WO2020223215A1 - Optimized sumf1 genes and expression cassettes and their use - Google Patents

Optimized sumf1 genes and expression cassettes and their use Download PDF

Info

Publication number
WO2020223215A1
WO2020223215A1 PCT/US2020/030236 US2020030236W WO2020223215A1 WO 2020223215 A1 WO2020223215 A1 WO 2020223215A1 US 2020030236 W US2020030236 W US 2020030236W WO 2020223215 A1 WO2020223215 A1 WO 2020223215A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression cassette
vector
aav
polynucleotide
sumf1
Prior art date
Application number
PCT/US2020/030236
Other languages
French (fr)
Inventor
Steven James Gray
Rachel BAILEY
Original Assignee
The University Of North Carolina At Chapel Hill
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The University Of North Carolina At Chapel Hill filed Critical The University Of North Carolina At Chapel Hill
Priority to US17/606,890 priority Critical patent/US20220213450A1/en
Priority to CA3144654A priority patent/CA3144654A1/en
Priority to EP20798551.6A priority patent/EP3963073A4/en
Publication of WO2020223215A1 publication Critical patent/WO2020223215A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0051—Oxidoreductases (1.) acting on a sulfur group of donors (1.8)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/44—Oxidoreductases (1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y108/00—Oxidoreductases acting on sulfur groups as donors (1.8)
    • C12Y108/03—Oxidoreductases acting on sulfur groups as donors (1.8) with oxygen as acceptor (1.8.3)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/16143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171—Demonstrated in vivo effect
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Definitions

