WO2020218494A1 - ACIDE NUCLÉIQUE miR302 MODIFIÉ - Google Patents

ACIDE NUCLÉIQUE miR302 MODIFIÉ Download PDF

Info

Publication number
WO2020218494A1
WO2020218494A1 PCT/JP2020/017659 JP2020017659W WO2020218494A1 WO 2020218494 A1 WO2020218494 A1 WO 2020218494A1 JP 2020017659 W JP2020017659 W JP 2020017659W WO 2020218494 A1 WO2020218494 A1 WO 2020218494A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid variant
seq
mir302
ribose
Prior art date
Application number
PCT/JP2020/017659
Other languages
English (en)
Japanese (ja)
Inventor
秀始 石井
雅允 今野
聡 小比賀
森　正樹
Original Assignee
国立大学法人大阪大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人大阪大学 filed Critical 国立大学法人大阪大学
Priority to JP2021516252A priority Critical patent/JPWO2020218494A1/ja
Publication of WO2020218494A1 publication Critical patent/WO2020218494A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • the present disclosure relates to miR302 nucleic acid variants and their use. More specifically, it relates to a human miR302a nucleic acid variant and its use.
  • the miR302 nucleic acid variants of the present disclosure can be used in the treatment of diseases such as cancer.
  • Non-Patent Document 1 ESC-related transcription factors such as Nanog, Oct3/4, Sox2 and Rex1 are miR302-367 promoters. It is expected to be an upstream regulator of, and miR302 thus regulated is thought to influence a variety of biological events.
  • the miR302 nucleic acid variant can be used for the treatment of diseases such as cancer, and have reached the present disclosure.
  • a miR302 nucleic acid variant and a composition containing the same are provided, and their use in the treatment of diseases such as cancer is also provided.
  • the miR302 nucleic acid variants of the present disclosure can be stable, for example in plasma, and can be effectively used in administration regimens with low subject load.
  • the present disclosure provides: (Item 1) Human miR302a nucleic acid variant.
  • a nucleic acid variant of any of the above items comprising a base sequence containing 0, 1, 2, 3, 4 or 5 substitutions, deletions or insertions from the base sequence of.
  • At least one of the 8th and 18th bases of UAAGUGCUUCCAUGUUUUGGUGA (g1) (SEQ ID NO: 2), or Anucleic acid variant of any of the above items, comprising a base sequence comprising a base substitution, deletion or insertion at a position corresponding to at least one of the 4th and 14th bases of ACUUAAACGUGGAUGUACUUGCU (p1) (SEQ ID NO: 3).
  • UAAGUGCTUCCAUGUTUTGGUTGA (SEQ ID NO: 4) has the same base sequence other than the 8th and 18th bases, or A nucleic acid variant of any of the above items, which comprises a base sequence having the same base other than the 4th and 14th bases of ACCAAAACAUGGAAGCACUUACT (p10) (SEQ ID NO: 5).
  • (Item 7) A nucleic acid variant of any of the above items, wherein R x is hydrogen, methyl, ethyl, n-propyl, isopropyl, or benzyl, respectively.
  • (Item 8) U ⁇ A (M) A ⁇ G (M) U ⁇ G (M) C ⁇ T (M) U ⁇ C (M) C ⁇ A (M) U ⁇ G (M) U ⁇ T (M) U ⁇ T (M) G ⁇ G (M) U ⁇ T (M) G (L) ⁇ A (L) or A (L) ⁇ C (L) ⁇ C ⁇ A ⁇ A ⁇ A ⁇ A ⁇ A ⁇ C ⁇ A ⁇ U ⁇ G ⁇ A ⁇ A ⁇ G ⁇ C ⁇ A ⁇ C ⁇ U ⁇ U ⁇ A ⁇ C ( L) ⁇ T (L) Structure (in the formula, U stands for uracil, T stands for thymine, A stands
  • (L) is the ribose in the ribonucleotide unit to the left of this symbol Represents a modification that has been replaced by ⁇ Represents a modification in which one oxygen atom that is not involved in the bond of the phosphate group between the adjacent ribonucleotide units is replaced with a sulfur atom)
  • (Item 11) A double strand formed by a nucleic acid variant of any of the above items, which is a guide strand, and a nucleic acid variant of any of the above items, which is a passenger strand.
  • (Item 12) A nucleic acid variant molecule comprising a portion of a nucleic acid variant of any of the above items which is a guide portion and a portion of a nucleic acid variant of any of the above items which is a passenger portion.
  • (Item 13) A nucleic acid variant molecule of any of the above items, which has a sequence that can be degraded in vivo.
  • a nucleic acid variant of any of the above items which produces lower luciferase luminescence than natural human miR302a when contacted with HT29 cells introduced by lentivirus with a nucleic acid construct in which the luciferase gene and the HnRNPA2B1 gene are bound.
  • Degradation rate when contacted with fetal bovine serum (FBS) in vitro is slower than that of natural human miR302a, nucleic acid variant of any of the above items, double strand of any of the above items, or any of the above items. Nucleic acid variant molecule.
  • a pharmaceutical composition for treating cancer comprising a nucleic acid variant of any of the above items, a double strand of any of the above items, or a nucleic acid variant of any of the above items.
  • a method for treating cancer comprising administering to a subject a nucleic acid variant of any of the above items, a double strand of any of the above items, or a nucleic acid variant molecule of any of the above items.
  • This disclosure is useful for the treatment of diseases such as cancer.
  • the result of the primary screening is shown.
  • the height of the bar indicates the relative luminescence intensity of luciferase observed in each guide chain-passenger chain pair when the result in the G1P1 pair (denoted as miR302 in the figure) is 1.
  • Each bar shows the results in any combination of any of the 19 guide chains and any of the 20 passenger chains.
  • Each bar is only arranged based on emission intensity, and the horizontal or vertical axis does not refer to a particular guide chain or passenger chain. For example, other bars in the same column or row as the G1P1 pair of bars do not necessarily result in a pair containing G1 or P1.
  • the effect of treatment with native miR302 (G1P1 pair) on Panc-1 cells is shown.
  • the graph on the left shows the results on the 4th day, and the graph on the right shows the results on the 7th day.
  • the vertical axis shows the relative DAPI staining area of the G1P1 pair when the control result is 1.
  • the difference in stained area between the G1P1 pair and the control was a statistically significant difference (P ⁇ 0.01).
  • the effect of treatment with miR302 nucleic acid variant or native miR302 (G1P1 pair) on MIA-PaCa cells is shown.
  • the vertical axis shows the relative DAPI staining area of each guide chain-passenger chain pair when the result of the G1P1 pair on the 4th day is 1.
  • the horizontal axis shows the types of guide-passenger pairs, for each pair the left bar shows the results for day 4 and the bar on the right shows the results for day 7. * Indicates that there is a statistically significant difference compared to the results of the G1P1 pair.
  • the effect of treatment with miR302 nucleic acid variant or native miR302 (G1P1 pair) on Panc-1 cells is shown.
  • the vertical axis shows the relative DAPI staining area of each guide-passenger pair when the result of the G1P1 pair on the 4th day is 1.
  • the horizontal axis shows the types of guide-passenger pairs, for each pair the left bar shows the results for day 4 and the bar on the right shows the results for day 7.
  • the change in body weight over time when a single dose of G1P1 pair, OUM302 or vehicle is administered to mice is shown.
  • the vertical axis shows the body weight (g).
  • the horizontal axis shows the number of days with the day of administration as the 0th day. Circled markers indicate vehicle administration group, triangle markers indicate OUM302 administration group, and square markers indicate G1P1 pair administration group. It shows the change in tumor volume over time when a single dose of G1P1 pair, OUM302 or vehicle is administered to mice.
  • the vertical axis shows the tumor volume (mm 3 ).
  • the horizontal axis shows the number of days with the day of administration as the 0th day.
  • Circled markers indicate vehicle administration group, triangle markers indicate OUM302 administration group, and square markers indicate G1P1 pair administration group. It shows the change in body weight over time when a single dose of G1P1 pair or OUM302 in combination with gemcitabine was administered to mice.
  • the vertical axis shows the body weight (g).
