WO2020146772A1 - Neuritin regulation of t cell anergy and t regulatory cell function - Google Patents

Neuritin regulation of t cell anergy and t regulatory cell function Download PDF

Info

Publication number
WO2020146772A1
WO2020146772A1 PCT/US2020/013151 US2020013151W WO2020146772A1 WO 2020146772 A1 WO2020146772 A1 WO 2020146772A1 US 2020013151 W US2020013151 W US 2020013151W WO 2020146772 A1 WO2020146772 A1 WO 2020146772A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
inhibitor
cell
neuritin
tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/013151
Other languages
French (fr)
Inventor
Drew M. Pardoll
Hong Yu
Joseph Barbi
Fan Pan
Charles G. DRAKE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Publication of WO2020146772A1 publication Critical patent/WO2020146772A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507Comprising a combination of two or more separate antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • compositions for the abrogation of suppression of an antigen specific immune response comprise neuritin inhibitors and checkpoint inhibitors.
  • Methods for treating cancer or other disorders in which an immune response has been suppressed include the administration of these compositions.
  • Immune homeostasis is achieved through both central and peripheral tolerance mechanisms. Thymic central tolerance shapes the peripheral T cell pool by eliminating most high-affinity self-reactive T cells. However, central tolerance is incomplete and thus, a significant number of peripheral CD4 + and CD8 + cells are self-reactive, displaying a broad TCR repertoire h These self-reactive T cells are kept in a quiescent state through peripheral tolerance mechanisms, including“ignorance”, peripheral deletion, induction of T cell anergy and suppression by regulatory T cells (Treg) 2 4 . Understanding these tolerance-promoting mechanisms and their restraint of self-reactive T cells is not only important for autoimmune disease prevention and therapy, it also has increasing implications for cancer immunotherapy.
  • Embodiments of the invention are directed to compositions which abrogate anergic T cell and T regulatory cell functions, thereby allowing for an effective immune response to antigens.
  • Methods of treating cancer are provided that include the use of these compositions.
  • a method of treating cancer comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell functions.
  • a method of inducing a tumor specific immune response in a subject comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell functions.
  • a method of abrogating T cell anergy comprises administering to a subject in need thereof, a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
  • a method of modulating T regulatory (Treg) cell function comprises administering to a subject in need thereof, a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
  • a method of inducing a tumor specific immune response in a subject comprises isolating T cells from a biological sample from the subject, culturing the T cells with an effective amount of a neuritin inhibitor and one or more checkpoint inhibitors, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity, adoptively transferring the T cells to the subject thereby, inducing the tumor specific immune response.
  • a method of inducing a tumor specific immune response in a subject comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity, thereby, inducing the tumor specific immune response.
  • a tumor specific antigen is co administered to the subject.
  • a method of stimulating an immune response in a subject comprises isolating immune cells, e.g. T cells; contacting the immune cells with a pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors embodied herein and/or tumor antigens or tumor cells from the subject; reinfusing the immune cells into the subject; thereby, stimulating the immune response in a subject.
  • the immune cells comprise autologous, haplo-identical, haplotype matched or combinations thereof.
  • the immune cells are derived from autologous or allogeneic stem cells.
  • the immune cells comprise NK cells, T cells, stem cell memory T cells, activated NK (aNK) cells, chimeric antigen receptor- NK (CAR-NK) cells, chimeric antigen receptor-T (CAR-T) cells, or combinations thereof.
  • one or more adjuvants are optionally administered with the soluble fusion protein complexes embodied herein.
  • the adoptively transferred immune cells or pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors are administered at least one time per month, e.g., twice per month, once per week, twice per week, once per day, twice per day, every 8 hours, every 4 hours, every 2 hours, or every hour.
  • Suitable modes of administration for the adoptively transferred immune cells include systemic administration, intravenous administration, or local administration. Suitable modes of administration for the
  • compositions include systemic administration, intravenous administration, local administration, subcutaneous administration, intramuscular administration, intratumoral administration, inhalation, and intraperitoneal administration.
  • the effective amounts of the adoptively transferred immune cells are between 1 x 10 4 cells/kg and 1 x 10 10 cells/kg.
  • the patient is pretreated or preconditioned to facilitate engraftment or survival of the adoptively transferred cells.
  • preconditioning include treatment with cyclophosphamide and fludarabine.
  • the patient may be treated with agents that promote activation, survival or persistence of the adoptively transferred cells pre- and/or post-cell transfer. Examples of such treatment include use of IL-2, IL-15 or other immunostimulatory agents.
  • Other therapeutic approaches of known in the field of adoptive cell therapy i.e., including but not limited to allogeneic, autologous, haploidentical, DLI, stem cell, NK92 -based and CAR NK therapies may also be used in the methods herein.
  • the neuritin inhibitor comprises: an anti-neuritin specific antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
  • one or more checkpoint inhibitors are administered, the checkpoint inhibitors comprising an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof.
  • the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof.
  • the checkpoint inhibitor comprises: an antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides, organic or inorganic molecules, enzymes, interfering RNAs or
  • the present method further comprise administration of: anti- CD25 antibodies, inhibitors of molecules associated with T cell anergy development, Toll like receptor 2 (TLR2) agonists, 4- IBB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, cytokines or combinations thereof.
  • TLR2 Toll like receptor 2
  • TNFR2 tumor necrosis factor receptor 2
  • the cytokines comprise: interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IL-15), interleukin-21 (IL- 21), tumor necrosis factor alpha (TNFa) or combinations thereof.
  • IL-2 interleukin-2
  • IL-6 interleukin- 6
  • IL-4 interleukin- 4
  • IL-7 interleukin- 7
  • IL-15 interleukin- 15
  • IL- 21 interleukin-21
  • TNFa tumor necrosis factor alpha
  • molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
  • a pharmaceutical composition comprises a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
  • a pharmaceutical composition comprises an anti-neuritin inhibitor and a first and second checkpoint inhibitor.
  • the first and second checkpoint inhibitors are distinct agents.
  • the checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, and/or TGFR-b or combinations thereof.
  • the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof.
  • the first checkpoint inhibitor is an inhibitor of PD-1 and the second checkpoint inhibitor is an inhibitor of CTLA4.
  • the pharmaceutical composition is administered intra muscularly, systemically, intratumorally, intraperitoneally or combinations thereof.
  • the methods described herein inhibit the growth or progression of cancer, e.g., a tumor, or a viral infection in a subject.
  • the methods described herein inhibit the growth of a tumor by at least 1%, e.g., by at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100%, relative an untreated control (e.g. tumor cells not treated with a neuritin inhibitor).
  • an untreated control e.g. tumor cells not treated with a neuritin inhibitor.
