WO2020148548A1 - Aav gene therapy for treating nephrotic syndrome - Google Patents

Aav gene therapy for treating nephrotic syndrome Download PDF

Info

Publication number
WO2020148548A1
WO2020148548A1 PCT/GB2020/050097 GB2020050097W WO2020148548A1 WO 2020148548 A1 WO2020148548 A1 WO 2020148548A1 GB 2020050097 W GB2020050097 W GB 2020050097W WO 2020148548 A1 WO2020148548 A1 WO 2020148548A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene therapy
aav
aav vector
vector gene
use according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2020/050097
Other languages
French (fr)
Inventor
Moin Ahson SALEEM-UDDIN
Gavin Iain Welsh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Bristol
Original Assignee
University of Bristol
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP24212299.2A priority Critical patent/EP4516915A3/en
Priority to CN202510707055.4A priority patent/CN120683181A/en
Priority to CN202080016138.4A priority patent/CN113543814B/en
Priority to CA3126429A priority patent/CA3126429A1/en
Priority to AU2020208997A priority patent/AU2020208997B2/en
Priority to US17/422,739 priority patent/US12544460B2/en
Priority to EP20701850.8A priority patent/EP3911368A1/en
Priority to JP2021541198A priority patent/JP7587506B2/en
Application filed by University of Bristol filed Critical University of Bristol
Publication of WO2020148548A1 publication Critical patent/WO2020148548A1/en
Anticipated expiration legal-status Critical
Priority to JP2024167091A priority patent/JP7835461B2/en
Priority to US18/949,585 priority patent/US20250064984A1/en
Priority to AU2026201536A priority patent/AU2026201536A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/20Animal model comprising regulated expression system
    • A01K2217/206Animal model comprising tissue-specific expression system, e.g. tissue specific expression of transgene, of Cre recombinase
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/035Animal model for multifactorial diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present invention relates to gene therapies for use in treating monogenic forms of nephrotic syndrome
  • Nephrotic syndrome is a chronic kidney disease characterized by significant proteinuria, hypoalbuminemia, oedema and hyperlipidemia, and is the most common primary glomerular disease in children, affecting 2/100,000 children below the age of 16 in Europe and the USA.
  • NS is associated with different ages of onset, from less than 3 months old at diagnosis to early adulthood, and is classified in different patients groups depending on their sensitivity to corticoids: ⁇ 80% of children with NS are classified as having steroid-sensitive nephrotic syndrome (SSNS) and can be successfully treated with corticosteroid therapy.
  • SSNS steroid-sensitive nephrotic syndrome
  • SRNS steroid- resistant nephrotic syndrome
  • the podocyte branches off cellular processes to cover the outside of the glomerular capillary, called foot processes, and their interdigitations with neighbouring foot processes form the glomerular slit membrane, critical for the glomerular filtration barrier efficiency and for the retention of protein in the blood stream.
  • mutations in genes coding for key podocyte processes such as the development, migration, basement membrane interaction, or regeneration of the podocyte, lead to the loss of integrity of the glomerular slit membrane and to the nephrotic syndrome phenotype.
  • Approximately 30% of cases of SRNS in children are genetic, where the most common mutations in childhood are in NPHS2 encoding podocin, accounting for 10-30% of sporadic genetic cases.
  • Podocin is a 42kDa hairpin like membrane-associated podocyte-specific protein that is a key component of the protein complex at the slit diaphragm; the cell-cell junction between adjacent podocyte foot processes. It localises to lipid rafts and interacts with other important slit diaphragm proteins like nephrin, CD2AP and TRPC6. It is essential in the maintenance of the slit diaphragm, and consequently the integrity of the glomerular filtration barrier. There are 126 mutations reported to date, but the most common mutation is R138Q, which causes mislocalisation of podocin to the endoplasmic reticulum.
  • tail vein injection was shown to be unsuitable for kidney transduction and, while a low level of gene expression in podocytes was observed, widespread expression was also observed in the liver, despite the use of an allegedly kidney specific promoter.
  • the study additionally failed to demonstrate successful transduction of a NS-associated transgene, such as podocin, and failed to demonstrate long term functional expression of such genes.
  • the present invention aims to reverse the NS phenotype and correct podocyte- associated kidney dysfunction in patients with monogenic forms of NS by administering AAV gene therapy expressing a NS-associated transgene under the control of a podocyte-specific promoter.
  • the present invention provides an adeno-associated virus (AAV) vector gene therapy for use in treating a monogenic form of nephrotic syndrome, wherein the AAV vector comprises: a NS-associated transgene; and minimal nephrin promoter NPHS1 or podocin promoter NPHS2.
  • AAV adeno-associated virus
  • the gene therapy vector can reverse the NS phenotype and correct podocyte-associated kidney dysfunction in patients with monogenic forms of NS.
  • Suitable AAV serotypes for use in the vector include 2/9, LK03 and 3B.
  • the AAV 2/9 serotype has shown significant tropism for newborn and adult mouse kidney, localising to the glomeruli and tubules (Luo et al., 2011; Picconi et al., 2014; Schievenbusch et al., 2010), and AAV2/9 vector combined with renal vein injection has been shown to be suitable for kidney-targeted gene delivery (Rocca at al., 2014).
  • AAV 2/9 is therefore one suitable vector for use in the gene therapy of the present invention.
  • Synthetic AAV capsids such as LK03 can also be suitable vectors for use in the gene therapy of the present invention.
  • This vector has been shown to transduce human primary hepatocytes at high efficiency in vitro and in vivo. However, until now it has not been utilised in kidney-targeted gene delivery.
  • the present inventors have demonstrated herein that AAV-LK03 vectors can achieve high transduction of close to 100% in human podocytes in vitro and can be used to transduce podocytes specifically in vitro.
  • the AAV-LK03 cap sequence consists of fragments from seven different wild-type serotypes (AAV1, 2, 3B, 4, 6, 8, 9), although AAV-3B represents 97.7% of the cap gene sequence and 98.9% of the amino acid sequence.
  • AAV-3B is also known for its human hepatocyte tropism is another a suitable vector for use in the gene therapy of the present invention. To date it has not been utilised in kidney- targeted gene delivery.
  • the NS-associated transgene used in the gene therapy is a gene associated with a monogenic form of NS and expressed in podocytes, and which encodes a protein of about 833 amino acids or less. This size limitation allows the NS-associated transgene to fit into the gene therapy vector of the present invention.
  • Suitable NS-associated transgenes include NPHS2 ; ADCK4 ; ALG1 ; ARHGAP24 ; ARGHDIA CD151 - CD2AP ; COQ2 ; COQ6 ; DGKE ; E2F3; EMP2) KANK2 ; LAGE3) LMNA LMX1B ; MAFB ; NUP85) NUP93 ; NXF5) OSGEP ; PAX ; PDSS2) PM M2) PODXL) SCARB2) SGPL1 ) Smad7) TP53RK) TPRKB) VDR; WDR73) WT1 ) ZMPSTE24) and APOL1.
  • the NS-associated transgene may be an SRNS- associated transgene such as ADCK4) CD2AP) DGKE) EMP2) NPHS2) NUP86) NUP93) SGPL1 ; WDR73) or I/I/P .
  • the NS-associated transgene is NPHS2, which encodes podocin.
  • NPHS2 encodes podocin.
  • Figure 6 One example of a suitable human NPHS2 transgene cDNA sequence is shown in Figure 6.
  • the transgene species is preferably matched to the patient species. For example, when treating a human patient one would typically use a human transgene.
  • the transgene may be naturally occurring, e.g. wild-type, or it may be recombinant.
  • the transgene is typically included in the gene therapy vector as a cDNA sequence.
  • NPHS1 or podocin promoter NPHS2 allows the gene therapy vector to be targeted specifically to podocytes (Moeller et al., 2002; Picconi et al., 2014). This enables transgene expression to be specifically targeted to podocytes in the glomerular basement membrane of the kidney and minimises off-target expression. As podocytes are terminally differentiated and non-dividing cells they can be targeted for stable expression of the transgene and reduce or avoid any risk of vector dilution effect.
  • the promoter is NPHS1.
  • NPHS1 One example of a suitable DNA sequence for the NPHS1 promoter is shown in Figure 5.
  • the species of the promotor is preferably matched to the patient species.
  • the AAV vector may additionally comprise a Woodchuck hepatitis post- transcriptional regulatory element (WPRE).
  • WPRE is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. Inclusion of WPRE may increase expression of the transgene delivered by the vector.
  • the WPRE sequence may be mutated to reduce oncogenicity without significant loss of RNA enhancement activity (Schambach et a/., 2005, incorporated herein by reference).
  • a suitable WPRE sequence is shown in Figure 7.
  • the NS-associated transgene may comprise a hemagglutinin (HA) tag.
  • HA can be used as an epitope tag and has been shown not to interfere with bioactivity or biodistribution of proteins to which it has been added.
  • the HA tag can facilitate detection, isolation, and purification of the transgene.
  • the AAV vector may additionally comprise a Kozak sequence between the promoter and the podocin transgene. The Kozak sequence is known to play a major role in the initiation of the translation process and can therefore enhance expression of the podocin transgene.
  • the AAV vector may additionally comprise a polyadenylation signal, such as bovine growth hormone (bGH) polyadenylation signal, e.g. as shown in Figure 8.
  • bGH bovine growth hormone
  • Polyadenylation is the addition of a poly(A) tail to a messenger RNA.
  • the poly(A) tail consists of multiple adenosine monophosphates; in other words, it is a stretch of RNA that has only adenine bases.
  • the poly(A) tail is important for the nuclear export, translation, and stability of mRNA. Inclusion of a polyadenylation signal can therefore enhance expression of the podocin transgene.
  • the AAV vector gene therapy additionally typically comprises Inverted Terminal Repeat (ITR) sequences at either end of the vector.
  • ITR Inverted Terminal Repeat
  • the vector structure may be, in order: ITR - promotor - transgene (with optional HA tag) - optional WRPE - polyadenylation signal - ITR.
  • the gene therapy vector of the present invention can therefore be used to treat or manage monogenic forms of NS in a patient.
  • patient as used herein may include any mammal, including a human.
  • the patient may be an adult or a paediatric patient, such as a neonate or an infant.
  • the patient may be a paediatric patient between the ages of about 1 and about 16 years old.
  • the patient is suffering from a monogenic form of NS.
  • the NS is caused by a mutation in one gene.
  • mutation is in a gene expressed in podocytes.
  • the NS may be SRNS caused by a mutation in NPHS2, which encodes podocin.
  • the monogenic form of NS may be caused by one or mutations in any one of ADCK4) ALG1 ; ARHGAP24 ; ARGHDIA ; CD151 ; CD2AP- COQ2- COQ6 ; DGKE ; E2F3 ; EMP2) KANK2 ; LAGE3 ; LMNA ; LMX1B ; MAFB ; NUP85) NUP93) NXF5 ; OSGEP) PAX2 ; PDSS2) PM M2) PODXL) SCARB2) SGPL1 ) Smad7) TP53RK) TPRKB) VDR) WDR73) WT1 ) ZMPSTE24) or APOL1.
  • ADCK4 ALG1 ; ARHGAP24 ; ARGHDIA ; CD151 ; CD2AP- COQ2- COQ6 ; DGKE ; E2F3 ; EMP2) KANK2 ; LAGE3 ; LMNA ; LMX1B ; MAFB ; N
  • the monogenic form of NS may be a monogenic form of SRNS caused by one or more mutations in any one of ADCK4) CD2AP) DGKE) EMP2) NPHS2) NUP86) NUP93) SGPL1 ) WDR73) or WTl .
  • the genetic mutation causing the SRNS may be an NPHS2 mutation affecting podocin expression, such as one or more of those listed in Table A below.
  • Table A non-exhaustive list of podocin ( NPHS2 ) mutations.
  • the genetic mutation may be p.Argl38Gln, also known as R138Q.
  • R138Q is the most common podocin mutation in children with SRNS in Caucasian populations. The mutation causes endoplasmic reticulum retention of podocin, which prevents it from reaching the slit diaphragm and interacting with other important slit diaphragm proteins to form a functional filtration barrier.
  • the NPHS2 mutations are all affecting the same gene any combination of these mutations could be treated by an AAV gene therapy vector of the present invention including an NPHS2 transgene.
  • the patient may have a p.Argl38Gln mutation and may also have one or more of the other mutations identified in Table A above.
  • the presence or absence of a monogenic form of NS can be determined by laboratory testing, such as that available from Bristol Genetics Laboratories, Bristol, UK. Typically, genetic testing can be performed by analysis of a blood sample obtained from the patient.
  • the AAV vector gene therapy may be administered systemically, such as by intravenous injection.
