WO2020222566A1 - 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물 - Google Patents

분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2020222566A1
WO2020222566A1 PCT/KR2020/005769 KR2020005769W WO2020222566A1 WO 2020222566 A1 WO2020222566 A1 WO 2020222566A1 KR 2020005769 W KR2020005769 W KR 2020005769W WO 2020222566 A1 WO2020222566 A1 WO 2020222566A1
Authority
WO
WIPO (PCT)
Prior art keywords
mitochondria
cells
myositis
pharmaceutical composition
group
Prior art date
Application number
PCT/KR2020/005769
Other languages
English (en)
French (fr)
Inventor
한규범
김천형
유신혜
이서은
임상민
정한선
나광민
한윤미
손준영
이은영
김정연
송영욱
팽진철
이윤상
황도원
Original Assignee
주식회사 파이안바이오테크놀로지
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 파이안바이오테크놀로지 filed Critical 주식회사 파이안바이오테크놀로지
Priority to EP20798096.2A priority Critical patent/EP3964218A4/en
Priority to US17/607,850 priority patent/US20220211754A1/en
Priority to CN202080048016.3A priority patent/CN114051410A/zh
Priority to JP2021563663A priority patent/JP2022530232A/ja
Priority to AU2020264869A priority patent/AU2020264869A1/en
Priority to CA3138170A priority patent/CA3138170A1/en
Priority to BR112021021804A priority patent/BR112021021804A2/pt
Publication of WO2020222566A1 publication Critical patent/WO2020222566A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/19—Platelets; Megacaryocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/30—Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/33—Fibroblasts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/34—Muscles; Smooth muscle cells; Heart; Cardiac stem cells; Myoblasts; Myocytes; Cardiomyocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/35—Fat tissue; Adipocytes; Stromal cells; Connective tissues
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/50—Placenta; Placental stem cells; Amniotic fluid; Amnion; Amniotic stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/52—Sperm; Prostate; Seminal fluid; Leydig cells of testes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating myositis comprising mitochondria as an active ingredient.
  • Myositis is a disease in which muscle fibers are damaged due to inflammation in the muscles, and the ability to contract muscles decreases along with pain in the muscles.
  • Myositis is divided into dermatomyositis, polymyositis, and inclusion body myositis, among which polymyositis and dermatomyositis are inflammatory myopathies, symptoms of decreased muscle strength in the limbs close to the trunk, increased muscle enzyme levels, increased expression of inflammatory cytokines, abnormal EMG, muscle Abnormalities appear on the biopsy.
  • muscle weakness due to polymyositis and dermatomyositis progresses gradually over several weeks or months, but in rare cases, it may progress rapidly. Untreated severe muscle weakness can lead to muscle loss. About 15% to 30% of patients suffering from polymyositis have been reported to be accompanied by malignant tumors, and when dermatomyositis occurs in old age, cancer has been reported.
  • Steroids, immunosuppressants or immunomodulators are used for the treatment of polymyositis and dermatomyositis.
  • Steroids are the most commonly used drugs for early treatment, and whether or not to use immunosuppressants depends on the reaction to steroid treatment and side effects.
  • About 75% of myositis patients are prescribed immunosuppressants in addition to steroids.
  • an immunomodulator intravenous immunoglobulin has been proven to be effective in improving not only muscle strength but also signs of muscle biopsy in dermatitis.
  • immunosuppressants and immunomodulators are directly involved in the immune system and may have side effects, and the effects of the drugs do not last long, so they must be re-injected at intervals of 6 to 8 weeks.
  • a myositis-induced mouse model was used to evaluate the myositis treatment effect of an immunosuppressant against CXCL10 (CXC motif chemokine 10), a chemokine that is increased in expression in the muscle tissue of multiple myositis (Kim et al. , Arthritis Research & Therapy 2014, 16:R126).
  • CXCL10 CXC motif chemokine 10
  • chemokine 10 a chemokine that is increased in expression in the muscle tissue of multiple myositis
  • mitochondria are organelles of eukaryotic cells that are involved in the synthesis and regulation of adenosine triphosphate (ATP), a source of energy in cells.
  • ATP adenosine triphosphate
  • Mitochondria are involved in various metabolic pathways in vivo, such as cell signaling, cell differentiation, cell death, as well as the control of cell cycle and cell growth.
  • an object of the present invention is to provide a pharmaceutical composition for treating myositis and a method of treating myositis using the same.
  • an aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of myositis comprising mitochondria as an active ingredient.
  • Another aspect of the present invention provides a method for preventing or treating myositis comprising administering the pharmaceutical composition to an individual.
  • the pharmaceutical composition containing the mitochondria of the present invention as an active ingredient is administered to an individual suffering from myositis, inflammatory cells infiltrating the muscle cells of the individual can be reduced.
  • the pharmaceutical composition of the present invention can effectively reduce the expression of inflammatory cytokines in muscle tissue in which myositis has occurred. Therefore, the pharmaceutical composition according to the present invention can be usefully used in the prevention or treatment of myositis.
  • 1 is a view showing the measurement of the amount of ATP synthesis of mitochondria isolated from umbilical cord-derived mesenchymal stem cells.
  • FIG. 2 is a diagram showing the measurement of membrane potential activity of mitochondria isolated from umbilical cord-derived mesenchymal stem cells.
  • FIG. 3 is a view showing the measurement of active oxygen in mitochondria isolated from umbilical cord-derived mesenchymal stem cells.
  • FIG. 4 is a schematic diagram of a first animal experiment plan for confirming the myositis treatment effect according to administration of mitochondria using myositis-induced mice.
  • Figure 5 is a photograph of the quadriceps and hamstring muscles of the negative control group, the positive control group, and the experimental group to which foreign mitochondria were administered to confirm the inflammatory cells infiltrating muscle fibers with H & E (Hematoxylin & eosin).
  • FIG. 6 is a view in which the quadriceps of the negative control group, the positive control group, and the experimental group to which foreign mitochondria were administered were stained with H&E, and then the number of inflammatory cells infiltrated with muscle fibers was measured and scored.
  • FIG. 7 is a diagram showing the blood IL-6 concentration of mice in a normal group, a negative control group, a positive control group, and an experimental group to which mitochondria were administered.
  • FIG. 10 is a diagram schematically illustrating a second animal experiment plan for confirming the myositis treatment effect according to the administration of foreign mitochondria using myositis-induced mice.
  • 11 is a photograph of the quadriceps muscle of the negative control group, the positive control group, and the experimental group to which foreign mitochondria were administered to confirm the inflammatory cells infiltrated into the muscle fibers with H&E.
  • FIG. 12 is a photograph of the muscles of the popliteal region of the negative control group, the positive control group, and the experimental group administered with foreign mitochondria in order to confirm the inflammatory cells infiltrated into the muscle fibers with H&E.
  • FIG. 13 is a view obtained by measuring the number of inflammatory cells infiltrated into the muscle fibers after staining the quadriceps muscle of the negative control group, the positive control group, and the experimental group administered with foreign mitochondria with H&E.
  • FIG. 14 is a diagram showing the blood IL-1 ⁇ concentration of mice in the normal group, the negative control group, the positive control group, and the experimental group mice to which foreign mitochondria were administered.
  • 15 is a diagram showing the serum IL-6 concentration of mice in the normal group, the negative control group, the positive control group, and the experimental group mice to which foreign mitochondria were administered.
  • FIG. 16 is a graph showing the concentration of TNF- ⁇ in the blood of mice in a normal group, a negative control group, a positive control group, and an experimental group to which foreign mitochondria were administered.
  • FIG. 17 is a diagram showing the expression levels of IL-6 mRNA in muscles of mice in a normal group, a negative control group, a positive control group, and an experimental group to which foreign mitochondria were administered.
  • FIG. 18 is a diagram schematically illustrating a 3rd animal experiment plan for confirming the effect of myositis treatment according to the administration of foreign mitochondria using myositis-induced mice.
  • FIG. 19 shows that the number of inflammatory cells stained with H&E (Hematoxylin & eosin) decreased after mitochondrial transplantation of mice induced myositis model.
  • H&E Hematoxylin & eosin
  • FIG. 20 shows that the histological score was decreased by the scoring method after transplanting the mitochondria to the mouse induced myositis model.
  • Fig. 21 shows the reduction of inflammatory cytokine after mitochondria are transplanted into mice induced myositis model.
  • FIG. 22 shows that mitochondria activity increased after mitochondria were implanted in mice induced myositis model.
  • FIG. 28 is a view comparing the ATP activity of mitochondria isolated from umbilical cord-derived mesenchymal stem cells stored frozen and mitochondria isolated from cultured umbilical cord-derived mesenchymal stem cells.
  • 29 is a view comparing the membrane potentials of mitochondria isolated from umbilical cord-derived mesenchymal stem cells stored frozen and mitochondria isolated from cultured umbilical cord-derived mesenchymal stem cells.
  • FIG. 30 is a diagram showing the measurement of free radicals in mitochondria isolated from umbilical cord-derived mesenchymal stem cells and mitochondria isolated from cultured umbilical cord-derived mesenchymal stem cells.
  • FIG. 31 is a diagram showing the number of mitochondria in a solution containing mitochondria at a concentration of 1 ⁇ g/ml measured using a particle counter (Multisizer 4e, Beckman Coulter).
  • FIG. 32 is a diagram showing the number of mitochondria in a solution containing mitochondria at a concentration of 2.5 ⁇ g/ml, measured using a particle counter.
  • 33 is a diagram showing the number of mitochondria in a solution containing mitochondria at a concentration of 5 ⁇ g/ml, measured using a particle counter.
  • FIG. 34 is a diagram confirming the ability of TNF- ⁇ , IL-1 ⁇ , and IL-6 to inhibit mRNA expression by various types of cell-derived mitochondria in RAW264.7 cells activated with LPS.
  • FIG. 35 is an observation of the ability to inhibit the expression of IL-6 mRNA by various types of cell-derived mitochondria in THP-1 cells activated with LPS.
  • FIG. 36 shows the ability to inhibit the expression of IL-6 protein by various types of cell-derived mitochondria in THP-1 cells activated with LPS.
  • One aspect of the present invention provides a pharmaceutical composition for preventing or treating myositis comprising mitochondria as an active ingredient.
  • myositis refers to a disease in which muscle fibers are damaged due to inflammation in the muscles. Specifically, myositis is divided into dermatomyositis, polymyositis and inclusion body myositis, of which polymyositis and dermatomyositis belong to inflammatory myopathies. In the muscle tissue of polymyositis or dermatomyositis, the expression of inflammatory cytokines or chemokines such as CXCL10, IL-1 ⁇ , TNF- ⁇ , and IL-6 is increased.
  • inflammatory cytokines or chemokines such as CXCL10, IL-1 ⁇ , TNF- ⁇ , and IL-6 is increased.
  • Immunosuppressants or immunomodulators that inhibit CXCL10, IL-1 ⁇ , TNF- ⁇ or IL-6 are being developed as therapeutic agents for myositis.
  • an immunosuppressive agent or an immunomodulatory agent there is a problem that side effects appear due to direct involvement in the immune system.
  • a myositis-induced mouse model may be used to develop a myositis treatment.
  • CFA Complete Freund's adjuvant
  • PT pertussis toxin
  • the tissues in which inflammation and inflammatory cells are observed in the muscle of a myositis patient are the quadriceps and the popliteal muscles, the quadriceps and the popliteal muscle tissues can also be used in myositis-causing mice.
  • active ingredient refers to an ingredient that exhibits activity alone or together with an adjuvant (carrier) that is not active as such.
  • metabolomic profiles were analyzed in both the white muscle of the quadriceps and the red muscle of the soleus muscle using CE-TOFMS in the muscle of the C-protein induced myositis mouse model (CIM).
  • CCM C-protein induced myositis mouse model
  • the ratio of malate and aspartate was decreased, and it was confirmed that mitochondria damage was present.
  • inflammation was alleviated and mitochondria damage was restored by a test to confirm the efficacy of several doses of foreign mitochondria injection in the CIM mouse model.
  • the mitochondria may be obtained from a mammal, or may be obtained from a human. Specifically, the mitochondria may be isolated from cells or tissues. For example, the mitochondria may be isolated from cells cultured in vitro. In addition, the mitochondria may be obtained from somatic cells, germ cells, blood cells, or stem cells. In addition, the mitochondria may be obtained from platelets. The mitochondria may be normal mitochondria obtained from cells having normal mitochondrial biological activity. In addition, the mitochondria may be cultured in vitro.
  • the mitochondria may be obtained from autologous, allogenic or xenogenic.
  • autologous mitochondria refers to mitochondria obtained from tissues or cells of the same individual.
  • homologous mitochondria refers to mitochondria obtained from individuals belonging to the same species as the individual and having different genotypes for alleles.
  • heterogeneous mitochondria refer to mitochondria obtained from individuals belonging to different species from the individual.
  • the somatic cells may be muscle cells, hepatocytes, neurons, fibroblasts, epithelial cells, adipocytes, bone cells, white blood cells, lymphocytes, platelets, or mucosal cells.
  • the germ cells are cells that undergo meiosis and somatic division, and may be sperm or egg.