  • This invention relates to polynucleotides comprising optimized SUMFl open reading frame (ORF) sequences, vectors comprising the same, and methods of using the same for delivery of the ORF to a cell or a subject and to treat disorders associated with aberrant expression of a SUMFl gene or aberrant activity of a SUMFl gene product in the subject, such as multiple sulfatase deficiency.
  • ORF open reading frame
  • the 9-exon sulfatase modifying factor- 1 (SUMFl ) gene encodes formylglycine generating enzyme (FGE), which is required for post-translational modification and activation of sulfatase enzymes (Dierks et a! 2005 Cell 121 (4): 541 -552).
  • FGE formylglycine generating enzyme
  • pathogenic mutations in the SUMFl gene impact the function of all 17 human sulfatase enzymes (Sardiello et al. 2005 Hum. Mol Genet. 14(21):3203-3217; Cosma et al. 2003 Cell 113:445- 456).
  • FGE modifies a common active site cysteine residue into C-alpha-formylglycine. Without this post-translational modification, sulfatase activity is absent, leading to multiple sulfatase deficiency (MSD).
  • MSD sulfatase deficiency
  • MSD metachromatic leukodystrophy
  • MPD metachromatic leukodystrophy
  • MPS mucopolysaccharidoses
  • X-linked ichthyosis X-linked chondrodysplasia punctata
  • all other sulfatases without known clinical correlation also contribute to the complex and variable phenotype found in individuals with MSD (Ahrens-Nicklas et al. 2018).
  • the late infantile forms include a severe and mild form that onset before or after 2 years of age, respectively.
  • the late infantile forms are characterized by progressive neurodegeneration, such as that observed in metachromatic leukodystrophy; however, individuals may also demonstrate MPS-like somatic symptoms.
  • the juvenile subtype is characterized by a later onset and attenuated symptoms.
  • this is the“mildest” form of MSD
  • individuals with juvenile MSD are affected by severe neurologic impairment by early childhood and premature death. While the existence of an adult-onset form of the disease has been postulated, no genetically confirmed adult-onset individuals have been reported in the literature. All clinical subtypes of MSD present in early childhood and experience severe, progressive central nervous system (CNS) dysfunction. Additionally, most individuals also are affected by extensive somatic involvement, and unfortunately, all affected individuals die by early adulthood mostly due to secondary problems as a result of MSD symptoms.
  • CNS central nervous system
  • the present invention is based, in part, on the development of optimized SUMF1 genes, expression cassettes, and vectors capable of providing therapeutic levels of SUMF1 expression for treating disorders associated with SUMF1 expression such as SUMF1 disease.
  • one aspect of the invention relates to a polynucleotide comprising a human SUMF1 open reading frame, wherein the human SUMF1 open reading frame has been codon-optimized for expression in human cells.
  • a further aspect of the invention relates to an expression cassette comprising a polynucleotide comprising a human SUMF1 open reading frame and vectors, transformed cells, and transgenic animals comprising the polynucleotide of the invention.
  • Another aspect of the invention relates to a pharmaceutical formulation comprising the polynucleotide, expression cassette, vector, and/or transformed cell of the invention in a pharmaceutically acceptable carrier.
  • An additional aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a cell, comprising contacting the cell with the polynucleotide, expression cassette, and/or vector of the invention, thereby expressing the SUMF1 open reading frame in the cell.
  • a further aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a subject, comprising delivering to the subject the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, thereby expressing the SUMF1 open reading frame in the subject.
  • An additional aspect of the invention relates to a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, such that the SUMF1 open reading frame is expressed in the subject.
  • a further aspect of the invention relates to a method of treating multiple sulfatase deficiency (MSD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, such that the SUMF1 open reading frame is expressed in the subject.
  • MSD multiple sulfatase deficiency
  • Another aspect of the invention relates to a polynucleotide, expression cassette, vector, and/or transformed cell of the invention for use in a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product in a subject in need thereof.
  • FIG. 1 shows similarities in protein sequence between different species.
  • Human (homo) SUMF1 protein sequence (SEQ ID NO: 11) compared to the mouse (mus; 90.27%; SEQ ID NO: 13), rat (rattus; 90.56%; SEQ ID NO: 14) and monkey (macaca; 96.77%; SEQ ID NO: 12) retain high level of amino acid identity.
  • the N-terminal signal peptide from the sequence was removed prior to the comparison.
  • the asterisk (*) annotates a fully conserved amino acid residue
  • colon colon
  • period (.) annotates weakly similar residues. Amino acids that are not conserved are not annotated.
  • FIGS. 2A-2B show AAV9/SUMF1 therapy in Sumfl-/- neonates improves survival.
  • Sumfl-/- mice received a single dose of AAV9/SUMF1 via ICV on PNDl .
  • Control cohorts did not receive any dosing or received a single dose of vehicle.
  • FIG. 2A shows survival curve for mice in each cohort.
  • FIG. 2B shows mean body weight of each cohort. Body weight of mice that were alive at the time of data collection have been included. Legend: Listed in the top comer of the figure applies to both panels.
  • FIGS. 3A-3B show AAV9/SUMF1 therapy in symptomatic Sumfl-/- mice improves survival. Sumfl-/- and Sumfl+/+ mice received a single dose of AAV9/SUMF1 via IT on PND7. Control cohorts did not receive any dosing or received a single dose of vehicle.
  • FIG. 3A shows survival curve for mice in each cohort.
  • FIG. 3B shows mean body weight of each cohort. Body weight of mice that were alive at the time of data collection have been included.
  • Nucleotide sequences are presented herein by single strand only, in the 5’ to 3’ direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 C.F.R. ⁇ 1.822 and established usage.
  • the term“about,” as used herein when referring to a measurable value such as an amount of a compound or agent of this invention, dose, time, temperature, and the like, is meant to encompass variations of ⁇ 10%, ⁇ 5%, ⁇ 1%, ⁇ 0.5%, or even ⁇ 0.1% of the specified amount.
  • transitional phrase“consisting essentially of’ is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.
  • the term“consisting essentially of’ as used herein should not be interpreted as equivalent to“comprising.”
  • the total of ten or less additional nucleotides or amino acids includes the total number of additional nucleotides or amino acids added together.
  • the term“materially altered,” as applied to polynucleotides of the invention refers to an increase or decrease in ability to express the encoded polypeptide of at least about 50% or more as compared to the expression level of a polynucleotide consisting of the recited sequence.
  • the term“materially altered,” as applied to polypeptides of the invention refers to an increase or decrease in biological activity of at least about 50% or more as compared to the activity of a polypeptide consisting of the recited sequence.
  • parvovirus encompasses the family Parvoviridae, including autonomously-replicating parvoviruses and dependoviruses.
  • the autonomous parvoviruses include members of the genera Parvovirus , Erythrovirus , Densovirus, Iteravirus , and Contravirus .
  • Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, HI parvovirus, muscovy duck parvovirus, snake parvovirus, and B19 virus.
  • Other autonomous parvoviruses are known to those skilled in the art. See, e.g., FIELDS el al. , VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • the genus Dependovirus contains the adeno-associated viruses (AAV), including but not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, avian AAV, bovine AAV, canine AAV, goat AAV, snake AAV, equine AAV, and ovine AAV. See, e.g., FIELDS et al. , VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers); and Table 1.
  • AAV adeno-associated viruses
  • AAV adeno-associated virus
  • AAV type 1 AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV and any other AAV now known or later discovered. See, e.g., BERNARD N. FIELDS et al. , VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • AAV serotypes and clades have been identified (see, e.g, Gao et al. , (2004) J. Virol. 78:6381-6388 and Table 2), which are also encompassed by the term“AAV.”
  • the parvovirus particles and genomes of the present invention can be from, but are not limited to, AAV.
  • the genomic sequences of various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the native ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank.
  • AAV1, AAV2 and AAV3 ITR sequences are provided by Xiao, X., (1996), “Characterization of Adeno-associated virus (AAV) DNA replication and integration,” Ph.D. Dissertation, University of Pittsburgh, Pittsburgh, PA (incorporated herein it its entirety).
  • A“chimeric” AAV nucleic acid capsid coding sequence or AAV capsid protein is one that combines portions of two or more capsid sequences.
  • A“chimeric” AAV virion or particle comprises a chimeric AAV capsid protein.
  • the term“tropism” as used herein refers to preferential entry of the virus into certain cell or tissue type(s) and/or preferential interaction with the cell surface that facilitates entry into certain cell or tissue types, optionally and preferably followed by expression (e.g ., transcription and, optionally, translation) of sequences carried by the viral genome in the cell, e.g., for a recombinant virus, expression of the heterologous nucleotide sequence(s).
  • transcription of a heterologous nucleic acid sequence from the viral genome may not be initiated in the absence of trans-acting factors, e.g, for an inducible promoter or otherwise regulated nucleic acid sequence.
  • gene expression from the viral genome may be from a stably integrated provirus and/or from a non-integrated episome, as well as any other form which the virus nucleic acid may take within the cell.
  • the term“tropism profile” refers to the pattern of transduction of one or more target cells, tissues and/or organs.
  • Representative examples of chimeric AAV capsids have a tropism profile characterized by efficient transduction of cells of the central nervous system (CNS) with only low transduction of peripheral organs (see e.g. , US Patent No. 9,636,370 McCown et al., and US patent publication 2017/0360960 Gray et al.).
  • disorder associated with aberrant expression of a SUMF1 gene refers to a disease, disorder, syndrome, or condition that is caused by or a symptom of decreased or altered expression of the SUMF1 gene in a subject relative to the expression level in a normal subject or in a population.
  • disorder associated with aberrant activity of a SUMF1 gene product refers to a disease, disorder, syndrome, or condition that is caused by or a symptom of decreased or altered activity of the SUMF1 gene product in a subject relative to the activity in a normal subject or in a population.
  • a disorder associated with aberrant activity of a SUMF1 gene product may be multiple sulfatase deficiency (e.g neonatal, severe late infantile, mild late infantile, juvenile, and/or adult-onset MSD).
  • Sulfatases are a conserved family of enzymes catalyzing hydrolysis of ester sulfates (Preusser-Kunze et al. 2005 J. Biol. Chem. 280(15): 14900-14910; Landgrebe et al. 2003 Gene. 316:47-56). In humans there are 17 sulfatases localized to various subcellular regions where they metabolize specific substrates (Sardiello et al.
  • GAGs glycosaminoglycans
  • sulfolipids sulfolipids
  • steroid sulfates sulfates
  • Post- translational activation of these sulfatase enzymes is dependent upon modification of a conserved catalytic domain cysteine within a conserved amino acid sequence recognized by FGE in every sulfatase (Schmidt et al. 1995 Cell. 82(2);271-278).
  • SUMFl-e ncoded FGE is the only enzyme capable of performing this modification in mammals (Dierks et al. 2009 Biochim. Biophys. Acta.
  • SUMF1 has been conserved through evolution retaining high level of homology across species.
  • the enzyme s stability and activity highly depend on disulfide bridges within the protein and cysteine residues in the active site. These residues are identical throughout species and allow similar fold and function of any SUMF1 homologue (Dierks et al. 2009; Landgrebe et al. 2003; Carlson et al. 2008 J. Biol. Chem. 283(29):20117-20125).
  • SUMF2 a highly similar paralogue of SUMF1 gene, lacks catalytic activity and is not able to activate sulfatases (Carlson et al. 2008). Overexpression of SUMFl in cell and animal models and in combination with sulfatases does not result in any pathophysiology (Spampanato et al. 2011 Mol. Ther. 19(5): 860-869).
  • “transduction” of a cell by a virus vector means entry of the vector into the cell and transfer of genetic material into the cell by the incorporation of nucleic acid into the virus vector and subsequent transfer into the cell via the virus vector.
  • “efficient transduction” or“efficient tropism,” or similar terms can be determined by reference to a suitable positive or negative control (e.g., at least about 50%, 60%, 70%, 80%, 85%, 90%, 95% or more of the transduction or tropism, respectively, of a positive control or at least about 110%, 120%, 150%, 200%, 300%, 500%, 1000% or more of the transduction or tropism, respectively, of a negative control).
  • a virus“does not efficiently transduce” or“does not have efficient tropism” for a target tissue, or similar terms by reference to a suitable control.
  • the virus vector does not efficiently transduce (i.e., does not have efficient tropism for) tissues outside the CNS, e.g., liver, kidney, gonads and/or germ cells.
  • undesirable transduction of tissue(s) e.g, liver
  • a “3’ portion” of a polynucleotide indicates a segment of the polynucleotide that is downstream of another segment.
  • the term“3’ portion” is not intended to indicate that the segment is necessarily at the 3’ end of the polynucleotide, or even that it is necessarily in the 3’ half of the polynucleotide, although it may be.
  • a“5’ portion” of a polynucleotide indicates a segment of the polynucleotide that is upstream of another segment.
  • the term“5’ portion” is not intended to indicate that the segment is necessarily at the 5’ end of the polynucleotide, or even that it is necessarily in the 5’ half of the polynucleotide, although it may be.
  • polypeptide encompasses both peptides and proteins, unless indicated otherwise.
  • A“polynucleotide,”“nucleic acid,” or“nucleotide sequence” may be of RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotides), but is preferably either a single or double stranded DNA sequence.
  • a promoter refers to a genetic element which controls some aspect of the expression of nucleic acid sequences.
  • a promoter is a regulatory element which facilitates the initiation of transcription of an operably linked coding region.
  • Other regulatory elements are splicing signals, polyadenylation signals, termination signals, etc.
  • the region in a nucleic acid sequence or polynucleotide in which one or more regulatory elements are found may be referred to as a“regulatory region.”
  • the term“operably linked” refers to a functional linkage between two or more nucleic acids.
  • a promoter sequence may be described as being“operably linked” to a heterologous nucleic acid sequence because the promoter sequences initiates and/or mediates transcription of the heterologous nucleic acid sequence.
  • the operably linked nucleic acid sequences are contiguous and/or are in the same reading frame.
  • the term“coding region” may be used interchangeably with open reading frame.
  • the term“codon-optimized,” as used herein, refers to a gene coding sequence that has been optimized to increase expression by substituting one or more codons normally present in a coding sequence (for example, in a wild-type sequence, including, e.g, a coding sequence for SUMF1) with a codon for the same (synonymous) amino acid.
  • a coding sequence for example, in a wild-type sequence, including, e.g, a coding sequence for SUMF1
  • the optimization substitutes one or more rare codons (that is, codons for tRNA that occur relatively infrequently in cells from a particular species) with synonymous codons that occur more frequently to improve the efficiency of translation.
  • Codon optimization can also increase gene expression through other mechanisms that can improve efficiency of transcription and/or translation.
  • Strategies include, without limitation, increasing total GC content (that is, the percent of guanines and cytosines in the entire coding sequence), decreasing CpG content (that is, the number of CG or GC dinucleotides in the coding sequence), removing cryptic splice donor or acceptor sites, and/or adding or removing ribosomal entry sites, such as Kozak sequences.
  • a codon-optimized gene exhibits improved protein expression, for example, the protein encoded thereby is expressed at a detectably greater level in a cell compared with the level of expression of the protein provided by the wild-type gene in an otherwise similar cell.
  • sequence identity has the standard meaning in the art. As is known in the art, a number of different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 45:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci.
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J Mol. Evol. 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5: 151 (1989).
  • BLAST algorithm Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al. , J. Mol. Biol. 275:403 (1990) and Karlin et al, Proc. Natl. Acad. Sci. USA 90: 5873 (1993).
  • a particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al. , Meth. Enzymol. , 266: 460 (1996); blast. wustl/edu/blast/README.html.
  • WU-BLAST-2 uses several search parameters, which are preferably set to the default values. The parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.
  • a percentage amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the“longer” sequence in the aligned region.
  • The“longer” sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).
  • percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in the candidate sequence that are identical with the nucleotides in the polynucleotide specifically disclosed herein.
  • the alignment may include the introduction of gaps in the sequences to be aligned.
  • the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides.
  • sequence identity of sequences shorter than a sequence specifically disclosed herein will be determined using the number of nucleotides in the shorter sequence, in one embodiment.
  • percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.
  • identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of“0,” which obviates the need for a weighted scale or parameters as described below for sequence similarity calculations.
  • Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the“shorter” sequence in the aligned region and multiplying by 100. The“longer” sequence is the one having the most actual residues in the aligned region.
  • an“isolated” nucleic acid or nucleotide sequence e.g an“isolated DNA” or an“isolated RNA
  • an“isolated DNA” or an“isolated RNA” means a nucleic acid or nucleotide sequence separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the nucleic acid or nucleotide sequence.
  • an “isolated” polypeptide means a polypeptide that is separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.
  • the term“modified,” as applied to a polynucleotide or polypeptide sequence refers to a sequence that differs from a wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.
  • virus vector As used herein, by“isolate” (or grammatical equivalents) a virus vector, it is meant that the virus vector is at least partially separated from at least some of the other components in the starting material.
  • “treat,” “treating,” or“treatment of’ is meant to reduce or to at least partially improve or ameliorate the severity of the subject’s condition and/or to alleviate, mitigate or decrease in at least one clinical symptom and/or to delay the progression of the condition.
  • the term“prevent,”“prevents,” or“prevention” means to delay or inhibit the onset of a disease.
  • the terms are not meant to require complete abolition of disease, and encompass any type of prophylactic treatment to reduce the incidence of the condition or delays the onset of the condition.
  • A“treatment effective” amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject.
  • a“treatment effective” amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one clinical symptom in the subject.
  • the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.
  • A“prevention effective” amount as used herein is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention.
  • the level of prevention need not be complete, as long as some benefit is provided to the subject.
  • A“heterologous nucleotide sequence” or“heterologous nucleic acid,” with respect to a virus, is a sequence or nucleic acid, respectively, that is not naturally occurring in the virus.
  • the heterologous nucleic acid or nucleotide sequence comprises an open reading frame that encodes a polypeptide and/or a nontranslated RNA.
  • A“vector” refers to a compound used as a vehicle to carry foreign genetic material into another cell, where it can be replicated and/or expressed.
  • a cloning vector containing foreign nucleic acid is termed a recombinant vector.
  • nucleic acid vectors are plasmids, viral vectors, cosmids, expression cassettes, and artificial chromosomes.
  • Recombinant vectors typically contain an origin of replication, a multicloning site, and a selectable marker.
  • the nucleic acid sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that serves as the“backbone” of the vector.
  • vectors which transfers genetic information to another cell
  • expression vectors are for the expression of the exogenous gene in the target cell, and generally have a promoter sequence that drives expression of the exogenous gene/ORF. Insertion of a vector into the target cell is referred to transformation or transfection for bacterial and eukaryotic cells, although insertion of a viral vector is often called transduction.
  • the term“vector” may also be used in general to describe items to that serve to carry foreign genetic material into another cell, such as, but not limited to, a transformed cell or a nanoparticle.
  • the term“vector,”“virus vector,”“delivery vector” in a specific embodiment generally refers to a virus particle that functions as a nucleic acid delivery vehicle, and which comprises the viral nucleic acid (i.e., the vector genome) packaged within the virion.
  • Virus vectors according to the present invention comprise a chimeric AAV capsid according to the invention and can package an AAV or rAAV genome or any other nucleic acid including viral nucleic acids.
  • the term“vector,”“virus vector,”“delivery vector” may be used to refer to the vector genome (e.g ., vDNA) in the absence of the virion and/or to a viral capsid that acts as a transporter to deliver molecules tethered to the capsid or packaged within the capsid.
  • the virus vectors of the invention can further be duplexed parvovirus particles as described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety).
  • double stranded (duplex) genomes can be packaged.
  • A“recombinant AAV vector genome” or“rAAV genome” is an AAV genome (i.e., vDNA) that comprises at least one inverted terminal repeat (e.g., one, two or three inverted terminal repeats) and one or more heterologous nucleotide sequences.
  • rAAV vectors generally retain the 145 base terminal repeat(s) (TR(s)) in c/s to generate virus; however, modified AAV TRs and non-AAV TRs including partially or completely synthetic sequences can also serve this purpose. All other viral sequences are dispensable and may be supplied in trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97).
  • the rAAV vector optionally comprises two TRs (e.g, AAV TRs), which generally will be at the 5’ and 3’ ends of the heterologous nucleotide sequence(s), but need not be contiguous thereto.
  • the TRs can be the same or different from each other.
  • the vector genome can also contain a single ITR at its 3’ or 5’ end.
  • the term“terminal repeat” or“TR” includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (ITR) (i.e., mediates the desired functions such as replication, virus packaging, integration and/or provirus rescue, and the like).
  • the TR can be an AAV TR or a non-AAV TR.
  • a non-AAV TR sequence such as those of other parvoviruses (e.g, canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as a TR, which can further be modified by truncation, substitution, deletion, insertion and/or addition.
  • the TR can be partially or completely synthetic, such as the“double-D sequence” as described in United States Patent No. 5,478,745 to Samulski et al.
  • Parvovirus genomes have palindromic sequences at both their 5’ and 3’ ends.
  • the palindromic nature of the sequences leads to the formation of a hairpin structure that is stabilized by the formation of hydrogen bonds between the complementary base pairs.
  • This hairpin structure is believed to adopt a“Y” or a“T” shape. See, e.g., FIELDS et al, VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
  • An“AAV terminal repeat” or“AAV TR” may be from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 or any other AAV now known or later discovered (see, e.g, Table 2).
  • An AAV terminal repeat need not have the native terminal repeat sequence (e.g, a native AAV TR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g, replication, virus packaging, integration, and/or provirus rescue, and the like.
  • rAAV particle and“rAAV virion” are used interchangeably here.
  • a “rAAV particle” or“rAAV virion” comprises a rAAV vector genome packaged within an AAV capsid.
  • the virus vectors of the invention can further be“targeted” virus vectors (e.g, having a directed tropism) and/or a“hybrid” parvovirus (i.e., in which the viral ITRs and viral capsid are from different parvoviruses) as described in international patent publication WO 00/28004 and Chao et al, (2000) Mol. Therapy 2:619.
  • “targeted” virus vectors e.g, having a directed tropism
  • a“hybrid” parvovirus i.e., in which the viral ITRs and viral capsid are from different parvoviruses
  • viral capsid or genomic elements can contain other modifications, including insertions, deletions and/or substitutions.
  • amino acid encompasses any naturally occurring amino acids, modified forms thereof, and synthetic amino acids, including non-naturally occurring amino acids.
  • the amino acid can be a modified amino acid residue (nonlimiting examples are shown in Table 4) or can be an amino acid that is modified by post-translation modification (e.g acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation or sulfatation).
  • post-translation modification e.g acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation or sulfatation.
  • non-naturally occurring amino acid can be an“unnatural” amino acid as described by Wang et al, (2006) Annu. Rev. Biophys. Biomol. Struct. 35:225-49. These unnatural amino acids can advantageously be used to chemically link molecules of interest to the AAV capsid protein.
  • the term“template” or“substrate” is used herein to refer to a polynucleotide sequence that may be replicated to produce the parvovirus viral DNA.
  • the template will typically be embedded within a larger nucleotide sequence or construct, including but not limited to a plasmid, naked DNA vector, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC) or a viral vector (e.g ., adenovirus, herpesvirus, Epstein-Barr Virus, AAV, baculoviral, retroviral vectors, and the like).
  • the template may be stably incorporated into the chromosome of a packaging cell.
  • parvovirus or AAV“Rep coding sequences” indicate the nucleic acid sequences that encode the parvoviral or AAV non- structural proteins that mediate viral replication and the production of new virus particles.
  • the parvovirus and AAV replication genes and proteins have been described in, e.g., FIELDS et al. , VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
  • The“Rep coding sequences” need not encode all of the parvoviral or AAV Rep proteins.
  • the Rep coding sequences do not need to encode all four AAV Rep proteins (Rep78, Rep 68, Rep52 and Rep40), in fact, it is believed that AAV5 only expresses the spliced Rep68 and Rep40 proteins.
  • the Rep coding sequences encode at least those replication proteins that are necessary for viral genome replication and packaging into new virions.
  • the Rep coding sequences will generally encode at least one large Rep protein ( i.e ., Rep78/68) and one small Rep protein ( i.e ., Rep52/40).
  • the Rep coding sequences encode the AAV Rep78 protein and the AAV Rep52 and/or Rep40 proteins. In other embodiments, the Rep coding sequences encode the Rep68 and the Rep52 and/or Rep40 proteins. In a still further embodiment, the Rep coding sequences encode the Rep68 and Rep52 proteins, Rep68 and Rep40 proteins, Rep78 and Rep52 proteins, or Rep78 and Rep40 proteins. [0088] As used herein, the term“large Rep protein” refers to Rep68 and/or Rep78. Large Rep proteins of the claimed invention may be either wild-type or synthetic.
  • a wild-type large Rep protein may be from any parvovirus or AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, or any other AAV now known or later discovered (see, e.g., Table 2).
  • a synthetic large Rep protein may be altered by insertion, deletion, truncation and/or missense mutations.
  • the replication proteins be encoded by the same polynucleotide.
  • the NS- 1 and NS-2 proteins (which are splice variants) may be expressed independently of one another.
  • the pl9 promoter may be inactivated and the large Rep protein(s) expressed from one polynucleotide and the small Rep protein(s) expressed from a different polynucleotide.
  • the viral promoters may not be recognized by the cell, and it is therefore necessary to express the large and small Rep proteins from separate expression cassettes.
  • the parvovirus or AAV “cap coding sequences” encode the structural proteins that form a functional parvovirus or AAV capsid (i.e., can package DNA and infect target cells).
  • the cap coding sequences will encode all of the parvovirus or AAV capsid subunits, but less than all of the capsid subunits may be encoded as long as a functional capsid is produced.
  • the cap coding sequences will be present on a single nucleic acid molecule.
  • the present invention relates to the design of a SUMF1 expression cassette to provide therapeutic levels of expression of formylglycine-generating enzyme (FGE), the enzyme encoded by the SUMF1 gene, and the use of the expression cassette to achieve therapeutic levels of SUMF1 and/or FGE in a subject.
  • FGE formylglycine-generating enzyme
  • one aspect of the invention relates to a polynucleotide comprising a mammalian SUM FI open reading frame (ORF), wherein the SEIMF1 open reading frame has been codon-optimized for expression in mammalian cells.
  • ORF mammalian SUM FI open reading frame
  • the term“mammal” as used herein includes, but is not limited to, humans, primates, non-human primates (e.g ., monkeys and baboons), cattle, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g., rats, mice, hamsters, and the like), etc.
  • the open reading frame is the portion of the SEIMF1 gene that encodes FGE.
  • the mammalian SUMF1 open reading frame may be a human SUMF1 open reading frame.
  • a mammalian SUMF1 ORF refers to a nucleotide sequence that encodes mammalian FGE, e.g, a human SUMF1 ORF refers to a nucleotide sequence that encodes a human FGE. Codon optimization is a technique well known in the art and optimal codons for expression in different species are known. The use of a codon-optimized SUMF1 sequence allows one to distinguish expression of the transduced sequence from expression of the endogenous SUMF1 sequence in a subject.
  • the codon-optimized SUMF1 open reading frame encodes an FGE enzyme that is modified from the wild-type sequence, e.g, comprises, consists essentially of, or consists of an amino acid sequence in which 1, 2, 3, 4, or 5 residues have been substituted, added, and/or deleted compared to the wild-type amino acid sequence.
  • the codon-optimized SUMF1 open reading frame comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: l or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • polynucleotide comprising a human SUMF1 open reading frame.
  • the polynucleotide is a human codon-optimized sequence, e.g., a polynucleotide comprising the nucleotide sequence of SEQ ID NO: l, or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • the SUMF1 open reading frame in the expression cassette may be operably linked to one or more expression elements that may enhance expression of SUMF1 and/or FGE.
  • the polynucleotide is operably linked to a promoter, e.g, a chicken beta- actin promoter, e.g, a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:2 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • a promoter e.g, a chicken beta- actin promoter, e.g, a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:2 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85,
  • the promoter further comprises the chimeric intron with chicken beta- actin splicing donor site and minute virus of mice (MVM) intron splicing acceptor site, e.g, comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO: 4, or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • VMM minute virus of mice
  • the polynucleotide is operably linked to a promoter, e.g., a CAGGS promoter, e.g, a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:5 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • a promoter e.g., a CAGGS promoter, e.g, a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:5 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • the polynucleotide is operably linked to an enhancer, e.g., a cytomegalovirus (CMV) enhancer, e.g, an enhancer comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:6 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • CMV enhancer e.g., an enhancer comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:6 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • CMV enhancer e.g., cytomegalovirus
  • the SUMF1 open reading frame is operably linked to a polyadenylation signal, e.g., a synthetic polyadenylation signal, e.g, a polyadenylation signal comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:7 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • a polyadenylation signal e.g., a synthetic polyadenylation signal, e.g, a polyadenylation signal comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:7 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97,
  • the SUMF 1 open reading frame is operably linked to a polyadenylation signal, e.g, a simian virus 40 (SV40) polyadenylation signal, e.g, a polyadenylation signal comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:8 or SEQ ID NO:9, or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • SV40 simian virus 40
  • SEQ ID NO:7 Synthetic polyadenylation signal (SpA)
  • SEQ ID NO:8 SEQ ID NO:8.
  • SV40 polyadenylation signal SV40pA
  • SV40 polyadenylation signal (SV40pA)
  • promoter/enhancer elements may be used depending on the level and tissue-specific expression desired.
  • the promoter/enhancer may be constitutive or inducible, depending on the pattern of expression desired.
  • the promoter/enhancer may be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced.
  • Promoter/enhancer elements can be native to the target cell or subject to be treated and/or native to the heterologous nucleic acid sequence.
  • the promoter/enhancer element is generally chosen so that it will function in the target cell(s) of interest.
  • the promoter/enhancer element is a mammalian promoter/enhancer element.
  • the promoter/enhance element may be constitutive or inducible.
  • Inducible expression control elements are generally used in those applications in which it is desirable to provide regulation over expression of the heterologous nucleic acid sequence(s).
  • Inducible promoters/enhancer elements for gene delivery can be tissue-specific or tissue-preferred promoter/enhancer elements, and include muscle specific or preferred (including cardiac, skeletal and/or smooth muscle), neural tissue specific or preferred (including brain-specific), eye (including retina-specific and cornea-specific), liver specific or preferred, bone marrow specific or preferred, pancreatic specific or preferred, spleen specific or preferred, and lung specific or preferred promoter/enhancer elements.
  • Other inducible promoter/enhancer elements include hormone-inducible and metal-inducible elements.
  • Exemplary inducible promoter s/enhancer elements include, but are not limited to, a Tet on/off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin- inducible promoter, and a metallothionein promoter.
  • initiation signals are generally employed for efficient translation of inserted protein coding sequences.