  • the AAV vector gene therapy may be administered by injection into the renal artery.
  • the AAV vector gene therapy may be administered by retrograde administration, e.g. via the ureters using a urinary catheter.
  • the gene therapy may be administered as a single dose, in other words, subsequent doses of the vector may not be needed.
  • vector used in a first dose may comprise AAV-LK03 or AAV-3B whereas the vector used in a subsequent dose may comprise AAV 2/9.
  • the gene therapy may be administered in combination with temporary immunosuppression of the patient, e.g. by administering the gene therapy at the same time as, or following treatment with, oral steroids. Immunosuppression may be desirable before and/or during gene therapy treatment to suppress the patient's immune response to the vector.
  • the AAV capsid is present only transiently in the transduced cell as it is not encoded by the vector.
  • the capsid is therefore gradually degraded and cleared, meaning that a short-term immunomodulatory regimen that blocks the immune response to the capsid until capsid sequences are cleared from the transduced cells can allow long-term expression of the transgene. Immunosuppression may therefore be desirable for a period of about six weeks following administration of the gene therapy.
  • the AAV vector gene therapy may be administered in the form of a pharmaceutical composition.
  • the AAV vector gene therapy may be combined with one or more pharmaceutically acceptable carriers or excipients.
  • a suitable pharmaceutical composition is preferably sterile.
  • Figure 1 shows that AAV 2/9 administered by tail vein injection transduces the kidney and expresses HA-tagged podocin in the podocyte.
  • Figure 2 shows that tail vein injection of AAV 2/9 expressing wild-type podocin under a podocyte-specific promoter ameliorates proteinuria in the conditional podocin knock-out mouse model (iPod NPHS2 fl/fl )
  • A) Urinary albumi creatinine ratio of mice injected with AAV 2/9 mNPHSl.mpod versus AAV 2/9 hNPHSl.mpod versus saline (n 9 in each group, **p ⁇ 0.01 ***p ⁇ 0.001).
  • the saline group showed proteinuria from day 14 onwards and showed a large amount of albumin while the vector treated groups showed later onset of albuminuria and milder albuminuria.
  • AAV LK03 shows efficient transduction of human podocytes in vitro with the minimal human nephrin promoter.
  • A, C, E immunofluorescence demonstrating transduction of human podocytes (Pod), glomerular endothelial cells (GEnC) and proximal tubule epithelial cells (PTEC) by AAV LK03 CMV GFP, with only expression of GFP in podocytes when using the minimal nephrin promoter
  • AAV LK03 hNPHSl GFP AAV LK03 hNPHSl GFP.
  • B Western blot demonstrating GFP expression in podocytes only when using the minimal human nephrin promoter using AAV LK03.
  • D) Flow cytometry demonstrating highly efficient transduction of podocytes using AAV LK03 CMV GFP, and confirming the GFP expression using the minimal nephrin promoter was only seen in podocytes.
  • FIG. 4 AAV LK03 expressing wild type human podocin shows functional rescue in the mutant podocin R138Q podocyte cell line.
  • Figure 5 shows an example DNA sequence for the minimal human nephrin promoter (NPHS1).
  • Figure 6 shows an example cDNA sequence for a human podocin transgene.
  • Figure 7 shows an example DNA sequence for a WPRE sequence.
  • Figure 8 shows an example DNA sequence for a bGH poly(A) signal sequence.
  • Figure 9 shows human podocytes transduced with either HAVDR (A) or HASmad7 (B) using AAV LK03 with the minimal human nephrin promoter.
  • Vector production We prepared pAV.hNPHSl.mpodHA.WPRE.bGH, pAV.mNPHSl.mpodHA.WPRE.bGH and pAV.hNPHSl.hpodHA.WPRE.bGH ( Figure 1A) pAV.mNPHSl.hHAVDR.WPRE.bGH and pAV.mNPHSl.hHASmad7.WPRE.bGH in our laboratory from a CMV eGFP L22Y pUC-AV2 construct (kind gift of Amit Nathwani) using human ( Figure 6) and mouse (sequence not shown) podocin cDNA (Origene, Herford, Germany) and human VDR and Smad7 cDNA.
  • Human embryonic kidney 293T cells were transfected with a capsid plasmid (pAAV9 from Penn Vector Core, pAAV LK03 was the kind gift of Mark Kay), a helper plasmid with adenoviral genes and the transgene plasmid using polyethyleneimine. Cells and supernatant were harvested at 72 hours post-transfection. Cells underwent 5 freeze-thaw cycles, while the supernatant underwent PEG precipitation (8% PEG 0.5N NaCI). These were combined and incubated with 0.25% sodium deoxycholic acid and 70units/ml Benzonase for 30 minutes at 37°C. The vector was purified by iodixanol gradient ultracentrifugation, and subsequently concentrated in PBS. Vectors were titrated by qPCR using the standard curve method using the following primers:
  • NPHS2 fl0X/fl0X mice (kind gift of Corinne Antignac, INSERM U983, Paris) were bred with NPHS2-rtTA/ Tet-On Cre mice to generate offspring with NPHS2-rtTA/ Tet-On Cre/ NPHS2 fl0X/fl0X . These mice develop a podocyte-specific knockout of podocin when exposed to doxycycline. These will be called iPod NPHS2 fl/fl from hereon.
  • mice were on a mixed background and equal numbers of each sex were used. Mice were administered AAV via tail vein injection at 8 weeks of age. (Figure IB) 10 to 14 days later, mice were provided with drinking water supplemented with doxycycline 2mg/ml and 5% sucrose for 3 weeks. Urine was taken weekly. Mice were culled by Schedule 1 methods at 6 weeks post initiation of doxycycline. A small number of mice were kept beyond 6 weeks to test for effect on survival. All mice were re-genotyped from tissue taken at death. Cell Culture
  • Conditionally immortalised human podocytes were cultured in RPMI with L- glutamine and NaHC03 with 10% Fetal Bovine Serum (Sigma Aldrich, Gillingham, UK).
  • Conditionally immortalised human glomerular endothelial cells were cultured in EBMTM-2 Endothelial Cell Growth Basal Medium-2 supplemented with EGMTM-2 Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, Basel, Switzerland).
  • Immortalised proximal tubule epithelial cells (ATCC, Teddington, UK) (PTEC) were cultured in DMEM/F12 supplemented with Insulin, Transferrin and Selenium, Hydrocortisone and 10% FBS.
  • Cells were transduced with AAV at a MOI of 5 x 10 5 .
  • GFP expression cells were used at 5-7 days post transduction to allow comparisons across different cell lines.
  • podocin, VDR and Smad7 expression cells were used at 10-14 days post transduction when podocytes are maximally differentiated.
  • DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Manchester, UK) from mouse kidney cortex. AAV DNA was detected using the primers above for viral titration and normalised against mouse beta-actin.
  • Cells were fixed with either 4% PFA and or ice cold methanol, incubated for 5 minutes with 0.03M glycine, permeabilised with 0.3% Triton then blocked with 3% BSA.
  • Primary antibodies were mouse HA.11 Epitope Tag Antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland), rabbit anti-Calnexin (Merck Millipore, Darmstadt, Germany) and rabbit anti-Caveolin 1 (Cell Signaling, Danvers, USA).
  • AlexaFluor 488 donkey anti-mouse AlexaFluor 488 donkey anti-rabbit
  • AlexaFluor 488 goat-anti guinea pig AlexaFluor 555 goat anti rabbit and AlexaFluor 633 goat anti-rat
  • AlexaFluor 633 Phalloidin Invitrogen, Thermo Fisher Scientific, Waltham, USA. Sections were counterstained with DAPI and mounted with Mowiol.
  • Live cells were stained with propidium iodide and only live single cells were included in the analysis.
  • Flow cytometry was carried out on the NovoCyte Flow Cytometer.
  • Cells were trypsinised and resuspended at 10 5 /ml and allowed to recover for 10 minutes before plating 50pl of cells diluted 1 in 2 with PBS in a 96 well plate. Technical triplicates were used. Cells were left to adhere for about 1 hour at 37°C. Cells were washed with PBS to wash away non adherent cells, then fixed with 4% PFA for 20 minutes. Cells were washed with distilled water then stained with 0.1% crystal violet in 2% ethanol for 60 minutes at room temperature. Cells were washed and incubated with 10% acetic acid on a shaker for 5 minutes. Absorbance was measured at 570nm and results were normalised against the wild type cell line transduced with AAV LK03 CMV GFP.
  • Albumin levels were measured using a mouse albumin ELISA kit (Bethyl Laboratories Inc, Montgomery, USA) and Creatinine levels were measured on the Konelab Prime 60i Analyzer.
  • Mouse plasma was processed either using the Konelab Prime 60i analyser or the Roche Cobas system with reagents and protocols supplied by the manufacturer.
  • Tail vein injection of AAV serotype 9 demonstrates transduction of kidney cells and expression in the podocyte
  • AAV2/9 expressing wild type podocin reduces albuminuria in iPod NPHS2 fi/fl mice
  • Vector treated groups showed a reduction in urinary albumin :creatinine ratio (ACR) ( Figure 2A, 2B).
  • mice in AAV 2/9 hNPHSl.mpod group and 1 of 9 mice in AAV 2/9 mNPHSl.mpod group had urinary ACRs of less than 30mg/mmol at day 42.
  • mice in vector treated groups showed an improvement, there was a large degree of variation within the groups which we hypothesised might be attributable to amount of vector that reached the kidney after a systemic injection.
  • AAV2/9 expressing wild type podocin partially rescues the phenotype in iPod NPHS2 fl/fl mice
  • AAV LK03 transduces human podocytes efficiently in vitro with the minimal human nephrin promoter
  • AAV LK03 with CMV GFP and AAV LK03 hNPHSl GFP were used to transduce human podocytes, glomerular endothelial cells and proximal tubular epithelial cells at a MOI of 5x10 s .
  • AAV 2/9 has been the serotype which has seen the best transduction in kidney cells in vivo in rodent kidneys, we tested the expression of AAV 2/9 CMV GFP on human kidney cell lines.
  • AAV LK03 with AAV LK03 hNPHSl HAVDR and AAV LK03 hNPHSl hSmad7 were used to transduce human podocytes showing good expression of both proteins (Figure 9).
  • AAV LK03 expressing human podocin under the minimal nephrin promoter shows functional rescue in mutant podocin R138Q podocyte cell line
  • the R138Q podocin mutant results in mislocalisation of podocin from the plasma membrane to the endoplasmic reticulum.
  • the mutant podocin R138Q podocyte cell line was acquired from a patient kidney and conditionally immortalised using temperature sensitive SV40 T antigen.
  • AAV LK03 hNPHSl hpod transduces R138Q podocytes and expresses HA-tagged podocin ( Figure 4A, 4B).
  • HA-tagged podocin is seen at the plasma membrane on confocal microscopy and colocalises with Caveolin-1, a lipid raft protein, as seen on TIRF microscopy ( Figure 4B, 4E).
  • Untransduced R138Q podocytes do not show any podocin expression at the plasma membrane ( Figure 4B).
  • HA-tagged podocin does not colocalise with Calnexin, an endoplasmic reticulum marker ( Figure 4D).
  • Podocytes show a decrease or increase in adhesion in diseased states. Previous work in our laboratory has shown that the R138Q mutation causes a decrease in podocyte adhesion. AAV transduction causes a decrease in podocyte adhesion but the R138Q podocytes still show reduced adhesion compared to wild type podocytes, and transduction with AAV LK03 hNPHSl hpod results in the rescue of the adhesional function of R138Q podocytes ( Figure 4C).
  • AAV LK03 has shown high transduction of close to 100% in human podocytes in vitro, which is reduced to 72.3% when using the minimal human nephrin promoter. We have shown that we can use this serotype to transduce podocytes specifically in vitro, and that expression of wild type podocin in R138Q mutant podocytes show functional rescue. Using AAV LK03 has implications on translation as such effective transduction of human podocytes might enable a significant reduction in effective dose in humans.
  • a recent UK study has shown low anti AAV LK03 neutralising antibody seroprevalence of 23%, with a nadir in late childhood (Perocheau, D. P. et al.), which makes this particular serotype a promising candidate for translational studies.
  • rAAV9 combined with renal vein injection is optimal for kidney-targeted gene delivery: conclusion of a comparative study. Gene therapy, 21, 618-628.
  • VAN DER WOUDEN E. A., SANDOVICI, M., HENNING, R. H., DE ZEEUW, D. & DEELMAN, L. E. 2004. Approaches and methods in gene therapy for kidney disease. J Pharmacol Toxicol Methods, 50, 13-24.
  • [SEQ ID NO: l] shows the ITR Forward primer.
  • [SEQ ID NO: 2] shows the ITR Reverse primer.
  • [SEQ ID NO: 3] shows the DNA sequence of the ITR probe FAM-5'- CACTCCCTCTCTGCGCGCTCG-3'-TAMRA.
  • [SEQ ID NO:4] shows the example DNA sequence for the minimal human nephrin promoter (NPHS1) as shown in Figure 5.
  • [SEQ ID NO: 5] shows the example cDNA sequence for the human podocin transgene shown in Figure 6.
  • [SEQ ID NO:6] shows the example DNA sequence for the WPRE sequence shown in Figure 7.
  • [SEQ ID NO:7] shows the example DNA sequence for the bGH poly(A) signal sequence shown in Figure 8.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides an adeno-associated virus (AAV) vector gene therapy for use in treating a monogenic form of nephrotic syndrome, wherein the AAV vector comprises a NS-associated transgene and minimal nephrin promoter NPHS1 or podocin promoter NPHS2.