  • the stem cells may be any one selected from the group consisting of mesenchymal stem cells, adult stem cells, dedifferentiated stem cells, embryonic stem cells, bone marrow stem cells, neural stem cells, limbic stem cells, and tissue-derived stem cells.
  • the mesenchymal stem cells may be any one selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, and placenta.
  • the mitochondria when the mitochondria are separated from a specific cell, the mitochondria may be separated through various known methods such as using a specific buffer solution or using a potential difference and a magnetic field.
  • the mitochondrial separation can be obtained by crushing and centrifuging cells in terms of maintaining mitochondrial activity.
  • culturing cells, and first centrifuging a pharmaceutical composition containing such cells to produce a pellet resuspending the pellet in a buffer solution, homogenizing, and preparing the homogenized solution.
  • Second centrifugation may be performed to prepare a supernatant, and the supernatant may be subjected to a third centrifugation to purify mitochondria.
  • the first to third centrifugation may be performed at a temperature of 0°C to 10°C, preferably 3°C to 5°C.
  • the time during which the centrifugation is performed may be performed for 1 to 50 minutes, and may be appropriately adjusted according to the number of centrifugation and the content of the sample.
  • the first centrifugation may be performed at a rate of 100 ⁇ g to 1,000 ⁇ g , or 200 ⁇ g to 700 ⁇ g , or 300 ⁇ g to 450 ⁇ g .
  • the second centrifugation may be performed at a rate of 1 ⁇ g to 2,000 ⁇ g , or 25 ⁇ g to 1,800 ⁇ g , or 500 ⁇ g to 1,600 ⁇ g .
  • the third centrifugation may be performed at a rate of 100 ⁇ g to 20,000 ⁇ g , or 500 ⁇ g to 18,000 ⁇ g , or 800 ⁇ g to 15,000 ⁇ g .
  • the separated mitochondria can be quantified by quantifying protein.
  • the isolated mitochondria may be quantified through a BCA (bicinchoninic acid assay) assay.
  • the mitochondria in the pharmaceutical composition may be contained in a concentration of 0.1 ⁇ g/ml to 1,000 ⁇ g/ml, 1 ⁇ g/ml to 750 ⁇ g/ml, or 25 ⁇ g/ml to 500 ⁇ g/ml. In one embodiment of the present invention, concentrations of 25 ⁇ g/ml, 50 ⁇ g/ml, and 100 ⁇ g/ml were used.
  • the number of the separated mitochondria can be measured through a particle counter (Multisizer 4e, Beckman Coulter), and referring to a paper written by James D. McCully ( J Vis Exp . 2014; (91): 51682.)
  • the number of mitochondria may be as shown in Table 1 below.
  • Amount of isolated mitochondria ( ⁇ g) Number of mitochondria Concentration ( ⁇ g/mL) 0.01 2.16 ⁇ 10 5 ⁇ 0.01 ⁇ 10 5 0.1
  • Example 9 of the present invention as a result of measuring the number of mitochondria using a particle counter of 1 ⁇ g/ml, 2.5 ⁇ g/ml and 5 ⁇ g/ml, 1.96 ⁇ 10 6 ⁇ 0.98 ⁇ 10 6 , 5.97 ⁇ The measurements were 10 6 ⁇ 0.19 ⁇ 10 6 and 1.01 ⁇ 10 7 ⁇ 0.32 ⁇ 10 7 pieces.
  • the number of mitochondria at a concentration of 10 ⁇ g/ml is 2.16 ⁇ 10 7 ⁇ 0.08 ⁇ 10 7 and when multiplied by twice the number of mitochondria at a concentration of 5 ⁇ g/ml, 2.02 ⁇ 10 7 ⁇ 0.64 ⁇ It was confirmed to have a similar number range of 10 7 pieces.
  • the mitochondria in the pharmaceutical composition may be included in an amount of 1 ⁇ 10 5 number of mitochondria/ml to 5 ⁇ 10 9 number of mitochondria/ml.
  • the mitochondria in the pharmaceutical composition are 1 ⁇ 10 5 number of mitochondria/ml to 5 ⁇ 10 9 number of mitochondria/ml, 2 ⁇ 10 5 number of mitochondria/ml to 2 ⁇ 10 9 number of mitochondria/ml, 5 ⁇ 10 5 Number of mitochondria/ml to 1 ⁇ 10 9 Number of mitochondria/ml, 1 ⁇ 10 6 Number of mitochondria/ml to 5 ⁇ 10 8 Number of mitochondria/ml, 2 ⁇ 10 6 Number of mitochondria/ml to 2 ⁇ 10 8 Number of mitochondria/ml, It may be included in an amount of 5 ⁇ 10 6 number of mitochondria/ml to 1 ⁇ 10 8 number of mitochondria/ml or 1 ⁇ 10 7 number of mitochondria/ml to 5 ⁇ 10 7 number of mitochondria/ml.
  • the therapeutically effective dose of mitochondria included in the pharmaceutical composition may be 3 ⁇ 10 5 mitochondria number/kg to 1.5 ⁇ 10 10 mitochondria number/kg once based on the body weight of the subject to be administered.
  • the therapeutically effective dose of mitochondria in the pharmaceutical composition is 3 ⁇ 10 5 mitochondria number/kg to 1.5 ⁇ 10 10 mitochondria number/kg, 6 ⁇ 10 5 mitochondria number/kg once based on the body weight of the subject to be administered.
  • the pharmaceutical composition may be administered once to 10 times, 3 to 8 times, or 5 to 6 times, preferably 5 times.
  • the administration interval may be 1 to 7 days or 2 to 5 days, preferably 3 days.
  • the pharmaceutical composition according to the present invention can be administered to humans or other mammals suffering from myositis or suffering from such disease or disease.
  • the pharmaceutical composition may be an injection that can be administered intravenously, intramuscularly or subcutaneously, and preferably may be an injection formulation.
  • the pharmaceutical composition according to the present invention is a very stable injection product physically and chemically by adjusting the pH using a buffer solution such as an acid aqueous solution or phosphate that can be used as an injection in order to secure product stability according to the distribution of injection formulations. Can be manufactured.
  • a buffer solution such as an acid aqueous solution or phosphate that can be used as an injection in order to secure product stability according to the distribution of injection formulations. Can be manufactured.
  • the pharmaceutical composition of the present invention may contain water for injection.
  • the water for injection refers to distilled water prepared to dissolve a solid injection or dilute a water-soluble injection.
  • the pharmaceutical composition of the present invention may include a stabilizer or a solubilizer.
  • the stabilizer may be pyrosulfite, citric acid, or ethylenediaminetetraacetic acid
  • the solubility aid is hydrochloric acid, acetic acid, sodium hydroxide, sodium hydrogen carbonate, sodium carbonate or potassium hydroxide.
  • the present invention provides a method for preventing or treating myositis comprising administering the pharmaceutical composition described above to an individual.
  • the individual may be a mammal, preferably a human.
  • the administration may be intra-venous, intra-muscular, or intra-dermal administration.
  • the pharmaceutical composition according to the present invention can supply foreign mitochondria having normal activity to the vein of an individual suffering from myositis, thereby increasing the activity of cells with reduced mitochondrial function or useful for regeneration of cells with abnormal mitochondrial function, It can be used for the prevention or treatment of myositis.
  • mitochondria for the prevention or treatment of myositis. Details on mitochondria and myositis are as described above.
  • Alpha-MEM Alpha-MEM (Alpha-Minimum Essential) containing 10% (v/v) fetal bovine serum (FBS, Gibco), 100 ⁇ g/ml streptomycin and 100 U/ml ampicillin from human umbilical cord-derived mesenchymal stem cells Medium) and cultured for 72 hours. After the culture was completed, it was washed twice using DPBS (Dulbecco's phosphate buffered saline, Gibco). Washed cells were treated with 0.25% (v/v) Trypsin-EDTA (TE, Gibco) to obtain cells.
  • DPBS Dulbecco's phosphate buffered saline
  • the obtained cells were recovered with a concentration of 1 ⁇ 10 7 cells/ml using a hemocytometer in order to separate mitochondria.
  • the cell line was subjected to the first centrifugation at a rate of 350 ⁇ g for 10 minutes at 4°C.
  • the obtained pellet was recovered, resuspended in a buffer solution, and homogenized for 10 to 15 minutes.
  • the composition containing the pellets was subjected to a second centrifugation at a rate of 1,100 ⁇ g for 3 minutes at a temperature of 4° C. to obtain a supernatant.
  • the supernatant was subjected to a third centrifugation at a rate of 12,000 ⁇ g for 15 minutes at 4° C. to separate mitochondria from the cell line.
  • the mitochondria thus obtained were mixed with PBS and then filled into a syringe.
  • Alpha-MEM Alpha-MEM (Alpha-Minimum essential) containing 10% fetal bovine serum (FBS, Gibco), 100 ⁇ g/ml streptomycin, and 100 U/ml ampicillin for human umbilical cord-derived mesenchymal stem cells (UC-MSC) medium, Gibco) medium and cultured for 72 hours. After the cultivation of the cells was completed, the cells were washed twice using DPBS. Then, cells were obtained by treatment with 0.25% Trypsin/EDTA. After the cells were resuspended so that the cell concentration became 1 ⁇ 10 7 cells/ml, the first centrifugation was performed at a rate of 350 ⁇ g for 10 minutes at 4°C.
  • FBS fetal bovine serum
  • U-MSC human umbilical cord-derived mesenchymal stem cells
  • the washed cells were resuspended using a mitochondrial separation solution and then crushed using a 1 ml syringe. Subsequently, the cell lysate was centrifuged at 1,500xg for 5 minutes at 4°C to remove impurities, and the supernatant containing mitochondria was recovered. The recovered supernatant was centrifuged at 20,000xg for 5 minutes at 4°C to recover the precipitated mitochondria, and the separated mitochondria were suspended in Tris buffer and used for protein quantification by the BCA method and then used in the experiment.
  • BM-MSC Human bone marrow-derived mesenchymal stem cells
  • Human fibroblasts (CCD-8LU, ATCC) were inoculated in DMEM (Gibco) medium containing 10% fetal bovine serum (FBS, Gibco), 100 ⁇ g/ml streptomycin and 100 U/ml ampicillin for 72 hours. During incubation.
  • DMEM Gibco
  • FBS fetal bovine serum
  • iPSCs Human dedifferentiated stem cells
  • the platelet lysate was centrifuged at 1,500xg for 5 minutes at 4°C to remove impurities, and the supernatant containing mitochondria was recovered.
  • the recovered supernatant was centrifuged at 20,000xg for 5 minutes at 4°C to recover the precipitated mitochondria, and the separated mitochondria were suspended in Tris buffer and used for protein quantification and then for the experiment.
  • DMEM-High glucose Dulbecco's modified eagle's medium-high glucose
  • FBS fetal bovine serum
  • L6 cells American Type Culture Collection, ATCC, CRL-1458
  • a source cell line derived from rat skeletal muscle. , Gibco medium and cultured for 72 hours.
  • JC-1 molecular probes, cat no. 1743159
  • the prepared 5 ⁇ g of mitochondria was mixed with 50 ⁇ l of PBS and then dispensed into a 96-well-plate, and 50 ⁇ l of PBS containing no mitochondria as a control group was also dispensed into a 96-well-plate.
  • 5 ⁇ g of mitochondria was mixed with 50 ⁇ l of CCCP (R&D systems, CAS 555-60-2), reacted at room temperature for 10 minutes, and then dispensed into a 96-well plate.
  • CCCP is an ion carrier of mitochondria and inhibits mitochondrial function by depolarizing the mitochondrial membrane potential.
  • the JC-1 dye was treated and reacted to each well to a concentration of 2 ⁇ M, and the absorbance was measured using a fluorescence microplate reader.
  • the JC-1 dye is present as a monomer at a low concentration and exhibits green fluorescence, and at a high concentration, the JC-1 dye aggregates to exhibit red fluorescence (Monomer: Ex 485 / Em 530, J-aggregate: Ex 535 nm / Em 590 nm).
  • the mitochondrial membrane potential was analyzed by calculating the ratio of the absorbance of the green fluorescence to the absorbance of the red fluorescence.
  • the prepared 5 ⁇ g of mitochondria was mixed with 50 ⁇ l of PBS and then dispensed into a 96-well-plate, and 50 ⁇ l of PBS containing no mitochondria as a control group was also dispensed into a 96-well-plate.
  • the MitoSOX red indicator dye was mixed with 50 ⁇ l of PBS to make a concentration of 10 ⁇ M, and then treated in each well and reacted for 20 minutes in an incubator under conditions of 37°C and 5% CO 2 .
  • the absorbance was measured using a fluorescent microplate reader (Ex 510 nm / Em 580 nm). As a result, it was confirmed that the mitochondrial active oxygen in the mitochondria was low in both the control group and the experimental group (FIG. 3). Through this, it was confirmed that the mitochondria isolated in Preparation Example 1 were not damaged.
  • CFA Complete Freund's adjuvant
  • PT pertussis toxin
  • a group in which the mitochondria isolated in Preparation Example 1 (5 ⁇ g) was administered once intravenously on the 1st or 7th day after myositis induction was set as the experimental group.
  • the group in which 100 ⁇ l of PBS was administered intraperitoneally was set as a negative control group
  • the group in which 0.8 mg/kg of dexamethasone was administered intraperitoneally from day 1 to day 14 after myositis induction was set as a positive control group. (Fig. 4).
  • Example 4.2 Identification of inflammatory infiltrating muscle fibers
  • mice of each group of Example 4.1 were sacrificed on the 14th day, and the quadriceps and hamstring muscle tissues were collected, stained with H & E (Hematoxylin & eosin), and then the infiltration of inflammatory cells was observed with an optical microscope.
  • H & E Hematoxylin & eosin
  • mice of each group were sacrificed, the quadriceps muscle and the popliteal muscle tissues were collected and stained with H&E, and the number of muscle fibers infiltrated with inflammatory cells was evaluated using a scoring system.
  • the score measurement method of the score system method is shown in Table 2 below. At this time, the average values of the right and left muscles of the quadriceps and the popliteal muscles were compared.
  • Example 4.3 Checking the concentration of cytokines in the blood
  • Example 4.4 Inflammatory response confirmation through PET/MRI analysis
  • the expression of oxidative phosphorylation complex II in quadriceps was decreased in the negative control group (CIM) compared to the control group (Control) and increased in the experimental group (CIM+Mito day 7) compared to the positive control group (DEXA).
  • the expression of TOM20 in soleus was decreased in the negative control group (CIM) compared to the control group (Control), and increased in the experimental group (CIM+Mito day 1, CIM+Mito day 7) compared to the positive control group (DEXA) (Fig. 9 ).
  • the second experiment was performed by setting the time point of administration of mitochondria to the 7th day after induction of myositis.
  • mice C57BL/6 female 8-week-old mice were injected intradermally with CFA containing 200 ⁇ g of C protein fragment and 100 ⁇ g of heat-treated bacterium, and 2 ⁇ g of PT was intraperitoneally injected.
  • a group in which the mitochondria isolated in Preparation Example 1 (5 ⁇ g) was administered once intravenously was set as the experimental group.