  • the methods described herein reduce the size of a tumor by at least 1 mm in diameter, e.g., by at least 2 mm in diameter, by at least 3 mm in diameter, by at least 4 mm in diameter, by at least 5 mm in diameter, by at least 6 mm in diameter, by at least 7 mm in diameter, by at least 8 mm in diameter, by at least 9 mm in diameter, by at least 10 mm in diameter, by at least 11 mm in diameter, by at least 12 mm in diameter, by a least 13 mm in diameter, by at least 14 mm in diameter, by at least 15 mm in diameter, by at least 20 mm in diameter, by at least 25 mm in diameter, by at least 30 mm in diameter, by at least 40 mm in diameter, by at least 50 mm in diameter or more, relative to an untreated control (e.g. tumor cells not treated with a neuritin inhibitor).
  • the subject has had the bulk of the tumor resected.
  • the subject is preferably a mammal in need of such treatment, e.g., a subject that has been diagnosed with cancer or a viral infection, or a predisposition thereto, i.e., at risk of developing cancer or a viral infection.
  • the mammal is any mammal, e.g., a human, a primate, a mouse, a rat, a dog, a cat, a horse, as well as livestock or animals grown for food consumption, e.g., cattle, sheep, pigs, chickens, and goats.
  • the mammal is a human.
  • Modes of administration include intravenous, systemic, oral, rectal, topical, intraocular, buccal, intravaginal, intracistemal, intracerebroventricular, intratracheal, nasal, transdermal, within/on implants, or parenteral routes.
  • parenteral includes subcutaneous, intrathecal, intravenous, intramuscular, intraperitoneal, or infusion.
  • Intravenous or intramuscular routes are not particularly suitable for long-term therapy and prophylaxis. They could, however, be preferred in emergency situations.
  • Compositions comprising a composition of the invention can be added to a physiological fluid, such as blood. Oral administration can be preferred for prophylactic treatment because of the convenience to the patient as well as the dosing schedule. Parenteral modalities
  • subcutaneous or intravenous may be preferable for more acute illness, or for therapy in patients that are unable to tolerate enteral administration due to gastrointestinal intolerance, ileus, or other concomitants of critical illness. Inhaled therapy is also provided.
  • the composition is administered in a form selected from the group consisting of pills, capsules, tablets, granules, powders, salts, crystals, liquids, serums, syrups, suspensions, gels, creams, pastes, films, patches, and vapors.
  • the methods described herein are used in conjunction with one or more agents or a combination of additional agents, e.g., an anti-cancer agent.
  • Suitable agents include current pharmaceutical and/or surgical therapies for an intended application, such as, for example, cancer.
  • the methods described herein can be used in conjunction with one or more chemotherapeutic or anti-neoplastic agents, e.g., chemotherapy, targeted cancer therapy, cancer vaccine therapy, or immunotherapy.
  • the additional chemotherapeutic agent is radiotherapy.
  • the chemotherapeutic agent is a cell death-inducing agent.
  • Treatment with immunotherapeutic methods or compositions described herein may be a stand-alone treatment, or may be one component or phase of a combination therapy regime, in which one or more additional therapeutic agents are also used to treat the patient.
  • “about” can mean within 1 or more than 1 standard deviation, per the practice in the art.
  • “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value or range.
  • the term can mean within an order of magnitude within 5-fold, and also within 2-fold, of a value.
  • the term“agent” is meant to encompass any molecule, chemical entity, composition, drug, therapeutic agent, chemotherapeutic agent, or biological agent capable of preventing, ameliorating, or treating a disease or other medical condition.
  • the term includes small molecule compounds, antisense oligonucleotides, siRNA reagents, antibodies, antibody fragments bearing epitope recognition sites, such as Fab, Fab’, F(ab’)2 fragments, Fv fragments, single chain antibodies, antibody mimetics (such as DARPins, affibody molecules, affilins, affitins, anticalins, avimers, fynomers, Kunitz domain peptides and monobodies), peptoids, aptamers; enzymes, peptides organic or inorganic molecules, natural or synthetic compounds and the like.
  • An agent can be assayed in accordance with the methods of the invention at any stage during clinical trials, during pre-trial testing, or following FDA-approval.
  • the term“agonist” refers to an agent that binds to a receptor and activates the receptor to produce a biological response. Whereas an agonist causes an action, an antagonist blocks the action of the agonist, and an inverse agonist causes an action opposite to that of the agonist.
  • ameliorate is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.
  • anti-plastic agent is used herein to refer to agents that have the functional property of inhibiting a development or progression of a neoplasm in a human, particularly a malignant (cancerous) lesion. Inhibition of metastasis is frequently a property of antineoplastic agents.
  • cancer or“tumor” or“hyperproliferative” refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain
  • Such cells exhibit such characteristics in part or in full due to the expression and activity of immune checkpoint inhibitors, such as PD-1, PD-L1, PD-L2, and/or CTLA-4.
  • Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell.
  • the term“cancer” includes premalignant as well as malignant cancers.
  • Cancers include, but are not limited to, B cell cancer, e.g., multiple myeloma, Waldenstrom's macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematologic tissues, and the like.
  • the heavy chain diseases such as, for
  • leukemias e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non- Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease.
  • leukemias e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia);
  • cancers are epithelial in nature and include but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, or skin cancer.
  • the cancer is breast cancer, prostate cancer, lung cancer, or colon cancer.
  • the epithelial cancer is non-small-cell lung cancer, nonpapillary renal cell carcinoma, cervical carcinoma, ovarian carcinoma (e.g., serous ovarian carcinoma), or breast carcinoma.
  • the epithelial cancers may be characterized in various other ways including, but not limited to, serous, endometrioid, mucinous, clear cell, Brenner, or undifferentiated.
  • checkpoint inhibitor means a group of molecules on the cell surface of CD4 + and/or CD8 + T cells that fine-tune immune responses by down-modulating or inhibiting an anti-tumor immune response.
  • Immune checkpoint proteins are well known in the art and include, without limitation, CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7- H4, B7-H6, 2B4, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-
  • Anti-immune checkpoint inhibitor therapy refers to the use of agents that inhibit immune checkpoint inhibitors. Inhibition of one or more immune checkpoint inhibitors can block or otherwise neutralize inhibitory signaling to thereby upregulate an immune response in order to more efficaciously treat cancer.
  • agents useful for inhibiting immune checkpoint inhibitors include antibodies, small molecules, peptides, peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit immune checkpoint proteins, or fragments thereof; as well as RNA interference, antisense, nucleic acid aptamers, etc. that can downregulate the expression and/or activity of immune checkpoint inhibitor nucleic acids, or fragments thereof.