Description

AAV GENE THERAPY FOR TREATING NEPHROTIC SYNDROME
Field of Invention
The present invention relates to gene therapies for use in treating monogenic forms of nephrotic syndrome
Background to the Invention
Nephrotic syndrome (NS) is a chronic kidney disease characterized by significant proteinuria, hypoalbuminemia, oedema and hyperlipidemia, and is the most common primary glomerular disease in children, affecting 2/100,000 children below the age of 16 in Europe and the USA. NS is associated with different ages of onset, from less than 3 months old at diagnosis to early adulthood, and is classified in different patients groups depending on their sensitivity to corticoids: ~80% of children with NS are classified as having steroid-sensitive nephrotic syndrome (SSNS) and can be successfully treated with corticosteroid therapy. A proportion of patients originally classified as SSNS relapse and need further steroid treatment, and a further 10-15% of NS patients do not achieve remission after weeks of therapy with corticosteroids and are classified as having steroid- resistant nephrotic syndrome (SRNS). Up to 50% of these SRNS patients progress to end-stage renal disease within 10 years and commonly face an elevated risk of recurrence after renal transplant, highlighting the lack of suitable and efficient treatment for these patients. Podocyte dysfunction and resultant disruption of the glomerular filtration barrier is central to the pathogenesis of NS. The podocyte branches off cellular processes to cover the outside of the glomerular capillary, called foot processes, and their interdigitations with neighbouring foot processes form the glomerular slit membrane, critical for the glomerular filtration barrier efficiency and for the retention of protein in the blood stream. In genetic forms of NS, mutations in genes coding for key podocyte processes such as the development, migration, basement membrane interaction, or regeneration of the podocyte, lead to the loss of integrity of the glomerular slit membrane and to the nephrotic syndrome phenotype. Approximately 30% of cases of SRNS in children are genetic, where the most common mutations in childhood are in NPHS2 encoding podocin, accounting for 10-30% of sporadic genetic cases. Podocin is a 42kDa hairpin like membrane-associated podocyte-specific protein that is a key component of the protein complex at the slit diaphragm; the cell-cell junction between adjacent podocyte foot processes. It localises to lipid rafts and interacts with other important slit diaphragm proteins like nephrin, CD2AP and TRPC6. It is essential in the maintenance of the slit diaphragm, and consequently the integrity of the glomerular filtration barrier. There are 126 mutations reported to date, but the most common mutation is R138Q, which causes mislocalisation of podocin to the endoplasmic reticulum.
As no effective treatment currently exists for patients with monogenic forms of NS, the use of gene therapy for the transfer of a functional gene copy in diseased podocytes could constitute a promising novel strategy to address monogenic forms of NS, reverse NS phenotype and correct kidney dysfunction. Indeed, US2003/0152954 generally suggested the use of viral vectors to deliver nucleic acids encoding polypeptides with podocin activity but failed to disclose or test any specific gene therapy constructs. It is likely that this is because the kidney has a complex anatomy with specialised compartments composed of glomeruli, tubules, vasculature, and interstitium, which makes it a difficult target for gene therapy vectors. To date renal-targeted gene therapy has been largely unsuccessful as the highly differentiated sub-structures of the kidney can be difficult to target and specifically transduce with viral vector approaches (van der Wouden et al., 2004).
A recent study attempted to target the kidney using rAAV vectors in combination with a CMV promoter and GFP or luciferase genes, which were administered via tail vein injection or renal vein injection (Rocca et al 2014). However, tail vein injection was shown to be unsuitable for kidney transduction and, while a low level of gene expression in podocytes was observed, widespread expression was also observed in the liver, despite the use of an allegedly kidney specific promoter. The study additionally failed to demonstrate successful transduction of a NS-associated transgene, such as podocin, and failed to demonstrate long term functional expression of such genes. The study also did not explore AAV serotypes suitable for human renal cell transduction. The present invention aims to reverse the NS phenotype and correct podocyte- associated kidney dysfunction in patients with monogenic forms of NS by administering AAV gene therapy expressing a NS-associated transgene under the control of a podocyte-specific promoter.
Summary of the Invention
The present invention provides an adeno-associated virus (AAV) vector gene therapy for use in treating a monogenic form of nephrotic syndrome, wherein the AAV vector comprises: a NS-associated transgene; and minimal nephrin promoter NPHS1 or podocin promoter NPHS2. The gene therapy vector can reverse the NS phenotype and correct podocyte-associated kidney dysfunction in patients with monogenic forms of NS.
Suitable AAV serotypes for use in the vector include 2/9, LK03 and 3B.
The AAV 2/9 serotype has shown significant tropism for newborn and adult mouse kidney, localising to the glomeruli and tubules (Luo et al., 2011; Picconi et al., 2014; Schievenbusch et al., 2010), and AAV2/9 vector combined with renal vein injection has been shown to be suitable for kidney-targeted gene delivery (Rocca at al., 2014). AAV 2/9 is therefore one suitable vector for use in the gene therapy of the present invention.
Synthetic AAV capsids such as LK03 can also be suitable vectors for use in the gene therapy of the present invention. This vector has been shown to transduce human primary hepatocytes at high efficiency in vitro and in vivo. However, until now it has not been utilised in kidney-targeted gene delivery. The present inventors have demonstrated herein that AAV-LK03 vectors can achieve high transduction of close to 100% in human podocytes in vitro and can be used to transduce podocytes specifically in vitro.
The AAV-LK03 cap sequence consists of fragments from seven different wild-type serotypes (AAV1, 2, 3B, 4, 6, 8, 9), although AAV-3B represents 97.7% of the cap gene sequence and 98.9% of the amino acid sequence. AAV-3B is also known for its human hepatocyte tropism is another a suitable vector for use in the gene therapy of the present invention. To date it has not been utilised in kidney- targeted gene delivery. The NS-associated transgene used in the gene therapy is a gene associated with a monogenic form of NS and expressed in podocytes, and which encodes a protein of about 833 amino acids or less. This size limitation allows the NS-associated transgene to fit into the gene therapy vector of the present invention.
Suitable NS-associated transgenes include NPHS2 ; ADCK4 ; ALG1 ; ARHGAP24 ; ARGHDIA CD151 - CD2AP ; COQ2 ; COQ6 ; DGKE ; E2F3; EMP2) KANK2 ; LAGE3) LMNA LMX1B ; MAFB ; NUP85) NUP93 ; NXF5) OSGEP ; PAX ; PDSS2) PM M2) PODXL) SCARB2) SGPL1 ) Smad7) TP53RK) TPRKB) VDR; WDR73) WT1 ) ZMPSTE24) and APOL1.
In embodiments of the invention the NS-associated transgene may be an SRNS- associated transgene such as ADCK4) CD2AP) DGKE) EMP2) NPHS2) NUP86) NUP93) SGPL1 ; WDR73) or I/I/P .
In preferred embodiments of the invention the NS-associated transgene is NPHS2, which encodes podocin. One example of a suitable human NPHS2 transgene cDNA sequence is shown in Figure 6.
The transgene species is preferably matched to the patient species. For example, when treating a human patient one would typically use a human transgene. The transgene may be naturally occurring, e.g. wild-type, or it may be recombinant. The transgene is typically included in the gene therapy vector as a cDNA sequence.
Use of a minimal nephrin promoter such as NPHS1 or podocin promoter NPHS2 allows the gene therapy vector to be targeted specifically to podocytes (Moeller et al., 2002; Picconi et al., 2014). This enables transgene expression to be specifically targeted to podocytes in the glomerular basement membrane of the kidney and minimises off-target expression. As podocytes are terminally differentiated and non-dividing cells they can be targeted for stable expression of the transgene and reduce or avoid any risk of vector dilution effect. In preferred embodiments of the invention the promoter is NPHS1. One example of a suitable DNA sequence for the NPHS1 promoter is shown in Figure 5. As with the transgene, the species of the promotor is preferably matched to the patient species. For example, when treating a human patient one would typically use human NHPS1 or human NPHS2. The AAV vector may additionally comprise a Woodchuck hepatitis post- transcriptional regulatory element (WPRE). WPRE is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. Inclusion of WPRE may increase expression of the transgene delivered by the vector. The WPRE sequence may be mutated to reduce oncogenicity without significant loss of RNA enhancement activity (Schambach et a/., 2005, incorporated herein by reference). One example of a suitable WPRE sequence is shown in Figure 7. The NS-associated transgene may comprise a hemagglutinin (HA) tag. HA can be used as an epitope tag and has been shown not to interfere with bioactivity or biodistribution of proteins to which it has been added. The HA tag can facilitate detection, isolation, and purification of the transgene. The AAV vector may additionally comprise a Kozak sequence between the promoter and the podocin transgene. The Kozak sequence is known to play a major role in the initiation of the translation process and can therefore enhance expression of the podocin transgene. The AAV vector may additionally comprise a polyadenylation signal, such as bovine growth hormone (bGH) polyadenylation signal, e.g. as shown in Figure 8. Polyadenylation is the addition of a poly(A) tail to a messenger RNA. The poly(A) tail consists of multiple adenosine monophosphates; in other words, it is a stretch of RNA that has only adenine bases. The poly(A) tail is important for the nuclear export, translation, and stability of mRNA. Inclusion of a polyadenylation signal can therefore enhance expression of the podocin transgene.