  • the horizontal axis shows the number of days with the day of administration as the 0th day.
  • the circle markers indicate the OUM302 + gemcitabine administration group, and the triangular markers indicate the G1P1 pair + gemcitabine administration group. It shows the change in tumor volume over time when a single dose of G1P1 pair or OUM302 in combination with gemcitabine was administered to mice.
  • the vertical axis shows the tumor volume (mm 3 ).
  • the horizontal axis shows the number of days with the day of administration as the 0th day.
  • the circle markers indicate the OUM302 + gemcitabine administration group, and the triangular markers indicate the G1P1 pair + gemcitabine administration group. It shows the change in body weight over time when a single dose of G1P1 pair or OUM302 in combination with 5FU (5-fluorouracil) was administered to mice.
  • the vertical axis shows the body weight (g).
  • the horizontal axis shows the number of days with the day of administration as the 0th day. Circled markers indicate the OUM302 + 5FU administration group, and triangular markers indicate the G1P1 vs. + 5FU administration group.
  • the vertical axis shows the tumor volume (mm 3 ).
  • the horizontal axis shows the number of days with the day of administration as the 0th day. Circled markers indicate the OUM302 + 5FU administration group, and triangular markers indicate the G1P1 vs. + 5FU administration group.
  • the change in body weight over time when a single dose of G1P1 pair or OUM302 in combination with TAS is shown in mice.
  • the vertical axis shows the body weight (g).
  • the horizontal axis shows the number of days with the day of administration as the 0th day.
  • Circled markers indicate the OUM302 + TAS administration group, and triangular markers indicate the G1P1 pair + TAS administration group. It shows the change in tumor volume over time when a single dose of G1P1 pair or OUM302 in combination with TAS (trifluridine / tipiracil hydrochloride, Ronsurf®) is administered to mice.
  • the vertical axis shows the tumor volume (mm 3 ).
  • the horizontal axis shows the number of days with the day of administration as the 0th day.
  • Circled markers indicate the OUM302 + TAS administration group, and triangular markers indicate the G1P1 pair + TAS administration group.
  • the vertical axis shows the tumor volume (mm 3 ).
  • the horizontal axis shows the number of days with the day of administration as the 0th day.
  • the x marker indicates the control treatment group
  • the square marker indicates the TAS single administration group
  • the circle marker indicates the OUM302 + TAS administration group
  • the triangular marker indicates the G1P1 pair + TAS administration group.
  • the vertical axis shows the body weight (g).
  • the horizontal axis shows the number of days with the day of administration as the 0th day.
  • the x marker indicates the vehicle administration group
  • the square marker indicates the G1P1 vs. single administration group
  • the circle marker indicates the OUM302 alone administration group
  • the triangular marker indicates the OUM302 + TAS administration group
  • the G1P1 vs + TAS administration group the G1P1 vs + TAS administration group.
  • the tumor weight 32 days after administration of vehicle, G1P1 pair alone or OUM302 alone to spontaneously developing pancreatic cancer mice is shown.
  • the vehicle administration group, the G1P1 administration group, and the OUM302 administration group are shown from the left, and in the right graph, the G1P1 administration group is shown on the left and the OUM302 administration group is shown on the right.
  • the graph on the right is an enlargement of the G1P1 administration group and the OUM302 administration group in the graph on the left.
  • the vertical axis shows the tumor weight (mg).
  • An electrophoretic image of four types of nucleic acids treated with FBS with 20% acrylamide / bisgel is shown.
  • Both ends are the result of 20bp DNA ladder (Takara Bio, Shiga). From the left, a set of processing results of g1, g9, p1, and p10 is shown. In each set, the results of no FBS addition, 15-minute treatment, 30-minute treatment, 1-hour treatment, 3-hour treatment, and 24-hour treatment are shown from the left. An electrophoretic image of two FBS-treated nucleic acid pairs on a 2% agarose gel (left) or 20% acrylamide / bisgel (right) is shown. Both ends are the result of 20bp DNA ladder (Takara Bio, Shiga). The left shows a set of processing results of g1p1 pair and the right shows a set of processing results of g9p10 pair. In each set, the left shows the result of FBS addition and the right shows the result of FBS 1 hour treatment.
  • nucleic acid is used in the usual sense as used in the art, and “modification” as used herein means substitution, deletion or insertion of a base, or a chemical structure other than a base (eg, for example. Refers to any modification of cross-linked nucleic acid (BNA), locked nucleic acid (LNA), modified nucleic acid such as AmNA). In the present specification, a substance containing at least one such modification is referred to as a variant.
  • nucleic acid variant refers to a substance in which an arbitrary modification (for example, modification of a base, modification of a chemical structure, etc.) is introduced into a naturally occurring nucleic acid.
  • miR302 nucleic acid variant refers to a substance in which any modification (eg, base modification, chemical structure modification (eg, introduction of modified nucleic acid), etc.) has been introduced into naturally occurring miR302.
  • nucleic acid variant refers to a functional part different from the modified (for example, detection of nucleic acid variant, tissue targeting, stability improvement and / or binding to other molecules. It is intended that substances into which (parts that promote) have been introduced are also included.
  • modified nucleic acid refers to a nucleic acid modified so as to have a structure different from that of a normal nucleic acid used in DNA or RNA.
  • modified nucleic acids include ethylene nucleic acids such as locked nucleic acids (LNA), 2'-O, 4'-C-ethylene bridged nucleic acids (2'-O, 4'-C-ethylene bridged nucleic acid, ENA), and others.
  • Bridged nucleic acid bridged nucleic acid, BNA
  • hexitol nucleic acid hexitol nucleic acid, HNA
  • amide bridged nucleic acid Amido-bridged nucleic acid, AmNA
  • morpholino nucleic acid tricyclo-DNA (tcDNA)
  • polyether nucleic acid for example, US Pat. No. 5,908,845
  • cyclohexene nucleic acid CeNA
  • BNA is said to mean Bicyclic Nucleic Acid as well as Bridged Nucleic Acid, and is also called “bridged nucleic acid", "bicyclic nucleic acid” or “bridged / bicyclic nucleic acid”.
  • the bicyclic nucleic acid refers to an arbitrary modified nucleic acid in which the 2'position and the 4'position of the nucleic acid are linked (crosslinked) to form two ring structures (bicyclic).
  • modified nucleic acids are known in the art, for example, Japanese Patent No. 4731324, Pradeep S. Pallan et al., Chem Communi (Camb). 2012 August 25; 48 (66): 8195-8197. Doi: 10.1039 / c2cc32286b
  • the crosslinked nucleic acid described in the above can be used.
  • substitution of a base means changing one base (A, G, C, T, U or a derivative thereof) to another base.
  • the term “deletion” of a base means changing a base sequence to a base sequence from which the target base has been removed.
  • the term “insertion” of a base means changing a base sequence to a base sequence to which a target base has been added.
  • deletion of a modification means to change a variant into which the target modification has been introduced to a substance in which the modification has not been introduced. For example, when this modification is deleted from a variant (AAAAA) in which a modification that deletes G from the base sequence AAAGAA is introduced, the base sequence of AAAGAA is given. In another example, from a variant that has introduced a modification that replaces ribose with deoxyribose, removing this modification gives a substance in which this deoxyribose of the variant is replaced with ribose.
  • complex or “complex molecule” means any construct that includes two or more moieties.
  • one part is a nucleic acid