  • Exemplary agents for upregulating an immune response include antibodies against one or more immune checkpoint inhibitor proteins block the interaction between the proteins and its natural receptor(s); a non activating form of one or more immune checkpoint inhibitor proteins (e.g., a dominant negative polypeptide); small molecules or peptides that block the interaction between one or more immune checkpoint inhibitor proteins and its natural receptor(s); fusion proteins (e.g. the extracellular portion of an immune checkpoint inhibition protein fused to the Fe portion of an antibody or immunoglobulin) that bind to its natural receptor(s); nucleic acid molecules that block immune checkpoint inhibitor nucleic acid transcription or translation; and the like.
  • a non activating form of one or more immune checkpoint inhibitor proteins e.g., a dominant negative polypeptide
  • small molecules or peptides that block the interaction between one or more immune checkpoint inhibitor proteins and its natural receptor(s)
  • fusion proteins e.g. the extracellular portion of an immune checkpoint inhibition protein fused to the Fe portion of an antibody or immunoglobulin
  • agents can directly block the interaction between the one or more immune checkpoint inhibitors and its natural receptor(s) (e.g., antibodies) to prevent inhibitory signaling and upregulate an immune response.
  • agents can indirectly block the interaction between one or more immune checkpoint proteins and its natural receptor(s) to prevent inhibitory signaling and upregulate an immune response.
  • a soluble version of an immune checkpoint protein ligand such as a stabilized extracellular domain can binding to its receptor to indirectly reduce the effective concentration of the receptor to bind to an appropriate ligand.
  • anti-PD-1 antibodies, anti-PD-Ll antibodies, and anti-CTLA-4 antibodies either alone or used in combination.
  • cancer therapy refers to a therapy useful in treating cancer.
  • anti-cancer therapeutic agents include, but are not limited to, surgery, chemotherapeutic agents, immunotherapy, growth inhibitory agents, cytotoxic agents, agents used in radiation therapy, anti- angiogenesis agents, apoptotic agents, anti-tubulin agents, and other agents to treat cancer, such as anti-HER-2 antibodies (e.g., HERCEPTINTM), anti-CD20 antibodies, an epidermal growth factor receptor (EGFR) antagonist (e.g., a tyrosine kinase inhibitor), HER1/EGFR inhibitor (e.g., erlotinib (TARCEVATM)), platelet derived growth factor inhibitors (e.g., GLEEVECTM (Imatinib Mesylate)), a COX-2 inhibitor (e.g., celecoxib), interferons, cytokines, antagonists (e.g., neutralizing antibodies) that bind to one or more of the HER-2 antibodies (e.g.
  • A“chemotherapeutic agent” is a chemical compound useful in the treatment of cancer.
  • co-administer refers to the simultaneous presence of two active agents in the blood of an individual. Active agents that are co- administered can be concurrently or sequentially delivered.
  • the terms“comprising,”“comprise” or“comprised,” and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements— or, as appropriate, equivalents thereof— and that other elements can be included and still fall within the scope/definition of the defined item, composition, apparatus, method, process, system, etc.
  • the phrase“consisting essentially of’ refers to the genera or species of active pharmaceutical agents included in a method or composition, as well as any inactive carrier or excipients for the intended purpose of the methods or compositions.
  • control refers to any reference standard suitable to provide a comparison to the expression products in the test sample.
  • the control comprises obtaining a“control sample” from which expression product levels are detected and compared to the expression product levels from the test sample.
  • a control sample may comprise any suitable sample, including but not limited to a sample from a control cancer patient (can be stored sample or previous sample measurement) with a known outcome; normal tissue or cells isolated from a subject, such as a normal patient or the cancer patient, cultured primary cells/tissues isolated from a subject such as a normal subject or the cancer patient, adjacent normal cells/tissues obtained from the same organ or body location of the cancer patient, a tissue or cell sample isolated from a normal subject, or a primary cells/tissues obtained from a depository.
  • control may comprise a reference standard expression product level from any suitable source, including but not limited to housekeeping genes, an expression product level range from normal tissue (or other previously analyzed control sample), a previously determined expression product level range within a test sample from a group of patients, or a set of patients with a certain outcome (for example, survival for one, two, three, four years, etc.) or receiving a certain treatment (for example, standard of care cancer therapy).
  • a certain outcome for example, survival for one, two, three, four years, etc.
  • a certain treatment for example, standard of care cancer therapy
  • control samples and reference standard expression product levels can be used in combination as controls in the methods of the present invention.
  • control may comprise normal or non-cancerous cell/tissue sample.
  • control may comprise an expression level for a set of patients, such as a set of cancer patients, or for a set of cancer patients receiving a certain treatment, or for a set of patients with one outcome versus another outcome.
  • the specific expression product level of each patient can be assigned to a percentile level of expression, or expressed as either higher or lower than the mean or average of the reference standard expression level.
  • control may comprise normal cells, cells from patients treated with combination chemotherapy, and cells from patients having benign cancer.
  • control may also comprise a measured value for example, average level of expression of a particular gene in a population compared to the level of expression of a housekeeping gene in the same population.
  • control comprises a ratio transformation of expression product levels, including but not limited to determining a ratio of expression product levels of two genes in the test sample and comparing it to any suitable ratio of the same two genes in a reference standard; determining expression product levels of the two or more genes in the test sample and determining a difference in expression product levels in any suitable control; and determining expression product levels of the two or more genes in the test sample, normalizing their expression to expression of housekeeping genes in the test sample, and comparing to any suitable control.
  • control comprises a control sample which is of the same lineage and/or type as the test sample.
  • control may comprise expression product levels grouped as percentiles within or based on a set of patient samples, such as all patients with cancer.
  • a control expression product level is established wherein higher or lower levels of expression product relative to, for instance, a particular percentile, are used as the basis for predicting outcome.
  • a control expression product level is established using expression product levels from cancer control patients with a known outcome, and the expression product levels from the test sample are compared to the control expression product level as the basis for predicting outcome.
  • the methods of the invention are not limited to use of a specific cut-point in comparing the level of expression product in the test sample to the control.
  • an“effective amount,”“therapeutically effective amount” or “effective dose” is an amount of a composition (e.g., a therapeutic composition or agent) that produces at least one desired therapeutic effect in a subject, such as preventing or treating a target condition or beneficially alleviating a symptom associated with the condition.
  • the term“immune cells” generally includes white blood cells
  • leukocytes which are derived from hematopoietic stem cells (HSC) produced in the bone marrow“Immune cells” includes, e.g., lymphocytes (T cells, B cells, natural killer (NK) cells) and myeloid-derived cells (neutrophil, eosinophil, basophil, monocyte, macrophage, dendritic cells).
  • HSC hematopoietic stem cells
  • immune response includes T cell mediated and/or B cell mediated immune responses.
  • exemplary immune responses include T cell responses, e.g., cytokine production and cellular cytotoxicity.