The AAV vector gene therapy additionally typically comprises Inverted Terminal Repeat (ITR) sequences at either end of the vector. For example, the vector structure may be, in order: ITR - promotor - transgene (with optional HA tag) - optional WRPE - polyadenylation signal - ITR.
The gene therapy vector of the present invention can therefore be used to treat or manage monogenic forms of NS in a patient. The term "patient" as used herein may include any mammal, including a human. The patient may be an adult or a paediatric patient, such as a neonate or an infant. In embodiments of the invention the patient may be a paediatric patient between the ages of about 1 and about 16 years old.
The patient is suffering from a monogenic form of NS. In other words, the NS is caused by a mutation in one gene. Preferably mutation is in a gene expressed in podocytes. For example, the NS may be SRNS caused by a mutation in NPHS2, which encodes podocin. Alternatively, the monogenic form of NS may be caused by one or mutations in any one of ADCK4) ALG1 ; ARHGAP24 ; ARGHDIA ; CD151 ; CD2AP- COQ2- COQ6 ; DGKE ; E2F3 ; EMP2) KANK2 ; LAGE3 ; LMNA ; LMX1B ; MAFB ; NUP85) NUP93) NXF5 ; OSGEP) PAX2 ; PDSS2) PM M2) PODXL) SCARB2) SGPL1 ) Smad7) TP53RK) TPRKB) VDR) WDR73) WT1 ) ZMPSTE24) or APOL1. In embodiments of the invention the monogenic form of NS may be a monogenic form of SRNS caused by one or more mutations in any one of ADCK4) CD2AP) DGKE) EMP2) NPHS2) NUP86) NUP93) SGPL1 ) WDR73) or WTl .
The genetic mutation causing the SRNS may be an NPHS2 mutation affecting podocin expression, such as one or more of those listed in Table A below.
Table A: non-exhaustive list of podocin ( NPHS2 ) mutations.
Figure imgf000008_0001
Figure imgf000009_0001
Figure imgf000010_0001
In preferred embodiments of the invention the genetic mutation may be p.Argl38Gln, also known as R138Q. R138Q is the most common podocin mutation in children with SRNS in Caucasian populations. The mutation causes endoplasmic reticulum retention of podocin, which prevents it from reaching the slit diaphragm and interacting with other important slit diaphragm proteins to form a functional filtration barrier.
As the NPHS2 mutations are all affecting the same gene any combination of these mutations could be treated by an AAV gene therapy vector of the present invention including an NPHS2 transgene. In other words, the patient may have a p.Argl38Gln mutation and may also have one or more of the other mutations identified in Table A above.
The presence or absence of a monogenic form of NS can be determined by laboratory testing, such as that available from Bristol Genetics Laboratories, Bristol, UK. Typically, genetic testing can be performed by analysis of a blood sample obtained from the patient.
The AAV vector gene therapy may be administered systemically, such as by intravenous injection. In embodiments of the invention the AAV vector gene therapy may be administered by injection into the renal artery. In alternative embodiments of the invention the AAV vector gene therapy may be administered by retrograde administration, e.g. via the ureters using a urinary catheter.
The gene therapy may be administered as a single dose, in other words, subsequent doses of the vector may not be needed. In the event that repeated doses are needed different AAV serotypes can be used in the vector. For example, vector used in a first dose may comprise AAV-LK03 or AAV-3B whereas the vector used in a subsequent dose may comprise AAV 2/9. Optionally the gene therapy may be administered in combination with temporary immunosuppression of the patient, e.g. by administering the gene therapy at the same time as, or following treatment with, oral steroids. Immunosuppression may be desirable before and/or during gene therapy treatment to suppress the patient's immune response to the vector. However, the AAV capsid is present only transiently in the transduced cell as it is not encoded by the vector. The capsid is therefore gradually degraded and cleared, meaning that a short-term immunomodulatory regimen that blocks the immune response to the capsid until capsid sequences are cleared from the transduced cells can allow long-term expression of the transgene. Immunosuppression may therefore be desirable for a period of about six weeks following administration of the gene therapy.
The AAV vector gene therapy may be administered in the form of a pharmaceutical composition. In other words the AAV vector gene therapy may be combined with one or more pharmaceutically acceptable carriers or excipients. A suitable pharmaceutical composition is preferably sterile.
Brief Description of the Drawings
The invention will now be described in detail, by way of example only, with reference to the figures.
Figure 1 shows that AAV 2/9 administered by tail vein injection transduces the kidney and expresses HA-tagged podocin in the podocyte. A) AAV vectors used to express mouse or human podocin or GFP. All vectors contained the Kozak sequence between the promoter and the transgene, as well as WPRE (Woodchuck hepatitis post-transcriptional regulatory element) and the bovine growth hormone (bGH) polyadenylation signal. B) Vector or saline was injected via tail vein in iPod NPHS2fl/fl mice at 8 weeks of age, and induction with doxycycline commenced 10- 14 days later. C) qPCR showing presence of AAV ITRs in mouse kidney cortex in mice injected with the viral vector. D) Representative immunofluorescence showing expression of HA tagged podocin with podocyte-specific proteins nephrin and podocin in iPod NPHS2fl/fl mice injected with AAV 2/9. Control (saline) images are of mice without the full iPod NPHS2fl/fl genotype injected and hence did not develop proteinuria or diseased glomeruli, as mice with diseased glomeruli showed loss of podocyte markers. Figure 2 shows that tail vein injection of AAV 2/9 expressing wild-type podocin under a podocyte-specific promoter ameliorates proteinuria in the conditional podocin knock-out mouse model (iPod NPHS2fl/fl) A) Urinary albumi creatinine ratio of mice injected with AAV 2/9 mNPHSl.mpod versus AAV 2/9 hNPHSl.mpod versus saline (n=9 in each group, **p<0.01 ***p<0.001). B) Coomassie staining showing representative images of degree of albuminuria in one mouse from each experimental group. The saline group showed proteinuria from day 14 onwards and showed a large amount of albumin while the vector treated groups showed later onset of albuminuria and milder albuminuria. C) Survival curve showing improved survival in mice injected with either AAV 2/9 hNPHSl.mpod or AAV 2/9 mNPHSl.mpod (Log-rank (Mantel-Cox) test p=0.049, n=3 in each virus group and n=4 in the saline group). D) The number of copies of viral DNA per 50ng total DNA has an inverse correlation with urinary albumimcreatinine ratio at day 42 (Spearman r= -0.4596, p=0.0477) E) Blood results including cholesterol, albumin, urea, and creatinine at 6 weeks post-doxycycline. (n=minimum of 3 mice in each group except for cholesterol with minimum of n=2 in each group) F) Histology showing representative images from each group on light microscopy. Saline injected group showed glomerular hypertrophy, increased collagen deposition and segmental sclerosis, along with tubular dilatation, consistent with FSGS. Those injected with AAV 2/9 expressing mouse podocin exhibited a range of histological findings which roughly correlated with their urine albumimcreatinine ratio at death. Some mice had healthy normal glomeruli, while others showed mild evidence of disease like pseudo-crescent formation (arrow) seen in the mouse injected with AAV 2/9 mNPHSl.mpodHA. G) iPod NPHS2fl/fl mice injected with saline showed loss of podocin, while nephrin expression showed a change from predominantly membranous staining to a diffuse pattern.
Figure 3. AAV LK03 shows efficient transduction of human podocytes in vitro with the minimal human nephrin promoter. A, C, E) immunofluorescence demonstrating transduction of human podocytes (Pod), glomerular endothelial cells (GEnC) and proximal tubule epithelial cells (PTEC) by AAV LK03 CMV GFP, with only expression of GFP in podocytes when using the minimal nephrin promoter AAV LK03 hNPHSl GFP. B) Western blot demonstrating GFP expression in podocytes only when using the minimal human nephrin promoter using AAV LK03. D) Flow cytometry demonstrating highly efficient transduction of podocytes using AAV LK03 CMV GFP, and confirming the GFP expression using the minimal nephrin promoter was only seen in podocytes. In comparison, AAV 2/9 CMV GFP showed low transduction efficiencies in podocytes (n=3) F) Bar chart showing median fluorescence intensity in podocytes transduced with AAV LK03 and histogram showing the degree of green fluorescence in podocytes transduced with AAV LK03 CMV GFP (right-hand peak), AAV LK03 hNPHSl GFP (central peak) and untransduced cells (left-hand peak).
