WO2020160150A1 - Rna-targeting cas enzymes - Google Patents
Rna-targeting cas enzymes Download PDFInfo
- Publication number
- WO2020160150A1 WO2020160150A1 PCT/US2020/015680 US2020015680W WO2020160150A1 WO 2020160150 A1 WO2020160150 A1 WO 2020160150A1 US 2020015680 W US2020015680 W US 2020015680W WO 2020160150 A1 WO2020160150 A1 WO 2020160150A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- acid molecule
- rna
- spacers
- casl3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/51—Physical structure in polymeric form, e.g. multimers, concatemers
Definitions
- CRISPR as a programmable genome-engineering tool provides transformative applications for both medicine and biotechnology.
- CRISPR CRISPR to target DNA.
- Improved compositions and methods for utilizing CRISPR to target RNA are therefore needed.
- nucleic acid molecule comprising: (a) a sequence encoding a Casl3 polypeptide; and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Casl3-specific direct repeats, wherein the spacers are capable of specifically hybridizing with one or more target RNAs.
- the Casl3 is Casl3d.
- the Casl3d is RfxCasl3d.
- the sequence encoding the Casl3 polypeptide further comprises a localization signal.
- the localization signal is a nuclear localization signal.
- the target RNA is an endogenous RNA or a viral RNA. In some embodiments, the target RNA is an mRNA. In some embodiments, the spacers are positioned between two Casl3- specific direct repeats. In some embodiments, the spacers are 20 to 40 nucleotides in length. In some embodiments, the spacers are 25 to 35 nucleotides in length. The nucleic acid molecule of claim 10, wherein the spacers are about 30 nucleotides in length. In some embodiments, the Cas 13 -specific direct repeats are 25 to 45 nucleotides in length. The nucleic acid molecule of claim 12, wherein the Casl3-specific direct repeats are 30 to 40 nucleotides in length.
- the guide RNA further comprises a AAAAC motif at its 5’ end.
- the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with the same target RNA.
- the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with different target RNAs.
- the guide RNA comprises three or more spacers.
- the sequence encoding a Casl3 polypeptide is operably linked to a ubiquitous promoter.
- the sequence encoding a Casl3 polypeptide is operably linked to an inducible promoter. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to a tissue- specific promoter.
- vectors comprising any of the nucleic acid molecules described herein. In some embodiments, the vector is a single vector. In some embodiments, the vector is an Adeno-associated viral vector. Also provided herein are cells comprising any of the nucleic acid molecules described herein.
- methods of modifying a target RNA in a cell the methods comprising contacting the cell with any of the nucleic acid molecules described herein.
- methods of modifying a target RNA in a cell the method comprising contacting the cell with any of the vectors described herein.
- the target RNA is endogenous RNA or viral RNA.
- RNA molecules comprising a sequence encoding a Casl3 polypeptide, and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Cas 13 -specific direct repeats, wherein the one or more spacers are capable of specifically hybridizing with the target RNA.
- the Casl3 is Casl3d.
- the Casl3d is RfxCasl3d.
- the sequence encoding the Cas 13 polypeptide further comprises a localization signal
- the localization signal is a nuclear localization signal.
- the spacers are positioned between two Casl3-specific direct repeats. In some embodiments, the spacers are 20 to 40 nucleotides in length. In some embodiments, the spacers are 25 to 35 nucleotides in length. In some embodiments, the spacers are about 30 nucleotides in length. In some embodiments, the Cas 13 -specific direct repeats are 25 to 45 nucleotides in length. In some embodiments, the Casl3-specific direct repeats are 30 to 40 nucleotides in length.
- the Casl3-specific direct repeats are about 36 nucleotides in length.
- the guide RNA further comprises a AAAAC motif at its 5’ end.
- the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with the same target RNA.
- the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with different target RNAs.
- the guide RNA comprises three or more spacers.
- the sequence encoding a Casl3 polypeptide is operably linked to a ubiquitous promoter.
- the sequence encoding a Casl3 polypeptide is operably linked to an inducible promoter. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to a tissue-specific promoter.
- the nucleic acid molecule is comprised within a first vector and the guide RNA is comprised within a second vector. In some embodiments, the first vector and/or the second vector is an AAV vector.
- transgenic organisms having a recombinant nucleic acid molecule stably integrated into the genome of the organisms, wherein the recombinant nucleic acid molecule comprises a sequence that encodes a Casl3 polypeptide.
- the Casl3 polypeptide is a Casl3d.
- the Casl3d polypeptide is RfxCasl3d.
- the organism is a vertebrate. In some embodiments, the organism is an invertebrate. In some embodiments, the organism is an insect.
- FIG.l is a schematic representation of constructs generated for the experiments described herein. All constructs used are depicted here along with addgene ID, insertion site, and Bloomington stock number.
- FIGs. 2A-2C show genetic assessment of programmable CasRx-mediated transcript knockdown in flies.
- FIG. 2A is a representative genetic crossing schematic for generating transhetrozygotes.
- FIG. 2B shows inheritance and penetrance rates of transheterozygous flies inheriting both Ubiq-CasRx, or Ubiq-dCasRx, and gRNA array corresponding to the box in FIG. 2A. Phenotype penetrance rate is depicted by shading in the box plot.
- FIG. 2C shows brightfield images of transheterozygous flies with representative phenotypes for each cross. Corresponding genotype for each image is dictated by the combination of constructs on top of the columns and the side of the rows.
- FIG. 3 shows the complete inheritance plot of bidirectional crosses featured in FIG.
- FIGs. 4A and 4B show development related inheritance and lethality of Ubiq-CasRx and Ubiq-dCasRx transheterozygotes.
- FIGs. 4A shows transheterozygote percentages at larval, pupal, and adult development periods for each gRNA array producing an observable phenotype (w, cn, wg ).
- FIG. 4B shows transheterozygote percentages through larval, pupal, and adult development periods for each gRNA array producing a lethal phenotype (N, y, GFP).
- FIGs. 5A-5C show CasRx-mediated transcript knockdown in restricted tissue types using the binary Gal4/UAS system.
- FIG. 5A shows representative genetic crossing schematic demonstrating the two steps followed in each generational cross.
- FIG. 5B shows inheritance rates of triple transheterozygous flies inheriting 3 transgenes (UASt-CasRx or UASt-dCasRx, gRNA array , and Gal4-driver), corresponding to flies highlighted in the box in FIG. 5 A.
- FIG.5C are image matrix of the triple transheterozygous flies inheriting 3 transgenes. The identities of inherited transgenes for each triple transheterozygote is specified through combination of the top and left side labels of the image matrix.
- the black arrow identifies tissue necrosis and pigment reduction observed from cn targeting.
- the white arrow identifies chitin pigment reduction in the thorax resulting fro my targeting.
- Black and white fly with“X” represents a lethal phenotype with no live adults able to be scored or imaged.
- FIG. 6 shows complete inheritance data for binary Gal4/UAS crosses.
- FIGs. 7A-7D show genetic assessment of CasRx-mediated transcript cleavage and subsequent lethality.
- FIG. 7 A is a representative genetic crossing schematic used to obtain triple transheterozygotes (box) for luciferase expression analysis.
- FIG. 7B shows total inheritance percentages for all genotypes emerging in F2 generation.
- FIG. 7C shows inheritance of Ubiq-CasRx/gRNA Fluc or Ubiq-CasRx/Ubiq-Fluc-Ubiq-Rluc, and inheritance ratios between Ubiq-CasRx and Ubiq-dCasRx transheterozygotes.
- FIG. 7D shows luciferase ratios normalizing Flue readings to Rluc readings.
- FIG. 8 shows dual-luciferase reporter system transgenic markers, with representative markers for each construct.
- FIGs. 9A-9C show CasRx-mediated knockdown of GFP.
- FIG. 9A shows a representative bidirectional genetic crossing schematic.
- M maternal inheritance of CasRx
- P paternal inheritance of CasRx.
- 9C are images of Fi larvae from paternal crosses clearly demonstrating significant reduction in GFP expression for transheterozygous larvae expressing both Ubiq-CasRx and gRNA' ,/ /' -OpIE2-GFP compared to control
- FIG. 10 shows modENCODE transcript expression relative to Drosophila
- Black box indicates which developmental period was chosen for RNA sequencing of samples for analysis of CasRx-mediated transcript knockdown in Ubiq- CasRx vs Ubiq-dCasRx comparison.
- FIGs. 11A-11C show quantification of CasRx-mediated on/off target activity.
- FIG. 11 A shows maximum a posteriori (MAP) estimates for the logarithmic fold change (LFC) of transcripts.
- Grey dots represent transcripts not significantly differentially expressed between Ubiq-CasRx and Ubiq-dCasRx group (p > 0.05).
- Red dots represent transcripts significantly differentially expressed between CasRx and dCasRx group (p ⁇ 0.05).
- Pink dot identifies the respective CasRx target gene for each analysis (p value indicated in the inset).
- FIG. 1 IB shows transcript expression levels (TPM) of transcripts targeted with CasRx or dCasRx.
- FIG. l lC shows percentage of transcripts significantly differentially expressed resulting from CasRx cleavage.
- FIGs. 12A and 12B are schematic diagrams showing CasRx-gRNA array transcript target selection and construct generation.
- FIG. 12A is a schematic representing the workflow for gRNA choice.
- FIG. 12B is a schematic diagram showing the generation of gRNA array construct.
- FIG. 13 shows schematic diagrams of transcriptome engineering with RNA-targeting Type VI-D CRISPR effectors and CRISPR-Casl3 precision transcriptome engineering in cancer.
- FIG. 14 shows mutant phenotypes in the eye and wing of D. melanogaster induced by RfxCasl3d and pre-crRNA arrays targeting /) melanogaster notch (CG3936) and white (CG2759) genes.
- FIG. 15 is a schematic diagram showing engineered pan-antiviral effector cassettes that can target multiple RNA viruses transmitted by mosquitoes, including Zika,
- nucleic acid molecules comprising (a) a sequence encoding a Casl3 polypeptide; and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Casl3-specific direct repeats, where the spacers are capable of specifically hybridizing with one or more target RNAs.
- the Casl3 is Casl3d. Also provided are methods of modifying a target RNA in a cell comprising contacting the cell with a nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide and a sequence encoding a guide RNA described herein.
- the present disclosure further provides transgenic organisms having a recombinant nucleic acid molecule stably integrated into the genome of the organism, where the recombinant nucleic acid molecule comprises a sequence that encodes a Casl3 polypeptide.
- the present disclosure reports, among other things, a programmable platform for transcript targeting applications utilizing a Type VI-D RNA- targeting Cas ribonuclease, CasRx.
- the present disclosure provides methods for genetically encoding CasRx allowing for CRISPR-based transcript targeting manifesting as visible phenotypes comparable to previous gene knockdown experiments. Through genetic and bioinformatic analysis, the disclosure demonstrates on-target transcript knockdown capabilities of CasRx.
- the disclosure also includes description of off-target effects following on-target transcript cleavage by CasRx, providing the first evidence of off-target activity expressing a Type VI ribonuclease in eukaryotes.
- the disclosure provides the use of a programmable RNA-targeting Cas system in e.g., Drosophila melanogaster, and provides alternative approaches for in vivo gene knockdown studies.
- CRISPR functions via the association of CRISPR RNAs (crRNAs) and CRISPR- associated (Cas) proteins to provide adaptive and heritable immunity to protect prokaryotic hosts from foreign genetic elements and invading viruses.
- crRNAs CRISPR RNAs
- Cas CRISPR-associated proteins
- it acts as a programmable RNA-guided nuclease capable of degrading exogenous nucleic acids (DNA or RNA) by exploiting molecular memory of prior infections archived as heritable DNA sequences in CRISPR arrays.
- These CRISPR arrays consist of altering repeats and invader- derived (spacer) DNA sequences which get transcribed and then processed into small, mature crRNAs.
- Mature crRNAs then combine with Cas proteins to form crRNA-Cas complexes, which target and cleave specific nucleic acid sequences.
- CRISPR systems There are several types and subtypes of CRISPR systems found in bacteria that utilize a diversity of proteins and mechanisms to provide immunity. For example, Type I, II, V (and perhaps IV) target DNA, while Type III targets both DNA and RNA, and Type VI targets RNA exclusively.
- RNA interference RNA interference
- the present disclosure provides the first use of a Cas-based RNA-targeting system through CasRx- mediated transcript targeting in vivo, e.g., in flies.
- the methods and compositions provided herein involve CasRx and guide RNA arrays (gRNA a,Ta ) that are encoded in the genome to promote robust expression throughout development.
- RNA sequencing RNA sequencing
- nuclease can refer to an enzyme which possesses endonucleolytic catalytic activity for polynucleotide cleavage.
- A“target RNA” as used herein can include an RNA that can include a“target sequence”.
- the term“target sequence” can refer to a nucleic acid sequence present in a target RNA to which a spacer of a guide RNA can hybridize, provided sufficient conditions for hybridization exist. Hybridization between the spacer and the target sequence can, for example, be based on Watson-Crick base pairing rules, which enables programmability in the spacer sequence.
- the spacer sequence can be designed, for instance, to hybridize with any target sequence.
- The“spacer” within a guide RNA can include a nucleotide sequence that is complementary to a specific sequence within a target RNA. “Binding” as used herein can refer to a non-covalent interaction between
- macromolecules e.g., between a protein and a nucleic acid. While in a state of non-covalent interaction, the macromolecules are said to be“associated” or“interacting” or“binding”
- Binding interactions are generally characterized by a dissociation constant (Kd) of less than 10 6 M, less than 10 7 M, less than 10 8 M, less than 10 9 M, less than 10 10 M, less than 10 11 M, less than 10 12 M, less than 10 13 M, less than 10 14 M, or less than 10 15 M.
- Kd is dependent on environmental conditions, e.g., pH and temperature, as is known by those in the art.“Affinity” refers to the strength of binding, and increased binding affinity is correlated with a lower Kd.
- hybridizing can refer to the pairing of substantially complementary or complementary nucleic acid sequences within two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence joins with a substantially or fully complementary sequence through base pairing to form a hybridization complex. For purposes of hybridization, two nucleic acid sequences or segments of sequences are“substantially complementary” if at least 80% of their individual bases are
- “operably linked” can refer to the situation in which part of a linear DNA sequence can influence the other parts of the same DNA molecule. For example, when a promoter controls the transcription of the coding sequence, it is operatively linked to the coding sequence.
- a“polypeptide” can include proteins, fragments of proteins, and peptides, whether isolated from natural sources, produced by recombinant techniques, or chemically synthesized.
- a polypeptide may have one or more modifications, such as a post- translational modification (such as glycosylation, etc.) or any other modification (such as PEGylation, etc.).
- the polypeptide may contain one or more non-naturally-occurring amino acids (such as an amino acid with a side chain modification).
- Polypeptides described herein typically comprise at least about 10 amino acids.
- contacting” a cell with a nucleic acid molecule can be allowing the nucleic acid molecule to be in sufficient proximity with the cell such that the nucleic acid molecule can be introduced into the cell.
- A“promoter” can be a region of DNA that leads to initiation of transcription of a gene.
- A“motif’ can be a nucleotide or amino acid sequence pattern that is correlated with biological significance or function.
- nucleic acid molecules comprising: (a) a sequence encoding a Cas 13 polypeptide; and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Cas 13 -specific direct repeats, where the spacers are capable of specifically hybridizing with one or more target RNAs.
- Nucleic acid molecules can include a DNA sequence or an RNA sequence.
- the Cas 13 polypeptide can be any of the Cas 13 polypeptides described herein or known in the art.“Casl3 polypeptides” and“Casl3” are used interchangeably herein.
- Casl3 are RNA-targeting programmable nucleases associated with Type VI CRISPR-Cas systems. Type VI CRISPR-Cas systems are dedicated RNA-targeting immune systems in prokaryotes.
- Casl3 family contains at least four known subtypes, including Casl3a (formerly C2c2), Casl3b, Casl3c and Casl3d.
- Type VI-A and VI-B systems possess the crRNA-dependent target cleavage activity and a non-specific, collateral RNase activity that is stimulated by target recognition and cleavage. Both of these activities are mediated by the two HEPN domains contained in type VI effectors Casl3a and Casl3b (Yan et al. Molecular Cell 70(2): 327-339, 2018).
- the Casl3 is a Casl3d protein.
- Casl3d are effectors associated with subtype VI-D, a variant of type VI CRISPR-Cas, and have robust target cleavage and collateral RNase activities along with their ability to process pre-crRNA.
- Cas 13d has a smaller size compared to other Cas 13s and can be advantageous for RNA targeting applications described herein, such as for packaging into a viral vector for delivery.
- Cas 13 can be guided by a guide RNA which encodes target specificity.
- the Cas 13 protein complexes with the guide RNA via recognition of a short hairpin in the crRNA and target specificity is encoded by a spacer that is complementary to the target region.
- Casl3s exhibit collateral activity after recognition and cleavage of a target transcript, leading to non-specific degradation of any nearby transcripts regardless of complementarity to the spacer.
- Cas 13 can process its own pre- crRNAs, allowing individual short single crRNAs to be customized to target RNA in vitro or to provide Escherichia coli with programmable immunity against the lytic single-stranded RNA MS2 bacteriophage.
- CRISPR/Casl3 can have broad applicability as an RNAi-like platform for RNA silencing. Compared to small RNAs and RNA interference, which are difficult in design and are limited by high off-target potential, CRISPR/Casl3 can be used to manipulate only the target RNA, with few or no off-target effects in eukaryotes, and multiple crRNAs can be used to eradicate a particular mRNA transcript.
- the Casl3 polypeptides can be naturally-occurring or non-naturally occurring.
- the Casl3 polypeptides can be a mutant Casl3 polypeptide (e.g., a mutant of a naturally occurring Casl3 polypeptide).
- Mutant Casl3 can have altered activity compared to a naturally occurring Casl3, such as altered nuclease activity without substantially diminished binding affinity to RNA).
- the mutant Casl3 has no nuclease (e.g., ribonuclease) activity.
- mutant Casl3 encodes a ribonuclease with the positively charged catalytic residues of the HEPN motifs inactivated thereby eliminating programmable RNA cleavage without affecting guide RNA array processing, or target RNA binding.
- the Casl3 can have a size of about 700 to about 1200 amino acids (e.g., about 700 to about 1100, about 700 to about 1000, about 700 to about 900, about 700 to about 800, about 800 to about 1200, about 800 to about 1100, about 800 to about 1000, about 800 to about 900, about 900 to about 1200, about 900 to about 1100, about 900 to about 1000, about 1000 to about 1200, about 1000 to about 1100, or about 1100 to about 1200 amino acids).
- the Casl3 has a size of about 930 amino acids.
- the Casl3 is Casl3d.
- Casl3d derived from a variety of species are contemplated herein, including but not limited to, Ruminococcus sp., Ruminoccocus flavefaciens, Ruminoccocus albus, and Eubacterium siraeum.
- the Casl3d is derived from Ruminococcus flavefaciens strain XPD3002 (e.g., CasRx or RfxCasl3d).