  • the other part may be a nucleic acid, with other substances (eg, polypeptides, substrates, sugars, lipids, nucleic acids, other hydrocarbons, etc.).
  • two or more portions constituting the complex may be bonded by a covalent bond or other bonds (for example, hydrogen bond, ionic bond, hydrophobic interaction, van der Waals force, etc.). It may have been done.
  • substituted refers to an atom or functional group in which one chemical group is substituted with another in the chemical structure of a nucleic acid variant.
  • base in the present specification means a monovalent group.
  • alkyl group means a monovalent saturated hydrocarbon group.
  • group may be omitted in the description of the substituent in the present specification.
  • the number of substituents in the groups defined by “substitutable or unsubstituted”, “may be substituted”, or “substituted” is not particularly limited as long as it can be substituted, and may be one or more. Is. Unless otherwise indicated, the description of each group also applies when the group is part of another group or a substituent.
  • substituted or unsubstituted is used interchangeably with “may be substituted”, and a specific group may be further substituted or substituted and has no substituent. It means that it is also good.
  • Substituents that can be used in the miRNA or nucleic acid variants used herein include alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, alkoxy, carbocyclic group, heterocyclic group, halogen, hydroxy, Examples include, but are not limited to, thiols, cyanos, nitros, aminos, carboxys, carbamoyls, acyls, acylaminos, thiocarboxys, amides, substituted carbonyls, substituted thiocarbonyls, substituted sulfonyls or substituted sulfinyls. All of the substituents may have a substituent other than hydrogen.
  • the substitution shall replace one or more hydrogen atoms in an organic compound or substituent with another atom or atomic group, or shall be a double bond or a triple bond.
  • the substitution shall replace one hydrogen atom and replace it with a monovalent substituent, or combine it with a single bond to form a double bond, and remove two hydrogen atoms to make a divalent substituent. It can be substituted or combined with a single bond to form a triple bond.
  • alkyl (group) refers to a monovalent group generated by the loss of one hydrogen atom from an aliphatic hydrocarbon (alkane) such as methane, ethane, or propane, and generally means C n H 2n + 1. It is represented by-(where n is a positive integer).
  • Alkyl can be straight or branched.
  • the alkyl (group) may be substituted or unsubstituted (unsubstituted).
  • specific examples of alkyl are C 1 to C 2 alkyl, C 1 to C 3 alkyl, C 1 to C 4 alkyl, C 1 to C 5 alkyl, C 1 to C 6 alkyl, and C 1 to C 7 alkyl.
  • C 1 to C 10 alkyl means a linear or branched alkyl having 1 to 10 carbon atoms.
  • substituted alkyl refers to an alkyl in which the H of the alkyl is substituted by the substituents specified herein.
  • CH 3 OCH 2- , CH 3 OCH 2 CH 2- , CH 3 OCH 2 CH 2 CH 2- , HOCH 2- , HOCH 2 CH 2- , HOCH 2 CH 2 CH 2- , NCCH 2- , NCCH 2 CH 2- , NCCH 2 CH 2 CH 2- , FCH 2- , FCH 2 CH 2- , FCH 2 CH 2- CH 2- , H 2 NCH 2- , H 2 NCH 2 CH 2- , H 2 NCH 2 CH 2 CH 2- , HOOCCH 2- , HOOCCH 2 CH 2- , HOOCCH 2 CH 2 CH 2- , C 6 H 5- CH 2- (benzyl group) can be mentioned. ..
  • alkenyl refers to a monovalent group produced by the loss of one hydrogen atom from an aliphatic hydrocarbon having one double bond in the molecule, and is generally C n H 2n-1- . Represented (where n is a positive integer greater than or equal to 2). "Substituted alkenyl” refers to an alkenyl in which hydrogen of the alkenyl is substituted by the above-mentioned substituent.
  • the 2 ⁇ C 10 alkyl means a straight or branched alkenyl containing 2 to 10 carbon atoms.
  • a C 2 ⁇ C 10 substituted alkenyl, a C 2 ⁇ C 10 alkenyl, of which 1 or more hydrogen atoms refer to those substituted by a substituent.
  • alkynyl refers to a monovalent group generated by the loss of one hydrogen atom from an aliphatic hydrocarbon having one triple bond in the molecule, and is generally represented by C n H 2n-3-. (Here, n is a positive integer greater than or equal to 2).
  • substituted alkynyl refers to an alkynyl in which the hydrogen of the alkynyl is substituted by the above-mentioned substituent.
  • aryl (group) refers to a group formed by the detachment of one hydrogen atom bonded to a ring of an aromatic hydrocarbon, and is included in the carbon ring group in the present specification. Phenyl from benzene (C 6 H 5 -), tolyl from toluene (CH 3 C 6 H 4 - ), xylyl from xylene ((CH 3) 2 C 6 H 3 -), naphthyl naphthalene The group (C 10 H 8- ) is induced.
  • alkoxy (group) is a group in which hydrogen of an alkyl group is replaced with hydroxy
  • the "alkyl (group)” portion is synonymous with the above-mentioned “alkyl (group)”.
  • it is "C 1 to 6 alkoxy (group)”.
  • Specific examples of "C 1 to 6 alkoxy (group)” include methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy and the like.
  • halogen (atom) includes, for example, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom and the like. It is preferably a fluorine atom or a chlorine atom.
  • arabinose as a sugar (pentose).
  • Nucleotides or nucleic acids can be referred to by a generally recognized one-letter code. Amino acids may be referred to herein by either their generally known three-letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • identity search can be performed using, for example, NCBI's BLAST 2.8.1 (issued on January 1.4, 2019).
  • the value of identity in the present specification usually refers to the value when the above BLAST is used and aligned under the default conditions. However, if a higher value is obtained by changing the parameter, the highest value is set as the identity value. When identity is evaluated in multiple regions, the highest value among them is set as the identity value. Similarity is a numerical value that takes into account similar amino acids in addition to identity.
  • U means uracil
  • T means thymine
  • A means adenine
  • C means cytosine.
  • (M) represents a modification in which the 2'hydroxyl group of ribose in the ribonucleotide unit to the left of this symbol is replaced with a methoxy group.
  • (L) represents a modification in which ribose in the ribonucleotide unit to the left of this symbol is replaced by LNA.
  • ⁇ Represents a modification in which one oxygen atom that is not involved in the bond of a phosphate group between adjacent ribonucleotide units is replaced with a sulfur atom.
  • the term "means” means a tool that can be an arbitrary tool for achieving a certain purpose (for example, detection, diagnosis, treatment), and in particular, in the present specification, “means for selective recognition (detection)". "" Means a means by which an object can be recognized (detected) differently from another.
  • label refers to an entity (eg, substance, energy, electromagnetic wave, etc.) for identifying a target molecule or substance from others.
  • labeling methods include RI (radioisotope) method, stable isotope labeling method, fluorescence method, biotin method, optical method using Raman scattering, chemiluminescence method and the like.
  • subject refers to an organism subject to the diagnosis, detection, or treatment of the present disclosure (for example, an organism such as a human being, cells taken from an organism, blood, serum, etc.). ..
  • drug As used herein, “drug”, “drug” or “factor” (both corresponding to agents in English) are used interchangeably in any sense as long as they can achieve their intended purpose. It may also be a substance or other element (eg, energy such as light, radioactivity, heat, electricity). Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (including, for example, cDNA, DNA such as genomic DNA, RNA such as mRNA), poly.
  • cDNA DNA such as genomic DNA
  • RNA such as mRNA
  • organic small molecules eg, hormones, ligands, signaling substances, organic small molecules, molecules synthesized with combinatorial chemistries, small molecules that can be used as pharmaceuticals (eg, small molecule ligands, etc.)