  • the group in which 100 ⁇ l of PBS was administered intraperitoneally was set as a negative control
  • the group in which 0.8 mg/kg of dexamethasone was administered intraperitoneally from day 7 to day 14 after myositis induction was set as a positive control group. (Fig. 10).
  • Example 5.2 Identification of inflammatory infiltrating muscle fibers
  • mice of each group of Example 5.1 were sacrificed on the 14th day, and the quadriceps and popliteal muscle tissues were collected, stained with H&E, and observed for infiltration of inflammatory cells with an optical microscope. As a result, it was confirmed that the number of inflammatory cells infiltrated into the muscle fibers of the positive control group and the experimental group was decreased compared to the negative control group (FIGS. 11 and 12).
  • mice of each group were sacrificed, the quadriceps muscle and the popliteal muscle tissues were collected and stained with H&E, and the number of muscle fibers infiltrated with inflammatory cells was evaluated using a scoring system.
  • the score measurement method of the scoring system was performed in the same manner as in Example 4.2. At this time, the average values of the right and left muscles of the quadriceps and the popliteal muscles were compared. As a result, the score of the inflammatory-infiltrated muscle fibers of the positive control group and the experimental group was significantly reduced compared to the negative control group (FIG. 13).
  • Example 5.3 Checking the concentration of cytokines in the blood
  • IL-6 mRNA expression was confirmed by RT-qPCR in the muscle-separated mRNA of normal mice and mice of each group of Example 5.1 on the 14th day. Specifically, total RNA was isolated from muscle using TRIzol reagent (Invitrogen), and qPCR was performed using SYBR Green (Perkin Elmer, MA, USA) and 7,500 Fast Real-Time PCR system (Applied Biosystems). The experimental results were normalized to the amount of ⁇ -actin mRNA. At this time, the primers used are shown in Table 3 below.
  • the negative control group significantly affected the metabolite profile of the skeletal muscle compared to the control group (Fig. 23). It was confirmed that the mitochondrial transplant group recovered similarly to the metabolite profile of the control group compared to the positive control group (DEXA).
  • the malate-aspartate shuttle (sometimes simply a malate aspartate shuttle defect) is a biochemical system that translocates the electrons generated during the process across the semipermeable inner membrane of the mitochondria for oxidative phosphorylation in eukaryotes.
  • Mitochondrial dysfunction seen in the myositis model is associated with the malate-aspartate shuttle, and it was confirmed by a decrease in the ratio of the relative quantitative value of malic acid and aspartate.
  • This ratio of the relative quantitative value of malic acid and aspartate was significantly increased after mitochondrial transplantation compared to the negative control group (CIM) and the positive control group (DEXA), and it was confirmed that recovery was at a level similar to that of the control group (Fig. 24 to Fig. 27).
  • CFA Complete Freund's adjuvant
  • PT pertussis toxin
  • a group administered a single intravenous dose of the mitochondria isolated in Preparation Example 1 was 0.2 ug, 1 ug, and 5 ug was set as the experimental group.
  • the group in which 100 ⁇ l of PBS was administered intraperitoneally was set as the negative control group, and the group administered with 0.8 mg/kg of dexamethasone (DEXA) intraperitoneally from day 7 to day 14 after induction of myositis It was set as a positive control group (Fig. 18).
  • DEXA dexamethasone
  • the level of inflammatory cytokine expression in mRNA isolated from muscle was observed through RT-qPCR. After mitochondrial transplantation, the degree of mitochondrial activity was evaluated by Western blot analysis of the expression of mitochondrial oxidative phosphorylation complexes (OXPHOS complexes). Table 4 shows the animal test group information.
  • Example 6.2 Identification of inflammatory infiltrating muscle fibers
  • mice of each group were sacrificed on the 14th day to collect quadriceps and hamstring muscle tissues, stained with H&E (Hematoxylin & eosin), and observed infiltration of inflammatory cells with an optical microscope. . As a result, it was confirmed that the number of inflammatory cells infiltrated into the muscle fibers of the positive control group and the experimental group was decreased compared to the negative control group (FIG. 19).
  • mice of each group were sacrificed, the quadriceps muscle and the popliteal muscle tissues were collected and stained with H&E, and the number of muscle fibers infiltrated with inflammatory cells was evaluated using a scoring system.
  • the score measurement method of the score system method is shown in Table 5 below. At this time, the average values of the right and left muscles of the quadriceps and the popliteal muscles were compared.
  • IL-6 and TNF- ⁇ mRNA which are inflammatory cytokines, were measured in the control group (Control), the negative control group (CIM), the positive control group (DEXA), and the experimental group (mitochondrial transplant group) by the muscle of each group of mice. Confirmed through -qPCR. Specifically, total RNA was isolated from muscle using TRIzol reagent (Invitrogen), and qPCR was performed using SYBR Green (Perkin Elmer, MA, USA) and 7500 Fast Real-Time PCR system (Applied Biosystems). The experimental results were normalized to the amount of ⁇ -actin mRNA. At this time, the primers used for RT-qPCR are shown in Table 6 below.
  • IL-6 mRNA expression tends to decrease in the muscles of the mitochondrial transplant group.
  • TNF- ⁇ mRNA expression was significantly reduced in the mitochondrial 5 ug transplant group.
  • the expression of IL-6 and TNF- ⁇ mRNA in the muscles of the positive control group (Dexa) was not decreased, and the mitochondrial transplant group was more effective than the positive control group (Dexa) in terms of the effect of reducing IL-6 and TNF- ⁇ mRNA. It was confirmed (Fig. 21).
  • the mitochondria prepared in Preparation Example 1 were administered intravenously to ICR mice once, and then changes in body weight and long-term changes through autopsy were confirmed.
  • the experiment was conducted by dividing each 12 male and female 7-week-old ICR mice into 4 groups as shown in Table 7 below.
  • the G1 group was administered an excipient.
  • the G2 to G4 groups were administered 25 ⁇ g, 50 ⁇ g or 100 ⁇ g of mitochondria, respectively.
  • mitochondria were administered in an amount exceeding the approximate lethal dose (ALD).
  • the administration site was sterilized with a 70% alcohol cotton, and then an excipient or mitochondria was administered at a rate of 1 ml/min through the caudal vein using a syringe equipped with a 26 gauge injection needle.
  • Example 8 Comparison of properties of mitochondria isolated from umbilical cord-derived stem cells stored frozen and mitochondria isolated from cultured umbilical cord-derived stem cells
  • Umbilical cord-derived mesenchymal stem cells were inoculated into Alpha-MEM medium containing 10% (v/v) fetal calf serum (FBS), 100 ⁇ g/ml streptomycin and 100 U/ml ampicillin, and cultured for 72 hours. The cultured cells were treated with 0.25% Trypsin-EDTA (TE) to obtain cells. The obtained cells are resuspended so that the cells become 1 ⁇ 10 7 cells/ml using a hemocytometer, transferred to a cryopreservation container by placing them in a freezing tube, and then frozen at -80°C for 24 hours to freeze liquid nitrogen. Stored in a storage tank. Separation of mitochondria from umbilical cord-derived stem cells stored frozen was separated in the same manner as in Preparation Example 1, and the cultured cell-derived mitochondria isolated in Preparation Example 1 and ATP activity, membrane potential, and mitochondrial reactive oxygen properties were compared.
  • FBS fetal calf serum
  • TE Trypsin-EDTA
  • Example 9 Measurement of the number of mitochondria using a particle counter
  • the mitochondria isolated from the human umbilical cord-derived mesenchymal stem cells isolated in Preparation Example 1 were prepared at concentrations of 1 ⁇ g/ml, 2.5 ⁇ g/ml, and 5 ⁇ g/ml, and then particle counters (Multisizer 4e, Beckman Coulter) to measure the number of mitochondria. At this time, it was measured twice for each concentration, and the measurement results are shown in Table 9 and FIGS. 31 to 33 below.
  • Example 10 Comparison of anti-inflammatory activity using quantitative real-time polymerization chain reaction by various types of cell-derived mitochondria in RAW264.7 cells
  • Example 3 In order to compare and analyze the anti-inflammatory activity of mitochondria obtained from various cells by the method of Example 2, Example 3, Example 4, and Example 7, a cell-based assay using a quantitative real-time polymerization chain reaction method was conducted. .
  • RAW264.7 cells a mouse-derived macrophage cell line, were cultured in DMEM medium containing 10% FBS. About 3 ⁇ 10 5 cells/well of cells were inoculated into a 6 well plate and cultured for 24 hours, followed by depletion conditions in DMEM medium from which FBS was removed for about 24 hours.
  • LPS salmonella-derived lipopolysaccharide
  • UC-MSC bone marrow-derived mesenchymal stem cells
  • BM-MSC umbilical cord-derived mesenchymal stem cells
  • L6 myoblast rat myoblasts
  • CCD-8LU mitochondria obtained from human lung-derived fibroblasts
  • RNA extract Trizol reagent, Thermo Fisher Scientific
  • RNAase-free distilled water was added, and quantification and purity of the obtained RNA were measured using a spectrophotometer.
  • RNAse inhibitor M- By adding MLV reverse transcriptase (Enzynomics, Korea), a cDNA synthesis reaction was performed at 42°C for 60 minutes.
  • the reverse transcriptase was inactivated by heating at 72° C. for 5 minutes, and then RNase H was added to remove single-stranded RNA to obtain a final cDNA.
  • Changes in the expression of the TNF- ⁇ gene, IL-1 ⁇ gene, and IL-6 gene, which are characteristic genes of the inflammatory response, were observed through quantitative real-time polymerization chain reaction. GAPDH gene was quantified together to correct for differences in expression.
  • the nucleotide sequences of the genes used in the quantitative real-time polymerization chain reaction are as described in Table 10 below.
  • Example 11 Comparison of anti-inflammatory activity by various types of cell-derived mitochondria in human mononuclear cells (THP-1)
  • THP-1 cells Human-derived mononuclear cells, THP-1 cells, were cultured in RPMI medium containing 10% FBS. Cells of 4 ⁇ 10 5 cells/well were inoculated into a 24 well plate and cultured for 15 to 16 hours in RPMI medium containing 1% FBS.
  • Salmonella-derived lipopolysaccharide was treated at a concentration of 2 ⁇ g/ml for 6 hours to induce an inflammatory response in the THP-1 cell line. After 6 hours of lipopolysaccharide treatment, mitochondria obtained from each cell were treated and further cultured for 24 hours. At this time, the negative control group was a lipopolysaccharide and a mitochondrial untreated group, and the positive control group was a group treated with a lipopolysaccharide at a concentration of 2 ⁇ g/ml alone.
  • a lipopolysaccharide of 2 ⁇ g/ml was treated, and umbilical cord-derived mesenchymal stem cells (UC-MSC) obtained by the method of Examples 2, 4, 5 and 6 after 6 hours.
  • U-MSC umbilical cord-derived mesenchymal stem cells
  • IPS human dedifferentiated stem cells
  • mitochondria obtained from porcine platelets were each treated with 40 ⁇ g.
  • cells were used in quantitative real-time polymerization chain reaction method, and culture medium was used in ELISA method.
  • RNA extract Trizol reagent, Thermo Fisher Scientific
  • 0.1 ml of chloroform was added, stirred for 15 seconds, and then centrifuged at 12,000xg for 10 minutes.
  • the separated supernatant was taken, the same volume of isopropyl alcohol was added, centrifuged at 12,000xg for 10 minutes, the supernatant was removed, washed once with 75% ethanol, and dried at room temperature.
  • RNA 50 ⁇ l of purified distilled water without RNAase was added, and the quantification and purity of RNA were measured using a spectrophotometer.
  • 2 ⁇ g of purified total RNA was subjected to a binding reaction with oligo dT at 70° C. for 5 minutes, and then 10X reverse transcription reaction buffer, 10 mM dNTP, RNAse inhibitor, and M-MLV reverse transcriptase (Enzynomics, Korea) were added. Then, the cDNA synthesis reaction was performed at 42° C. for 60 minutes. After the reaction was heated at 72° C. for 5 minutes to inactivate the reverse transcriptase, RNase H was added to remove single stranded RNA to obtain cDNA.
  • a quantitative polymerization chain reaction (quantitative RT-PCR) was performed using the primers shown in Table 11 below to determine whether the expression of cytokines of the pro-inflammatory factors was changed. At this time, the difference in expression was corrected by quantifying it with 18S as a gene for correction.
  • IL-6 gene was increased when lipopolysaccharide was treated in human mononuclear cells, THP-1 cells.
  • the expression of IL-6 gene induced by lipopolysaccharide was It was confirmed that umbilical cord-derived mesenchymal stem cells, human lung-derived fibroblasts, human dedifferentiated stem cells, and mitochondria obtained from porcine platelets were inhibited to a significant level when treated. Through this, it was confirmed that the mitochondria obtained from various cells showed remarkably excellent anti-inflammatory activity (FIG. 35, * P ⁇ 0.05).
  • IL-6 protein was increased when lipopolysaccharide was treated in human mononuclear cells, THP-1 cells, and IL-6 protein induced by lipopolysaccharide was umbilical cord-derived mesenchymal stem.
  • Cells, human lung-derived fibroblasts, human dedifferentiated stem cells, and mitochondria obtained from porcine platelets were significantly inhibited when treated, and were consistent with gene expression results. Through this, it was confirmed that mitochondria obtained from various cells exhibited remarkably excellent anti-inflammatory activity (FIG. 36, * P ⁇ 0.05).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Reproductive Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Gynecology & Obstetrics (AREA)
  • Ophthalmology & Optometry (AREA)
  • Neurosurgery (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 근염 예방 또는 치료용 약학 조성물에 관한 것이며, 보다 상세하게는 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물에 관한 것이다. 본 발명의 외래 미토콘드리아를 유효성분으로 포함하는 약학 조성물을 근염을 앓고 있는 개체에 투여할 경우, 개체의 근세포에 침윤된 염증세포를 감소시킬 수 있다. 또한, 본 발명의 약학 조성물은 염증성 사이토카인인 IL-1β, TNF-α 및 IL-6의 발현을 효과적으로 억제시킨다. 따라서, 본 발명에 따른 약학 조성물은 근염의 예방 또는 치료에 유용하게 사용될 수 있다.