  • exogenous translational control sequences which may include the ATG initiation codon (i.e translation start site) and adjacent sequences, can be of a variety of origins, both natural and synthetic.
  • the expression cassette further comprises at least one adeno-associated virus (AAV) inverted terminal repeat (ITR), e.g., two AAV ITRs.
  • AAV adeno-associated virus
  • ITR inverted terminal repeat
  • the two ITRs may have the same nucleotide sequence or different nucleotide sequences.
  • the AAV ITRs may be from any AAV serotype, e.g, AAV2.
  • Each ITR independently may be the wild-type sequence or a modified sequence.
  • a modified ITR may have a D-element deletion (WO 01/92551).
  • a D-element deletion is defined as the removal of that portion of the ITR known as the D-element.
  • the D-element can be alternatively referred to or known as a D region, or D sequence, and/or the nucleotides of the ITR that do not form palindromic hairpin structures.
  • the expression cassette is an AAV genome, e.g., a self-complementary AAV genome.
  • the expression cassette comprises an enhancer, a promoter, a human SUMF1 open reading frame, and a polyadenylation site, optionally in the recited order.
  • the expression cassette comprises an AAV ITR, an enhancer, a promoter, a human SUMF1 open reading frame, a polyadenylation site, and an AAV ITR, optionally in the recited order.
  • the expression cassette comprises a CMV enhancer, a chicken beta actin promoter, a human SUMF1 open reading frame, and an SV40 polyadenylation site, optionally in the recited order.
  • the expression cassette comprises an AAV ITR, a CMV enhancer, a chicken beta actin promoter, a human SUMFl open reading frame, an SV40 polyadenylation site, and an AAV ITR, optionally in the recited order.
  • the expression cassette comprises an AAV2 ITR, a CMV enhancer, a chicken beta actin promoter, a human SUMFl open reading frame, an SV40 polyadenylation site, and an AA2V ITR, optionally in the recited order.
  • the expression cassette comprises a wildtype AAV2 ITR, a CMV enhancer, a chicken beta actin promoter, a human SUMFl open reading frame, an SV40 polyadenylation site, and a modified AA2V ITR, optionally in the recited order.
  • the aforementioned components are in operable linkage.
  • the expression cassette comprise, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 10 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
  • a further aspect of the invention relates to a vector comprising the polynucleotide or the expression cassette of the invention.
  • Suitable vectors include, but are not limited to, a plasmid, phage, viral vector (e.g an AAV vector, a lentiviral vector, an adenovirus vector, a herpesvirus vector, an alphavirus vector, or a baculovirus vector), bacterial artificial chromosome (BAC), or yeast artificial chromosome (YAC).
  • the nucleic acid can comprise, consist of, or consist essentially of an AAV vector comprising a 5’ and/or 3’ terminal repeat ( e.g ., 5’ and/or 3’ AAV terminal repeat).
  • the vector is a delivery vehicle such as a particle (e.g., a microparticle or nanoparticle) or a liposome to which the expression cassette is attached or in which the expression cassette is embedded.
  • the vector may be any delivery vehicle suitable to carry the expression cassette into a cell.
  • the vector is a viral vector, e.g, a lentiviral vector and/or an AAV vector.
  • the AAV vector may be any AAV serotype, e.g, AAV9.
  • the AAV vector may comprise wild-type capsid proteins.
  • the AAV vector may comprise a modified capsid protein with altered tropism compared to a wild-type capsid protein, e.g, a modified capsid protein is liver-detargeted or has enhanced tropism for particular cells.
  • the vector is a single-stranded AAV (ssAAV) vector.
  • the vector is a self-complementary or duplexed AAV (scAAV) vector.
  • scAAV vectors are described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety). Use of scAAV to express the SUMF1 ORF may provide an increase in the number of cells transduced, the copy number per transduced cell, or both.
  • An additional aspect of the invention relates to a transformed cell comprising the polynucleotide, expression cassette, and/or vector of the invention.
  • the polynucleotide, expression cassette, and/or vector is stably incorporated into the cell genome.
  • the cell may be an in vitro , ex vivo , or in vivo cell.
  • Another aspect of the invention relates to a transgenic animal comprising the polynucleotide, expression cassette, vector, and/or the transformed cell of the invention.
  • the animal is a laboratory animal, e.g, a mouse, rat, rabbit, dog, monkey, or non-human primate.
  • a further aspect of the invention relates to a pharmaceutical formulation comprising the polynucleotide, expression cassette, vector, and/or transformed cell of the invention in a pharmaceutically acceptable carrier.
  • the polynucleotide, expression cassette, vector, and/or transformed cell of the invention is isolated.
  • the polynucleotide, expression cassette, vector, and/or transformed cell of the invention is purified.
  • the present invention further provides methods of producing virus vectors.
  • the present invention provides a method of producing a recombinant AAV particle, comprising providing to a cell permissive for AAV replication: (a) a recombinant AAV template comprising (i) the polynucleotide or expression cassette of the invention, and (ii) an ITR; (b) a polynucleotide comprising Rep coding sequences and Cap coding sequences; under conditions sufficient for the replication and packaging of the recombinant AAV template; whereby recombinant AAV particles are produced in the cell.
  • Conditions sufficient for the replication and packaging of the recombinant AAV template can be, e.g., the presence of AAV sequences sufficient for replication of the AAV template and encapsidation into AAV capsids (e.g, AAV rep sequences and AAV cap sequences) and helper sequences from adenovirus and/or herpesvirus.
  • the AAV template comprises two AAV ITR sequences, which are located 5’ and 3’ to the polynucleotide of the invention, although they need not be directly contiguous thereto.
  • the recombinant AAV template comprises an ITR that is not resolved by Rep to make duplexed AAV vectors as described in international patent publication WO 01/92551.
  • the AAV template and AAV rep and cap sequences are provided under conditions such that virus vector comprising the AAV template packaged within the AAV capsid is produced in the cell.
  • the method can further comprise the step of collecting the virus vector from the cell.
  • the virus vector can be collected from the medium and/or by lysing the cells.
  • the cell can be a cell that is permissive for AAV viral replication. Any suitable cell known in the art may be employed.
  • the cell is a mammalian cell (e.g, a primate or human cell).
  • the cell can be a trans-complementing packaging cell line that provides functions deleted from a replication-defective helper virus, e.g, 293 cells or other El a trans-complementing cells.
  • the AAV replication and capsid sequences may be provided by any method known in the art. Current protocols typically express the AAV rep!cap genes on a single plasmid. The AAV replication and packaging sequences need not be provided together, although it may be convenient to do so.
  • the AAV rep and/or cap sequences may be provided by any viral or non-viral vector.
  • the rep! cap sequences may be provided by a hybrid adenovirus or herpesvirus vector (e.g, inserted into the El a or E3 regions of a deleted adenovirus vector). EBV vectors may also be employed to express the AAV cap and rep genes.
  • EBV vectors are episomal, yet will maintain a high copy number throughout successive cell divisions (i.e., are stably integrated into the cell as extra-chromosomal elements, designated as an “EBV based nuclear episome,” see Margolski, (1992) Curr. Top. Microbiol. Immun. 158:67).
  • the rep!cap sequences may be stably incorporated into a cell.
  • the AAV rep!cap sequences will not be flanked by the TRs, to prevent rescue and/or packaging of these sequences.
  • the AAV template can be provided to the cell using any method known in the art.
  • the template can be supplied by a non-viral (e.g ., plasmid) or viral vector.
  • the AAV template is supplied by a herpesvirus or adenovirus vector (e.g., inserted into the Ela or E3 regions of a deleted adenovirus).
  • a herpesvirus or adenovirus vector e.g., inserted into the Ela or E3 regions of a deleted adenovirus.
  • Palombo et al. (1998) J. Virology 72:5025, describes a baculovirus vector carrying a reporter gene flanked by the AAV TRs.
  • EBV vectors may also be employed to deliver the template, as described above with respect to the rep!cap genes.
  • the AAV template is provided by a replicating rAAV virus.
  • an AAV provirus comprising the AAV template is stably integrated into the chromosome of the cell.
  • helper virus functions e.g, adenovirus or herpesvirus
  • helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences will be provided by a helper adenovirus or herpesvirus vector.
  • the adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, e.g, as a non- infectious adenovirus miniplasmid that carries all of the helper genes that promote efficient AAV production as described by Ferrari et al. , (1997) Nature Med. 3: 1295, and U.S. Patent Nos. 6,040,183 and 6,093,570.
  • helper virus functions may be provided by a packaging cell with the helper sequences embedded in the chromosome or maintained as a stable extrachromosomal element.
  • helper virus sequences cannot be packaged into AAV virions, e.g, are not flanked by ITRs.
  • helper construct may be a non-viral or viral construct.
  • the helper construct can be a hybrid adenovirus or hybrid herpesvirus comprising the AAV rep!cap genes.
  • the AAV replcap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector.
  • This vector can further comprise the AAV template.
  • the AAV replcap sequences and/or the AAV template can be inserted into a deleted region (e.g ., the El a or E3 regions) of the adenovirus.
  • the AAV replcap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector.
  • the AAV template can be provided as a plasmid template.
  • the AAV replcap sequences and adenovirus helper sequences are provided by a single adenovirus helper vector, and the AAV template is integrated into the cell as a provirus.
  • the AAV template is provided by an EBV vector that is maintained within the cell as an extrachromosomal element (e.g., as an EBV based nuclear episome).
  • the AAV replcap sequences and adenovirus helper sequences are provided by a single adenovirus helper.
  • the AAV template can be provided as a separate replicating viral vector.
  • the AAV template can be provided by an AAV particle or a second recombinant adenovirus particle.
  • the hybrid adenovirus vector typically comprises the adenovirus 5’ and 3’ cis sequences sufficient for adenovirus replication and packaging (; i.e ., the adenovirus terminal repeats and PAC sequence).
  • the AAV replcap sequences and, if present, the AAV template are embedded in the adenovirus backbone and are flanked by the 5’ and 3’ cis sequences, so that these sequences may be packaged into adenovirus capsids.
  • the adenovirus helper sequences and the AAV replcap sequences are generally not flanked by ITRs so that these sequences are not packaged into the AAV virions.
  • Zhang et al. (2001 Gene Ther. 18:704-12) describe a chimeric helper comprising both adenovirus and the AAV rep and cap genes.
  • Herpesvirus may also be used as a helper virus in AAV packaging methods.
  • Hybrid herpesviruses encoding the AAV Rep protein(s) may advantageously facilitate scalable AAV vector production schemes.
  • a hybrid herpes simplex virus type I (HSV-1) vector expressing the AAV-2 rep and cap genes has been described (Conway et al., 1999 Gene Ther. 6:986 and WO 00/17377).
  • the virus vectors of the invention can be produced in insect cells using baculovirus vectors to deliver the replcap genes and AAV template as described, for example, by Urabe et al., 2002 Human Gene Ther. 13: 1935-43.
  • AAV vector stocks free of contaminating helper virus may be obtained by any method known in the art. For example, AAV and helper virus may be readily differentiated based on size. AAV may also be separated away from helper virus based on affinity for a heparin substrate (Zolotukhin et al. 1999 Gene Therapy 6:973). Deleted replication-defective helper viruses can be used so that any contaminating helper virus is not replication competent.
  • an adenovirus helper lacking late gene expression may be employed, as only adenovirus early gene expression is required to mediate packaging of AAV.
  • Adenovirus mutants defective for late gene expression are known in the art (e.g ., tslOOK and tsl49 adenovirus mutants).
  • the present invention also relates to methods for delivering a SUMF1 ORF to a cell or a subject to increase production of SUMF1 and/or FGE, e.g., for therapeutic or research purposes in vitro , ex vivo , or in vivo.
  • one aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a cell, comprising contacting the cell with the polynucleotide, expression cassette, and/or the vector of the invention, thereby expressing the SUMF1 open reading frame in the cell.
  • the cell is an in vitro cell, an ex vivo cell, or an in vivo cell. Expression of the present invention in vitro may be beneficial for research purposes, e.g, to evaluate efficacy and/or safety, prior to expression in vivo.
  • Another aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a subject, comprising delivering to the subject the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, thereby expressing the SUMF1 open reading frame in the subject.
  • the subject is an animal model of a disorder associated with aberrant SUMF1 gene expression.
  • a further aspect of the invention relates to a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product (e.g, FGE) in a subject in need thereof, comprising delivering to the subject a therapeutically effective amount of the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, thereby treating the disorder associated with aberrant expression of the SUMF1 gene or aberrant activity of a SUMF1 gene product in the subject.
  • a SUMF1 gene product e.g, FGE
  • the invention provides a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product (e.g, FGE) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, the expression cassette, vector, and/or transformed cell of the invention, such that the SUMF1 open reading frame is expressed in the subject.
  • a SUMF1 gene product e.g, FGE
  • the disorder associated with expression of the SUMF1 gene or gene product may be neonatal MSD.
  • the disorder associated with expression of the SUMF1 gene or gene product may be severe late infantile MSD.
  • the disorder associated with expression of the SUMF1 gene or gene product may be mild late infantile MSD. In some embodiments, the disorder associated with expression of the SUMF1 gene or gene product may be juvenile MSD. In some embodiments, the disorder associated with expression of the SUMFl gene or gene product may be adult-onset MSD.
  • the invention further provides a method of treating MSD in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, the expression cassette, vector, and/or transformed cell of the invention, such that the SUMFl open reading frame is expressed in the subject.
  • the methods of the present invention further comprise administering to the subject a bone marrow transplant (BMT), e.g., prior to administering the effective amount of a polynucleotide, expression cassette, vector, and/or transformed cell of the present invention.
  • BMT bone marrow transplant
  • Techniques for performing BMT are well known to those of skill in the art, and are routine for clinicians in the treatment of subjects (e.g, patients, e.g, human patients) in need thereof.
  • the skilled clinician can readily determine the proper regimen to be used for performing BMT based on factors including the age and condition of the subject, type of disease being treated, stage of the disease, patient size, and the like.
  • the polynucleotide, expression cassette, vector, and/or transformed cell is delivered to the subject, e.g, systemically (e.g, intravenously) or directly to the central nervous system (e.g, to the cerebrospinal fluid by intrathecal or intraventricular injection) of the subject.
  • the polynucleotide, expression cassette, vector, and/or transformed cell is delivered intravenously.
  • the polynucleotide, expression cassette, vector, and/or transformed cell is delivered intracerebroventricularly.
  • Recombinant virus vectors according to the present invention find use in both veterinary and medical applications. Suitable subjects include both avians and mammals.
  • avian as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasant, parrots, parakeets.
  • mammal as used herein includes, but is not limited to, humans, primates, non-human primates (e.g, monkeys and baboons), cattle, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g, rats, mice, hamsters, and the like), etc. Human subjects include neonates, infants, juveniles, and adults.
  • the subject is“in need of’ the methods of the present invention, e.g., because the subject has or is believed at risk for a disorder including those described herein or that would benefit from the delivery of a polynucleotide including those described herein.
  • the subject can be a laboratory animal and/or an animal model of disease.
  • the subject is a human.
  • the polynucleotide of the invention is administered to a subject in need thereof as early as possible in the life of the subject, e.g, as soon as the subject is diagnosed with aberrant SUMF1 and/or FGE expression or activity or any of the above-mentioned diseases or disorders.
  • the polynucleotide is administered to a newborn subject, e.g, after newborn screening has identified aberrant SUMF1 and/or FGE expression or activity.
  • the polynucleotide is administered to a subject prior to the age of 5 years, e.g, prior to 1, 2, 3, 4, or 5 years of age.
  • the polynucleotide is administered to a fetus in utero , e.g, after prenatal screening has identified aberrant SUMF1 and/or FGE expression or activity or the presence of one of the above-mentioned diseases or disorders. In some embodiments, the polynucleotide is administered to a subject as soon as the subject develops symptoms associated with aberrant SUMF1 and/or FGE expression or activity or is suspected or diagnosed as having aberrant SUMF1 and/or FGE expression or activity or one of the above- mentioned diseases or disorders.
  • the polynucleotide is administered to a subject before the subject develops symptoms associated with aberrant SUMF1 and/or FGE expression or activity or disease/disorder, e.g, a subject that is suspected or diagnosed as having aberrant SUMF1 and/or FGE expression or activity or one of the above-mentioned diseases or disorders but has not started to exhibit symptoms.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polynucleotide, expression cassette, vector, and/or transformed cell of the invention in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc.
  • the carrier will typically be a liquid.
  • the carrier may be either solid or liquid.
  • the carrier will be respirable, and will preferably be in solid or liquid particulate form.
  • a pharmaceutical carrier may be D-sorbitol (e.g, PBS 5% w/v D-sorbitol).
  • compositions that are not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects.
  • pharmaceutically acceptable it is meant a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects.
  • One aspect of the present invention is a method of transferring a SUMF1 ORF to a cell in vitro.
  • the polynucleotide, expression cassette, and/or vector of the invention may be introduced to the cells in the appropriate amount.
  • the virus vector may be introduced to the cells at the appropriate multiplicity of infection according to standard transduction methods appropriate for the particular target cells.
  • Titers of the virus vector or capsid to administer can vary, depending upon the target cell type and number, and the particular virus vector or capsid, and can be determined by those of skill in the art without undue experimentation. In particular embodiments, at least about 10 3 infectious units, more preferably at least about 10 5 infectious units are introduced to the cell.
  • the cell(s) into which the polynucleotide, expression cassette, and/or vector of the invention, e.g., virus vector, can be introduced may be of any type, including but not limited to neural cells (including cells of the peripheral and central nervous systems, in particular, brain cells such as neurons, oligodendrocytes, glial cells, astrocytes), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (e.g, gut and respiratory epithelial cells), skeletal muscle cells (including myoblasts, myotubes and myofibers), diaphragm muscle cells, dendritic cells, pancreatic cells (including islet cells), hepatic cells, a cell of the gastrointestinal tract (including smooth muscle cells, epithelial cells), heart cells (including cardiomyocytes), bone cells (e.g, bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocyte
  • the cell may be any progenitor cell.
  • the cell can be a stem cell (e.g, neural stem cell, liver stem cell).
  • the cell may be a cancer or tumor cell.
  • the cells can be from any species of origin, as indicated above.
  • the polynucleotide, expression cassette, and/or vector of the invention may be introduced to cells in vitro for the purpose of administering the modified cell to a subject.
  • the cells have been removed from a subject, the polynucleotide, expression cassette, and/or vector of the invention, e.g, virus vector, is introduced therein, and the cells are then replaced back into the subject.
  • Methods of removing cells from subject for treatment ex vivo , followed by introduction back into the subject are known in the art (see, e.g, U.S. patent No. 5,399,346).
  • the polynucleotide, expression cassette, and/or vector of the invention is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof.
  • Suitable cells for ex vivo gene therapy are as described above. Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 10 2 to about 10 8 or about 10 3 to about 10 6 cells will be administered per dose in a pharmaceutically acceptable carrier.
  • the cells transduced with the virus vector ex vivo are administered to the subject in an effective amount in combination with a pharmaceutical carrier.
  • a further aspect of the invention is a method of administering the polynucleotide, expression cassette, and/or vector of the invention, e.g., virus vector, to a subject.
  • the method comprises a method of delivering a SUMF1 ORF to an animal subject, the method comprising: administering an effective amount of a virus vector according to the invention to an animal subject.
  • Administration of the virus vectors of the present invention to a human subject or an animal in need thereof can be by any means known in the art.
  • the virus vector is delivered in an effective dose in a pharmaceutically acceptable carrier.
  • Dosages of the virus vectors to be administered to a subject will depend upon the mode of administration, the disease or condition to be treated, the individual subject’s condition, the particular virus vector, and the nucleic acid to be delivered, and can be determined in a routine manner.
  • Exemplary doses for achieving therapeutic effects are virus titers of at least about 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 transducing units or more, e.g., about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 transducing units, yet more preferably about 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 transducing units (TU).
  • Doses and virus titer transducing units may be calculated as vector or viral genomes (vg), and/or vg/kg of the subject.
  • more than one administration may be employed to achieve the desired level of gene expression over a period of various intervals, e.g, daily, weekly, monthly, yearly, etc.
  • Exemplary modes of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g, via an aerosol), buccal (e.g, sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g, intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and/or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g, to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intro- lymphatic, and the like, as well as direct tissue or organ injection (e.g, to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain).
  • parenteral e.g, intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and/or cardiac muscle], intradermal, intrapleural
  • Administration can also be to a tumor (e.g, in or a near a tumor or a lymph node).
  • a tumor e.g, in or a near a tumor or a lymph node.
  • the most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular vector that is being used.
  • more than one mode and/or route of administration may be utilized, for example, e.g, intraparenchymal administration and i ntr acer eb r oventri cul ar admi ni strati on .
  • the viral vector is administered to the CNS, the peripheral nervous system, or both.
  • the viral vector is administered directly to the CNS, e.g, the brain or the spinal cord.
  • Direct administration can result in high specificity of transduction of CNS cells, e.g, wherein at least 80%, 85%, 90%, 95% or more of the transduced cells are CNS cells. Any method known in the art to administer vectors directly to the CNS can be used.
  • the vector may be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (corpus striatum, cerebrum including the occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and amygdala), limbic system, neocortex, corpus striatum, cerebrum, and inferior colliculus.
  • the vector may also be administered to different regions of the eye such as the retina, cornea or optic nerve.
  • the vector may be delivered into the cerebrospinal fluid (e.g, by lumbar puncture) for more disperse administration of the vector.
  • the delivery vector may be administered to the desired region(s) of the CNS by any route known in the art, including but not limited to, intrathecal, intracerebral, intraventricular, intraparenchymal, intranasal, intra-aural, intra-ocular (e.g, intra- vitreous, sub-retinal, anterior chamber) and peri-ocular (e.g, sub-Tenon’s region) delivery or any combination thereof.
  • intrathecal intracerebral
  • intraventricular intraparenchymal
  • intranasal intra-aural
  • intra-ocular e.g, intra- vitreous, sub-retinal, anterior chamber
  • peri-ocular e.g, sub-Tenon’s region
  • the delivery vector may be administered in a manner that produces a more widespread, diffuse transduction of tissues, including the CNS, the peripheral nervous system, and/or other tissues.
  • the viral vector will be administered in a liquid formulation by direct injection (e.g, stereotactic injection) to the desired region or compartment in the CNS and/or other tissues.
  • the vector can be delivered via a reservoir and/or pump.
  • the vector may be provided by topical application to the desired region or by intra-nasal administration of an aerosol formulation. Administration to the eye or into the ear, may be by topical application of liquid droplets.
  • the vector may be administered as a solid, slow-release formulation. Controlled release of parvovirus and AAV vectors is described by international patent publication WO 01/91803.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • the virus vector can be delivered dried to a surgically implantable matrix such as a bone graft substitute, a suture, a stent, and the like (e.g as described in U.S. Patent 7,201,898).
  • compositions suitable for oral administration can be presented in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the composition of this invention; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion.
  • Oral delivery can be performed by complexing a virus vector of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers include plastic capsules or tablets, as known in the art.
  • Such formulations are prepared by any suitable method of pharmacy, which includes the step of bringing into association the composition and a suitable carrier (which may contain one or more accessory ingredients as noted above).
  • a suitable carrier which may contain one or more accessory ingredients as noted above.
  • the pharmaceutical composition according to embodiments of the present invention are prepared by uniformly and intimately admixing the composition with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the resulting mixture.
  • a tablet can be prepared by compressing or molding a powder or granules containing the composition, optionally with one or more accessory ingredients.
  • Compressed tablets are prepared by compressing, in a suitable machine, the composition in a free-flowing form, such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, and/or surface active/dispersing agent(s). Molded tablets are made by molding, in a suitable machine, the powdered compound moistened with an inert liquid binder.
  • compositions suitable for buccal (sub-lingual) administration include lozenges comprising the composition of this invention in a flavored base, usually sucrose and acacia or tragacanth; and pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia.
  • compositions suitable for parenteral administration can comprise sterile aqueous and non-aqueous injection solutions of the composition of this invention, which preparations are optionally isotonic with the blood of the intended recipient. These preparations can contain anti-oxidants, buffers, bacteriostats and solutes, which render the composition isotonic with the blood of the intended recipient.
  • Aqueous and non-aqueous sterile suspensions, solutions and emulsions can include suspending agents and thickening agents.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
  • compositions can be presented in unit/dose or multi-dose containers, for example, in sealed ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water- for-injection immediately prior to use.
  • sterile liquid carrier for example, saline or water- for-injection immediately prior to use.
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the kind previously described.
  • an injectable, stable, sterile composition of this invention in a unit dosage form in a sealed container can be provided.
  • the composition can be provided in the form of a lyophilizate, which can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into a subject.
  • the unit dosage form can be from about 1 pg to about 10 grams of the composition of this invention.
  • a sufficient amount of emulsifying agent which is physiologically acceptable, can be included in sufficient quantity to emulsify the composition in an aqueous carrier.
  • emulsifying agent is phosphatidyl choline.
  • compositions suitable for rectal administration can be presented as unit dose suppositories. These can be prepared by admixing the composition with one or more conventional solid carriers, such as for example, cocoa butter and then shaping the resulting mixture.
  • compositions of this invention suitable for topical application to the skin can take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil.
  • Carriers that can be used include, but are not limited to, petroleum jelly, lanoline, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof.
  • topical delivery can be performed by mixing a pharmaceutical composition of the present invention with a lipophilic reagent (e.g DMSO) that is capable of passing into the skin.
  • a lipophilic reagent e.g DMSO
  • Pharmaceutical compositions suitable for transdermal administration can be in the form of discrete patches adapted to remain in intimate contact with the epidermis of the subject for a prolonged period of time.
  • compositions suitable for transdermal administration can also be delivered by iontophoresis (see, for example, Pharm. Res. 3:318 (1986)) and typically take the form of an optionally buffered aqueous solution of the composition of this invention.
  • Suitable formulations can comprise citrate or bis ⁇ tris buffer (pH 6) or ethanol/water and can contain from 0.1 to 0.2M active ingredient.
  • the virus vectors disclosed herein may be administered to the lungs of a subject by any suitable means, for example, by administering an aerosol suspension of respirable particles comprised of the virus vectors, which the subject inhales.
  • the respirable particles may be liquid or solid.
  • Aerosols of liquid particles comprising the virus vectors may be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skill in the art. See, e.g., U.S. Patent No. 4,501,729. Aerosols of solid particles comprising the virus vectors may likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.
  • a codon-optimized (amino acids do not change) human SUMF1 sequence for AAV9-mediated delivery was developed.
  • the hSUMFlopt was compared to the mouse, rat and monkey using the Clustal sequence alignment program.
  • the comparison of the sequences with the signal peptide removed indicates a high-level of identity between the sequences as shown in FIG. 1. Based on the high degree of conservation, it is highly unlikely that SUMF1 will have an altered biological activity in rodents versus primates.
  • EXAMPLE 2 AAV9/SUMF1 construct design.
  • AAV9/SUMF1 is a recombinant serotype 9 adeno-associated virus (AAV) encoding a codon-optimized human SIJMF1 transgene ⁇ hSUMFlopt).
  • AAV serotype 9 vector is capable of widespread transduction (tissue tropism), including the central nervous system (CNS) and somatic system (body) following intravenous or intracerebrospinal fluid administration.
  • CNS and systemic tropisms of AAV9 make it ideal for treating lysosomal storage diseases with global organ disease manifestations. Codon optimization of the DNA sequence modifies the sequence such that the final amino acid sequence is unchanged but nucleotide sequence is altered for easier detection along with potentially stronger expression.
  • the final product consists of AAV9 capsids that are packaged with the self-complementary AAV genome comprising a mutant AAV2 inverted terminal repeat (ITR) with the D element deleted, the“CBh” promoter (796 kb CMV enhancer, chicken beta actin promoter, synthetic intron (Gray et al. 2011 Human Gene Therapy 22(9): 1134-1153)), codon-optimized human SUMF 1 DNA coding sequence (1122 bp), the simian virus 40 polyadenylation signal (143 bp), and WT AAV2 ITR.
  • the CBh promoter is identical to the construct utilized and characterized in rodents, pigs, and non -human primates (Federici et al.
  • the CBh promoter and SV40 polyA are utilized for their ability to both be small in size as well as drive strong expression allowing for packaging into a self-complementary (sc) AAV vector.
  • the upstream inverted terminal repeat (ITR; proximal to the promoter) is from AAV2, with the D element deleted to promote packaging of a sc genome.
  • the downstream ITR (proximal to the polyA) is an intact WT AAV2 ITR.
  • Self-complementary scAAV vectors are 10-100 times more efficient at transduction compared to traditional single-stranded AAV vectors (McCarty et al.
  • the final product consists of a solution of AAV9/SUMF1 in phosphate-buffered saline with 5% D-sorbitol.
  • EXAMPLE 3 Mouse in vivo MSD rescue studies.
  • Intervention is at PND1 and PND 7 as outlined above in Table 5.
  • Age groups are as follows:
  • PND 1 Neuronatal intervention: The data from this cohort is expected to provide a proof-of-concept for the therapy, demonstrating the highest efficacy.
  • the route of administration for this cohort is intracerebroventricular (ICV), as a proof-of-concept. Note that these mice receive a dose of 2.8xlO u vg (approximately 2.8xl0 14 vg/kg).
  • PND7 (Delayed intervention): This cohort represents intervention following the detection of MSD disease signs in the mice and evaluation of long term safety data, using the IT route of administration. Note that these mice receive a dose of 7xlO u vg. [0179] The survival data for these cohorts and the body weights are presented in FIGS. 2A- 2B and FIGS. 3A-3B. The untreated Sumfl KO cohort had ⁇ 50% mortality on PND 10 and 6% of mice survived past Day 40 with eventual 100% lethality. Mice that received AAV9/SUMF1 on PND1 had significantly better survival with greater than 75% of mice surviving past Day 40 and over 50% of mice surviving beyond 300 days, so far (FIG. 2A).
  • mice that received AAV9/SUMF1 on PND7 also had significantly better survival with 70% of mice surviving past Day 40 and great than 50% of mice surviving beyond 200 days, so far (FIG. 3A).
  • the treated mice gained weight gradually with a growth curve similar to their wild-type littermates, but at a slower pace (FIGS. 2B and 3B).
  • No signs of tremors or seizures were detected, or signs of kyphosis.
  • the treated mice retain cranio-facial abnormalities, which may be due to underlying bone deformities during development.
  • the improved survival is likely from resolution of underlying pathology as evidenced by lack of physical deformities (besides facial dismorphometry) and clinical signs including seizures in these mice.
  • no overt adverse events were observed in Sumfl-/- or littermate control mice when treated with the vector and the injection technique did not negatively impact vehicle treated mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Obesity (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