  • immune response includes immune responses that are indirectly effected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., macrophages.
  • the term“in combination” in the context of the administration of a therapy to a subject refers to the use of more than one therapy for therapeutic benefit.
  • the term“in combination” in the context of the administration can also refer to the prophylactic use of a therapy to a subject when used with at least one additional therapy.
  • the use of the term“in combination” does not restrict the order in which the therapies (e.g., a first and second therapy) are administered to a subject.
  • a therapy can be administered prior to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy to a subject which had, has, or is susceptible to cancer.
  • the therapies are administered to a subject in a sequence and within a time interval such that the therapies can act together.
  • the therapies are administered to a subject in a sequence and within a time interval such that they provide an increased benefit than if they were administered otherwise. Any additional therapy can be administered in any order with the other additional therapy.
  • “Mammal” covers warm blooded mammals that are typically under medical care (e.g., humans and domesticated animals). Examples include feline, canine, equine, bovine, and human, as well as just human.
  • modulating refers to an increase or decrease in an adaptive immune system response. In a preferred embodiment, this relates to an increased, up-regulated or enhanced adaptive immune system response.
  • An effective amount of an immunomodulatory agent is an amount that when applied or administered in accordance to the techniques herein is sufficient to modulate, preferably up-regulate, an adaptive immune system response.
  • “patient,”“subject,” and“individual” may be used interchangeably and refer to either a human or a non-human animal. These terms include mammals such as humans, primates, livestock animals (e.g., bovines, porcines), companion animals (e.g., canines, felines) and rodents (e.g., mice and rats).
  • “Pharmaceutical agent,” also referred to as a“drug,” or“therapeutic agent” is used herein to refer to an agent that is administered to a subject to treat a disease, disorder, or other clinically recognized condition that is harmful to the subject, or for prophylactic purposes, and has a clinically significant effect on the body to treat or prevent the disease, disorder, or condition.
  • Therapeutic agents include, without limitation, agents listed in the United States Pharmacopeia (USP), Goodman and Gilman's The Pharmacological Basis of Therapeutics, 12 th Ed., McGraw Hill, 2001; Katzung, B. (ed.) Basic and Clinical Pharmacology, McGraw- Hill/ Appleton & Lange; 8 th edition (Sep. 21, 2000); Physician's Desk Reference (Thomson Publishing), and/or The Merck Manual of Diagnosis and Therapy, 18 th ed. (2006), or the 19 th ed (2011), Robert S. Porter, MD., Editor-in-chief and Justin L.
  • the terms“preventing” and grammatical variants thereof refer to an approach for preventing the development of, or altering the pathology of, a condition, disease or disorder. Accordingly,“prevention” may refer to prophylactic or preventive measures.
  • beneficial or desired clinical results include, but are not limited to, prevention or slowing of symptoms, progression or development of a disease, whether detectable or undetectable.
  • a subject e.g., a human
  • the term“prevention” includes slowing the onset of disease relative to the absence of treatment, and is not necessarily meant to imply permanent prevention of the relevant disease, disorder or condition.
  • “preventing” or“prevention” of a condition may in certain contexts refer to reducing the risk of developing the condition, or preventing or delaying the development of symptoms associated with the condition.
  • response refers to an anti-cancer response, e.g. in the sense of reduction of tumor size or inhibiting tumor growth.
  • the terms can also refer to an improved prognosis, for example, as reflected by an increased time to recurrence, which is the period to first recurrence censoring for second primary cancer as a first event or death without evidence of recurrence, or an increased overall survival, which is the period from treatment to death from any cause.
  • To respond or to have a response means there is a beneficial endpoint attained when exposed to a stimulus. Alternatively, a negative or detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. It will be appreciated that evaluating the likelihood that a tumor or subject will exhibit a favorable response is equivalent to evaluating the likelihood that the tumor or subject will not exhibit favorable response (i.e., will exhibit a lack of response or be non-responsive).
  • RNA interfering agent is defined as any agent which interferes with or inhibits expression of a target gene by RNA interference (RNAi).
  • RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target gene of the invention, or a fragment thereof, short interfering RNA (siRNA), and small molecules which interfere with or inhibit expression of a target nucleic acid by RNA interference (RNAi).
  • RNA interference (RNAi)” is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target nucleic acid results in the sequence specific degradation or specific post-transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene (see Cobum, G.
  • PTGS sequence specific degradation or specific post-transcriptional gene silencing
  • RNA is double stranded RNA (dsRNA).
  • dsRNA double stranded RNA
  • RNAi is initiated by the dsRNA-specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double- stranded fragments termed siRNAs.
  • siRNAs are incorporated into a protein complex that recognizes and cleaves target mRNAs.
  • RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target nucleic acids.
  • nucleic acid molecules e.g., synthetic siRNAs or RNA interfering agents
  • “inhibition of target nucleic acid expression” or“inhibition of marker gene expression” includes any decrease in expression or protein activity or level of the target nucleic acid or protein encoded by the target nucleic acid. The decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as compared to the expression of a target nucleic acid or the activity or level of the protein encoded by a target nucleic acid which has not been targeted by an RNA interfering agent.
  • targeted therapy refers to administration of agents that selectively interact with a chosen biomolecule to thereby treat cancer, e.g. immunotherapy targeting tumor antigens.
  • the term“therapeutically effective regimen” refers to a regimen for dosing, timing, frequency, and duration of the administration of one or more therapies for the treatment and/or management of cancer or a symptom thereof.
  • the regimen achieves one, two, three, or more of the following results: (1) a stabilization, reduction or elimination in the cancer cell population; (2) a stabilization or reduction in the growth of a tumor or neoplasm; (3) an impairment in the formation of a tumor; (4) eradication, removal, or control of primary, regional and/or metastatic cancer; (5) a reduction in mortality; (6) an increase in disease-free, relapse-free, progression-free, and/or overall survival, duration, or rate; (7) an increase in the response rate, the durability of response, or number of patients who respond or are in remission; (8) a decrease in hospitalization rate, (9) a decrease in hospitalization lengths, (10) the size of the tumor is maintained and does not increase or increases by less than 10%, preferably less than
  • “treating” or“treatment” and grammatical variants thereof refer to an approach for obtaining beneficial or desired clinical results.
  • the term may refer to slowing the onset or rate of development of a condition, disorder or disease, reducing or alleviating symptoms associated with it, generating a complete or partial regression of the condition, or some combination of any of the above.
  • beneficial or desired clinical results include, but are not limited to, reduction or alleviation of symptoms, diminishment of extent of disease, stabilization (i.e., not worsening) of state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.“Treatment” can also mean prolonging survival relative to expected survival time if not receiving treatment.