- the Casl3d is a catalytically inactive version of CasRx (e.g.
- dCasRx An exemplary sequence of CasRx (NLS- RfxCasl3d-NLS) can be found at Plasmid #109049 (pXROOl : EFla-CasRx-2A-EGFP, addgene).
- sequence encoding a Casl3 polypeptide described herein can be at least 80% identical (e.g. at least 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, or 99% identical) to the sequence of RfxCasl3d. In some instances, the sequence encoding a Casl3 polypeptide is identical to the sequence of Casl3d.
- the nucleic acid molecule provided herein comprises a sequence encoding a Casl3 protein and further comprises one or more localization signals.
- Localization signals can be an amino acid sequence on a protein that tags the protein for transportation to a particular location in a cell.
- An exemplary localization signal is nuclear localization signal, which can be an amino acid sequence that tags a protein for import into the cell nucleus by nuclear transport.
- the localization signals can be operably linked to the sequence encoding a Casl3 protein.
- the localization signal is a nuclear localization signal.
- the sequence encoding Casl3 can encode two nuclear localization signals, where upon translation, the Casl3 is fused to N- and C- terminal nuclear localization signals.
- NLS is SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 1)) and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 2)).
- Other NLSs are known in the art; see, e.g., Konermann et al, Cell 173:665-676, 2018; Cokol et al., EMBO Rep. 1(5):411-415 (2000); Freitas and Cunha, Curr Genomics 10(8): 550-557 (2009).
- the sequence encoding a Casl3 polypeptide is operably linked to a promoter.
- Suitable promoters include but are not limited to ubiquitous promoters (e.g., ubiquitin promoter), tissue-specific promoters, inducible promoters, and constitutive promoters.
- sequence encoding a Casl3 polypeptide can be further operably linked to a sequence that encodes one or more reporter genes. Any suitable reporter genes are contemplated, including but not limited to, fluorescent reporters.
- guide RNAs comprising one or more spacers and one or more Casl3-specific direct repeats, where the spacers are capable of specifically hybridizing with one or more target RNAs. Also provided herein are sequences encoding the guide RNAs provided herein.
- the guide RNA can include at least one (e.g., at least two, three, four, five, six, or seven) spacers.
- the spacers can bind to the same or different target sequences in the same target RNA, or can bind to different target RNAs.
- the spacers can be designed to target any sequence in a target RNA. In instances where two or more spacers are included in the guide RNA, the spacers can have the same or different length.
- the spacers can have a length of between 20 to 40 nucleotides (e.g., 20 to 35, 20 to 30, 20 to 25, 25 to 40, 25 to 35, 25 to 30,
- the spacers can have a length of about 30 nucleotides.
- the guide RNA can include at least one (e.g., at least two, three, four, five, six, or seven) direct repeats.
- a direct repeat can be a repetitive sequence within a CRISPR locus that are interspersed by short spacers.
- a direct repeat sequence can have homology to a trans activating CRISPR RNA, and facilitates the formation of a crRNA: tracrRNA duplex.
- the sequence and secondary structure of Cas 13-specific direct repeats can be dependent on the specific Casl3. For instance, Casl3d from different species can have different direct repeat sequences and/or secondary structures. Exemplary direct repeat sequences for Casl3d can be found at e.g. Konnerman et al. Cell 173:665-676 (2016).
- the Casl3-specific direct repeats in the guide RNA provided herein can be chosen based on the specific Cas 13 used. Direct repeat sequences functioning together with Cas 13 proteins of various bacterial species may be identified by bioinformatic analysis of sequence repeats occurring in the respective
- the Cas 13-specific direct repeats can be about 30 to about 40 (e.g., about 31, 32, 33, 34, 35, 36, 37, 38, or 39) nucleotides in length. In some instances, the Cas 13-specific (e.g., Casl3d-specific) direct repeats are about 36 nucleotides in length. In some instances, the direct repeats form a hairpin structure capable of interacting with the Casl3 polypeptide to form a complex. In some instances, the Casl3- specific direct repeats are Casl3d-specific direct repeats. Exemplary Casl3d-specific direct repeat sequences can be found at Konermann et al. Cell 173:665-676 (2016).
- RfxCasl3d-specific direct repeat An exemplary sequence of a RfxCasl3d-specific direct repeat is shown below (SEQ ID NO: 3): CAAGUAAACCCCUACCAACUGGUCGGGGUUUGAAAC
- the direct repeats in the guide RNA described herein can include a sequence that is at least 80% identical (e.g. at least 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99% identical) to SEQ ID NO: 3.
- the spacers can be arranged in tandem and interspersed by direct repeats.
- a spacer can be positioned between two direct repeats.
- the guide RNA can include, e.g., as part of its sequence, [direct repeat 1 - spacer 1 - direct repeat 2 - spacer 2 - direct repeat 3 - spacer 3 - direct repeat 4 - spacer 4 - direct repeat 5]
- the guide RNA includes n spacers and n+1 direct repeats, where n > 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10).
- nucleic acid molecules that encode the guide RNA Some embodiments provide vectors comprising nucleic acid molecules encoding the guide RNA. Nucleic acid molecules encoding the guide RNA can be operably linked to one or more promoters. Any suitable promoters described herein and known in the art are contemplated, such as but not limited to, a polymerase III promoter, such as a polymerase-3 U6 (U6:3) promoter. Exemplary U6 promoters can be found e.g., in Xia et al. Nucleic Acids Res. 31(17) elOO; or at Addgene plasmid #112688 (gRNA[Sxl].1026B).
- a polymerase III promoter such as a polymerase-3 U6 (U6:3) promoter.
- Exemplary U6 promoters can be found e.g., in Xia et al. Nucleic Acids Res. 31(17) elOO; or at Addgene plasm
- Nucleic acid molecules encoding the guide RNA can be further operably linked to sequences that encode one or more reporter genes. Any suitable reporter genes are contemplated, including but not limited to, fluorescent reporters.
- vectors e.g. viral vectors
- nucleic acid molecules comprising a sequence encoding a Casl3 polypeptide (e.g. any Casl3 polypeptides described herein) and/or a sequence encoding a guide RNA (e.g. any guide RNAs described herein).
- the viral vector is an Adeno-associated viral vector (AAV).
- Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle.
- AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo.
- AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther. 2009 Aug; 11(4): 442-447; Asokan et al, Mol Ther. 2012 April; 20(4): 699-708.
- AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression.
- AAV2, AAV5, AAV2/5, AAV2/8 and AAV2/7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al, Vision Research 2008, 48(3):377-385; Khani et al, Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3954-61; Allocca et al, J. Virol. 2007 81(20): 11372-11380).
- the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in
- PCT/US2014/060163 for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT/US2014/060163, and a Cas9 sequence and guide RNA sequence as described herein.
- the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44.
- the AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype.
- ITRs inverted terminal repeats
- Exemplary left and right ITRs are presented in Table 6 of WO 2018/026976. It should be noted, however, that numerous modified versions of the AAV2 ITRs are used in the field, and the ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure.
- Expression of Casl3 and/or guide RNA in the AAV vector can be driven by a promoter described herein or known in the art.
- the target RNA can be any RNA molecules endogenous or exogenous to a eukaryotic cell, and can be protein-coding or non-protein-coding.
- RNA targets are contemplated herein.
- a target RNA can be messenger RNA (mRNA), ribosomal RNA (rRNA), signal recognition particle RNA (SRP RNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), antisense RNA (aRNA), long noncoding RNA (IncRNA), microRNA (miRNA), piwi-interacting RNA (piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), retrotransposon RNA, viral genome RNA, viral noncoding RNA, or the like.
- a guide RNA provided herein can include spacers that are capable of specifically hybridizing with the same target RNA or at least two different target RNAs.
- the RNA can be a viral RNA (e.g., single stranded viral RNA).
- the viral RNA can be from an anthropod-bome virus (arboviruse), such as but not limited to tick- borne viruses, midge-borne viruses, and mosquito-borne viruses.
- anthropod-bome virus arboviruse
- Exemplary viruses include, but are not limited to, Zika, Chikungunya, Dengue, Yellow fever, West Nile, Japanese encephalitis, Rift Valley fever, and Eastern equine encephalitis viruses. See, e.g. Reynolds et al. Comp Med 67(3):232-241 (2017).
- Additional viruses contemplated include, but are not limited to, lymphocytic choriomeningitis virus (LCMV), influenza A virus (IAV), and vesicular stomatitis virus (VSV). Additional viral RNAs that can be targeted by the compositions and methods described here in can be found at e.g., Frejie et al, Molecular Cell, 76(5):826-837. Collateral cleavage and tissue-specific cell death resulting from the use of the systems provided herein can be useful for ssRNA virus targeting in arbovirus vectors.
- LCMV lymphocytic choriomeningitis virus
- IAV influenza A virus
- VSV vesicular stomatitis virus
- the present disclosure provides methods of modifying a target RNA in a cell.
- the methods can include introducing a nucleic acid sequence encoding a Casl3 polypeptide (e.g., any of the Casl3 polypeptides described herein) and a guide RNA (e.g., any of the guide RNAs described herein) into the cell.
- the sequence encoding a Casl3 protein and the guide RNA can be introduced into the cell in the same nucleic acid molecule or in different nucleic acid molecules.
- the methods include contacting the cell with (a) a nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide, and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Cas 13 -specific direct repeats, wherein the one or more spacers are capable of specifically hybridizing with the target RNA.
- the sequence encoding a Cas 13 polypeptide is introduced via a first vector (e.g. any suitable vectors described herein) and the guide RNA is introduced via a second vector (e.g. any suitable vectors described herein).
- cells comprising the nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide and/or a sequence encoding a guide RNA described herein.
- compositions for and methods of monitoring target RNA modification e.g., in a cell, comprising monitoring the presence and/or levels of a target RNA, or monitoring the presence and/or levels of a protein corresponding to a target RNA (e.g. for protein-coding RNA).
- a target RNA e.g. for protein-coding RNA
- Any suitable techniques and assays for monitoring RNA and/or protein levels known in the art are contemplated herein. Exemplary methods include in situ hybridization, antibody staining, and RNA sequencing.
- a“transgenic organism” can include a non-human animal in which one or more of the cells of the organism includes a transgene.
- the organism can be a vertebrate or an invertebrate, such as an arthropod (e.g., an insect).
- a transgenic organism provided herein has a recombinant nucleic acid molecule stably integrated into the genome of the organism, wherein the recombinant nucleic acid molecule comprises a sequence that encodes a Casl3 polypeptide (e.g. any of the Casl3 polypeptides described herein).
- a transgenic organism has two or more recombinant nucleic acid molecules stably integrated into the genome of the organism, comprising at least a first recombinant nucleic acid molecule that comprises a sequence encoding a Casl3 polypeptide, and a second recombinant nucleic acid molecule that comprises a sequence that encodes a guide RNA.
- a founder animal carrying a recombinant nucleic acid comprising a sequence that encodes a Casl3 polypeptide can be identified based upon the presence of the sequence in its genome and/or expression of Casl3 in tissues or cells of the animal.
- a founder animal carrying a recombinant nucleic acid comprising a sequence that encodes a guide RNA can be identified based upon the presence of the sequence in its genome.
- a transgenic founder animal can then be used to breed additional animals carrying the transgene.
- a transgenic animal can be heterozygous or homozygous for the transgenes.
- WO2016049024 See, e.g., US 4,873,191
- retrovirus mediated gene transfer into germ lines See, e.g., US 4,873,191
- retrovirus mediated gene transfer into germ lines See, e.g., US 4,873,191
- fetal fibroblasts can be genetically modified using CRISPR as described herein, and then fused with enucleated oocytes. After activation of the oocytes, the eggs are cultured to the blastocyst stage. See, for example, Cibelli et al, Science, 280: 1256-1258 (1998).
- the present disclosure also provides a population of cells isolated from an organism as described herein, as well as primary or cultured cells, e.g., isolated cells, engineered to include a sequence that encodes a Casl3 protein and/or a guide RNA.
- the cells can be isolated from any of the transgenic animals described above.
- methods of introducing the transgenes described herein into a cell e.g., primary cells or cultured cells. Exemplary methods include viral delivery (e.g., using viral vectors) and electroporation.
- flies were engineered to encode the CasRx ribonuclease.
- two transgenes were generated utilizing a broadly expressing ubiquitin (Ubiq) promoter to drive expression of either CasRx (Ubiq-CasRx), or a catalytically inactive version of the ribonuclease, termed dCasRx (Ubiq-dCasRx), used as a negative control (FIG. 1).
- Ubiq ubiquitin
- dCasRx encodes a ribonuclease with the positively charged catalytic residues of the HEPN motifs inactivated thereby eliminating programmable RNA cleavage without affecting gRNA aiTa processing, or target RNA binding.
- Transgenic lines integrating each transgene site-specifically were established using an available ⁇ >C31 docking site located on the 2nd chromosome (attp40w) (FIG. 1, Table 1). While these flies were viable, homozygotes were able to be generated, for neither CasRx nor dCasRx, presumably due to high levels of ubiquitous ribonuclease expression.
- Each array consisted of four ssRNA transcript-targeting spacers (30nt in length) each positioned between CasRx-specific direct repeats (36nt in length) with a conserved 5’- AAAAC motif designed to be processed by either CasRx or dCasRx (FIG. 1).
- the transgene was site-specifically integrated at an available 0C31 docking site located on the 3rd chromosome (site 8622) and a homozygous transgenic line was established (FIG. 1, Table 1).
- Table 1 shows transgenic fly lines used in this study. List of transgenic fly lines used in this study identifying the corresponding Addgene vector number, the
- Bloomington Drosophila Stock Center stock number and the components of each integrated construct.
- FIG. 2B shows inheritance and penetrance rates of transheterozygous flies inheriting both Ubiq-CasRx, or Ubiq-dCasRx, and gRNA array corresponding to the box in FIG. 2A. Phenotype penetrance rate is depicted by shading in the box plot.
- FIG. 2C shows brightfield images of transheterozygous flies with representative phenotypes for each cross. Corresponding genotype for each image is dictated by the combination of constructs on top of the columns and the side of the rows. Clear pigment reduction is visible in both gRNA" and gRNATM crosses.
- FIG. 3 shows the complete inheritance plot of bidirectional crosses featured in FIG. 2B.
- the plot includes all genotypes scored in all crosses between Ubiq-CasRx or Ubiq-dCasRx and a respective gRNA array .
- gRNA array only inheritance is dramatically higher than transheterozygote inheritance rates including Ubiq-dCasRx crosses.
- FIG. 4B shows transheterozygote percentages through larval, pupal, and adult development periods for each gRNA array producing a lethal phenotype (N, y, GFP). No Ubiq-CasRx transheterozygotes developed beyond larvae.
- Table 2 shows the complete data set for the Ubiq-CasRx and Ubiq-dCasRx bidirectional crosses. Absolute counts of inheritance and phenotype penetrance for maternal and paternal inheritance of Ubiq-CasRx and Ubiq-dCasRx crosses to gRNA array or Ubiq-Fluc- Ubiq-Rluc expressing flies. Each cross (paternal and maternal) was done in triplicate.
- Gal4 driver lines that restricted expression to either the eye (GMR-Gal4), embryos and imaginal discs (armadillo-Gal4), or the wing and body (yellow-Gal4) (Table 1) were used, and the same homozygous gRNA aiTa lines described above targeting w, cn, wg, y, or N (FIG. 1, Table 1) were used.
- a 2-step genetic crossing scheme was performed to generate F2 triple transheterozygotes (either UASt-CasRx/+; gRNA a " a /Gal4 or UASt-dCasRx/+; gRNA a " a /Gal4) (Fig. 2A).
- the second step was to cross the F 1 transheterozygote males expressing both a CasRx ribonuclease and the gRNA array (UASt- CasRx/+; gRNA array /TM6 or UASt-dCasRx/+; gRNA array /TM6) to respective homozygous Gal4 driver lines generating F2 triple transheterozygotes (UASt-CasRx/+; gRNA array /Gal4 or UASt-dCasRx/+; gRNA a " ay /Gal4) to be scored for phenotypes (FIG. 5A).
- tissue-specific expression of CasRx can indeed result in expected phenotypes, however this was occasionally accompanied by tissue-specific cell death, or lethality, similar to previous observations described above.
- tissue-specific expression of CasRx can indeed result in expected phenotypes, however this was occasionally accompanied by tissue-specific cell death, or lethality, similar to previous observations described above.
- tissue-specific expression of CasRx can indeed result in expected phenotypes, however this was occasionally accompanied by tissue-specific cell death, or lethality, similar to previous observations described above.
- the gRNA" F2 triple transheterozygote inheritance rate was significantly less than the corresponding negative control F2 triple transheterozygote (UASt-dCasRx/+; gRNA w /GMR-Gal4) inheritance rate which was closer to the expected 25% Mendelian inheritance (27.6%) (FIG. 6, Table 3).
- UASt-dCasRx/+; gRNA w /GMR-Gal4 negative control F2 triple transheterozygote
- transheterozygotes UASt-CasRx/+; gRNA N /GMR-Gal4 compared to 29.3% inheritance rate for the negative control F2 triple transheterozygotes (UASt-dCasRx/+; gRNA N /GMR-Gal4) (FIGs. 5B, 5C, and 6, Table 3). All gRNATM F2 triple transheterozygotes (UASt-CasRx/+, gRNA cn /GMR-Gal4) displayed pigment reduction along with a mild cell death phenotype in their eyes (FIG.
- crosses were performed using the armadillo-Gal4 driver (arm-Gal4) (arm-Gal4/arm-Gal4; +/+) and, interestingly, the F2 triple transheterozygotes (UASt-CasRx/arm-GAL4; gRNA wg /+) were 100% lethal while the negative control F2 triple transheterozygotes (UASt-dCasRx/arm-GAL4; gRNA wg /+) were viable and inherited transgenes near the expected rate (29.7%) (FIGs. 5B, 5C, and 6, Table 3).
- FIG. 5B shows the inheritance rates of triple transheterozygous flies inheriting 3 transgenes (UASt-CasRx or UASt-dCasRx, gRNA array , and Gal4-driver), corresponding to flies highlighted in red box in panel A.
- FIG. 6 shows a plot that includes all genotypes scored in all crosses for UASt-CasRx and UASt-dCasRx.
- This assay comprised of ubiquitously expressed firefly luciferase (Flue) and a control renilla luciferase (Rluc) (Ubiq-Fluc-Ubiq-Rluc) (FIG. 1) enabling normalization and allowing for
- the reporter construct was integrated at an available ⁇ >C31 docking site on the 3rd chromosome (site 9744) and generated a homozygous transgenic stock (+/+; Ubiq-Fluc- Ubiq-Rluc/Ubiq-Fluc-Ubiq-Rluc) (FIG. 1, Table 1).
- gRNA Fluc A gRNA aiTa - targeting Flue (gRNA Fluc ) was then engineered, and a homozygous transgenic stock (+/+; gRNA Fluc /gRNA Fluc ) was generated by integrating the gRNA anav on the 3rd chromosome using 0C3 1 integration (site 8622) (FIG. 1, Table 1).
