WO2020172854A1 - Use of endothelial progenitor cells (epcs) in rejuvenating microvasculature, preventing aging and treating age-related diseases - Google Patents

Use of endothelial progenitor cells (epcs) in rejuvenating microvasculature, preventing aging and treating age-related diseases Download PDF

Info

Publication number
WO2020172854A1
WO2020172854A1 PCT/CN2019/076488 CN2019076488W WO2020172854A1 WO 2020172854 A1 WO2020172854 A1 WO 2020172854A1 CN 2019076488 W CN2019076488 W CN 2019076488W WO 2020172854 A1 WO2020172854 A1 WO 2020172854A1
Authority
WO
WIPO (PCT)
Prior art keywords
lmna
mice
epcs
aging
dysfunction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CN2019/076488
Other languages
French (fr)
Other versions
WO2020172854A9 (en
Inventor
Baohua Liu
Shimin Sun
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen University
Original Assignee
Shenzhen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen University filed Critical Shenzhen University
Priority to PCT/CN2019/076488 priority Critical patent/WO2020172854A1/en
Priority to CN201980092741.8A priority patent/CN113498347B/en
Publication of WO2020172854A1 publication Critical patent/WO2020172854A1/en
Publication of WO2020172854A9 publication Critical patent/WO2020172854A9/en
Anticipated expiration legal-status Critical
Priority to US17/461,094 priority patent/US20220031762A1/en
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48Reproductive organs
    • A61K35/51Umbilical cord; Umbilical cord blood; Umbilical stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/44Vessels; Vascular smooth muscle cells; Endothelial cells; Endothelial progenitor cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/069Vascular Endothelial cells
    • C12N5/0692Stem cells; Progenitor cells; Precursor cells