  • a subject e.g., a human
  • treatment includes inhibition or reduction of an increase in severity of a pathological state or symptoms relative to the absence of treatment, and is not necessarily meant to imply complete cessation of the relevant disease, disorder or condition.
  • untargeted therapy refers to administration of agents that do not selectively interact with a chosen biomolecule yet treat cancer.
  • Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
  • compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
  • FIGS. 1A-1H are a series of graphs and plots demonstrating Nrnl expression in anergic T cells and Treg.
  • FIGS. 1A-1D Nml expression in anergic CD4 cells.
  • Nml mRNA measurement by qRT-PCR FIG. 1A among 6.5 T cells recovered from C3HA host and wt host infected with VacHA virus (n>3 per group of mice) at various times after transfer;
  • FIG. 1A among 6.5 T cells recovered from C3HA host and wt host infected with VacHA virus (n>3 per group of mice) at various times after transfer
  • FIG. IB among AE7 cells stimulated with plate bound anti-CD3 in the presence (activation) or absence (anergy) of anti-CD28 for the indicated times (O/
  • FIG. ID Detection of Nml expression by anti-Nml antibody staining among CD4 + CD44 + Foxp3- FR4 hi CD73 hi cells from wt Nml +/+ and NrnT /_ splenocytes.
  • FIGS. 1E-1H Nml expression by Treg.
  • FIG. IF Nml expression in CD4 + CD44 low /CD62L high cTreg and CD4 + CD44 hlgh /CD62L low eTreg and upon activation respectively.
  • FIG. 1H Expression of neuritin message by cTreg and eTreg isolated from the peripheral blood of healthy human donors. Data are presented as mean +/- SEM. Data are representative of 2-3 independent experiments.
  • FIGS. 2A-2K are a series of graphs demonstrating that Nrnl deficiency affects CD4 T cells anergy development and pTreg cell conversion in vivo.
  • FIGS. 2A-2C Susceptibility of Nml 7- and Nml +/_ CD4 cells to suppression by Treg and anergy development.
  • FIG. 2A is a schematic representation showing an experimental outline: 2xl0 6 Thyl.l + Nml 7- or Nml +/_ CD4 OTII T cells were co-transferred with 4-5xl0 5 Thyl.2 + Thyl.l- wt Treg cells into TCRa /_ mice. Cells were recovered on day 13 post transfer.
  • FIG. 2B Proportions of CD4 cells
  • FIG. 2C OTII cell numbers recovered from recipient lymph node and spleen
  • FIG. 2D IF2 secretion from OTII cells upon ex vivo stimulation with OVA peptide.
  • FIG. 2E Foxp3 + cell percentage among Thyl.l + Nrnl 7- or Nrnl +/ CD4 cells.
  • FIGGS.2F-2K Comparison of Nml 7- and Nrnl +/ CD45.2 + T cell response to self-antigen in the absence of Treg cells in CD45.1 wt host.
  • FIGS. 2F Experimental outline: 6xl0 6 CD45.2 + T cells from Nml 7- or Nrnl +/ FDG mice was transferred into CD45.1 congenic wt FDG mice on day 0. Host mice were treated with DT at lpg/mouse i.p. for 3 days to delete all Treg cells both from wt host and from transferred Nml 7- and Nml +/ T cells. Cells were analyzed on dayl l after transfer.
  • FIG. 2G Foxp3 percentage
  • FIG. 2H CD4 + CD44 + FR4 hl CD73 hl cell proportion among adoptive transferred CD45.2 + Nrn l 7 - or Nml +/ CD4 cells and wt host CD45.1+ CD4 cells.
  • FIGS 3A-3J are a series of plots, graphs and photographs of histological stains, demonstrating that loss of Nml affect Treg cell suppression function.
  • FIG. 3 A Acquisition of eTreg traits by in vitro stimulation of Nml +/_ and Nml 7- nTregs.
  • Representative flow plots of post-activation CD62F and CD44 staining are shown from 3 separate experiment.
  • FIGS. 3B-3H Examination of Nrnl 7- Treg cell suppression function in vivo in a colitis model.
  • FIGS. 3B Mean percentage weight changes (+/-SEM) over time of experimental mice.
  • FIGS. 3C and 3D Representative H/E stained colon tissue sections and the averaged pathology scores from recipient mice in FIG. 3B are shown.
  • FIG. 3E The frequencies of cytokine-producing lymphocytes infiltrating the mesenteric lymph node (mLN) and lamina intestinal (FP) were determined by intracellular cytokine staining (ICS) and FACS.
  • FIG. 3 F Representative absolute numbers of FP- infiltrating IENg and IL-17 producing leukocytes from the indicated recipient mice are shown.
  • FIG. 3G Representative flow cytometry analysis of injected Foxp3 + /CD45.2 + Tregs frequency among CD4 + LP cells and FIG.
  • FIG. 31 and 3J The development and resolution of EAE symptoms in Nml _/ mice or in their Nrnl +/ littermates.
  • FIG. 31 Ascending paralysis was scored daily and mean scores (+/-SEM) over time are shown.
  • FIG. 3J Proinflammatory cytokine and Foxp3 expression by the spinal cord-infiltrating CD4 + lymphocytes of Nrnl +/ and Nml _/ mice afflicted with EAE were determined by flow cytometry. Shown are representative findings from at least 3 independent experiments.
  • FIGS. 4A-4G are a series of graphs and heat maps demonstrating that Nml deficiency disrupts anergy and Treg cell signature gene expression patterns.
  • FIGS. 4A-4E Whole transcriptome (RNAseq) analysis of genes expressed by Nml _/ vs Nml +/ OTII cells recovered from the peptide induced anergy model outlined in FIG. 2A.
  • FIG. 4A
  • FIG. 4B Results of a Gene Set Enrichment Analysis (GSEA) comparing the gene expression signature previously reported for anergized Thl cells (GEO:GSE46243) to those of Nrnl +/_ and Nrnl _/ T cells in the aforementioned anergy-inducing model.
  • FIG. 4C GSEA depicting a Treg cell gene profile (GEO: GSE42021) by Nrn 1 +A and Nml 7 T cells from FIG. 2A.
  • FIG. 4D (Left) Heatmap of DEGs enriched in Nrn +/ T cells under anergy-inducing conditions that overlap with Thl anergy gene signature. (Right) Examples of anergy specific gene expression (mean FPKM +/- SEM) are displayed in bar graphs.
  • FIG. 4E GSEA of NFAT dependent transcription gene set (PID_NFAT_TFPATHWAY) expressed by Nrnl +/ and Nrnl _/ T cells from FIG. 2A.
  • FIGS. 4F, 4G RNAseq analysis of the gene expression patterns of Tregs isolated from Nrnl _/ or Nml +/ mice.