- a 2-step cross was followed by initially mating heterozygous, double-balanced Ubiq-CasRx (Ubiq-CasRx/CyO; TM6/+) flies, or Ubiq- dCasRx (Ubiq-dCasRx/CyO; TM6/+) negative controls to homozygous dual luciferase reporter flies (Ubiq-Fluc-Ubiq-Rluc/Ubiq-Fluc-Ubiq-Rluc).
- F i transheterozygous males carrying the TM6 balancer chromosome (Ubiq-CasRx/+; Ubiq-Fluc-Ubiq-Rluc/TM6 or Ubiq-dCasRx/+; Ubiq-Fluc-Ubiq-Rluc/TM6) were then crossed to homozygous gRNA Fluc (+/+; gRNA Fluc /gRNA Fluc ) expressing flies (FIG. 7A).
- FIG. 8 shows dual-luciferase reporter system transgenic markers, with representative markers for each construct. The top row is a bright field image of all respective genotypes involved in the reporter system (a heterozygote is used in the first column to demonstrate the expected GFP expression). w + represents either Ubiq- Fluc-Ubiq-Rluc or gRNA Fluc expression.
- OpIE2-dsRed expression represents Ubiq-CasRx or Ubiq-dCasRx expression. (Left to right) Ubiq-Fluc-Ubiq-Rluc heterozygote, Ubiq- CasRx/Ubiq-Fluc-Ubiq-Rluc transheterozygote, Ubiq-dCasRx/Ubiq-Fluc-Ubiq-Rluc transheterozygote, and Ubiq-dCasRx/Ubiq-Fluc-Ubiq-Rluc/gRNA Fluc triple
- a GFP reporter assay was generated to directly visualize CasRx-mediated transcript knockdown.
- a binary GFP reporter construct was generated, comprised of both a CasRx gRNA array targeting GFP along with GFP expression driven by the broadly expressing OpIE2 promoter (gRNA GF ) (FIGs. 9A-9C, FIG. 1, Table 1).
- a homozygous transgenic line (+/+; gRNA' ,/ / '-OpIE2-GFP/gRNA' ,/ / '-OpIE2-GFP) was established by site-specifically integrating the construct at an available 0C3 1 docking site located on the 3rd chromosome (site 8622) (FIG. 1, Table 1).
- RNA-targeting activity and the lethality is dependent upon the availability of a broadly expressed target sequence as well as enzymatic RNA cleavage mediated by the positively charged residues of CasRx HEPN domains.
- RNAseq analysis was implemented comparing Fi Ubiq-CasRx transheterozygotes (Ubiq-CasRx/+; gRNA ana /+) compared to control Fi Ubiq-dCasRx transheterozygotes (Ubiq-dCasRx/+; gRNA array /+) (FIG. 2A box with asterisk, FIG. 9A box with asterisk, Table 5).
- FIG. 10 shows modENCODE transcript expression relative to Drosophila melanogaster development. Black box indicates which developmental period was chosen for RNA sequencing of samples for analysis of CasRx-mediated transcript knockdown in Ubiq-CasRx vs Ubiq-dCasRx comparison. Not included: GFP 1 st instar larvae were chosen for analysis of GFP transcript knockdown.
- FIGs. 1 lA-11C show quantification of CasRx-mediated on/off target activity.
- FIG. 11 A shows maximum a posteriori (MAP) estimates for the logarithmic fold change (LFC) of transcripts.
- DESeq2 pipeline was used for estimating shrunken MAP LFCs. Wald test with Benjamini-Hochberg correction was used for statistical inference.
- Grey dots represent transcripts not significantly differentially expressed between Ubiq-CasRx and Ubiq-dCasRx group (p > 0.05).
- FIG. 11C shows percentage of transcripts significantly differentially expressed resulting from CasRx cleavage. Pairwise two-sample test for independent proportions with Benjamini-Hochberg correction was used to calculate significance.
- Gadd45 a gene involved in cellular arrest and apoptosis in Drosophila melanogaster, was found to be significantly misexpressed in 4 samples (w, N, y, and GFP). It is possible that CasRx cleavage may result in a dramatically higher number of misexpressed genes and possible lethality or cellular apoptosis.
- Casl3 enzymes have been proposed to be highly specific ribonucleases with the ability to replace previously developed RNAi technologies. dCasl3 enzymes retain efficient RNA binding activity and can be modified to effectively diminish the promiscuous RNase activity of Casl3 ribonucleases. Previous studies have utilized dCasl3 enzymes for RNA base editing, dynamic imaging of RNA, and to manipulate pre-mRNA splicing, demonstrating both the specificity and versatility of dCasl3 RNA binding. Further modifications to dCasRx may provide viable alternatives for targeted transcript degradation in flies through manipulation of the nonsense mediated mRNA decay (NMD) pathway or through inhibition of proper transcript splicing. However, there remain advantages to the catalytic activity of CasRx and other Casl3 ribonucleases, including the promiscuous RNase activity these enzymes exhibit.
- NMD nonsense mediated mRNA decay
- the CasRx RNA targeting system in arthropods provides a platform to reduce the spread of ssRNA arboviruses by directly targeting ssRNA virus genomes in a programmable manner. In this case, collateral cleavage and tissue-specific cell death may serve as a significant advantage for ssRNA virus targeting in arbovirus vectors.
- FIGs. 12A and 12B show CasRx-gRNA aiTav transcript target selection and construct generation.
- FIG. 12A is a schematic representing the workflow for gRNA choice.
- the transcript CDS for a GOI is entered into the mFold database (condition: 25°C) where predictive analysis identifies the most probable secondary and tertiary folding of the entire transcript.
- We then chose specific regions predicted to be easily accessible for CasRx targeting blue line
- FIG. 12B is a schematic showing the generation of gRNA array construct.
- dsDNA is first synthesized to contain 4 spacer and 5 DR sequences with specific restriction sites present on the 5’ and 3’ end of the DNA. Simultaneously the vector backbone containing the miniwhite marker, a U6:3 promoter fragment, and an attB site is digested using the corresponding restriction sites of the dsDNA gene fragment. The two pieces are then ligated together to generate a CasRx gRNA array covering the majority of the transcript for the GOI.A11 RNA folding/hairpin analysis was performed using the mFold server. For transgenic gRNA arrays, 4 targets per gene were selected to ensure efficient targeting.
- Casl3d ribonucleases were shown to possess gRNA processing RNase activity without additional helper ribonucleases.
- OA-1050E Additional plasmid # 132416, Ubiq-CasRx
- OA-1050R Additional plasmid # 132417, Ubiq-dCasRx
- the SpCas9-T2A-GFP fragment was removed from the base vector by cutting with restriction enzymes Swal and Pad, and then replaced with CasRx and dCasRx fragments amplified with primers 1050E.C3 and 1050E.C4 (Table 15) from constructs pNLS-RfxCasl3d-NLS-HA (pCasRx) and pNLS-dRfxCasl3d-NLS-HA (pdCasRx), respectively.
- OA-1050L Additional plasmid # 132418, UASt-CasRx
- OA-1050S Additional plasmid # 132419, UASt-dCasRx
- the base vector described above was digested with restriction enzymes Notl and Pad to remove the Ubiq promoter and SpCas9-T2A-GFP fragments. And then UASt promoter fragment and CasRx or dCasRx fragments, respectively, were cloned in.
- the UASt promoter fragment was amplified from plasmid pJFRC81, with primers 1041. C9 and 1041. Cl 1 (Table 15).
- the CasRx and dCasRx fragments were amplified with primers 1050L.C1 and 1050E.C4 (Table 15) from constructs pCasRx and pdCasRx, respectively.
- OA-1050G Additional plasmid # 132420
- OA-1050I Additional plasmid # 132421
- OA-1050J Additional plasmid # 133304
- OA-1050K Additional plasmid # 132422
- OA-1050U Additional plasmid # 132423
- OA- 1050V Additional plasmid # 132424
- OA-1050Z4 Additional plasmid # 132425
- Addgene plasmid # 112688 containing the miniwhite gene as a marker, an attB-docking site, a I) melanogaster polymerase-3 U6 (U6:3) promoter fragment, and a guide RNA fragment with a target, scaffold, and terminator sequence (gRNA) was digested with restriction enzymes Ascl and Xbal to remove the U6:3 promoter and gRNA fragments. Then the U6:3 promoter fragment amplified from the same Addgene plasmid # 112688 with primers 1043. Cl and 1043.
- OA-1050G was digested with restriction enzymes Pstl and Notl, a fragment containing arrays of four tandem variable gRNAs (comprised of a 36-nt direct repeat (DR) and a 30-nt spacer) corresponding to different target genes respectively, followed by an extra DR and a 7 thymines terminator was synthesized and subcloned into the digested backbone using Gene Synthesis (GenScript USA Inc., Piscataway, NJ).
- DR direct repeat
- OA-1050J To generate constructs OA-1050J, a fragment containing arrays of four tandem variable gRNAs targeting GFP with an extra DR and a 7 thymines terminator, followed by the OpIE2-GFP marker was synthesized and subcloned into the above digested OA-1043 backbone using Gene Synthesis (GenScript USA Inc., Piscataway, NJ).
- OA-1052B To assemble construct OA-1052B (Addgene plasmid # 132426), the dual-luciferase expression vector consisted of firefly luciferase linked with T2A-EGFP (Fluc-T2A-EGFP) and renilla luciferase both driven by Ubiq promoter fragment (Ubiq-Fluc-T2A-eGFP-Ubiq- Rluc), Addgene plasmid # 112688 containing the white gene as a marker, an attB-docking site as described previously was digested with enzymes Ascl and Xbal, and the following components were cloned in using the Gibson enzymatic assembly method: i) a D.
- Homozygous lines were established for UASt-CasRx and UASt- dCasRx and heterozygous balanced lines were established for Ubiq-CasRx and Ubiq-dCasRx (over Curly of Oster: CyO). All gRNA array expressing lines were generated by site- specifically integrating constructs at an available 0C31 integration site on the 3rd chromosome (site 8622). Homozygous lines were established for all gRNA ana expressing flies. Dual-luciferase reporter expressing lines were generated by site-specifically integrating the constructs at an available ⁇ >C31 integration site on the 3rd chromosome (site 9744).
- Flies were incubated at 26°C for 48h with yeast to induce embryo laying. Flies were then transferred to embryo collection chambers containing yeast-smeared grape-juice plates and incubated at 26°C overnight (16h). The grape-juice plates were then removed, embryos counted, and the grape-juice plates incubated for 24h at 26°C. Total larvae and transheterozygote larvae were then counted and the grape-juice plates transferred to jars and incubated at 26°C. Once all larvae reached the pupal stage, total and transhet pupae were counted. Finally, total adult flies and total adult transheterozygotes were counted 20 days post initial lay. Each genetic cross was set using 5$ and 10$ (paternal CasRx) or 4 $ and 8$ (maternal CasRx) flies in triplicate.
- FIG. 3A F2 triple transheterozygotes
- ⁇ $ double balanced UASt- CasRx or UASt-dCasRx expressing flies
- ⁇ $ double balanced UASt- CasRx or UASt-dCasRx expressing flies
- homozygous gRNA ana expressing flies ($) to generate Fi transheterozygote males carrying TM6 balancer chromosome.
- the Fi transheterozygote males carrying TM6 were then crossed with a Gal4 driver expressing line.
- Fi transheterozygote males carrying TM6 were selected and crossed to homozygous gRNA Fluc expressing flies. Selecting for the Ubiq-CasRx or Ubiq-dCasRx marker, dsRed, red eyes, and against TM6, F2 triple transheterozygotes inheritance was scored and males were frozen at -80°C prior to luciferase analysis. Each cross was set using 1 S and 10 $ flies in triplicate. Flies were imaged on the Leica M165FC fluorescent stereomicroscope equipped with a Leica DMC4500 color camera. Image stacks of adult flies were taken in Leica Application Suite X (LAS X) and compiled in Helicon Focus 7. Stacked images were then cropped and edited in Adobe Photoshop CC 2018.
- LAS X Leica Application Suite X
- gRNA transheterozygous adult heads were cut off one day after emerging and frozen at -80°C.
- gRNATM, gRNA" gRNA 1' flies were incubated in vials for 48h with yeast to induce embryo laying. Flies were then transferred to embryo collection chambers containing yeast-smeared grape-juice plates and incubated at 26°C for 3h.
- RNA integrity was assessed using RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513).
- RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770) following the manufacturer's instructions previously three replicates for all CasRx and dCasRx samples were sequenced and analyzed with the exception of gRNATM where 2 replicates were analyzed. In total 34 samples, 17 CasRx experimental samples and 17 dCasRx control samples, were sequenced and analyzed.
- NA Per DESeq2 analysis requirement, some values are shown as NA due to the following reasons: 1) if all samples for a given transcripts have 0 transcript counts, this transcript's baseMean will be 0 and its LFC, p value, and padj will be set to NA; 2) If one replicate of a transcript is an outlier with extreme count (detected by Cook's distance), this transcript's p value and padj will be set to NA. 3) If a transcript is found to have a low mean normalized count after automatic independent filtering, this transcript's padj will be set to NA.
- Luciferase assays To measure the efficacy of targeted CasRx knockdown a dual Luciferase reporter system comprised of both Firefly md Renilla Luciferase was utilized. A 2-step genetic crossing scheme was performed (FIG. 7A), and F2 male triple transheterozygotes were collected for luciferase quantification. Flies were aged between 2-4 days at 26°C then frozen at -80°C. Each assay was performed on 5 male flies and 5m1 of lysed tissue was used to measure Luciferase activity. Luciferase activity in flies was then analyzed using a Dual- Luciferase® Reporter Assay System with a Glomax 20/20 Luminometer (Promega El 910 & E5331).
- Embodiment 1 A method of modifying a target locus of interest in vivo in an organism, comprising delivering to said locus a Type VI CRISPR-Cas loci effector protein and one or more nucleic acid components, wherein at least the one or more nucleic acid components is engineered and the effector protein forms a complex with the one or more nucleic acid components and upon binding of said complex to the target locus of interest the effector protein induces a modification of the target locus of interest.
- Embodiment 2 The method of Embodiment 1, wherein the target locus of interest comprises RNA.
- Embodiment 3 The method of Embodiment 2, wherein the target locus of interest comprises endogenous mRNA.
- Embodiment 4 The method of any one of Embodiments 1-3, wherein the modification of the target locus of interest comprises a strand break.
- Embodiment 5 The method of any one of Embodiments 1-4, wherein the effector protein and one or more nucleic acid components are non-naturally occurring.
- Embodiment 6 The method of any one of Embodiments 1-5, wherein the effector protein is encoded by a subtype VI-D CRISPR-Cas loci.
- Embodiment 7 The method of Embodiment 6, wherein the effector protein comprises Casl3d.
- Embodiment 8 The method of Embodiment 7, wherein the Casl3d is derived from Ruminococcus flavefaciens.
- Embodiment 9 The method of any one of Embodiments 1-8, wherein the effector protein is fused to one or more localization signal.
- Embodiment 10 The method of Embodiment 9, wherein the one or more localization signal is nuclear localization signal.
- Embodiment 11 The method of any one of the preceding Embodiments, wherein when in complex with the effector protein the nucleic acid component(s) is capable of effecting or effects sequence specific binding of the complex to a target sequence of the target locus of interest.
- Embodiment 12 The method of any one of the preceding Embodiments, wherein the nucleic acid component(s) comprise one or more CRISPR RNA (crRNA) arrays and/or one or more trans-activating crRNA (tracrRNA).
- crRNA CRISPR RNA
- tracrRNA trans-activating crRNA
- Embodiment 13 The method of any one of the preceding Embodiments, wherein the nucleic acid component(s) comprise one or more CRISPR RNA (crRNA) arrays and do not comprise any trans-activating crRNA (tracrRNA).
- crRNA CRISPR RNA
- Embodiment 14 The method of Embodiments 12 or 13, wherein the one or more CRISPR RNA (crRNA) arrays are pre-crRNA arrays.
- crRNA CRISPR RNA
- Embodiment 15 The method of any one of the preceding Embodiments, wherein the effector protein and nucleic acid component(s) are provided via one or more polynucleotide molecules encoding the effector protein and/or the nucleic acid component(s), and wherein the one or more polynucleotide molecules are operably configured to express the effector protein and/or the nucleic acid component(s).
- Embodiment 16 The method of Embodiment 15, wherein the one or more polynucleotide molecules comprise one or more regulatory elements operably configured to express the effector protein and/or the nucleic acid component(s).
- Embodiment 17 The method of Embodiment 16, wherein the one or more regulatory elements are ubiquitous promoters or inducible promotors.
- Embodiment 18 The method of Embodiment 17, wherein the one or more regulatory elements comprise one or more inducible UAS promoters.
- Embodiment 19 The method of any one of Embodiments 15-18, wherein the one or more polynucleotide molecules are comprised within one or more vectors.
- Embodiment 20 The method of any one of Embodiments 15-18, wherein the one or more polynucleotide molecules are comprised in a delivery system, or the method of claim 19 wherein the one or more vectors are comprised in a delivery system.
- Embodiment 21 The method of any one of the preceding Embodiments, wherein the effector protein and one or more nucleic acid component(s) are delivered via one or more delivery vehicles comprising liposome(s), particle(s), exosome(s), microvesicle(s), a gene-gun or one or more viral vectors.
- Embodiment 22 The method of any one of the preceding Embodiments, wherein the organism is a vertebrate.
- Embodiment 23 The method of any one of the preceding Embodiments, wherein the organism is an invertebrate.
- Embodiment 24 The method of Embodiment 23, wherein the organism is an insect.
- Embodiment 25 An organism comprising a modified target locus of interest, wherein the target locus of interest has been modified according to a method of any one of the preceding Embodiments.
- Embodiment 26 The organism of Embodiment 26, wherein the organism is a vertebrate.
- Embodiment 27 The organism of Embodiment 26, wherein the organism is an invertebrate.
- Embodiment 28 The organism of Embodiment 27, wherein the organism is an insect.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Provided herein are compositions and methods for CRISPR based RNA-targeting. The compositions include nucleic acid molecules comprising a sequence encoding a Cas13 polypeptide and a sequence encoding a guide RNA comprising one or more spacers and one or more Cas13-specific direct repeats, where the spacers are capable of specifically hybridizing with one or more target RNAs. The disclosure further provides methods of modifying a target RNA in a cell and transgenic organisms.
Description
RNA- TARGETING CAS ENZYMES
CROSS-REFERENCE TO REUATED APPUICATIONS
This application claims priority to U.S. Patent Application Serial No. 62/798,078, filed January 29, 2019, which is incorporated herein by reference in its entirety.
STATEMENT OF GOVERNMENT SUPPORT
This invention was made with government support under HR0011-17-2- 0047 awarded by the Defense Advanced Research Project Agency. The government has certain rights in the invention.