Definitions

  • the present invention relates to endothelial progenitor cells (EPCs) and their role in preventing aging, extending lifespan and treating age-related diseases.
  • the present invention relates to use of endothelial progenitor cells in clinical progeria treatment.
  • the blood vessel consists of the tunica intima (composed of endothelial cells; ECs) , the tunica media (composed of vascular smooth muscle cells; VSMCs) and the tunica adventitia (consisting of connective tissue) (Tian and Li, 2014) .
  • the endothelium separates the vessel wall from the blood flow and has an irreplaceable role in regulating vascular tone and homeostasis (Brandes et al., 2005; Hadi et al., 2005) .
  • ECs secrete various vasodilators and vasoconstrictors that act on VSMCs and induce blood-vessel contraction and relaxation (Ignarro et al., 2001) .
  • nitric oxide (NO) is synthesized from L-arginine by endothelial NO synthase (eNOS) in ECs and is released on VSMCs to induce blood-vessel relaxation (Cheang et al., 2014) .
  • HGPS Hutchinson-Gilford progeria syndrome
  • G608G mutation in LMNA gene which activates an alternate splicing event and generates a 50-amino-acid-truncated form of lamin A, referred to as progerin (Scaffidi and Misteli, 2006) .
  • the murine Lmna G609G which is equivalent to LMNA G608G in humans, causes aging phenotypes resembling HGPS (Osorio et al., 2011) .
  • progerin targets SMCs and causes blood vessel calcification and atherosclerosis (Liu et al., 2011; Liu et al., 2013; McClintock et al., 2006; Ragnauth et al., 2010; Varga et al., 2006; Zhang et al., 2011) .
  • SMC-specific progerin knock-in mice are healthy and have a normal lifespan, but suffer from blood-vessel calcification, atherosclerosis and shortened lifespan when crossed to Apoe-/-mice (Hamczyk et al., 2018; Kim et al., 2018) .
  • VE vascular endothelium
  • Endothelial progenitor cells mainly exist in the bone marrow (Hill et al., 2003; Williamson et al., 2012) .
  • cytokines and growth factors such as VEGF, SDF-1, G-CSF and estrogen, mobilize EPCs to the peripheral circulation.
  • the EPCs then seed at the injury site and promote repair via neovascularization (Ghebre et al., 2016; Hill et al., 2003) .
  • An age-related decline in the number and function of EPCs is a main reason for decreased VE repair capacity (Dantas et al., 2012; Moriya and Minamino, 2017; Williamson et al., 2012) .
  • Progeria models exhibit depleted stem cells, including mesenchymal stem cells (MSCs) , epithelial stem cells, muscular stem cells and hematopoietic stem cells (HSCs) (Espada et al., 2008; Liu et al., 2011; Scaffidi and Misteli, 2008; Song et al., 2013) . Questions remain as to whether EPCs also decline in progeria and if so, whether this decline causally accelerates aging. To address these issues, we generated a conditional progerin (Lmna G609G ) knock-in (KI) model, i.e. Lmna f/f mice. In combination with E2A-Cre and Tie2-Cre mice, we aimed to investigate the roles of the VE dysfunction and the EPCs to systemic aging.
  • MSCs mesenchymal stem cells
  • HSCs hematopoietic stem cells
  • vascular dysfunction is one of the typical characteristics of aging, but its contributing roles to systemic aging is lacking experimental evidence. Accumulating data suggest that mechanisms underlying aging are similar to those governing Hutchinson-Gilford progeria syndrome (HGPS) , a premature aging syndrome in which affected patients typically succumb to cardiovascular diseases (CVDs) .
  • HGPS Hutchinson-Gilford progeria syndrome
  • CVDs cardiovascular diseases
  • HGPS Hutchinson-Gilford progeria syndrome
  • CVDs cardiovascular diseases
  • endothelial-specific dysfunction shortens lifespan in Lmna f/f ; TC mice.
  • MLECs murine lung endothelial cells
  • FACS analysis and neovascularization assay we observed that the number and function of EPCs in the bone marrow decline in Lmna f/f ; TC mice compared to Lmna f/f control mice.
  • Replenishing wild-type EPCs rejuvenates neovascularization capacity, ameliorates aging features and extends lifespan in progeria mice.
  • the present invention provides use of endothelial progenitor cells (EPCs) in the manufacture of a medicament for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases.
  • EPCs endothelial progenitor cells
  • the age-related diseases are cardiovascular diseases and/or osteoporosis. More preferably, the cardiovascular diseases are atherosclerosis and/or heart failure.
  • the present invention provides a method for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases, comprising administering a pharmaceutically effective amount of EPCs to a subject in need thereof.
  • the age-related diseases are cardiovascular diseases and/or osteoporosis. More preferably, the cardiovascular diseases are atherosclerosis and/or heart failure.
  • Figure 1 shows single-cell transcriptomic profiles of CD31 + MLECs.
  • t-SNE projection of CD31 + cells revealed four clusters: endothelial cells (ECs) , B lymphocytes (B-like) , T lymphocytes (T-like) and Macrophages (M -like) .
  • C Marker gene expression in the four clusters: ECs (Cd31, Cd34, Cdh5) , B-like (Ly6d, Cd22, Cd81) , T-like (Cd3d, Cd3e, Cd28) and M -like (Cd14, Cd68, Cd282) .
  • Figure 2 shows that single-cell transcriptomic analysis indicates an inflammatory response and cardiac dysfunction in progeroid ECs.
  • B-D GO and KEGG pathway enrichment of differentially expressed genes between G609G and Flox cells.
  • Lmna G609G/G609G MLECs show enrichment in genes that regulate the inflammatory response (C) and genes related to heart dysfunction (D) .
  • Figure 3 shows endothelial-specific dysfunction in progeria mice.
  • Figure 4 shows reduced capillary density and defective neovascularization.
  • Figure 5 shows systemic aging phenotypes in Lmna f/f ; TC mice.
  • A-C Masson trichrome staining showing an atheromatous plaque in the aorta (A) , smooth muscle cell loss (B) and cardiac fibrosis (C) in Lmna f/f ; TC mice. Scale bar, 20 ⁇ m.
  • Heart weight and echocardiographic parameters including heart rate, cardiac output, left ventricular (LV) ejection fraction and LV ejection shortening.
  • FIG. 6 shows that EPCs rejuvenate the microvasculature and extend lifespan in progeria mice.
  • G-H Representative immunofluorescence images of the liver (G) , aorta (H) , muscle (I) and lung (J) of Lmna f/f ; TC mice after EPC therapy, showing ECs that have differentiated from rosa26-rainbow EPCs. Scale bar, 15 ⁇ m.
  • Figure 7 shows generation of Lmna f/f mice and phenotypic analysis of Lmna G609G/G609G mice.
  • Figure 8 shows single cell transcriptomic analysis of CD31 + MLECs.
  • Figure 9 shows VE-specific progerin expression.
  • A-B Progerin and CD31 expression was detected by immunofluorescence staining in aorta (A) and muscle (B) tissue of Lmna f/f ; TC and Lmna f/f mice.
  • Figure 10 shows vasodilation analysis of Lmna G609G/+ mice.
  • ACh Acetylcholine
  • SNP sodium nitroprusside
  • Figure 11 shows the expression of atherosclerosis-associated and osteoporosis-associated genes in MLEC transcriptomes.
  • Figure 12 shows CD133 + Endothelial progenitor cells labeled with Dil-acLDL and UEA. The nuclei were counterstained with DAPI. Scale bar, 50 ⁇ m.
  • Figure 13 shows comparison of expression levels of genes that are associated with atherosclerosis, arthritis, heart failure, osteoporosis and amyotrophy in different clusters of cells recovered from the single-cell RNA sequencing.
  • the present invention provides use of endothelial progenitor cells (EPCs) in the manufacture of a medicament for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases, more preferably atherosclerosis and/or heart failure.
  • EPCs endothelial progenitor cells
  • the EPCs are CD133 + EPCs.
  • the age-related diseases are characterized by vascular endothelium (VE) dysfunction.
  • VE vascular endothelium
  • the VE dysfunction includes a loss of endothelial cells, reduced capillary density and defective neovascularization capacity.
  • the VE dysfunction is caused by progerin.
  • the present invention also provides a method for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases, comprising administering a pharmaceutically effective amount of EPCs to a subject in need thereof; preferably, the age-related diseases are cardiovascular diseases and/or osteoporosis, more preferably atherosclerosis and/or heart failure.
  • the EPCs are CD133 + EPCs.
  • the age-related diseases are characterized by vascular endothelium (VE) dysfunction.
  • VE vascular endothelium
  • the VE dysfunction includes a loss of endothelial cells, reduced capillary density and defective neovascularization capacity.
  • the VE dysfunction is caused by progerin.
  • Lmna f/f alleles (Lmna G609G flanked by 2 loxP sites) were generated accordingly.
  • the 5’ and 3’ homology arms were amplified from BAC clones RP23-21K15 and RP23-174J9, respectively.
  • the G609G (GGC to GGT) mutation was introduced into exon 11 in the 3’ homology arm.
  • C57BL/6 embryonic stem cells were used for gene targeting.
  • Lmna f/f mice were bred with E2A-Cre mice.
  • VE-specific progerin expression Lmna f/f mice were bred with Tie2-cre mice. Mice were purchased from Cyagen Biosciences Inc., China, housed and handled in accordance with protocols approved by the Committee on the Use of Live Animals in Teaching and Research of Shenzhen University, China.
  • mice Four months old male mice were anesthetized with 4%chloral hydrate (0.20 ml/20 g) by intraperitoneal injection.
  • Hind limb ischemia was performed by unilateral femoral artery ligation and excision, as previously described (Limlaub et al., 2009) .
  • the neurovascular pedicle was visualized under a light microscope following a 1-cm incision in the skin of the left hind limb.
  • Ligations were made in the left femoral artery proximal to the superficial epigastric artery branch and anterior to the saphenous artery. Then, the femoral artery and the attached branches between ligations were excised.
  • the skin was closed using a 4-0 suture line and erythromycin ointment was applied to prevent wound infection after surgery.
  • Recovery of the blood flow was evaluated before and after surgery using a dynamic microcirculation imaging system (Teksqray, Shenzhen, China) . Relative blood flow recovery is expressed as the ischemia to non-ischemia ratio. At least three mice were included in each experimental group.
  • HEK293 cells and human umbilical vein endothelial cells were purchased from ATCC.
  • HEK293 cells were cultured in DMEM (Life Technologies, USA) supplemented with 10%fetal bovine serum (FBS) at 37°C, 5%CO 2 .
  • HUVECs were cultured in M199 (Life Technologies, USA) supplemented with 15%FBS, 50 ⁇ g/ml endothelial cell growth supplement (ECGS) and 100 ⁇ g/ml heparin at 37°C, 5%CO 2 . All cell lines used were authenticated by short tandem repeat (STR) profile analysis and were mycoplasma free.
  • STR short tandem repeat
  • Aorta, skeletal muscle and liver tissues were collected from Lmna G609G/G609G , Lmna +/+ , Lmna f/f ; TC and Lmna f/f mice.
  • Frozen sections were prepared and fixed in 4%PFA, permeabilized with 0.3%Triton X-100, blocked with 5%BSA and 1%goat serum, and then incubated with primary antibodies at room temperature for 2 h or at 4°C overnight. After three washes with PBST, the sections were incubated with secondary antibodies for 1 h at room temperature and then stained with DAPI anti-fade mounting medium. Images were captured under a Zeiss LSM880 confocal microscope. All antibodies are listed in Table 2.
  • Paraffin-embedded sections of PFA-fixed tissues were dewaxed and hydrated. Staining was then performed using a Masson trichrome staining kit (Beyotime, China) . In brief, the sections were dipped in Bouin buffer for 2 h at 37°C, and then successively stained with Celestite blue staining solution, Hematoxylin staining solution, Ponceau’s staining solution and Aniline blue solution for 3 minutes. After dehydrating with ethyl alcohol three times, the sections were mounted with Neutral Balsam Mounting Medium (BBI Life Science, China) . Images were captured under a Zeiss LSM880 confocal microscope.
  • mice were sacrificed by decapitation.
  • the lungs were then collected, cut into small pieces and then digested with collagenase I (200 U/ml) and neutral protease (0.565 mg/ml) for 1 h at 37°C.
  • the isolated cells were incubated with PE-conjugated anti CD31 antibody for 1 h at 4°C and then 7-AAD (1: 100) for 5 min.
  • CD31-positive and 7-AAD-negative cells were sorted on a flow cytometer (BD biosciences, USA) .
  • mice Four months old male mice were anesthetized with 4%chloral hydrate by intraperitoneal injection. Thoracic aortas were collected, rinsed in ice-cold Krebs solution and cut into 2 mm-length rings. Each aorta ring was bathed in 5 ml oxygenated (95%O 2 and 5%CO 2 ) Krebs solution at 37°C for 30 min in a myograph chamber (620M, Danish Myo Technology) . Each ring was stretched in a stepwise fashion to the optimal resting tension (thoracic aortas to ⁇ 9 mN) and equilibrated for 30 min.
  • a cytokine assay for mice or human samples was performed according to the manufacturer’s instructions. Briefly, membranes were incubated in blocking buffer for 30 min at room temperature. The samples prepared from serum or cell lysates were added to each membrane and incubated for 4 h at room temperature. After three washes with buffer 1 and two washes with buffer 2, the membranes were reacted with a biotinylated antibody cocktail at 4°C overnight. After incubation with 1000 ⁇ HRP-Streptavidin for 2 h, the membranes were again washed three times with buffer 1 and two times with buffer 2 and then visualized using a Bio-Rad detection system. At least three mice were included in each experimental group.
  • mice 7-8 months old male mice were anesthetized by isoflurane gas inhalation and then subjected to transthoracic echocardiography (IU22, Philips) .
  • Parameters including heart rate, cardiac output, left ventricular posterior wall dimension (LVPWD) , left ventricular end-diastolic dimension (LVEDD) , left ventricular end-systolic diameter (LVESD) , LV ejection fraction and LV fractional shortening were acquired. At least three mice were included in each experimental group.
  • mice 7-8 months old male mice were sacrificed by decapitation. The thigh bone was fixed in 4%PFA at 4°C overnight. The relevant data were collected by micro-CT (Scanco Medical, ⁇ CT100) . At least three mice were included in each experimental group.
  • mice were placed on the rotating lane and the speed of the rotations gradually increased to 40 r/min. When the mice were exhausted, they were safely dropped from the rotating lane and the latency to fall was recorded. At least three mice were included in each experimental group.
  • CD31 + cells isolated from murine lung by FACS were used for single-cell RNA sequencing.
  • a sequence library was built according to the Chromium Single Cell Instrument library protocol (Neal et al., 2018) . Briefly, single-cell RNAs were barcoded and reverse-transcribed using Chromium TM Single Cell 3’ Reagent Kits v2, then fragmented and amplified to generate cDNAs. The cDNAs were quantified using an Agilent Bioanalyzer 2100 DNA Chip, and the library was sequenced using an Illumina Hiseq PE150 with ⁇ 10-30M raw data assigned for each cell.
  • the reads were mapped to the mouse mm9 genome and analyzed using STAR: >90%reads mapped confidently to genomic regions and >50%mapped to exonic regions.
  • Cell Ranger 2.1.0 was employed to align reads, generate feature-barcode matrices and perform clustering and gene expression analysis. >80,000 mean reads and 900 median genes per cell were obtained.
  • the UMI (unique molecular identifier) counts were used to quantify the gene expression levels and the t-SNE algorithm was used for dimensionality reduction.
  • the Log2FoldChange was the ratio of gene expression of one cluster to that of all other cells.
  • the p-value was calculated using the negative binomial test and the false discovery rate was determined by Benjamini-Hochberg procedure. GO and KEGG enrichment analysis were performed in DAVID version 6.8. (Huang da et al., 2009)
  • mice 3 months old male mice were sacrificed by decapitation.
  • the femora and tibiae were separated and placed in a 0.5 ml micro-centrifuge tube which had a hole drilled in the bottom.
  • a 1.5 ml micro-centrifuge tube was used to nest the 0.5 ml tube and the pair of tubes was centrifuged at 10,000 ⁇ g for 15 sec.
  • the bone marrow was suspended in 1 ml red blood cell lysis buffer at room temperature for 5 min, and the suspension was strained successively through a 75- ⁇ m and then 40- ⁇ m cell strainer ( USA) .
  • mice After centrifugation at 300 ⁇ g at 4°C for 5 min, the cells were suspended in 500 ⁇ l MACS buffer and incubated with 5 ⁇ l anti-CD133 antibody (Miltenyi Biotec, Germany) for 10 min. After incubating with 20 ⁇ l beads (Miltenyi Biotec, Germany) in 80 ⁇ l MACS buffer, CD133 + progenitor cells were obtained by magnetic selection. At least three mice were included in each experimental group.
  • Single-cell transcriptomic analysis reveals four predominant cell clusters in CD31 + murine lung endothelial cells (MLECs)
  • Lmna f/f mice were crossed to E2A-Cre mice, in which Cre recombinase is ubiquitously expressed including germ cells, to generate Lmna G609G/G609G mice.
  • Progerin was ubiquitously expressed in these Lmna G609G/G609G mice, which recapitulated many progeroid features found in HGPS, including growth retardation and shortened lifespan etc. ( Figure 7B-D) .
  • CD31 + MLECs Longchamp et al., 2018
  • G609G Lmna G609G/G609G
  • Flox Lmna f/f
  • Progeroid ECs exhibit a systemic inflammatory response
  • VE dysfunction promotes vasodilation defects in progeria mice
  • progerin was only observed in the VE of Lmna f/f ; TC but not Lmna f/f control mice or other tissues ( Figure 9) .
  • VE-specific progerin induced intima-media thickening in Lmna f/f ; TC mice, in a similar manner as Lmna G609G/G609G mice ( Figure 3A-B) .
  • Ach-induced thoracic aorta relaxation was significantly compromised in Lmna f/f ; TC mice ( Figure 3C) .
  • Progeria mice show defective neovascularization following ischemia
  • Endothelial dysfunction is a causal factor of systemic aging
  • the heart/body weight ratio was significantly increased in Lmna f/f ; TC compared to Lmna f/f control mice ( Figure 5D) .
  • Echocardiography confirmed that the heart rate and cardiac output were significantly reduced in 7-8-month old Lmna f/f ; TC compared to Lmna f/f control mice.
  • Both the left ventricular ejection fraction (LVEF) and fractional shortening (LVFS) were below the normal values of healthy mice, which are 54%and 28%respectively..
  • LVEF left ventricular ejection fraction
  • LVFS fractional shortening
  • micro-computed tomography identified a decrease in trabecular bone volume/tissue volume (BV/TV) , trabecular number (Tb. N) and trabecular thickness (Tb. Th) , but an increase of trabecular separation (Tb. Sp) in Lmna f/f ; TC mice ( Figure 5F) , indicative of osteoporosis, which is also a hallmark of aging (Chen et al., 2013) .
  • endothelial dysfunction at least in the context of progeria, acts as a causal factor of systemic aging.
  • EPCs rejuvenate the microvasculature, ameliorate aging and extend lifespan
  • the VE-specific dysfunction not only accelerated aging in various tissues/organs, but also shortened the median lifespan in Lmna f/f ; TC mice (24 weeks) , to a similar extent as Lmna G609G/G609G mice (21 weeks) (Figure 6A) .
  • Lmna G609G/G609G mice suffered from body-weight loss from 8 weeks of age Lmna f/f ; TC mice only showed a slight drop in body weight (Figure 6B) .
  • CD133 + mononuclear cells are enriched in the bone marrow and are potential EPCs that are essential for vascular hemostasis (Ghebre et al., 2016; Hill et al., 2003) .
  • EPCs have a causal role in accelerating aging and shortening lifespan in progeria mice.
  • MACS Magnetic-activated cell sorting
  • Donor-derived ECs were detected by fluorescence microscopy in the liver, muscle, aorta and lung ( Figure 6G-J, tdTomato labeled) .
  • Capillary density CD31 + gastrocnemius muscle
  • EPC-treated 581.5 ⁇ 85.6
  • age-related body-weight loss was significantly attenuated upon EPC therapy in Lmna G609G/G609G mice ( Figure 6B)
  • the median lifespan was extended from 21 to 27 weeks ( Figure 6A) .
  • a reduced systemic inflammatory response was confirmed by an antibody array detecting protein factors in the blood serum ( Figure 12) .
  • endothelial dysfunction is a conspicuous marker for vascular aging and CVDs (Cui et al., 2014; de la Sierra and Larrousse, 2010; Liu et al., 2017) . Whether endothelial dysfunction primarily triggers organismal aging, however, is elusive.
  • the murine Lmna G609G mutation equivalent to the LMNA G608G found in humans with HGPS, causes premature aging phenotypes in various tissues/organs, thus providing an ideal model for studying aging mechanisms at both the tissue and organismal level.
  • VE dysfunction is the vascular cell heterogeneity and the lack of appropriate in vitro system for ECs.
  • FACS single-cell RNA sequencing technique
  • MLECs isolated by CD31-immunofluorescence labeling turned out to be a mixture of cells, including ECs, T-like, B-like and M -like cells. It is unclear whether these cells are T cells, B cells and M cells that express low level of CD31 (Bantikassegn et al., 2015) , or are transdifferentiated from ECs.
  • various drugs clinically used to treat CVDs can mobilize EPCs from the bone marrow to peripheral circulation and enhance endothelial repair.
  • statins and PPAR ⁇ agonists can mobilize EPCs from the bone marrow to peripheral circulation and enhance endothelial repair.
  • PPAR ⁇ agonists can mobilize EPCs from the bone marrow to peripheral circulation and enhance endothelial repair.
  • VE dysfunction is a trigger of systemic aging and is also a risk factor for age-related diseases like atherosclerosis, heart failure and osteoporosis. It suggests that many clinically used drugs and molecules that target VE might serve as good candidates in the treatment of age-related diseases other than CVDs. Likewise, the findings in EPCs implicate great potentials of stem-cell-based therapeutic strategy for progeria as well as in anti-aging applications.
  • Metformin protects endothelial function in diet-induced obese mice by inhibition of endoplasmic reticulum stress through 5' adenosine monophosphate-activated protein kinase-peroxisome proliferator-activated receptor delta pathway. Arterioscler Thromb Vasc Biol 34, 830-836.
  • Tie2-Cre transgenic mice a new model for endothelial cell-lineage analysis in vivo. Dev Biol 230, 230-242.
  • Prelamin A accelerates vascular calcification via activation of the DNA damage response and senescence-associated secretory phenotype in vascular smooth muscle cells. Circ Res 112, e99-109.
  • Hutchinson-Gilford progeria mutant lamin A primarily targets human vascular cells as detected by an anti-Lamin A G608G antibody. Proc Natl Acad Sci U S A 103, 2154-2159.
  • Prelamin A acts to accelerate smooth muscle cell senescence and is a novel biomarker of human vascular aging. Circulation 121, 2200-2210.
  • Muscle-derived stem/progenitor cell dysfunction in Zmpste24-deficient progeroid mice limits muscle regeneration.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Vascular Medicine (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Reproductive Health (AREA)
  • Cardiology (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Disclosed are endothelial progenitor cells (EPCs), their role in preventing aging, extending lifespan and treating age-related diseases, and in particular, the use of endothelial progenitor cells in clinical progeria treatment.