This invention relates to polynucleotides comprising optimized SUMF1 open reading frame (ORF) sequences, vectors comprising the same, and methods of using the same for delivery of the ORF to a cell or a subject and to treat disorders associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product in the subject, such as SUMF1 disease.

Description

Optimized SUMF1 Genes and Expression Cassettes and Their Use
STATEMENT OF PRIORITY
[0001] This application claims the benefit, under 35 U.S.C. § 119(e), of U.S. Provisional Application No. 62/840,114, filed on April 29, 2019, the entire contents of which are incorporated by reference herein.
STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING
[0002] A Sequence Listing in ASCII text format, submitted under 37 C.F.R. § 1.821, entitled 5470-863WO_ST25.txt, 22,442 bytes in size, generated on February 18, 2020 and filed via EFS-Web, is provided in lieu of a paper copy. This Sequence Listing is hereby incorporated herein by reference into the specification for its disclosures.
FIELD OF THE INVENTION
[0003] This invention relates to polynucleotides comprising optimized SUMFl open reading frame (ORF) sequences, vectors comprising the same, and methods of using the same for delivery of the ORF to a cell or a subject and to treat disorders associated with aberrant expression of a SUMFl gene or aberrant activity of a SUMFl gene product in the subject, such as multiple sulfatase deficiency.
BACKGROUND OF THE INVENTION
[0004] The 9-exon sulfatase modifying factor- 1 ( SUMFl ) gene encodes formylglycine generating enzyme (FGE), which is required for post-translational modification and activation of sulfatase enzymes (Dierks et a! 2005 Cell 121 (4): 541 -552). As such pathogenic mutations in the SUMFl gene impact the function of all 17 human sulfatase enzymes (Sardiello et al. 2005 Hum. Mol Genet. 14(21):3203-3217; Cosma et al. 2003 Cell 113:445- 456). FGE modifies a common active site cysteine residue into C-alpha-formylglycine. Without this post-translational modification, sulfatase activity is absent, leading to multiple sulfatase deficiency (MSD). The correlation between different specific SUMFl mutations, alteration in enzyme activity, and clinical presentation has not been fully elucidated (Ahrens- Nicklas et al. 2018 Mol. Genet. Metab. 123(3):337-346). Some of the variety of mutations reported in the literature and the associated disease phenotype are listed in Table 1 However, the genotype-phenotype association is not well understood. Table 1: Published SUMF1 mutations and phenotypes
Figure imgf000003_0001
[0005] Individuals affected by MSD exhibit a constellation of neurologic and somatic features that overlap with known inherited single sulfatase disorders (i.e., metachromatic leukodystrophy (MLD) and five mucopolysaccharidoses (MPS) subtypes, X-linked ichthyosis and X- linked chondrodysplasia punctata). In addition all other sulfatases without known clinical correlation also contribute to the complex and variable phenotype found in individuals with MSD (Ahrens-Nicklas et al. 2018).
[0006] There are four clinical subtypes of MSD based on the predominant symptoms and ages of onset (Eto et al. 1987 Enzyme 38(l-4):273-279; Jaszczuk et al. 2017 Mol. Genet. Metab. 121(3):252-258; Garavelli et al. 2014 Ital. J. Pediatr. 41 :86; Schlotawa et al. 2011 Eur. J. Hum. Genet. 19(3):253-261). The neonatal subtype is characterized by severe mucopolysaccharidoses-like symptoms occurring in the first months of life and usually leads to early death before 1 year of age. The late infantile forms include a severe and mild form that onset before or after 2 years of age, respectively. The late infantile forms are characterized by progressive neurodegeneration, such as that observed in metachromatic leukodystrophy; however, individuals may also demonstrate MPS-like somatic symptoms. The juvenile subtype is characterized by a later onset and attenuated symptoms. Although this is the“mildest” form of MSD, individuals with juvenile MSD are affected by severe neurologic impairment by early childhood and premature death. While the existence of an adult-onset form of the disease has been postulated, no genetically confirmed adult-onset individuals have been reported in the literature. All clinical subtypes of MSD present in early childhood and experience severe, progressive central nervous system (CNS) dysfunction. Additionally, most individuals also are affected by extensive somatic involvement, and unfortunately, all affected individuals die by early adulthood mostly due to secondary problems as a result of MSD symptoms.
[0007] There are currently no specific treatments available for this disorder. Individuals affected by MSD are managed by supportive care, consultation with medical professionals from multiple disciplines, physical therapy, and pharmacological interventions to alleviate symptoms. There is a need to provide a meaningful and long-term therapeutic benefit for this population in the near future.
SUMMARY OF THE INVENTION
[0008] The present invention is based, in part, on the development of optimized SUMF1 genes, expression cassettes, and vectors capable of providing therapeutic levels of SUMF1 expression for treating disorders associated with SUMF1 expression such as SUMF1 disease. [0009] Thus, one aspect of the invention relates to a polynucleotide comprising a human SUMF1 open reading frame, wherein the human SUMF1 open reading frame has been codon-optimized for expression in human cells.
[0010] A further aspect of the invention relates to an expression cassette comprising a polynucleotide comprising a human SUMF1 open reading frame and vectors, transformed cells, and transgenic animals comprising the polynucleotide of the invention.
[0011] Another aspect of the invention relates to a pharmaceutical formulation comprising the polynucleotide, expression cassette, vector, and/or transformed cell of the invention in a pharmaceutically acceptable carrier.
[0012] An additional aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a cell, comprising contacting the cell with the polynucleotide, expression cassette, and/or vector of the invention, thereby expressing the SUMF1 open reading frame in the cell.
[0013] A further aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a subject, comprising delivering to the subject the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, thereby expressing the SUMF1 open reading frame in the subject.
[0014] An additional aspect of the invention relates to a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, such that the SUMF1 open reading frame is expressed in the subject.
[0015] A further aspect of the invention relates to a method of treating multiple sulfatase deficiency (MSD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, such that the SUMF1 open reading frame is expressed in the subject.
[0016] Another aspect of the invention relates to a polynucleotide, expression cassette, vector, and/or transformed cell of the invention for use in a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product in a subject in need thereof.
[0017] These and other aspects of the invention are set forth in more detail in the description of the invention below. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 shows similarities in protein sequence between different species. Human (homo) SUMF1 protein sequence (SEQ ID NO: 11) compared to the mouse (mus; 90.27%; SEQ ID NO: 13), rat (rattus; 90.56%; SEQ ID NO: 14) and monkey (macaca; 96.77%; SEQ ID NO: 12) retain high level of amino acid identity. The N-terminal signal peptide from the sequence was removed prior to the comparison. The asterisk (*) annotates a fully conserved amino acid residue, colon (:) annotates strongly similar residues and period (.) annotates weakly similar residues. Amino acids that are not conserved are not annotated.
[0019] FIGS. 2A-2B show AAV9/SUMF1 therapy in Sumfl-/- neonates improves survival. Sumfl-/- mice received a single dose of AAV9/SUMF1 via ICV on PNDl . Control cohorts did not receive any dosing or received a single dose of vehicle. FIG. 2A shows survival curve for mice in each cohort. FIG. 2B shows mean body weight of each cohort. Body weight of mice that were alive at the time of data collection have been included. Legend: Listed in the top comer of the figure applies to both panels.
[0020] FIGS. 3A-3B show AAV9/SUMF1 therapy in symptomatic Sumfl-/- mice improves survival. Sumfl-/- and Sumfl+/+ mice received a single dose of AAV9/SUMF1 via IT on PND7. Control cohorts did not receive any dosing or received a single dose of vehicle. FIG. 3A shows survival curve for mice in each cohort. FIG. 3B shows mean body weight of each cohort. Body weight of mice that were alive at the time of data collection have been included.
DETAILED DESCRIPTION OF THE INVENTION
[0021] The present invention is explained in greater detail below. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure which do not depart from the instant invention. Hence, the following specification is intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.
[0022] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0024] Nucleotide sequences are presented herein by single strand only, in the 5’ to 3’ direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 C.F.R. §1.822 and established usage.
[0025] Except as otherwise indicated, standard methods known to those skilled in the art may be used for production of recombinant and synthetic polypeptides, antibodies or antigen binding fragments thereof, manipulation of nucleic acid sequences, production of transformed cells, the construction of rAAV constructs, modified capsid proteins, packaging vectors expressing the AAV rep and/or cap sequences, and transiently and stably transfected packaging cells. Such techniques are known to those skilled in the art. See, e.g., SAMBROOK el al. , MOLECULAR CLONING: A LABORATORY MANUAL 4th Ed. (Cold Spring Harbor, NY, 2012); F. M. AUSUBEL et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).
[0026] All publications, patent applications, patents, nucleotide sequences, amino acid sequences and other references mentioned herein are incorporated by reference in their entirety.
Definitions
[0027] As used in the description of the invention and the appended claims, the singular forms“a,”“an” and“the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. [0028] As used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
[0029] Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.
[0030] Furthermore, the term“about,” as used herein when referring to a measurable value such as an amount of a compound or agent of this invention, dose, time, temperature, and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified amount.
[0031] As used herein, the transitional phrase“consisting essentially of’ is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term“consisting essentially of’ as used herein should not be interpreted as equivalent to“comprising.”
[0032] The term“consists essentially of’ (and grammatical variants), as applied to a polynucleotide or polypeptide sequence of this invention, means a polynucleotide or polypeptide that consists of both the recited sequence ( e.g ., SEQ ID NO) and a total of ten or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides or amino acids on the 5’ and/or 3’ or N-terminal and/or C-terminal ends of the recited sequence or between the two ends (e.g, between domains) such that the function of the polynucleotide or polypeptide is not materially altered. The total of ten or less additional nucleotides or amino acids includes the total number of additional nucleotides or amino acids added together. The term“materially altered,” as applied to polynucleotides of the invention, refers to an increase or decrease in ability to express the encoded polypeptide of at least about 50% or more as compared to the expression level of a polynucleotide consisting of the recited sequence. The term“materially altered,” as applied to polypeptides of the invention, refers to an increase or decrease in biological activity of at least about 50% or more as compared to the activity of a polypeptide consisting of the recited sequence.
[0033] The term “parvovirus” as used herein encompasses the family Parvoviridae, including autonomously-replicating parvoviruses and dependoviruses. The autonomous parvoviruses include members of the genera Parvovirus , Erythrovirus , Densovirus, Iteravirus , and Contravirus . Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, HI parvovirus, muscovy duck parvovirus, snake parvovirus, and B19 virus. Other autonomous parvoviruses are known to those skilled in the art. See, e.g., FIELDS el al. , VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
[0034] The genus Dependovirus contains the adeno-associated viruses (AAV), including but not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, avian AAV, bovine AAV, canine AAV, goat AAV, snake AAV, equine AAV, and ovine AAV. See, e.g., FIELDS et al. , VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers); and Table 1.
[0035] The term“adeno-associated virus” (AAV) in the context of the present invention includes without limitation AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV and any other AAV now known or later discovered. See, e.g., BERNARD N. FIELDS et al. , VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of additional AAV serotypes and clades have been identified (see, e.g, Gao et al. , (2004) J. Virol. 78:6381-6388 and Table 2), which are also encompassed by the term“AAV.”
[0036] The parvovirus particles and genomes of the present invention can be from, but are not limited to, AAV. The genomic sequences of various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the native ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank. See, e.g, GenBank Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, AY631966, AX753250, EU285562, NC_001358, NC_001540, AF513851, AF513852 and AY530579; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also, e.g, Bantel- Schaal et al., (1999 ) J. Virol. 73: 939; Chiorini et al, (1997) J. Virol. 71 :6823; Chiorini et al, (1999) . Virol. 73: 1309; Gao et al, (2002) Proc. Nat. Acad. Sci. USA 99: 11854; Moris et al, (2004) Virol. 33-:375-383; Mori et al, (2004) Virol 330:375; Muramatsu et al, (1996) Virol 221 :208; Ruffing et al, (1994) J. Gen. Virol. 75:3385; Rutledge et al, (1998) J. Virol. 72:309; Schmidt et al, (2008) J. Virol. 82:8911; Shade et al, (1986) J. Virol. 58:921; Srivastava et al, (1983) J. Virol. 45:555; Xiao et al, (1999) J. Virol. 73:3994; international patent publications WO 00/28061, WO 99/61601, WO 98/11244; and U.S. Patent No. 6,156,303; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also Table 2. An early description of the AAV1, AAV2 and AAV3 ITR sequences is provided by Xiao, X., (1996), “Characterization of Adeno-associated virus (AAV) DNA replication and integration,” Ph.D. Dissertation, University of Pittsburgh, Pittsburgh, PA (incorporated herein it its entirety).
[0037] A“chimeric” AAV nucleic acid capsid coding sequence or AAV capsid protein is one that combines portions of two or more capsid sequences. A“chimeric” AAV virion or particle comprises a chimeric AAV capsid protein.
[0038] The term“tropism” as used herein refers to preferential entry of the virus into certain cell or tissue type(s) and/or preferential interaction with the cell surface that facilitates entry into certain cell or tissue types, optionally and preferably followed by expression ( e.g ., transcription and, optionally, translation) of sequences carried by the viral genome in the cell, e.g., for a recombinant virus, expression of the heterologous nucleotide sequence(s). Those skilled in the art will appreciate that transcription of a heterologous nucleic acid sequence from the viral genome may not be initiated in the absence of trans-acting factors, e.g, for an inducible promoter or otherwise regulated nucleic acid sequence. In the case of a rAAV genome, gene expression from the viral genome may be from a stably integrated provirus and/or from a non-integrated episome, as well as any other form which the virus nucleic acid may take within the cell.
[0039] The term“tropism profile” refers to the pattern of transduction of one or more target cells, tissues and/or organs. Representative examples of chimeric AAV capsids have a tropism profile characterized by efficient transduction of cells of the central nervous system (CNS) with only low transduction of peripheral organs (see e.g. , US Patent No. 9,636,370 McCown et al., and US patent publication 2017/0360960 Gray et al.).
[0040] The term“disorder associated with aberrant expression of a SUMF1 gene” as used herein refers to a disease, disorder, syndrome, or condition that is caused by or a symptom of decreased or altered expression of the SUMF1 gene in a subject relative to the expression level in a normal subject or in a population.
[0041] The term“disorder associated with aberrant activity of a SUMF1 gene product” as used herein refers to a disease, disorder, syndrome, or condition that is caused by or a symptom of decreased or altered activity of the SUMF1 gene product in a subject relative to the activity in a normal subject or in a population. In some embodiments, a disorder associated with aberrant activity of a SUMF1 gene product may be multiple sulfatase deficiency ( e.g neonatal, severe late infantile, mild late infantile, juvenile, and/or adult-onset MSD).
Table 2
Figure imgf000011_0001
[0042] Sulfatases are a conserved family of enzymes catalyzing hydrolysis of ester sulfates (Preusser-Kunze et al. 2005 J. Biol. Chem. 280(15): 14900-14910; Landgrebe et al. 2003 Gene. 316:47-56). In humans there are 17 sulfatases localized to various subcellular regions where they metabolize specific substrates (Sardiello et al. 2005) such as glycosaminoglycans (GAGs), sulfolipids and steroid sulfates (Hopwood & Ballabio 1997 The Metabolic and Molecular Basis of the Inherited Disease McGraw-Hill, pp 3725-3732) among others. Post- translational activation of these sulfatase enzymes is dependent upon modification of a conserved catalytic domain cysteine within a conserved amino acid sequence recognized by FGE in every sulfatase (Schmidt et al. 1995 Cell. 82(2);271-278). SUMFl-e ncoded FGE is the only enzyme capable of performing this modification in mammals (Dierks et al. 2009 Biochim. Biophys. Acta. 1793(4):710-725). When SUMF1 is mutated, impacting FGE function, the activity of sulfatases is severely impaired. Residual sulfatase activity depends on stability and activity of mutant FGE. Impaired or absent sulfatase activities result in lysosomal storage of substrates resulting in cell pathology as a lysosomal storage disorder and additional dysfunction of non- lysosomal sulfatases.
[0043] SUMF1 has been conserved through evolution retaining high level of homology across species. The enzyme’s stability and activity highly depend on disulfide bridges within the protein and cysteine residues in the active site. These residues are identical throughout species and allow similar fold and function of any SUMF1 homologue (Dierks et al. 2009; Landgrebe et al. 2003; Carlson et al. 2008 J. Biol. Chem. 283(29):20117-20125). SUMF2 , a highly similar paralogue of SUMF1 gene, lacks catalytic activity and is not able to activate sulfatases (Carlson et al. 2008). Overexpression of SUMFl in cell and animal models and in combination with sulfatases does not result in any pathophysiology (Spampanato et al. 2011 Mol. Ther. 19(5): 860-869).
[0044] As used herein,“transduction” of a cell by a virus vector ( e.g ., an AAV vector) means entry of the vector into the cell and transfer of genetic material into the cell by the incorporation of nucleic acid into the virus vector and subsequent transfer into the cell via the virus vector.
[0045] Unless indicated otherwise,“efficient transduction” or“efficient tropism,” or similar terms, can be determined by reference to a suitable positive or negative control (e.g., at least about 50%, 60%, 70%, 80%, 85%, 90%, 95% or more of the transduction or tropism, respectively, of a positive control or at least about 110%, 120%, 150%, 200%, 300%, 500%, 1000% or more of the transduction or tropism, respectively, of a negative control). [0046] Similarly, it can be determined if a virus“does not efficiently transduce” or“does not have efficient tropism” for a target tissue, or similar terms, by reference to a suitable control. In particular embodiments, the virus vector does not efficiently transduce (i.e., does not have efficient tropism for) tissues outside the CNS, e.g., liver, kidney, gonads and/or germ cells. In particular embodiments, undesirable transduction of tissue(s) (e.g, liver) is 20% or less, 10% or less, 5% or less, 1% or less, 0.1% or less of the level of transduction of the desired target tissue(s) (e.g, CNS cells).
[0047] The terms“5’ portion” and“3’ portion” are relative terms to define a spatial relationship between two or more elements. Thus, for example, a “3’ portion” of a polynucleotide indicates a segment of the polynucleotide that is downstream of another segment. The term“3’ portion” is not intended to indicate that the segment is necessarily at the 3’ end of the polynucleotide, or even that it is necessarily in the 3’ half of the polynucleotide, although it may be. Likewise, a“5’ portion” of a polynucleotide indicates a segment of the polynucleotide that is upstream of another segment. The term“5’ portion” is not intended to indicate that the segment is necessarily at the 5’ end of the polynucleotide, or even that it is necessarily in the 5’ half of the polynucleotide, although it may be.
[0048] As used herein, the term“polypeptide” encompasses both peptides and proteins, unless indicated otherwise.
[0049] A“polynucleotide,”“nucleic acid,” or“nucleotide sequence” may be of RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotides), but is preferably either a single or double stranded DNA sequence.
[0050] The term“regulatory element” refers to a genetic element which controls some aspect of the expression of nucleic acid sequences. For example, a promoter is a regulatory element which facilitates the initiation of transcription of an operably linked coding region. Other regulatory elements are splicing signals, polyadenylation signals, termination signals, etc. The region in a nucleic acid sequence or polynucleotide in which one or more regulatory elements are found may be referred to as a“regulatory region.”
[0051] As used herein with respect to nucleic acids, the term“operably linked” refers to a functional linkage between two or more nucleic acids. For example, a promoter sequence may be described as being“operably linked” to a heterologous nucleic acid sequence because the promoter sequences initiates and/or mediates transcription of the heterologous nucleic acid sequence. In some embodiments, the operably linked nucleic acid sequences are contiguous and/or are in the same reading frame. [0052] The term“open reading frame (ORF),” as used herein, refers to the portion of a polynucleotide, e.g., a gene, that encodes a polypeptide. The term“coding region” may be used interchangeably with open reading frame.
[0053] The term“codon-optimized,” as used herein, refers to a gene coding sequence that has been optimized to increase expression by substituting one or more codons normally present in a coding sequence (for example, in a wild-type sequence, including, e.g, a coding sequence for SUMF1) with a codon for the same (synonymous) amino acid. In this manner, the protein encoded by the gene is identical, but the underlying nucleobase sequence of the gene or corresponding mRNA is different. In some embodiments, the optimization substitutes one or more rare codons (that is, codons for tRNA that occur relatively infrequently in cells from a particular species) with synonymous codons that occur more frequently to improve the efficiency of translation. For example, in human codon- optimization one or more codons in a coding sequence are replaced by codons that occur more frequently in human cells for the same amino acid. Codon optimization can also increase gene expression through other mechanisms that can improve efficiency of transcription and/or translation. Strategies include, without limitation, increasing total GC content (that is, the percent of guanines and cytosines in the entire coding sequence), decreasing CpG content (that is, the number of CG or GC dinucleotides in the coding sequence), removing cryptic splice donor or acceptor sites, and/or adding or removing ribosomal entry sites, such as Kozak sequences. Desirably, a codon-optimized gene exhibits improved protein expression, for example, the protein encoded thereby is expressed at a detectably greater level in a cell compared with the level of expression of the protein provided by the wild-type gene in an otherwise similar cell.