BACKGROUND
The development of CRISPR as a programmable genome-engineering tool provides transformative applications for both medicine and biotechnology. However, much of the recent focus in synthetic biology has been on exploiting CRISPR to target DNA. Improved compositions and methods for utilizing CRISPR to target RNA are therefore needed.
SUMMARY
In one aspect, provided herein are nucleic acid molecule comprising: (a) a sequence encoding a Casl3 polypeptide; and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Casl3-specific direct repeats, wherein the spacers are capable of specifically hybridizing with one or more target RNAs. In some embodiments, the Casl3 is Casl3d. In some embodiments, the Casl3d is RfxCasl3d. In some embodiments, the sequence encoding the Casl3 polypeptide further comprises a localization signal. In some embodiments, the localization signal is a nuclear localization signal. In some embodiments, the target RNA is an endogenous RNA or a viral RNA. In some embodiments, the target RNA is an mRNA. In some embodiments, the spacers are positioned between two Casl3- specific direct repeats. In some embodiments, the spacers are 20 to 40 nucleotides in length. In some embodiments, the spacers are 25 to 35 nucleotides in length. The nucleic acid molecule of claim 10, wherein the spacers are about 30 nucleotides in length. In some embodiments, the Cas 13 -specific direct repeats are 25 to 45 nucleotides in length. The nucleic acid molecule of claim 12, wherein the Casl3-specific direct repeats are 30 to 40
nucleotides in length. The nucleic acid molecule of claim 13, wherein the Casl3-specific direct repeats are about 36 nucleotides in length. In some embodiments, the guide RNA further comprises a AAAAC motif at its 5’ end. In some embodiments, the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with the same target RNA. In some embodiments, the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with different target RNAs. In some embodiments, the guide RNA comprises three or more spacers. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to a ubiquitous promoter. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to an inducible promoter. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to a tissue- specific promoter. In another aspect, provided herein are vectors comprising any of the nucleic acid molecules described herein. In some embodiments, the vector is a single vector. In some embodiments, the vector is an Adeno-associated viral vector. Also provided herein are cells comprising any of the nucleic acid molecules described herein. In another aspect, provided herein are methods of modifying a target RNA in a cell, the methods comprising contacting the cell with any of the nucleic acid molecules described herein. Also provided herein are methods of modifying a target RNA in a cell, the method comprising contacting the cell with any of the vectors described herein. In some embodiments, the target RNA is endogenous RNA or viral RNA.
In another aspect, provided herein are methods of modifying a target RNA in a cell, the methods comprising contacting the cell with (a) a nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide, and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Cas 13 -specific direct repeats, wherein the one or more spacers are capable of specifically hybridizing with the target RNA. In some embodiments, the Casl3 is Casl3d. In some embodiments, the Casl3d is RfxCasl3d. In some embodiments, the sequence encoding the Cas 13 polypeptide further comprises a localization signal In some embodiments, the localization signal is a nuclear localization signal. In some embodiments, the spacers are positioned between two Casl3-specific direct repeats. In some embodiments, the spacers are 20 to 40 nucleotides in length. In some embodiments, the spacers are 25 to 35 nucleotides in length. In some embodiments, the spacers are about 30 nucleotides in length. In some embodiments, the Cas 13 -specific direct
repeats are 25 to 45 nucleotides in length. In some embodiments, the Casl3-specific direct repeats are 30 to 40 nucleotides in length. In some embodiments, the Casl3-specific direct repeats are about 36 nucleotides in length. In some embodiments, the guide RNA further comprises a AAAAC motif at its 5’ end. In some embodiments, the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with the same target RNA. In some embodiments, the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with different target RNAs. In some embodiments, the guide RNA comprises three or more spacers. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to a ubiquitous promoter. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to an inducible promoter. In some embodiments, the sequence encoding a Casl3 polypeptide is operably linked to a tissue-specific promoter. In some embodiments, the nucleic acid molecule is comprised within a first vector and the guide RNA is comprised within a second vector. In some embodiments, the first vector and/or the second vector is an AAV vector.
In another aspect, provided herein are transgenic organisms having a recombinant nucleic acid molecule stably integrated into the genome of the organisms, wherein the recombinant nucleic acid molecule comprises a sequence that encodes a Casl3 polypeptide. Also provided are transgenic organisms having two or more recombinant nucleic acid molecules stably integrated into the genome of the organism, comprising at least a first recombinant nucleic acid molecule that comprises a sequence encoding a Casl3 polypeptide, and a second recombinant nucleic acid molecule that comprises a sequence that encodes a guide RNA. In some embodiments, the Casl3 polypeptide is a Casl3d. In some
embodiments, the Casl3d polypeptide is RfxCasl3d. In some embodiments, the organism is a vertebrate. In some embodiments, the organism is an invertebrate. In some embodiments, the organism is an insect.
All publications, patents, patent applications, and information available on the internet and mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, patent application, or item of information was specifically and individually indicated to be incorporated by reference. To the extent publications, patents, patent applications, and items of information incorporated by reference
contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.
Where values are described in terms of ranges, it should be understood that the description includes the disclosure of all possible sub-ranges within such ranges, as well as specific numerical values that fall within such ranges irrespective of whether a specific numerical value or specific sub-range is expressly stated.
Various embodiments of the features of this disclosure are described herein. However, it should be understood that such embodiments are provided merely by way of example, and numerous variations, changes, and substitutions can occur to those skilled in the art without departing from the scope of this disclosure. It should also be understood that various alternatives to the specific embodiments described herein are also within the scope of this disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG.l is a schematic representation of constructs generated for the experiments described herein. All constructs used are depicted here along with addgene ID, insertion site, and Bloomington stock number.
FIGs. 2A-2C show genetic assessment of programmable CasRx-mediated transcript knockdown in flies. FIG. 2A is a representative genetic crossing schematic for generating transhetrozygotes. FIG. 2B shows inheritance and penetrance rates of transheterozygous flies inheriting both Ubiq-CasRx, or Ubiq-dCasRx, and gRNAarray corresponding to the box in FIG. 2A. Phenotype penetrance rate is depicted by shading in the box plot. FIG. 2C shows brightfield images of transheterozygous flies with representative phenotypes for each cross. Corresponding genotype for each image is dictated by the combination of constructs on top of the columns and the side of the rows.
FIG. 3 shows the complete inheritance plot of bidirectional crosses featured in FIG.
2B.
FIGs. 4A and 4B show development related inheritance and lethality of Ubiq-CasRx and Ubiq-dCasRx transheterozygotes. FIGs. 4A shows transheterozygote percentages at larval, pupal, and adult development periods for each gRNAarray producing an observable phenotype (w, cn, wg ). FIG. 4B shows transheterozygote percentages through larval, pupal, and adult development periods for each gRNAarray producing a lethal phenotype (N, y, GFP).
FIGs. 5A-5C show CasRx-mediated transcript knockdown in restricted tissue types using the binary Gal4/UAS system. FIG. 5A shows representative genetic crossing schematic demonstrating the two steps followed in each generational cross. FIG. 5B shows inheritance rates of triple transheterozygous flies inheriting 3 transgenes (UASt-CasRx or UASt-dCasRx, gRNAarray, and Gal4-driver), corresponding to flies highlighted in the box in FIG. 5 A. FIG.5C are image matrix of the triple transheterozygous flies inheriting 3 transgenes. The identities of inherited transgenes for each triple transheterozygote is specified through combination of the top and left side labels of the image matrix. The black arrow identifies tissue necrosis and pigment reduction observed from cn targeting. The white arrow identifies chitin pigment reduction in the thorax resulting fro my targeting. Black and white fly with“X” represents a lethal phenotype with no live adults able to be scored or imaged.
FIG. 6 shows complete inheritance data for binary Gal4/UAS crosses.
FIGs. 7A-7D show genetic assessment of CasRx-mediated transcript cleavage and subsequent lethality. FIG. 7 A is a representative genetic crossing schematic used to obtain triple transheterozygotes (box) for luciferase expression analysis. FIG. 7B shows total inheritance percentages for all genotypes emerging in F2 generation. FIG. 7C shows inheritance of Ubiq-CasRx/gRNAFluc or Ubiq-CasRx/Ubiq-Fluc-Ubiq-Rluc, and inheritance ratios between Ubiq-CasRx and Ubiq-dCasRx transheterozygotes. FIG. 7D shows luciferase ratios normalizing Flue readings to Rluc readings.
FIG. 8 shows dual-luciferase reporter system transgenic markers, with representative markers for each construct.
FIGs. 9A-9C show CasRx-mediated knockdown of GFP. FIG. 9A shows a representative bidirectional genetic crossing schematic. FIG. 9B shows a box plot of transheterozygote inheritance resulting from bidirectional crosses between Ubiq-CasRx or Ubiq-dCasRx and gRNA / /'-OpIE2-GFP flies (M = maternal inheritance of CasRx; P = paternal inheritance of CasRx). FIG. 9C are images of Fi larvae from paternal crosses clearly demonstrating significant reduction in GFP expression for transheterozygous larvae expressing both Ubiq-CasRx and gRNA',/ /'-OpIE2-GFP compared to control
transheterozygotes expressing Ubiq-dCasRx and gRNA''/ 7'-OpIE2-GFP or without expressing a CasRx protein. (Left-right) Ubiq-CasRx/gRNAGFP transheterozygous larvae, heterozygous gRNAGF larvae from Ubiq-CasRx cross, Ubiq-dCasRx/gRNAGFP
transheterozygous larvae, heterozygous gRNAGF larvae from Ubiq-dCasRx cross.
FIG. 10 shows modENCODE transcript expression relative to Drosophila
melanogaster development. Black box indicates which developmental period was chosen for RNA sequencing of samples for analysis of CasRx-mediated transcript knockdown in Ubiq- CasRx vs Ubiq-dCasRx comparison.
FIGs. 11A-11C show quantification of CasRx-mediated on/off target activity. FIG.
11 A shows maximum a posteriori (MAP) estimates for the logarithmic fold change (LFC) of transcripts. Grey dots represent transcripts not significantly differentially expressed between Ubiq-CasRx and Ubiq-dCasRx group (p > 0.05). Red dots represent transcripts significantly differentially expressed between CasRx and dCasRx group (p < 0.05). Pink dot identifies the respective CasRx target gene for each analysis (p value indicated in the inset). FIG. 1 IB shows transcript expression levels (TPM) of transcripts targeted with CasRx or dCasRx. FIG. l lC shows percentage of transcripts significantly differentially expressed resulting from CasRx cleavage.
FIGs. 12A and 12B are schematic diagrams showing CasRx-gRNAarray transcript target selection and construct generation. FIG. 12A is a schematic representing the workflow for gRNA choice. FIG. 12B is a schematic diagram showing the generation of gRNAarray construct.
FIG. 13 shows schematic diagrams of transcriptome engineering with RNA-targeting Type VI-D CRISPR effectors and CRISPR-Casl3 precision transcriptome engineering in cancer.
FIG. 14 shows mutant phenotypes in the eye and wing of D. melanogaster induced by RfxCasl3d and pre-crRNA arrays targeting /) melanogaster notch (CG3936) and white (CG2759) genes.
FIG. 15 is a schematic diagram showing engineered pan-antiviral effector cassettes that can target multiple RNA viruses transmitted by mosquitoes, including Zika,
chikungunya, dengue fever, and yellow fever viruses.
DETAILED DESCRIPTION
The present disclosure provides nucleic acid molecules comprising (a) a sequence encoding a Casl3 polypeptide; and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Casl3-specific direct repeats, where the spacers are capable of specifically hybridizing with one or more target RNAs. In some instances, the Casl3 is Casl3d. Also provided are methods of modifying a target RNA in a cell comprising
contacting the cell with a nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide and a sequence encoding a guide RNA described herein. The present disclosure further provides transgenic organisms having a recombinant nucleic acid molecule stably integrated into the genome of the organism, where the recombinant nucleic acid molecule comprises a sequence that encodes a Casl3 polypeptide.
Current applications of CRISPR-Cas nucleases in Drosophila melanogaster are limited to DNA-targeting class 2 systems. The present disclosure reports, among other things, a programmable platform for transcript targeting applications utilizing a Type VI-D RNA- targeting Cas ribonuclease, CasRx. The present disclosure provides methods for genetically encoding CasRx allowing for CRISPR-based transcript targeting manifesting as visible phenotypes comparable to previous gene knockdown experiments. Through genetic and bioinformatic analysis, the disclosure demonstrates on-target transcript knockdown capabilities of CasRx. The disclosure also includes description of off-target effects following on-target transcript cleavage by CasRx, providing the first evidence of off-target activity expressing a Type VI ribonuclease in eukaryotes. The disclosure provides the use of a programmable RNA-targeting Cas system in e.g., Drosophila melanogaster, and provides alternative approaches for in vivo gene knockdown studies.
CRISPR functions via the association of CRISPR RNAs (crRNAs) and CRISPR- associated (Cas) proteins to provide adaptive and heritable immunity to protect prokaryotic hosts from foreign genetic elements and invading viruses. Specifically, it acts as a programmable RNA-guided nuclease capable of degrading exogenous nucleic acids (DNA or RNA) by exploiting molecular memory of prior infections archived as heritable DNA sequences in CRISPR arrays. These CRISPR arrays consist of altering repeats and invader- derived (spacer) DNA sequences which get transcribed and then processed into small, mature crRNAs. Mature crRNAs then combine with Cas proteins to form crRNA-Cas complexes, which target and cleave specific nucleic acid sequences. There are several types and subtypes of CRISPR systems found in bacteria that utilize a diversity of proteins and mechanisms to provide immunity. For example, Type I, II, V (and perhaps IV) target DNA, while Type III targets both DNA and RNA, and Type VI targets RNA exclusively.
While much of the recent focus in synthetic biology has been on exploiting CRISPR to target DNA, the recent findings that Type VI CRISPR systems can also be reprogrammed to target RNA has revealed exciting possibilities for transcriptome engineering. For example,
one recent discovery was the finding and functional characterization of CasRx as a compact single-effector Cas enzyme that exclusively targets RNA with superior efficiency and specificity as compared to RNA interference (RNAi) (See e.g., Konermann et al. Cell 173:665-676 (2018)). In human cells, CasRx demonstrated highly efficient on-target gene knockdown with limited off-target activity. Given these characteristics, we wanted to test its functionality in Drosophila melanogaster (flies) to enable the exploration of new biological questions in vivo. While CRISPR has been used extensively to generate heritable DNA mutations in flies, RNA-targeting using CRISPR has not been demonstrated and therefore RNA-targeting in flies is restricted to the application of RNAi-based approaches.
The present disclosure provides the first use of a Cas-based RNA-targeting system through CasRx- mediated transcript targeting in vivo, e.g., in flies. In some instances, the methods and compositions provided herein involve CasRx and guide RNA arrays (gRNAa,Ta ) that are encoded in the genome to promote robust expression throughout development.
Performing bidirectional and binary genetic crosses with ubiquitous and tissue-specific expression of CasRx, the disclosure demonstrates the ability to obtain clear, highly penetrant phenotypes comparable to previously established phenotypes obtained by RNAi. In some instances, transcript knockdown are quantified through RNA sequencing (RNAseq) analysis. CasRx is shown to be capable of targeted knockdown for various genes at numerous stages of fly development, and can be useful for transcript targeting applications and genome editing in vivo.
Unless otherwise indicated“nuclease” can refer to an enzyme which possesses endonucleolytic catalytic activity for polynucleotide cleavage.
A“target RNA” as used herein can include an RNA that can include a“target sequence”. The term“target sequence” can refer to a nucleic acid sequence present in a target RNA to which a spacer of a guide RNA can hybridize, provided sufficient conditions for hybridization exist. Hybridization between the spacer and the target sequence can, for example, be based on Watson-Crick base pairing rules, which enables programmability in the spacer sequence. The spacer sequence can be designed, for instance, to hybridize with any target sequence.
The“spacer” within a guide RNA can include a nucleotide sequence that is complementary to a specific sequence within a target RNA.
“Binding” as used herein can refer to a non-covalent interaction between
macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be“associated” or“interacting” or“binding”
(e.g., when a molecule X is said to interact with a molecule Y, it means that the molecule X binds to molecule Y in a non-covalent manner). Binding interactions are generally characterized by a dissociation constant (Kd) of less than 10 6 M, less than 10 7 M, less than 10 8 M, less than 10 9 M, less than 10 10 M, less than 10 11 M, less than 10 12 M, less than 10 13 M, less than 10 14 M, or less than 10 15 M. Kd is dependent on environmental conditions, e.g., pH and temperature, as is known by those in the art.“Affinity” refers to the strength of binding, and increased binding affinity is correlated with a lower Kd.
The terms“hybridizing” or“hybridize” can refer to the pairing of substantially complementary or complementary nucleic acid sequences within two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence joins with a substantially or fully complementary sequence through base pairing to form a hybridization complex. For purposes of hybridization, two nucleic acid sequences or segments of sequences are“substantially complementary” if at least 80% of their individual bases are
complementary to one another.
As used herein,“operably linked” can refer to the situation in which part of a linear DNA sequence can influence the other parts of the same DNA molecule. For example, when a promoter controls the transcription of the coding sequence, it is operatively linked to the coding sequence.
As used herein, a“polypeptide” can include proteins, fragments of proteins, and peptides, whether isolated from natural sources, produced by recombinant techniques, or chemically synthesized. A polypeptide may have one or more modifications, such as a post- translational modification (such as glycosylation, etc.) or any other modification (such as PEGylation, etc.). The polypeptide may contain one or more non-naturally-occurring amino acids (such as an amino acid with a side chain modification). Polypeptides described herein typically comprise at least about 10 amino acids.
As used herein,“contacting” a cell with a nucleic acid molecule can be allowing the nucleic acid molecule to be in sufficient proximity with the cell such that the nucleic acid molecule can be introduced into the cell.
A“promoter” can be a region of DNA that leads to initiation of transcription of a gene.
A“motif’ can be a nucleotide or amino acid sequence pattern that is correlated with biological significance or function.
I. Cas 13 polypeptide
Provided herein are nucleic acid molecules comprising: (a) a sequence encoding a Cas 13 polypeptide; and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Cas 13 -specific direct repeats, where the spacers are capable of specifically hybridizing with one or more target RNAs.
“Nucleic acid molecules” as used herein can include a DNA sequence or an RNA sequence. The Cas 13 polypeptide can be any of the Cas 13 polypeptides described herein or known in the art.“Casl3 polypeptides” and“Casl3” are used interchangeably herein. Casl3 are RNA-targeting programmable nucleases associated with Type VI CRISPR-Cas systems. Type VI CRISPR-Cas systems are dedicated RNA-targeting immune systems in prokaryotes. Casl3 family contains at least four known subtypes, including Casl3a (formerly C2c2), Casl3b, Casl3c and Casl3d. Type VI-A and VI-B systems possess the crRNA-dependent target cleavage activity and a non-specific, collateral RNase activity that is stimulated by target recognition and cleavage. Both of these activities are mediated by the two HEPN domains contained in type VI effectors Casl3a and Casl3b (Yan et al. Molecular Cell 70(2): 327-339, 2018).