Figure 4. AAV LK03 expressing wild type human podocin shows functional rescue in the mutant podocin R138Q podocyte cell line. A) Western blot showing AAV LK03.CMV.hpodocinHA and AAV LK03. hNPHSl. hpodocinHA transduces R138Q podocytes and expresses HA-tagged podocin. B) Immunofluorescence demonstrating expression of HA tagged wild type podocin in the mutant podocin R138Q podocytes. C) Adhesion assay showing a decrease in adhesion in mutant podocin R138Q podocytes, with rescue of adhesion in R138Q podocytes treated with AAV LK03. hNPHSl. hpodHA.WPRE.bGH. D) confocal microscopy showing HA- tagged podocin does not colocalize with calnexin, an endoplasmic reticulum marker E) TIRF microscopy demonstrating expression of HA-tagged podocin within lOOnm of the plasma membrane with some colocalisation with caveolin, a lipid raft marker.
Figure 5 shows an example DNA sequence for the minimal human nephrin promoter (NPHS1).
Figure 6 shows an example cDNA sequence for a human podocin transgene.
Figure 7 shows an example DNA sequence for a WPRE sequence.
Figure 8 shows an example DNA sequence for a bGH poly(A) signal sequence.
Figure 9 shows human podocytes transduced with either HAVDR (A) or HASmad7 (B) using AAV LK03 with the minimal human nephrin promoter.
Examples
METHODS
Vector production We prepared pAV.hNPHSl.mpodHA.WPRE.bGH, pAV.mNPHSl.mpodHA.WPRE.bGH and pAV.hNPHSl.hpodHA.WPRE.bGH (Figure 1A) pAV.mNPHSl.hHAVDR.WPRE.bGH and pAV.mNPHSl.hHASmad7.WPRE.bGH in our laboratory from a CMV eGFP L22Y pUC-AV2 construct (kind gift of Amit Nathwani) using human (Figure 6) and mouse (sequence not shown) podocin cDNA (Origene, Herford, Germany) and human VDR and Smad7 cDNA. Human embryonic kidney 293T cells were transfected with a capsid plasmid (pAAV9 from Penn Vector Core, pAAV LK03 was the kind gift of Mark Kay), a helper plasmid with adenoviral genes and the transgene plasmid using polyethyleneimine. Cells and supernatant were harvested at 72 hours post-transfection. Cells underwent 5 freeze-thaw cycles, while the supernatant underwent PEG precipitation (8% PEG 0.5N NaCI). These were combined and incubated with 0.25% sodium deoxycholic acid and 70units/ml Benzonase for 30 minutes at 37°C. The vector was purified by iodixanol gradient ultracentrifugation, and subsequently concentrated in PBS. Vectors were titrated by qPCR using the standard curve method using the following primers:
ITR F GGAACCCCTAGTGATGGAGTT,
ITR R CGGCCTCAGTGAGCGA,
ITR probe FAM-5'-CACTCCCTCTCTGCGCGCTCG-3'-TAMRA.
Animals
All animal experiments and procedures were approved by the UK Home Office in accordance with the Animals (Scientific Procedures) Act 1986, and the Guide for the Care and Use of Laboratory Animals was followed during experiments. NPHS2fl0X/fl0X mice (kind gift of Corinne Antignac, INSERM U983, Paris) were bred with NPHS2-rtTA/ Tet-On Cre mice to generate offspring with NPHS2-rtTA/ Tet-On Cre/ NPHS2fl0X/fl0X. These mice develop a podocyte-specific knockout of podocin when exposed to doxycycline. These will be called iPod NPHS2fl/fl from hereon. Mice were on a mixed background and equal numbers of each sex were used. Mice were administered AAV via tail vein injection at 8 weeks of age. (Figure IB) 10 to 14 days later, mice were provided with drinking water supplemented with doxycycline 2mg/ml and 5% sucrose for 3 weeks. Urine was taken weekly. Mice were culled by Schedule 1 methods at 6 weeks post initiation of doxycycline. A small number of mice were kept beyond 6 weeks to test for effect on survival. All mice were re-genotyped from tissue taken at death. Cell Culture
Conditionally immortalised human podocytes (Pod) were cultured in RPMI with L- glutamine and NaHC03 with 10% Fetal Bovine Serum (Sigma Aldrich, Gillingham, UK). Conditionally immortalised human glomerular endothelial cells (GEnC) were cultured in EBMTM-2 Endothelial Cell Growth Basal Medium-2 supplemented with EGMTM-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, Basel, Switzerland). Immortalised proximal tubule epithelial cells (ATCC, Teddington, UK) (PTEC) were cultured in DMEM/F12 supplemented with Insulin, Transferrin and Selenium, Hydrocortisone and 10% FBS.
Cells were transduced with AAV at a MOI of 5 x 105. For GFP expression, cells were used at 5-7 days post transduction to allow comparisons across different cell lines. For podocin, VDR and Smad7 expression, cells were used at 10-14 days post transduction when podocytes are maximally differentiated.
Quantitative PCR
DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Manchester, UK) from mouse kidney cortex. AAV DNA was detected using the primers above for viral titration and normalised against mouse beta-actin.
RNA was extracted using RNeasy Mini Kit with RNase-Free DNase set (Qiagen, Manchester, UK).
Immunofluorescence
5pm sections were fixed using 4% PFA and blocked with 3% BSA 0.3% Triton X- 100 and 5% of either goat or donkey serum. Primary antibodies were anti-HA High Affinity from rat IgGl (Roche, Basel, Switzerland), Guinea Pig anti-Nephrin (1243-1256) Antibody (Origene, Herford, Germany), and Rabbit anti-NPHS2 Antibody (Proteintech, Manchester, UK).
Cells were fixed with either 4% PFA and or ice cold methanol, incubated for 5 minutes with 0.03M glycine, permeabilised with 0.3% Triton then blocked with 3% BSA. Primary antibodies were mouse HA.11 Epitope Tag Antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland), rabbit anti-Calnexin (Merck Millipore, Darmstadt, Germany) and rabbit anti-Caveolin 1 (Cell Signaling, Danvers, USA). Secondary antibodies were AlexaFluor 488 donkey anti-mouse, AlexaFluor 488 donkey anti-rabbit, AlexaFluor 488 goat-anti guinea pig, AlexaFluor 555 goat anti rabbit and AlexaFluor 633 goat anti-rat, and AlexaFluor 633 Phalloidin (Invitrogen, Thermo Fisher Scientific, Waltham, USA). Sections were counterstained with DAPI and mounted with Mowiol. Images were taken on a Leica SPE single channel confocal laser scanning microscope attached to a Leica DMi8 inverted epifluorescence microscope, or Leica SP5-II confocal laser scanning microscope attached to a Leica DMI 6000 inverted epifluorescence microscope, or Leica AM TIRF MC (multi-colour) system attached to a Leica DMI 6000 inverted epifluorescence microscope using LAS (Leica Application Suite) X Software.
Western Blotting
Cells were extracted in SDS lysis buffer. Samples were run on a 12.5% gel and transferred to PVDF membrane. Membranes were blocked in 5% milk in TBST
0.1%. Primary antibodies used were mouse HA.11 Epitope Tag Antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland) in 3% BSA in TBST 0.1%, or rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK). Secondary antibodies were anti-rabbit or anti-mouse IgG Peroxidase (Sigma Aldrich, Gillingham, UK) in 3% BSA in TBST 0.1%. Membranes were imaged on Amersham Imager 600.
Flow Cytometry
Live cells were stained with propidium iodide and only live single cells were included in the analysis. Flow cytometry was carried out on the NovoCyte Flow Cytometer.
Adhesion assay
Cells were trypsinised and resuspended at 105/ml and allowed to recover for 10 minutes before plating 50pl of cells diluted 1 in 2 with PBS in a 96 well plate. Technical triplicates were used. Cells were left to adhere for about 1 hour at 37°C. Cells were washed with PBS to wash away non adherent cells, then fixed with 4% PFA for 20 minutes. Cells were washed with distilled water then stained with 0.1% crystal violet in 2% ethanol for 60 minutes at room temperature. Cells were washed and incubated with 10% acetic acid on a shaker for 5 minutes. Absorbance was measured at 570nm and results were normalised against the wild type cell line transduced with AAV LK03 CMV GFP.
Urine
Albumin levels were measured using a mouse albumin ELISA kit (Bethyl Laboratories Inc, Montgomery, USA) and Creatinine levels were measured on the Konelab Prime 60i Analyzer.
Blood tests
Mouse plasma was processed either using the Konelab Prime 60i analyser or the Roche Cobas system with reagents and protocols supplied by the manufacturer.
Statistical Analysis
All data is presented as mean±SEM unless stated otherwise. Statistical analyses were performed in GraphPad Prism (Graphpad softward, La Jolla, USA). Statistical tests used include two-tailed t-test, one-way ANOVA with Tukey's multiple comparison posthoc analysis, two-way ANOVA with Tukey's multiple comparison posthoc analysis, and Logrank (Mantel-Cox) test for survival analysis.
RESULTS
Tail vein injection of AAV serotype 9 demonstrates transduction of kidney cells and expression in the podocyte
At 8 weeks of age, mice were administered 1.5 x 1012 vg via tail vein of either AAV2/9 hNPHSl.mpod or AAV2/9 mNPHSl.mpod, or saline. 6 weeks later, AAV ITRs were detected in the kidney cortex of mice injected with AAV (AAV 2/9 hNPHSl.mpod = 39,067± 13,285 copies ssDNA, AAV 2/9 mNPHSlmpod=76,533.33±32047 copies ssDNA, n=5-6/group) (Figure 1C). HA- tagged podocin was shown to co-localise with podocyte markers nephrin and podocin (Figure ID).
AAV2/9 expressing wild type podocin reduces albuminuria in iPod NPHS2fi/fl mice Vector treated groups showed a reduction in urinary albumin :creatinine ratio (ACR) (Figure 2A, 2B). The effect of tail vein injection of AAV 2/9 expressing podocin on urinary ACR yielded an F ratio of F (2, 24) = 9.61, p<0.001 (n=9/group). At 14 days post-doxycycline, urinary ACR was higher in the saline group than either of the vector treated groups, although this was not significant (AAV 2/9 hNPHSl.mpod = 758.1±488.1 mg/mmol, AAV 2/9 mNPHSl.mpod = 59.8±28.0 mg/mmol, saline = 3,770.1± 1337.6 mg/mmol, AAV 2/9 hNPHSl.mpod vs saline p=0.40, AAV 2/9 mNPHSl.mpod vs saline p=0.25). There was a significant reduction in urinary ACR in the vector treated groups at day 28 (AAV 2/9 hNPHSl.mpod = 3,083.0±932.8 mg/mmol, AAV 2/9 mNPHSl.mpod = 2,195.1±778.9 mg/mmol, saline = 10,198±3,189.5 mg/mmol, AAV 2/9 hNPHSl.mpod vs saline p=0.008, AAV 2/9 mNPHSl.mpod vs saline p=0.002) and day 42 (AAV 2/9 hNPHSl.mpod = 3,266.8± 1,212.2 mg/mmol, AAV 2/9 mNPHSl.mpod = 3,553.3± l,477.87mg/mmol, saline = 13, 488.8±3, 877.3 mg/mmol, AAV 2/9 hNPHSl.mpod vs saline p<0.001, AAV 2/9 mNPHSl.mpod vs saline p<0.001). In the vector treated groups, 2 of 9 mice in AAV 2/9 hNPHSl.mpod group and 1 of 9 mice in AAV 2/9 mNPHSl.mpod group had urinary ACRs of less than 30mg/mmol at day 42.