  • treatment refers to a disease or disorder (eg, cancer) that, when such a condition occurs, prevents the exacerbation of such disease or disorder, preferably maintains the status quo. It preferably refers to alleviation, more preferably withdrawal, and includes the ability to exert a symptom-improving effect or a preventive effect on a patient's disease or one or more symptoms associated with the disease. Diagnosis in advance and appropriate treatment is called “companion treatment”, and the diagnostic agent for that purpose is sometimes called “companion diagnostic agent”.
  • the "therapeutic agent (drug)” means any drug that can treat a target condition (for example, a disease such as cancer) in a broad sense.
  • the "therapeutic agent” may be a pharmaceutical composition comprising an active ingredient and one or more pharmacologically acceptable carriers.
  • the pharmaceutical composition can be produced, for example, by mixing the active ingredient with the carrier and any method known in the technical field of pharmaceutics.
  • the therapeutic agent is not limited in the form of use as long as it is used for treatment, and may be the active ingredient alone or a mixture of the active ingredient and an arbitrary ingredient.
  • the shape of the carrier is not particularly limited, and may be, for example, a solid or a liquid (for example, a buffer solution).
  • the therapeutic agent for cancer or the like includes a drug (preventive agent) used for prevention of cancer or the like or an inhibitor for cancer or the like.
  • prevention means to prevent a certain disease or disorder (for example, a disease such as cancer) from becoming such a state before it becomes such a state.
  • the agents of the present disclosure can be used to make a diagnosis, and if necessary, the agents of the present disclosure can be used to prevent, for example, cancer, or to take preventive measures.
  • preventive drug means any drug that can prevent a target condition (for example, a disease such as cancer) in a broad sense.
  • kits are a unit in which parts to be provided (for example, a test drug, a diagnostic drug, a therapeutic drug, an antibody, a label, an instruction manual, etc.) are usually divided into two or more sections. To say.
  • the form of this kit is preferred when the purpose is to provide a composition that should not be mixed and provided for stability and the like, but is preferably mixed and used immediately before use.
  • kits are preferably instructions or instructions describing how to use the provided parts (eg, test agents, diagnostic agents, therapeutic agents, or how reagents should be treated).
  • the kit When the kit is used as a reagent kit in the present specification, the kit usually includes an instruction manual or the like that describes how to use a test drug, a diagnostic drug, a therapeutic drug, an antibody, or the like. Is included.
  • the "instruction” describes the method of using this disclosure to a doctor or another user.
  • This instruction sheet contains words instructing the detection method of the present disclosure, how to use a diagnostic agent, or administration of a medicine or the like.
  • the instruction sheet may include a wording instructing the administration site to be administered orally or to the esophagus (for example, by injection).
  • This instruction is prepared and approved by the regulatory agency of the country in which this disclosure is implemented (eg, Ministry of Health, Labor and Welfare in Japan, Food and Drug Administration (FDA) in the United States, etc.). It is clearly stated that it has been received.
  • the instruction sheet is a so-called package insert, which is usually provided in a paper medium, but is not limited thereto, and is in a form such as an electronic medium (for example, a homepage provided on the Internet, an e-mail). But can be provided.
  • the present disclosure provides a miR302 nucleic acid variant.
  • a human miR302 nucleic acid variant is provided, and more specifically, a human miR302a nucleic acid variant is provided.
  • miR302 is a kind of microRNA and is said to form a miR-302 / 367 cluster, so any microRNA belonging to this cluster falls into this category. It contains at least five members, miR-367, miR-302d, miR-302a, miR-302c and miR-302b (eg Gao Z, Zhu X, Dou Y.
  • the miR-302 / 367 cluster a comprehensive update on its evolution and functions. Open Biol.2015; 5 (12): 150138. See doi: 10.1098 / rsob.150138.
  • Natural human miR302a is a microRNA having the following base sequence. 5'-CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAGAAGUAAGUGCUUCCAUGUUUUGGUGAUGG-3'(SEQ ID NO: 1)
  • the natural human miR302a molecule is thought to form the stem-loop structure shown below.
  • the nucleic acid considered to correspond to the upper half of this stem-loop structure is referred to as a passenger strand (p)
  • the nucleic acid considered to correspond to the lower half of this stem-loop structure is referred to as a guide strand (g). is there.
  • the miR302 nucleic acid variant of the present disclosure comprises 5 to 70 consecutive arbitrary bases of SEQ ID NO: 1, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,35,40,45,50,55,60,65 or 70 pieces
  • Modifications eg, substitutions, deletions or insertions
  • 0 to 10 eg, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 from the base sequence consisting of It may contain or consist of a base sequence containing.
  • the modified base sequence includes alkyl bases other than adenine (A), guanine (G), cytosine (C), uracil (U) and thymine (T) (eg, alkyl of any of these bases such as methylated adenine). Chemicals (eg, methylated) may be included.
  • the miR302 nucleic acid variant molecules of the present disclosure have an arbitrary base length of 5 to 500 (eg, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16).
  • the miR302 nucleic acid variants of the present disclosure are: UAAGUGCUUCCAUGUUUUGGUGA (g1) (SEQ ID NO: 2) or ACUUAAACGUGGAUGUACUUGCU (p1) (SEQ ID NO: 3)
  • Both the sequences of SEQ ID NO: 2 and SEQ ID NO: 3 are 23 consecutive base sequences of SEQ ID NO: 1.
  • the miR302 nucleic acid variants of the present disclosure are: At least one of the 8th and 18th bases of UAAGUGCUUCCAUGUUUUGGUGA (g1) (SEQ ID NO: 2), or ACUUAAACGUGGAUGUACUUGCU (p1) (SEQ ID NO: 3) may contain a base sequence containing a base substitution, deletion or insertion at a position corresponding to at least one of the 4th and 14th bases. Even if the 8th and 18th bases of SEQ ID NO: 2 are modified, the effect on their functions is expected to be small. Even if the 4th and 14th bases of SEQ ID NO: 3 are modified, the effect on their functions is expected to be small.
  • the miR302 nucleic acid variants of the present disclosure are: A base sequence containing 0, 1, 2, 3, 4 or 5 substitutions, deletions or insertions in bases other than the 8th and 18th bases of UAAGUGCUUCCAUGUUUUGGUGA (g1) (SEQ ID NO: 2), or ACUUAAACGUGGAUGUACUUGCU (p1) (SEQ ID NO: 3) may contain base sequences other than the 4th and 14th bases containing 0, 1, 2, 3, 4 or 5 substitutions, deletions or insertions.
  • the miR302 nucleic acid variants of the present disclosure are: A base sequence containing 0, 1, 2, 3, 4 or 5 substitutions, deletions or insertions in bases other than the 8th and 18th bases of UAAGUGCTUCCAUGUTUTGGUTGA (g9) (SEQ ID NO: 4), or It may contain a base sequence containing 0, 1, 2, 3, 4 or 5 substitutions, deletions or insertions in bases other than the 4th and 14th bases of ACCAAAACAUGGAAGCACUUACT (p10) (SEQ ID NO: 5).
  • SEQ ID NO: 4 is a sequence having substitutions of 3 bases and insertion of 1 base from 23 consecutive base sequences (bases 44 to 66) of SEQ ID NO: 1.
  • SEQ ID NO: 5 is a sequence having 7 base substitutions from 23 consecutive base sequences (6th to 28th bases) of SEQ ID NO: 1. Even if the 8th and 18th bases of SEQ ID NO: 4 are modified, the effect on their functions is expected to be small. Even if the 4th and 14th bases of SEQ ID NO: 5 are modified, the effect on their functions is expected to be small.
  • the miR302 nucleic acid variants of the present disclosure may exist as a complex of two molecules (eg, a complex of a guide chain molecule and a passenger molecule) or as a plurality of separated molecules. It may be present as one of the guide chain molecule or the passenger molecule alone, or may be present as a molecule in which both the guide chain portion and the passenger moiety are contained in one molecule. If necessary, this molecule may have a sequence that can be decomposed in vivo by the action of, for example, Dicer.
