromogen (Dako, Agilent, Santa Clara, CA) as previously described.
Results
Mitochondrial Biodistribution
To demonstrate biodistribution of mitochondria delivered by pulmonary artery (vascular delivery) and by aerosol delivery via the trachea via nebulization, PET imaging studies were performed using mitochondria labeled with 18F-rhodamine 6G.
18F-Labeled rhodamine 6G radiolabeled mitochondria delivered either via vascular delivery (“Mito V”; FIG. 6A) or via nebulization (“Mito Neb”; FIG. 6C) were taken up diffusely by the lungs. 18F -Rhodamine 6G radiolabeled mitochondria were not detected in any other region of the body.
The results show that mitochondria delivered specifically to the lungs via the pulmonary artery or aerosol delivery through the trachea are rapidly taken up by the lungs and distributed throughout. In Mito V, the mitochondria were also observed in the pulmonary artery; in Mito Neb, the mitochondria were also found along trachea and bronchial tree.
Mitochondrial Tissue Uptake
To demonstrate uptake of the transplanted mitochondria into lung tissue, mitochondria isolated from human adult cardiac fibroblasts were used. The use of human mitochondria in a murine model allows identification of the transplanted mitochondria based on immuno-reactivity to a human-specific mitochondrial antibody.
Exogenous mitochondria were isolated from human cardiac fibroblasts and delivered either via vascular delivery (“Mito V”; FIG. 6B) or via nebulization (“Mito Neb”; FIG. 6D). Analysis of mitochondrial uptake showed the majority of mitochondria based on signal intensity were globally distributed throughout the lung in Mito V and in Mito Neb (FIG. 6B and FIG. 6D). Immunohistochemical analysis showed that the transplanted mitochondria were detected in alveoli and in connective tissue in both Mito V and Mito Neb (FIG. 6B and FIG. 6D).
The transplanted mitochondria were found throughout the lung tissue, demonstrating that mitochondria delivered by either infusion into pulmonary artery or by aerosol delivery via the trachea via nebulization were effectively taken up in the lung.
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A method for increasing efficacy of a chemotherapeutic agent in a subject the method comprising administering to a subject who is or will be undergoing treatment with a chemotherapeutic agent and a therapeutically effective amount of a composition comprising mitochondria, to thereby increase the efficacy of the chemotherapeutic agent in the subject.
2. The method of claim 1, wherein the mitochondria are respiration-competent mitochondria.
3. The method of claim 1, wherein the mitochondria are delivered via the organ-specific vasculature.
4. The method of claim 3, wherein the organ to which the mitochondria are delivered is the lung, liver, kidney, prostate, heart, breast, ovary or pancreas.
5. The method of claim 1, wherein the mitochondria are delivered via nebulization.
6. The method of claim 1, wherein the chemotherapeutic agent is administered to the subject before the composition comprising mitochondria is administered to the subject.
7. The method of claim 1, wherein the chemotherapeutic agent is administered to the subject after the composition comprising mitochondria is administered to the subject.
8. The method of claim 1, wherein the chemotherapeutic agent and the composition comprising mitochondria are administered to the subject at about the same time.
9. The method of claim 1, wherein the method increases the efficacy of the
chemotherapeutic agent by at least 50%, 60%, 70%, 80%, 90%, 1 fold, 2 folds, 3 folds, or 5 folds.
10. The method of claim 1, wherein the therapeutically effective dose of the
chemotherapeutic agent is at least 10% lower than an FDA-approved dose for the chemotherapeutic agent.
11. The method of claim 1, wherein the subject has cancer.
12. The method of claim 11, wherein the cancer is a solid tumor.
13. The method of claim 11, wherein the cancer is prostate cancer.
14. The method of claim 1, wherein the chemotherapeutic agent is cisplatin or docetaxel.
15. The method of claim 1, wherein lxlO5 to lxlO9 of mitochondria is administered to the subject.
16. The method of claim 1, wherein the composition comprising mitochondria is administered to the subject by injection, through the subject’s respiratory tract, or through a blood vessel of the subject.
17. The method of claim 1, wherein the mitochondria are autogenic, allogeneic, or xenogeneic.
18. The method of claim 1, wherein the composition further comprises a pharmaceutically acceptable diluent, excipient, or carrier.
19. The method of claim 1, wherein the mitochondria are genetically modified.
20. The method of claim 1, wherein the mitochondria comprise exogenous polypeptide.
21. The method of claim 1, wherein the mitochondria comprise exogenous
polynucleotide.
22. The method of claim 1, wherein the mitochondria prior to administration to the subject are incubated with a composition comprising an enzyme.
23. A method for administering a chemotherapeutic agent to a subject, the method comprising:
(a) administering to the subject a therapeutically effective amount of a composition comprising mitochondria; and
(b) before, during, or after (a), administering to the subject at least one dose of a chemotherapeutic agent, wherein the dose is at least 10% lower than an FDA-approved dose for the chemotherapeutic agent.
24. The method of claim 23, wherein the chemotherapeutic agent is administered to the subject before the composition comprising mitochondria is administered to the subject.
25. The method of claim 23, wherein the chemotherapeutic agent is administered to the subject after the composition comprising mitochondria is administered to the subject.
26. The method of claim 23, wherein the chemotherapeutic agent is administered to the subject during administration of the composition comprising mitochondria.
27. The method of claim 23, wherein the dose is at least 20%, 30%, 40%, 50%, 60%,
70%, 80%, or 90%, lower than the FDA-approved dose for the chemotherapeutic agent .
28. The method of claim 23, wherein the subject has cancer.
29. The method of claim 28, wherein the cancer is prostate cancer.
30. The method of claim 23, wherein the chemotherapeutic agent is cisplatin, or docetaxel.
31. The method of claim 23, wherein lxlO5 to lxlO9 of mitochondria is administered to the subject.
32. The method of claim 23, wherein the composition comprising mitochondria is administered to the subject by injection, through the subject’s respiratory tract, or through a blood vessel in the subject.