Description

Use of endothelial progenitor cells (EPCs) in rejuvenating the microvasculature, preventing aging and treating age-related diseases Technical Field
The present invention relates to endothelial progenitor cells (EPCs) and their role in preventing aging, extending lifespan and treating age-related diseases. In particular, the present invention relates to use of endothelial progenitor cells in clinical progeria treatment.
Background
Aging represents the largest risk factor for many age-related diseases, as exemplified by vascular dysfunction and cardiovascular diseases (CVDs) (Le Couteur and Lakatta, 2010) . The blood vessel consists of the tunica intima (composed of endothelial cells; ECs) , the tunica media (composed of vascular smooth muscle cells; VSMCs) and the tunica adventitia (consisting of connective tissue) (Tian and Li, 2014) . The endothelium separates the vessel wall from the blood flow and has an irreplaceable role in regulating vascular tone and homeostasis (Brandes et al., 2005; Hadi et al., 2005) . Age-related functional decline in ECs and VSMCs is a main cause of CVDs (Brandes et al., 2005; Ghebre et al., 2016; Tao et al., 2004) . ECs secrete various vasodilators and vasoconstrictors that act on VSMCs and induce blood-vessel contraction and relaxation (Ignarro et al., 2001) . For instance, nitric oxide (NO) is synthesized from L-arginine by endothelial NO synthase (eNOS) in ECs and is released on VSMCs to induce blood-vessel relaxation (Cheang et al., 2014) . When ECs become senescent or dysfunctional, vasoconstrictive, pro-coagulative and pro-inflammatory cytokines are released; this effect reduces NO bioavailability and in turn increases vascular intimal permeability and EC migration (Li et al., 2017) . Despite advances in the understanding of the mechanisms of endothelial dysfunction, it is unclear whether it directly triggers organismal aging.
Accumulating data suggest that the mechanisms underlying normal aging are similar to those governing Hutchinson-Gilford progeria syndrome (HGPS) –a premature aging syndrome in which affected patients typically succumb to CVDs (Cao et al.,  2011; De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003; Liu et al., 2012; McClintock et al., 2007; Scaffidi and Misteli, 2006) . HGPS is predominantly caused by an a c. 1824 C > T, p. G608G mutation in LMNA gene, which activates an alternate splicing event and generates a 50-amino-acid-truncated form of lamin A, referred to as progerin (Scaffidi and Misteli, 2006) . The murine Lmna G609G, which is equivalent to LMNA G608G in humans, causes aging phenotypes resembling HGPS (Osorio et al., 2011) . It has been shown that progerin targets SMCs and causes blood vessel calcification and atherosclerosis (Liu et al., 2011; Liu et al., 2013; McClintock et al., 2006; Ragnauth et al., 2010; Varga et al., 2006; Zhang et al., 2011) . Recent work by two groups showed that SMC-specific progerin knock-in mice are healthy and have a normal lifespan, but suffer from blood-vessel calcification, atherosclerosis and shortened lifespan when crossed to Apoe-/-mice (Hamczyk et al., 2018; Kim et al., 2018) . In contrast to SMCs, the contributing roles of the vascular endothelium (VE) to systemic/organismal aging are elusive.
Endothelial progenitor cells (EPCs) mainly exist in the bone marrow (Hill et al., 2003; Williamson et al., 2012) . Upon VE injury, cytokines and growth factors, such as VEGF, SDF-1, G-CSF and estrogen, mobilize EPCs to the peripheral circulation. The EPCs then seed at the injury site and promote repair via neovascularization (Ghebre et al., 2016; Hill et al., 2003) . An age-related decline in the number and function of EPCs is a main reason for decreased VE repair capacity (Dantas et al., 2012; Moriya and Minamino, 2017; Williamson et al., 2012) . Progeria models exhibit depleted stem cells, including mesenchymal stem cells (MSCs) , epithelial stem cells, muscular stem cells and hematopoietic stem cells (HSCs) (Espada et al., 2008; Liu et al., 2011; Scaffidi and Misteli, 2008; Song et al., 2013) . Questions remain as to whether EPCs also decline in progeria and if so, whether this decline causally accelerates aging. To address these issues, we generated a conditional progerin (Lmna G609G) knock-in (KI) model, i.e. Lmna f/f mice. In combination with E2A-Cre and Tie2-Cre mice, we aimed to investigate the roles of the VE dysfunction and the EPCs to systemic aging.
Summary of the Invention
Vascular dysfunction is one of the typical characteristics of aging, but its contributing  roles to systemic aging is lacking experimental evidence. Accumulating data suggest that mechanisms underlying aging are similar to those governing Hutchinson-Gilford progeria syndrome (HGPS) , a premature aging syndrome in which affected patients typically succumb to cardiovascular diseases (CVDs) . Here, we generated a knock-in mouse model with the causative HGPS Lmna G609G mutation. Using the Lmna f/f and Tie2-Cre mice, we showed that endothelial-specific dysfunction compromises the microvasculature and neovascularization and accelerates aging in multiple tissues/organs. Most importantly, endothelial-specific dysfunction shortens lifespan in Lmna f/f; TC mice. Mechanistically, single-cell transcriptomic analysis of murine lung endothelial cells (MLECs) revealed a significant up-regulation of genes that regulate inflammation including Il6, Il8, Il15, Cxcl1 and Il1α etc. Further determined by FACS analysis and neovascularization assay, we observed that the number and function of EPCs in the bone marrow decline in Lmna f/f; TC mice compared to Lmna f/f control mice. Replenishing wild-type EPCs rejuvenates neovascularization capacity, ameliorates aging features and extends lifespan in progeria mice. These data reveal that endothelial dysfunction triggers systemic aging and highlight EPC therapy as a potential anti-aging strategy and clinical progeria treatment.
In one aspect, the present invention provides use of endothelial progenitor cells (EPCs) in the manufacture of a medicament for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases. Preferably, the age-related diseases are cardiovascular diseases and/or osteoporosis. More preferably, the cardiovascular diseases are atherosclerosis and/or heart failure.
In another aspect, the present invention provides a method for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases, comprising administering a pharmaceutically effective amount of EPCs to a subject in need thereof. Preferably, the age-related diseases are cardiovascular diseases and/or osteoporosis. More preferably, the cardiovascular diseases are atherosclerosis and/or  heart failure.
Description of the Figures
Figure 1 shows single-cell transcriptomic profiles of CD31 + MLECs.
(A) Purity analysis of sorted CD31 + MLECs by FACS.
(B) t-SNE projection of CD31 + cells revealed four clusters: endothelial cells (ECs) , B lymphocytes (B-like) , T lymphocytes (T-like) and Macrophages (M
Figure PCTCN2019076488-appb-000001
-like) .
(C) Marker gene expression in the four clusters: ECs (Cd31, Cd34, Cdh5) , B-like (Ly6d, Cd22, Cd81) , T-like (Cd3d, Cd3e, Cd28) and M
Figure PCTCN2019076488-appb-000002
-like (Cd14, Cd68, Cd282) .
(D) Heatmap showing marker gene expression levels in E2A and Flox mice.
Figure 2 shows that single-cell transcriptomic analysis indicates an inflammatory response and cardiac dysfunction in progeroid ECs.
(A) t-SNE projection of Lmna G609G/G609G (G609G) and Lmna f/f (Flox) CD31 + MLECs, according to transcriptomic data.
(B-D) GO and KEGG pathway enrichment of differentially expressed genes between G609G and Flox cells. Lmna G609G/G609G MLECs show enrichment in genes that regulate the inflammatory response (C) and genes related to heart dysfunction (D) .
(E) Quantitative PCR analysis of altered genes observed in (C) and (D) in human umbilical vein endothelial cells (HUVECs) with ectopic expression of progerin or wild type LMNA. Data represent the means ± s.e.m. *P < 0.05, *P < 0.01, *P < 0.001 (Student’s t test) .
Figure 3 shows endothelial-specific dysfunction in progeria mice.
(A, B) H&E staining of thoracic aorta sections from (A) Lmna f/f; TC and (B) Lmna G609G/G609G and Lmna f/f control mice showing intima-media thickening. Scale bar, 20 μm.
(C) Acetylcholine (ACh) -induced thoracic aorta vasodilation in Lmna f/f; TC and Lmna f/f control mice. **P < 0.01.
(D) ACh-induced thoracic aorta vasodilation in Lmna G609G/G609G and control mice. **P < 0.01.
(E) Sodium nitroprusside (SNP) -induced thoracic aorta vasodilation in Lmna G609G/G609G and control mice.
(E) eNOS level in thoracic aorta sections from Lmna f/f; TC and control mice. Scale bar, 20 μm.
All data represent the means ± s.e.m. P values were calculated by Student’s t test.
Figure 4 shows reduced capillary density and defective neovascularization.
(A) Immunofluorescence staining (left) and quantification (right) of CD31 + gastrocnemius muscle in Lmna f/f; TC and Lmna f/f mice. Scale bar, 50 μm.
(B) CD31 immunofluorescent staining in Lmna f/f; TC and Lmna f/f liver. Scale bar, 50 μm.
(C) Representative microcirculation images (left) and quantification of blood flow recovery (right) following hind limb ischemia in Lmna f/f; TC and Lmna f/f mice.
(D) Representative transverse sections and quantification of CD31 + gastrocnemius muscle 14 days after femoral artery ligation. Scale bar, 50 μm.
All data represent the means ± s.e.m. P values were calculated by Student’s t test.
Figure 5 shows systemic aging phenotypes in Lmna f/f; TC mice.
(A-C) Masson trichrome staining showing an atheromatous plaque in the aorta (A) , smooth muscle cell loss (B) and cardiac fibrosis (C) in Lmna f/f; TC mice. Scale bar, 20 μm.
(D) Heart weight and echocardiographic parameters, including heart rate, cardiac output, left ventricular (LV) ejection fraction and LV ejection shortening.
(E) Decreased running endurance in Lmna f/f; TC mice.
(F) Micro-CT analysis showing a decrease in trabecular bone volume/tissue volume (BV/TV) , trabecular number (Tb. N) and trabecular thickness (Tb. Th) , and an increase in trabecular separation (Tb. Sp) in Lmna f/f; TC mice.
All data represent the means ± s.e.m. P values were calculated by Student’s t test.
Figure 6 shows that EPCs rejuvenate the microvasculature and extend lifespan in progeria mice.
(A) Lifespan of EPC-treated and untreated Lmna G609G/G609G mice, Lmna f/f; TC and Lmna f/f mice.
(B) Body weight of EPC-treated and untreated Lmna G609G/G609G mice, Lmna f/f; TC and Lmna f/f mice. *P < 0.05.
(C) Percent CD133 + EPCs in Lmna f/f; TC and Lmna f/f mice.
(D) Neovascularization assay of CD133 + EPCs derived from Lmna f/f; TC and Lmna f/f mice in mice with hind limb ischemia.
(E) EPCs from rosa26-rainbow mice rescue hind limb ischemia in Lmna f/f; TC mice.
(F) Representative immunofluorescence image showing ECs that have differentiated from rosa26-rainbow EPCs. Scale bar, 15 μm.
(G-H) Representative immunofluorescence images of the liver (G) , aorta (H) , muscle (I) and lung (J) of Lmna f/f; TC mice after EPC therapy, showing ECs that have differentiated from rosa26-rainbow EPCs. Scale bar, 15 μm.
All data represent the means ± s.e.m. P values were calculated by Student’s t test.
Figure 7 shows generation of Lmna f/f mice and phenotypic analysis of Lmna G609G/G609G mice.
(A) Schematic illustration of knock-in strategy of Lmna f/f mice harboring Lmna G609G mutation (Lmna 1827C>T)
(B) Representative photo of Lmna G609G/G609G mice and Lmna f/f control mice.
(C) Representative immunoblot showing Lamin A, Progerin and Lamin A expression in Lmna G609G/+, Lmna G609G/G609G and Lmna +/+ control mice.
(D) Lifespan determination of Lmna G609G/+, Lmna G609G/G609G and Lmna +/+ mice.
Figure 8 shows single cell transcriptomic analysis of CD31 + MLECs.
(A) p21 Cip/Waf1 mRNA levels in Lmna G609G/G609G (G609G) and Lmna f/f (Flox) CD31 + MLECs. p21 Cip/Waf1 was elevated specifically in ECs and MΦ-like cells isolated from G609G mice.
(B) Cd45 and Tie2 levels in G609G and Flox CD31 + MLECs. Cd45 expression was lacking in ECs and Tie2 expression was EC-specific.
Figure 9 shows VE-specific progerin expression.
(A-B) Progerin and CD31 expression was detected by immunofluorescence staining in aorta (A) and muscle (B) tissue of Lmna f/f; TC and Lmna f/f mice.
Figure 10 shows vasodilation analysis of Lmna G609G/+ mice.
Acetylcholine (ACh) -induced (left) and sodium nitroprusside (SNP) -induced (right) vasodilation in Lmna G609G/+ and Lmna +/+ control mice.
Figure 11 shows the expression of atherosclerosis-associated and osteoporosis-associated genes in MLEC transcriptomes.
Figure 12 shows CD133 + Endothelial progenitor cells labeled with Dil-acLDL and UEA. The nuclei were counterstained with DAPI. Scale bar, 50 μm.
Figure 13 shows comparison of expression levels of genes that are associated with atherosclerosis, arthritis, heart failure, osteoporosis and amyotrophy in different clusters of cells recovered from the single-cell RNA sequencing.
Particular Embodiments
The present invention provides use of endothelial progenitor cells (EPCs) in the manufacture of a medicament for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases, more preferably atherosclerosis and/or heart failure.