  • sequences can be appropriately designed by those skilled in the art, including, but not limited to, sequences and structures such as UUGAAACUAAAGAAG (SEQ ID NO: 7), such sequences, guide chain moieties and passengers.
  • the nucleic acid can be designed as a part-containing molecule (eg, the degradation sequence is located between the guide strand portion and the passenger moiety).
  • the miR302 nucleic acid variants of the present disclosure are modified by any one or more of the following (1) to (5): (1) Substitution of ribose to crosslinked sugar (2) Substitution of oxygen atom of phosphate group to sulfur atom (3) Substitution of sugar at 2'position (4) Substitution of ribose to stereoisomer sugar (5) One or more phosphorylations at the 5'position of the terminal nucleic acid unit (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16) , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65 or 70).
  • the miR302 nucleic acid variant may comprise any of the nucleotide sequences described above.
  • the miR302 nucleic acid variant of the present disclosure is modified from any of the above (1), (3), (4) and (5) from 0 to 10 (eg, 0, 1, 2).
  • the crosslinked sugar in the modification "replacement of ribose with a crosslinked sugar” in (1) above may have any suitable structure.
  • Substituent linear or branched C 1 to C 12 alkyl, optionally substituted linear or branched C 2 to C 12 alkenyl, optionally substituted direct chain or branched C 2 ⁇ C 12 alkynyl, substituted optionally unsaturated also be 5-12 membered, in unsaturated or aromatic cyclic group (ring, two or three N, O Or S may be included), halogen, OJ 1 , N (J 1 ) 2 , SJ 1 , N 3 , or CN; each J 1 is independently H, a linear array which may be substituted.
  • each R 1 in the formula can be H or C 1 to C 12 alkyl.
  • the modification of (1) above is the substitution of ribose with a crosslinked sugar having any of the structures shown below.
  • R x are independently hydrogen, substituted or unsubstituted linear or branched C 1 to C 12 alkyl, substituted or unsubstituted linear or branched C 2 to C 12 alkenyl, substituted or unsubstituted linear or branched C 2 -C 12 alkynyl, substituted or unsubstituted 5- to 12-membered cyclic group, halogen, OJ 1 , N (J 1 ) 2 , SJ 1 , N 3 , or CN, and in a specific embodiment, R x is H, methyl, ethyl, n-propyl, isopropyl, or benzyl).
  • crosslinked sugar having the above structure mutual substitution between crosslinked sugars having Rx of hydrogen, methyl, ethyl, n-propyl, isopropyl, or benzyl is predicted to have a small effect on the function of nucleic acid variants containing the crosslinked sugars. Will be done.
  • substitution of an oxygen atom of a phosphate group with a sulfur atom is typically a modification of replacing one oxygen atom that is not involved in the bond of a phosphate group with a sulfur atom, that is, Structure, It is a modification that replaces the structure of.
  • substitution of the 2'position of sugar for example, the hydroxyl group at the 2'position of sugar (for example, ribose) is replaced with halogen (for example, fluorine), -R 3 , -OR 3 and Substituents that change to a substituent selected from the group consisting of ⁇ N (R 3 ) 2 are mentioned, in which R 3 is hydrogen, substituted or unsubstituted linear or branched C 1 to C.
  • R 3 is hydrogen, methyl, ethyl, n- propyl, are selected from the group consisting of isopropyl or benzyl.
  • the modification of (3) above can be a modification that replaces the 2'hydroxyl group of a sugar (eg, ribose) with a hydrogen, fluorine or alkoxyl group (eg, a methoxyl group).
  • substitution of ribose to a stereoisomer sugar includes at least one of the 1', 2', 3'and 4'positions of ribose (for example, one, two, three or more).
  • substitution with a stereoisomer sugar in which the bonding relationship (back or front of the ring) between two groups (hydrogen atom and substituent) bonded to the same carbon is reversed can be mentioned.
  • ribose-type to arabino-type substitution substitution with a stereoisomer sugar in which the bond relationship (back or front of the ring) between two groups bonded to the carbon at the 2'position of Bose is reversed.
  • the modification may be on one nucleic acid unit or on a plurality of nucleic acid units.
  • the modification of (2) above “substitution of oxygen atom of phosphoric acid group with sulfur atom”
  • the modification of (3) above “2'position of sugar”
  • the miR302 nucleic acid variants of the present disclosure may have any combination of any of the modifications described above.
  • the miR302 nucleic acid variant disclosed in the present application is: U ⁇ A (M) A ⁇ G (M) U ⁇ G (M) C ⁇ T (M) U ⁇ C (M) C ⁇ A (M) U ⁇ G (M) U ⁇ T (M) U ⁇ T (M) G ⁇ G (M) U ⁇ T (M) G (L) ⁇ A (L) or A (L) ⁇ C (L) ⁇ C ⁇ A ⁇ A ⁇ A ⁇ A ⁇ A ⁇ C ⁇ A ⁇ U ⁇ G ⁇ G ⁇ A ⁇ A ⁇ G ⁇ C ⁇ A ⁇ C ⁇ U ⁇ U ⁇ A ⁇ C ( L) ⁇ T (L) (During the ceremony, U stands for uracil, T stands for thymine, A stands for adenine, C stands for cytosine, (M) represents a modification in which the 2'hydroxyl group of ribose in the ribonucleot
  • (L) is the ribose in the ribonucleotide unit to the left of this symbol Represents a modification that has been replaced by ⁇ Represents a modification in which one oxygen atom that is not involved in the bond of the phosphate group between the adjacent ribonucleotide units is replaced with a sulfur atom) ,
  • 0 to 10 modifications of (M), (L) and ⁇ eg, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10
  • 0 to 10 eg, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or any modifications of (1) to (5) above have been deleted.
  • 10) have been added and may contain structures containing 0, 1, 2, 3, 4 or 5 base substitutions, deletions or insertions.
  • the miR302 nucleic acid variants of the present disclosure are: U ⁇ A (M) A ⁇ G (M) U ⁇ G (M) C ⁇ T (M) U ⁇ C (M) C ⁇ A (M) U ⁇ G (M) U ⁇ T (M) U ⁇ T (M) G ⁇ G (M) U ⁇ T (M) G (L) ⁇ A (L) or A (L) ⁇ C (L) ⁇ C ⁇ A ⁇ A ⁇ A ⁇ A ⁇ A ⁇ C ⁇ A ⁇ U ⁇ G ⁇ A ⁇ A ⁇ G ⁇ C ⁇ A ⁇ C ⁇ U ⁇ U ⁇ A ⁇ C ( L) ⁇ T (L) (In the formula, U, T,
  • 0, 1, 2, 3 or 4 has been changed to the substitution with another cross-linked sugar in (1) above, and 0 to 10 modifications of ⁇ (eg, 0, 1, 2, 3). 4, 5, 6, 7, 8, 9 or 10) have been deleted, and 0 to 10 modifications (2) above (eg 0, 1, 2, 3, 4, 5, 6, 7) have been deleted. , 8, 9 or 10), and 0 to 5 (eg, 0, 1, 2, 3, 4) of any modification of (1), (3), (4) or (5) above. Or 5) may be a structure-containing molecule that has been added and contains 0, 1, 2, 3, 4 or 5 base substitutions, deletions or insertions.
  • the miR302 nucleic acid variants of the present disclosure facilitate functional moieties different from those of the modifications (eg, detection of nucleic acid variants, tissue targeting, stability enhancement and / or binding to other molecules.
  • the part to be used may be included.
  • Functional moieties include, but are not limited to, for example, fluorescent dyes, luminescent dyes, PEGs, cholesterol, lipids, biotin, linker moieties (such as moieties containing NHS, azides or alkynes).
  • modified nucleic acids described herein using any known technique.
  • synthesis of modified nucleic acids refer to, for example, Current protocols in nucleic acid chemistry (https://currentprotocols.onlinelibrary.wiley.com/journal/19349289).
  • the miR302 nucleic acid variant of the present disclosure is a case where HT29 cells into which a nucleic acid construct in which a luciferase gene and an HnRNPA2B1 gene are bound are introduced by a lentivirus are brought into contact with the miR302 nucleic acid variant.
  • Lower than the double strand (g1p1 pair) formed by the native human miR302a or nucleic acid of SEQ ID NO: 2 (g1) and nucleic acid of SEQ ID NO: 3 (p1) (eg, 1% -99.99% lower, For example, about 1%, about 2%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, (About 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9% or about 99.99% lower) can result in luciferase luminescence.
  • the miR302 nucleic acid variants of the present disclosure are in vitro with fetal bovine serum (FBS).
  • FBS fetal bovine serum