33. The method of claim 23, wherein the mitochondria are autogenic, allogeneic, or xenogeneic.
34. The method of claim 23, wherein the mitochondria are genetically modified.
35. The method of claim 23, wherein the mitochondria comprise exogenous polypeptide.
36. The method of claim 23, wherein the mitochondria comprise exogenous
polynucleotide.
37. A composition comprising a therapeutically effective amount of mitochondria, and a therapeutically effective amount of a chemotherapeutic agent, wherein the chemotherapeutic agent is not linked to the mitochondria.
38. The composition of claim 37, wherein the chemotherapeutic agent is cisplatin, or docetaxel.
39. The composition of claim 37, wherein the composition comprises lxlO5 to lxlO9 of mitochondria.
40. The composition of claim 37, wherein the mitochondria are autogenic, allogeneic, or xenogeneic.
41. The composition of claim 37, wherein the mitochondria are genetically modified.
42. The composition of claim 37, wherein the mitochondria comprise exogenous polypeptide.
43. The composition of claim 37, wherein the mitochondria comprise exogenous polynucleotide.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962845064P | 2019-05-08 | 2019-05-08 | |
| US62/845,064 | 2019-05-08 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020227682A1 true WO2020227682A1 (en) | 2020-11-12 |
Family
ID=73051219
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/032222 Ceased WO2020227682A1 (en) | 2019-05-08 | 2020-05-08 | Treating cancer |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2020227682A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024252284A1 (en) * | 2023-06-07 | 2024-12-12 | Universidad San Francisco De Quito Usfq | Method for modifying and damaging mitochondria by means of radiation |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080166344A1 (en) * | 2006-12-29 | 2008-07-10 | Astellas Pharma Inc. | Method of treating cancer by co-administration of anticancer agents |
| US20140193511A1 (en) * | 2011-09-11 | 2014-07-10 | Minovia Therapeutics Ltd. | Compositions Of Functional Mitochondria And Uses Thereof |
| US20170120237A1 (en) * | 2014-06-13 | 2017-05-04 | Children's Medical Center Corporation | Products and methods to isolate mitochondria |
| US20170151287A1 (en) * | 2015-11-30 | 2017-06-01 | Flagship Ventures Management, Inc. | Methods and compositions of chondrisomes |
| US20180057610A1 (en) * | 2016-01-15 | 2018-03-01 | Children's Medical Center Corporation | Therapeutic Use of Mitochondria and Combined Mitochondrial Agent |
-
2020
- 2020-05-08 WO PCT/US2020/032222 patent/WO2020227682A1/en not_active Ceased
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080166344A1 (en) * | 2006-12-29 | 2008-07-10 | Astellas Pharma Inc. | Method of treating cancer by co-administration of anticancer agents |
| US20140193511A1 (en) * | 2011-09-11 | 2014-07-10 | Minovia Therapeutics Ltd. | Compositions Of Functional Mitochondria And Uses Thereof |
| US20170120237A1 (en) * | 2014-06-13 | 2017-05-04 | Children's Medical Center Corporation | Products and methods to isolate mitochondria |
| US20170151287A1 (en) * | 2015-11-30 | 2017-06-01 | Flagship Ventures Management, Inc. | Methods and compositions of chondrisomes |
| US20180057610A1 (en) * | 2016-01-15 | 2018-03-01 | Children's Medical Center Corporation | Therapeutic Use of Mitochondria and Combined Mitochondrial Agent |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024252284A1 (en) * | 2023-06-07 | 2024-12-12 | Universidad San Francisco De Quito Usfq | Method for modifying and damaging mitochondria by means of radiation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12527874B2 (en) | Bioorthogonal compositions | |
| CN111787945B (en) | Engineered nanovesicles as checkpoint blockers for cancer immunotherapy | |
| JP6092824B2 (en) | Combinations and modes of administration of therapeutic agents and combination therapy | |
| US10800817B2 (en) | Compositions and methods for treating diseases by inhibiting exosome release | |
| JP7551110B2 (en) | Cell population-mediated delivery of checkpoint inhibitors for cancer immunotherapy | |
| US20200078459A1 (en) | Near infrared (nir) photodynamic therapy (pdt) in combination with chemotherapy | |
| JP2020535171A (en) | Castration-resistant prostate cancer | |
| US10925852B2 (en) | Talc-bound compositions and uses thereof | |
| JP2019517477A (en) | Drug delivery nanoparticles and treatments for drug resistant cancer | |
| US20210205475A1 (en) | Mitochondrial optogenetics-based gene therapy for treating cancer | |
| US20240342211A1 (en) | Short-term activated dc1s and methods for their production and use | |
| WO2020227682A1 (en) | Treating cancer | |
| US20220370496A1 (en) | Her3 pulsed dc1 therapy | |
| US20250049936A1 (en) | Bioorthogonal compositions | |
| US20250375458A1 (en) | Compositions and methods to combat multidrug-resistant and persistent t-cell-mediated, oncological and infectious diseases | |
| HK40112162A (en) | Targeted protein contrast agents, methods of making, and uses thereof | |
| WO2025207803A1 (en) | Lipid compounds, compositions and methods of use thereof | |
| CN118846116A (en) | A biomimetic system that can instantly open cell membranes | |
| WO2025171300A1 (en) | Lipids and lipid nanoparticles comprising the same | |
| HK1206281B (en) | Hemoglobin-based oxygen carrier-containing pharmaceutical composition for cancer targeting treatment and prevention of cancer recurrence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20802218 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20802218 Country of ref document: EP Kind code of ref document: A1 |