In some instances, the Casl3 is a Casl3d protein. Casl3d are effectors associated with subtype VI-D, a variant of type VI CRISPR-Cas, and have robust target cleavage and collateral RNase activities along with their ability to process pre-crRNA. Cas 13d has a smaller size compared to other Cas 13s and can be advantageous for RNA targeting applications described herein, such as for packaging into a viral vector for delivery.
Cas 13 can be guided by a guide RNA which encodes target specificity. The Cas 13 protein complexes with the guide RNA via recognition of a short hairpin in the crRNA and target specificity is encoded by a spacer that is complementary to the target region. In addition to programmable RNase activity, Casl3s exhibit collateral activity after recognition and cleavage of a target transcript, leading to non-specific degradation of any nearby transcripts regardless of complementarity to the spacer. Cas 13 can process its own pre-
crRNAs, allowing individual short single crRNAs to be customized to target RNA in vitro or to provide Escherichia coli with programmable immunity against the lytic single-stranded RNA MS2 bacteriophage. CRISPR/Casl3 can have broad applicability as an RNAi-like platform for RNA silencing. Compared to small RNAs and RNA interference, which are difficult in design and are limited by high off-target potential, CRISPR/Casl3 can be used to manipulate only the target RNA, with few or no off-target effects in eukaryotes, and multiple crRNAs can be used to eradicate a particular mRNA transcript.
The Casl3 polypeptides can be naturally-occurring or non-naturally occurring. The Casl3 polypeptides can be a mutant Casl3 polypeptide (e.g., a mutant of a naturally occurring Casl3 polypeptide). Mutant Casl3 can have altered activity compared to a naturally occurring Casl3, such as altered nuclease activity without substantially diminished binding affinity to RNA). In some instances, the mutant Casl3 has no nuclease (e.g., ribonuclease) activity. For instance, mutant Casl3 encodes a ribonuclease with the positively charged catalytic residues of the HEPN motifs inactivated thereby eliminating programmable RNA cleavage without affecting guide RNA array processing, or target RNA binding. The Casl3 can have a size of about 700 to about 1200 amino acids (e.g., about 700 to about 1100, about 700 to about 1000, about 700 to about 900, about 700 to about 800, about 800 to about 1200, about 800 to about 1100, about 800 to about 1000, about 800 to about 900, about 900 to about 1200, about 900 to about 1100, about 900 to about 1000, about 1000 to about 1200, about 1000 to about 1100, or about 1100 to about 1200 amino acids). In some instances, the Casl3 has a size of about 930 amino acids. In some instances, the Casl3 is Casl3d. Casl3d derived from a variety of species are contemplated herein, including but not limited to, Ruminococcus sp., Ruminoccocus flavefaciens, Ruminoccocus albus, and Eubacterium siraeum. In some instances, the Casl3d is derived from Ruminococcus flavefaciens strain XPD3002 (e.g., CasRx or RfxCasl3d). In some instances, the Casl3d is a catalytically inactive version of CasRx (e.g. dCasRx). An exemplary sequence of CasRx (NLS- RfxCasl3d-NLS) can be found at Plasmid #109049 (pXROOl : EFla-CasRx-2A-EGFP, addgene).
The sequence encoding a Casl3 polypeptide described herein can be at least 80% identical (e.g. at least 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, or 99% identical)
to the sequence of RfxCasl3d. In some instances, the sequence encoding a Casl3 polypeptide is identical to the sequence of Casl3d.
In some embodiments, the nucleic acid molecule provided herein comprises a sequence encoding a Casl3 protein and further comprises one or more localization signals. Localization signals can be an amino acid sequence on a protein that tags the protein for transportation to a particular location in a cell. An exemplary localization signal is nuclear localization signal, which can be an amino acid sequence that tags a protein for import into the cell nucleus by nuclear transport. The localization signals can be operably linked to the sequence encoding a Casl3 protein. In some embodiments, the localization signal is a nuclear localization signal. For example, the sequence encoding Casl3 can encode two nuclear localization signals, where upon translation, the Casl3 is fused to N- and C- terminal nuclear localization signals. An exemplary NLS is SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 1)) and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 2)). Other NLSs are known in the art; see, e.g., Konermann et al, Cell 173:665-676, 2018; Cokol et al., EMBO Rep. 1(5):411-415 (2000); Freitas and Cunha, Curr Genomics 10(8): 550-557 (2009).
In some instances, the sequence encoding a Casl3 polypeptide is operably linked to a promoter. Suitable promoters include but are not limited to ubiquitous promoters (e.g., ubiquitin promoter), tissue-specific promoters, inducible promoters, and constitutive promoters.
The sequence encoding a Casl3 polypeptide can be further operably linked to a sequence that encodes one or more reporter genes. Any suitable reporter genes are contemplated, including but not limited to, fluorescent reporters.
II. Guide RNA
Provided herein are guide RNAs comprising one or more spacers and one or more Casl3-specific direct repeats, where the spacers are capable of specifically hybridizing with one or more target RNAs. Also provided herein are sequences encoding the guide RNAs provided herein.
The guide RNA can include at least one (e.g., at least two, three, four, five, six, or seven) spacers. The spacers can bind to the same or different target sequences in the same target RNA, or can bind to different target RNAs. The spacers can be designed to target any
sequence in a target RNA. In instances where two or more spacers are included in the guide RNA, the spacers can have the same or different length. The spacers can have a length of between 20 to 40 nucleotides (e.g., 20 to 35, 20 to 30, 20 to 25, 25 to 40, 25 to 35, 25 to 30,
30 to 40, 30 to 35, or 35 to 40 nucleotides). In some instances, the spacers can have a length of about 30 nucleotides.
The guide RNA can include at least one (e.g., at least two, three, four, five, six, or seven) direct repeats. A direct repeat can be a repetitive sequence within a CRISPR locus that are interspersed by short spacers. A direct repeat sequence can have homology to a trans activating CRISPR RNA, and facilitates the formation of a crRNA: tracrRNA duplex. The sequence and secondary structure of Cas 13-specific direct repeats can be dependent on the specific Casl3. For instance, Casl3d from different species can have different direct repeat sequences and/or secondary structures. Exemplary direct repeat sequences for Casl3d can be found at e.g. Konnerman et al. Cell 173:665-676 (2018). The Casl3-specific direct repeats in the guide RNA provided herein can be chosen based on the specific Cas 13 used. Direct repeat sequences functioning together with Cas 13 proteins of various bacterial species may be identified by bioinformatic analysis of sequence repeats occurring in the respective
CRISPR/Cas operons and by experimental binding studies of Cas 13 protein together with putative DR sequence flanked target sequences. The Cas 13-specific direct repeats can be about 30 to about 40 (e.g., about 31, 32, 33, 34, 35, 36, 37, 38, or 39) nucleotides in length. In some instances, the Cas 13-specific (e.g., Casl3d-specific) direct repeats are about 36 nucleotides in length. In some instances, the direct repeats form a hairpin structure capable of interacting with the Casl3 polypeptide to form a complex. In some instances, the Casl3- specific direct repeats are Casl3d-specific direct repeats. Exemplary Casl3d-specific direct repeat sequences can be found at Konermann et al. Cell 173:665-676 (2018).
An exemplary sequence of a RfxCasl3d-specific direct repeat is shown below (SEQ ID NO: 3): CAAGUAAACCCCUACCAACUGGUCGGGGUUUGAAAC
The direct repeats in the guide RNA described herein can include a sequence that is at least 80% identical (e.g. at least 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99% identical) to SEQ ID NO: 3.
The spacers can be arranged in tandem and interspersed by direct repeats. For example, a spacer can be positioned between two direct repeats. The guide RNA can include, e.g., as part of its sequence, [direct repeat 1 - spacer 1 - direct repeat 2 - spacer 2 - direct
repeat 3 - spacer 3 - direct repeat 4 - spacer 4 - direct repeat 5] In some instances, the guide RNA includes n spacers and n+1 direct repeats, where n > 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10).
Some embodiments disclosed herein provide nucleic acid molecules that encode the guide RNA. Some embodiments provide vectors comprising nucleic acid molecules encoding the guide RNA. Nucleic acid molecules encoding the guide RNA can be operably linked to one or more promoters. Any suitable promoters described herein and known in the art are contemplated, such as but not limited to, a polymerase III promoter, such as a polymerase-3 U6 (U6:3) promoter. Exemplary U6 promoters can be found e.g., in Xia et al. Nucleic Acids Res. 31(17) elOO; or at Addgene plasmid #112688 (gRNA[Sxl].1026B).
Nucleic acid molecules encoding the guide RNA can be further operably linked to sequences that encode one or more reporter genes. Any suitable reporter genes are contemplated, including but not limited to, fluorescent reporters.
III. Vectors
Some embodiments disclosed herein provide vectors (e.g. viral vectors) that comprise nucleic acid molecules comprising a sequence encoding a Casl3 polypeptide (e.g. any Casl3 polypeptides described herein) and/or a sequence encoding a guide RNA (e.g. any guide RNAs described herein). Any suitable vectors described herein and known in the art are contemplated. In some instances, the viral vector is an Adeno-associated viral vector (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review, see Muzyczka et al., Curr. Topics in Micro and
Immunol.158:97-129 (1992)). AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo. AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther. 2009 Aug; 11(4): 442-447; Asokan et al, Mol Ther. 2012 April; 20(4): 699-708. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. For example, AAV2, AAV5, AAV2/5, AAV2/8 and AAV2/7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al, Vision Research 2008,
48(3):377-385; Khani et al, Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3954-61; Allocca et al, J. Virol. 2007 81(20): 11372-11380). In some embodiments, the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in
PCT/US2014/060163; for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT/US2014/060163, and a Cas9 sequence and guide RNA sequence as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44. In some embodiments, the AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6 of WO 2018/026976. It should be noted, however, that numerous modified versions of the AAV2 ITRs are used in the field, and the ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure. Expression of Casl3 and/or guide RNA in the AAV vector can be driven by a promoter described herein or known in the art.
IV. Target RNA and methods of modifying a target RNA in a cell
The target RNA can be any RNA molecules endogenous or exogenous to a eukaryotic cell, and can be protein-coding or non-protein-coding. A variety of RNA targets are contemplated herein. For example, a target RNA can be messenger RNA (mRNA), ribosomal RNA (rRNA), signal recognition particle RNA (SRP RNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), antisense RNA (aRNA), long noncoding RNA (IncRNA), microRNA (miRNA), piwi-interacting RNA (piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), retrotransposon RNA, viral genome RNA, viral noncoding RNA, or the like. A guide RNA provided herein can include spacers that are capable of specifically hybridizing with the same target RNA or at least two different target RNAs.
In some instances, the RNA can be a viral RNA (e.g., single stranded viral RNA). The viral RNA can be from an anthropod-bome virus (arboviruse), such as but not limited to tick- borne viruses, midge-borne viruses, and mosquito-borne viruses. Exemplary viruses include, but are not limited to, Zika, Chikungunya, Dengue, Yellow fever, West Nile, Japanese
encephalitis, Rift Valley fever, and Eastern equine encephalitis viruses. See, e.g. Reynolds et al. Comp Med 67(3):232-241 (2017). Additional viruses contemplated include, but are not limited to, lymphocytic choriomeningitis virus (LCMV), influenza A virus (IAV), and vesicular stomatitis virus (VSV). Additional viral RNAs that can be targeted by the compositions and methods described here in can be found at e.g., Frejie et al, Molecular Cell, 76(5):826-837. Collateral cleavage and tissue-specific cell death resulting from the use of the systems provided herein can be useful for ssRNA virus targeting in arbovirus vectors.
In some aspects, the present disclosure provides methods of modifying a target RNA in a cell. The methods can include introducing a nucleic acid sequence encoding a Casl3 polypeptide (e.g., any of the Casl3 polypeptides described herein) and a guide RNA (e.g., any of the guide RNAs described herein) into the cell. The sequence encoding a Casl3 protein and the guide RNA can be introduced into the cell in the same nucleic acid molecule or in different nucleic acid molecules. In some instances, the methods include contacting the cell with (a) a nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide, and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Cas 13 -specific direct repeats, wherein the one or more spacers are capable of specifically hybridizing with the target RNA. In some instances, the sequence encoding a Cas 13 polypeptide is introduced via a first vector (e.g. any suitable vectors described herein) and the guide RNA is introduced via a second vector (e.g. any suitable vectors described herein).
Also contemplated are cells comprising the nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide and/or a sequence encoding a guide RNA described herein.
Methods of monitoring target RNA modification
The present disclosure in some instances provides compositions for and methods of monitoring target RNA modification e.g., in a cell, comprising monitoring the presence and/or levels of a target RNA, or monitoring the presence and/or levels of a protein corresponding to a target RNA (e.g. for protein-coding RNA). Any suitable techniques and assays for monitoring RNA and/or protein levels known in the art are contemplated herein. Exemplary methods include in situ hybridization, antibody staining, and RNA sequencing.
V. Transgenic organisms
As used herein, a“transgenic organism” can include a non-human animal in which one or more of the cells of the organism includes a transgene. The organism can be a vertebrate or an invertebrate, such as an arthropod (e.g., an insect).
In some instances, a transgenic organism provided herein has a recombinant nucleic acid molecule stably integrated into the genome of the organism, wherein the recombinant nucleic acid molecule comprises a sequence that encodes a Casl3 polypeptide (e.g. any of the Casl3 polypeptides described herein). In some instances, a transgenic organism has two or more recombinant nucleic acid molecules stably integrated into the genome of the organism, comprising at least a first recombinant nucleic acid molecule that comprises a sequence encoding a Casl3 polypeptide, and a second recombinant nucleic acid molecule that comprises a sequence that encodes a guide RNA.
A founder animal carrying a recombinant nucleic acid comprising a sequence that encodes a Casl3 polypeptide can be identified based upon the presence of the sequence in its genome and/or expression of Casl3 in tissues or cells of the animal. A founder animal carrying a recombinant nucleic acid comprising a sequence that encodes a guide RNA can be identified based upon the presence of the sequence in its genome. A transgenic founder animal can then be used to breed additional animals carrying the transgene. A transgenic animal can be heterozygous or homozygous for the transgenes.
Methods for making transgenic animals are known in the art; see, e.g.,
WO2016049024; WO201604925; WO2017124086; W02018009562; and US 9,901,080. Such techniques include, without limitation, pronuclear microinjection (See, e.g., US 4,873,191), retrovirus mediated gene transfer into germ lines (Van der Putten et al, Proc.
Natl. Acad. Sci. USA, 82:6148-1652 (1985)), gene targeting into embryonic stem cells (Thompson et al, Cell 56:313-321 (1989)), electroporation of embryos (Lo, Mol. Cell. Biol., 3: 1803-1814 (1983)), and in vitro transformation of somatic cells, such as cumulus or mammary cells, followed by nuclear transplantation (Wilmut et al, Nature, 385:810-813 (1997); and Wakayama et al, Nature, 394:369-374 (1998)); these methods can be modified to use CRISPR as described herein. For example, fetal fibroblasts can be genetically modified using CRISPR as described herein, and then fused with enucleated oocytes. After activation of the oocytes, the eggs are cultured to the blastocyst stage. See, for example, Cibelli et al, Science, 280: 1256-1258 (1998).
The present disclosure also provides a population of cells isolated from an organism as described herein, as well as primary or cultured cells, e.g., isolated cells, engineered to include a sequence that encodes a Casl3 protein and/or a guide RNA. The cells can be isolated from any of the transgenic animals described above. Also provided are methods of introducing the transgenes described herein into a cell (e.g., primary cells or cultured cells). Exemplary methods include viral delivery (e.g., using viral vectors) and electroporation.
EXAMPLES
Example 1: Genetically encoding CasRx in flies
To determine the efficacy of CRISPR-based programmable RNA-targeting in flies, flies were engineered to encode the CasRx ribonuclease. To do so, two transgenes were generated utilizing a broadly expressing ubiquitin (Ubiq) promoter to drive expression of either CasRx (Ubiq-CasRx), or a catalytically inactive version of the ribonuclease, termed dCasRx (Ubiq-dCasRx), used as a negative control (FIG. 1). Importantly, dCasRx encodes a ribonuclease with the positively charged catalytic residues of the HEPN motifs inactivated thereby eliminating programmable RNA cleavage without affecting gRNAaiTa processing, or target RNA binding. Transgenic lines integrating each transgene site-specifically were established using an available < >C31 docking site located on the 2nd chromosome (attp40w) (FIG. 1, Table 1). While these flies were viable, homozygotes were able to be generated, for neither CasRx nor dCasRx, presumably due to high levels of ubiquitous ribonuclease expression. Therefore, these stocks were maintained as heterozygotes balanced over the chromosome Curly-of-Oster (CyO) (Table 1). To genetically measure the efficacy of programmable RNA-targeting, five genes known to produce visible phenotypes when expression is disrupted were targeted, including: white (w). cinnabar ( cn ), wingless ( wg ), Notch (N), and yellow (y). To target these genes with CasRx, a gRNAarray was designed for each gene driven by a ubiquitously expressed polymerase-3 U6 (U6:3) promoter (FIG. 1, Table 1). Each array consisted of four ssRNA transcript-targeting spacers (30nt in length) each positioned between CasRx-specific direct repeats (36nt in length) with a conserved 5’- AAAAC motif designed to be processed by either CasRx or dCasRx (FIG. 1). For each gRNAarray, the transgene was site-specifically integrated at an available 0C31 docking site located on the 3rd chromosome (site 8622) and a homozygous transgenic line was established (FIG. 1, Table 1). Table 1 shows transgenic fly lines used in this study. List of transgenic fly
lines used in this study identifying the corresponding Addgene vector number, the
Bloomington Drosophila Stock Center stock number, and the components of each integrated construct.
Example 2: Programmable RNA-targeting of endogenous target genes
To assess the efficacy of programmable RNA-targeting by CasRx, bidirectional genetic crosses were conducted between homozygous gRNAaiTa (+/+; g RN Aana-7g RN AaiTa ) expressing flies crossed to either Ubiq-CasRx (Ubiq-CasRx/CyO; +/+), or Ubiq-dCasRx (Ubiq-dCasRx/CyO; +/+) expressing flies (FIG. 2A). Interestingly when crossed to Ubiq- CasRx, highly -penetrant (68-100%) clear visible phenotypes exclusively in
transheterozygotes (Ubiq-CasRx/+; gRNAarray /+) for gRNA" . gRNAc", and gRNA" " were able to be obtained, indicating that CasRx exhibits programmable on-target RNA cleavage capabilities (FIGs. 2B and 2C, Table 2). FIG. 2B shows inheritance and penetrance rates of transheterozygous flies inheriting both Ubiq-CasRx, or Ubiq-dCasRx, and gRNAarray corresponding to the box in FIG. 2A. Phenotype penetrance rate is depicted by shading in the box plot. Significant differences in inheritance between CasRx and dCasRx groups were observed in 4 out of 5 groups with the exception of gRNA™ (gRNA" . p = 0.00135 ; gRNAv. p = 0.00006; gRNA" ". p = 0.00851 ; gRNA1'. p = 0.00016). FIG. 2C shows brightfield images of transheterozygous flies with representative phenotypes for each cross. Corresponding genotype for each image is dictated by the combination of constructs on top of the columns and the side of the rows. Clear pigment reduction is visible in both gRNA" and gRNA™ crosses. Arrows point to tissue necrosis in the eye where more prominent tissue necrosis is observed in gRNA™ transheterozygous flies. Image for the gRNA" " cross is an example of the notching phenotype resulting from incomplete development of wing margin. Black and white fly with“X” represents lethality phenotype where no transheterozygote adults emerged.