In a specific embodiment, the EPCs are CD133 + EPCs.
In a specific embodiment, the age-related diseases are characterized by vascular endothelium (VE) dysfunction.
In particular, the VE dysfunction includes a loss of endothelial cells, reduced capillary density and defective neovascularization capacity.
More particularly, the VE dysfunction is caused by progerin.
The present invention also provides a method for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or  treating progeria and/or age-related diseases, comprising administering a pharmaceutically effective amount of EPCs to a subject in need thereof; preferably, the age-related diseases are cardiovascular diseases and/or osteoporosis, more preferably atherosclerosis and/or heart failure.
In a specific embodiment, the EPCs are CD133 + EPCs.
In a specific embodiment, the age-related diseases are characterized by vascular endothelium (VE) dysfunction.
In particular, the VE dysfunction includes a loss of endothelial cells, reduced capillary density and defective neovascularization capacity.
More particularly, the VE dysfunction is caused by progerin.
The present invention will be further demonstrated by the following experimental procedures and examples, which are used only for illustration purpose, but not limiting the scope of the present invention.
Experimental procedures
Animals
Lmna f/f alleles (Lmna G609G flanked by 2 loxP sites) were generated accordingly. The 5’ and 3’ homology arms were amplified from BAC clones RP23-21K15 and RP23-174J9, respectively. The G609G (GGC to GGT) mutation was introduced into exon 11 in the 3’ homology arm. C57BL/6 embryonic stem cells were used for gene targeting. To obtain ubiquitous progerin expression (Lmna G609G/G609G) , Lmna f/f mice were bred with E2A-Cre mice. To obtain VE-specific progerin expression, Lmna f/f mice were bred with Tie2-cre mice. Mice were purchased from Cyagen Biosciences Inc., China, housed and handled in accordance with protocols approved by the Committee on the Use of Live Animals in Teaching and Research of Shenzhen University, China.
Hind limb ischemia
Four months old male mice were anesthetized with 4%chloral hydrate (0.20 ml/20 g) by intraperitoneal injection. Hind limb ischemia was performed by unilateral femoral artery ligation and excision, as previously described (Limbourg et al., 2009) . In brief, the neurovascular pedicle was visualized under a light microscope following a 1-cm  incision in the skin of the left hind limb. Ligations were made in the left femoral artery proximal to the superficial epigastric artery branch and anterior to the saphenous artery. Then, the femoral artery and the attached branches between ligations were excised. The skin was closed using a 4-0 suture line and erythromycin ointment was applied to prevent wound infection after surgery. Recovery of the blood flow was evaluated before and after surgery using a dynamic microcirculation imaging system (Teksqray, Shenzhen, China) . Relative blood flow recovery is expressed as the ischemia to non-ischemia ratio. At least three mice were included in each experimental group.
Cell culture
HEK293 cells and human umbilical vein endothelial cells (HUVECs) were purchased from ATCC. HEK293 cells were cultured in
Figure PCTCN2019076488-appb-000003
DMEM (Life Technologies, USA) supplemented with 10%fetal bovine serum (FBS) at 37℃, 5%CO 2. HUVECs were cultured in
Figure PCTCN2019076488-appb-000004
M199 (Life Technologies, USA) supplemented with 15%FBS, 50 μg/ml endothelial cell growth supplement (ECGS) and 100 μg/ml heparin at 37℃, 5%CO 2. All cell lines used were authenticated by short tandem repeat (STR) profile analysis and were mycoplasma free.
RNA isolation and quantitative PCR (Q-PCR) analysis
Total RNA was extracted from cells or mouse tissues using
Figure PCTCN2019076488-appb-000005
reagent RNAiso Plus (Takara, Japan) and transcribed into cDNA using 5 × Primescript RT Master Mix (Takara, Japan) , following the manufacturer’s instructions. The mRNA levels were determined by quantitative PCR with SYBR Premix Ex Taq II (Takara, Japan) detected on a CFX Connected Real-Time PCR Detection System (Bio-Rad) . All primer sequences are listed in Table 1.
Table 1
Targets (Homo) Forward Reverse
hIL15 GCAATGTTCCATCATGTTCC GCCTCCTACAATACAATACGA
hCXCL1 CTGAACAGTGACAAATCCAA GGGGTTGACATTTCAAAAAGAA
hCCL2 TGAGACTAACCCAGAAACATC CTTGAAGATCACAGCTTCTTT
IL1β CATTGCTCAAGTGTCTGAAG TTCATCTGTTTAGGGCCATC
CXCL2 CCAACCATGCATAAAAGGGG GGGGCGCTCCTGCTG
PTGIS AGCTTCCACATTACAGCCCC AGGAGAAGTCGAGGAGACCC
TGFb2 CGAAACTGTCTGCCCAGTTG TGTAGAAAGTGGGCGGGATG
CXCL14 CTAAGATGACCATGCGCCCT AATGCGGCATATACTGGGGG
SERPINE1 GCAAGGCACCTCTGAGAACT GGGTGAGAAAACCACGTTGC
Progerin GTTGAGGACGACGAGGATGAG CAGTTCTGGGGGCTCTGGGCTC
hIL1A TGAGTCAGCAAAGAAGTCAA GATTGGCTTAAACTCAACCG
IL6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG
β-actin AGAGCTAGCTGCCTGAC GGATGCCACAGGACTCCA
Protein extraction and Western blotting
For protein extraction, cells were suspended in SDS lysis buffer and boiled. Then, the lysate was centrifuged at 12,000× g for 2 min and the supernatant was collected. For Western blotting, protein samples were separated on SDS-polyacrylamide gels, transferred to PVDF membranes (Millipore, USA) , blocked with 5%non-fat milk and incubated with the relevant antibodies. Images were acquired on a Bio-Rad system. All antibodies are listed in Table 2.
Table 2
Figure PCTCN2019076488-appb-000006
Figure PCTCN2019076488-appb-000007
Immunofluorescence staining
Aorta, skeletal muscle and liver tissues were collected from Lmna G609G/G609G, Lmna +/+, Lmna f/f; TC and Lmna f/f mice. Frozen sections were prepared and fixed in 4%PFA, permeabilized with 0.3%Triton X-100, blocked with 5%BSA and 1%goat serum, and then incubated with primary antibodies at room temperature for 2 h or at 4℃ overnight. After three washes with PBST, the sections were incubated with secondary antibodies for 1 h at room temperature and then stained with DAPI anti-fade mounting medium. Images were captured under a Zeiss LSM880 confocal microscope. All antibodies are listed in Table 2.
Masson trichrome staining
Paraffin-embedded sections of PFA-fixed tissues were dewaxed and hydrated. Staining was then performed using a Masson trichrome staining kit (Beyotime, China) . In brief, the sections were dipped in Bouin buffer for 2 h at 37℃, and then successively stained with Celestite blue staining solution, Hematoxylin staining solution, Ponceau’s staining solution and Aniline blue solution for 3 minutes. After dehydrating with ethyl alcohol three times, the sections were mounted with Neutral  Balsam Mounting Medium (BBI Life Science, China) . Images were captured under a Zeiss LSM880 confocal microscope.
Fluorescence activated cell sorting (FACS)
Mice were sacrificed by decapitation. The lungs were then collected, cut into small pieces and then digested with collagenase I (200 U/ml) and neutral protease (0.565 mg/ml) for 1 h at 37℃. The isolated cells were incubated with PE-conjugated anti CD31 antibody for 1 h at 4℃ and then 7-AAD (1: 100) for 5 min. CD31-positive and 7-AAD-negative cells were sorted on a flow cytometer (BD biosciences, USA) .
Myography
Four months old male mice were anesthetized with 4%chloral hydrate by intraperitoneal injection. Thoracic aortas were collected, rinsed in ice-cold Krebs solution and cut into 2 mm-length rings. Each aorta ring was bathed in 5 ml oxygenated (95%O 2 and 5%CO 2) Krebs solution at 37℃ for 30 min in a myograph chamber (620M, Danish Myo Technology) . Each ring was stretched in a stepwise fashion to the optimal resting tension (thoracic aortas to ~9 mN) and equilibrated for 30 min. Then, 100 mM K+ Krebs solution was added to the chambers to elicit a reference contraction and then washed out with Krebs solution at 37℃ until achieved a baseline. Vasodilatation induced by acetylcholine (Ach) or sodium nitroprusside (SNP) (1 nM to 100 μM) was recorded in 5-HT (2 μM) contracted rings. Data are represented as a percentage of force reduction and the peak of K+-induced contraction. At least three mice were included in each experimental group.
Mice/Human Cytokine Antibody Array
A cytokine assay for mice or human samples
Figure PCTCN2019076488-appb-000008
was performed according to the manufacturer’s instructions. Briefly, membranes were incubated in blocking buffer for 30 min at room temperature. The samples prepared from serum or cell lysates were added to each membrane and incubated for 4 h at room temperature. After three washes with buffer 1 and two washes with buffer 2, the membranes were reacted with a biotinylated antibody cocktail at 4℃ overnight. After incubation with 1000 × HRP-Streptavidin for 2 h, the membranes were again washed three times with buffer 1 and two times with buffer 2 and then visualized using a Bio-Rad detection system. At least three mice were included in each experimental group.
Echocardiography
7-8 months old male mice were anesthetized by isoflurane gas inhalation and then subjected to transthoracic echocardiography (IU22, Philips) . Parameters, including heart rate, cardiac output, left ventricular posterior wall dimension (LVPWD) , left ventricular end-diastolic dimension (LVEDD) , left ventricular end-systolic diameter (LVESD) , LV ejection fraction and LV fractional shortening were acquired. At least three mice were included in each experimental group.
Bone density analysis
7-8 months old male mice were sacrificed by decapitation. The thigh bone was fixed in 4%PFA at 4℃ overnight. The relevant data were collected by micro-CT (Scanco Medical, μCT100) . At least three mice were included in each experimental group.
Endurance running test
A Rota-Rod Treadmill (YLS-4C, Jinan Yiyan Scientific Research Company, China) was used to monitor fatigue resistance. Briefly, mice were placed on the rotating lane and the speed of the rotations gradually increased to 40 r/min. When the mice were exhausted, they were safely dropped from the rotating lane and the latency to fall was recorded. At least three mice were included in each experimental group.
10 × Genomics single-cell-RNA-sequencing
CD31 + cells isolated from murine lung by FACS (>90%viability) were used for single-cell RNA sequencing. A sequence library was built according to the Chromium Single Cell Instrument library protocol (Neal et al., 2018) . Briefly, single-cell RNAs were barcoded and reverse-transcribed using Chromium TM Single Cell 3’ Reagent Kits v2, then fragmented and amplified to generate cDNAs. The cDNAs were quantified using an Agilent Bioanalyzer 2100 DNA Chip, and the library was  sequenced using an Illumina Hiseq PE150 with ~10-30M raw data assigned for each cell. The reads were mapped to the mouse mm9 genome and analyzed using STAR: >90%reads mapped confidently to genomic regions and >50%mapped to exonic regions. Cell Ranger 2.1.0 was employed to align reads, generate feature-barcode matrices and perform clustering and gene expression analysis. >80,000 mean reads and 900 median genes per cell were obtained. The UMI (unique molecular identifier) counts were used to quantify the gene expression levels and the t-SNE algorithm was used for dimensionality reduction. The cell population was then clustered by k-means clustering (k = 4) . The Log2FoldChange was the ratio of gene expression of one cluster to that of all other cells. The p-value was calculated using the negative binomial test and the false discovery rate was determined by Benjamini-Hochberg procedure. GO and KEGG enrichment analysis were performed in DAVID version 6.8. (Huang da et al., 2009)
Isolation of CD133 + progenitor cells
3 months old male mice were sacrificed by decapitation. The femora and tibiae were separated and placed in a 0.5 ml micro-centrifuge tube which had a hole drilled in the bottom. A 1.5 ml micro-centrifuge tube was used to nest the 0.5 ml tube and the pair of tubes was centrifuged at 10,000×g for 15 sec. The bone marrow was suspended in 1 ml red blood cell lysis buffer at room temperature for 5 min, and the suspension was strained successively through a 75-μm and then 40-μm cell strainer (
Figure PCTCN2019076488-appb-000009
USA) . After centrifugation at 300×g at 4℃ for 5 min, the cells were suspended in 500 μl MACS buffer and incubated with 5 μl anti-CD133 antibody (Miltenyi Biotec, Germany) for 10 min. After incubating with 20 μl beads (Miltenyi Biotec, Germany) in 80 μl MACS buffer, CD133 + progenitor cells were obtained by magnetic selection. At least three mice were included in each experimental group.
Statistical analysis
A two-tailed Student’s t-test was used to determine statistical significance. All data are presented as the means ± s.d. or means ± s.e.m. as indicated, and a p value < 0.05 was considered statistically significant.
Example 1
Single-cell transcriptomic analysis reveals four predominant cell clusters in CD31 + murine lung endothelial cells (MLECs)