Although the mice in vector treated groups showed an improvement, there was a large degree of variation within the groups which we hypothesised might be attributable to amount of vector that reached the kidney after a systemic injection. The amount of viral DNA detected in kidney cortex showed an inverse correlation with the degree of albuminuria at day 42 (Spearman r= -0.4596, p=0.0477) (Figure 2D).
AAV2/9 expressing wild type podocin partially rescues the phenotype in iPod NPHS2fl/fl mice
Vector treated mice showed a reduction in creatinine (saline = 39.0±8.5 pmol/L, AAV 2/9 hNPHSl.mpod = 27.3±7.9 pmol/L, AAV 2/9 mNPHSl.mpod = 18.6±4.4 mmol/L, p=0.1622), a reduction in urea (saline = 39.4± 17.6 mmol/L, AAV 2/9 hNPHSl.mpod = 12.0±2.0 mmol/L, AAV 2/9 mNPHSl.mpod = 11.6± 1.6 mmol/L, p=0.058), an increase in albumin (saline = 10.5±5.4 g/L, AAV 2/9 hNPHSl.mpod 17.1=4.8 ± g/L, AAV 2/9 mNPHSl.mpod = 17.1±3.6 g/L, p=0.5602) and a significant reduction in cholesterol (saline = 15.76± 1.75 mmol/L, AAV 2/9 hNPHSl.mpod = 2.64±0.60 mmol/L, AAV 2/9 mNPHS2.mpod = 4.86±0.76 mmol/L, p=0009) (Figure 2E).
Saline treated mice showed histological features of FSGS by 6 weeks. Vector treated mice did not show histological features of FSGS on light microscopy, but demonstrated a range of histological findings from completely normal glomeruli to pseudo-crescents or mesangial hypercellularity. (Figure 2F)
These mice also showed prolonged survival (n=3-4/group), with a median survival of 75.5 days (range 38 to 111 days) in the saline group, compared to median survival of 192 days (range 74 to still alive at 206 days) in AAV 2/9 hNPHSl.mpod and median survival of 192 days (range 131 to still alive at 206 days) in AAV 2/9 mNPHSl.mpod (p=0.049).
Untreated mice show loss of expression of podocin with a change in pattern of expression of nephrin to a diffuse pattern (Figure 2G). This is a stark contrast to the predominantly membranous pattern of expression of nephrin and podocin seen in vector treated mice (Figure ID).
AAV LK03 transduces human podocytes efficiently in vitro with the minimal human nephrin promoter
AAV LK03 with CMV GFP and AAV LK03 hNPHSl GFP were used to transduce human podocytes, glomerular endothelial cells and proximal tubular epithelial cells at a MOI of 5x10s. Flow cytometry (n=3) showed that AAV LK03 CMV GFP had highly efficient transduction of the podocyte (% GFP expression=98.83±0.84), AAV LK03 hNPHSl GFP had good transduction (% GFP expression=71.3±3.39) and untransduced cells had unremarkable expression (% GFP expression=0.89±0.36) (Figure 3D). This is reflected on immunofluorescence (Figure 3A, 3C, 3E) and western blot (Figure 3B). Although the proportion of cells positive for GFP expression is high in podocytes transduced with AAV LK03 hNPHSl GFP, the cells have a lower fluorescence intensity than those transduced with AAV LK03 CMV GFP (Figure 3F).
Interestingly, AAV LK03 CMV GFP showed much lower transduction in glomerular endothelial cells (% GFP expression=7.35±0.19). AAV LK03 hNPHSl GFP showed minimal transduction in glomerular endothelial cells (% GFP expression=0.59±0.10), on a similar level to untransduced glomerular endothelial cells (% GFP expression=0.23±0.02). As AAV 2/9 has been the serotype which has seen the best transduction in kidney cells in vivo in rodent kidneys, we tested the expression of AAV 2/9 CMV GFP on human kidney cell lines. AAV 2/9 CMV GFP showed low transduction efficiency in both podocytes (% GFP expression= 13.9± 1.98) and glomerular endothelial cells (% GFP expression=21.99±4.35) (Figure 3D). AAV LK03 with AAV LK03 hNPHSl HAVDR and AAV LK03 hNPHSl hSmad7 were used to transduce human podocytes showing good expression of both proteins (Figure 9).
AAV LK03 expressing human podocin under the minimal nephrin promoter shows functional rescue in mutant podocin R138Q podocyte cell line
The R138Q podocin mutant results in mislocalisation of podocin from the plasma membrane to the endoplasmic reticulum. The mutant podocin R138Q podocyte cell line was acquired from a patient kidney and conditionally immortalised using temperature sensitive SV40 T antigen. AAV LK03 hNPHSl hpod transduces R138Q podocytes and expresses HA-tagged podocin (Figure 4A, 4B). HA-tagged podocin is seen at the plasma membrane on confocal microscopy and colocalises with Caveolin-1, a lipid raft protein, as seen on TIRF microscopy (Figure 4B, 4E). Untransduced R138Q podocytes do not show any podocin expression at the plasma membrane (Figure 4B). HA-tagged podocin does not colocalise with Calnexin, an endoplasmic reticulum marker (Figure 4D).
Podocytes show a decrease or increase in adhesion in diseased states. Previous work in our laboratory has shown that the R138Q mutation causes a decrease in podocyte adhesion. AAV transduction causes a decrease in podocyte adhesion but the R138Q podocytes still show reduced adhesion compared to wild type podocytes, and transduction with AAV LK03 hNPHSl hpod results in the rescue of the adhesional function of R138Q podocytes (Figure 4C).
DISCUSSION
Here we have successfully targeted the podocyte with AAV 2/9 using a minimal nephrin promoter to express mouse podocin in a conditional mouse knock-out model, with partial rescue of the phenotype and improvements in albuminuria seen in vector treated mice. As a first proof of principle study, we have chosen to inject the vector prior to doxycycline induction, so that effective rescue by the vector is in place when podocin is knocked out. The effect of doxycycline induction is rapid, and the progression to severe nephrosis (8-14 days) and FSGS is relative quick (about 6 weeks). We have shown here that in vitro, introducing wild type human podocin to R138Q podocytes enables expression of podocin that reaches the plasma membrane, and rescues podocyte adhesion. Although we have shown that the vector improves albuminuria and survival in these mice, there is large degree of variability in the degree of albuminuria both in treated and untreated mice. The variability within treated mice could be at least partially explained by the amount of viral transduction in the kidney (Figure 2D).
AAV LK03 has shown high transduction of close to 100% in human podocytes in vitro, which is reduced to 72.3% when using the minimal human nephrin promoter. We have shown that we can use this serotype to transduce podocytes specifically in vitro, and that expression of wild type podocin in R138Q mutant podocytes show functional rescue. Using AAV LK03 has implications on translation as such effective transduction of human podocytes might enable a significant reduction in effective dose in humans. A recent UK study has shown low anti AAV LK03 neutralising antibody seroprevalence of 23%, with a nadir in late childhood (Perocheau, D. P. et al.), which makes this particular serotype a promising candidate for translational studies.
We describe a first proof of principle study that demonstrates AAV transduction of podocytes with a podocyte-specific promoter ameliorates albuminuria in the iPod NPHS2fl/fl mouse model. We also show that a synthetic capsid, AAV LK03, shows highly efficient transduction of human podocytes. In combination, this work is a first step towards translation of AAV gene therapy targeting monogenic disease of the podocyte. References
LUO, X., HALL, G., LI, S., BIRD, A., LAVIN, P. J., WINN, M. P., KEMPER, A. R., BROWN, T. T. & KOEBERL, D. D. 2011. Hepatorenal correction in murine glycogen storage disease type I with a double-stranded adeno-associated virus vector. Mol Ther, 19, 1961-70.
MOELLER, M. J., SANDEN, S. K., SOOFI, A., WIGGINS, R. C. & HOLZMAN, L. B. 2002. Two gene fragments that direct podocyte-specific expression in transgenic mice. J Am Soc Nephrol, 13, 1561-7. PEROCHEAU, D. P. et al. Age-Related Seroprevalence of Antibodies Against AAV- LK03 in a UK Population Cohort, doi : 10.1089/hum.2018.098.
PICCONI, J. L, MUFF-LUETT, M. A., WU, D., BUNCHMAN, E., SCHAEFER, F. & BROPHY, P. D. 2014. Kidney-specific expression of GFP by in-utero delivery of pseudotyped adeno-associated virus 9. Molecular Therapy. Methods & Clinical Development, 1, 14014.
ROCCA, C. J., UR, S. N., HARRISON, F. & CHERQUI, S. 2014. rAAV9 combined with renal vein injection is optimal for kidney-targeted gene delivery: conclusion of a comparative study. Gene therapy, 21, 618-628.
SCHIEVEN BUSCH, S., STRACK, I., SCHEFFLER, M., NISCHT, R., COUTELLE, O., HOSEL, M., HALLEK, M., FRIES, J. W. U., DIENES, H.-P., ODENTHAL, M. & BLINING, H. 2010. Combined Paracrine and Endocrine AAV9 mediated Expression of Hepatocyte Growth Factor for the Treatment of Renal Fibrosis. Molecular Therapy, 18, 1302-1309.
SCHAMBACH, A., BOHNE, J., BAUM, C., HERMANN, F. G., EGERER, L., VON LAER, D. & GIROGLOU, T. 2005. Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Gene Therapy, 13, 641.
VAN DER WOUDEN, E. A., SANDOVICI, M., HENNING, R. H., DE ZEEUW, D. & DEELMAN, L. E. 2004. Approaches and methods in gene therapy for kidney disease. J Pharmacol Toxicol Methods, 50, 13-24.
Sequence Listing Free Text
[SEQ ID NO: l] shows the ITR Forward primer.
[SEQ ID NO: 2] shows the ITR Reverse primer.
[SEQ ID NO: 3] shows the DNA sequence of the ITR probe FAM-5'- CACTCCCTCTCTGCGCGCTCG-3'-TAMRA. [SEQ ID NO:4] shows the example DNA sequence for the minimal human nephrin promoter (NPHS1) as shown in Figure 5.
[SEQ ID NO: 5] shows the example cDNA sequence for the human podocin transgene shown in Figure 6.
[SEQ ID NO:6] shows the example DNA sequence for the WPRE sequence shown in Figure 7. [SEQ ID NO:7] shows the example DNA sequence for the bGH poly(A) signal sequence shown in Figure 8.