[0054] The term“sequence identity,” as used herein, has the standard meaning in the art. As is known in the art, a number of different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 45:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, WI), the Best Fit sequence program described by Devereux et at. , Nucl. Acid Res. 72:387 (1984), preferably using the default settings, or by inspection.
[0055] An example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J Mol. Evol. 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5: 151 (1989).
[0056] Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al. , J. Mol. Biol. 275:403 (1990) and Karlin et al, Proc. Natl. Acad. Sci. USA 90: 5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al. , Meth. Enzymol. , 266: 460 (1996); blast. wustl/edu/blast/README.html. WU-BLAST-2 uses several search parameters, which are preferably set to the default values. The parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.
[0057] An additional useful algorithm is gapped BLAST as reported by Altschul et al, Nucleic Acids Res. 25: 3389 (1997).
[0058] A percentage amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the“longer” sequence in the aligned region. The“longer” sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).
[0059] In a similar manner, percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in the candidate sequence that are identical with the nucleotides in the polynucleotide specifically disclosed herein.
[0060] The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer nucleotides than the polynucleotides specifically disclosed herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides. Thus, for example, sequence identity of sequences shorter than a sequence specifically disclosed herein, will be determined using the number of nucleotides in the shorter sequence, in one embodiment. In percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.
[0061] In one embodiment, only identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of“0,” which obviates the need for a weighted scale or parameters as described below for sequence similarity calculations. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the“shorter” sequence in the aligned region and multiplying by 100. The“longer” sequence is the one having the most actual residues in the aligned region.
[0062] As used herein, an“isolated” nucleic acid or nucleotide sequence ( e.g an“isolated DNA” or an“isolated RNA”) means a nucleic acid or nucleotide sequence separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the nucleic acid or nucleotide sequence.
[0063] Likewise, an “isolated” polypeptide means a polypeptide that is separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.
[0064] As used herein, the term“modified,” as applied to a polynucleotide or polypeptide sequence, refers to a sequence that differs from a wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.
[0065] As used herein, by“isolate” (or grammatical equivalents) a virus vector, it is meant that the virus vector is at least partially separated from at least some of the other components in the starting material.
[0066] By the term“treat,” “treating,” or“treatment of’ (or grammatically equivalent terms) is meant to reduce or to at least partially improve or ameliorate the severity of the subject’s condition and/or to alleviate, mitigate or decrease in at least one clinical symptom and/or to delay the progression of the condition.
[0067] As used herein, the term“prevent,”“prevents,” or“prevention” (and grammatical equivalents thereof) means to delay or inhibit the onset of a disease. The terms are not meant to require complete abolition of disease, and encompass any type of prophylactic treatment to reduce the incidence of the condition or delays the onset of the condition.
[0068] A“treatment effective” amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, a“treatment effective” amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one clinical symptom in the subject. Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.
[0069] A“prevention effective” amount as used herein is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention. Those skilled in the art will appreciate that the level of prevention need not be complete, as long as some benefit is provided to the subject.
[0070] A“heterologous nucleotide sequence” or“heterologous nucleic acid,” with respect to a virus, is a sequence or nucleic acid, respectively, that is not naturally occurring in the virus. Generally, the heterologous nucleic acid or nucleotide sequence comprises an open reading frame that encodes a polypeptide and/or a nontranslated RNA.
[0071] A“vector” refers to a compound used as a vehicle to carry foreign genetic material into another cell, where it can be replicated and/or expressed. A cloning vector containing foreign nucleic acid is termed a recombinant vector. Examples of nucleic acid vectors are plasmids, viral vectors, cosmids, expression cassettes, and artificial chromosomes. Recombinant vectors typically contain an origin of replication, a multicloning site, and a selectable marker. The nucleic acid sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that serves as the“backbone” of the vector. The purpose of a vector which transfers genetic information to another cell is typically to isolate, multiply, or express the insert in the target cell. Expression vectors (expression constructs or expression cassettes) are for the expression of the exogenous gene in the target cell, and generally have a promoter sequence that drives expression of the exogenous gene/ORF. Insertion of a vector into the target cell is referred to transformation or transfection for bacterial and eukaryotic cells, although insertion of a viral vector is often called transduction. The term“vector” may also be used in general to describe items to that serve to carry foreign genetic material into another cell, such as, but not limited to, a transformed cell or a nanoparticle.
[0072] As used herein, the term“vector,”“virus vector,”“delivery vector” (and similar terms) in a specific embodiment generally refers to a virus particle that functions as a nucleic acid delivery vehicle, and which comprises the viral nucleic acid (i.e., the vector genome) packaged within the virion. Virus vectors according to the present invention comprise a chimeric AAV capsid according to the invention and can package an AAV or rAAV genome or any other nucleic acid including viral nucleic acids. Alternatively, in some contexts, the term“vector,”“virus vector,”“delivery vector” (and similar terms) may be used to refer to the vector genome ( e.g ., vDNA) in the absence of the virion and/or to a viral capsid that acts as a transporter to deliver molecules tethered to the capsid or packaged within the capsid.
[0073] The virus vectors of the invention can further be duplexed parvovirus particles as described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety). Thus, in some embodiments, double stranded (duplex) genomes can be packaged.
[0074] A“recombinant AAV vector genome” or“rAAV genome” is an AAV genome (i.e., vDNA) that comprises at least one inverted terminal repeat (e.g., one, two or three inverted terminal repeats) and one or more heterologous nucleotide sequences. rAAV vectors generally retain the 145 base terminal repeat(s) (TR(s)) in c/s to generate virus; however, modified AAV TRs and non-AAV TRs including partially or completely synthetic sequences can also serve this purpose. All other viral sequences are dispensable and may be supplied in trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97). The rAAV vector optionally comprises two TRs (e.g, AAV TRs), which generally will be at the 5’ and 3’ ends of the heterologous nucleotide sequence(s), but need not be contiguous thereto. The TRs can be the same or different from each other. The vector genome can also contain a single ITR at its 3’ or 5’ end.
[0075] The term“terminal repeat” or“TR” includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (ITR) (i.e., mediates the desired functions such as replication, virus packaging, integration and/or provirus rescue, and the like). The TR can be an AAV TR or a non-AAV TR. For example, a non-AAV TR sequence such as those of other parvoviruses (e.g, canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as a TR, which can further be modified by truncation, substitution, deletion, insertion and/or addition. Further, the TR can be partially or completely synthetic, such as the“double-D sequence” as described in United States Patent No. 5,478,745 to Samulski et al.
[0076] Parvovirus genomes have palindromic sequences at both their 5’ and 3’ ends. The palindromic nature of the sequences leads to the formation of a hairpin structure that is stabilized by the formation of hydrogen bonds between the complementary base pairs. This hairpin structure is believed to adopt a“Y” or a“T” shape. See, e.g., FIELDS et al, VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
[0077] An“AAV terminal repeat” or“AAV TR” may be from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 or any other AAV now known or later discovered (see, e.g, Table 2). An AAV terminal repeat need not have the native terminal repeat sequence (e.g, a native AAV TR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g, replication, virus packaging, integration, and/or provirus rescue, and the like.
[0078] The terms“rAAV particle” and“rAAV virion” are used interchangeably here. A “rAAV particle” or“rAAV virion” comprises a rAAV vector genome packaged within an AAV capsid.
[0079] The virus vectors of the invention can further be“targeted” virus vectors (e.g, having a directed tropism) and/or a“hybrid” parvovirus (i.e., in which the viral ITRs and viral capsid are from different parvoviruses) as described in international patent publication WO 00/28004 and Chao et al, (2000) Mol. Therapy 2:619.
[0080] Further, the viral capsid or genomic elements can contain other modifications, including insertions, deletions and/or substitutions.
[0081] As used herein, the term“amino acid” encompasses any naturally occurring amino acids, modified forms thereof, and synthetic amino acids, including non-naturally occurring amino acids..
[0082] Naturally occurring, levorotatory (L-) amino acids are shown in Table 3.
Table 3
Figure imgf000019_0001
Figure imgf000020_0001
[0083] Alternatively, the amino acid can be a modified amino acid residue (nonlimiting examples are shown in Table 4) or can be an amino acid that is modified by post-translation modification ( e.g acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation or sulfatation).
Table 4: Amino Acid Residue Derivatives
Figure imgf000020_0002
Figure imgf000021_0001
[0084] Further, the non-naturally occurring amino acid can be an“unnatural” amino acid as described by Wang et al, (2006) Annu. Rev. Biophys. Biomol. Struct. 35:225-49. These unnatural amino acids can advantageously be used to chemically link molecules of interest to the AAV capsid protein.
[0085] The term“template” or“substrate” is used herein to refer to a polynucleotide sequence that may be replicated to produce the parvovirus viral DNA. For the purpose of vector production, the template will typically be embedded within a larger nucleotide sequence or construct, including but not limited to a plasmid, naked DNA vector, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC) or a viral vector ( e.g ., adenovirus, herpesvirus, Epstein-Barr Virus, AAV, baculoviral, retroviral vectors, and the like). Alternatively, the template may be stably incorporated into the chromosome of a packaging cell.
[0086] As used herein, parvovirus or AAV“Rep coding sequences” indicate the nucleic acid sequences that encode the parvoviral or AAV non- structural proteins that mediate viral replication and the production of new virus particles. The parvovirus and AAV replication genes and proteins have been described in, e.g., FIELDS et al. , VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
[0087] The“Rep coding sequences” need not encode all of the parvoviral or AAV Rep proteins. For example, with respect to AAV, the Rep coding sequences do not need to encode all four AAV Rep proteins (Rep78, Rep 68, Rep52 and Rep40), in fact, it is believed that AAV5 only expresses the spliced Rep68 and Rep40 proteins. In representative embodiments, the Rep coding sequences encode at least those replication proteins that are necessary for viral genome replication and packaging into new virions. The Rep coding sequences will generally encode at least one large Rep protein ( i.e ., Rep78/68) and one small Rep protein ( i.e ., Rep52/40). In particular embodiments, the Rep coding sequences encode the AAV Rep78 protein and the AAV Rep52 and/or Rep40 proteins. In other embodiments, the Rep coding sequences encode the Rep68 and the Rep52 and/or Rep40 proteins. In a still further embodiment, the Rep coding sequences encode the Rep68 and Rep52 proteins, Rep68 and Rep40 proteins, Rep78 and Rep52 proteins, or Rep78 and Rep40 proteins. [0088] As used herein, the term“large Rep protein” refers to Rep68 and/or Rep78. Large Rep proteins of the claimed invention may be either wild-type or synthetic. A wild-type large Rep protein may be from any parvovirus or AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, or any other AAV now known or later discovered (see, e.g., Table 2). A synthetic large Rep protein may be altered by insertion, deletion, truncation and/or missense mutations.
[0089] Those skilled in the art will further appreciate that it is not necessary that the replication proteins be encoded by the same polynucleotide. For example, for MVM, the NS- 1 and NS-2 proteins (which are splice variants) may be expressed independently of one another. Likewise, for AAV, the pl9 promoter may be inactivated and the large Rep protein(s) expressed from one polynucleotide and the small Rep protein(s) expressed from a different polynucleotide. Typically, however, it will be more convenient to express the replication proteins from a single construct. In some systems, the viral promoters (e.g, AAV pl9 promoter) may not be recognized by the cell, and it is therefore necessary to express the large and small Rep proteins from separate expression cassettes. In other instances, it may be desirable to express the large Rep and small Rep proteins separately, i.e., under the control of separate transcriptional and/or translational control elements. For example, it may be desirable to control expression of the large Rep proteins, so as to decrease the ratio of large to small Rep proteins. In the case of insect cells, it may be advantageous to down-regulate expression of the large Rep proteins (e.g, Rep78/68) to avoid toxicity to the cells (see, e.g, Urabe et al. , (2002) Human Gene Therapy 13: 1935).
[0090] As used herein, the parvovirus or AAV “cap coding sequences” encode the structural proteins that form a functional parvovirus or AAV capsid (i.e., can package DNA and infect target cells). Typically, the cap coding sequences will encode all of the parvovirus or AAV capsid subunits, but less than all of the capsid subunits may be encoded as long as a functional capsid is produced. Typically, but not necessarily, the cap coding sequences will be present on a single nucleic acid molecule.
[0091] The capsid structure of autonomous parvoviruses and AAV are described in more detail in BERNARD N. FIELDS et al. , VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
[0092] By“substantially retain” a property, it is meant that at least about 75%, 85%, 90%, 95%, 97%, 98%, 99% or 100% of the property (e.g, activity or other measurable characteristic) is retained. SUMF1 Expression Cassettes and Vectors
[0093] The present invention relates to the design of a SUMF1 expression cassette to provide therapeutic levels of expression of formylglycine-generating enzyme (FGE), the enzyme encoded by the SUMF1 gene, and the use of the expression cassette to achieve therapeutic levels of SUMF1 and/or FGE in a subject.
[0094] Thus, one aspect of the invention relates to a polynucleotide comprising a mammalian SUM FI open reading frame (ORF), wherein the SEIMF1 open reading frame has been codon-optimized for expression in mammalian cells. The term“mammal” as used herein includes, but is not limited to, humans, primates, non-human primates ( e.g ., monkeys and baboons), cattle, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g., rats, mice, hamsters, and the like), etc. The open reading frame is the portion of the SEIMF1 gene that encodes FGE. In some embodiments, the mammalian SUMF1 open reading frame may be a human SUMF1 open reading frame. As used herein, a mammalian SUMF1 ORF refers to a nucleotide sequence that encodes mammalian FGE, e.g, a human SUMF1 ORF refers to a nucleotide sequence that encodes a human FGE. Codon optimization is a technique well known in the art and optimal codons for expression in different species are known. The use of a codon-optimized SUMF1 sequence allows one to distinguish expression of the transduced sequence from expression of the endogenous SUMF1 sequence in a subject.
[0095] In some embodiments, the codon-optimized SUMF1 open reading frame encodes an FGE enzyme that is modified from the wild-type sequence, e.g, comprises, consists essentially of, or consists of an amino acid sequence in which 1, 2, 3, 4, or 5 residues have been substituted, added, and/or deleted compared to the wild-type amino acid sequence.
[0096] In some embodiments, the codon-optimized SUMF1 open reading frame comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: l or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
SEQ ID NO:l. Human codon-optimized SUMF 1 open reading frame
ATGGCCGCCCCAGCTCTTGGACTCGTGTGCGGAAGATGCCCTGAACTCGGACTCG
TGTTGTTGTTGCTGCTGCTGTCCCTGCTGTGCGGCGCCGCCGGATCGCAAGAAGC
GGGAACCGGAGCGGGTGCCGGATCCCTGGCCGGGTCCTGTGGTTGCGGAACACC
GCAACGGCCCGGCGCACATGGATCCAGCGCCGCTGCGCACCGCTACTCCCGGGA
AGCTAACGCCCCTGGGCCCGTGCCCGGGGAAAGACAGCTCGCCCACTCCAAAAT
GGTGCCGATCCCCGCCGGAGTGTTCACTATGGGTACTGACGACCCACAGATTAAG CAGGACGGAGAGGCACCAGCGCGCCGGGTCACCATTGACGCTTTTTACATGGAC
GCCTACGAGGTGTCAAACACTGAGTTCGAGAAGTTCGTGAACTCAACCGGATAC
CTGACCGAGGCCGAAAAGTTCGGCGACTCGTTCGTGTTCGAGGGCATGCTGTCGG
AACAAGTCAAGACCAACATCCAGCAGGCCGTGGCTGCAGCCCCGTGGTGGCTGC
CCGTGAAGGGGGCCAATTGGAGACACCCCGAGGGCCCAGACTCCACCATCCTCC
ACCGGCCTGACCACCCTGTGCTTCACGTGTCCTGGAACGATGCAGTCGCATACTG
CACCTGGGCCGGAAAGAGGCTGCCGACTGAAGCCGAATGGGAATACTCCTGCCG
GGGCGGCCTGCACAACCGCCTGTTTCCCTGGGGCAACAAGCTCCAGCCTAAGGG
CCAGCACTACGCGAACATTTGGCAGGGAGAATTCCCTGTGACCAACACCGGAGA
GGACGGTTTCCAAGGCACCGCCCCGGTCGATGCGTTCCCGCCGAACGGTTACGG
CCTCTACAACATCGTGGGGAACGCCTGGGAGTGGACGTCGGATTGGTGGACCGT
GCACCATAGCGTCGAAGAGACTCTGAACCCGAAAGGGCCCCCGAGCGGAAAGG
ACAGAGTGAAGAAGGGAGGCAGCTATATGTGTCATCGGTCCTACTGTTACCGCT
ACCGCTGCGCGGCCCGGAGCCAGAATACTCCCGACTCTTCCGCGTCCAACCTGGG
CTTCCGCTGCGCCGCCGATAGGCTGCCTACCATGGAT
[0097] Another aspect of the invention relates to an expression cassette comprising a polynucleotide comprising a human SUMF1 open reading frame. In certain embodiments, the polynucleotide is a human codon-optimized sequence, e.g., a polynucleotide comprising the nucleotide sequence of SEQ ID NO: l, or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
[0098] The SUMF1 open reading frame in the expression cassette may be operably linked to one or more expression elements that may enhance expression of SUMF1 and/or FGE. In some embodiments, the polynucleotide is operably linked to a promoter, e.g, a chicken beta- actin promoter, e.g, a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:2 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. In some embodiments, the promoter further comprises the chimeric intron with chicken beta- actin splicing donor site and minute virus of mice (MVM) intron splicing acceptor site, e.g, comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO: 4, or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. SEQ ID NO:2. Chicken beta-actin promoter
TACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCA
CTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAAT
TATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGG
GCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGC
CAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCG
GCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG
SEQ ID NO:3. Chimeric intron with chicken beta-actin splicing donor site and minute virus of mice (MVM) intron splicing acceptor site with A deletion
GGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCC
GCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACG
GCCCTTCTCCTCCGGGCTGTAATTAGC
SEQ ID NO:4. Chimeric intron with chicken beta-actin splicing donor site and minute virus of mice (MVM) intron splicing acceptor site
GGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGC
CGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGAC
GGCCCTTCTCCTCCGGGCTGTAATTAGC
[0099] In some embodiments, the polynucleotide is operably linked to a promoter, e.g., a CAGGS promoter, e.g, a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:5 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
SEQ ID NO:5. CAGGS promoter 1.6kb CMV enhancer, CBA promoter and partial 5’ UTR
GATCTGAATTCGGATCTTCAATATTGGCCATTAGCCATATTATTCATTGGTTATAT
AGCATAAATCAATATTGGATATTGGCCATTGCATACGTTGTATCTATATCATAAT
ATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATT
GACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATG
GAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACG
ACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGG
GACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCA
GT AC AT C AAGT GT AT CAT AT GCC AAGTCCGCCCCCT ATT GACGT C AAT GACGGT A AATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACG TTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTT ATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCG CCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGC GGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTG CGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCC GGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCC TCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGC GTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCG GGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCCCGCGCTGC CCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTG TGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGC GAGGGGA AC A A AGGC T GC GT GC GGGGT GT GT GC GT GGGGGGGT GAGC AGGGGG TATGGGCGCGGCGGTCGGGCTGTAACCCCCCCCTGCACCCCCCTCCCCGAGTTGC TGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTACGGGGCGTGGCGCGGGGCT CGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGCCGGGCGGGGCGGGGC CGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCC GGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCG AGAGGGCGCAGGGACTTACTTTGTCCCAAATCTGTGCGGAGCCGAAATCTGGGA GGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCA GGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTC TCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGAC GGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTG CTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTT ATTGTGCTGTCTCATCATTTTGGCAAAG
[0100] In some embodiments, the polynucleotide is operably linked to an enhancer, e.g., a cytomegalovirus (CMV) enhancer, e.g, an enhancer comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:6 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. SEO ID NO:6. CMV enhancer
TACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCA
TTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGT
ATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTAC
GCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTAC
ATGACCTTATGGGACTTTCCTACTTGGCAGTACATC
[0101] In some embodiments, the SUMF1 open reading frame is operably linked to a polyadenylation signal, e.g., a synthetic polyadenylation signal, e.g, a polyadenylation signal comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:7 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. In some embodiments, the SUMF 1 open reading frame is operably linked to a polyadenylation signal, e.g, a simian virus 40 (SV40) polyadenylation signal, e.g, a polyadenylation signal comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:8 or SEQ ID NO:9, or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
SEQ ID NO:7. Synthetic polyadenylation signal (SpA)
AATAAAGAGCTCAGATGCATCGATCAGAGTGTGTTGGTTTTTTGTGTG
SEQ ID NO:8. SV40 polyadenylation signal (SV40pA)
AGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTG AAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTA T AAGCTGC AAT AAAC AAGTT AAC AAC AAC AATT
SEQ ID NO:9. SV40 polyadenylation signal (SV40pA)
TGTTT ATTGC AGCTT AT AAT GGTT AC A AAT AAAGC AAT AGC AT C AC AAATTT C AC
AAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATG
TATCTTATCATG
[0102] Those skilled in the art will further appreciate that a variety of promoter/enhancer elements may be used depending on the level and tissue-specific expression desired. The promoter/enhancer may be constitutive or inducible, depending on the pattern of expression desired. The promoter/enhancer may be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced.
[0103] Promoter/enhancer elements can be native to the target cell or subject to be treated and/or native to the heterologous nucleic acid sequence. The promoter/enhancer element is generally chosen so that it will function in the target cell(s) of interest. In representative embodiments, the promoter/enhancer element is a mammalian promoter/enhancer element. The promoter/enhance element may be constitutive or inducible.
[0104] Inducible expression control elements are generally used in those applications in which it is desirable to provide regulation over expression of the heterologous nucleic acid sequence(s). Inducible promoters/enhancer elements for gene delivery can be tissue-specific or tissue-preferred promoter/enhancer elements, and include muscle specific or preferred (including cardiac, skeletal and/or smooth muscle), neural tissue specific or preferred (including brain-specific), eye (including retina-specific and cornea-specific), liver specific or preferred, bone marrow specific or preferred, pancreatic specific or preferred, spleen specific or preferred, and lung specific or preferred promoter/enhancer elements. Other inducible promoter/enhancer elements include hormone-inducible and metal-inducible elements. Exemplary inducible promoter s/enhancer elements include, but are not limited to, a Tet on/off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin- inducible promoter, and a metallothionein promoter.
[0105] In embodiments wherein the SUMF1 open reading frame is transcribed and then translated in the target cells, specific initiation signals are generally employed for efficient translation of inserted protein coding sequences. These exogenous translational control sequences, which may include the ATG initiation codon ( i.e translation start site) and adjacent sequences, can be of a variety of origins, both natural and synthetic.
[0106] In certain embodiments, the expression cassette further comprises at least one adeno-associated virus (AAV) inverted terminal repeat (ITR), e.g., two AAV ITRs. The two ITRs may have the same nucleotide sequence or different nucleotide sequences. The AAV ITRs may be from any AAV serotype, e.g, AAV2. Each ITR independently may be the wild-type sequence or a modified sequence. In some embodiments, a modified ITR may have a D-element deletion (WO 01/92551). A D-element deletion is defined as the removal of that portion of the ITR known as the D-element. The D-element can be alternatively referred to or known as a D region, or D sequence, and/or the nucleotides of the ITR that do not form palindromic hairpin structures. In some embodiments, the expression cassette is an AAV genome, e.g., a self-complementary AAV genome.
[0107] In certain embodiments, the expression cassette comprises an enhancer, a promoter, a human SUMF1 open reading frame, and a polyadenylation site, optionally in the recited order. In certain embodiments, the expression cassette comprises an AAV ITR, an enhancer, a promoter, a human SUMF1 open reading frame, a polyadenylation site, and an AAV ITR, optionally in the recited order. In certain embodiments, the expression cassette comprises a CMV enhancer, a chicken beta actin promoter, a human SUMF1 open reading frame, and an SV40 polyadenylation site, optionally in the recited order. In certain embodiments, the expression cassette comprises an AAV ITR, a CMV enhancer, a chicken beta actin promoter, a human SUMFl open reading frame, an SV40 polyadenylation site, and an AAV ITR, optionally in the recited order. In certain embodiments, the expression cassette comprises an AAV2 ITR, a CMV enhancer, a chicken beta actin promoter, a human SUMFl open reading frame, an SV40 polyadenylation site, and an AA2V ITR, optionally in the recited order. In certain embodiments, the expression cassette comprises a wildtype AAV2 ITR, a CMV enhancer, a chicken beta actin promoter, a human SUMFl open reading frame, an SV40 polyadenylation site, and a modified AA2V ITR, optionally in the recited order. The aforementioned components are in operable linkage.
[0108] In some embodiments, the expression cassette comprise, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 10 or a sequence at least about 70% identical thereto, e.g, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
SEQ ID NO: 10. Human SUMFl expression cassette excluding ITRs
GGTTCGGTACCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCA
ACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACG
TCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTAT
CATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGC
ATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGT
ATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCC
CCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTT
GTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGG
CGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCA
GAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCC CTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCC
CGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCG
TTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGC
TGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTA
ATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGTTGGACCGGTTCCGGA
GCCACCATGGCCGCCCCAGCTCTTGGACTCGTGTGCGGAAGATGCCCTGAACTCG
GACTCGTGTTGTTGTTGCTGCTGCTGTCCCTGCTGTGCGGCGCCGCCGGATCGCA
AGAAGCGGGAACCGGAGCGGGTGCCGGATCCCTGGCCGGGTCCTGTGGTTGCGG
AACACCGCAACGGCCCGGCGCACATGGATCCAGCGCCGCTGCGCACCGCTACTC
CCGGGAAGCTAACGCCCCTGGGCCCGTGCCCGGGGAAAGACAGCTCGCCCACTC
CAAAATGGTGCCGATCCCCGCCGGAGTGTTCACTATGGGTACTGACGACCCACA
GATTAAGCAGGACGGAGAGGCACCAGCGCGCCGGGTCACCATTGACGCTTTTTA
CAT GGACGCCT ACGAGGT GT C AAAC ACTGAGTTCGAGAAGTTCGT GAACTC AAC
CGGATACCTGACCGAGGCCGAAAAGTTCGGCGACTCGTTCGTGTTCGAGGGCAT
GCTGTCGGAACAAGTCAAGACCAACATCCAGCAGGCCGTGGCTGCAGCCCCGTG
GTGGCTGCCCGTGAAGGGGGCCAATTGGAGACACCCCGAGGGCCCAGACTCCAC
CATCCTCCACCGGCCTGACCACCCTGTGCTTCACGTGTCCTGGAACGATGCAGTC
GCATACTGCACCTGGGCCGGAAAGAGGCTGCCGACTGAAGCCGAATGGGAATAC
TCCTGCCGGGGCGGCCTGCACAACCGCCTGTTTCCCTGGGGCAACAAGCTCCAGC
CTAAGGGCCAGCACTACGCGAACATTTGGCAGGGAGAATTCCCTGTGACCAACA
CCGGAGAGGACGGTTTCCAAGGCACCGCCCCGGTCGATGCGTTCCCGCCGAACG
GTTACGGCCTCTACAACATCGTGGGGAACGCCTGGGAGTGGACGTCGGATTGGT
GGACCGTGCACCATAGCGTCGAAGAGACTCTGAACCCGAAAGGGCCCCCGAGCG
GAAAGGACAGAGTGAAGAAGGGAGGCAGCTATATGTGTCATCGGTCCTACTGTT
ACCGCTACCGCTGCGCGGCCCGGAGCCAGAATACTCCCGACTCTTCCGCGTCCAA
CCTGGGCTTCCGCTGCGCCGCCGATAGGCTGCCTACCATGGATTGATAGGCGGCC
GCGGAGCTCTCGAGAGACATGATAAGATACATTGATGAGTTTGGACAAACCACA
ACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTT
T ATTTGT AACC ATT AT AAGCTGC AAT AAAC AAGTT AAC A AC AAC A ATT ACGCGT
[0109] A further aspect of the invention relates to a vector comprising the polynucleotide or the expression cassette of the invention. Suitable vectors include, but are not limited to, a plasmid, phage, viral vector ( e.g an AAV vector, a lentiviral vector, an adenovirus vector, a herpesvirus vector, an alphavirus vector, or a baculovirus vector), bacterial artificial chromosome (BAC), or yeast artificial chromosome (YAC). For example, the nucleic acid can comprise, consist of, or consist essentially of an AAV vector comprising a 5’ and/or 3’ terminal repeat ( e.g ., 5’ and/or 3’ AAV terminal repeat). In some embodiments, the vector is a delivery vehicle such as a particle (e.g., a microparticle or nanoparticle) or a liposome to which the expression cassette is attached or in which the expression cassette is embedded. The vector may be any delivery vehicle suitable to carry the expression cassette into a cell.
[0110] In some embodiments, the vector is a viral vector, e.g, a lentiviral vector and/or an AAV vector. The AAV vector may be any AAV serotype, e.g, AAV9. In some embodiments, the AAV vector may comprise wild-type capsid proteins. In other embodiments, the AAV vector may comprise a modified capsid protein with altered tropism compared to a wild-type capsid protein, e.g, a modified capsid protein is liver-detargeted or has enhanced tropism for particular cells.
[0111] In some embodiments, the vector is a single-stranded AAV (ssAAV) vector. In some embodiments, the vector is a self-complementary or duplexed AAV (scAAV) vector. scAAV vectors are described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety). Use of scAAV to express the SUMF1 ORF may provide an increase in the number of cells transduced, the copy number per transduced cell, or both.
[0112] An additional aspect of the invention relates to a transformed cell comprising the polynucleotide, expression cassette, and/or vector of the invention. In some embodiments, the polynucleotide, expression cassette, and/or vector is stably incorporated into the cell genome. The cell may be an in vitro , ex vivo , or in vivo cell.
[0113] Another aspect of the invention relates to a transgenic animal comprising the polynucleotide, expression cassette, vector, and/or the transformed cell of the invention. In some embodiments, the animal is a laboratory animal, e.g, a mouse, rat, rabbit, dog, monkey, or non-human primate.
[0114] A further aspect of the invention relates to a pharmaceutical formulation comprising the polynucleotide, expression cassette, vector, and/or transformed cell of the invention in a pharmaceutically acceptable carrier.
[0115] In a specific embodiment, the polynucleotide, expression cassette, vector, and/or transformed cell of the invention is isolated.
[0116] In another specific embodiment, the polynucleotide, expression cassette, vector, and/or transformed cell of the invention is purified. Methods of Producing Virus Vectors
[0117] The present invention further provides methods of producing virus vectors. In one particular embodiment, the present invention provides a method of producing a recombinant AAV particle, comprising providing to a cell permissive for AAV replication: (a) a recombinant AAV template comprising (i) the polynucleotide or expression cassette of the invention, and (ii) an ITR; (b) a polynucleotide comprising Rep coding sequences and Cap coding sequences; under conditions sufficient for the replication and packaging of the recombinant AAV template; whereby recombinant AAV particles are produced in the cell. Conditions sufficient for the replication and packaging of the recombinant AAV template can be, e.g., the presence of AAV sequences sufficient for replication of the AAV template and encapsidation into AAV capsids (e.g, AAV rep sequences and AAV cap sequences) and helper sequences from adenovirus and/or herpesvirus. In particular embodiments, the AAV template comprises two AAV ITR sequences, which are located 5’ and 3’ to the polynucleotide of the invention, although they need not be directly contiguous thereto.
[0118] In some embodiments, the recombinant AAV template comprises an ITR that is not resolved by Rep to make duplexed AAV vectors as described in international patent publication WO 01/92551.
[0119] The AAV template and AAV rep and cap sequences are provided under conditions such that virus vector comprising the AAV template packaged within the AAV capsid is produced in the cell. The method can further comprise the step of collecting the virus vector from the cell. The virus vector can be collected from the medium and/or by lysing the cells.
[0120] The cell can be a cell that is permissive for AAV viral replication. Any suitable cell known in the art may be employed. In particular embodiments, the cell is a mammalian cell (e.g, a primate or human cell). As another option, the cell can be a trans-complementing packaging cell line that provides functions deleted from a replication-defective helper virus, e.g, 293 cells or other El a trans-complementing cells.
[0121] The AAV replication and capsid sequences may be provided by any method known in the art. Current protocols typically express the AAV rep!cap genes on a single plasmid. The AAV replication and packaging sequences need not be provided together, although it may be convenient to do so. The AAV rep and/or cap sequences may be provided by any viral or non-viral vector. For example, the rep! cap sequences may be provided by a hybrid adenovirus or herpesvirus vector (e.g, inserted into the El a or E3 regions of a deleted adenovirus vector). EBV vectors may also be employed to express the AAV cap and rep genes. One advantage of this method is that EBV vectors are episomal, yet will maintain a high copy number throughout successive cell divisions (i.e., are stably integrated into the cell as extra-chromosomal elements, designated as an “EBV based nuclear episome,” see Margolski, (1992) Curr. Top. Microbiol. Immun. 158:67).
[0122] As a further alternative, the rep!cap sequences may be stably incorporated into a cell.
[0123] Typically the AAV rep!cap sequences will not be flanked by the TRs, to prevent rescue and/or packaging of these sequences.
[0124] The AAV template can be provided to the cell using any method known in the art. For example, the template can be supplied by a non-viral ( e.g ., plasmid) or viral vector. In particular embodiments, the AAV template is supplied by a herpesvirus or adenovirus vector (e.g., inserted into the Ela or E3 regions of a deleted adenovirus). As another illustration, Palombo et al. , (1998) J. Virology 72:5025, describes a baculovirus vector carrying a reporter gene flanked by the AAV TRs. EBV vectors may also be employed to deliver the template, as described above with respect to the rep!cap genes.
[0125] In another representative embodiment, the AAV template is provided by a replicating rAAV virus. In still other embodiments, an AAV provirus comprising the AAV template is stably integrated into the chromosome of the cell.
[0126] To enhance virus titers, helper virus functions (e.g, adenovirus or herpesvirus) that promote a productive AAV infection can be provided to the cell. Helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences will be provided by a helper adenovirus or herpesvirus vector. Alternatively, the adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, e.g, as a non- infectious adenovirus miniplasmid that carries all of the helper genes that promote efficient AAV production as described by Ferrari et al. , (1997) Nature Med. 3: 1295, and U.S. Patent Nos. 6,040,183 and 6,093,570.
[0127] Further, the helper virus functions may be provided by a packaging cell with the helper sequences embedded in the chromosome or maintained as a stable extrachromosomal element. Generally, the helper virus sequences cannot be packaged into AAV virions, e.g, are not flanked by ITRs.
[0128] Those skilled in the art will appreciate that it may be advantageous to provide the AAV replication and capsid sequences and the helper virus sequences (e.g, adenovirus sequences) on a single helper construct. This helper construct may be a non-viral or viral construct. As one nonlimiting illustration, the helper construct can be a hybrid adenovirus or hybrid herpesvirus comprising the AAV rep!cap genes. [0129] In one particular embodiment, the AAV replcap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. This vector can further comprise the AAV template. The AAV replcap sequences and/or the AAV template can be inserted into a deleted region ( e.g ., the El a or E3 regions) of the adenovirus.
[0130] In a further embodiment, the AAV replcap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. According to this embodiment, the AAV template can be provided as a plasmid template.
[0131] In another illustrative embodiment, the AAV replcap sequences and adenovirus helper sequences are provided by a single adenovirus helper vector, and the AAV template is integrated into the cell as a provirus. Alternatively, the AAV template is provided by an EBV vector that is maintained within the cell as an extrachromosomal element (e.g., as an EBV based nuclear episome).
[0132] In a further exemplary embodiment, the AAV replcap sequences and adenovirus helper sequences are provided by a single adenovirus helper. The AAV template can be provided as a separate replicating viral vector. For example, the AAV template can be provided by an AAV particle or a second recombinant adenovirus particle.
[0133] According to the foregoing methods, the hybrid adenovirus vector typically comprises the adenovirus 5’ and 3’ cis sequences sufficient for adenovirus replication and packaging (; i.e ., the adenovirus terminal repeats and PAC sequence). The AAV replcap sequences and, if present, the AAV template are embedded in the adenovirus backbone and are flanked by the 5’ and 3’ cis sequences, so that these sequences may be packaged into adenovirus capsids. As described above, the adenovirus helper sequences and the AAV replcap sequences are generally not flanked by ITRs so that these sequences are not packaged into the AAV virions.
[0134] Zhang et al. (2001 Gene Ther. 18:704-12) describe a chimeric helper comprising both adenovirus and the AAV rep and cap genes.
[0135] Herpesvirus may also be used as a helper virus in AAV packaging methods. Hybrid herpesviruses encoding the AAV Rep protein(s) may advantageously facilitate scalable AAV vector production schemes. A hybrid herpes simplex virus type I (HSV-1) vector expressing the AAV-2 rep and cap genes has been described (Conway et al., 1999 Gene Ther. 6:986 and WO 00/17377).
[0136] As a further alternative, the virus vectors of the invention can be produced in insect cells using baculovirus vectors to deliver the replcap genes and AAV template as described, for example, by Urabe et al., 2002 Human Gene Ther. 13: 1935-43. [0137] AAV vector stocks free of contaminating helper virus may be obtained by any method known in the art. For example, AAV and helper virus may be readily differentiated based on size. AAV may also be separated away from helper virus based on affinity for a heparin substrate (Zolotukhin et al. 1999 Gene Therapy 6:973). Deleted replication-defective helper viruses can be used so that any contaminating helper virus is not replication competent. As a further alternative, an adenovirus helper lacking late gene expression may be employed, as only adenovirus early gene expression is required to mediate packaging of AAV. Adenovirus mutants defective for late gene expression are known in the art ( e.g ., tslOOK and tsl49 adenovirus mutants).
Methods of Using SUMF1 Vectors
[0138] The present invention also relates to methods for delivering a SUMF1 ORF to a cell or a subject to increase production of SUMF1 and/or FGE, e.g., for therapeutic or research purposes in vitro , ex vivo , or in vivo. Thus, one aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a cell, comprising contacting the cell with the polynucleotide, expression cassette, and/or the vector of the invention, thereby expressing the SUMF1 open reading frame in the cell. In some embodiments, the cell is an in vitro cell, an ex vivo cell, or an in vivo cell. Expression of the present invention in vitro may be beneficial for research purposes, e.g, to evaluate efficacy and/or safety, prior to expression in vivo.
[0139] Another aspect of the invention relates to a method of expressing a SUMF1 open reading frame in a subject, comprising delivering to the subject the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, thereby expressing the SUMF1 open reading frame in the subject. In some embodiments, the subject is an animal model of a disorder associated with aberrant SUMF1 gene expression.
[0140] A further aspect of the invention relates to a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product (e.g, FGE) in a subject in need thereof, comprising delivering to the subject a therapeutically effective amount of the polynucleotide, expression cassette, vector, and/or transformed cell of the invention, thereby treating the disorder associated with aberrant expression of the SUMF1 gene or aberrant activity of a SUMF1 gene product in the subject. The invention provides a method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product (e.g, FGE) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, the expression cassette, vector, and/or transformed cell of the invention, such that the SUMF1 open reading frame is expressed in the subject. In some embodiments, the disorder associated with expression of the SUMF1 gene or gene product may be neonatal MSD. In some embodiments, the disorder associated with expression of the SUMF1 gene or gene product may be severe late infantile MSD. In some embodiments, the disorder associated with expression of the SUMF1 gene or gene product may be mild late infantile MSD. In some embodiments, the disorder associated with expression of the SUMF1 gene or gene product may be juvenile MSD. In some embodiments, the disorder associated with expression of the SUMFl gene or gene product may be adult-onset MSD.
[0141] The invention further provides a method of treating MSD in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide, the expression cassette, vector, and/or transformed cell of the invention, such that the SUMFl open reading frame is expressed in the subject.
[0142] In some embodiments, the methods of the present invention further comprise administering to the subject a bone marrow transplant (BMT), e.g., prior to administering the effective amount of a polynucleotide, expression cassette, vector, and/or transformed cell of the present invention. Techniques for performing BMT (referred to interchangeably as a hematopoietic stem cell transplant (HSCT)) are well known to those of skill in the art, and are routine for clinicians in the treatment of subjects (e.g, patients, e.g, human patients) in need thereof. The skilled clinician can readily determine the proper regimen to be used for performing BMT based on factors including the age and condition of the subject, type of disease being treated, stage of the disease, patient size, and the like.
[0143] In certain embodiments, the polynucleotide, expression cassette, vector, and/or transformed cell is delivered to the subject, e.g, systemically (e.g, intravenously) or directly to the central nervous system (e.g, to the cerebrospinal fluid by intrathecal or intraventricular injection) of the subject. In some embodiments, the polynucleotide, expression cassette, vector, and/or transformed cell is delivered intravenously. In some embodiments, the polynucleotide, expression cassette, vector, and/or transformed cell is delivered intracerebroventricularly.