An outstanding question in the field of aging is whether endothelial dysfunction causally triggers systemic aging. The heterogeneity of vascular cells and their close communication with the blood stream, however, renders it difficult to understand the primary function of the VE. The murine Lmna G609G mutation, which is equivalent to human LMNA G608G, causes aging phenotypes in various tissues resembling HGPS. To examine the contributing roles of the VE to systemic aging, we generated a mouse model of conditional progerin knock-in, in which the Lmna G609G mutation was flanked with loxP sites, i.e. Lmna f/f mice (Figure 7A) . The Lmna f/f mice were crossed to E2A-Cre mice, in which Cre recombinase is ubiquitously expressed including germ cells, to generate Lmna G609G/G609G mice. Progerin was ubiquitously expressed in these Lmna G609G/G609G mice, which recapitulated many progeroid features found in HGPS, including growth retardation and shortened lifespan etc. (Figure 7B-D) .
To understand the primary alterations in the VE, we isolated CD31 + MLECs (Longchamp et al., 2018) from three pairs of Lmna G609G/G609G (G609G) and Lmna f/f (Flox) control mice by FACS (Figure 1A) and performed 10× Genomics single-cell RNA sequencing. We recovered 6,004 cells (4,137 from G609G and 1,867 from Flox mice) and used the k means clustering algorithm to cluster the cells into four groups (Figure 1B) . As expected, one group exhibited high Cd31, Cd34 and Cdh5 expression, and thus largely represented MLECs. The other three groups, co-purified with CD31 +MLECs by FACS, showed relatively lower Cd31 expression (>10-fold lower than MLECs) but high Cd45 expression (Figure 8) . Further analysis revealed that these clusters most likely contained B lymphocytes (B-like) , with high Cd22, Cd81 and Ly6d expression; T lymphocytes (T-like) with high Cd3d, Cd3e and Cd28 expression; and Macrophages (M
Figure PCTCN2019076488-appb-000010
-like) with high Cd14, Cd68 and Cd282 expression (Figure 1C) . Most of the marker-gene expression levels were comparable between G609G and Flox mice, except for Cd34 and Icam1, which were significantly elevated in G609G ECs, and Cd14 and Vcam1, which were increased in G609G M
Figure PCTCN2019076488-appb-000011
-like cells (Figure  1D) . Of note, Icam1 and Vcam1 are among the most conserved markers of endothelial senescence and atherosclerosis. Thus, we established a Lmna f/f conditional progerin KI mouse model and revealed a unique EC population for mechanistic study.
Example 2
Progeroid ECs exhibit a systemic inflammatory response
Of the four clusters of CD31 + MLECs, ECs and M
Figure PCTCN2019076488-appb-000012
-like cells showed high levels of p21 Cip1/Waf1 (Figure 8A) , a typical senescence marker. This finding suggests that these cells are the main target of progerin in the context of aging. Interestingly, a previous study reported that M
Figure PCTCN2019076488-appb-000013
-specific progerin, achieved by crossing Lmna f/+ to Lyz-Cre mice, caused minimal aging phenotypes (Hamczyk et al., 2018) , implicating that M
Figure PCTCN2019076488-appb-000014
might have only a minor role in organismal aging. We thus focused on ECs for further analysis. We recovered 899 and 445 ECs from E2A and Flox mice, respectively (Figure 2A) . Genes with >1.5-fold change in expression between these mice were chosen for GO and KEGG analysis. We observed a significant enrichment in the pathways that regulate chemotaxis, immune responses in Malaria and Chagas diseases, inflammatory bowel disease and rheumatoid arthritis and pathways essential for cardiac function (Figure 2B-D) . To confirm this observation, and to exclude paracrine effects from other cell types, we over-expressed progerin in human umbilical vein endothelial cells (HUVECs) and analyzed the representative genes by quantitative PCR. The majority of the examined genes, including IL6, IL8, IL15, CXCL1 and IL1αwere significantly up-regulated upon ectopic progerin expression (Figure 2E) . Together, these data suggest that progerin might cause an inflammatory response in ECs, which leads to systemic aging in various organs.
Example 3
VE dysfunction promotes vasodilation defects in progeria mice
Our single-cell transcriptomic analysis in MLECs and quantitative PCR in HUVECs suggest that the VE have essential roles in systemic aging. To confirm these findings, we crossed the Lmna f/f mice to a Tie2-Cre line, in which Cre recombinase expression is driven by the promoter/enhancer of endothelial-specific Tie2 gene (Kisanuki et al.,  2001) , to generate Lmna f/f; TC mice. Single-cell transcriptome analysis confirmed that Tie2 gene was mainly detected in ECs (Figure 8B) . Consistently, progerin was only observed in the VE of Lmna f/f; TC but not Lmna f/f control mice or other tissues (Figure 9) . VE-specific progerin induced intima-media thickening in Lmna f/f; TC mice, in a similar manner as Lmna G609G/G609G mice (Figure 3A-B) . We next performed a functional analysis of the VE based on acetylcholine (Ach) -regulated vasodilation. Ach-induced thoracic aorta relaxation was significantly compromised in Lmna f/f; TC mice (Figure 3C) . Similar defects were observed in Lmna G609G/G609G and Lmna G609G/+ mice (Figure 3D and 10) , where progerin was expressed in both ECs and SMCs (Hamczyk et al., 2018) . To gain more evidence supporting VE-specific dysfunction, we examined thoracic aorta relaxation induced by sodium nitroprusside (SNP) , which is a SMC-dependent vasodilator. Little difference was observed in thoracic aorta vasodilation in Lmna G609G/G609G and Lmna G609G/+ compared to Lmna f/f control mice (Figure 3E and Figure 10) , supporting that the VE dysfunction is a key contributor of vasodilation defects in progeria mice. As NO is the most potent vasodilator, we examined eNOS levels in thoracic aorta of Lmna f/f; TC and Lmna f/f control mice. As expected, the level of eNOS was significantly reduced in Lmna f/f; TC mice compared to Lmna f/f control mice (Figure 3F) . Thus, the data confer a VE-specific dysfunction in progeria mice.
Example 4
Progeria mice show defective neovascularization following ischemia
Reduced capillary density and neovascularization capacity are both characteristics of vascular aging (Le Couteur and Lakatta, 2010) . We thus examined the microvasculature in various tissues of Lmna f/f; TC mice by immunofluorescence staining. We observed a significant loss in CD31 + ECs in Lmna f/f; TC mice compared to controls (Figure 4A-B) . We further examined ischemia-induced neovascularization ability in Lmna f/f; TC mice following femoral artery ligation. Indeed, limb perfusion after ischemia was significantly blunted in Lmna f/f; TC mice compared to controls (Figure 4C) . Histological analysis confirmed that the defect in blood-flow recovery in Lmna f/f; TC mice was a reflection of an impaired ability to form new blood vessels in  the ischemic region (Figure 4D) . Taken together, Lmna f/f; TC mice are characterized by a loss of ECs, a reduced capillary density and defective neovascularization capacity.
Example 5
Endothelial dysfunction is a causal factor of systemic aging
Our single-cell transcriptomic data implicated heart dysfunction in Lmna G609G/G609G mice (Figure 2) . We also observed a significant correlation with gene alterations associated with atherosclerosis and osteoporosis in Lmna G609G/G609G ECs (the Online Mendelian Inheritance in Man database) (Figure 11) . We thus reasoned that endothelial dysfunction might trigger systemic aging. Strikingly, atherosclerosis was prominent in Lmna f/f; TC mice (Figure 5A; aorta atheromatous plaque observed in all eight examined mice) , as well as severe fibrosis in the arteries and hearts (Figure 5B-C) ; both are typical features of aging. Moreover, the heart/body weight ratio was significantly increased in Lmna f/f; TC compared to Lmna f/f control mice (Figure 5D) . Echocardiography confirmed that the heart rate and cardiac output were significantly reduced in 7-8-month old Lmna f/f; TC compared to Lmna f/f control mice. Both the left ventricular ejection fraction (LVEF) and fractional shortening (LVFS) were below the normal values of healthy mice, which are 54%and 28%respectively.. We also found that the running endurance was largely compromised in Lmna f/f; TC mice (Figure 5E) , which is likely a reflection of amyotrophy and/or heart dysfunction. Finally, micro-computed tomography (micro-CT) identified a decrease in trabecular bone volume/tissue volume (BV/TV) , trabecular number (Tb. N) and trabecular thickness (Tb. Th) , but an increase of trabecular separation (Tb. Sp) in Lmna f/f; TC mice (Figure 5F) , indicative of osteoporosis, which is also a hallmark of aging (Chen et al., 2013) . Together, these results implicate that endothelial dysfunction, at least in the context of progeria, acts as a causal factor of systemic aging.
Example 6
EPCs rejuvenate the microvasculature, ameliorate aging and extend lifespan The VE-specific dysfunction not only accelerated aging in various tissues/organs, but  also shortened the median lifespan in Lmna f/f; TC mice (24 weeks) , to a similar extent as Lmna G609G/G609G mice (21 weeks) (Figure 6A) . While Lmna G609G/G609G mice suffered from body-weight loss from 8 weeks of age, Lmna f/f; TC mice only showed a slight drop in body weight (Figure 6B) . These data suggest that body-weight loss itself is a less likely primary contributing factor to progeria than endothelial dysfunction.
CD133 + mononuclear cells are enriched in the bone marrow and are potential EPCs that are essential for vascular hemostasis (Ghebre et al., 2016; Hill et al., 2003) . We purified CD133 + EPCs from Lmna f/f; TC mice and Lmna f/f control mice by FACS and studied the functional relevance in VE dysfunction and aging. Here, we found that >30%of the freshly isolated EPCs were positive for low density lipoproteins (as indicated by Dil-acLDL labeling) and Ulex europaeus agglutinin 1 (UEA-1) (Figure 12) , indicating the endothelial potential of the EPCs (Asahara et al., 1997) . We then analyzed EPCs in progeria mice. The number of EPCs dropped by up to 50%in Lmna f/f; TC mice compared to Lmna f/f control (Figure 6C) . The neovascularization ability of Lmna f/f; TC EPCs was compromised more than 30% (Figure 6D) . We next asked whether EPC decline contributes to the neovascularization defect in progeria mice. On-site injection of CD133 + EPCs isolated from rosa26-rainbow mice (tdTomato labeled) completely restored the neovascularization defect in Lmna f/f; TC mice, and histological analyses confirmed the presence of donor-derived ECs in the regenerated vasculature of Lmna f/f; TC mice (Figure 6E-F) .
We then asked whether EPCs have a causal role in accelerating aging and shortening lifespan in progeria mice. To this end, we injected (via the tail vein) 1×10 6 MACS (Magnetic-activated cell sorting) -purified EPCs from rosa26-rainbow mice into Lmna G609G/G609G mice. EPCs were administered from 15 weeks before the earliest death event in Lmna G609G/G609G mice and repeated every week. Two of the EPC-treated mice were still alive at 27 weeks-of-age and were sacrificed for histological analysis. Donor-derived ECs were detected by fluorescence microscopy in the liver, muscle, aorta and lung (Figure 6G-J, tdTomato labeled) . Capillary density (CD31 + gastrocnemius muscle) significantly increased from 347.2±121.5 (untreated) to 581.5±85.6 (EPC-treated) . More importantly, age-related body-weight loss was significantly attenuated upon EPC therapy in Lmna G609G/G609G mice (Figure 6B) , and  the median lifespan was extended from 21 to 27 weeks (Figure 6A) . A reduced systemic inflammatory response was confirmed by an antibody array detecting protein factors in the blood serum (Figure 12) . Altogether, these data suggest that progerin-caused endothelial dysfunction and systemic aging are partially, if not entirely, attributable to EPC decline.
Discussion
Mounting evidence supports that endothelial dysfunction is a conspicuous marker for vascular aging and CVDs (Cui et al., 2014; de la Sierra and Larrousse, 2010; Liu et al., 2017) . Whether endothelial dysfunction primarily triggers organismal aging, however, is elusive. The murine Lmna G609G mutation, equivalent to the LMNA G608G found in humans with HGPS, causes premature aging phenotypes in various tissues/organs, thus providing an ideal model for studying aging mechanisms at both the tissue and organismal level. Data from the Lmna G609G model have suggested that SMCs are the primary cause of vascular diseases, such as atherosclerosis (Liu et al., 2011; Liu et al., 2013; McClintock et al., 2006; Ragnauth et al., 2010; Varga et al., 2006; Zhang et al., 2011) . Interestingly, a recent study showed that the specific expression of Lmna G609G in SMCs only causes atherosclerosis and shortens lifespan in atherosclerosis-prone apolipoprotein E-deficient (Apoe-/-) mice (Hamczyk et al., 2018) . The researchers also found that macrophage-specific Lmna G609G knock-in mediated by Lyz-Cre merely affects aging and lifespan. Here, we used Tie2-Cre mice to generate a VE-specific Lmna G609G model. These mice exhibited vascular dysfunction, accelerated aging and a shortened lifespan to a similar extent to the whole body Lmna G609G model. In support of our findings, Foisner et al. recently reported that the VE-cadherin promoter-driven endothelial-specific expression of progerin in a transgenic line causes cardiovascular abnormalities and shortened lifespan (Osmanagic-Myers et al., 2018) . The data from both our study and that of Foisner strongly suggest that, as the largest secretory organ (Brandes et al., 2005; Hadi et al., 2005) , the VE is pivotal in regulating systemic aging and lifespan.