Description

분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물
본 발명은 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물에 관한 것이다.
근염은 근육에 염증이 생겨 근섬유가 손상되는 질환으로, 근육의 통증과 함께 근육의 수축 능력이 저하된다. 근염은 피부근염, 다발성근염 및 봉입체 근염으로 나뉘며, 그 중 다발성근염 및 피부근염은 염증성 근육병증으로, 몸통에서 가까운 사지 근력의 저하 증상, 근육 효소수치 증가, 염증성 사이토카인 발현 증가, 근전도 이상, 근육 조직검사상 이상 등이 나타난다.
또한, 다발성근염 및 피부근염으로 인한 근력 약화는 대부분 수주일 또는 수개월에 걸쳐 점차 진행되지만, 극히 드물게 급속도로 진행되는 경우도 있다. 심한 근력 약화를 치료하지 않으면 근육의 소실로 이어지게 된다. 다발성 근육염을 앓고 있는 환자의 약 15% 내지 30% 경우가 악성 종양이 동반되는 것으로 보고 되었고, 고령에서 피부근염이 발생한 경우 암이 함께 발병하는 경우가 보고된 바 있다.
다발성근염 및 피부근염의 치료에는 스테로이드제, 면역억제제 또는 면역조절제가 사용되고 있다. 스테로이드제는 조기 치료로 가장 많이 쓰이는 약물이며, 스테로이드 치료에 대한 반응과 부작용에 따라 면역억제제를 사용할 것인지 결정하게 된다. 약 75% 정도의 근염 환자는 스테로이드 외의 추가적으로 면역억제제를 같이 처방 받고 있다. 최근 면역조절제로서 정맥용 면역글로불린이 피부근염에서 근력뿐만 아니라 근육 생검상 나타나는 징후도 개선시키는 효과가 있음이 입증되어 사용되고 있다. 다만, 면역억제제 및 면역조절제는 면역시스템에 직접적으로 관여하여 부작용이 동반될 수 있으며, 약물의 효과가 오래 지속되지 못해 6주 내지 8주 간격으로 다시 주사해야 하는 단점이 있다.
또한, 최근 근염 유발 마우스 모델이 개발되어 근염 치료제 개발에 이용되고 있다. 구체적으로, 2007년에 recombinant skeletal muscle fast-type C protein의 단회 투여로 C57BL/6 마우스에서 다발 근염을 유도할 수 있고, 근염의 질환 특이적인 치료법의 연구를 시도할 수 있는 가능성이 제시되었다(Sugihara T et al., Arthritis Rheum. 2007, 56(4):1304-14). 다발성 근염의 근육 조직에서 발현이 증가되는 케모카인(chemokine)인 CXCL10(C-X-C motif chemokine 10)에 대한 면역억제제의 근염 치료효과의 평가에 근염 유발 마우스 모델을 이용한 바 있다(Kim et al., Arthritis Research & Therapy 2014, 16:R126).
한편, 미토콘드리아는 세포 내 에너지 공급원인 아데노신 트라이포스페이트(ATP)의 합성 및 조절에 관여하는 진핵세포의 세포 소기관이다. 미토콘드리아는 생체 내 다양한 대사 경로, 예를 들어, 세포 신호처리, 세포 분화, 세포 사멸 뿐만 아니라 세포 주기 및 세포 성장의 제어와 연관이 있다.
근염을 치료하기 위한 연구가 진행된 바 있으나, 개발된 약물은 부작용이 발생하는 문제가 있거나 주기적으로 주사해야 하는 문제가 있어, 현재까지 획기적인 치료법은 개발되지 않은 실정이다. 따라서, 안전하고 효과적인 근염 치료제에 대한 지속적인 연구개발이 필요한 상황이다.
따라서, 본 발명은 근염을 치료하기 위한 약학 조성물 및 이를 이용한 근염을 치료하는 방법을 제공하는 것을 목적으로 한다.
상기 과제를 해결하기 위하여, 본 발명의 일 측면은 미토콘드리아를 유효성분으로 포함하는 근염의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 다른 측면은 상기 약학 조성물을 개체에 투여하는 단계를 포함하는 근염 예방 또는 치료 방법을 제공한다.
본 발명의 미토콘드리아를 유효성분으로 포함하는 약학 조성물을 근염을 앓고 있는 개체에 투여할 경우, 개체의 근세포에 침윤된 염증세포를 감소시킬 수 있다. 또한, 본 발명의 약학 조성물은 근염이 발병된 근육 조직의 염증성 사이토카인의 발현을 효과적으로 감소시킬 수 있다. 따라서, 본 발명에 따른 약학 조성물은 근염의 예방 또는 치료에 유용하게 사용될 수 있다.
도 1은 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아의 ATP 합성량을 측정하여 나타낸 도면이다.
도 2는 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아의 막전위 활성을 측정하여 나타낸 도면이다.
도 3은 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아 내 활성산소를 측정하여 나타낸 도면이다.
도 4는 근염 유발 마우스를 이용하여 미토콘드리아 투여에 따른 근염 치료효과를 확인하기 위한 1차 동물실험 계획을 도식화한 도면이다.
도 5는 근섬유 침윤된 염증세포를 확인하기 위해 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군의 사두근(Quadriceps) 및 슬와부근(Hamstring muscle)을 H&E(Hematoxylin & eosin)로 염색한 사진이다.
도 6은 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군의 사두근(Quadriceps)을 H&E로 염색한 후, 근섬유 침윤된 염증세포 수를 측정하여 점수화한 도면이다.
도 7은 정상군, 음성대조군, 양성대조군 및 미토콘드리아를 투여한 실험군 마우스의 혈중 IL-6 농도를 나타낸 도면이다.
도 8은 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군의 마우스를 PET/MRI로 촬영한 사진이다.
도 9는 근염모델을 유도한 마우스에 미토콘드리아를 이식한 후 mitochondria activity가 증가한 것을 나타낸 것이다.
도 10은 근염 유발 마우스를 이용하여 외래 미토콘드리아 투여에 따른 근염 치료효과를 확인하기 위한 2차 동물실험 계획을 도식화한 도면이다.
도 11은 근섬유에 침윤된 염증세포를 확인하기 위해 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군의 사두근을 H&E로 염색한 사진이다.
도 12는 근섬유에 침윤된 염증세포를 확인하기 위해 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군의 슬와부근을 H&E로 염색한 사진이다.
도 13은 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군의 사두근을 H&E로 염색한 후, 근섬유에 침윤된 염증세포 수를 측정하여 점수화한 도면이다.
도 14는 정상군, 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군 마우스의 혈중 IL-1β 농도를 나타낸 도면이다.
도 15는 정상군, 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군 마우스의 혈중 IL-6 농도를 나타낸 도면이다.
도 16은 정상군, 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군 마우스의 혈중 TNF-α 농도를 나타낸 도면이다.
도 17은 정상군, 음성대조군, 양성대조군 및 외래 미토콘드리아를 투여한 실험군 마우스의 근육 내 IL-6 mRNA의 발현량을 나타낸 도면이다.
도 18은 근염 유발 마우스를 이용하여 외래 미토콘드리아 투여에 따른 근염 치료효과를 확인하기 위한 3차 동물실험 계획을 도식화한 도면이다.
도 19는 근염모델을 유도한 마우스의 미토콘드리아 이식 치료 후에 H&E(Hematoxylin & eosin)로 염색된 염증세포의 수가 감소한 것을 확인한 것이다.
도 20은 근염모델을 유도한 마우스에 미토콘드리아를 이식한 후 점수체계법에 의한 조직학적 점수가 감소한 것을 확인한 것이다.
도 21은 근염모델을 유도한 마우스에 미토콘드리아를 이식한 후 염증성 cytokine의 감소를 나타낸 것이다.
도 22는 근염모델을 유도한 마우스에 미토콘드리아를 이식한 후 mitochondria activity가 증가한 것을 나타낸 것이다.
도 23은 근염모델을 유도한 마우스에 미토콘드리아를 이식한 후 metabolome 분석에 의한 근육의 프로필 열지도 분석결과 골격근의 전체 대사 산물의 증가 및 감소를 나타낸 것이다.
도 24 내지 도 27은 근염모델을 유도한 마우스에 미토콘드리아를 이식한 후 metabolome 분석에 의한 말릭산과 아스파르테이트의 상대 정량값 비율이 유의하게 증가하여 대조군 수준으로 회복됨을 확인하였다.
도 28은 동결 보관된 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아와 배양된 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아의 ATP 활성을 비교한 도면이다.
도 29는 동결 보관된 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아와 배양된 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아의 막전위를 비교한 도면이다.
도 30은 동결 보관된 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아와 배양된 탯줄유래 중간엽 줄기세포로부터 분리한 미토콘드리아 내 활성산소를 측정하여 나타낸 도면이다.
도 31은 1 ㎍/㎖ 농도의 미토콘드리아를 포함하는 용액 내 미토콘드리아 개수를 파티클 카운터(Multisizer 4e, Beckman Coulter)를 이용하여 측정한 도면이다.
도 32는 2.5 ㎍/㎖ 농도의 미토콘드리아를 포함하는 용액 내 미토콘드리아 개수를 파티클 카운터를 이용하여 측정한 도면이다.
도 33은 5 ㎍/㎖ 농도의 미토콘드리아를 포함하는 용액 내 미토콘드리아 개수를 파티클 카운터를 이용하여 측정한 도면이다.
도 34는 LPS로 활성화된 RAW264.7 세포에서 여러 종류의 세포유래 미토콘드리아에 의한 TNF-α, IL-1β, IL-6의 mRNA 발현억제능을 확인한 도면이다.
도 35는 LPS로 활성화된 THP-1 세포에서 여러 종류의 세포유래 미토콘드리아에 의한 IL-6 mRNA의 발현억제능을 관찰한 것이다.
도 36은 LPS로 활성화된 THP-1 세포에서 여러 종류의 세포유래 미토콘드리아에 의한 IL-6 단백질의 발현억제능을 관찰한 것이다.
도 37은 Metabolome 분석에 사용된 근육의 정보를 나타낸 것이다.
이하, 본 발명에 대하여 상세히 설명하도록 한다.
본 발명의 일 측면은 미토콘드리아를 유효성분으로 포함하는 근염의 예방 또는 치료용 약학 조성물을 제공한다.
본 명세서에서 사용된 용어 “근염”이란, 근육에 염증이 생겨 근섬유가 손상되는 질환을 의미한다. 구체적으로, 근염은 피부근염, 다발성근염 및 봉입체 근염으로 나뉘며, 그 중 다발성근염 및 피부근염은 염증성 근육병증에 속한다. 다발성근염 또는 피부근염의 근육 조직에서는 CXCL10, IL-1β, TNF-α, IL-6 등의 염증성 사이토카인 또는 케모카인 발현이 증가되고. CXCL10, IL-1β, TNF-α 또는 IL-6를 억제시키는 면역억제제 또는 면역조절제가 근염 치료제로서 개발되고 있다. 하지만, 면역억제제 또는 면역조절제의 경우 면역시스템에 직접적으로 관여하여 부작용이 나타나는 문제점이 있다.
또한, 근염 치료제의 개발에는 근염 유발 마우스 모델이 이용될 수 있다. 근염 유발 마우스 모델은 C 단백질 단편(protein fragments) 및 열처리된 우락균(heat-killed Mycobacterium butyricum)을 포함하는 CFA(Complete Freund's adjuvant)를 피부 내 주입(intradermally injection)하고, PT(pertussis toxin)를 복강 내 주입(intraperitoneally injection)하여 제작할 수 있다. 이때, 상기 약물 주입 후 7일 후부터 CD8 T세포가 이동하여, 근육에 침윤이 일어나 염증이 유발될 수 있다. 이때, 근염 환자의 근육에서 염증 및 염증세포가 관찰되는 조직이 사두근 및 슬와부근이기 때문에 근염 유발 마우스에서도 사두근 및 슬와부근 조직을 이용할 수 있다.
본 명세서에서 특별한 언급이 없는 한,　"유효성분"은　단독으로 활성을 나타내거나 또는 그 자체로는 활성이 없는 보조제(담체)와 함께 활성을 나타내는 성분을 지칭한다.
실험예에서 살펴본 바와 같이, C-protein induced myositis mouse model(CIM)의 muscle에서 CE-TOFMS를 이용하여, White muscle인 quadriceps와 red muscle인 soleus muscle 모두에서 metabolomic profile을 분석하였다. 근염 유도군에서 malate와 aspartate의 비율이 저하되어 있었고, 이를 통해 mitochondria 손상이 있음을 확인할 수 있었다. 실험 결과, CIM mouse model에서 여러 용량의 외래 미토콘드리아 주입 효력 확인 시험에 의해 염증을 완화시키고 mitochondria 손상을 회복 시킴을 확인하였다.
상기 미토콘드리아는 포유동물로부터 수득된 것일 수 있으며, 인간으로부터 수득된 것일 수 있다. 구체적으로, 상기 미토콘드리아는 세포 또는 조직으로부터 분리된 것일 수 있다. 예를 들어, 상기 미토콘드리아는 체외 배양된 세포부터 분리된 것일 수 있다. 또한, 상기 미토콘드리아는 체세포, 생식세포, 혈액세포 또는 줄기세포로부터 수득된 것일 수 있다. 또한, 상기 미토콘드리아는 혈소판(platelet)에서 수득된 것일 수 있다. 상기 미토콘드리아는 미토콘드리아의 생물학적 활성이 정상인 세포로부터 수득된 정상적인 미토콘드리아일 수 있다. 또한, 상기 미토콘드리아는 체외에서 배양된 것일 수 있다.
또한, 상기 미토콘드리아는 자가(autologous), 동종(allogenic) 또는 이종(xenogenic)으로부터 수득된 것일 수 있다. 구체적으로, 자가 미토콘드리아는 동일 개체의 조직 또는 세포로부터 수득된 미토콘드리아를 의미한다. 또한, 동종 미토콘드리아는 개체와 같은 종에 속하면서 대립유전자에 대해서는 다른 유전자형을 가지는 개체로부터 수득된 미토콘드리아를 의미한다. 또한, 이종 미토콘드리아는 개체와 다른 종에 속하는 개체로부터 수득된 미토콘드리아를 의미한다.
구체적으로, 상기 체세포는 근육세포, 간세포, 신경세포, 섬유아세포, 상피세포, 지방세포, 골세포, 백혈구, 림프구, 혈소판 또는 점막세포일 수 있다. 또한, 상기 생식세포는 감수분열과 체세포 분열을 하는 세포로서 정자 또는 난자일 수 있다. 또한, 상기 줄기세포는 중간엽줄기세포, 성체줄기세포, 역분화줄기세포, 배아줄기세포, 골수줄기세포, 신경줄기세포, 윤부줄기세포 및 조직 유래 줄기세포로 구성된 군으로부터 선택되는 어느 하나일 수 있다. 이때, 상기 중간엽줄기세포는 탯줄, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군으로부터 선택되는 어느 하나일 수 있다.
한편, 상기 미토콘드리아를 특정 세포로부터 분리하는 경우에는, 예를 들어, 특정 버퍼 용액을 사용하거나 전위차 및 자기장을 이용하는 등 공지된 다양한 방법을 통해 미토콘드리아를 분리할 수 있다.
상기 미토콘드리아 분리는 미토콘드리아 활성 유지 측면에서, 세포를 파쇄하고 원심분리하여 수득할 수 있다. 일 구체예로, 세포를 배양하고, 이러한 세포를 포함하는 약학 조성물을 제1차 원심분리하여 펠렛을 생성하는 단계, 상기 펠렛을 버퍼 용액에 재현탁시키고, 균질화하는 단계, 상기 균질화된 용액을 제2차 원심분리하여 상청액을 제조하는 단계 및 상기 상청액을 제3차 원심분리하여 미토콘드리아를 정제하는 단계로 수행될 수 있다. 이때, 제2차 원심분리가 수행되는 시간은 제1차 및 제3차 원심분리가 수행되는 시간보다 짧도록 조절되는 것이 세포 활성 유지 면에서 바람직하며, 제1차 원심분리에서 제3차 원심분리로 갈수록 속도를 높일 수 있다.
구체적으로, 상기 제1차 내지 제3차 원심분리는 0℃ 내지 10℃의 온도, 바람직하게는 3℃ 내지 5℃의 온도에서 수행될 수 있다. 또한, 상기 원심분리가 수행되는 시간은 1분 내지 50분 동안 수행될 수 있으며, 원심분리 횟수 및 샘플의 함량 등에 따라 적절히 조정될 수 있다.