However, while the Mendelian transheterozygote inheritance rates were expected to be 50%, the recorded inheritance rates were significantly lower than expected (ranging from 9.6-28.4%) suggesting some possible toxicity leading to lethality (FIG. 2B, FIG. 3, Table 2). FIG. 3 shows the complete inheritance plot of bidirectional crosses featured in FIG. 2B. The plot includes all genotypes scored in all crosses between Ubiq-CasRx or Ubiq-dCasRx and a respective gRNAarray. In all crosses, gRNAarray only inheritance is dramatically higher than transheterozygote inheritance rates including Ubiq-dCasRx crosses. Furthermore, while the
phenotypes for w, and cn resembled the expected disrupted eye pigmentation phenotypes, minor eye-specific necrosis was observed that was most prominent in Ubiq-CasRx/gRNAc" transheterozygotes (Fig. 2C, arrows). Moreover when targeting wg, a notching phenotype was observed that was similar to previously observed phenotypes resulting from inhibition of wg signaling. However, when targeting y, or N, Ubiq-CasRx transheterozygotes (Ubiq- CasRx/+; gRNAarray /+) were 100% lethal and did not develop beyond the second instar larvae (FIGs. 4A and 4B). FIGs. 4A shows transheterozygote percentages at larval, pupal, and adult development periods for each gRNAarray producing an observable phenotype ( w , cn, wg). There were no significant differences in inheritance with the exception of gRNA"" adults (p = 0.014). FIG. 4B shows transheterozygote percentages through larval, pupal, and adult development periods for each gRNAarray producing a lethal phenotype (N, y, GFP). No Ubiq-CasRx transheterozygotes developed beyond larvae. This was expected for A as there are many examples of lethal alleles for this gene, however mutations in y should be recessive viable with defective chitin pigmentation phenotypes. Moreover, phenotypes were not obtained in transheterozygotes (Ubiq-dCasRx/+; gRNAarray /+) from the negative control crosses using all arrays tested, indicating that a catalytically active form of the ribonuclease is necessary for phenotypes to be observed (Fig. 2C). Taken together, these compelling genetic results indicate that the catalytically active form of the CasRx ribonuclease can generate expected phenotypes although some unexpected tissue necrosis and lethality were also observed. Table 2 shows the complete data set for the Ubiq-CasRx and Ubiq-dCasRx bidirectional crosses. Absolute counts of inheritance and phenotype penetrance for maternal and paternal inheritance of Ubiq-CasRx and Ubiq-dCasRx crosses to gRNAarray or Ubiq-Fluc- Ubiq-Rluc expressing flies. Each cross (paternal and maternal) was done in triplicate.
Example 3: Tissue-specific RNA-targeting by CasRx
To further explore the utility of programmable RNA-targeting of CasRx in flies, its efficiency was investigated when expression was restricted to specific cell types and tissues by leveraging the classical binary Gal4/UAS system. To develop this system, two transgenes were generated using the UASt promoter to drive expression of either CasRx (UASt-CasRx), or as a negative control dCasRx (UASt-dCasRx) (FIG. 1). These transgenes were integrated site-specifically using a 0C31 docking site located on the 2nd chromosome (site 8621) and these stocks were homozygous viable (FIG. 1, Table 1). To activate CasRx expression,
several available Gal4 driver lines that restricted expression to either the eye (GMR-Gal4), embryos and imaginal discs (armadillo-Gal4), or the wing and body (yellow-Gal4) (Table 1) were used, and the same homozygous gRNAaiTa lines described above targeting w, cn, wg, y, or N (FIG. 1, Table 1) were used. To test this system, a 2-step genetic crossing scheme was performed to generate F2 triple transheterozygotes (either UASt-CasRx/+; gRNAa"a /Gal4 or UASt-dCasRx/+; gRNAa"a /Gal4) (Fig. 2A). This consisted of initially crossing homozygous gRNAarra (gRNAarray/gRNAarray) expressing flies to heterozygous, double-balanced UASt- CasRx (UASt-CasRx/Cyo; TM6/+) flies, or the negative control, heterozygous, double- balanced UASt-dCasRx (UASt-dCasRx/Cyo; TM6/+) flies. The second step was to cross the F 1 transheterozygote males expressing both a CasRx ribonuclease and the gRNAarray (UASt- CasRx/+; gRNAarray/TM6 or UASt-dCasRx/+; gRNAarray/TM6) to respective homozygous Gal4 driver lines generating F2 triple transheterozygotes (UASt-CasRx/+; gRNAarray/Gal4 or UASt-dCasRx/+; gRNAa"ay/Gal4) to be scored for phenotypes (FIG. 5A). From these crosses, the results indicated that tissue-specific expression of CasRx can indeed result in expected phenotypes, however this was occasionally accompanied by tissue-specific cell death, or lethality, similar to previous observations described above. For example, from the Fi cross between gRNAw (UASt-CasRx/+; gRNAw/TM6) and GMR-Gal4 (+/+; GMR-Gal4/GMR- Gal4), of the expected 25% Mendelian inheritance rates survival of only 0.57% viable F2 triple transheterozygotes (UASt-CasRx/+; gRNAw/GMR-Gal4) was observed, all of which displayed phenotypes in the eye (FIGs. 5B, 5C, and 6, Table 3). The gRNA" F2 triple transheterozygote inheritance rate was significantly less than the corresponding negative control F2 triple transheterozygote (UASt-dCasRx/+; gRNAw/GMR-Gal4) inheritance rate which was closer to the expected 25% Mendelian inheritance (27.6%) (FIG. 6, Table 3). Moreover, using the same Gal4 driver (GMR-Gal4) a significant difference in inheritance was also observed for A targeting which resulted in 100% lethality in F2 triple
transheterozygotes (UASt-CasRx/+; gRNAN/GMR-Gal4) compared to 29.3% inheritance rate for the negative control F2 triple transheterozygotes (UASt-dCasRx/+; gRNAN/GMR-Gal4) (FIGs. 5B, 5C, and 6, Table 3). All gRNA™ F2 triple transheterozygotes (UASt-CasRx/+, gRNAcn/GMR-Gal4) displayed pigment reduction along with a mild cell death phenotype in their eyes (FIG. 5C, arrows), while sharing comparable inheritance ratios (28% vs 28%) with their negative control F2 triple transheterozygotes (UASt-dCasRx/+; gRNAcn/GMR-Gal4) (FIG. 6, Table 3). For wg targeting, crosses were performed using the armadillo-Gal4 driver
(arm-Gal4) (arm-Gal4/arm-Gal4; +/+) and, interestingly, the F2 triple transheterozygotes (UASt-CasRx/arm-GAL4; gRNAwg/+) were 100% lethal while the negative control F2 triple transheterozygotes (UASt-dCasRx/arm-GAL4; gRNAwg/+) were viable and inherited transgenes near the expected rate (29.7%) (FIGs. 5B, 5C, and 6, Table 3). Finally, when targeting y, using the yellow-Gal4 driver (+/+; y-Gal4/y-Gal4) marginal chitin pigment reduction was observed at the back of the thorax and abdomen in F2 triple transheterozygotes (UASt-CasRx/+; gRNAy/y-Gal4) (FIG. 5C, arrows). Similar to crosses described above, the F2 triple transheterozygote (UASt-CasRx/+; gRNAVy-Gal4) inheritance was significantly lower (2.67%) when compared to the control F2 triple transheterozygote (UASt-dCasRx/+; gRNAy/y-Gal4) inheritance (25.2%), indicating partial lethality during development (FIGs. 5B, 5C, and 6, Table 3). Phenotypes in F2 triple transheterozygotes (UASt-dCasRx/+;
gRNAa"a /Gal4) was not observed in any of the negative control crosses (Figure 5B and 5C, Table 3). Taken together, these results demonstrate that tissue specific expression of CasRx using the classical Gal4/UAS approach can result in expected phenotypes, however, as seen in the ubiquitous binary approach above, cell death phenotypes and lethality were also observed. FIG. 5B shows the inheritance rates of triple transheterozygous flies inheriting 3 transgenes (UASt-CasRx or UASt-dCasRx, gRNAarray, and Gal4-driver), corresponding to flies highlighted in red box in panel A. Significant differences in inheritance between CasRx and dCasRx groups were observed in 4 of 5 gene targets with the exception of gRNA“ (gRNAw, p = 0.00595; gRNAfy p = 0.00402; gRNAwg, p = 0.00577; gRNAy, p = 0.02205). FIG. 6 shows a plot that includes all genotypes scored in all crosses for UASt-CasRx and UASt-dCasRx. For all 5 gRNAarray targets, the inheritance of transheterozygous progeny expressing UASt-CasRx, a Gal4 driver, and a gRNAarray were lower compared to the other non-transheterozygous flies and to their corresponding dCasRx control group expressing UASt-dCasRx, a Gal4 driver, and a gRNAarray. Table 3 shows the complete data set for the Gal4/UASt-CasRx or Gal4/UASt-dCasRx crosses. Absolute counts of inheritance and phenotype penetrance for the F2 generation resulting from Fi transheterozygote males expressing U A S t-C as Rx/g RN Aan a or U A S t-dC as Rx/g RN Aan a crossed to Gal4 driver lines.
Example 4: Criteria for CasRx mediated Phenotypes
To further explore programmable ribonuclease activity of CasRx and quantify the level of transcript reduction, a dual luciferase reporter assay was developed. This assay comprised of ubiquitously expressed firefly luciferase (Flue) and a control renilla luciferase
(Rluc) (Ubiq-Fluc-Ubiq-Rluc) (FIG. 1) enabling normalization and allowing for
quantification of Flue protein expression reduction resulting from CasRx transcript targeting. The reporter construct was integrated at an available < >C31 docking site on the 3rd chromosome (site 9744) and generated a homozygous transgenic stock (+/+; Ubiq-Fluc- Ubiq-Rluc/Ubiq-Fluc-Ubiq-Rluc) (FIG. 1, Table 1). A gRNAaiTa- targeting Flue (gRNAFluc) was then engineered, and a homozygous transgenic stock (+/+; gRNAFluc/gRNAFluc) was generated by integrating the gRNAanav on the 3rd chromosome using 0C3 1 integration (site 8622) (FIG. 1, Table 1). For genetic analysis, a 2-step cross was followed by initially mating heterozygous, double-balanced Ubiq-CasRx (Ubiq-CasRx/CyO; TM6/+) flies, or Ubiq- dCasRx (Ubiq-dCasRx/CyO; TM6/+) negative controls to homozygous dual luciferase reporter flies (Ubiq-Fluc-Ubiq-Rluc/Ubiq-Fluc-Ubiq-Rluc). F i transheterozygous males carrying the TM6 balancer chromosome (Ubiq-CasRx/+; Ubiq-Fluc-Ubiq-Rluc/TM6 or Ubiq-dCasRx/+; Ubiq-Fluc-Ubiq-Rluc/TM6) were then crossed to homozygous gRNAFluc (+/+; gRNAFluc/gRNAFluc) expressing flies (FIG. 7A). Interestingly, despite the target gene being non-essential, expressing all three transgenes in F2 triple transheterozygotes (Ubiq- CasRx/+; gRNAFluc/Ubiq-Fluc-Ubiq-Rluc) was found to result in 100% lethality compared to control crosses involving Ubiq-dCasRx, where lethality was completely eliminated in the F2 triple transheterozygotes (Ubiq-dCasRx/+; gRNAFluc/Ubiq-Fluc-Ubiq-Rluc) (FIG. 7B, FIG.
8). As shown in FIG. 7B, inheritance of all 3 transgenes (Ubiq-CasRx, Ubiq-Fluc-Ubiq-Rluc, and gRNAarray) in F2 progeny was 100% lethal and significantly lower than Ubiq-dCasRx triple transheterozygotes (p = 0.001, t-test). FIG. 8 shows dual-luciferase reporter system transgenic markers, with representative markers for each construct. The top row is a bright field image of all respective genotypes involved in the reporter system (a heterozygote is used in the first column to demonstrate the expected GFP expression). w+ represents either Ubiq- Fluc-Ubiq-Rluc or gRNAFluc expression. OpIE2-dsRed expression represents Ubiq-CasRx or Ubiq-dCasRx expression. (Left to right) Ubiq-Fluc-Ubiq-Rluc heterozygote, Ubiq- CasRx/Ubiq-Fluc-Ubiq-Rluc transheterozygote, Ubiq-dCasRx/Ubiq-Fluc-Ubiq-Rluc transheterozygote, and Ubiq-dCasRx/Ubiq-Fluc-Ubiq-Rluc/gRNAFluc triple
transheterozygote. Ubiq-CasRx/Ubiq-Fluc-Ubiq-Rluc/gRNAFluc triple transheterozygotes were 100% lethal and thus could not be imaged.
Furthermore, it was confirmed that only the combination of all three transgenes (Ubiq-CasRx/+; gRNAFluc/Ubiq-Fluc-Ubiq-Rluc) resulted in lethality by crossing
heterozygous flies expressing Ubiq-CasRx (Ubiq-CasRx/Cyo; +/+) to homozygous flies expressing either gRNAFluc (+/+; gRNAFluc/gRNAFluc) or homozygous flies expressing the dual luciferase reporter transgene (+/+; Ubiq-Fluc-Ubiq-Rluc/Ubiq-Fluc-Ubiq-Rluc). As expected, no distinguishable phenotypes or dramatic influence on inheritance in Fi transheterozygotes (Ubiq-CasRx/+; gRNAFluc/+ or Ubiq-CasRx/+; Ubiq-Fluc-Ubiq-Rluc/+) compared to Ubiq-dCasRx controls (Ubiq-dCasRx/+; gRNAFluc/+ or Ubiq-dCasRx/+; Ubiq- Fluc-Ubiq-Rluc/+) were observed (FIG. 7C, Table 2). As shown in FIG. 7C, inheritance of Ubiq-CasRx/gRNAFluc or Ubiq-CasRx/Ubiq-Fluc-Ubiq-Rluc did not lead to 100% lethality and inheritance ratios between Ubiq-CasRx and Ubiq-dCasRx transheterozygotes are not significantly different (p = 0.41 and p = 0.51, respectively, t-test). Next, Flue and Rluc expression levels in flies of all viable genotypes were measured, and no significant reduction in Flue expression in the Ubiq-dCasRx triple transheterozygotes (Ubiq-dCasRx/+;
gRNAFluc/Ubiq-Fluc-Ubiq-Rluc) compared to dual luciferase reporter controls was observed, suggesting that Flue protein expression levels were not reduced by dCasRx targeting (FIG. 7D). However, given the complete embryonic lethality of the Ubiq-CasRx F2 triple transheterozygotes (Ubiq-CasRx/+; gRNAFluc/Ubiq-Fluc-Ubiq-Rluc) the luciferase activity in these flies were unable to be measured.
Given the inability to generate and measure luciferase expression from Ubiq-CasRx F2 triple transheterozygotes (Ubiq-CasRx/+; gRNAFluc/Ubiq-Fluc-Ubiq-Rluc) in the luciferase crosses described above, a GFP reporter assay was generated to directly visualize CasRx-mediated transcript knockdown. A binary GFP reporter construct was generated, comprised of both a CasRx gRNAarray targeting GFP along with GFP expression driven by the broadly expressing OpIE2 promoter (gRNAGF ) (FIGs. 9A-9C, FIG. 1, Table 1). A homozygous transgenic line (+/+; gRNA',/ /'-OpIE2-GFP/gRNA',/ /'-OpIE2-GFP) was established by site-specifically integrating the construct at an available 0C3 1 docking site located on the 3rd chromosome (site 8622) (FIG. 1, Table 1). To test for GFP transcript targeting, bidirectional crosses was performed between homozygous flies expressing gRNAGF (+/+; gRNA / /'-0pIE2-GFP/gRNA / /'-0pIE2-GFP) to heterozygous Ubiq-CasRx expressing flies (Ubiq-CasRx/CyO; +/+), or heterozygous Ubiq-dCasRx expressing flies (Ubiq-dCasRx/CyO; +/+) as a negative control (FIG. 9A). Interestingly, 100% adult lethality was observed for Fi transheterozygotes (Ubiq-CasRx/+; gRNA / /'-0pIE2-GFP/+). while adult lethality was completely eliminated in Fi transheterozygote controls (Ubiq-dCasRx/+;
gRNA ,/ /'-OpIE2-GFP/+) and lethality was observed regardless of maternal or paternal deposition of CasRx (FIG. 9B, Table 2). Given that GFP expression was also visible in larvae, the development of the Fi progeny was monitored and it was observed that Ubiq- CasRx transheterozygotes survived only to the first instar developmental stage, but not beyond (FIG. 4B). Given this survival, first instar transheterozygote (Ubiq- CasRx/+ gRNA',/ /'-OpIE2-GFP/+) larvae was imaged and complete reduction in GFP expression for Ubiq-CasRx transheterozygote larvae as compared to Ubiq-dCasRx transheterozygote (Ubiq-dCasRx/+:gRNA',/ /'-OpIE2-GFP/+) control larvae was observed (FIG. 9C). Taken together, these results strongly indicate that CasRx possesses
programmable RNA-targeting activity and the lethality is dependent upon the availability of a broadly expressed target sequence as well as enzymatic RNA cleavage mediated by the positively charged residues of CasRx HEPN domains.
Example 5: Quantification of CasRx mediated on/off target activity
Upon obtaining distinct visual phenotypes from Ubiq-CasRx transheterozygotes (Ubiq-CasRx/+; gRNAana /+), both the on- and potential off-target transcript reduction rates were quantified. All gRNAarray target genes from our binary crosses producing either highly - penetrant, visible phenotypes (w. cn, and wg) or lethal phenotypes ( N , y, and GFP) were analyzed (Table 5). To do so, whole-transcriptome RNAseq analysis was implemented comparing Fi Ubiq-CasRx transheterozygotes (Ubiq-CasRx/+; gRNAana /+) compared to control Fi Ubiq-dCasRx transheterozygotes (Ubiq-dCasRx/+; gRNAarray /+) (FIG. 2A box with asterisk, FIG. 9A box with asterisk, Table 5). Using available transcriptome data of Drosophila melanogaster (modENCODE), total RNA was extracted at various stages of development when high transcript expression levels were expected for each target gene with the exception of GFP, where first instar larvae was sequenced (FIG. 10, Table 5). FIG. 10 shows modENCODE transcript expression relative to Drosophila melanogaster development. Black box indicates which developmental period was chosen for RNA sequencing of samples for analysis of CasRx-mediated transcript knockdown in Ubiq-CasRx vs Ubiq-dCasRx comparison. Not included: GFP 1st instar larvae were chosen for analysis of GFP transcript knockdown.