One limitation in the understanding of mechanisms of VE dysfunction is the vascular cell heterogeneity and the lack of appropriate in vitro system for ECs. Here, we took  advantage of single-cell RNA sequencing technique to analyze the transcriptomes of MLECs. Surprisingly, although >95%purity was achieved by FACS, MLECs isolated by CD31-immunofluorescence labeling turned out to be a mixture of cells, including ECs, T-like, B-like and M
Figure PCTCN2019076488-appb-000015
-like cells. It is unclear whether these cells are T cells, B cells and M
Figure PCTCN2019076488-appb-000016
 cells that express low level of CD31 (Bantikassegn et al., 2015) , or are transdifferentiated from ECs. Nevertheless, this finding suggests that one can’ t just purify CD31 + cells and pool them together for further mechanistic study, otherwise might get misleading conclusion. Indeed, we compared the expression of genes that are associated with atherosclerosis, arthritis, heart failure, osteoporosis or amyotrophy (the Online Mendelian Inheritance in Man database) between progeroid and control in all four clusters. An obvious alteration of these genes/pathway was observed mainly in ECs and M
Figure PCTCN2019076488-appb-000017
-like cells (Figure 13) . As we did single-cell transcriptomic analysis in Lmna G609G/G609G mice, it is difficult to separate cell-autonomous and paracrine effects among different cell populations. In future study, it is worth to do a similar analysis in Lmna f/f; TC MLECs. The data will be useful to study the paracrine effect of ECs on the other cell populations.
The stem-cell theory of aging dictates that the number and functional decline of stem cells directly leads to defective tissue regeneration and consequently organismal aging. EPCs, MSCs and HSCs represent 3 stem-cell populations found in the bone marrow, of which the latter two have implicated clinical potential. We previously showed that the number and function of MSCs and HSCs decline in another progeria mouse model, Zmpste24-/-mice (Liu et al., 2012) ; however, we didn’ t observe any beneficial effect when MSCs from healthy donors was transplanted into Zmpste24-/-mice by tail vein injection (Figure S8) . Consistent with the rapid decline of HSCs and MSCs, we found that the number and function of EPCs, represented by CD133 + mononuclear cells, significantly declined in progeria mice compared to healthy controls. Remarkably, EPC transplantation via tail vein injection improved the microvasculature, attenuated body-weight loss, and extended lifespan in progeria mice. To our knowledge, this study provides the first evidence to support the potential of stem-cell therapy in progeria treatment. We thus consider it worthwhile to optimize the conditions of this therapy to maximize the rescue effect elicited by EPCs, and to screen for chemicals  that increase the number, improve the function and promote the mobilization of EPCs. Indeed, various drugs clinically used to treat CVDs, such as statins and PPARγagonists, can mobilize EPCs from the bone marrow to peripheral circulation and enhance endothelial repair. Thus, further investigation is warranted to examine whether these drugs can slow down aging and promote longevity.
Collectively, we reveal that VE dysfunction is a trigger of systemic aging and is also a risk factor for age-related diseases like atherosclerosis, heart failure and osteoporosis. It suggests that many clinically used drugs and molecules that target VE might serve as good candidates in the treatment of age-related diseases other than CVDs. Likewise, the findings in EPCs implicate great potentials of stem-cell-based therapeutic strategy for progeria as well as in anti-aging applications.
References
Asahara, T., Murohara, T., Sullivan, A., Silver, M., van der Zee, R., Li, T., Witzenbichler, B., Schatteman, G., and Isner, J.M. (1997) . Isolation of putative progenitor endothelial cells for angiogenesis. Science 275, 964-967.
Bantikassegn, A., Song, X., and Politi, K. (2015) . Isolation of epithelial, endothelial, and immune cells from lungs of transgenic mice with oncogene-induced lung adenocarcinomas. Am J Respir Cell Mol Biol 52, 409-417.
Brandes, R.P., Fleming, I., and Busse, R. (2005) . Endothelial aging. Cardiovasc Res 66, 286-294.
Cao, K., Blair, C.D., Faddah, D.A., Kieckhaefer, J.E., Olive, M., Erdos, M.R., Nabel, E.G., and Collins, F.S. (2011) . Progerin and telomere dysfunction collaborate to trigger cellular senescence in normal human fibroblasts. J Clin Invest 121, 2833-2844.
Cheang, W.S., Tian, X.Y., Wong, W.T., Lau, C.W., Lee, S.S., Chen, Z.Y., Yao, X., Wang, N., and Huang, Y. (2014) . Metformin protects endothelial function in diet-induced obese mice by inhibition of endoplasmic reticulum stress through 5' adenosine monophosphate-activated protein kinase-peroxisome proliferator-activated receptor delta pathway. Arterioscler Thromb Vasc Biol 34, 830-836.
Chen, H., Zhou, X., Fujita, H., Onozuka, M., and Kubo, K.Y. (2013) . Age-related changes in trabecular and cortical bone microstructure. Int J Endocrinol 2013, 213234.
Cui, G., Sun, J., Zhang, L., Li, R., Wang, Y., Cianflone, K., Ding, H., and Wang, D.W. (2014) . Lack of causal relationship between leukocyte telomere length and coronary heart disease. Atherosclerosis 233, 375-380.
Dantas, A.P., Jimenez-Altayo, F., and Vila, E. (2012) . Vascular aging: facts and factors. Frontiers in physiology 3, 325.
de la Sierra, A., and Larrousse, M. (2010) . Endothelial dysfunction is associated with increased levels of biomarkers in essential hypertension. J Hum Hypertens 24, 373-379.
De Sandre-Giovannoli, A., Bernard, R., Cau, P., Navarro, C., Amiel, J., Boccaccio, I., Lyonnet, S., Stewart, C.L., Munnich, A., Le Merrer, M., et al. (2003) . Lamin a truncation in Hutchinson-Gilford progeria. Science 300, 2055.
Eriksson, M., Brown, W.T., Gordon, L.B., Glynn, M.W., Singer, J., Scott, L., Erdos, M.R., Robbins, C.M., Moses, T.Y., Berglund, P., et al. (2003) . Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature 423, 293-298.
Espada, J., Varela, I., Flores, I., Ugalde, A.P., Cadinanos, J., Pendas, A.M., Stewart, C.L., Tryggvason, K., Blasco, M.A., Freije, J.M., et al. (2008) . Nuclear envelope defects cause stem cell dysfunction in premature-aging mice. The Journal of cell biology 181, 27-35.
Ghebre, Y.T., Yakubov, E., Wong, W.T., Krishnamurthy, P., Sayed, N., Sikora, A.G., and Bonnen, M.D. (2016) . Vascular Aging: Implications for Cardiovascular Disease and Therapy. Transl Med (Sunnyvale) 6.
Hadi, H.A., Carr, C.S., and Al Suwaidi, J. (2005) . Endothelial dysfunction: cardiovascular risk factors, therapy, and outcome. Vasc Health Risk Manag 1, 183-198.
Hamczyk, M.R., Villa-Bellosta, R., Gonzalo, P., Andres-Manzano, M.J., Nogales, P., Bentzon, J.F., Lopez-Otin, C., and Andres, V. (2018) . Vascular Smooth Muscle-Specific Progerin Expression Accelerates Atherosclerosis and Death in a Mouse Model of Hutchinson-Gilford Progeria Syndrome. Circulation 138, 266-282.
Hill, J.M., Zalos, G., Halcox, J.P., Schenke, W.H., Waclawiw, M.A., Quyyumi, A.A., and Finkel, T. (2003) . Circulating endothelial progenitor cells, vascular function, and cardiovascular risk. N Engl J Med 348, 593-600.
Huang da, W., Sherman, B.T., and Lempicki, R.A. (2009) . Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57.
Ignarro, L.J., Buga, G.M., Wei, L.H., Bauer, P.M., Wu, G., and del Soldato, P. (2001) . Role of  the arginine-nitric oxide pathway in the regulation of vascular smooth muscle cell proliferation. Proc Natl Acad Sci U S A 98, 4202-4208.
Kim, P.H., Luu, J., Heizer, P., Tu, Y., Weston, T.A., Chen, N., Lim, C., Li, R.L., Lin, P.Y., Dunn, J.C.Y., et al. (2018) . Disrupting the LINC complex in smooth muscle cells reduces aortic disease in a mouse model of Hutchinson-Gilford progeria syndrome. Sci Transl Med 10.
Kisanuki, Y.Y., Hammer, R.E., Miyazaki, J., Williams, S.C., Richardson, J.A., and Yanagisawa, M. (2001) . Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol 230, 230-242.
Le Couteur, D.G., and Lakatta, E.G. (2010) . A vascular theory of aging. J Gerontol A Biol Sci Med Sci 65, 1025-1027.
Li, X., Dai, Y., Shen, T., and Gao, C. (2017) . Induced migration of endothelial cells into 3D scaffolds by chemoattractants secreted by pro-inflammatory macrophages in situ. Regen Biomater 4, 139-148.
Limbourg, A., Korff, T., Napp, L.C., Schaper, W., Drexler, H., and Limbourg, F.P. (2009) . Evaluation of postnatal arteriogenesis and angiogenesis in a mouse model of hind-limb ischemia. Nat Protoc 4, 1737-1746.
Liu, B., Ghosh, S., Yang, X., Zheng, H., Liu, X., Wang, Z., Jin, G., Zheng, B., Kennedy, B.K., Suh, Y., et al. (2012) . Resveratrol Rescues SIRT1-Dependent Adult Stem Cell Decline and Alleviates Progeroid Features in Laminopathy-Based Progeria. Cell metabolism 16, 738-750. Liu, G.H., Barkho, B.Z., Ruiz, S., Diep, D., Qu, J., Yang, S.L., Panopoulos, A.D., Suzuki, K., Kurian, L., Walsh, C., et al. (2011) . Recapitulation of premature ageing with iPSCs from Hutchinson-Gilford progeria syndrome. Nature 472, 221-225.
Liu, H., Wu, H.Y., Wang, W.Y., Zhao, Z.L., Liu, X.Y., and Wang, L.Y. (2017) . Regulation of miR-92a on vascular endothelial aging via mediating Nrf2-KEAP1-ARE signal pathway. Eur Rev Med Pharmacol Sci 21, 2734-2742.
Liu, Y., Drozdov, I., Shroff, R., Beltran, L.E., and Shanahan, C.M. (2013) . Prelamin A accelerates vascular calcification via activation of the DNA damage response and senescence-associated secretory phenotype in vascular smooth muscle cells. Circ Res 112, e99-109.
Longchamp, A., Mirabella, T., Arduini, A., MacArthur, M.R., Das, A., Trevino-Villarreal, J.H.,  Hine, C., Ben-Sahra, I., Knudsen, N.H., Brace, L.E., et al. (2018) . Amino Acid Restriction Triggers Angiogenesis via GCN2/ATF4 Regulation of VEGF and H2S Production. Cell 173, 117-129 e114.
McClintock, D., Gordon, L.B., and Djabali, K. (2006) . Hutchinson-Gilford progeria mutant lamin A primarily targets human vascular cells as detected by an anti-Lamin A G608G antibody. Proc Natl Acad Sci U S A 103, 2154-2159.
McClintock, D., Ratner, D., Lokuge, M., Owens, D.M., Gordon, L.B., Collins, F.S., and Djabali, K. (2007) . The mutant form of lamin A that causes Hutchinson-Gilford progeria is a biomarker of cellular aging in human skin. PloS one 2, e1269.
Moriya, J., and Minamino, T. (2017) . Angiogenesis, Cancer, and Vascular Aging. Front Cardiovasc Med 4, 65.
Neal, J.T., Li, X., Zhu, J., Giangarra, V., Grzeskowiak, C.L., Ju, J., Liu, I.H., Chiou, S.H., Salahudeen, A.A., Smith, A.R., et al. (2018) . Organoid Modeling of the Tumor Immune Microenvironment. Cell 175, 1972-1988 e1916.
Osmanagic-Myers, S., Kiss, A., Manakanatas, C., Hamza, O., Sedlmayer, F., Szabo, P.L., Fischer, I., Fichtinger, P., Podesser, B.K., Eriksson, M., et al. (2018) . Endothelial progerin expression causes cardiovascular pathology through an impaired mechanoresponse. J Clin Invest.
Osorio, F.G., Navarro, C.L., Cadinanos, J., Lopez-Mejia, I.C., Quiros, P.M., Bartoli, C., Rivera, J., Tazi, J., Guzman, G., Varela, I., et al. (2011) . Splicing-directed therapy in a new mouse model of human accelerated aging. Sci Transl Med 3, 106ra107.
Ragnauth, C.D., Warren, D.T., Liu, Y., McNair, R., Tajsic, T., Figg, N., Shroff, R., Skepper, J., and Shanahan, C.M. (2010) . Prelamin A acts to accelerate smooth muscle cell senescence and is a novel biomarker of human vascular aging. Circulation 121, 2200-2210.
Scaffidi, P., and Misteli, T. (2006) . Lamin A-dependent nuclear defects in human aging. Science 312, 1059-1063.
Scaffidi, P., and Misteli, T. (2008) . Lamin A-dependent misregulation of adult stem cells associated with accelerated ageing. Nature cell biology 10, 452-459.
Song, M., Lavasani, M., Thompson, S.D., Lu, A., Ahani, B., and Huard, J. (2013) . Muscle-derived stem/progenitor cell dysfunction in Zmpste24-deficient progeroid mice limits muscle regeneration. Stem cell research &therapy 4, 33.
Tao, J., Jin, Y.F., Yang, Z., Wang, L.C., Gao, X.R., Lui, L., and Ma, H. (2004) . Reduced arterial elasticity is associated with endothelial dysfunction in persons of advancing age: comparative study of noninvasive pulse wave analysis and laser Doppler blood flow measurement. Am J Hypertens 17, 654-659.
Tian, X.L., and Li, Y. (2014) . Endothelial cell senescence and age-related vascular diseases. J Genet Genomics 41, 485-495.
Varga, R., Eriksson, M., Erdos, M.R., Olive, M., Harten, I., Kolodgie, F., Capell, B.C., Cheng, J., Faddah, D., Perkins, S., et al. (2006) . Progressive vascular smooth muscle cell defects in a mouse model of Hutchinson-Gilford progeria syndrome. Proc Natl Acad Sci U S A 103, 3250-3255.
Williamson, K., Stringer, S.E., and Alexander, M.Y. (2012) . Endothelial progenitor cells enter the aging arena. Frontiers in  physiology  3, 30.
Zhang, J., Lian, Q., Zhu, G., Zhou, F., Sui, L., Tan, C., Mutalif, R.A., Navasankari, R., Zhang, Y., Tse, H.F., et al. (2011) . A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects. Cell stem cell 8, 31-45.