아울러, 상기 제1차 원심분리는 100×g 내지 1,000×g, 또는 200×g 내지 700×g, 또는 300×g 내지 450×g의 속도로 수행될 수 있다. 또한, 상기 제2차 원심분리는 1×g 내지 2,000×g, 또는 25×g 내지 1,800×g, 또는 500×g 내지 1,600×g의 속도로 수행될 수 있다. 또한, 상기 제3차 원심분리는 100×g 내지 20,000×g, 또는 500×g 내지 18,000×g, 또는 800×g 내지 15,000×g의 속도로 수행될 수 있다.
상기 분리된 미토콘드리아는 단백질을 정량함으로써, 미토콘드리아를 정량할 수 있다. 구체적으로, 상기 분리된 미토콘드리아를 BCA(bicinchoninic acid assay) 분석법을 통해 정량할 수 있다. 이때, 상기 약학 조성물 내 미토콘드리아는 0.1 ㎍/㎖ 내지 1,000 ㎍/㎖, 1 ㎍/㎖ 내지 750 ㎍/㎖ 또는 25 ㎍/㎖ 내지 500 ㎍/㎖의 농도로 포함될 수 있다. 본 발명의 일 실시예에서는, 25 ㎍/㎖, 50 ㎍/㎖ 및 100 ㎍/㎖ 농도로 사용하였다.
또한, 상기 분리된 미토콘드리아를 파티클 카운터(Multisizer 4e, Beckman Coulter)를 통해 개수를 측정할 수 있으며, James D. McCully가 저술한 논문(J Vis Exp. 2014; (91): 51682.)을 참고하면 미토콘드리아의 개수는 하기 표 1과 같을 수 있다.
분리한 미토콘드리아의 양 (㎍) 미토콘드리아 개수 농도 (㎍/㎖)
0.01 2.16×105 ± 0.01×105 0.1
1 2.16×107 ± 0.08×107 10
25 0.54×109 ± 0.02×109 250
50 1.08×109 ± 0.04×109 500
100 2.16×109 ± 0.08×109 1,000
본 발명의 실시예 9에서 나타난 바와 같이, 1 ㎍/㎖, 2.5 ㎍/㎖ 및 5 ㎍/㎖을 파티클 카운터를 이용해 미토콘드리아의 개수를 측정한 결과, 1.96×106 ± 0.98×106, 5.97×106 ± 0.19×106 및 1.01×107 ± 0.32×107 개로 측정되었다. 상기 표 1과 비교하여 보면, 10 ㎍/㎖ 농도의 미토콘드리아 개수는 2.16×107±0.08×107 개이며, 5 ㎍/㎖ 농도의 미토콘드리아 개수의 2배수를 곱하면 2.02×107 ± 0.64×107 개로 유사한 개수 범위를 갖는 것을 확인하였다. 이때, 상기 약학 조성물 내 미토콘드리아는 1×105 미토콘드리아 개수/㎖ 내지 5×109 미토콘드리아 개수/㎖의 함량으로 포함될 수 있다. 구체적으로, 상기 상기 약학 조성물 내 미토콘드리아는 1×105 미토콘드리아 개수/㎖ 내지 5×109 미토콘드리아 개수/㎖, 2×105 미토콘드리아 개수/㎖ 내지 2×109 미토콘드리아 개수/㎖, 5×105 미토콘드리아 개수/㎖ 내지 1×109 미토콘드리아 개수/㎖, 1×106 미토콘드리아 개수/㎖ 내지 5×108 미토콘드리아 개수/㎖, 2×106 미토콘드리아 개수/㎖ 내지 2×108 미토콘드리아 개수/㎖, 5×106 미토콘드리아 개수/㎖ 내지 1×108 미토콘드리아 개수/㎖ 또는 1×107 미토콘드리아 개수/㎖ 내지 5×107 미토콘드리아 개수/㎖의 함량으로 포함될 수 있다. 상기 약학 조성물은 상기 범위의 농도 및 함량으로 미토콘드리아를 포함함으로써, 투여 시 미토콘드리아 용량 조절이 용이하고, 환자의 근염 병증 개선 정도가 보다 향상될 수 있다.
특히, 상기 약학 조성물에 포함되는 미토콘드리아의 치료 효과 용량은, 투여할 개체의 체중을 기준으로 1회 3×105 미토콘드리아 개수/㎏ 내지 1.5×1010 미토콘드리아 개수/㎏일 수 있다. 구체적으로, 상기 약학 조성물 내 미토콘드리아의 치료 효과 용량은, 투여할 개체의 체중을 기준으로 1회 3×105 미토콘드리아 개수/㎏ 내지 1.5×1010 미토콘드리아 개수/㎏, 6×105 미토콘드리아 개수/㎏ 내지 6×109 미토콘드리아 개수/㎏, 1.5×106 미토콘드리아 개수/㎏ 내지 3×109 미토콘드리아 개수/㎏, 3×106 미토콘드리아 개수/㎏ 내지 1.5×109 미토콘드리아 개수/㎏, 6×106 미토콘드리아 개수/㎏ 내지 6×108 미토콘드리아 개수/㎏, 1.5×107 미토콘드리아 개수/㎏ 내지 3×108 미토콘드리아 개수/㎏ 또는 3×107 미토콘드리아 개수/㎏ 내지 1.5×108 미토콘드리아 개수/㎏일 수 있다. 즉, 상기 미토코드리아를 포함하는 약학 조성물을 근염이 발병된 개체의 체중을 기준으로 상기 범위의 용량으로 미토콘드리아가 투여되는 것이 세포 활성 측면에서 가장 바람직하다.
또한, 상기 약학 조성물은 1회 내지 10회, 3회 내지 8회 또는 5회 내지 6회 투여할 수 있으며, 바람직하게는 5회 투여할 수 있다. 이때, 투여 간격은 1일 내지 7일 또는 2일 내지 5일 간격으로 할 수 있으며, 바람직하게는 3일 간격으로 투여할 수 있다.
또한, 본 발명에 따른 약학 조성물은 근염에 걸릴 수 있거나, 그러한 질환 또는 질병을 앓고 있는 인간 또는 다른 포유동물에 대하여 투여될 수 있다. 또한, 상기 약학 조성물은 정맥, 근육 또는 피하 투여될 수 있는 주사제일 수 있고, 바람직하게는 주사용 제제일 수 있다.
따라서, 본 발명에 따른 약학 조성물은 주사제 처방의 유통에 따른 제품 안정성을 확보하기 위하여, 주사제로 사용 가능한 산수용액 또는 인산염 등의 완충용액을 사용하여 pH를 조절함으로써, 물리적으로나 화학적으로 매우 안정한 주사제로 제조될 수 있다.
구체적으로, 본 발명의 약학 조성물은 주사용수를 포함할 수 있다. 상기 주사용수는 고형주사제의 용해나 수용성 주사제를 희석하기 위하여 만들어진 증류수를 의미한다.
또한, 본 발명의 약학 조성물은 안정화제 또는 용해보조제를 포함할 수 있다. 예를 들어, 안정화제는 피로설파이트(pyrosulfite), 구연산(citric acid) 또는 에틸렌 디아민테트라아세트산(ethylenediaminetetraacetic acid)일 수 있고, 용해보조제는 염산, 아세트산, 수산화나트륨, 탄산수소나트륨, 탄산나트륨 또는 수산화칼륨일 수 있다.
본 발명의 또 다른 측면으로, 본 발명은 전술한 약학 조성물을 개체의 투여하는 단계를 포함하는 근염의 예방 또는 치료 방법을 제공한다. 여기서 개체는 포유동물일 수 있으며, 바람직하게는 인간일 수 있다.
이때, 투여는 정맥 내(intra-venous), 근육 내(intra-muscular) 또는 피부 내(intra-dermal)에 투여되는 것일 수 있다. 이를 통해, 본 발명에 따른 약학 조성물은 근염을 앓고 있는 개체의 정맥에 정상적인 활성을 갖는 외래 미토콘드리아를 공급할 수 있어, 미토콘드리아 기능이 저하된 세포의 활성을 증가시키거나 미토콘드리아 기능 이상 세포 재생에 유용하며, 근염의 예방 또는 치료에 이용될 수 있다.
본 발명의 또 다른 측면으로, 근염 예방 또는 치료를 위한 분리된 미토콘드리아의 용도를 제공한다. 미토콘드리아 및 근염에 대한 사항은 상술한 바와 같다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
I. 미토콘드리아를 포함한 조성물의 제조
제조예 1. 인간 탯줄 유래 중간엽 줄기세포에서 분리된 미토콘드리아를 포함하는 조성물의 제조 I
인간 탯줄 유래 중간엽 줄기세포를 10%(v/v) 우태혈청(Fetal bovine serum, FBS, Gibco), 100 ㎍/㎖ 스트렙토마이신 및 100 U/㎖ 암피실린을 포함하는 Alpha-MEM(Alpha-Minimum Essential Medium) 배지에 접종하고 72시간 동안 배양하였다. 배양이 종료된 후, DPBS(Dulbecco's phosphate buffered saline, Gibco)를 이용하여 2회 세척하였다. 세척된 세포는 0.25%(v/v) Trypsin-EDTA(TE, Gibco)를 처리하여 세포를 수득하였다.
수득한 세포는 미토콘드리아를 분리하기 위하여, 혈구계산기를 이용하여 1×107 cells/㎖ 농도의 세포를 회수하였다. 상기 세포주를 4℃ 온도에서 10분 동안 350×g의 속도로 제1차 원심분리를 수행하였다. 이때 얻어진 펠렛을 회수하여 버퍼 용액에 재현탁 시킨 후, 10분 내지 15분 동안 균질화시켰다. 그 후, 상기 펠렛을 포함하는 조성물을 4℃ 온도에서 3분 동안 1,100×g의 속도로 제2차 원심분리시켜 상청액을 수득하였다. 상기 상청액을 4℃ 온도에서 15분 동안 12,000×g의 속도로 제3차 원심분리시켜 세포주로부터 미토콘드리아를 분리하였다. 이렇게 얻어진 미토콘드리아를 PBS와 혼합한 뒤 주사기에 충진하였다.
제조예 2. 인간 탯줄 유래 중간엽줄기세포에서 분리된 미토콘드리아를 포함하는 조성물의 제조 II
인간 탯줄 유래 중간엽줄기세포(UC-MSC)를 10% 우태혈청(Fetal bovine serum, FBS, Gibco), 100 ㎍/㎖ 스트렙토마이신 및 100 U/㎖ 암피실린을 함유하는 Alpha-MEM(Alpha-Minimum essential medium, Gibco) 배지에 접종하고 72시간 동안 배양하였다. 상기 세포의 배양이 종료된 후, DPBS를 이용하여 2회 세척하였다. 그 후, 0.25% Trypsin/EDTA를 처리하여 세포를 획득하였다. 세포농도가 1×107 cells/㎖가 되도록 세포를 재현탁 후 4℃에서 10분 동안 350×g의 속도로 제1차 원심분리를 수행하였다.
세척된 세포는 미토콘드리아 분리용액을 이용하여 재부유한 후 1 ml 주사기를 이용하여 파쇄하였다. 이후 세포 파쇄액은 1,500xg로 5분간 4℃에서 원심분리하여 불순물을 제거하고 미토콘드리아가 포함되어 있는 상등액을 회수하였다. 회수된 상등액은 20,000xg로 5분간 4℃에서 원심분리하여 침전된 미토콘드리아를 회수하였으며, 분리한 미토콘드리아는 트리스버퍼에 부유하여 BCA법으로 단백질 정량 후 실험에 이용하였다.
제조예 3. 인간 골수 유래 중간엽줄기세포에서 분리된 미토콘드리아를 포함하는 조성물의 제조
인간 골수 유래 중간엽줄기세포(BM-MSC)를 10% 우태혈청(Fetal bovine serum, FBS, Gibco), 100 ㎍/㎖ 스트렙토마이신 및 100 U/㎖ 암피실린을 함유하는 DMEM(Gibco) 배지에 접종하고 72시간 동안 배양하였다.
상기 세포의 배양이 종료된 후 제조예 2에서 기술한 방법과 같이 미토콘드리아를 회수 및 정량한 후 실험에 이용하였다.
제조예 4. 인간 섬유아세포에서 분리된 미토콘드리아를 포함하는 조성물의 제조
인간 섬유아세포(CCD-8LU, ATCC)를 10% 우태혈청(Fetal bovine serum, FBS, Gibco), 100 ㎍/㎖ 스트렙토마이신 및 100 U/㎖ 암피실린을 함유하는 DMEM(Gibco) 배지에 접종하고 72시간 동안 배양하였다.
상기 세포의 배양이 종료된 후 제조예 2에서 기술한 방법과 같이 미토콘드리아를 회수 및 정량한 후 실험에 이용하였다.
제조예 5. 인간 역분화줄기세포에서 분리된 미토콘드리아를 포함하는 조성물의 제조
인간 역분화 줄기세포(iPSC)는 10 ug/ml의 vitronectin(stem cell 07180)으로 코팅한 세포배양용기에서 TeSRTM-E8TM(stem cell 05990)배지에서 배양하여 사용하였다.
상기 세포의 배양이 종료된 후 제조예 2에서 기술한 방법과 같이 미토콘드리아를 회수 및 정량한 후 실험에 이용하였다.
제조예 6. 혈소판 미토콘드리아의 분리된 미토콘드리아를 포함하는 조성물의 제조
혈소판에서 미토콘드리아를 분리하기 위하여 돼지 전혈을 상온에서 3분간 500×g로 원심 분리한 후 혈소판이 풍부한 혈장(PRP, Platelet-rich plasma)이 포함된 상층액을 회수하였다. 회수된 상층액은 1,500×g로 5분간 원심분리하여 상등액을 제거하여 혈소판이 함유된 침전물을 회수하였다. 농축된 혈소판 침전물은 PBS를 이용하여 재부유한 후 1,500xg로 5분간 원심분리하여 세척하였고, 세척된 혈소판은 미토콘드리아 분리용액을 이용하여 재부유한 후 1 ml 주사기를 이용하여 파쇄하였다. 이후 혈소판 파쇄액은 1,500xg로 5분간 4℃에서 원심분리하여 불순물을 제거하고 미토콘드리아가 포함되어 있는 상등액을 회수하였다. 회수된 상등액은 20,000xg로 5분간 4℃에서 원심분리하여 침전된 미토콘드리아를 회수하였으며, 분리한 미토콘드리아는 트리스버퍼에 부유하여 단백질 정량 후 실험에 이용하였다.
제조예 7. 흰쥐의 골격근 유래 근원 세포에서 분리된 미토콘드리아를 포함하는 조성물의 제조
흰쥐의 골격근 유래 근원 세포주인 L6 세포(American Type Culture Collection, ATCC, CRL-1458)를 10% 우태혈청(Fetal bovine serum, FBS, Gibco)을 함유하는 DMEM-High glucose(Dulbecco's modified eagle's medium-High glucose, Gibco) 배지에 접종하고 72시간 동안 배양하였다.
상기 세포의 배양이 종료된 후 제조예 2에서 기술한 방법과 같이 미토콘드리아를 회수 및 정량한 후 실험에 이용하였다.
II. 미토콘드리아의 특성 확인
실시예 1. 미토콘드리아 ATP 합성 확인
제조예 1에서 분리한 미토콘드리아가 정상적으로 ATP를 합성하는지 확인하기 위해, 분리된 미토콘드리아를 BCA(bicinchoninic acid assay) 분석법을 통해 미토콘드리아 단백질 농도를 정량화하여 5 ㎍의 미토콘드리아를 준비하였다. 그 후, CellTiter-Glo luminescence kit(Promega, Madison, WI)를 이용하여 제조사의 매뉴얼에 따라 ATP의 양을 정량하였다.
구체적으로, 실험군으로서 상기 준비된 5 ㎍의 미토콘드리아를 PBS 100 ㎕에 섞어준 후 96-웰-플레이트에 분주하고, 대조군으로서 미토콘드리아가 포함되지 않은 PBS 100 ㎕도 96-웰-플레이트에 분주하였다. 그 후, 상기 CellTiter-Glo luminescence kit에 포함된 테스트 용액을 각 웰에 100 ㎕씩 처리한 후, 2분 동안 교반기에서 반응시켜 잘 섞어주었다. 그 후, 상온에서 10분간 반응시킨 뒤, 발광 마이크로플레이트 리더기(Luminescence microplate reader)를 이용하여 560 nm 파장에서 흡광도를 측정하였다.
그 결과, 미토콘드리아가 포함된 실험군의 ATP 양이 대조군의 ATP 양보다 약 3배 이상 많은 것이 확인되었다(도 1). 이를 통해 제조예 1에서 분리한 미토콘드리아가 정상적으로 ATP를 합성하는 것을 확인하였다.
실시예 2. 미토콘드리아의 막전위 측정
제조예 1에서 분리한 미토콘드리아의 막전위를 측정하기 위해, 분리된 미토콘드리아를 BCA를 통해 미토콘드리아 단백질 농도를 정량화하여 5 ㎍의 미토콘드리아를 준비하였다. JC-1(molecular probes, cat no.1743159) 염료를 사용하여 미토콘드리아의 막전위를 측정하였다.
구체적으로, 실험군으로서 상기 준비된 5 ㎍의 미토콘드리아를 PBS 50 ㎕에 섞어준 후 96-웰-플레이트에 분주하고, 대조군으로서 미토콘드리아가 포함되지 않은 PBS 50 ㎕도 96-웰-플레이트에 분주하였다. 또한, 추가 실험군으로서 5 ㎍의 미토콘드리아를 CCCP 50 ㎕(R&D systems, CAS 555-60-2)에 섞어준 뒤 10분간 실온에서 반응시킨 후 96-웰-플레이트에 분주하였다. 이때, CCCP는 미토콘드리아의 이온운반체로서, 미토콘드리아의 막전위를 탈분극(depolarization)시킴으로써 미토콘드리아의 기능을 저해한다.
그 후, 2 μM 농도가 되도록 JC-1 염료를 각 웰에 처리하여 반응시킨 뒤, 형광 마이크로플레이트 리더기(Fluorescence Microplate reader)를 이용하여 흡광도를 측정하였다. 이때, JC-1 염료는 저농도에서 단량체로 존재하여 녹색 형광을 띄고, 고농도에서는 JC-1 염료가 응집되어 붉은색 형광을 나타낸다(Monomer: Ex 485 / Em 530, J-aggregate: Ex 535 nm / Em 590 nm). 미토콘드리아의 막전위는 붉은색 형광의 흡광도에 대한 녹색 형광의 흡광도 비율로 계산하여 분석하였다.
그 결과, 미토콘드리아를 포함하는 실험군에서 높은 막전위 활성을 나타내었다. 반면, 미토콘드리아에 CCCP를 처리한 추가 실험군에서는 낮은 막전위 활성을 나타내었다(도 2). 이를 통해 제조예 1에서 분리한 미토콘드리아가 정상적인 막전위 활성을 나타냄을 확인하였다.
실시예 3. 미토콘드리아 내 활성산소 측정