  • FIG. 4F GSEA of Treg cell gene signature
  • FIG. 4G an NFAT dependent transcription gene set
  • FIGS.5A-5J are a series of graphs and plots demonstrating that Nrnl deficiency affects adaptive anti-tumor response and tumor progression.
  • FIGS. 5A, 5B Comparison of tumor growth in NmT /_ and Nml +/+ mice.
  • FIG. 5A EL4 tumor growth
  • FIGS. 5C-5F Analysis of TILs in tumor from B 16F10- implanted in NrnL /_ or Nml +/+ mice.
  • FIG. 5C Frequencies of Foxp3 + CD4 + T cells; FIG.
  • FIG. 5D FR4 hi CD73 hi CD4 + T cells
  • FIG. 5C IFNy producing CD4 + cells
  • FIG. 5F IFNy producing CD 8 cells among the B16F10 TILs from NrnL /_ or Nrnl +/+ mice were determined by flow cytometry.
  • FIG. 5G Expression of Nrnl mRNA by Foxp3-expressing Tregs and non-Treg CD4 + cells in s.c. B 16 melanoma.
  • CD4 + T cells were recovered from the tumors and peripheral blood of FDG reporter mice bearing subcutaneous B16 melanomas. Nml expression was assessed by qRT-PCR analysis.
  • FIG. 5G Expression of Nrnl mRNA by Foxp3-expressing Tregs and non-Treg CD4 + cells in s.c. B 16 melanoma.
  • CD4 + T cells were recovered from the tumors and peripheral blood of FDG reporter mice bearing subcutaneous B16 melanomas. Nml expression was assessed by q
  • FIGS. 51, 5J Impact of Nml deficiency in Treg on tumor growth and anti-tumor immunity.
  • Rag2 /_ mice were reconstituted with Treg-depleted CD45.1 + spleen and lymph node cells (2 xlO 6 ) and Tregs from either NmL /_ or Nrnl +/_ mice (CD45.2VCD45.1-, 0.5 x 10 6 ).
  • Rag2 /_ mice were subsequently challenged with s.c. B16F10 cells.
  • FIG. 51 Tumor growth as measured in FIG. 5B.
  • FIG. 5J the frequencies of transferred Tregs (CD45.L) and non-Tregs (CD45.1 + ) in tissues of tumor-bearing recipients were found by flow cytometry. Results from at least 2 trials are presented as mean +/- SEM.
  • FIGS. 6A-6I are a series of graphs and a scan of a photograph demonstrating that the combination of Nml, CTLA4 and PD1 blockade synergistically inhibits tumor growth.
  • FIGS. 6A-6D Effect of Nrnl blockade on the growth of multiple tumors.
  • B16F10, MC38, CT26 or 4T1 average tumor growth curve in mice treated with anti-Nrnl Ab or an inert isotype control Ab (mIgG2b) on day 5-6 after tumor implantation.
  • Mean tumor volume (+/- SEM) over time was plotted (n>8 per group, data represent the results of at least two experiments).
  • FIG. 6E- 6G Flow cytometric analysis of TILs recovered from anti-Nrnl or isotype control treated B16F10 bearing mice 20 days after tumor inoculation.
  • FIG. 6E The CD8/CD4Foxp3 + ratio as well as the FIGS. 6F, 6G, frequencies of Tbet expressing and IFNy expressing among CD8 cells among the TILs of anti-Nrnl or control Ab treated mice.
  • FIGS. 6H, 61 Impact of combining anti-Nrnl, anti-CTLA4 and anti-PDl antibody treatments on B16F10 tumor growth. Anti-Nrnl and anti-CTLA4 antibody treatments were initiated 5-6 days after tumor injection. Anti-PDl blockade was administered starting on day 8 after tumor injection.
  • FIG. 6H Mean tumor volumes (+/- SEM) over time and FIG. 6J, representative tumor sizes 18 days after tumor inoculation. Data representative of at least 3 separate experiments (n>7 per experimental group/trial).
  • FIG. 7A is a graph and a Western blot and FIG. 7B a plot demonstrating that Nrnl is expressed in Treg cells.
  • FIG. 7A Nml message and protein levels were measured across immune cell types isolated from Foxp3DTRgfp reporter mice by qRT-PCR and western blot.
  • FIG. 7B Flow cytometry analysis of surface Nml expression by CD4 + Foxp3 + CD25 + cells.
  • FIGS. 8A-8F are a series of graphs and blots demonstrating that Nrnl affects anergy development and pTreg cell conversion.
  • FIGS. 8A, 8B Induction of anergy in wt B6 host mice. 5xl0 6 congenically marked Nml _/ or Nml +/_ Thyl.l+ OTII cells were transferred into wt Thyl.2 + B6 mice and subjected to 3 treatment of OVAII peptide (100pg i.v) every three days. Thyl.l + cells were recovered 13 days after cell transfer.
  • FIG. 8A, 8B Induction of anergy in wt B6 host mice. 5xl0 6 congenically marked Nml _/ or Nml +/_ Thyl.l+ OTII cells were transferred into wt Thyl.2 + B6 mice and subjected to 3 treatment of OVAII peptide (100pg i.v) every
  • FIG. 8 A IL2 production by recovered OTII cells upon ex vivo restimulation with OVAII peptide measured by ELISA.
  • FIG. 8B the frequencies of Foxp3 + cells among recovered Thyl.l+OTII cells determined by flow cytometry.
  • FIG. 8C Schematic of CD2N Nrnl transgenic mouse design. A transgenic construct expressing Nml under the CD2 promoter was used for pronuclear injection and transgene positive mice were maintained on a C57BL/6 background (referred to as CD2N mice).
  • FIG. 8D Detection of cell surface Nml expression among CD3 + T cells from CD2N and littermate wt Nml +/+ mice by flow cytometry.
  • FIGS. 8E, 8F Anergy development and pTreg conversion among CD2N T cells. 6xl0 6 total T cells from CD45.2 + CD2N + or wt littermate control mice on FDG background were transferred into CD45.1 + FDG hosts and administered DT lug/mouse as indicated in Fig.
  • FIGS 8A-8C, 8E, and 8F depict mean values +/- S EM .
  • FIGS. 9A-9F are a series of graphs, blots and histological stain demonstrating that transgenic Nrnl overexpression and monoclonal antibody-mediated blockade of Nml have divergent effects on Treg function in vivo.
  • FIG. 9A Colitis was induced in Rag2 /_ mice by i.p. injection of 4xl0 5 naive CD4 + T cells. Weight loss in recipient mice was monitored weekly. After the development of colitis symptoms (2-3 weeks later), 3-5xl0 5 wt Tregs, CD2N + Tregs, or no Tregs were transferred to the colitis mice.