Claims

Claims
1. An adeno-associated virus (AAV) vector gene therapy for use in treating a monogenic form of nephrotic syndrome, wherein the AAV vector comprises:
a NS-associated transgene; and
minimal nephrin promoter NPHS1 or podocin promoter NPHS2.
2. An AAV vector gene therapy for use according to claim 1, wherein the AAV vector is AAV serotype 2/9, LK03 or 3B.
3. An AAV vector gene therapy for use according to claim 1 or 2, wherein the NS-associated transgene is NPHS2- ADCK4- ALG1 ) ARHGAP24) ARGHDIA ; CD151 ) CD2AP- COQ2- COQ6 ; DGKE ; E2F3 ; EMP2) KANK2 ; LAGE3 ; LMNA ; LMX1B ; MAFB ; NUP85- NUP93- NXF5 ; OSGEP) PAX2 ; PDSS2) PM M2) PODXL) SCARB2) SGPL1 ) Smad7; TP53RK) TPRKB) VDR; WDR73) WT1 ) ZMPSTE24) or APOL1.
4. An AAV vector gene therapy for use according to any of claims 1 to 3, wherein the AAV vector additionally comprises a Woodchuck hepatitis post- transcriptional regulatory element (WPRE).
5. An AAV vector gene therapy for use according to any of claims 1 to 4, wherein the NS-associated transgene is human and/or comprises a hemagglutinin (HA) tag.
6. An AAV vector gene therapy for use according to any of claims 1 to 5, wherein the AAV vector additionally comprises a Kozak sequence between the promoter and the podocin transgene.
7. An AAV vector gene therapy for use according to any of claims 1 to 6, wherein the AAV vector additionally comprises a polyadenylation signal such as bovine growth hormone (bGH) polyadenylation signal.
8. An AAV vector gene therapy for use according to any of claims 1 to 7, wherein the AAV vector gene therapy is to be administered to a human patient.
9. An AAV vector gene therapy for use according to claim 8, wherein the patient is a paediatric patient.
10. An AAV vector gene therapy for use according to any of claims 1 to 9, wherein the monogenic form of NS is a monogenic form of steroid-resistant nephrotic syndrome.
11. An AAV vector gene therapy for use according to any of claims 1 to 10, wherein the AAV vector gene therapy is to be administered systemically.
12. An AAV vector gene therapy for use according to any of claims 1 to 11, wherein the AAV vector gene therapy is to be administered by intravenous injection.
13. An AAV vector gene therapy for use according to any of claims 1 to 12, wherein the AAV vector gene therapy is to be administered by injection into the renal artery.
PCT/GB2020/050097 2019-01-18 2020-01-17 Aav gene therapy for treating nephrotic syndrome Ceased WO2020148548A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
EP20701850.8A EP3911368A1 (en) 2019-01-18 2020-01-17 Aav gene therapy for treating nephrotic syndrome
CN202080016138.4A CN113543814B (en) 2019-01-18 2020-01-17 AAV gene therapy for nephrotic syndrome
CA3126429A CA3126429A1 (en) 2019-01-18 2020-01-17 Aav gene therapy for treating nephrotic syndrome
AU2020208997A AU2020208997B2 (en) 2019-01-18 2020-01-17 AAV gene therapy for treating nephrotic syndrome
US17/422,739 US12544460B2 (en) 2019-01-18 2020-01-17 AAV gene therapy for treating nephrotic syndrome
EP24212299.2A EP4516915A3 (en) 2019-01-18 2020-01-17 Aav gene therapy for treating nephrotic syndrome
CN202510707055.4A CN120683181A (en) 2019-01-18 2020-01-17 AAV gene therapy for nephrotic syndrome
JP2021541198A JP7587506B2 (en) 2019-01-18 2020-01-17 AAV Gene Therapy for Treating Nephrotic Syndrome
JP2024167091A JP7835461B2 (en) 2019-01-18 2024-09-26 AAV gene therapy for treating nephrotic syndrome
US18/949,585 US20250064984A1 (en) 2019-01-18 2024-11-15 Aav gene therapy for the kidney
AU2026201536A AU2026201536A1 (en) 2019-01-18 2026-02-27 AAV gene therapy for treating nephrotic syndrome

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1900702.0A GB201900702D0 (en) 2019-01-18 2019-01-18 Therapy
GB1900702.0 2019-01-18

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/422,739 A-371-Of-International US12544460B2 (en) 2019-01-18 2020-01-17 AAV gene therapy for treating nephrotic syndrome
US18/949,585 Continuation US20250064984A1 (en) 2019-01-18 2024-11-15 Aav gene therapy for the kidney

Publications (1)

Publication Number Publication Date
WO2020148548A1 true WO2020148548A1 (en) 2020-07-23

Family

ID=65528327

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2020/050097 Ceased WO2020148548A1 (en) 2019-01-18 2020-01-17 Aav gene therapy for treating nephrotic syndrome

Country Status (8)

Country Link
US (2) US12544460B2 (en)
EP (2) EP3911368A1 (en)
JP (2) JP7587506B2 (en)
CN (2) CN120683181A (en)
AU (2) AU2020208997B2 (en)
CA (1) CA3126429A1 (en)
GB (1) GB201900702D0 (en)
WO (1) WO2020148548A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021176220A1 (en) 2020-03-04 2021-09-10 The University Of Bristol Gene therapy
WO2022189811A1 (en) * 2021-03-12 2022-09-15 The University Of Bristol Minimal nephrin promoter
EP4273243A1 (en) 2022-05-02 2023-11-08 Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca Nucleic acid constructs and vectors for podocyte specific expression
US12121593B2 (en) 2020-06-15 2024-10-22 The University Of Bristol Therapy
US12544460B2 (en) 2019-01-18 2026-02-10 The University Of Bristol AAV gene therapy for treating nephrotic syndrome
US12589167B2 (en) 2020-03-12 2026-03-31 The University Of Bristol AAV gene therapy vector with podocyte-specific promoter
WO2026074284A1 (en) * 2024-10-02 2026-04-09 Purespring Therapeutics Limited Methods of transducing podocytes

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114592052A (en) * 2022-04-01 2022-06-07 中国人民解放军陆军军医大学第二附属医院 A PDSS2 pathogenic mutation gene in patients with nephrotic syndrome and its detection reagent
WO2025072667A2 (en) * 2023-09-29 2025-04-03 University Of Utah Research Foundation Compositions and methods for treating phosphomannomutase 2 (pmm2) deficiency
CN117871216B (en) * 2024-03-12 2024-06-04 中日友好医院(中日友好临床医学研究所) A three-dimensional visualization method for glomerular slit membrane in paraffin specimens

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030152954A1 (en) 2000-01-20 2003-08-14 Institut National De La Sante Et De La Recherche Medicale (Inserm) NPHS2 gene involved in the steroid-resistant nephrotic syndrome, protein encoded by said gene and diagnostic and therapeutic uses
WO2017144080A1 (en) * 2016-02-23 2017-08-31 Eyeserv Gmbh Gene therapy for the treatment of a disease of retinal cone cells