제조예 1에서 분리한 미토콘드리아의 손상을 확인하기 위해, 분리된 미토콘드리아를 BCA를 통해 미토콘드리아 단백질 농도를 정량화하여 5 ㎍의 미토콘드리아를 준비하였다. MitoSOX red indicator(Invitrogen, cat no. M36008) 염료를 이용하여 미토콘드리아 내 미토콘드리아성 활성산소(ROS)를 측정하였다.
구체적으로, 실험군으로서 상기 준비된 5 ㎍의 미토콘드리아를 PBS 50 ㎕에 섞어준 후 96-웰-플레이트에 분주하고, 대조군으로서 미토콘드리아가 포함되지 않은 PBS 50 ㎕도 96-웰-플레이트에 분주하였다. 그 후, MitoSOX red indicator 염료를 PBS 50 ㎕에 섞어 10 μM 농도가 되도록 한 후, 각 웰에 처리하고 37℃, 5% CO2 조건의 배양기에서 20분 동안 반응시켰다. 반응이 끝난 후, 형광 마이크로플레이트 리더기를 이용하여 흡광도를 측정하였다(Ex 510 nm / Em 580 nm). 그 결과, 대조군과 실험군 모두에서 미토콘드리아 내 미토콘드리아성 활성산소가 낮은 것으로 확인되었다(도 3). 이를 통해 제조예 1에서 분리한 미토콘드리아가 손상이 없음을 확인하였다.
III. In vivo에서 미토콘드리아의 근염 치료 효과 확인
실시예 4. 근염 유발 마우스 모델에서의 외래 미토콘드리아 투여에 따른 근염 치료효과 확인 : 1차 실험
실시예 4.1. 근염 유발 마우스 모델 제작 및 미토콘드리아 투여(n=3)
C57BL/6 암컷 8주령 마우스에 200 ㎍의 C 단백질 단편(protein fragments) 및 100 ㎍의 열처리된 우락균(heat-killed Mycobacterium butyricum)을 포함하는 CFA(Complete Freund's adjuvant)를 피부 내 주입(intradermally injection)하고, 2 ㎍의 PT(pertussis toxin)를 복강 내 주입(intraperitoneally injection)하였다.
근염 유도 후 1일째 또는 7일째에 제조예 1에서 분리한 미토콘드리아(5 ㎍)를 정맥 내 단회 투여한 그룹을 실험군으로 설정하였다. 또한, 100 ㎕ 용량의 PBS를 복강내 투여한 그룹을 음성대조군으로 설정하였으며, 근염 유도 후, 1일째부터 14일째까지 매일 0.8 mg/kg 용량의 덱사메타손을 복강 내 투여한 그룹을 양성대조군으로 설정하였다(도 4).
실시예 4.2. 염증 침윤 근섬유 확인
실시예 4.1의 각 군의 마우스를 14일째에 희생시켜 사두근(Quadriceps) 및 슬와부근(Hamstring muscle) 조직을 채취하여 H&E(Hematoxylin & eosin)로 염색한 후 광학현미경으로 염증세포의 침윤을 관찰하였다.
그 결과, 음성대조군에 비해 양성대조군 및 실험군의 근섬유에 침윤된 염증세포의 수가 감소된 것을 확인하였다(도 5). 또한, 14일째에 각 군의 마우스를 희생시켜 사두근 및 슬와부근 조직을 채취하여 H&E로 염색한 후, 염증세포가 침윤된 근섬유의 개수를 점수체계법을 이용하여 평가하였다. 점수체계법의 점수 측정방식을 하기 표 2에 나타내었다. 이때, 사두근 및 슬와부근의 오른쪽 및 왼쪽 근육의 평균값을 비교하였다.
점수 평가방식(염증 침윤 근섬유 수)
1 염증 침윤 근섬유 1 개 관찰
2 염증 침윤 근섬유 2-5 개 관찰
3 염증 침윤 근섬유 6-15 개 관찰
4 염증 침윤 근섬유 16-30 개 관찰
5 염증 침윤 근섬유 30-99 개 관찰
6 염증 침윤 근섬유 100 개 이상 관찰
그 결과, 음성 대조군에 비해 양성대조군 및 실험군의 염증 침윤된 근섬유의 점수가 감소되었다(도 6).
실시예 4.3. 혈중 사이토카인 농도 확인
정상 마우스 및 14일째의 실시예 4.1의 각 군의 마우스의 혈중 IL-6 농도를 확인하기 위해, 각 군의 마우스의 혈액으로부터 혈청을 분리한 후, IL-6 ELISA Kit(R&D Systems, MN, USA)를 이용하여 제조사의 매뉴얼에 따라 혈중 IL-6 농도를 측정하였다.
그 결과, 대조군의 혈중 IL-6 농도는 증가한 반면, 양성대조군 및 실험군의 혈중 IL-6 농도가 감소한 것을 확인하였다(도 7).
실시예 4.4. PET/MRI 분석을 통한 염증 반응 확인
먼저, 실시예 4.1의 각 군의 마우스의 조직 내 포도당 섭취효율을 높이기 위해, 영상촬영 8시간 전부터 먹이를 주지 않았다. 8시간 후, 200 uci 18F-FDG(서울대병원 핵의학과 사이클로트론실)를 마우스의 정맥을 통해 주사하였고, 1시간 후 PET/MR 영상을 촬영하였다.
그 결과, 음성대조군 마우스의 다리 부분에서 강한 방사성핵종 신호가 관찰되었다. 18F-FDG 방사성의약품은 주로 염증세포인 마크로파지에 선택적으로 섭취된다. 따라서, 핵의학적 영상기술을 통해 염증 반응을 쉽게 모니터링할 수 있었다(도 8).
실시예 4.5. 미토콘드리아 산화 인산화 복합체 발현 변화 확인
사두근(quadriceps)에서 산화 인산화 복합체 Ⅱ의 발현이 대조군(Control)에 비해 음성대조군(CIM)에서 감소되어 있고, 양성대조군(DEXA)에 비해 실험군(CIM+Mito day7)에서 증가되었다. 가자미근(soleus)에서 TOM20의 발현이 대조군 (Control)에 비해 음성대조군(CIM)에서 감소되어 있고, 양성대조군 (DEXA)에 비해 실험군(CIM+Mito day1, CIM+Mito day7)에서 증가되었다(도 9).
상기 실시예 4.2 내지 4.5의 실험 결과를 종합하여, 미토콘드리아 투여 시점을 근염 유도 후 7일째로 설정하여 2차 실험을 진행하였다.
실시예 5. 근염 유발 마우스 모델에서의 외래 미토콘드리아 투여에 따른 근염 치료효과 확인 : 2차 실험
실시예 5.1. 근염 유발 마우스 모델 제작 및 미토콘드리아 투여(n=10)
C57BL/6 암컷 8주령 마우스에 200 ㎍의 C 단백질 단편 및 100 ㎍의 열처리된 우락균을 포함하는 CFA를 피부 내 주입하고, 2 ㎍의 PT를 복강 내 주입하였다.
근염 유도 후 7일째에 제조예 1에서 분리한 미토콘드리아(5 ㎍)를 정맥 내 단회 투여한 그룹을 실험군으로 설정하였다. 또한, 100 ㎕ 용량의 PBS를 복강내 투여한 그룹을 음성대조군으로 설정하였으며, 근염 유도 후, 7일째부터 14일째까지 매일 0.8 mg/kg 용량의 덱사메타손을 복강 내 투여한 그룹을 양성대조군으로 설정하였다(도 10).
실시예 5.2. 염증 침윤 근섬유 확인
실시예 5.1의 각 군의 마우스를 14일째에 희생시켜 사두근 및 슬와부근 조직을 채취하여 H&E로 염색한 후 광학현미경으로 염증세포의 침윤을 관찰하였다. 그 결과, 음성대조군에 비해 양성대조군 및 실험군의 근섬유에 침윤된 염증세포의 수가 감소된 것을 확인하였다(도 11 및 도 12).
또한, 14일째에 각 군의 마우스를 희생시켜 사두근 및 슬와부근 조직을 채취하여 H&E로 염색한 후, 염증세포가 침윤된 근섬유의 개수를 점수체계법을 이용하여 평가하였다. 점수체계법의 점수 측정방식은 실시예 4.2와 동일하게 수행하였다. 이때, 사두근 및 슬와부근의 오른쪽 및 왼쪽 근육의 평균값을 비교하였다. 그 결과, 음성 대조군에 비해 양성대조군 및 실험군의 염증 침윤된 근섬유의 점수가 유의하게 감소되었다(도 13).
실시예 5.3. 혈중 사이토카인 농도 확인
정상 마우스 및 14일째의 실시예 5.1의 각 군의 마우스의 혈중 IL-1β, IL-6 및 TNF-α 농도를 확인하기 위해, 각 군의 마우스의 혈액으로부터 혈청을 분리한 후, IL-1β ELISA Kit(R&D Systems, MN, USA), IL-6 ELISA Kit 및 TNF-α ELISA Kit(R&D Systems, MN, USA)를 이용하여 각각 제조사의 매뉴얼에 따라 혈중 IL-1β, IL-6 및 TNF-α 농도를 각각 측정하였다.
그 결과, 음성대조군과 비교해 양성대조군의 혈중 IL-6 농도는 증가한 반면, 실험군의 혈중 IL-6, IL-1β 및 TNF-α 농도는 음성대조군보다 감소한 것을 확인하였다(도 14, 도 15 및 도 16).
실시예 5.4. IL-6 mRNA 발현 변화 확인
정상 마우스 및 14일째의 실시예 5.1의 각 군의 마우스의 근육으로 분리한 mRNA에서 IL-6 mRNA 발현정도를 RT-qPCR을 통해 확인하였다. 구체적으로, 총 RNA는 TRIzol 시약(Invitrogen)을 사용하여 근육으로부터 분리하고, SYBR Green(Perkin Elmer, MA, USA) 및 7,500 Fast Real-Time PCR 시스템(Applied Biosystems)을 이용하여 qPCR을 수행하였다. 실험 결과는 β-액틴 mRNA의 양으로 정규화 하였다. 이때, 사용된 프라이머는 하기 표 3에 나타내었다.
프라이머 서열정보 서열번호
IL-6-F TAGTCCTTCCTACCCCAATTTCC 1
IL-6-R TTGGTCCTTAGCCACTCCTTC 2
그 결과, 실험군의 IL-6 mRNA 발현이 감소되는 것을 확인하였다. 반면, 양성대조군의 IL-6 mRNA 발현은 감소되지 않았으며, IL-6 mRNA 발현 감소효과와 관련하여 실험군이 양성대조군에 비해 효과적인 것을 확인하였다(도 17).
실시예 5.5. Metabolome 분석을 통해 미토콘드리아 기능 변화 확인
근염 동물 모델(CIM)을 유도한 후, 대조군(Control), 음성대조군(CIM), 양성대조군(DEXA)과 미토콘드리아를 5 ug 이식한 군의 사두근(Quadriceps) 및 넙치근(Soleus muscle)에서 CE-TOFMS 기반 대사 체 분석의 양이온 및 음이온 모드에서 측정하였다. CE-MS 분석의 분석 품질을 향상시켜 샘플을 측정을 위해 도 37에 나타낸 바와 같이 희석시켰다.
근육의 프로필 열지도 분석에서 알 수 있듯이, 대조군(Control)에 비해 음성대조군(CIM)의 골격근의 대사 산물 프로파일에 심각한 영향을 미침을 나타내었다(도 23). 양성대조군(DEXA)에 비해 미토콘드리아 이식군에서 대조군의 대사 산물 프로파일과 유사하게 회복됨을 확인하였다. 말레이트-아스파르테이트 셔틀(때로는 간단히 말레이트 셔틀, Malate aspartate shuttle defect)은 진핵 생물에서 산화 적 인산화를 위해 미토콘드리아의 반투과성 내부 막을 가로 질러 해당 과정 동안 생성된 전자를 전위시키는 생화학적 시스템이다.
근염모델에서 보이는 미토콘드리아 기능장애는 말 레이트-아스파르테이트 셔틀과 연관이 있으며, 말릭산과 아스파르테이트 상대 정량값의 비율이 감소됨을 통해 확인할 수 있었다. 이러한 말릭산과 아스파르테이트 상대 정량값의 비율은 음성대조군(CIM)과 양성대조군(DEXA)에 비해 미토콘드리아 이식 후에 유의하게 증가하였고, 대조군(Control)과 유사한 수준으로 회복됨을 확인할 수 있었다(도 24 내지 도 27).
결론적으로 CIM 마우스모델에서 5 ug 미토콘드리아 이식의 치료효능을 확인하였다.
실시예 6. 근염 유발 마우스 모델에서의 외래 미토콘드리아 투여에 따른 근염 치료효과 확인 : 3차 실험
실시예 6.1. 실험 방법(n=5)
C57BL/6 암컷 8주령 마우스에 200 ㎍의 C 단백질 단편(protein fragments) 및 100 ㎍의 열처리된 우락균(heat-killed Mycobacterium butyricum)을 포함하는 CFA(Complete Freund's adjuvant)를 피부 내 주입(intradermally injection)하고, 2 ㎍의 PT(pertussis toxin)를 복강 내 주입(intraperitoneally injection)하였다.
근염 유도 후 7일째에 제조예 1에서 분리한 미토콘드리아의 용량을 0.2 ug, 1 ug, 5 ug으로 하여 정맥 내 단회 투여한 그룹을 실험군으로 설정하였다. 또한, 100 ㎕ 용량의 PBS를 복강내 투여한 그룹을 음성대조군으로 설정하였으며, 근염 유도 후, 7일째부터 14일째까지 매일 0.8 mg/kg 용량의 덱사메타손(Dexamethasone, DEXA)을 복강 내 투여한 그룹을 양성대조군으로 설정하였다(도 18). 염증 평가 방법으로 H&E stain 후에 근염을 histologic severity에 따라 1 부터 6까지 점수로 나누어서 평가하였다.
근육에서 분리한 mRNA에서 염증성 cytokine 발현 정도를 RT-qPCR을 통해 관찰하였다. 미토콘드리아 이식 후, 미토콘드리아 활성 정도는 미토콘드리아 산화 인산화 복합체(OXPHOS complexs)의 발현을 Western blot 분석을 통해서 평가하였다. 하기 표 4에 동물시험 그룹 정보를 나타내었다.
그룹 개체 수 (n) CIM 유도 목적
Control (non-treat) 5 x 대조군
Vehicle (CIM) 5 O 음성대조군
Dexamethasone 5 O 양성대조군
MT 0.2 ug 5 O 실험군
MT 1 ug 5 O 실험군
MT 5 ug 5 O 실험군
총 개체수 30
실시예 6.2. 염증 침윤 근섬유 확인
각 군의(표 4)의 마우스를 14일째에 희생시켜 사두근(Quadriceps) 및 슬와부근(Hamstring muscle) 조직을 채취하여 H&E(Hematoxylin & eosin)로 염색한 후 광학현미경으로 염증세포의 침윤을 관찰하였다. 그 결과, 음성대조군에 비해 양성대조군 및 실험군의 근섬유에 침윤된 염증세포의 수가 감소된 것을 확인하였다(도 19). 또한, 14일째에 각 군의 마우스를 희생시켜 사두근 및 슬와부근 조직을 채취하여 H&E로 염색한 후, 염증세포가 침윤된 근섬유의 개수를 점수체계법을 이용하여 평가하였다. 점수체계법의 점수 측정방식을 하기 표 5에 나타내었다. 이때, 사두근 및 슬와부근의 오른쪽 및 왼쪽 근육의 평균값을 비교하였다.
점수 평가방식(염증 침윤 근섬유 수)
1 염증 침윤 근섬유 1 개 관찰
2 염증 침윤 근섬유 2-5 개 관찰
3 염증 침윤 근섬유 6-15 개 관찰
4 염증 침윤 근섬유 16-30 개 관찰
5 염증 침윤 근섬유 30-99 개 관찰
6 염증 침윤 근섬유 100 개 이상 관찰
그 결과, 음성대조군에 비해 양성대조군 및 5 μg의 미토콘드리아를 이식 하였을 때 근섬유에 침윤된 염증세포의 수가 유의하게 감소된 것을 확인하였다(도 20).
실시예 6.3. IL-6 와 TNF-α mRNA 발현 변화 확인
대조군(Control), 음성대조군(CIM), 양성대조군(DEXA), 실험군(미토콘드리아 이식군)에서 각 군의 마우스의 근육으로 분리한 mRNA에서 염증성 cytokine 인 IL-6 와 TNF-α mRNA 발현정도를 RT-qPCR을 통해 확인하였다. 구체적으로, 총 RNA는 TRIzol 시약(Invitrogen)을 사용하여 근육으로부터 분리하고, SYBR Green(Perkin Elmer, MA, USA) 및 7500 Fast Real-Time PCR 시스템(Applied Biosystems)을 이용하여 qPCR을 수행하였다. 실험 결과는 β-액틴 mRNA의 양으로 정규화 하였다. 이때, RT-qPCR에 사용된 프라이머는 하기 표 6에 나타내었다.
프라이머 서열정보 서열번호
IL-6-F TAGTCCTTCCTACCCCAATTTCC 1
IL-6-R TTGGTCCTTAGCCACTCCTTC 2
TNF-α-F CCCTCACACTCAGATCATCTTCT 3
TNF-α-R GCTACGACGTGGGCTACAG 4
그 결과, 미토콘드리아 이식군의 근육에서 IL-6 mRNA 발현이 감소되는 경향성을 확인하였다. 그리고 TNF-α mRNA 발현은 미토콘드리아 5 ug 이식군에서 유의하게 감소되는 것을 확인하였다. 반면, 양성대조군(Dexa)의 근육에서 IL-6와 TNF-α mRNA 발현은 감소되지 않았으며, IL-6와 TNF-α mRNA 감소효과와 관련하여 미토콘드리아 이식군이 양성대조군(Dexa)에 비해 효과적인 것을 확인하였다(도 21).
실시예 6.4. 미토콘드리아 산화 인산화 복합체 발현 변화 확인
대조군(Control), 음성대조군(CIM), 양성대조군(DEXA), 실험군(미토콘드리아 이식군)에서 각 군의 마우스의 근육으로부터 분리한 protein에서 산화 인산화 복합체 발현 변화를 western blotting(Total OXPHOS mouse WB Antibody Cocktail, abcam)을 통해서 확인하였다. 산화 인산화 복합체 Ⅰ과 Ⅱ의 발현이 대조군(Control)에 비해 음성대조군(CIM)에서 감소되어 있고, 양성대조군(DEXA)에 비해 모든 용량의 실험군(미토콘드리아 이식군)에서 산화 인산화 복합체 Ⅰ과 Ⅱ의 발현이 증가됨을 확인하였다(도 22).
결론적으로, CIM 마우스모델에서 5 μg 미토콘드리아 이식의 치료효능과 용량의존성을 확인하였다.