  • the rate of degradation upon contact is slower than the double strand (g1p1 pair) formed by the native human miR302a or the nucleic acid of SEQ ID NO: 2 (g1) and the nucleic acid of SEQ ID NO: 3 (p1) (eg, 1).
  • % -99.99% slower eg, about 1%, about 2%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60% , About 70%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9% or about 99.99% slower) Can have stability.
  • the miR302 nucleic acid variants of the present disclosure can be used in the treatment of diseases such as cancer.
  • the miR302 nucleic acid variants of the present disclosure may be provided in the form contained in the composition.
  • Cancers that can be treated with the miR302 nucleic acid variants of the present disclosure include pancreatic cancer (eg, early pancreatic cancer), liver cancer, gallbladder cancer, biliary tract cancer, gastric cancer, colon cancer, bladder cancer, and kidney.
  • Cancer, breast cancer, lung cancer, brain cancer and skin cancer include, but are not limited to.
  • the miR302 nucleic acid variants of the present disclosure are provided as various forms of compositions or pharmaceuticals (therapeutic or prophylactic agents).
  • the administration route of the therapeutic agent is preferably one that is effective for treatment, and may be, for example, intravenous, subcutaneous, intramuscular, intraperitoneal, or oral administration.
  • the administration form may be, for example, an injection, a capsule, a tablet, a granule, or the like.
  • the aqueous solution for injection may be stored, for example, in a vial or a stainless steel container. Further, the aqueous solution for injection may contain, for example, physiological saline, sugar (for example, trehalose), NaCl, NaOH or the like. Further, the therapeutic agent may contain, for example, a buffer (for example, a phosphate buffer), a stabilizer, or the like.
  • compositions, pharmaceuticals, therapeutic agents, prophylactic agents, etc. of the present disclosure include therapeutically effective amounts of therapeutic or active ingredients, and pharmaceutically acceptable carriers or excipients.
  • pharmaceutically acceptable is used in animals, and more specifically in humans, for use in government regulatory agencies or in the pharmacopoeia or other generally accepted pharmacopoeia. It means that it is listed.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle to which a therapeutic agent is administered together.
  • Such carriers can also be sterile liquids such as water and oils, including, but not limited to, petroleum, animal, plant or synthetic origins, sesame oil, soybean oil, minerals.
  • saline and aqueous dextrose are the preferred carriers.
  • saline solution, as well as aqueous dextrose and glycerol solutions are used as liquid carriers for the injectable solution.
  • Suitable excipients include light anhydrous silicic acid, crystalline cellulose, mannitol, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, choke, silica gel, sodium stearate, glycerol monostearate, talc, chloride.
  • composition Sodium, defatted milk powder, glycerol, propylene, glycol, water, ethanol, carmellose calcium, carmellose sodium, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, polyvinyl acetal diethylaminoacetate, polyvinyl pyrrolidone, gelatin, medium chain fatty acid triglyceride, polyoxyethylene curing
  • castor oil 60 sucrose, carboxymethyl cellulose, corn starch, inorganic salts and the like.
  • the composition can also contain small amounts of wetting or emulsifying agents, or pH buffers, if desired.
  • compositions can also take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. It is also possible to formulate the composition as a suppository using traditional binders and carriers such as triglycerides. Oral formulations can also include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, saccharin sodium, cellulose, magnesium carbonate and the like. Examples of suitable carriers are E.I. W. Described in Martin, Remington's Pharmaceutical Sciences (Mark Publishing Company, Easton, U.S.A.).
  • compositions contain a therapeutically effective amount of a therapeutic agent, preferably a purified form, along with an appropriate amount of carrier to provide a form for appropriate administration to the patient.
  • a therapeutic agent preferably a purified form
  • the formulation should be suitable for the mode of administration.
  • surfactants for example, surfactants, excipients, colorants, fragrances, preservatives, stabilizers, buffers, suspending agents, tonicity agents, binders, disintegrants, lubricants, fluidity It may contain an accelerator, a flavoring agent and the like.
  • the "salt” includes, for example, an anion salt formed of any acidic (eg, carboxyl) group or a cationic salt formed of any basic (eg, amino) group.
  • the salts include inorganic salts or organic salts, and include, for example, the salts described in Berg et al., J. Pharm. Sci., 1977, 66, 1-19. Further, for example, a metal salt, an ammonium salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid and the like can be mentioned.
  • a "solvate" is a compound formed by a solute and a solvent. For the solvate, for example, J.
  • the solvent is water, the solvate formed is a hydrate.
  • the solvent is preferably one that does not interfere with the biological activity of the solute. Examples of such preferred solvents include, but are not limited to, water or various buffers.
  • the miR302 nucleic acid variants of the present disclosure are administered as pharmaceuticals
  • various delivery systems are known, and such systems can also be used to administer the therapeutic agents of the present disclosure to appropriate sites.
  • encapsulation in liposomes, microparticles, and microcapsules the use of receptor-mediated endocytosis; construction of therapeutic nucleic acids as part of retroviral vectors or other vectors. and so on.
  • Induction methods include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • the drug can be administered by any of the preferred routes, eg by injection, by bolus injection, by absorption through the epithelial or mucocutaneous lining (eg, oral, rectal and intestinal mucosa).
  • Inhalers or nebulizers can be used, depending on the aerosolizing agent, and can also be administered with other bioactive agents. Administration can also be systemic or topical.
  • the miR302 nucleic acid variant of the present disclosure can be further administered by any appropriate route, such as direct injection into the cancer (lesion).
  • the composition can be blended as a pharmaceutical composition adapted for administration to humans according to a known method.
  • Such compositions can be administered by injection.
  • the composition for injection administration is a solution in a sterile isotonic aqueous buffer.
  • the composition can also include a solubilizer and a local anesthetic such as lidocaine to relieve pain at the injection site.
  • the ingredients are supplied separately or mixed together in a unit dosage form and lyophilized powder or water-free concentrate in a sealed container such as an ampoule or sachet indicating the amount of activator. It can be supplied as a thing.
  • composition is to be administered by infusion, it can also be dispensed using an infusion bottle containing sterile drug grade water or saline. If the composition is to be administered by injection, it is also possible to provide an ampoule of sterile water or saline for injection so that the ingredients can be mixed prior to administration.
  • compositions, pharmaceuticals, therapeutic agents and prophylactic agents of the present disclosure in neutral or salt forms or other prodrugs (eg, esters, etc.).
  • Pharmaceutically acceptable salts include those formed with free carboxyl groups derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, prokine. It includes those formed with free amine groups such as those derived from such as, and those derived from sodium, potassium, ammonium, calcium, ferric hydroxide and the like.
  • the amount of therapeutic agent of the present disclosure effective for the treatment of a particular disorder or condition may vary depending on the nature of the disorder or condition, but one of ordinary skill in the art can determine by standard clinical techniques as described herein.