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0173552B1 (en) 1984-08-24 1991-10-09 The Upjohn Company Recombinant dna compounds and the expression of polypeptides such as tpa
AU2003220966A1 (en) 2002-04-03 2003-10-13 Naohide Yamashita Drug containing human placenta-origin mesenchymal cells and process for producing vegf using the cells
IL158868A0 (en) 2003-11-13 2004-05-12 Yeda Res & Dev Methods of generating and using stem cells enriched with immature primitive progenitor
WO2007125723A1 (en) 2006-04-28 2007-11-08 Osaka University Glomerular slit protein inducer
CN105745326A (en) * 2013-10-24 2016-07-06 优尼科Ip有限公司 AAV-5 pseudotyped vectors for gene therapy of neurological diseases
GB201403684D0 (en) 2014-03-03 2014-04-16 King S College London Vector
HK1256681A1 (en) 2015-04-06 2019-10-04 President And Fellows Of Harvard College Compositions and methods for non-myeloablative conditioning
PE20231949A1 (en) 2015-10-30 2023-12-05 Spark Therapeutics Inc VARIANTS OF FACTOR VIII REDUCED WITH CpG, COMPOSITIONS AND METHODS AND USES FOR THE TREATMENT OF HEMOSTASY DISORDERS
JP6978774B2 (en) 2015-11-06 2021-12-08 国立大学法人 熊本大学 Pharmaceutical composition for the prevention or treatment of heart failure
CN109715205A (en) 2016-08-19 2019-05-03 库瑞瓦格股份公司 RNA use for cancer treatment
WO2018144709A2 (en) 2017-02-01 2018-08-09 The Trustees Of The University Of Pennsylvania Gene therapy for treating citrullenemia
GB201900702D0 (en) 2019-01-18 2019-03-06 Univ Bristol Therapy
EP4273243A1 (en) 2022-05-02 2023-11-08 Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca Nucleic acid constructs and vectors for podocyte specific expression

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030152954A1 (en) 2000-01-20 2003-08-14 Institut National De La Sante Et De La Recherche Medicale (Inserm) NPHS2 gene involved in the steroid-resistant nephrotic syndrome, protein encoded by said gene and diagnostic and therapeutic uses
WO2017144080A1 (en) * 2016-02-23 2017-08-31 Eyeserv Gmbh Gene therapy for the treatment of a disease of retinal cone cells

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
AGNIESZKA BIERZYNSKA ET AL: "Genomic and clinical profiling of a national nephrotic syndrome cohort advocates a precision medicine approach to disease management", KIDNEY INTERNATIONAL, vol. 91, no. 4, 1 April 2017 (2017-04-01), GB, pages 937 - 947, XP055677142, ISSN: 0085-2538, DOI: 10.1016/j.kint.2016.10.013 *
C J ROCCA ET AL: "rAAV9 combined with renal vein injection is optimal for kidney-targeted gene delivery: conclusion of a comparative study", GENE THERAPY, vol. 21, no. 6, 1 May 2014 (2014-05-01), GB, pages 618 - 628, XP055676072, ISSN: 0969-7128, DOI: 10.1038/gt.2014.35 *
GIANLUCA CARIDI ET AL: "NPHS2 (Podocin) Mutations in Nephrotic Syndrome. Clinical Spectrum and Fine Mechanisms", PEDIATRIC RESEARCH, vol. 57, no. 5 Part 2, 1 May 2005 (2005-05-01), US, pages 54R - 61R, XP055677935, ISSN: 0031-3998, DOI: 10.1203/01.PDR.0000160446.01907.B1 *
LUO, X.HALL, G.LI, S.BIRD, A.LAVIN, P. J.WINN, M. P.KEMPER, A. R.BROWN, T. T.KOEBERL, D. D.: "Hepatorenal correction in murine glycogen storage disease type I with a double-stranded adeno-associated virus vector", MOL THER, vol. 19, 2011, pages 1961 - 70
MANSOUREH TABATABAEIFAR ET AL: "An inducible mouse model of podocin-mutation-related nephrotic syndrome", PLOS ONE, vol. 12, no. 10, 19 October 2017 (2017-10-19), pages e0186574, XP055677131, DOI: 10.1371/journal.pone.0186574 *
MARKUS J. KEMPER ET AL: "Treatment of Genetic Forms of Nephrotic Syndrome", FRONTIERS IN PEDIATRICS, vol. 6, 26 March 2018 (2018-03-26), XP055677123, DOI: 10.3389/fped.2018.00072 *
MOELLER, M. J.SANDEN, S. K.SOOFI, A.WIGGINS, R. C.HOLZMAN, L. B.: "Two gene fragments that direct podocyte-specific expression in transgenic mice", J AM SOC NEPHROL, vol. 13, 2002, pages 1561 - 7
PEROCHEAU, D. P. ET AL., AGE-RELATED SEROPREVALENCE OF ANTIBODIES AGAINST AAV-LK03 IN A UK POPULATION COHORT
PICCONI, J. L.MUFF-LUETT, M. A.WU, D.BUNCHMAN, E.SCHAEFER, F.BROPHY, P. D.: "Kidney-specific expression of GFP by in-utero delivery of pseudotyped adeno-associated virus 9", MOLECULAR THERAPY. METHODS & CLINICAL DEVELOPMENT, vol. 1, 2014, pages 14014
ROCCA, C. J.UR, S. N.HARRISON, F.CHERQUI, S.: "rAAV9 combined with renal vein injection is optimal for kidney-targeted gene delivery: conclusion of a comparative study", GENE THERAPY, vol. 21, 2014, pages 618 - 628
SCHAMBACH, A.BOHNE, J.BAUM, C.HERMANN, F. G.EGERER, L.VON LAER, D.GIROGLOU, T.: "Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression", GENE THERAPY, vol. 13, 2005, pages 641
SCHIEVENBUSCH, S.STRACK, I.SCHEFFLER, M.NISCHT, R.COUTELLE, O.HOSEL, M.HALLEK, M.FRIES, J. W. U.DIENES, H.-P.ODENTHAL, M.: "Combined Paracrine and Endocrine AAV9 mediated Expression of Hepatocyte Growth Factor for the Treatment of Renal Fibrosis", MOLECULAR THERAPY, vol. 18, 2010, pages 1302 - 1309
See also references of EP3911368A1
VAN DER WOUDEN, E. A.SANDOVICI, M.HENNING, R. H.DE ZEEUW, D.DEELMAN, L. E.: "Approaches and methods in gene therapy for kidney disease", J PHARMACOL TOXICOL METHODS, vol. 50, 2004, pages 13 - 24

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12544460B2 (en) 2019-01-18 2026-02-10 The University Of Bristol AAV gene therapy for treating nephrotic syndrome
WO2021176220A1 (en) 2020-03-04 2021-09-10 The University Of Bristol Gene therapy
CN115315517A (en) * 2020-03-04 2022-11-08 布里斯托尔大学 Gene therapy
US12589167B2 (en) 2020-03-12 2026-03-31 The University Of Bristol AAV gene therapy vector with podocyte-specific promoter
US12121593B2 (en) 2020-06-15 2024-10-22 The University Of Bristol Therapy
WO2022189811A1 (en) * 2021-03-12 2022-09-15 The University Of Bristol Minimal nephrin promoter
JP2024509316A (en) * 2021-03-12 2024-02-29 ザ ユニバーシティ オブ ブリストル minimal nephrin promoter
EP4273243A1 (en) 2022-05-02 2023-11-08 Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca Nucleic acid constructs and vectors for podocyte specific expression
WO2023213738A1 (en) 2022-05-02 2023-11-09 Fundació Hospital Universitari Vall D’Hebron – Institut De Recerca Nucleic acid constructs and vectors for podocyte specific expression
WO2026074284A1 (en) * 2024-10-02 2026-04-09 Purespring Therapeutics Limited Methods of transducing podocytes

Also Published As

Publication number Publication date
AU2020208997A1 (en) 2021-08-05
AU2020208997B2 (en) 2025-12-11
JP2025011130A (en) 2025-01-23
JP7587506B2 (en) 2024-11-20
CN113543814A (en) 2021-10-22
JP7835461B2 (en) 2026-03-25
JP2022517407A (en) 2022-03-08
EP3911368A1 (en) 2021-11-24
AU2026201536A1 (en) 2026-03-19
EP4516915A3 (en) 2025-07-09
CN120683181A (en) 2025-09-23
US20220125950A1 (en) 2022-04-28
US12544460B2 (en) 2026-02-10
EP4516915A2 (en) 2025-03-05
US20250064984A1 (en) 2025-02-27
CA3126429A1 (en) 2020-07-23
CN113543814B (en) 2025-06-17
GB201900702D0 (en) 2019-03-06

Similar Documents

Publication Publication Date Title
US20250064984A1 (en) Aav gene therapy for the kidney
JP7170656B2 (en) MECP2-based therapy
Neymeyer et al. Activation of annexin A1 signalling in renal fibroblasts exerts antifibrotic effects
US20230175016A1 (en) Vector
CN104540952A (en) Methods and compositions for treating amyloid deposits
RS66255B1 (en) Modified aav capsid proteins for treatment of arthritic disease
US20260109998A1 (en) Compositions and methods for treating duchenne muscular dystrophy
JP2023529503A (en) AAV-mediated gene transfer for retinopathy
US20240325570A1 (en) Treating diseases and improving nucleic acid delivery
HK40122408A (en) Aav gene therapy for treating nephrotic syndrome
KR20260003703A (en) AAV variants for the treatment of complement disorders
EP4410988A1 (en) An aav2-vector variant for targeted transfer of genes
US20240115736A1 (en) Methods and materials for treating tdp-43 proteinopathies
US20250064975A1 (en) Therapy
RU2854890C1 (en) Vector
Ding Investigating Adeno-Associated Virus as a Vector for Gene Therapy for Steroid-Resistant Nephrotic Syndrome
CN117813321A (en) Retinal disorders
Al-Rafiah PLASTIN3 AS A THERAPEUTIC TARGET IN SPINAL MUSCULAR ATROPHY
HK40049102B (en) Compositions and methods for treating duchenne muscular dystrophy
BR122024005873A2 (en) RECOMBINANT MUTANT PROTEIN OF THE DYSTROPHIN SUPERFAMILY, RECOMBINANT ADENO-ASSOCIATED VIRUS, RECOMBINANT NUCLEIC ACID SEQUENCE, PLASMID, PHARMACEUTICAL COMPOSITION AND THEIR USES

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20701850

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3126429

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021541198

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020208997

Country of ref document: AU

Date of ref document: 20200117

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020701850

Country of ref document: EP

Effective date: 20210818

WWG Wipo information: grant in national office

Ref document number: 202080016138.4

Country of ref document: CN

WWG Wipo information: grant in national office

Ref document number: 17422739

Country of ref document: US