In total 34 samples were analyzed (Table 5), and CasRx was found to be capable of consistent on-target transcript reduction based on bioinformatic analysis (FIGs. 11A and
1 IB). For example, of the 6 target genes CasRx was found to be able to target and significantly reduce the target transcript expression level of 3 genes compared to dCasRx controls: N, y, and GFP (FIG. 11B, Table 6-Table 11). Although significant transcript reduction targeting w, cn, or wg was not observed, relative expression reduction was consistently observed comparing Ubiq-CasRx samples to Ubiq-dCasRx controls indicating some degree of on-target reduction (FIG. 11B, Table 6-Table 8, Table 12-Table 14). The number of genes with significantly misexpressed transcripts were also quantified comparing Ubiq-CasRx to Ubiq-dCasRx using DESeq2 (FIG. 11 A, red dots). FIGs. 1 lA-11C show quantification of CasRx-mediated on/off target activity. FIG. 11 A shows maximum a posteriori (MAP) estimates for the logarithmic fold change (LFC) of transcripts. DESeq2 pipeline was used for estimating shrunken MAP LFCs. Wald test with Benjamini-Hochberg correction was used for statistical inference. Grey dots represent transcripts not significantly differentially expressed between Ubiq-CasRx and Ubiq-dCasRx group (p > 0.05). Red dots represent transcripts significantly differentially expressed between CasRx and dCasRx group (p < 0.05). Pink dot identifies the respective CasRx target gene for each analysis (p value indicated in the inset). FIG. 1 IB shows transcript expression levels (TPM) of transcripts targeted with CasRx or dCasRx. Student’s t-test was used to calculate significance (P values: w= 0.07, cn= 0.65, wg= 0.73, N= 0.04, y= 0.006, GFP= 0.008). FIG. 11C shows percentage of transcripts significantly differentially expressed resulting from CasRx cleavage. Pairwise two-sample test for independent proportions with Benjamini-Hochberg correction was used to calculate significance. Table 5 shows Illumina RNA sequencing whole-transcriptome analysis samples. List of samples, in triplicate, analyzed for quantification of CasRx- mediated transcript knockdown in comparison to dCasRx. The genotype, development stage or tissue type, and corresponding vectors are elaborated (Experimental = Ubiq-CasRx, Control = Ubiq-dCasRx).
These results demonstrate the use of CasRx for programmable RNA-targeting in flies. Although cellular toxicity from ubiquitous expression of CasRx and dCasRx was observed, as well as unexpected lethality and tissue necrosis in both bidirectional and Gal4/UAS crosses, clear, visible phenotypes as well as quantitative evidence demonstrating on-target transcript cleavage were obtained. This is the first demonstration of a programmable RNA targeting Cas system in Drosophila melanogaster, paving the way to providing an alternative
approach for gene knockdown studies in vivo, however with further optimization may be required to increase the CasRx on-target cleavage rates.
Through analysis of RNaseq data, consistent reduction in target gene expression was found, however only 50% of the samples crossed a significance threshold. Since clear phenotypes were observed indicating on-target transcript knockdown for w, cn, and wg targeting, but no significant on-target reduction was found through DESeq2 analysis, it is hypothesized that developmental timing of sample collection is imperative for quantifying transcript knockdown efficiency. Notwithstanding, significant on-target transcript expression reduction were obtained that also corresponded with lethality phenotypes (y, N, and GFP ) and resulted in numerous misexpressed genes. Targeting GFP, a non-essential gene, produced the largest quantity of misexpressed genes as well as the most significant fold change compared to all other gene targets analyzed. Interestingly, Gadd45, a gene involved in cellular arrest and apoptosis in Drosophila melanogaster, was found to be significantly misexpressed in 4 samples (w, N, y, and GFP). It is possible that CasRx cleavage may result in a dramatically higher number of misexpressed genes and possible lethality or cellular apoptosis.
Evidence of off-target effects resulting from catalytic activity of CasRx identified through DESeq2 analysis is provided. This is the first report of off-target activity occurring from the application of a Casl3 ribonuclease in eukaryotic cells, and key factors that determine lethality are highlighted. Two main factors contributing to CasRx-mediated lethality were identified: the catalytic activity of the CasRx HEPN domains and the presence of the target transcript resulting in on-target cleavage. For example, lethality and tissue necrosis phenotypes were eliminated comparing dCasRx to CasRx crosses and no lethality was observed when crossing Ubiq-CasRx expressing flies to gRNAFluc expressing flies in the absence of the Flue transcript. These results recapitulate previous mechanistic analysis of CasRx and other Casl3 ribonucleases demonstrating that off-target activity following targeted transcript cleavage is a native feature of Casl3 ribonuclease applications.
Casl3 enzymes have been proposed to be highly specific ribonucleases with the ability to replace previously developed RNAi technologies. dCasl3 enzymes retain efficient RNA binding activity and can be modified to effectively diminish the promiscuous RNase activity of Casl3 ribonucleases. Previous studies have utilized dCasl3 enzymes for RNA base editing, dynamic imaging of RNA, and to manipulate pre-mRNA splicing,
demonstrating both the specificity and versatility of dCasl3 RNA binding. Further modifications to dCasRx may provide viable alternatives for targeted transcript degradation in flies through manipulation of the nonsense mediated mRNA decay (NMD) pathway or through inhibition of proper transcript splicing. However, there remain advantages to the catalytic activity of CasRx and other Casl3 ribonucleases, including the promiscuous RNase activity these enzymes exhibit.
Due to the programmable nature of CRISPR systems, numerous arthropods can theoretically be transgenically engineered and studied applying CasRx. This report provides a preliminary characterization of CasRx function in arthropods and opens up numerous avenues to explore transcript targeting, virus targeting, and technological development of RNA binding applications. One potential application could involve controlling the spread of vector-bome illnesses in arthropods, such as mosquitoes. Recently, in cell culture experiments, a Cast 3 ribonuclease was used to directly target a variety of ssRNA viruses known to infect humans. Aedes mosquitoes are primary vectors for ssRNA viruses such as dengue virus, with an estimated 390 million people infected annually. ssRNA viruses transmitted through Aeries mosquitoes rapidly evolve in both vectors and humans, which presents a significant challenge for generating efficient vaccines or biological methodologies for reducing transmission. The CasRx RNA targeting system in arthropods provides a platform to reduce the spread of ssRNA arboviruses by directly targeting ssRNA virus genomes in a programmable manner. In this case, collateral cleavage and tissue-specific cell death may serve as a significant advantage for ssRNA virus targeting in arbovirus vectors.
Example 6: Methods used in the above experiments
Design and assembly of constructs
To select RNA sites for CasRx targeting, target genes were analyzed to identify 30- nucleotide regions that had no poly-U stretches greater than 4 bp, had GC base content between 30% and 70%, and were not predicted to form very strong hairpin structures. Care was also taken to select target sites in RNA regions that were predicted to be accessible, such as regions without predicted RNA secondary or tertiary structure (FIGs. 12A and 12B). FIGs. 12A and 12B show CasRx-gRNAaiTav transcript target selection and construct generation.
FIG. 12A is a schematic representing the workflow for gRNA choice. The transcript CDS for a GOI is entered into the mFold database (condition: 25°C) where predictive analysis
identifies the most probable secondary and tertiary folding of the entire transcript. We then chose specific regions predicted to be easily accessible for CasRx targeting (blue line), contains GC content between 30% and 70%, and possesses no poly-U stretches longer than 4nt. We then convert the target sequence into the reverse complement (red line) and enter this spacer sequence into mFold (condition: 25°C) for hairpin analysis. This is repeated until 4 optimal target sites are selected. FIG. 12B is a schematic showing the generation of gRNAarray construct. dsDNA is first synthesized to contain 4 spacer and 5 DR sequences with specific restriction sites present on the 5’ and 3’ end of the DNA. Simultaneously the vector backbone containing the miniwhite marker, a U6:3 promoter fragment, and an attB site is digested using the corresponding restriction sites of the dsDNA gene fragment. The two pieces are then ligated together to generate a CasRx gRNAarray covering the majority of the transcript for the GOI.A11 RNA folding/hairpin analysis was performed using the mFold server. For transgenic gRNA arrays, 4 targets per gene were selected to ensure efficient targeting.
Previously, Casl3d ribonucleases were shown to possess gRNA processing RNase activity without additional helper ribonucleases.
Four CasRx- and dCasRx-expressing constructs were assembled under the control of one of two promoters: Ubiquitin-63E (Ubiq) or UASt (Ubiq-CasRx, Ubiq-dCasRx, UASt- CasRx, UASt-dCasRx) using the Gibson enzymatic assembly method. A base vector (Addgene plasmid # 112686) containing piggyBac and an attB-docking site, Ubiq promoter fragment, SpCas9-T2A-GFP, and the Opie2-dsRed transformation marker was used as a template to build all four constructs. To assemble constructs OA-1050E (Addgene plasmid # 132416, Ubiq-CasRx) and OA-1050R (Addgene plasmid # 132417, Ubiq-dCasRx), the SpCas9-T2A-GFP fragment was removed from the base vector by cutting with restriction enzymes Swal and Pad, and then replaced with CasRx and dCasRx fragments amplified with primers 1050E.C3 and 1050E.C4 (Table 15) from constructs pNLS-RfxCasl3d-NLS-HA (pCasRx) and pNLS-dRfxCasl3d-NLS-HA (pdCasRx), respectively. To assemble constructs OA-1050L (Addgene plasmid # 132418, UASt-CasRx) and OA-1050S (Addgene plasmid # 132419, UASt-dCasRx), the base vector described above was digested with restriction enzymes Notl and Pad to remove the Ubiq promoter and SpCas9-T2A-GFP fragments. And then UASt promoter fragment and CasRx or dCasRx fragments, respectively, were cloned in. The UASt promoter fragment was amplified from plasmid pJFRC81, with primers 1041. C9
and 1041. Cl 1 (Table 15). The CasRx and dCasRx fragments were amplified with primers 1050L.C1 and 1050E.C4 (Table 15) from constructs pCasRx and pdCasRx, respectively.
Seven four-gRNA-array constructs were designed, OA-1050G (Addgene plasmid # 132420), OA-1050I (Addgene plasmid # 132421), OA-1050J (Addgene plasmid # 133304), OA-1050K (Addgene plasmid # 132422), OA-1050U (Addgene plasmid # 132423), OA- 1050V (Addgene plasmid # 132424), OA-1050Z4 (Addgene plasmid # 132425), targeting transcripts oΐ white, Notch, GFP, firefly luciferase, cinnabar, wingless, and yellow, respectively. To generate a base plasmid, OA-1043, which was used to build all the final seven four-gRNA-array constructs, Addgene plasmid # 112688 containing the miniwhite gene as a marker, an attB-docking site, a I) melanogaster polymerase-3 U6 (U6:3) promoter fragment, and a guide RNA fragment with a target, scaffold, and terminator sequence (gRNA) was digested with restriction enzymes Ascl and Xbal to remove the U6:3 promoter and gRNA fragments. Then the U6:3 promoter fragment amplified from the same Addgene plasmid # 112688 with primers 1043. Cl and 1043. C23 (Table S16), was cloned back using Gibson enzymatic assembly method. To generate constructs OA-1050G, OA-1050I, OA- 1050K, OA-1050U, OA-1050V, OA-1050Z4, plasmid OA-1043 was digested with restriction enzymes Pstl and Notl, a fragment containing arrays of four tandem variable gRNAs (comprised of a 36-nt direct repeat (DR) and a 30-nt spacer) corresponding to different target genes respectively, followed by an extra DR and a 7 thymines terminator was synthesized and subcloned into the digested backbone using Gene Synthesis (GenScript USA Inc., Piscataway, NJ). To generate constructs OA-1050J, a fragment containing arrays of four tandem variable gRNAs targeting GFP with an extra DR and a 7 thymines terminator, followed by the OpIE2-GFP marker was synthesized and subcloned into the above digested OA-1043 backbone using Gene Synthesis (GenScript USA Inc., Piscataway, NJ).
To assemble construct OA-1052B (Addgene plasmid # 132426), the dual-luciferase expression vector consisted of firefly luciferase linked with T2A-EGFP (Fluc-T2A-EGFP) and renilla luciferase both driven by Ubiq promoter fragment (Ubiq-Fluc-T2A-eGFP-Ubiq- Rluc), Addgene plasmid # 112688 containing the white gene as a marker, an attB-docking site as described previously was digested with enzymes Ascl and Xbal, and the following components were cloned in using the Gibson enzymatic assembly method: i) a D.
melanogaster Ubiq promoter fragment amplified from Addgene plasmid # 112686 with primers 1052B.C1 and 1052B.C2; ii) a custom gBlocks® Gene Fragment (Integrated DNA
Technologies, Coralville, Iowa) of a firefly luciferase coding sequence; iii) a T2A-eGFP fragment amplified from Addgene plasmid # 112686 with primers 908. A1 and 908. A2; iv) a custom gBlocks® Gene Fragment containing a plO 3’UTR fragment, reversed renilla luciferase followed by an SV40 3’UTR fragment; v) another Ubiq promoter fragment as reversed sequence amplified from Addgene plasmid # 112686 with primers 908. A3 and 908. A4 (Table 15). All plasmids and sequence maps were made available for download and/or order at Addgene (www.addgene.com) with identification numbers listed in FIG. 1 and Table 1. Table 15 shows primers used for vector construction. A list of primers and their respective sequences used to generate the constructs used in this study.
Fly genetics and imaging
Flies were maintained under standard conditions at 26°C. Embryo injections were performed at Rainbow Transgenic Flies, Inc. (http://www.rainbowgene.com). All CasRx and dCasRx expressing lines were generated by site-specifically integrating constructs at available < >C31 integration sites on the 2nd chromosome (site 8621 (UASA(d)CasRx) and attp40w (Ubiq-(d)CasRx)). Homozygous lines were established for UASt-CasRx and UASt- dCasRx and heterozygous balanced lines were established for Ubiq-CasRx and Ubiq-dCasRx (over Curly of Oster: CyO). All gRNAarray expressing lines were generated by site- specifically integrating constructs at an available 0C31 integration site on the 3rd chromosome (site 8622). Homozygous lines were established for all gRNAana expressing flies. Dual-luciferase reporter expressing lines were generated by site-specifically integrating the constructs at an available < >C31 integration site on the 3rd chromosome (site 9744).
Homozygous lines were established for the dual-luciferase reporter expressing flies.
To genetically assess efficiency of CasRx ribonuclease activity, at 26°C, Ubiq-CasRx and Ubiq-dCasRx expressing lines were bidirectionally crossed to gRNAana expressing lines and let lay for 4 days before removing parents. FI transheterozygotes were scored for inheritance and penetrance of observable phenotypes up to 17 days post initial laying (13-17 days). Embryo, larvae, and pupae counts preceded by crossing male Ubiq-CasRx and Ubiq- dCasRx expressing flies to female gRNAarray expressing flies. Flies were incubated at 26°C for 48h with yeast to induce embryo laying. Flies were then transferred to embryo collection chambers containing yeast-smeared grape-juice plates and incubated at 26°C overnight (16h). The grape-juice plates were then removed, embryos counted, and the grape-juice plates
incubated for 24h at 26°C. Total larvae and transheterozygote larvae were then counted and the grape-juice plates transferred to jars and incubated at 26°C. Once all larvae reached the pupal stage, total and transhet pupae were counted. Finally, total adult flies and total adult transheterozygotes were counted 20 days post initial lay. Each genetic cross was set using 5$ and 10$ (paternal CasRx) or 4 $ and 8$ (maternal CasRx) flies in triplicate.
To investigate the tissue-specific activity of CasRx, a 2-step crossing scheme was designed to generate F2 triple transheterozygotes (FIG. 3A). First, double balanced UASt- CasRx or UASt-dCasRx expressing flies (<$) were crossed to homozygous gRNAana expressing flies ($) to generate Fi transheterozygote males carrying TM6 balancer chromosome. The Fi transheterozygote males carrying TM6 were then crossed with a Gal4 driver expressing line. Marked by the presence of dsRed, the UASt-CasRx or UASt-dCasRx marker, red eyes, and the lack of TM6, F2 triple transheterozygotes inheritance and phenotype penetrance was scored. Each cross was set using 1 S and 10 $ flies in triplicate. Following a similar 2-step cross, the efficiency of CasRx mediated transcript reduction at the protein level was investigated by utilizing a dual luciferase reporter assay (FIG. 7A). Double balanced Ubiq-CasRx or Ubiq-dCasRx expressing flies were initially crossed to luciferase reporter expressing flies. Fi transheterozygote males carrying TM6 were selected and crossed to homozygous gRNAFluc expressing flies. Selecting for the Ubiq-CasRx or Ubiq-dCasRx marker, dsRed, red eyes, and against TM6, F2 triple transheterozygotes inheritance was scored and males were frozen at -80°C prior to luciferase analysis. Each cross was set using 1 S and 10 $ flies in triplicate. Flies were imaged on the Leica M165FC fluorescent stereomicroscope equipped with a Leica DMC4500 color camera. Image stacks of adult flies were taken in Leica Application Suite X (LAS X) and compiled in Helicon Focus 7. Stacked images were then cropped and edited in Adobe Photoshop CC 2018.
Illumina RNA-Sequencing
Total RNA was extracted from Fi transheterozygous flies at different developmental stages based on the reported highest expression level available through modENCODE analysis (FIG. 10). gRNA" : transheterozygous adult heads were cut off one day after emerging and frozen at -80°C. gRNA™, gRNA"". gRNA1': flies were incubated in vials for 48h with yeast to induce embryo laying. Flies were then transferred to embryo collection chambers containing yeast-smeared grape-juice plates and incubated at 26°C for 3h. Flies
were then removed and embryos on grape-juice plates incubated for additional time related to target gene (gRNA"" = 3h, 3-6h total; gRNAc" = 5h, 5-8h total; RNA1 = 17h, 17-20h total). Embryos were removed from grape-juice plates, washed with diH20, and frozen at -80°C. gRNA v. gRNAGFP: flies were incubated in vials for 48h with yeast to induce embryo laying. Flies were then transferred to a new vial and allowed to lay overnight (16h). Adults were removed and the vials were incubated at 26°C for 24h. Transheterozygote first instar larvae were then picked (based on dsRed expression) and frozen at -80°C.
For all samples, total RNA was extracted using Qiagen RNeasy Mini Kit (Qiagen 74104). Following extraction, total RNA was treated with Invitrogen Turbo™ DNase (Invitrogen AM2238). RNA concentration was analyzed using Nanodrop Onec UV-vis spectrophotometer (ThermoFisher ND-ONEC-W). RNA integrity was assessed using RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513). RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770) following the manufacturer's instructions previously three replicates for all CasRx and dCasRx samples were sequenced and analyzed with the exception of gRNA™ where 2 replicates were analyzed. In total 34 samples, 17 CasRx experimental samples and 17 dCasRx control samples, were sequenced and analyzed.