  • in vitro assays can optionally be used to assist in identifying optimal dosage ranges.
  • the exact dose to be used in the formulation may also vary depending on the route of administration and the severity of the disease or disorder and should be determined according to the discretion of the attending physician and the circumstances of each patient. However, the dose is not particularly limited, and may be, for example, 0.001, 1, 5, 10, 15, 100, or 1000 mg / kg body weight per dose, within the range of any two of these values. There may be.
  • the dosing interval is not particularly limited, but may be administered once or twice per 1, 7, 14, 21, or 28 days, and once or twice within the range of any two of these values. May be good.
  • the miR302 nucleic acid variants of the present disclosure may have high plasma stability and / or high activity, so administration frequency may be reduced.
  • the dose, administration interval, and administration method may be appropriately selected depending on the age and weight of the patient, symptoms, target organ, and the like.
  • the therapeutic agent preferably contains a therapeutically effective amount or an effective amount of the active ingredient that exerts a desired action. If the malignant tumor marker is significantly reduced after administration, it may be judged that there is a therapeutic effect. Effective doses can be estimated from dose-response curves obtained in vitro or from animal model test systems.
  • the "patient” or “subject” is a human or mammal (eg, mouse, guinea pig, hamster, rat, mouse, rabbit, pig, sheep, goat, cow, horse, cat, dog, Includes marmosets, monkeys, or chimpanzees, etc.).
  • a human or mammal eg, mouse, guinea pig, hamster, rat, mouse, rabbit, pig, sheep, goat, cow, horse, cat, dog, Includes marmosets, monkeys, or chimpanzees, etc.
  • the pharmaceutical composition or therapeutic or prophylactic agent of the present disclosure can be provided as a kit.
  • the present disclosure provides drug packs or kits comprising one or more containers filled with one or more components of the compositions or pharmaceuticals of the present disclosure.
  • compositions containing the ingredients of the present disclosure can be administered via liposomes, microparticles, or microcapsules. In various embodiments of the present disclosure, it may be useful to use such compositions to achieve sustained release of the components of the present disclosure.
  • oligonucleotides of the present disclosure in the manufacture of immunostimulatory oligonucleotide nucleic acid reagents is provided. It is understood that the oligonucleotides used in this aspect can use any of the forms described herein.
  • Example 1 Design of miR302 nucleic acid variant Nucleic acid having a partial sequence of miR302 nucleic acid variant and natural human miR302a (19 types of guide strands and 20 types of passenger strands in total) was requested to Gene Design (Osaka). And synthesized.
  • -(M) represents a modification in which the 2'hydroxyl group of ribose in the ribonucleotide unit to the left of this symbol is replaced with a methoxy group.
  • ⁇ In (L) the ribose in the ribonucleotide unit to the left of this symbol is Represents a modification that has been replaced by ⁇ ⁇ Represents a modification in which one oxygen atom that is not involved in the bond of the phosphate group between the adjacent ribonucleotide units is replaced with a sulfur atom).
  • Alexa647 was attached to the 5'end of the guide chains (g1 and g9) via an ssH amino linker.
  • Example 2 Preparation of cells for primary screening
  • a gene in which a luciferase gene was fused to 3'UTR (hereinafter) of the HnRNPA2B1 gene was used in HT29 cells using a lentiwill. It was introduced into (colon cancer cell line) to prepare cells that stably express this fusion gene.
  • the binding of miR302a to the 3'UTR region of the HnRNPA2B1 gene destabilizes the mRNA of the fusion gene and reduces the amount of luciferase luminescence.
  • Example 3 Primary screening The above HT29 cells were seeded on a 96-well plate (Nunc TM) at a concentration of 1 ⁇ 10 3 cells / well (day 0). On day 1, cells in each well were introduced with the above miR302 nucleic acid variant or native miR302 (combination of guide and passenger strands) using Lipofectamine RNAi MAX (Invitrogen, USA). The medium was changed on the second day, and the amount of luciferase emitted was measured on the third day. The Dual-Glo® Luciferase Assay System (promega, USA) and GLO MAX MULTI (promega, USA) were used to measure luciferase luminescence. The stained area was calculated with Image J and compared. The results are shown in FIG.
  • Example 4 Secondary screening As a result of the primary screening, 10 kinds of miR302 nucleic acid variant combinations having a high inhibitory effect on luciferase luminescence were subjected to the secondary screening.
  • pancreatic cancer cell lines Panc-1 and MIA-PaCa were seeded on 96-well plates (Cell able®, Toyo Gosei, Tokyo) (day 0) and the next day.
  • the above miR302 nucleic acid variant or native miR302 was introduced using Lipofectamine RNAi MAX (Invitrogen, USA).
  • Example 5 Animal administration experiment Nucleic acid (62.5 nmol / kg) (OUM302 or natural miR302 (G1P1 pair)) + unit PIC was intravenously injected into NOD-SCID mice having a tumor volume of 50 mm 3 and 14 Body weight and tumor volume were observed until days later. In addition, the vehicle-administered group was included. The results are shown in FIGS. 5 to 6. In mice, OUM302 showed superior antitumor effects compared to native miR302.
  • Nucleic acid (62.5 nmol / kg) (OUM302 or native miR302) + unit PIC) + anti-cancer agent (TAS-102 (trifluridine / tipiracil hydrochloride, Ronsurf) in NOD-SCID mice with a tumor volume of 50 mm 3 Registered trademark)) (150 mg / kg), 5FU (5-fluorouracil) (8.3 mg / kg) or gemcitabine (100 mg / kg)) was administered as a single dose, and body weight and tumor volume were observed until 14 days later. The results are shown in FIGS. 7-12. In mice, OUM302 showed superior antitumor effects compared to native miR302 when combined with anticancer agents.
  • TAS-102 trifluridine / tipiracil hydrochloride, Ronsurf
  • 5FU 5-fluorouracil
  • gemcitabine 100 mg / kg
  • EL1-SV40 Tg mouse FVB / N-Tg (Cela1-Luc, Cela1-Tag) 116Xen mouse purchased from Taconic
  • nucleic acid (62.5 nmol / kg)
  • TAS-102 150 mg / kg
  • TAS-102 150 mg / kg
  • Example 6 Stability of miR302 nucleic acid variant MiR302 nucleic acid variant (g1, g9, p1 or p10) was added to a solution to which FBS was added so as to have a final concentration of 1% so that the final concentration was 2 ⁇ M. Incubated at 37 ° C. Samples were collected 15 minutes, 30 minutes, 1 hour, 3 hours and 24 hours after the start of incubation and subjected to electrophoresis. Electrophoresis was performed with 20% acrylamide / bisgel. The condition without adding FBS was used as a control. A 20 bp DNA ladder (Takara Bio, Shiga) was used as the migration marker. The exposure time was Cy3_30sec. (Fig. 16)
  • a miR302 nucleic acid variant (natural g1p1 pair or g9p10 vs. OUM302) was added to a solution to which FBS was added to a final concentration of 1% to a final concentration of 2 ⁇ M, and the mixture was incubated at 37 ° C. Samples were collected 1 hour after the start of incubation and subjected to electrophoresis. Electrophoresis was performed on a 2% agarose gel or 20% acrylamide / bisgel. The condition without adding FBS was used as a control. A 20 bp DNA ladder (Takara Bio, Shiga) was used as the migration marker (Fig. 17).
  • This disclosure is available for pharmaceutical products, such as pharmaceutical products for treating cancer.
  • -SEQ ID NO: 1 Natural human miR302a sequence CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAGAAGUAAGUGCUUCCAUGUUUUGGUGAUGG
  • SEQ ID NO: 2 Guide sequence of natural human miR302a (g1) UAAGUGCUUCCAUGUUUUGGUGA
  • SEQ ID NO: 3 Passenger sequence of natural human miR302a (p1) ACUUAAACGUGGAUGUACUUGCU SEQ ID NO: 4: Nucleotide sequence of miR302 nucleic acid variant (g9) UAAGUGCTUCCAUGUTUTGGUTGA
  • SEQ ID NO: 5 Nucleotide sequence of miR302 nucleic acid variant (p10) ACCAAAACAUGGAAGCACUUACT
  • SEQ ID NO: 6 3'UTR sequence of the HnRNPA2B1 gene used
  • SEQ ID NO: 7 exemplary degraded sequence UUGAAACUAAAGAAG