Claims (10)

  1. Use of endothelial progenitor cells (EPCs) in the manufacture of a medicament for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases.
  2. Use according to claim 1, wherein the EPCs are CD133 + EPCs.
  3. Use according to claim 1 or 2, wherein the age-related diseases are cardiovascular diseases and/or osteoporosis; preferably, the cardiovascular diseases are atherosclerosis and/or heart failure.
  4. Use according to any one of claims 1-3, wherein the diseases are characterized by vascular endothelium (VE) dysfunction.
  5. Use according to claim 4, wherein the VE dysfunction includes a loss of endothelial cells, reduced capillary density and defective neovascularization capacity.
  6. Use according to claim 4 or 5, wherein the VE dysfunction is caused by progerin.
  7. A method for rejuvenating neovascularization capacity, ameliorating aging features, preventing aging, extending lifespan, and/or treating progeria and/or age-related diseases, comprising administering a pharmaceutically effective amount of EPCs to a subject in need thereof; preferably, the age-related diseases are cardiovascular diseases and/or osteoporosis, more preferably atherosclerosis and/or heart failure.
  8. The method according to claim 7, wherein the EPCs are CD133 + EPCs.
  9. The method according to claim 7 or 8, wherein the age-related diseases are characterized by vascular endothelium (VE) dysfunction; particularly, the VE dysfunction includes a loss of endothelial cells, reduced capillary density and defective neovascularization capacity.
  10. The method according to claim 9, wherein the VE dysfunction is caused by progerin.
PCT/CN2019/076488 2019-02-28 2019-02-28 Use of endothelial progenitor cells (epcs) in rejuvenating microvasculature, preventing aging and treating age-related diseases Ceased WO2020172854A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
PCT/CN2019/076488 WO2020172854A1 (en) 2019-02-28 2019-02-28 Use of endothelial progenitor cells (epcs) in rejuvenating microvasculature, preventing aging and treating age-related diseases
CN201980092741.8A CN113498347B (en) 2019-02-28 2019-02-28 The use of endothelial progenitor cells (EPCs) in the treatment of progeria syndrome
US17/461,094 US20220031762A1 (en) 2019-02-28 2021-08-30 Use of endothelial progenitor cells in rejuvenating the microvasculature, preventing aging and treating age-related diseases