  • FIG. 9F Representative H&E staining of colon sections from the mice represented in FIG. 9A are shown.
  • FIG. 9C The absolute numbers of inflammatory cytokine producing leukocyte recovered from the lamina propria (LP) of the indicated recipient mice were found after intracellular cytokine staining. Shown are representative results of 3 experiments.
  • FIG. 9D Percentages of Foxp3-expressing cells in the original transferred Treg population (CD45.1 + ) recovered from the LP of recipient mice.
  • FIGS. 9E, 9F Nml functional blockade by antibody results in exacerbated EAE. Disease was induced in a cohort of age/sex matched wt C57BL/6 mice as in FIG. 31.
  • FIG. 9E Clinical scoring of EAE disease severity in mice given either an anti- Nmlantibody or an isotype control at the time of disease induction.
  • FIG. 9F Production of proinflammatory cytokines by CNS-infiltrating T cells recovered from mice treated with anti- Nml or isotype control Ab. Shown are the representative findings of at least 3 independent experiments.
  • FIGS. 10A-10D are a series of graphs and heatmaps demonstrating that Nrnl deficiency impacts gene expression by CD4 cells activated under anergy-inducing condition in vivo.
  • Analysis of RNAseq data from Nrnl _/ or Nml +/ OTII cells recovered from an i.v. peptide driven model of anergy (outlined in FIG. 2A).
  • FIG. 10A molecular function GO term analysis was carried out using the Molecular Signature Database (MSigDB) based on the DEGs that were enriched in Nml +/ T cells relative to Nrnl _/ T cells recovered from the anergy model. The top 5 terms are shown.
  • MSigDB Molecular Signature Database
  • FIG. 10B Top 5 terms identified by GO term analysis with KEGG pathway using DEGs enriched in Nrnl +/_ T cells.
  • FIG. IOC GSEA of DEGs from Nml +/_ and NrnT /_ cells recovered from anergy condition (FIG. 2A) to a previously reported anergic CD4+ T cell gene set (GSE5960) and a AE7 gene set.
  • FIG. 10D Representative expression of cation transport and Ca 2+ binding related genes by T cells recovered from in vivo anergy-inducing condition (mean FPKM +/- SEM).
  • FIGS. 11A-11C are a series of graphs and a scan of a photograph demonstrating the effect of genetic modulation of Nml expression on B16F10 tumor progression.
  • FIG. 11A, B16F10 mean tumor volumes per group (+/-SEM) in NmT /_ , Nml +/_ and Nml +/+ host mice.
  • FIGS. 11B, llC, B16F10 mean tumor volumes per group (+/- SEM) and representative tumor sizes at 20 days after tumor injection in CD2N mice, wt CD2N littermate controls and NrnT /_ mice. (n>4 per group; data represent of at least 2 trials).
  • FIGS. 12A-12D are a series of graphs demonstrating the impact of Nml blockade on tumor progression in multiple murine cancer models.
  • FIGS. 4A-4D The indicated tumor cell lines were implanted s.c. into age-/sex-matched wt C57BL/6 mice. 5 days post implantation. Mice were treated with anti- Nml or an isotype control. Changes in the tumor volumes of individual mice in treatment and control cohorts are shown for FIG. 12A, B16F10; FIG. 12B, MC38; FIG. 12C, CT26 and FIG. 12D, 4T1 tumors. (N>7 mice/group/trial). Data shown are representative at least two independent experiments).
  • FIGS. 13A-13C are a series of graphs showing results obtained from the treatment of B16F10 tumor-bearing mice with combinedNml blockade and checkpoint inhibition therapy.
  • FIG. 13A Anti-Nrnl combination therapy with anti-CTLA4.
  • the following experimental groups are included for assessing the efficacy of anti-Nrnl and anti-CTLA4 combination therapy: isotype control (mIgG2b), anti-Nrnl, anti- CTLA4, anti-PDl, anti-Nrnl with anti-CTLA4, and anti-CTLA4 with anti-PDl.
  • FIG. 13B Anti-Nml combination therapy with anti-PDl. Anti- PDl was administered 3 days after the initiation of Nml blockade.
  • FIG. 13C Individual tumor growth curve for tumor bearing mice subjected to triple combination therapy with anti- Nml, anti-CTLA4 mAh and anti-PDl blockade. Anti-Nml and anti-CTLA4 were administered on day5 post tumor establishment, anti-PDl was administered 3 days after the initiation of anti-Nrnl and anti-CTLA4 treatment. Mean tumor volume (bolded line) and individual tumor volume were plotted over time. Data represents 2-3 independent experiments (n>7 per group/trial).
  • FIG. 14 shows representative flow cytometry gating strategy for analyzing anergic CD4 + CD44 + FR4 hl CD73 hl cells, anergic cells, cTreg and eTreg cells.
  • Cancer immunotherapy strategies rely on activating (or reactivating) T cell populations specific for either tumor specific, mutation associated neoantigens; viral antigens (for vims-associated cancers); de -repressed endogenous retroviral antigens; and tumor- associated self-antigens. It has been shown that tumor antigen specific CD4 T cells can become anergized and convert to Treg rapidly after tumor emergence 5 . These cells and pre existing Treg cells can accumulate in the tumor microenvironment and are capable of preventing effector T cell infiltration and obstmcting cytotoxic activity at the tumor site 5 6 . Understanding the precise mechanisms and molecules involved in inducing and maintaining the immune-tolerant state has already and will continue to underpin the success of immunotherapy for autoimmune disease and cancer. Accordingly, embodiments of the invention are directed to compositions which target molecules involved in inducing and maintaining the immune-tolerant state thereby abrogating the suppression of the immune response to a particular tumor.
  • T cell anergy and Treg cell mediated suppression are two complementary peripheral tolerance mechanisms.
  • T cell anergy is historically defined as a state of functional inactivation wherein T cells lose the capacity to respond and produce cytokine upon re encountering cognate antigen 7 .
  • T cell anergy can be induced in vitro by providing TCR signal in the absence of costimulation 1 .
  • anergy is observed in CD4 + T cells after systemic, repeated exposure to a soluble antigen (Ag) or superantigen in the absence of infection or adjuvant 8 .
  • Ag soluble antigen
  • Treg autoreactive T cell responses against self-antigen and modulating immune activation throughout the life span of normal animals.
  • Most Treg differentiate in the thymus and are referred to as thymic Treg or natural Treg (tTreg or nTreg, respectively), whereas others originate in the periphery from conventional Foxp3(-) CD4 + T cells and are referred to as peripherally induced Treg (pTreg, or iTreg if generated in vitro).
  • pTreg peripherally induced Treg
  • Both nTreg and pTreg subsets are marked by the canonical Treg transcription factor Foxp3 and are required for optimal immune homeostasis 2 15 16 .