Bioinformatics
To further understand CasRx-induced differential gene expression profiles, the raw transcript counts were normalized by transcripts per million (TPM) and maximum a posteriori (MAP) method was used with the original shrinkage estimator in DESeq2 pipeline to estimate transcript logarithmic fold change (LFC) (47). Wald test with Benjamini- Hochberg correction was used for statistical inference. The detailed analysis results are presented in Tables 7 - 12. Per DESeq2 analysis requirement, some values are shown as NA due to the following reasons: 1) if all samples for a given transcripts have 0 transcript counts, this transcript's baseMean will be 0 and its LFC, p value, and padj will be set to NA; 2) If one replicate of a transcript is an outlier with extreme count (detected by Cook's distance), this transcript's p value and padj will be set to NA. 3) If a transcript is found to have a low mean normalized count after automatic independent filtering, this transcript's padj will be set to NA.
Luciferase assays
To measure the efficacy of targeted CasRx knockdown a dual Luciferase reporter system comprised of both Firefly md Renilla Luciferase was utilized. A 2-step genetic crossing scheme was performed (FIG. 7A), and F2 male triple transheterozygotes were collected for luciferase quantification. Flies were aged between 2-4 days at 26°C then frozen at -80°C. Each assay was performed on 5 male flies and 5m1 of lysed tissue was used to measure Luciferase activity. Luciferase activity in flies was then analyzed using a Dual- Luciferase® Reporter Assay System with a Glomax 20/20 Luminometer (Promega El 910 & E5331).
ADDITIONAL EMBODIMENTS
Embodiment 1 : A method of modifying a target locus of interest in vivo in an organism, comprising delivering to said locus a Type VI CRISPR-Cas loci effector protein and one or more nucleic acid components, wherein at least the one or more nucleic acid components is engineered and the effector protein forms a complex with the one or more nucleic acid components and upon binding of said complex to the target locus of interest the effector protein induces a modification of the target locus of interest.
Embodiment 2: The method of Embodiment 1, wherein the target locus of interest comprises RNA.
Embodiment 3: The method of Embodiment 2, wherein the target locus of interest comprises endogenous mRNA. Embodiment 4: The method of any one of Embodiments 1-3, wherein the modification of the target locus of interest comprises a strand break.
Embodiment 5: The method of any one of Embodiments 1-4, wherein the effector protein and one or more nucleic acid components are non-naturally occurring.
Embodiment 6: The method of any one of Embodiments 1-5, wherein the effector protein is encoded by a subtype VI-D CRISPR-Cas loci.
Embodiment 7 : The method of Embodiment 6, wherein the effector protein comprises Casl3d.
Embodiment 8: The method of Embodiment 7, wherein the Casl3d is derived from
Ruminococcus flavefaciens.
Embodiment 9: The method of any one of Embodiments 1-8, wherein the effector protein is fused to one or more localization signal.
Embodiment 10: The method of Embodiment 9, wherein the one or more localization signal is nuclear localization signal.
Embodiment 11 : The method of any one of the preceding Embodiments, wherein when in complex with the effector protein the nucleic acid component(s) is capable of effecting or effects sequence specific binding of the complex to a target sequence of the target locus of interest.
Embodiment 12: The method of any one of the preceding Embodiments, wherein the nucleic acid component(s) comprise one or more CRISPR RNA (crRNA) arrays and/or one or more trans-activating crRNA (tracrRNA).
Embodiment 13: The method of any one of the preceding Embodiments, wherein the nucleic acid component(s) comprise one or more CRISPR RNA (crRNA) arrays and do not comprise any trans-activating crRNA (tracrRNA).
Embodiment 14: The method of Embodiments 12 or 13, wherein the one or more CRISPR RNA (crRNA) arrays are pre-crRNA arrays.
Embodiment 15: The method of any one of the preceding Embodiments, wherein the effector protein and nucleic acid component(s) are provided via one or more polynucleotide molecules encoding the effector protein and/or the nucleic acid component(s), and wherein the one or more polynucleotide molecules are operably configured to express the effector protein and/or the nucleic acid component(s).
Embodiment 16: The method of Embodiment 15, wherein the one or more polynucleotide molecules comprise one or more regulatory elements operably configured to express the effector protein and/or the nucleic acid component(s).
Embodiment 17 : The method of Embodiment 16, wherein the one or more regulatory elements are ubiquitous promoters or inducible promotors.
Embodiment 18: The method of Embodiment 17, wherein the one or more regulatory
elements comprise one or more inducible UAS promoters.
Embodiment 19: The method of any one of Embodiments 15-18, wherein the one or more polynucleotide molecules are comprised within one or more vectors.
Embodiment 20: The method of any one of Embodiments 15-18, wherein the one or more polynucleotide molecules are comprised in a delivery system, or the method of claim 19 wherein the one or more vectors are comprised in a delivery system.
Embodiment 21: The method of any one of the preceding Embodiments, wherein the effector protein and one or more nucleic acid component(s) are delivered via one or more delivery vehicles comprising liposome(s), particle(s), exosome(s), microvesicle(s), a gene-gun or one or more viral vectors.
Embodiment 22: The method of any one of the preceding Embodiments, wherein the organism is a vertebrate.
Embodiment 23: The method of any one of the preceding Embodiments, wherein the organism is an invertebrate.
Embodiment 24: The method of Embodiment 23, wherein the organism is an insect.
Embodiment 25: An organism comprising a modified target locus of interest, wherein the target locus of interest has been modified according to a method of any one of the preceding Embodiments.
Embodiment 26: The organism of Embodiment 26, wherein the organism is a vertebrate. Embodiment 27 : The organism of Embodiment 26, wherein the organism is an invertebrate. Embodiment 28: The organism of Embodiment 27, wherein the organism is an insect.
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Table 1: Transgenic Lines Used in this study
Table 2
Table 2 continued
Table 4
Table 4 continued
Table 5: Samples for Illumina RNA Sequencing
Table 8 continued: Illumina RNA Sequencing Normalized expression of all GOIs
Table 9: GFP DESeq2
Table 10: Notch DESeq2
Table llryellow DESeq2
Table 12: white DESeq2
Table 13: cinnabar DESeq2
Table 14: wingless DESeq2
Table 15: Primers used to generate the constructs in this study
Claims
1. A nucleic acid molecule comprising:
(a) a sequence encoding a Casl3 polypeptide; and
(b) a sequence encoding a guide RNA comprising one or more spacers and one or more Cas 13 -specific direct repeats, wherein the spacers are capable of specifically hybridizing with one or more target RNAs.
2. The nucleic acid molecule of claim 1, wherein the Cas 13 is Cas 13d.
3. The nucleic acid molecule of claim 2, wherein the Casl3d is RfxCasl3d.
4. The nucleic acid molecule of any one of claims 1-3, wherein the sequence encoding the Cas 13 polypeptide further comprises a localization signal.
5. The nucleic acid molecule of claim 4, wherein the localization signal is a nuclear localization signal.
6. The nucleic acid molecule of any one of claims 1-5, wherein the target RNA is an endogenous RNA or a viral RNA.
7. The nucleic acid molecule of any one of claims 1-6, wherein the target RNA is an mRNA.
8. The nucleic acid molecule of any one of claims 1-7, wherein the spacers are
positioned between two Casl3-specific direct repeats.
9. The nucleic acid molecule of any one of claims 1-8, wherein the spacers are 20 to 40 nucleotides in length.
10. The nucleic acid molecule of claim 9, wherein the spacers are 25 to 35 nucleotides in length.
11. The nucleic acid molecule of claim 10, wherein the spacers are about 30 nucleotides in length.
12. The nucleic acid molecule of any one of claims 1-11, wherein the Casl3-specific direct repeats are 25 to 45 nucleotides in length.
13. The nucleic acid molecule of claim 12, wherein the Casl3-specific direct repeats are 30 to 40 nucleotides in length.
14. The nucleic acid molecule of claim 13, wherein the Casl3-specific direct repeats are about 36 nucleotides in length.
15. The nucleic acid molecule of any one of claims 1-14, wherein the guide RNA further comprises a AAAAC motif at its 5’ end.
16. The nucleic acid molecule of any one of claims 1-15, wherein the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with the same target RNA.
17. The nucleic acid molecule of any one of claims 1-15, wherein the guide RNA
comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with different target RNAs.
18. The nucleic acid molecule of any one of claims 1-17, wherein the guide RNA
comprises three or more spacers.
19. The nucleic acid molecule of any one of claims 1-18, wherein the sequence encoding a Casl3 polypeptide is operably linked to a ubiquitous promoter.
20. The nucleic acid molecule of any one of claims 1-18, wherein the sequence encoding a Casl3 polypeptide is operably linked to an inducible promoter.
21. The nucleic acid molecule of any one of claims 1-18, wherein the sequence encoding a Casl3 polypeptide is operably linked to a tissue-specific promoter.
22. A vector comprising the nucleic acid molecule of any one of claims 1-21.
23. The vector of claim 22, wherein the vector is a single vector.
24. The vector of claim 22, wherein the vector is an Adeno-associated viral vector.
25. A cell comprising the nucleic acid molecule of any one of claims 1-21.
26. A method of modifying a target RNA in a cell, the method comprising contacting the cell with the nucleic acid molecule of any one of claims 1-21.
27. A method of modifying a target RNA in a cell, the method comprising contacting the cell with the vector of claim 22.
28. The method of claims 26 or 27, wherein the target RNA is endogenous RNA or viral RNA.
29. A method of modifying a target RNA in a cell, the method comprising contacting the cell with (a) a nucleic acid molecule comprising a sequence encoding a Casl3 polypeptide, and (b) a sequence encoding a guide RNA comprising one or more spacers and one or more Casl3-specific direct repeats, wherein the one or more spacers are capable of specifically hybridizing with the target RNA.
30. The method of claim 29, wherein the Casl3 is Casl3d.
31. The method of claim 30, wherein the Casl3d is RfxCasl3d.
32. The method of any one of claims 29-31, wherein the sequence encoding the Casl3 polypeptide further comprises a localization signal.
33. The method of claim 32, wherein the localization signal is a nuclear localization signal.
34. The method of any one of claims 29-33, wherein the spacers are positioned between two Cas 13 -specific direct repeats.
35. The method of any one of claims 29-34, wherein the spacers are 20 to 40 nucleotides in length.
36. The method of claim 35, wherein the spacers are 25 to 35 nucleotides in length.
37. The method of claim 36, wherein the spacers are about 30 nucleotides in length.
38. The method of any one of claims 29-37, wherein the Casl3-specific direct repeats are 25 to 45 nucleotides in length.
39. The method of claim 38, wherein the Casl3-specific direct repeats are 30 to 40
nucleotides in length.
40. The method of claim 39, wherein the Casl3-specific direct repeats are about 36 nucleotides in length.
41. The method of any one of claims 29-40, wherein the guide RNA further comprises a AAAAC motif at its 5’ end.
42. The method of any one of claims 29-41, wherein the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with the same target RNA.
43. The method of any one of claims 29-41, wherein the guide RNA comprises two or more spacers, and wherein the two or more spacers are capable of specifically hybridizing with different target RNAs.
44. The method of any one of claims 29-41, wherein the guide RNA comprises three or more spacers.
45. The method of any one of claims 29-44, wherein the sequence encoding a Cas 13 polypeptide is operably linked to a ubiquitous promoter,
46. The method of any one of claims 29-44, wherein the sequence encoding a Cas 13 polypeptide is operably linked to an inducible promoter,
47. The method of any one of claims 29-44, wherein the sequence encoding a Cas 13 polypeptide is operably linked to a tissue-specific promoter.
48. The method of any one of claims 29-47, wherein the nucleic acid molecule is comprised within a first vector and the guide RNA is comprised within a second vector.
49. The method of claim 48, wherein the first vector and/or the second vector is an AAV vector.
50. A transgenic organism having a recombinant nucleic acid molecule stably integrated into the genome of the organism, wherein the recombinant nucleic acid molecule comprises a sequence that encodes a Casl3 polypeptide.
51. A transgenic organism having two or more recombinant nucleic acid molecules stably integrated into the genome of the organism, comprising at least a first recombinant nucleic acid molecule that comprises a sequence encoding a Casl3 polypeptide, and a second recombinant nucleic acid molecule that comprises a sequence that encodes a guide RNA.
52. The transgenic organism of claims 50 or 51, wherein the Casl3 polypeptide is a Cast 3d.
53. The transgenic organism of claim 52, wherein the Casl3d polypeptide is RfxCasl3d.
54. The transgenic organism of any one of claims 50-53, wherein the organism is a
vertebrate.
55. The transgenic organism of any one of claims 50-53, wherein the organism is an invertebrate.
56. The transgenic organism of claim 55, wherein the organism is an insect.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/426,467 US20220145297A1 (en) | 2019-01-29 | 2020-01-29 | Rna-targeting cas enzymes |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962798078P | 2019-01-29 | 2019-01-29 | |
| US62/798,078 | 2019-01-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020160150A1 true WO2020160150A1 (en) | 2020-08-06 |
Family
ID=71841139
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/015680 Ceased WO2020160150A1 (en) | 2019-01-29 | 2020-01-29 | Rna-targeting cas enzymes |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20220145297A1 (en) |
| WO (1) | WO2020160150A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549054A (en) * | 2020-05-22 | 2020-08-18 | 中国农业科学院植物保护研究所 | CRISPR/RfxCas13d anti-plant RNA virus vector and its construction method and application |
| WO2023205637A1 (en) * | 2022-04-18 | 2023-10-26 | Locanabio, Inc. | Rna-targeting compositions and methods for treating c9/orf72 diseases |
| WO2024041653A1 (en) * | 2022-08-26 | 2024-02-29 | 广州瑞风生物科技有限公司 | Crispr-cas13 system and use thereof |
| US12351818B2 (en) | 2022-11-23 | 2025-07-08 | Amber Bio Inc. | Gene-modifying endonucleases |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021169980A1 (en) * | 2020-02-25 | 2021-09-02 | Shanghaitech University | Compositions and methods for detecting nucleic acid-protein interactions |
| CN114107253B (en) * | 2021-12-17 | 2024-03-15 | 复旦大学附属华山医院 | A system and method for gene editing using engineered cells |
| WO2025259543A1 (en) * | 2024-06-09 | 2025-12-18 | Mercury Bio, Inc. | Targeted delivery of cas13d and associated guide shrna to silence targeted rnas via yeast extracellular vesicles |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190002889A1 (en) * | 2017-06-30 | 2019-01-03 | Arbor Biotechnologies, Inc. | Novel crispr rna targeting enzymes and systems and uses thereof |
| WO2019005884A1 (en) * | 2017-06-26 | 2019-01-03 | The Broad Institute, Inc. | Crispr/cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10476825B2 (en) * | 2017-08-22 | 2019-11-12 | Salk Institue for Biological Studies | RNA targeting methods and compositions |
-
2020
- 2020-01-29 US US17/426,467 patent/US20220145297A1/en active Pending
- 2020-01-29 WO PCT/US2020/015680 patent/WO2020160150A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019005884A1 (en) * | 2017-06-26 | 2019-01-03 | The Broad Institute, Inc. | Crispr/cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing |
| US20190002889A1 (en) * | 2017-06-30 | 2019-01-03 | Arbor Biotechnologies, Inc. | Novel crispr rna targeting enzymes and systems and uses thereof |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549054A (en) * | 2020-05-22 | 2020-08-18 | 中国农业科学院植物保护研究所 | CRISPR/RfxCas13d anti-plant RNA virus vector and its construction method and application |
| WO2023205637A1 (en) * | 2022-04-18 | 2023-10-26 | Locanabio, Inc. | Rna-targeting compositions and methods for treating c9/orf72 diseases |
| WO2024041653A1 (en) * | 2022-08-26 | 2024-02-29 | 广州瑞风生物科技有限公司 | Crispr-cas13 system and use thereof |
| US12297450B2 (en) | 2022-08-26 | 2025-05-13 | Guangzhou Reforgene Medicine Co., Ltd. | CRISPR-Cas13 system and use thereof |
| US12351818B2 (en) | 2022-11-23 | 2025-07-08 | Amber Bio Inc. | Gene-modifying endonucleases |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220145297A1 (en) | 2022-05-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220145297A1 (en) | Rna-targeting cas enzymes | |
| Hall et al. | Genome editing in mice using CRISPR/Cas9 technology | |
| US11225649B2 (en) | Engineered nucleic-acid targeting nucleic acids | |
| CN114375334B (en) | Engineered CaSX system | |
| Emelyanov et al. | Trans-kingdom transposition of the maize dissociation element | |
| JP6665088B2 (en) | Optimized CRISPR-Cas double nickase system, method and composition for sequence manipulation | |
| Tasic et al. | Site-specific integrase-mediated transgenesis in mice via pronuclear injection | |
| JP6625971B2 (en) | Delivery, engineering and optimization of tandem guide systems, methods and compositions for array manipulation | |
| Di Donato et al. | 2C-Cas9: a versatile tool for clonal analysis of gene function | |
| Burg et al. | Conditional mutagenesis by oligonucleotide-mediated integration of loxP sites in zebrafish | |
| Skromne et al. | Current perspectives in zebrafish reverse genetics: moving forward | |
| DE202019005567U1 (en) | New CRISPR DNA Targeting Enzymes and Systems | |
| Shiraki et al. | A tRNA-based multiplex sgRNA expression system in zebrafish and its application to generation of transgenic albino fish | |
| JP2018530336A5 (en) | ||
| CN110484549B (en) | Genome targeted modification methods | |
| Port et al. | Creating heritable mutations in Drosophila with CRISPR-Cas9 | |
| Nakayama et al. | Simple embryo injection of long single‐stranded donor templates with the CRISPR/Cas9 system leads to homology‐directed repair in Xenopus tropicalis and Xenopus laevis | |
| Takasu et al. | Precise genome editing in the silkworm Bombyx mori using TALENs and ds-and ssDNA donors–A practical approach | |
| WO2019173248A1 (en) | Engineered nucleic acid-targeting nucleic acids | |
| Backfisch et al. | Tools for gene-regulatory analyses in the marine annelid Platynereis dumerilii | |
| Williamson et al. | Conditional knockdown of transformer in sheep blow fly suggests a role in repression of dosage compensation and potential for population suppression | |
| EP3652320B1 (en) | Materials and methods for efficient targeted knock in or gene replacement | |
| US20190241879A1 (en) | Methods and compounds for gene insertion into repeated chromosome regions for multi-locus assortment and daisyfield drives | |
| Ustyantsev et al. | Proof of principle for piggyBac-mediated transgenesis in the flatworm Macrostomum lignano | |
| Ishibashi et al. | Development of an in vivo cleavable donor plasmid for targeted transgene integration by CRISPR-Cas9 and CRISPR-Cas12a |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20749422 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20749422 Country of ref document: EP Kind code of ref document: A1 |





