IV. 미토콘드리아를 포함한 조성물의 독성 및 물성 확인 확인
실시예 7. 독성실험
미토콘드리아 투여 시 독성이 나타나는지 확인하기 위해, 제조예 1로 제조한 미토콘드리아를 ICR 마우스에 단회 정맥 투여한 후, 체중변화 및 부검을 통한 장기 변화 등을 확인하였다. 7 주령의 ICR 마우스 암수 각 12마리를 하기 표 7과 같이 4개의 그룹으로 나누어 실험을 진행하였다.
그룹 성별 개체 수 투여물질 투여경로 투여량 (㎍/개체) 투여량 (㎖/개체) 농도 (㎍/㎖)
G1 M/F 3/3 부형제 IV - 0.3 -
G2 M/F 3/3 미토콘드리아 IV 25 0.3 100
G3 M/F 3/3 미토콘드리아 IV 50 0.3 200
G4 M/F 3/3 미토콘드리아 IV 100 0.3 400
상기 표 7에 나타난 바와 같이 G1 그룹은 부형제를 투여하였다. G2 내지 G4 그룹은 각각 25 ㎍, 50 ㎍ 또는 100 ㎍의 미토콘드리아를 투여하였다. 이때, G4 그룹의 경우, 개략적인 치사량(ALD, approximate lethal dose)에 상회하는 양의 미토콘드리아를 투여하였다. 이때, 투여는 투여부위를 70% 알코올 솜으로 소독한 다음, 26 게이지 주사바늘이 장착된 주사기를 이용하여 미정맥을 통해 1 ㎖/분의 속도로 부형제 또는 미토콘드리아를 투여하였다.
먼저, 일반증상은 모든 마우스에 대하여 사육기간 동안 사망을 포함한 일반증상의 종류 및 정도를 1일 1회 이상 관찰하고, 개체별로 기록하였다. 단, 투여 당일에는 투여 후 1시간 까지는 지속적으로 관찰하고, 그 후부터는 1시간 간격으로 5시간 동안 관찰하였다. 빈사동물 및 사망동물은 계획부검 동물에 준하여 처리하였다. 부형제 또는 미토콘드리아 투여 개시일을 1일로 설정하였다.
일반증상 관찰 결과, 전 시험기간 중 모든 군에서 사망동물은 관찰되지 않았고, 미토콘드리아 투여 후 1 일째에 관찰된 이상증상은 이후 시험기간 동안 관찰되지 않았기에, 미토콘드리아에 의한 일시적인 변화로 여겨진다. 또한, 모든 마우스 개체에 대하여 투여 전, 투여 후 2일, 4일, 8일 및 15일에 체중을 측정하였다. 측정결과를 하기 표 8에 나타내었다.
수컷 체중(g) 암컷 체중(g)
일 그룹 그룹
G1 G2 G3 G4 G1 G2 G3 G4
1 37.48±1.78 37.88±1.11 37.94±1.18 38.02±1.07 29.12±1.36 29.09±1.28 29.18±0.99 29.32±0.93
2 37.62±1.55 38.06±0.55 36.46±1.71 36.59±1.45 29.23±1.48 28.96±0.76 28.93±0.76 28.21±0.96
4 37.50±1.86 37.88±0.66 36.61±2.17 37.46±1.55 28.99±0.96 28.97±.61 29.54±1.62 28.51±1.09
8 38.49±1.53 38.75±1.65 37.12±3.09 38.96±1.79 29.13±0.71 29.58±0.27 29.90±1.78 28.92±1.79
15 39.21±1.11 39.19±1.17 37.73±2.85 39.98±1.39 30.56±0.52 30.22±0.45 30.82±1.43 29.70±1.39
N 3 3 3 3 3 3 3 3
표 8에 나타난 바와 같이, G1 내지 G4 그룹에서 모두 유의미한 체중변화가 관찰되지 않았다. 또한, 15일에 모든 마우스 개체를 마취시킨 후 개복하여 육안적으로 모든 장기를 검사하였다. 그 결과, G1 내지 G4 그룹에서 모두 장기 변화가 관찰되지 않았다.
상기 결과로 미루어 보아, 본 시험조건하에서 미토콘드리아를 ICR 마우스에 단회 정맥투여하였을 때, 암수 모두 미토콘드리아 농도 100 ㎍/head까지 독성이 나타나지 않음을 확인하였다.
실시예 8. 동결 보관된 탯줄유래 줄기세포에서 분리한 미토콘드리아와 배양된 탯줄유래 줄기세포에서 분리한 미토콘드리아의 특성 비교
탯줄 유래 중간엽 줄기세포를 10%(v/v) 우태혈청(FBS), 100 ㎍/㎖ 스트렙토마이신 및 100 U/㎖ 암피실린을 포함하는 Alpha-MEM 배지에 접종하고 72시간 동안 배양하였다. 배양된 세포는 0.25% Trypsin-EDTA(TE)를 처리하여 세포를 수득하였다. 수득한 세포는 혈구계산기를 이용하여 세포를 1×107 cells/㎖가 되도록 세포를 재현탁시킨 뒤, 동결 튜브에 넣어 동결 보존 용기로 옮긴 후 -80℃ 온도에서 24시간 동안 동결하여 액체질소 동결 보존 탱크에 보관하였다. 동결 보관된 탯줄유래 줄기세포의 미토콘드리아 분리는 상기 제조예 1과 동일한 방법으로 분리하였으며, 제조예 1에서 분리한 배양된 세포 유래 미토콘드리아와 ATP 활성, 막전위 및 미토콘드리아성 활성산소 특성을 비교하였다.
그 결과, 동결 보존된 탯줄유래 줄기세포로부터 분리된 미토콘드리아와 배양된 탯줄유래 줄기세포로부터 분리된 미토콘드리아의 ATP 합성 능력을 비교하기 위해, 기질(substrate; ADP)을 추가하여 기초 에너지대사량에 비해 두 조건 모두 비슷한 비율로 ATP 활성이 회복되는 것을 확인하였다. 또한 막전위 활성은 두가지 조건에서 유사하게 나타났으며, 미토콘드리아성 활성산소의 생성도 유사한 수준임을 확인하였다(도 28 내지 도 30).
실시예 9. 파티클 카운터를 이용한 미토콘드리아 개수 측정
제조예 1에서 분리한 인간 탯줄 유래 중간엽줄기세포로부터 분리한 미토콘드리아를 1 ㎍/㎖, 2.5 ㎍/㎖ 및 5 ㎍/㎖ 농도가 되도록 각각의 용액을 제조한 후, 파티클 카운터(Multisizer 4e, Beckman Coulter)를 통해 미토콘드리아의 개수를 측정하였다. 이때, 각 농도 별로 2회 측정하였으며, 측정 결과를 하기 표 9 및 도 31 내지 도 33에 나타내었다.
1 ㎍/㎖ 2.5 ㎍/㎖ 5 ㎍/㎖
미토콘드리아 개수/㎖ 1차 2차 1차 2차 1차 2차
2.66E±06 1.25E±06 6.11E±06 5.83E±06 1.24E±07 7.83E±06
평균 1.96×106±0.98×106 5.97×106±0.19×106 1.01×107±0.32×107
V. In vitro에서 미토콘드리아에 의한 항염증 효과 확인
실시예 10. RAW264.7 세포에서 여러 종류의 세포유래 미토콘드리아에 의한 정량적 실시간 중합연쇄반응을 이용한 항염증 활성 비교
실시예 2, 실시예 3, 실시예 4, 실시예 7의 방법으로 다양한 세포로부터 얻은 미토콘드리아들에 의한 항 염증 활성을 비교 분석하기 위하여, 정량적 실시간 중합연쇄반응법을 이용한 세포 기반 분석 실험을 진행하였다.
마우스 유래 대식세포주인 RAW264.7 세포를 10% FBS를 포함하는 DMEM 배지에서 배양하였다. 약 3x105 개/well의 세포를 6 well 플레이트에 접종을 하고 24시간 동안 배양을 한 후에 FBS가 제거된 DMEM 배지에서 약 24시간 동안 결핍 조건을 진행하였다.
24시간 후에, 1 μg/㎖의 농도로 salmonella 유래 지질다당류 (lipopolysaccharide, LPS)를 6시간 동안 처리하여 대식 세포주에서 염증반응을 유도하였다. 지질다당류 처리 6시간 후에 PBS 완충 용액으로 2회 씻어준 뒤 각 세포로부터 얻은 미토콘드리아를 처리하고 18시간 동안 추가로 배양하였다. 이 때, 음성 대조군은 지질다당류 및 미토콘드리아 미처리군이며, 양성 대조군은 1 μg/㎖ 농도의 지질다당류를 단독으로 처리한 군이다. 또한, 실험군으로는 1 μg/㎖ 농도의 지질다당류를 처리하고, 6시간 후에 골수유래 중간엽 줄기세포(UC-MSC), 탯줄유래 중간엽 줄기세포(BM-MSC), 래트 근아세포(L6 myoblast), 및 인간 폐 유래 섬유아세포(CCD-8LU)에서 얻은 미토콘드리아를 각각 30 μg씩 처리하였다.
미토콘드리아 처리 18시간 후에, 배양액을 제거하고 세포에 PBS 완충 용액을 첨가하여 2회 세척하고, 0.5 ㎖의 RNA 추출액(Trizol reagent, Thermo Fisher Scientific)액을 직접 첨가한 후, 10분 동안 상온에서 방치하였다. 그리고 나서, 0.1 ㎖의 클로로포름을 첨가하여 15초 동안 교반한 다음, 약 12,000xg로 10분 동안 원심분리 하였다.
분리된 상층액을 수득하고, 동일 부피만큼의 아이소프로필알콜을 첨가한 후에 12,000xg로 10분 동안 원심분리 하였다. 그 후, 액체를 제거하고 75% 에탄올로 1회 세척을 한 후에 상온에서 건조하였다. 건조 후, RNAase-free 정제 증류수를 약 50 ㎕를 첨가하고, 분광 광도계를 이용하여 수득된 RNA의 정량 및 순도를 측정하였다.
수득된 RNA를 이용하여 cDNA를 합성하기 위해, 정제된 총 RNA 2 ㎍에 oligo dT와 결합 반응을 70℃에서 5분 동안 진행한 후, 10X 역전사반응 완충 용액, 10 mM dNTP, RNAse 저해제 및 M-MLV 역전사효소(Enzynomics, Korea)를 첨가하여, cDNA 합성 반응을 42℃에서 60분 동안 수행하였다.
cDNA 합성 반응이 끝난 후에 72℃에서 5분 동안 가열하여 역전사효소를 불활성화시킨 다음, RNase H를 첨가하여 단일 가닥의 RNA를 제거하여 최종 cDNA를 수득하였다. 염증 반응의 특징 유전자인 TNF-α 유전자, IL-1β 유전자 및 IL-6 유전자의 발현 변화 여부를 정량적 실시간 중합연쇄반응을 통해 관찰하였다. GAPDH 유전자를 함께 정량화 하여 발현의 차이를 보정하였다. 정량적 실시간 중합연쇄반응에 사용된 유전자들의 염기 서열은 하기의 표 10에 기재된 바와 같다.
프라이머 서열
TNF-alpha-S 5'-TCTCATCAGTTCTATGGCCC-3' (서열번호 5)
TNF-alpha-AS 5'-GGGAGTAGACAAGGTACAAC-3' (서열번호 6)
IL-1beta-F 5'-AACCTGCTGGTGTGTGACGTTC-3' (서열번호 7)
IL-1beta-R 5'-CAGCACGAGGCTTTTTTGTTGT-3' (서열번호 8)
IL-6-AS 5'-CTAGGTTTGCCGAGTAGATCT-3' (서열번호 9)
IL-6-S 5'-CCAAACTGGATATAATCAGGAAAT -3' (서열번호 10)
GAPDH-S 5'-GGTGAAGGTCGGTGTGAAG-3' (서열번호 11)
GAPDH-AS 5'-CTCGCTCCTGGAAGATGGTG-3' (서열번호 12)
실험 결과에 나타난 바와 같이, 마우스 대식세포주인 RAW 264.7 세포에 지질다당류를 처리하였을 때 TNF-α, IL-1β 및 IL-6 유전자의 발현이 증가함을 알 수 있었으며, 지질다당류에 의해 유도되는 TNF-α, IL-1β 및 IL-6 유전자의 발현은 골수유래 중간엽 줄기세포, 탯줄유래 중간엽 줄기세포, 래트 근아세포, 그리고 인간 폐 유래 섬유아세포 로부터 얻어진 미토콘드리아를 처리하였을 때 유의한 수준으로 억제됨을 확인하였다. 이를 통하여, 본 발명에서 사용된 세포로부터 얻어진 미토콘드리아는 현저하게 우수한 항 염증 활성을 나타내는 것을 확인할 수 있었다(도 34).
실시예 11. 인간 단핵세포(THP-1)에서 여러 종류의 세포유래 미토콘드리아에 의한 항 염증 활성 비교
사람유래 단핵세포인 THP-1 세포를 10% FBS를 포함하는 RPMI 배지에서 배양하였다. 4x105 개/well의 세포를 24 well 플레이트에 접종을 하고 1% FBS를 포함하는 RPMI 배지에서 15 내지 16시간 동안 배양을 진행하였다.
2 μg/㎖의 농도로 salmonella 유래 지질다당류(lipopolysaccharide, LPS)를 6시간 동안 처리하여 THP-1 세포주에서 염증반응을 유도하였다. 지질다당류 처리 6시간 후에 각 세포로부터 얻은 미토콘드리아를 처리하고 24시간 동안 추가로 배양하였다. 이 때, 음성 대조군은 지질다당류 및 미토콘드리아 미처리군이며, 양성 대조군은 2 μg/㎖ 농도의 지질다당류를 단독으로 처리한 군이다. 또한, 실험군으로는 2 μg/㎖ 농도의 지질다당류를 처리하고, 6시간 후에 실시예 2, 실시예 4, 실시예 5, 실시예 6의 방법으로 수득한 탯줄유래 중간엽 줄기세포(UC-MSC), 인간 폐 유래 섬유아세포(CCD-8LU), 사람 역분화줄기세포(IPS) 및 돼지 혈소판(Platelet)에서 얻은 미토콘드리아를 각각 40 μg 씩 처리하였다. 반응 후 항 염증활성 비교를 위해 세포는 정량적 실시간 중합연쇄반응법에 이용하였고, 배양액은 ELISA법에 이용하였다.
실시예 11.1. 정량적 실시간 중합연쇄반응을 이용한 항염증 활성비교
이 후 배양액을 제거하고 세포에 PBS 완충용액을 첨가하여 2회 세척하고 0.5 ml의 RNA 추출 액(Trizol reagent, Thermo Fisher Scientific)액을 직접 가하였다. 10분간 상온에서 방치한 후 0.1 ml의 클로로포름을 첨가하여 15초간 교반 한 뒤 12,000xg로 10분간 원심분리 하였다. 분리된 상층액을 취하여 동일 부피의 이소프로필알콜을 첨가하고 12,000xg로 10분간 원심분리한 뒤 상등액을 제거한 후 75 % 에탄올로 1회 세척을 하고 상온에서 건조하였다.
RNAase가 없는 정제 증류수 50 μl를 가하여 분광광도계를 이용하여 RNA의 정량 및 순도를 측정하였다. cDNA를 합성하기 위해 정제된 총 RNA 2μg에 oligo dT와 결합 반응을 70℃에서 5분간 진행시킨 후 10X 역전사반응 완충용액, 10 mM dNTP, RNAse 저해제, 및 M-MLV 역전사효소(Enzynomics, Korea)를 가하여 cDNA 합성반응을 42℃에서 60분간 수행하였다. 반응 후 72℃에서 5분간 가열하여 역전사효소를 불활성화시킨 뒤 RNase H를 첨가하여 단일 가닥의 RNA를 제거하여 cDNA를 수득하였다.
전-염증인자들의 사이토카인 발현 변화 여부를 하기 표 11에 나타난 프라이머들을 이용하여 정량적 중합연쇄반응(quantitative RT-PCR)을 수행하였다. 이때 보정을 위한 유전자로서 18S로 정량화하여 발현의 차이를 보정하였다.
primer 염기서열
Human IL-6-S ccacacagacagccactcac (서열번호 13)
Human IL-6-AS tttcaccaggcaagtctcct (서열번호 14)
Human 18S-S ctcccacttggataactgtgg (서열번호 15)
Human 18S-AS gaccgggttggttttgatct (서열번호 16)
실험 결과에 나타난 바와 같이, 사람 단핵세포인 THP-1 세포에 지질다당류를 처리하였을 때 IL-6 유전자의 발현이 증가함을 알 수 있었다 또한, 지질다당류에 의해 유도되는 IL-6 유전자의 발현은 탯줄유래 중간엽 줄기세포, 인간 폐 유래 섬유아세포, 사람 역분화줄기세포 및 돼지 혈소판으로부터 얻어진 미토콘드리아를 처리하였을 때 유의한 수준으로 억제됨을 확인하였다. 이를 통하여, 다양한 세포로부터 수득된 미토콘드리아는 현저하게 우수한 항 염증 활성을 나타내는 것을 확인할 수 있었다(도 35, * P < 0.05).
실시예 11.2. ELISA법을 이용한 항염증 활성비교
수득한 상등액으로 THP-1 세포의 전-염증인자(pro-inflammatory) 사이토카인인 IL-6의 발현 양을 확인하기 위해 Human IL-6(R&D Systems)을 이용하여 제조사의 매뉴얼에 따라 다음과 같이 실험을 수행하였다.
100 ㎕ 코팅용액을 96-웰-플레이트에 넣어 상온에서 하룻밤동안 반응하고 3회 세척 후 시약희석액(reagent diluent)으로 상온에서 1시간 반응하고 3회 세척하였다. 10배 희석 상등액과 표준액은 상온에서 2시간 반응 후 3회 세척한 뒤 표지된 항체(detection antibody)를 각 웰에 처리한 후, 2시간 동안 상온에서 반응시켰다. 3회 세척한 뒤 스트렙트아비틴액(streptavidine-HRP)을 상온에서 20분간 반응 시킨 후 3회 세척한 뒤 발색용액(Substrate solution)을 암소 상온 조건에서 20분간 반응 후 반응정지액을 첨가하여 450 nm 파장에서 흡광도를 측정하였다.
실험 결과에 나타난 바와 같이, 사람 단핵세포인 THP-1 세포에 지질다당류를 처리하였을 때 IL-6 단백질이 증가함을 알 수 있었으며, 지질다당류에 의해 유도되는 IL-6 단백질은 탯줄유래 중간엽 줄기세포, 인간 폐 유래 섬유아세포, 사람 역분화줄기세포 그리고 돼지 혈소판으로부터 얻어진 미토콘드리아를 처리하였을 때 유의한 수준으로 억제됨을 확인하였고 유전자 발현결과와 일치하였다. 이를 통하여, 다양한 세포로부터 얻어진 미토콘드리아는 현저하게 우수한 항염증 활성을 나타내는 것을 확인할 수 있었다(도 36, * P < 0.05).