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un acide nucléique miR302 modifié. Selon un mode de réalisation, la présente invention concerne un traitement pour des maladies telles que le cancer qui utilise l'acide nucléique miR302 modifié. Selon un mode de réalisation, la présente invention concerne une composition qui comprend l'acide nucléique miR302 modifié et une utilisation de la composition dans le traitement de maladies telles que le cancer. Selon un mode de réalisation, l'acide nucléique miR302 modifié de la présente invention peut comprendre une séquence de base qui comprend de 0 à 10 modifications (par exemple, substitutions, délétions ou insertions) à partir d'une séquence de base qui comprend de 5 à 70 bases arbitraires consécutives de la séquence SEQ ID NO : 1.
PCT/JP2020/017659 2019-04-26 2020-04-24 ACIDE NUCLÉIQUE miR302 MODIFIÉ WO2020218494A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2021516252A JPWO2020218494A1 (fr) 2019-04-26 2020-04-24

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2019085789 2019-04-26
JP2019-085789 2019-04-26

Publications (1)

Publication Number Publication Date
WO2020218494A1 true WO2020218494A1 (fr) 2020-10-29

Family

ID=72942825

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2020/017659 WO2020218494A1 (fr) 2019-04-26 2020-04-24 ACIDE NUCLÉIQUE miR302 MODIFIÉ

Country Status (2)

Country Link
JP (1) JPWO2020218494A1 (fr)
WO (1) WO2020218494A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023021715A1 (fr) * 2021-08-17 2023-02-23 国立大学法人大阪大学 Dérivé de sucre et conjugué sucre-acide nucléique

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015522257A (ja) * 2012-06-13 2015-08-06 ステムジェント， インコーポレイテッドＳｔｅｍｇｅｎｔ， Ｉｎｃ． 多能性幹細胞を調製する方法

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015522257A (ja) * 2012-06-13 2015-08-06 ステムジェント， インコーポレイテッドＳｔｅｍｇｅｎｔ， Ｉｎｃ． 多能性幹細胞を調製する方法

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KONNO MASAMITSU: "Issue number:16K15615 Development of innovative nucleic acid medicine for gastroenterological cancer", GRANTS-IN AID FOR SCIENTIFIC RESEARCH, FINAL RESEARCH REPORT, 29 March 2019 (2019-03-29), XP055760643, Retrieved from the Internet <URL:https://kaken.nii.ac.jp/ja/file/KAKENHI-PROJECT-16K15615/16K15615seika.pdf> [retrieved on 20201216] *
XIN LI, LI LI LIU, JU LEI YAO, KAI WANG, HAO AI: "Human Umbilical Cord Mesenchymal Stem Cell-Derived Extracellular Vesicles Inhibit Endometrial Cancer Cell Proliferation and Migration through Delivery of Exogenous miR-302a", STEM CELLS INTERNATIONAL, HINDAWI PUBLISHING CORPORATION, US, vol. 2019, 14 March 2019 (2019-03-14), US, pages 1 - 11, XP055752755, ISSN: 1687-966X, DOI: 10.1155/2019/8108576 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023021715A1 (fr) * 2021-08-17 2023-02-23 国立大学法人大阪大学 Dérivé de sucre et conjugué sucre-acide nucléique

Also Published As

Publication number Publication date
JPWO2020218494A1 (fr) 2020-10-29

Similar Documents

Publication Publication Date Title
JP6954843B2 (ja) ペプチドオリゴヌクレオチドコンジュゲート
US9938525B2 (en) Compositions and methods for selective delivery of oligonucleotide molecules to cell types
JP2022526419A (ja) 中枢神経系における遺伝子発現を阻害するための組成物及び方法
AU2015328242A1 (en) Anti-TNF compounds
KR20170029512A (ko) 인트론 잔류의 감소
US20180312839A1 (en) Methods and compositions for increasing smn expression
US20210052706A1 (en) Compositions and methods for facilitating delivery of synthetic nucleic acids to cells
US20240026357A1 (en) Modified mir-135, conjugated form thereof, and uses of same
JP6519842B2 (ja) 福山型筋ジストロフィー治療用アンチセンス核酸
WO2013056670A1 (fr) Petits arn d&#39;interférence, leurs utilisations et procédé destiné à l&#39;inhibition de l&#39;expression du gène plk1
WO2020218494A1 (fr) ACIDE NUCLÉIQUE miR302 MODIFIÉ
BR112021012516A2 (pt) Composições e métodos para inibir a expressão de hmgb1
JP7306653B2 (ja) 構造強化されたＳ－ＴｕＤを用いた新規がん治療法
JP6029147B2 (ja) ｍｉＲＮＡ機能抑制用オリゴヌクレオチド誘導体
WO2015051135A2 (fr) Compositions organiques destinées au traitement de maladies associées à l&#39;hepcidine
WO2018221649A1 (fr) Acides nucléiques suppresseurs de l&#39;expression d&#39;apcs
Caroleo et al. Overview of microrna-based therapeutics
EP4361271A2 (fr) Fusions aptamère-arnic
US9617538B2 (en) Heptamer-type small guide nucleic acids inducing apoptosis of human leukemia cells
US20230151363A1 (en) Modified short-interfering rna compositions and their use in the treatment of cancer
TW202345873A (zh) 調節ｓｃａｐ活性之組合物及方法
KR20240111757A (ko) Apoc3 발현을 조절하기 위한 조성물 및 방법
TW202400193A (zh) 抑制跨膜絲胺酸蛋白酶６（ｔｍｐｒｓｓ６）表現的組成物及方法
CN118043462A (zh) 用于避免脱靶效应的方法和组合物
JP2017012028A (ja) 人工マッチ型ｍｉＲＮＡおよびその用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20794669

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021516252

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20794669

Country of ref document: EP

Kind code of ref document: A1