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2019/076488 WO2020172854A1 (en) 2019-02-28 2019-02-28 Use of endothelial progenitor cells (epcs) in rejuvenating microvasculature, preventing aging and treating age-related diseases

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/461,094 Continuation-In-Part US20220031762A1 (en) 2019-02-28 2021-08-30 Use of endothelial progenitor cells in rejuvenating the microvasculature, preventing aging and treating age-related diseases

Publications (2)

Publication Number Publication Date
WO2020172854A1 true WO2020172854A1 (en) 2020-09-03
WO2020172854A9 WO2020172854A9 (en) 2021-07-01

Family

ID=72238850

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2019/076488 Ceased WO2020172854A1 (en) 2019-02-28 2019-02-28 Use of endothelial progenitor cells (epcs) in rejuvenating microvasculature, preventing aging and treating age-related diseases

Country Status (3)

Country Link
US (1) US20220031762A1 (en)
CN (1) CN113498347B (en)
WO (1) WO2020172854A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025086234A1 (en) * 2023-10-26 2025-05-01 深圳大学 Use of cd133-positive endothelial-like stem cells in preparation of medicament for promoting endothelial cell differentiation and vascular regeneration
CN117919278A (en) * 2023-10-26 2024-04-26 深圳大学 Application of CD133 positive endothelial-like stem cells in preparation of medicines for promoting endothelial cell differentiation and angiogenesis

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004010959A2 (en) * 2002-07-25 2004-02-05 The Scripps Research Institute Hematopoietic stem cells and methods of treatment of neovascular eye diseases therewith

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2019318A1 (en) * 2007-07-27 2009-01-28 Erasmus University Medical Center Rotterdam Protein markers for cardiovascular events
CN101940593B (en) * 2010-08-27 2013-12-04 上海士腾生物技术有限公司 Preparation for treating ischemic diseases caused by peripheral atherosclerosis and preparation method thereof
US9295696B2 (en) * 2012-06-08 2016-03-29 University of Pittsburgh—of the Commonwealth System of Higher Education Compositions and methods for restoring or rejuvenating stem/progenitor cell function
WO2014138793A1 (en) * 2013-03-13 2014-09-18 The University Of Queensland A method of isolating cells for therapy and prophylaxis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004010959A2 (en) * 2002-07-25 2004-02-05 The Scripps Research Institute Hematopoietic stem cells and methods of treatment of neovascular eye diseases therewith

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GHEBRE YT ET AL.: "Vascular Aging: Implications for Cardiovascular Disease and Therapy", TRANSLATIONAL MEDICINE(SUNNYVALE), vol. 6, no. 4, 30 August 2016 (2016-08-30), DOI: 20191219155621A *
WANG X. ET AL.: "The effects of endothelial progenitor cells on rat atherosclerosis", BIOTECHNOLOGY AND APPLIED BIOCHEMISTRY, vol. 62, no. 2, 3 September 2014 (2014-09-03), XP055729058, DOI: 20191219162458X *

Also Published As

Publication number Publication date
US20220031762A1 (en) 2022-02-03
CN113498347A (en) 2021-10-12
WO2020172854A9 (en) 2021-07-01
CN113498347B (en) 2024-02-02

Similar Documents

Publication Publication Date Title
Hurskainen et al. Single cell transcriptomic analysis of murine lung development on hyperoxia-induced damage
Guo et al. Cell sheet formation enhances the therapeutic effects of human umbilical cord mesenchymal stem cells on myocardial infarction as a bioactive material
ES2537516T3 (en) Mesenchymal stem cell particles
Zhuang et al. LncRNA-H19 drives cardiomyocyte senescence by targeting miR-19a/socs1/p53 axis
Thayaparan et al. Endothelial dysfunction drives atherosclerotic plaque macrophage-dependent abdominal aortic aneurysm formation
EP3868875A1 (en) Viral vector particle based on aav2 for gene therapy
US20220031762A1 (en) Use of endothelial progenitor cells in rejuvenating the microvasculature, preventing aging and treating age-related diseases
JP2024529495A (en) Blood-compatible mesenchymal stem cells, their production method and use
US20250352562A1 (en) Prevention of sympathetic denervation of the pineal gland in cardiac disease
ES2791415T3 (en) Method to diagnose cardiomyopathies
Zhao et al. Oct4 cooperates with c-Myc to improve mesenchymal-to-endothelial transition and myocardial repair of cardiac-resident mesenchymal stem cells
Ahrens et al. Opposing effects of monomeric and pentameric C-reactive protein on endothelial progenitor cells
US20200080081A1 (en) A method for regulating the function of a heart cell, related nucleotides and compounds
WO2021068242A1 (en) An agent that enables sirt7 gene expression and the use thereof
US11464872B2 (en) Lentiviral vectors for therapeutic expression of BTK in haematopoietic cells
Sun et al. GSDME-dependent pyroptosis drives abdominal aortic aneurysm via promoting vascular senescence
Strobel Modeling pulmonary fibrosis by AAV-mediated TGFβ1 Expression: a proof of concept study for AAV-based disease modeling and riboswitch-controlled vector production
Hurskainen et al. Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mouse
Iordache et al. Amniotic fetal stem cells—Derived endothelial progenitors, a support for personalized cardiovascular regenerative medicine
Zhang et al. Naked mole-rat hyaluronan synthase 2 promotes longevity and enhances healthspan in mice
CN116254340B (en) Thoracic aortic aneurysm biomarkers and their applications
WO2025086234A1 (en) Use of cd133-positive endothelial-like stem cells in preparation of medicament for promoting endothelial cell differentiation and vascular regeneration
Cao et al. Mitochondrial metabolic maturation in postnatal right ventricle restricted by volume overload
Aalkjaer The Negative Side of Life–The Calcium Activated Chloride Conductances in Vascular Smooth Muscle Cells
Maus Elucidating the Role of Long Noncoding RNA H19 in Aortic Valve Disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19917303

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19917303

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 19917303

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 28.03.2022)

122 Ep: pct application non-entry in european phase

Ref document number: 19917303

Country of ref document: EP

Kind code of ref document: A1