Claims (12)

  1. 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서,
    상기 미토콘드리아는 세포 또는 조직으로부터 분리된 것인, 근염 예방 또는 치료용 약학 조성물.
  3. 제2항에 있어서,
    상기 미토콘드리아는 체외 배양된 세포부터 분리된 것인, 근염 예방 또는 치료용 약학 조성물.
  4. 제2항에 있어서,
    상기 세포는 체세포, 생식세포, 줄기세포 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나인 것인, 근염 예방 또는 치료용 약학 조성물.
  5. 제4항에 있어서,
    상기 체세포가 근육세포, 간세포, 신경세포, 섬유아세포, 상피세포, 지방세포, 골세포, 백혈구, 림프구, 혈소판 또는 점막세포로 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나인 것인, 근염 예방 또는 치료용 약학 조성물.
  6. 제4항에 있어서,
    상기 생식세포가 정자, 난자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나인 것인, 근염 예방 또는 치료용 약학 조성물.
  7. 제4항에 있어서,
    상기 줄기세포가 중간엽줄기세포, 성체줄기세포, 역분화줄기세포, 배아줄기세포, 골수줄기세포, 신경줄기세포, 윤부줄기세포, 조직 유래 줄기세포 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나인 것인, 근염 예방 또는 치료용 약학 조성물.
  8. 제7항에 있어서,
    상기 중간엽줄기세포가 탯줄, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막, 태반, 활액, 정소, 골막 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나로부터 수득된 것인, 근염 예방 또는 치료용 약학 조성물.
  9. 제1항에 있어서,
    상기 약학 조성물에 대하여, 상기 미토콘드리아는 0.1 ㎍/㎖ 내지 1000 ㎍/㎖의 농도로 포함되는, 근염 예방 또는 치료용 약학 조성물.
  10. 제1항에 있어서,
    상기 약학 조성물에 대하여, 상기 미토콘드리아는 1×105 내지 5×108 미토콘드리아 개수/㎖의 함량으로 포함되는 것인, 근염 또는 치료용 약학 조성물.
  11. 제1항 내지 제10항 중 어느 한 항의 약학 조성물을 개체에 투여하는 단계를 포함하는 근염 예방 또는 치료 방법.
  12. 근염 예방 또는 치료를 위한 분리된 미토콘드리아의 용도.
PCT/KR2020/005769 2019-04-30 2020-04-29 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물 WO2020222566A1 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP20798096.2A EP3964218A4 (en) 2019-04-30 2020-04-29 PHARMACEUTICAL COMPOSITION FOR PREVENTION OR TREATMENT OF MYOSITIS WITH ISOLATED MITOCHONDRIA AS ACTIVE INGREDIENT
US17/607,850 US20220211754A1 (en) 2019-04-30 2020-04-29 Pharmaceutical composition for preventing or treating myositis, comprising isolated mitochondria as active ingredient
CN202080048016.3A CN114051410A (zh) 2019-04-30 2020-04-29 包含分离的线粒体为有效成分的预防或治疗肌炎的药物组合物
JP2021563663A JP2022530232A (ja) 2019-04-30 2020-04-29 活性成分として単離されたミトコンドリアを含む、筋炎を予防又は治療するための医薬組成物
AU2020264869A AU2020264869A1 (en) 2019-04-30 2020-04-29 Pharmaceutical composition for preventing or treating myositis, comprising isolated mitochondria as active ingredient
CA3138170A CA3138170A1 (en) 2019-04-30 2020-04-29 Pharmaceutical composition for preventing or treating myositis, comprising isolated mitochondria as active ingredient
BR112021021804A BR112021021804A2 (pt) 2019-04-30 2020-04-29 Composição farmacêutica para prevenção ou tratamento de miosite compreendendo mitocôndrias isoladas como ingrediente ativo

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0050527 2019-04-30
KR20190050527 2019-04-30

Publications (1)

Publication Number Publication Date
WO2020222566A1 true WO2020222566A1 (ko) 2020-11-05

Family

ID=73028891

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/005769 WO2020222566A1 (ko) 2019-04-30 2020-04-29 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물

Country Status (10)

Country Link
US (1) US20220211754A1 (ko)
EP (1) EP3964218A4 (ko)
JP (1) JP2022530232A (ko)
KR (1) KR102391020B1 (ko)
CN (1) CN114051410A (ko)
AU (1) AU2020264869A1 (ko)
BR (1) BR112021021804A2 (ko)
CA (1) CA3138170A1 (ko)
TW (1) TW202106314A (ko)
WO (1) WO2020222566A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240002487A (ko) * 2022-06-29 2024-01-05 건국대학교 글로컬산학협력단 전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008137035A1 (en) * 2007-05-02 2008-11-13 The Mclean Hospital Corporation Methods and compositions for mitochondrial replacement therapy
KR20180062387A (ko) * 2016-11-30 2018-06-08 차의과학대학교 산학협력단 미토콘드리아를 포함하는 근질환 예방 또는 치료용 약학 조성물
US20190111016A1 (en) * 2016-02-26 2019-04-18 The Regents Of The University Of California Methods of treating muscle and liver disorders

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2016518357A (ja) * 2013-04-08 2016-06-23 プレジデント アンド フェローズ オブ ハーバード カレッジ 骨格筋幹細胞を若返らせる方法および組成物
EP3540067A4 (en) 2016-11-14 2020-10-28 Paean Biotechnology Inc. METHOD OF INTRODUCING EXOGENOUS MITOCHONDRIA INTO CELLS

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008137035A1 (en) * 2007-05-02 2008-11-13 The Mclean Hospital Corporation Methods and compositions for mitochondrial replacement therapy
US20190111016A1 (en) * 2016-02-26 2019-04-18 The Regents Of The University Of California Methods of treating muscle and liver disorders
KR20180062387A (ko) * 2016-11-30 2018-06-08 차의과학대학교 산학협력단 미토콘드리아를 포함하는 근질환 예방 또는 치료용 약학 조성물

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
A. OLDFORS, A. R. MOSLEMI, L. JONASSON, M. OHLSSON, G. KOLLBERG, C. LINDBERG: "Mitochondrial abnormalities in inclusion-body myositis", NEUROLOGY, vol. 66, no. 1, 24 January 2006 (2006-01-24), pages S49 - S55, XP009531485, ISSN: 0028-3878, DOI: 10.1212/01.wnl.0000192127.63013.8d *
JAMES D. MCCULLY, J VIS EXP, no. 91, 2014, pages 51682
KIM ET AL., ARTHRITIS RESEARCH & THERAPY, vol. 16, 2014, pages R126
RYGIEL, K. A. ET AL.: "Mitochondrial and inflammatory changes in sporadic inclusion body myositis", NEUROPATHOLOGY AND APPLIED NEUROBIOLOGY, vol. 41, 2015, pages 288 - 303, XP055756609 *
See also references of EP3964218A4
SUGIHARA T ET AL., ARTHRITIS RHEUM, vol. 56, no. 4, 2007, pages 1304 - 14

Also Published As

Publication number Publication date
CN114051410A (zh) 2022-02-15
EP3964218A1 (en) 2022-03-09
KR20200126929A (ko) 2020-11-09
CA3138170A1 (en) 2020-11-05
KR102391020B1 (ko) 2022-04-26
JP2022530232A (ja) 2022-06-28
AU2020264869A1 (en) 2021-11-18
EP3964218A4 (en) 2022-07-06
BR112021021804A2 (pt) 2022-01-04
TW202106314A (zh) 2021-02-16
US20220211754A1 (en) 2022-07-07

Similar Documents

Publication Publication Date Title
WO2018101708A1 (ko) 미토콘드리아를 포함하는 약학 조성물
WO2018074758A2 (ko) 면역질환 치료를 위한 고효능 줄기세포 선별방법
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2020222483A1 (ko) 분리된 미토콘드리아를 유효성분으로 포함하는 패혈증 또는 전신성 염증 반응 증후군 치료용 약학 조성물
WO2022103138A1 (ko) 비피도박테리움 롱검 rapo (kctc13773bp)를 포함하는 암 예방 또는 치료용 조성물
WO2019117633A1 (ko) 아토피성 피부염, 탈모, 상처 또는 피부 주름의 개선용 화장료 조성물 및 약학 조성물
WO2018088693A1 (ko) 2ｄｇ를 이용한 줄기세포 역량 향상 방법
WO2018056706A1 (ko) 티오레독신 결합단백질 유래 펩타이드 또는 이를 암호화 하는 폴리뉴클레오타이드를 유효성분으로 함유하는 노화 줄기세포의 역노화용 조성물 및 이의 용도
WO2020222566A1 (ko) 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2017023047A1 (ko) 아리피프라졸을 유효성분으로 함유하는 염증성 질환 또는 암 예방 또는 치료용 조성물
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2015023147A1 (ko) mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2019194598A1 (ko) 비만 및 당뇨 개선을 위한 골격근 대사 활성화제로서의 rock2 억제제
WO2022131742A1 (ko) 소포체 스트레스 유발 물질로 처리된 세포 유래 엑소좀 및 이의 용도
WO2010021516A2 (ko) 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도
WO2022098143A1 (ko) 분리된 미토콘드리아를 포함하는 섬유증 예방 또는 치료용 약학 조성물
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
RU2810508C2 (ru) Фармацевтическая композиция для профилактики или лечения миозита, содержащая выделенные митохондрии в качестве активного ингредиента
WO2020149538A1 (ko) 클로날 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 약학적 조성물
WO2016190480A1 (ko) 미토콘드리아 분열 조절제의 스크리닝 방법
WO2020122666A1 (ko) 중간엽줄기세포가 포함된 생체 이식용 임플란트를 포함하는 간 질환의 예방 또는 치료용 약학적 조성물
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20798096

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021563663

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3138170

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021021804

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020264869

Country of ref document: AU

Date of ref document: 20200429

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020798096

Country of ref document: EP

Effective date: 20211130

ENP Entry into the national phase

Ref document number: 112021021804

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20211029