[0144] Recombinant virus vectors according to the present invention find use in both veterinary and medical applications. Suitable subjects include both avians and mammals. The term“avian” as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasant, parrots, parakeets. The term“mammal” as used herein includes, but is not limited to, humans, primates, non-human primates (e.g, monkeys and baboons), cattle, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g, rats, mice, hamsters, and the like), etc. Human subjects include neonates, infants, juveniles, and adults. Optionally, the subject is“in need of’ the methods of the present invention, e.g., because the subject has or is believed at risk for a disorder including those described herein or that would benefit from the delivery of a polynucleotide including those described herein. As a further option, the subject can be a laboratory animal and/or an animal model of disease. Preferably, the subject is a human.
[0145] In certain embodiments, the polynucleotide of the invention is administered to a subject in need thereof as early as possible in the life of the subject, e.g, as soon as the subject is diagnosed with aberrant SUMF1 and/or FGE expression or activity or any of the above-mentioned diseases or disorders. In some embodiments, the polynucleotide is administered to a newborn subject, e.g, after newborn screening has identified aberrant SUMF1 and/or FGE expression or activity. In some embodiments, the polynucleotide is administered to a subject prior to the age of 5 years, e.g, prior to 1, 2, 3, 4, or 5 years of age. In some embodiments, the polynucleotide is administered to a fetus in utero , e.g, after prenatal screening has identified aberrant SUMF1 and/or FGE expression or activity or the presence of one of the above-mentioned diseases or disorders. In some embodiments, the polynucleotide is administered to a subject as soon as the subject develops symptoms associated with aberrant SUMF1 and/or FGE expression or activity or is suspected or diagnosed as having aberrant SUMF1 and/or FGE expression or activity or one of the above- mentioned diseases or disorders. In some embodiments, the polynucleotide is administered to a subject before the subject develops symptoms associated with aberrant SUMF1 and/or FGE expression or activity or disease/disorder, e.g, a subject that is suspected or diagnosed as having aberrant SUMF1 and/or FGE expression or activity or one of the above-mentioned diseases or disorders but has not started to exhibit symptoms.
[0146] In particular embodiments, the present invention provides a pharmaceutical composition comprising a polynucleotide, expression cassette, vector, and/or transformed cell of the invention in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. For other methods of administration, the carrier may be either solid or liquid. For inhalation administration, the carrier will be respirable, and will preferably be in solid or liquid particulate form. In some embodiments, a pharmaceutical carrier may be D-sorbitol (e.g, PBS 5% w/v D-sorbitol).
[0147] By“pharmaceutically acceptable” it is meant a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects. [0148] One aspect of the present invention is a method of transferring a SUMF1 ORF to a cell in vitro. The polynucleotide, expression cassette, and/or vector of the invention may be introduced to the cells in the appropriate amount. The virus vector may be introduced to the cells at the appropriate multiplicity of infection according to standard transduction methods appropriate for the particular target cells. Titers of the virus vector or capsid to administer can vary, depending upon the target cell type and number, and the particular virus vector or capsid, and can be determined by those of skill in the art without undue experimentation. In particular embodiments, at least about 103 infectious units, more preferably at least about 105 infectious units are introduced to the cell.
[0149] The cell(s) into which the polynucleotide, expression cassette, and/or vector of the invention, e.g., virus vector, can be introduced may be of any type, including but not limited to neural cells (including cells of the peripheral and central nervous systems, in particular, brain cells such as neurons, oligodendrocytes, glial cells, astrocytes), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (e.g, gut and respiratory epithelial cells), skeletal muscle cells (including myoblasts, myotubes and myofibers), diaphragm muscle cells, dendritic cells, pancreatic cells (including islet cells), hepatic cells, a cell of the gastrointestinal tract (including smooth muscle cells, epithelial cells), heart cells (including cardiomyocytes), bone cells (e.g, bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, joint cells (including, e.g, cartilage, meniscus, synovium and bone marrow), germ cells, and the like. Alternatively, the cell may be any progenitor cell. As a further alternative, the cell can be a stem cell (e.g, neural stem cell, liver stem cell). As still a further alternative, the cell may be a cancer or tumor cell. Moreover, the cells can be from any species of origin, as indicated above.
[0150] The polynucleotide, expression cassette, and/or vector of the invention, e.g, virus vector, may be introduced to cells in vitro for the purpose of administering the modified cell to a subject. In particular embodiments, the cells have been removed from a subject, the polynucleotide, expression cassette, and/or vector of the invention, e.g, virus vector, is introduced therein, and the cells are then replaced back into the subject. Methods of removing cells from subject for treatment ex vivo , followed by introduction back into the subject are known in the art (see, e.g, U.S. patent No. 5,399,346). Alternatively, the polynucleotide, expression cassette, and/or vector of the invention, e.g, virus vector, is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof. [0151] Suitable cells for ex vivo gene therapy are as described above. Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 102 to about 108 or about 103 to about 106 cells will be administered per dose in a pharmaceutically acceptable carrier. In particular embodiments, the cells transduced with the virus vector ex vivo are administered to the subject in an effective amount in combination with a pharmaceutical carrier.
[0152] A further aspect of the invention is a method of administering the polynucleotide, expression cassette, and/or vector of the invention, e.g., virus vector, to a subject. In particular embodiments, the method comprises a method of delivering a SUMF1 ORF to an animal subject, the method comprising: administering an effective amount of a virus vector according to the invention to an animal subject. Administration of the virus vectors of the present invention to a human subject or an animal in need thereof can be by any means known in the art. Optionally, the virus vector is delivered in an effective dose in a pharmaceutically acceptable carrier.
[0153] Dosages of the virus vectors to be administered to a subject will depend upon the mode of administration, the disease or condition to be treated, the individual subject’s condition, the particular virus vector, and the nucleic acid to be delivered, and can be determined in a routine manner. Exemplary doses for achieving therapeutic effects are virus titers of at least about 102, 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015, 1016 transducing units or more, e.g., about 107, 108, 109, 1010, 1011, 1012, 1013, 1014, or 1015 transducing units, yet more preferably about 1010, 1011, 1012, 1013, 1014, or 1015 transducing units (TU). Doses and virus titer transducing units may be calculated as vector or viral genomes (vg), and/or vg/kg of the subject.
[0154] In particular embodiments, more than one administration (e.g, two, three, four or more administrations) may be employed to achieve the desired level of gene expression over a period of various intervals, e.g, daily, weekly, monthly, yearly, etc.
[0155] Exemplary modes of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g, via an aerosol), buccal (e.g, sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g, intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and/or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g, to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intro- lymphatic, and the like, as well as direct tissue or organ injection (e.g, to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain). Administration can also be to a tumor (e.g, in or a near a tumor or a lymph node). The most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular vector that is being used. In some embodiments, more than one mode and/or route of administration may be utilized, for example, e.g, intraparenchymal administration and i ntr acer eb r oventri cul ar admi ni strati on .
[0156] In some embodiments, the viral vector is administered to the CNS, the peripheral nervous system, or both. In some embodiments, the viral vector is administered directly to the CNS, e.g, the brain or the spinal cord. Direct administration can result in high specificity of transduction of CNS cells, e.g, wherein at least 80%, 85%, 90%, 95% or more of the transduced cells are CNS cells. Any method known in the art to administer vectors directly to the CNS can be used. The vector may be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (corpus striatum, cerebrum including the occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and amygdala), limbic system, neocortex, corpus striatum, cerebrum, and inferior colliculus. The vector may also be administered to different regions of the eye such as the retina, cornea or optic nerve. The vector may be delivered into the cerebrospinal fluid (e.g, by lumbar puncture) for more disperse administration of the vector.
[0157] The delivery vector may be administered to the desired region(s) of the CNS by any route known in the art, including but not limited to, intrathecal, intracerebral, intraventricular, intraparenchymal, intranasal, intra-aural, intra-ocular (e.g, intra- vitreous, sub-retinal, anterior chamber) and peri-ocular (e.g, sub-Tenon’s region) delivery or any combination thereof.
[0158] The delivery vector may be administered in a manner that produces a more widespread, diffuse transduction of tissues, including the CNS, the peripheral nervous system, and/or other tissues.
[0159] Typically, the viral vector will be administered in a liquid formulation by direct injection (e.g, stereotactic injection) to the desired region or compartment in the CNS and/or other tissues. In some embodiments, the vector can be delivered via a reservoir and/or pump. In other embodiments, the vector may be provided by topical application to the desired region or by intra-nasal administration of an aerosol formulation. Administration to the eye or into the ear, may be by topical application of liquid droplets. As a further alternative, the vector may be administered as a solid, slow-release formulation. Controlled release of parvovirus and AAV vectors is described by international patent publication WO 01/91803. [0160] Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, one may administer the virus vector in a local rather than systemic manner, for example, in a depot or sustained-release formulation. Further, the virus vector can be delivered dried to a surgically implantable matrix such as a bone graft substitute, a suture, a stent, and the like ( e.g as described in U.S. Patent 7,201,898).
[0161] Pharmaceutical compositions suitable for oral administration can be presented in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the composition of this invention; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion. Oral delivery can be performed by complexing a virus vector of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers include plastic capsules or tablets, as known in the art. Such formulations are prepared by any suitable method of pharmacy, which includes the step of bringing into association the composition and a suitable carrier (which may contain one or more accessory ingredients as noted above). In general, the pharmaceutical composition according to embodiments of the present invention are prepared by uniformly and intimately admixing the composition with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the resulting mixture. For example, a tablet can be prepared by compressing or molding a powder or granules containing the composition, optionally with one or more accessory ingredients. Compressed tablets are prepared by compressing, in a suitable machine, the composition in a free-flowing form, such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, and/or surface active/dispersing agent(s). Molded tablets are made by molding, in a suitable machine, the powdered compound moistened with an inert liquid binder.
[0162] Pharmaceutical compositions suitable for buccal (sub-lingual) administration include lozenges comprising the composition of this invention in a flavored base, usually sucrose and acacia or tragacanth; and pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia.
[0163] Pharmaceutical compositions suitable for parenteral administration can comprise sterile aqueous and non-aqueous injection solutions of the composition of this invention, which preparations are optionally isotonic with the blood of the intended recipient. These preparations can contain anti-oxidants, buffers, bacteriostats and solutes, which render the composition isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions, solutions and emulsions can include suspending agents and thickening agents. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
[0164] The compositions can be presented in unit/dose or multi-dose containers, for example, in sealed ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water- for-injection immediately prior to use.
[0165] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the kind previously described. For example, an injectable, stable, sterile composition of this invention in a unit dosage form in a sealed container can be provided. The composition can be provided in the form of a lyophilizate, which can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into a subject. The unit dosage form can be from about 1 pg to about 10 grams of the composition of this invention. When the composition is substantially water- insoluble, a sufficient amount of emulsifying agent, which is physiologically acceptable, can be included in sufficient quantity to emulsify the composition in an aqueous carrier. One such useful emulsifying agent is phosphatidyl choline.
[0166] Pharmaceutical compositions suitable for rectal administration can be presented as unit dose suppositories. These can be prepared by admixing the composition with one or more conventional solid carriers, such as for example, cocoa butter and then shaping the resulting mixture.
[0167] Pharmaceutical compositions of this invention suitable for topical application to the skin can take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers that can be used include, but are not limited to, petroleum jelly, lanoline, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof. In some embodiments, for example, topical delivery can be performed by mixing a pharmaceutical composition of the present invention with a lipophilic reagent ( e.g DMSO) that is capable of passing into the skin. [0168] Pharmaceutical compositions suitable for transdermal administration can be in the form of discrete patches adapted to remain in intimate contact with the epidermis of the subject for a prolonged period of time. Compositions suitable for transdermal administration can also be delivered by iontophoresis (see, for example, Pharm. Res. 3:318 (1986)) and typically take the form of an optionally buffered aqueous solution of the composition of this invention. Suitable formulations can comprise citrate or bis\tris buffer (pH 6) or ethanol/water and can contain from 0.1 to 0.2M active ingredient.
[0169] The virus vectors disclosed herein may be administered to the lungs of a subject by any suitable means, for example, by administering an aerosol suspension of respirable particles comprised of the virus vectors, which the subject inhales. The respirable particles may be liquid or solid. Aerosols of liquid particles comprising the virus vectors may be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skill in the art. See, e.g., U.S. Patent No. 4,501,729. Aerosols of solid particles comprising the virus vectors may likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.
[0170] Having described the present invention, the same will be explained in greater detail in the following examples, which are included herein for illustration purposes only, and which are not intended to be limiting to the invention.
EXAMPLES
EXAMPLE 1: SUMF1 species comparison.
[0171] A codon-optimized (amino acids do not change) human SUMF1 sequence for AAV9-mediated delivery was developed. The hSUMFlopt was compared to the mouse, rat and monkey using the Clustal sequence alignment program. The comparison of the sequences with the signal peptide removed indicates a high-level of identity between the sequences as shown in FIG. 1. Based on the high degree of conservation, it is highly unlikely that SUMF1 will have an altered biological activity in rodents versus primates.
EXAMPLE 2: AAV9/SUMF1 construct design.
[0172] AAV9/SUMF1 is a recombinant serotype 9 adeno-associated virus (AAV) encoding a codon-optimized human SIJMF1 transgene {hSUMFlopt). AAV serotype 9 vector is capable of widespread transduction (tissue tropism), including the central nervous system (CNS) and somatic system (body) following intravenous or intracerebrospinal fluid administration. The CNS and systemic tropisms of AAV9 make it ideal for treating lysosomal storage diseases with global organ disease manifestations. Codon optimization of the DNA sequence modifies the sequence such that the final amino acid sequence is unchanged but nucleotide sequence is altered for easier detection along with potentially stronger expression. The final product consists of AAV9 capsids that are packaged with the self-complementary AAV genome comprising a mutant AAV2 inverted terminal repeat (ITR) with the D element deleted, the“CBh” promoter (796 kb CMV enhancer, chicken beta actin promoter, synthetic intron (Gray et al. 2011 Human Gene Therapy 22(9): 1134-1153)), codon-optimized human SUMF 1 DNA coding sequence (1122 bp), the simian virus 40 polyadenylation signal (143 bp), and WT AAV2 ITR. The CBh promoter is identical to the construct utilized and characterized in rodents, pigs, and non -human primates (Federici et al. 2011 Gene Ther. 19(8):852-859; Gray et al. 2011 Mol Ther. 19(6): 1058-1069). The CBh promoter and SV40 polyA are utilized for their ability to both be small in size as well as drive strong expression allowing for packaging into a self-complementary (sc) AAV vector. The upstream inverted terminal repeat (ITR; proximal to the promoter) is from AAV2, with the D element deleted to promote packaging of a sc genome. The downstream ITR (proximal to the polyA) is an intact WT AAV2 ITR. Self-complementary scAAV vectors are 10-100 times more efficient at transduction compared to traditional single-stranded AAV vectors (McCarty et al. 2003 Gene Ther. 10:2112-2118; McCarty et al. 2001 Gene Ther. 8: 1248-1254). The final product consists of a solution of AAV9/SUMF1 in phosphate-buffered saline with 5% D-sorbitol.
EXAMPLE 3: Mouse in vivo MSD rescue studies.
[0173] The present study was performed using a mouse model of SUMF1 deficiency. Settembre et. al. generated a Sumfl knock out mouse model (Settembre et al. 2007 PNAS 104(11);4506-4511; Spampanato et al. 2011) where the sulfatase activities are completely absent in Sumfl-I- mice. These mice display severe developmental, neurological, behavioral and histopathological deficits starting in the first week. The mice are smaller compared to wildtype mice, including slower overall growth, flattened facial features, shorter limbs, and smaller skull, with severe kyphosis, spinal vertebral and joint deficits and seizures and tremors. While severe, the phenotype reported in these mice is consistent with the development of pathology from defects in SUMF1. This model is representative of the most severe form of MSD in human populations, the neonatal presentation.
[0174] A colony of Sumfl-/- mice was established at the Jackson Laboratory, Bar Harbor, ME wherein proof-of-concept and therapeutic interventions with AAV9/SUMF1 are being executed. Sumfl -/- mice are able to survive until 5 days of age and approximately 30% survive to 20 days (FIGS. 2A and 3A). Wild-type mice are used to compare the performance of the treatment where untreated KO mice are not available due to their short lifespan.
[0175] The age of disease onset in individuals with SUMF1 mutations is at birth or within the first few years. Earliest possible intervention is expected to be the most beneficial, due to the rapid neurodegenerative properties of the disease. The preclinical model has an early lethality phenotype, so the intervention window is limited. Survival and adverse events are a measure of therapeutic benefit and safety endpoints for risk analysis following the treatment.
Table 5: Mouse model efficacy studies.
Figure imgf000045_0002
*Maximum feasible dose for ICV route only. **Maximum feasible dose for IT route only.
Figure imgf000045_0001
[0176] Intervention is at PND1 and PND 7 as outlined above in Table 5. Treatment included 6 cohorts: 1) Untreated Sumfl +/+ mice represent a healthy cohort, 2) A A V9/ SUMP 1 -i nj ected Sumfl +/+ mice represent a non-disease phenotype to monitor safety of the gene therapy, 3) A A V9/ SUMF 1 -i nj ected Sumfl -/- mice to investigate the efficacy and safety of the gene therapy, 4) untreated administered Sumfl-/- mice to represent the natural course of the disease and 5) vehicle treated Sumfl +/+ and 6) vehicle treated Sumfl -/- mice to monitor any effects from injection technique. Age groups are as follows:
[0177] PND 1 (Neonatal intervention): The data from this cohort is expected to provide a proof-of-concept for the therapy, demonstrating the highest efficacy. The route of administration for this cohort is intracerebroventricular (ICV), as a proof-of-concept. Note that these mice receive a dose of 2.8xlOu vg (approximately 2.8xl014 vg/kg).
[0178] PND7 (Delayed intervention): This cohort represents intervention following the detection of MSD disease signs in the mice and evaluation of long term safety data, using the IT route of administration. Note that these mice receive a dose of 7xlOu vg. [0179] The survival data for these cohorts and the body weights are presented in FIGS. 2A- 2B and FIGS. 3A-3B. The untreated Sumfl KO cohort had ~ 50% mortality on PND 10 and 6% of mice survived past Day 40 with eventual 100% lethality. Mice that received AAV9/SUMF1 on PND1 had significantly better survival with greater than 75% of mice surviving past Day 40 and over 50% of mice surviving beyond 300 days, so far (FIG. 2A). Mice that received AAV9/SUMF1 on PND7 also had significantly better survival with 70% of mice surviving past Day 40 and great than 50% of mice surviving beyond 200 days, so far (FIG. 3A). The treated mice gained weight gradually with a growth curve similar to their wild-type littermates, but at a slower pace (FIGS. 2B and 3B). No signs of tremors or seizures were detected, or signs of kyphosis. The treated mice retain cranio-facial abnormalities, which may be due to underlying bone deformities during development. The improved survival is likely from resolution of underlying pathology as evidenced by lack of physical deformities (besides facial dismorphometry) and clinical signs including seizures in these mice. In addition, no overt adverse events were observed in Sumfl-/- or littermate control mice when treated with the vector and the injection technique did not negatively impact vehicle treated mice.
[0180] All references cited herein are incorporated herein by reference in their entireties and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.
[0181] The foregoing examples are illustrative of the present invention, and are not to be construed as limiting thereof. Although the invention has been described in detail with reference to preferred embodiments, variations and modifications exist within the scope and spirit of the invention as described and defined in the following claims.

Claims

What is claimed is:
1. A polynucleotide comprising a human SUMFl open reading frame, wherein the human SUMFl open reading frame is codon-optimized for expression in a human cell.
2. The polynucleotide of claim 1, wherein the human SUMFl open reading frame comprises the nucleotide sequence of SEQ ID NO: l or a nucleotide sequence having at least about 90% identity thereto.
3. An expression cassette comprising a polynucleotide comprising a human SUMFl open reading frame.
4. The expression cassette of claim 3, wherein the polynucleotide is the polynucleotide of claim 1 or 2.
5. The expression cassette of claim 3 or 4, wherein the human SUMFl open reading frame is operably linked to a promoter.
6. The expression cassette of claim 5, wherein the promoter is a chicken beta actin promoter.
7. The expression cassette of any one of claims 3-6, wherein the human SUMFl open reading frame is operably linked to a polyadenylation signal.
8. The expression cassette of claim 7, wherein the polyadenylation signal is a simian virus 40 (SV40) polyadenylation signal.
9. The expression cassette of any one of claims 3-8, wherein the human SUMFl open reading frame is operably linked to an enhancer.
10. The expression cassette of claim 9, wherein the enhancer is a cytomegalovirus (CMV) enhancer.
11. The expression cassette of any one of claims 3-10, further comprising at least one adeno-associated virus (AAV) inverted terminal repeat (ITR).
12. The expression cassette of claim 11, wherein the expression cassette comprises two AAV ITRs.
13. The expression cassette of claim 12, wherein the two AAV ITRs have the same nucleotide sequence.
14. The expression cassette of claim 12, wherein the two AAV ITRs have different nucleotide sequences.
15. The expression cassette of any one of claims 12-14, wherein one of the two AAV ITRs is a modified ITR.
16. The expression cassette of any one of claims 12-14, wherein one of the two AAV ITRs is a D-element deletion modified ITR.
17. The expression cassette of any one of claims 11-16, wherein the AAV ITRs are AAV2 ITRs.
18. The expression cassette of any one of claims 3-17, wherein the expression cassette is a self-complementary AAV genome.
19. The expression cassette of any one of claims 3-18, wherein the expression cassette comprises a promoter, the human SUMF1 open reading frame, and a polyadenylation site.
20. The expression cassette of any one of claims 3-19, wherein the expression cassette comprises an AAV ITR, a promoter, the human SUMF1 open reading frame, a polyadenylation site, and an AAV ITR.
21. The expression cassette of any one of claims 3-20, wherein the expression cassette comprises an AAV ITR, an enhancer, a promoter, the human SUMF1 open reading frame, a polyadenylation site, and an AAV ITR.
22. The expression cassette of any one of claims 3-21, wherein the expression cassette comprises a CMV enhancer, a chicken beta actin promoter, the human SUMF1 open reading frame, and an SV40 polyadenylation site.
23. The expression cassette of any one of claims 3-22, wherein the expression cassette comprises an AAV ITR, a CMV enhancer, a chicken beta actin promoter, the human SUMF1 open reading frame, an SV40 polyadenylation site, and an AAV ITR.
24. The expression cassette of any one of claims 3-23, wherein the expression cassette comprises an AAV2 ITR, a CMV enhancer, a chicken beta actin promoter, the human SUMF1 open reading frame, an SV40 polyadenylation site, and an AAV2 ITR.
25. The expression cassette of any one of claims 3-24, wherein the expression cassette comprises a wildtype AAV2 ITR, a CMV enhancer, a chicken beta actin promoter, the human SUMF1 open reading frame, an SV40 polyadenylation site, and a modified AAV2 ITR.
26. The expression cassette of claim 24 or 25, comprising the nucleotide sequence of SEQ ID NO: 10 or a sequence at least about 90% identical thereto.
27. A vector comprising the polynucleotide of claim 1 or 2 or the expression cassette of any one of claims 3-26.
28. The vector of claim 27, wherein the vector is a viral vector.
29. The vector of claim 27, wherein the vector is an AAV vector.
30. The vector of claim 29, wherein the AAV vector is an AAV9 vector.
31. A transformed cell comprising the polynucleotide of claim 1 or 2, the expression cassette of any one of claims 3-26, and/or the vector of any one of claims 27-30.
32. The transformed cell of claim 31, wherein the polynucleotide, expression cassette, and/or vector is stably incorporated into the cell genome.
33. A transgenic animal comprising the polynucleotide of claim 1 or 2, the expression cassette of any one of claims 3-26, the vector of any one of claims 27-30, and/or the transformed cell of claim 31 or 32.
34. A pharmaceutical composition comprising the polynucleotide of claim 1 or 2, the expression cassette of any one of claims 3-26, the vector of any one of claims 27-30, and/or the transformed cell of claim 31 or 32 in a pharmaceutically acceptable carrier.
35. A method of expressing a SUMF1 open reading frame in a cell, comprising contacting the cell with the polynucleotide of claim 1 or 2, the expression cassette of any one of claims 3-26, and/or the vector of any one of claims 27-30, thereby expressing the SUMF1 open reading frame in the cell.
36. A method of expressing a SUMF1 open reading frame in a subject, comprising delivering to the subject the polynucleotide of claim 1 or 2, the expression cassette of any one of claims 3-26, the vector of any one of claims 27-30, and/or the transformed cell of claim 31 or 32, thereby expressing the SUMF1 open reading frame in the subject.
37. A method of treating a disorder associated with aberrant expression of a SUMF1 gene or aberrant activity of a SUMF1 gene product in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide of claim 1 or 2, the expression cassette of any one of claims 3-26, the vector of any one of claims 27- 30, and/or the transformed cell of claim 31 or 32, such that the SUMF1 open reading frame is expressed in the subject.
38. The method of claim 37, wherein the disorder associated with expression of the SUMF1 gene is multiple sulfatase deficiency (MSD) (e.g, neonatal, severe late infantile, mild late infantile, and/or juvenile MSD).
39. A method of treating multiple sulfatase deficiency (MSD) (e.g, neonatal, severe late infantile, mild late infantile, and/or juvenile MSD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide of claim 1 or 2, the expression cassette of any one of claims 3-26, the vector of any one of claims 27- 30, and/or the transformed cell of claim 31 or 32, such that the SUMF1 open reading frame is expressed in the subject.
40. The method of any one of claims 36-39, wherein the subject exhibits symptoms of the disease prior to delivery of the polynucleotide, expression cassette, vector, and/or
transformed cell.
41. The method of any one of claims 36-40, wherein the polynucleotide, expression cassette, vector, and/or transformed cell is delivered prior to the age of 5 years ( e.g 5 years,
4 years, 3, years, 2 years, 1 year) of the subject.
42. The method of any one of claims 36-40, wherein the polynucleotide, expression cassette, vector, and/or transformed cell is delivered in utero.
43. The method of any one of claims 36-42, wherein the subject is a human.
44. The method of any one of claims 36-43, wherein the polynucleotide, expression cassette, vector, and/or transformed cell is delivered to the nervous system of the subject.
45. The method of 36-44, wherein the polynucleotide, expression cassette, vector, and/or transformed cell is delivered intravenously.
46. The method of claim 44, wherein the polynucleotide, expression cassette, vector, and/or transformed cell is delivered by intrathecal, intracerebral, intraparenchymal, intracerebroventricular, intranasal, intra-aural, intra-ocular, or peri-ocular delivery, or any combination thereof.
47. The method of claim 46, wherein the polynucleotide, expression cassette, vector, and/or transformed cell is delivered intrathecally.
48. The method of claim 46, wherein the polynucleotide, expression cassette, vector, and/or transformed cell is delivered intracerebroventricularly.
PCT/US2020/030236 2019-04-29 2020-04-28 Optimized sumf1 genes and expression cassettes and their use WO2020223215A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US17/606,890 US20220213450A1 (en) 2019-04-29 2020-04-28 Optimized sumf1 genes and expression cassettes and their use
CA3144654A CA3144654A1 (en) 2019-04-29 2020-04-28 Optimized sumf1 genes and expression cassettes and their use
EP20798551.6A EP3963073A4 (en) 2019-04-29 2020-04-28 Optimized sumf1 genes and expression cassettes and their use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962840114P 2019-04-29 2019-04-29
US62/840,114 2019-04-29

Publications (1)

Publication Number Publication Date
WO2020223215A1 true WO2020223215A1 (en) 2020-11-05

Family

ID=73029444

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/030236 WO2020223215A1 (en) 2019-04-29 2020-04-28 Optimized sumf1 genes and expression cassettes and their use

Country Status (4)

Country Link
US (1) US20220213450A1 (en)
EP (1) EP3963073A4 (en)
CA (1) CA3144654A1 (en)
WO (1) WO2020223215A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112889712A (en) * 2021-01-28 2021-06-04 海南昌江元道养殖有限公司 Standardized healthy breeding method for high-quality golden pomfret

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014136065A2 (en) * 2013-03-05 2014-09-12 Oxyrane Uk Limited Production of catalytically active type i sulfatase
US20160201039A1 (en) * 2008-01-18 2016-07-14 Biomarin Pharmaceutical Inc. Manufacture of Active Highly Phosphorylated Human Lysosomal Sulfatase Enzymes and Uses Thereof
US20160230205A1 (en) * 2015-02-05 2016-08-11 R.P. Scherer Technologies, Llc Activated Formylglycine-Generating Enzymes and Methods of Producing and Using the Same
US20170191041A1 (en) * 2014-07-11 2017-07-06 Biostrategies LC Materials and methods for treating disorders associated with sulfatase enzymes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190269799A1 (en) * 2016-11-15 2019-09-05 Kanut LAOHARAWEE Method for improving neurological function in mpsi and mpsii and other neurological disorders

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160201039A1 (en) * 2008-01-18 2016-07-14 Biomarin Pharmaceutical Inc. Manufacture of Active Highly Phosphorylated Human Lysosomal Sulfatase Enzymes and Uses Thereof
WO2014136065A2 (en) * 2013-03-05 2014-09-12 Oxyrane Uk Limited Production of catalytically active type i sulfatase
US20170191041A1 (en) * 2014-07-11 2017-07-06 Biostrategies LC Materials and methods for treating disorders associated with sulfatase enzymes
US20160230205A1 (en) * 2015-02-05 2016-08-11 R.P. Scherer Technologies, Llc Activated Formylglycine-Generating Enzymes and Methods of Producing and Using the Same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FRALDI, A. ET AL.: "SUMF1 enhances sulfatase activities in vivo in five sulfatase deficiencies", BIOCHEM. J., vol. 403, 2007, pages 305 - 312, XP002601852, DOI: 10.1042/BJ20061783 *
See also references of EP3963073A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112889712A (en) * 2021-01-28 2021-06-04 海南昌江元道养殖有限公司 Standardized healthy breeding method for high-quality golden pomfret

Also Published As

Publication number Publication date
EP3963073A4 (en) 2023-01-25
US20220213450A1 (en) 2022-07-07
CA3144654A1 (en) 2020-11-05
EP3963073A1 (en) 2022-03-09

Similar Documents

Publication Publication Date Title
US20230372544A1 (en) Optimized cln1 genes and expression cassettes and their use
AU2020279387A1 (en) UBE3A genes and expression cassettes and their use
EP3833767A1 (en) Optimized cln7 genes and expression cassettes and their use
WO2020223215A1 (en) Optimized sumf1 genes and expression cassettes and their use
US11491241B2 (en) Optimized AGA genes and expression cassettes and their use
WO2022020697A1 (en) Optimized slc13a5 genes and expression cassettes and their use
WO2020132385A1 (en) Optimized galc genes and expression cassettes and their use
US20230149564A1 (en) Aav-naglu vectors for treatment of mucopolysaccharidosis iiib
EP3877532A1 (en) Optimized fig4 genes and expression cassettes and their use
EP4423264A1 (en) Aav-idua vector for treatment of mps i
WO2022204077A1 (en) Arsb vectors for treatment of mps vi-associated blindness and other ocular manifestations
WO2020006200A1 (en) Optimized cln5 genes and expression cassettes and their use
WO2023240220A1 (en) Aav-sgsh vectors for treatment of mucopolysaccharidosis iiia

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20798551

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020798551

Country of ref document: EP

Effective date: 20211129

ENP Entry into the national phase

Ref document number: 3144654

Country of ref document: CA