  • Anergic T cells and Treg are functionally related. Although anergic T cells are generally non-proliferative, they are not functionally inert. These cells may function as suppressor cells and anergy development in vivo is often associated with the emergence of pTreg 17-2a Further linking these cell types are observations that deletion of pTreg within the anergic T cell pool largely abrogates its suppressive function 18 19 ⁇ Thus, anergic T cells may contribute to the establishment of peripheral tolerance partly through induction of or differentiation into pTreg 3 . On the other hand, target cells suppressed by Treg exhibit anergic cell characteristics, including defective cytokine production.
  • Nml neuritin
  • Treg T regulatory cells
  • Nml is important in anergy development and Treg mediated suppressive function. Accordingly, growth of multiple tumors was significantly inhibited in Nml deficient mice. Treatment with antibodies to Nml alone and in combination with anti-CTLA4 and anti-PDl significantly inhibited growth of established B16F10 melanoma, a poorly immunogenic tumor.
  • a method of treating cancer comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and T regulatory cell functions.
  • a method of inducing a tumor specific immune response in a subject comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and T regulatory cell functions.
  • a method of abrogating T cell anergy comprises
  • a pharmaceutical composition comprising a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
  • a method of modulating T regulatory (Treg) cell function comprises administering to a subject in need thereof, a pharmaceutical composition comprising a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
  • Checkpoint Inhibitors In certain embodiments, a method of treating cancer, administering one or more checkpoint inhibitors.
  • the one or more checkpoint inhibitors comprises an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG- 3, CEACAM-1, CEAC AM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof.
  • the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof.
  • the at least one or more checkpoint inhibitors are administered to the patient prior to, during and/or after administration of the neuritin inhibitors. Examples of checkpoint inhibitors include without limitation, an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3,
  • CEACAM-1 CEAC AM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4 or TGFR-b.
  • the duration and/or dose of treatment with checkpoint inhibitor therapies may vary according to the particular anti-immune checkpoint inhibitor agent or combination thereof (e.g., anti-ARGl agents like small molecule inhibitors in combination with inhibitors of PD- 1, PD-L1, PD-L2, CTLA4, and the like).
  • An appropriate treatment time for a particular cancer therapeutic agent will be appreciated by the skilled artisan.
  • dosage concentrations and dosing regimens are configured based upon one or more cancer related factors such as tumor size, tumor volume, cancer stage of a cancer patient or group of cancer patients (such as pre or post metastatic cancer).
  • the invention contemplates the continued assessment of optimal treatment schedules for each cancer therapeutic agent, where the phenotype of the cancer of the subject as determined by the methods of the invention is a factor in determining optimal treatment doses and schedules.
  • the Programmed Death 1 (PD-1) protein is an inhibitory member of the extended CD28/CTLA-4 family of T cell regulators (Okazaki et al. (2002) Curr Opin Immunol 14: 391779-82; Bennett et al. (2003) J. Immunol. 170:711-8).
  • Other members of the CD28 family include CD28, CTLA-4, ICOS and BTLA.
  • Two cell surface glycoprotein ligands for PD-1 have been identified, Program Death Ligand 1 (PD-L1) and Program Death Ligand 2 (PD- L2).
  • PD-L1 and PD-L2 have been shown to downregulate T cell activation and cytokine secretion upon binding to PD-1 (Freeman et al.
  • PD-L1 (also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7- Hl)) is a 40 kDa type 1 transmembrane protein. PD-L1 binds to its receptor, PD-1, found on activated T cells, B cells, and myeloid cells, to modulate activation or inhibition. Both PD-L1 and PD-L2 are B7 homologs that bind to PD-1, but do not bind to CD28 or CTLA-4 (Blank et al. (2005) Cancer Immunol Immunother. 54:307-14).
  • Binding of PD-L1 with its receptor PD- 1 on T cells delivers a signal that inhibits TCR-mediated activation of IL-2 production and T cell proliferation.
  • the mechanism involves inhibition of ZAP70 phosphorylation and its association with CD3z (Sheppard et al. (2004) FEBS Lett. 574:37-41).
  • PD-1 signaling attenuates PKC-0 activation loop phosphorylation resulting from TCR signaling, necessary for the activation of transcription factors NF-KB and AP-1, and for production of IL-2.
  • PD-L1 also binds to the costimulatory molecule CD80 (B7-1), but not CD86 (B7-2) (Butte et al. (2008) Mol Immunol. 45:3567-72).
  • PD-L1 has been shown to be upregulated through IFN-g stimulation.
  • PD-L1 expression has been found in many cancers, including human lung, ovarian and colon carcinoma and various myelomas, and is often associated with poor prognosis (Iwai et al. (2002) PNAS 99:12293-7; Ohigashi et al. (2005) Clin Cancer Res 11:2947-53; Okazaki et al. (2007) Intern. Immun. 19:813-24; Thompson et al. (2006) Cancer Res. 66:3381-5).
  • PD-L1 has been suggested to play a role in tumor immunity by increasing apoptosis of antigen-specific T-cell clones (Dong et al.
  • checkpoint inhibitor antibodies for cancer therapy have generated unprecedented response rates in cancers previously thought to be resistant to cancer treatment (see, e.g., Ott & Bhardwaj, 2013, Frontiers in Immunology 4:346; Menzies & Long, 2013, Ther Adv Med Oncol 5:278-85; Pardoll, 2012, Nature Reviews 12:252-264).
  • Therapy with antagonistic checkpoint blocking antibodies against CTLA-4, PD-1 and PD-L1 are one of the most promising new avenues of immunotherapy for cancer and other diseases.
  • checkpoint inhibitor do not target tumor cells directly, but rather target lymphocyte receptors or their ligands in order to enhance the endogenous antitumor activity of the immune system.
  • ADCs antibody-drug conjugates
  • PD-1 Programmed cell death protein 1
  • CD279 encodes a cell surface membrane protein of the immunoglobulin superfamily, which is expressed in B cells and NK cells (Shinohara et al., 1995, Genomics 23:704-6; Blank et al., 2007, Cancer Immunol Immunother 56:739-45; Finger et al., 1997, Gene 197:177-87; Pardoll, 2012, Nature Reviews 12:252-264).
  • Anti-PDl antibodies have been used for treatment of melanoma, non- small-cell lung cancer, bladder cancer, prostate cancer, colorectal cancer, head and neck cancer, triple negative breast cancer, leukemia, lymphoma and renal cell cancer (Topalian et al., 2012, N Engl J Med 366:2443-54; Lipson et al., 2013, Clin Cancer Res 19:462-8; Berger et al., 2008, Clin Cancer Res 14:3044-51; Gildener-Leapman el al., 2013, Oral Oncol 49:1089-96;
  • anti-PDl antibodies include pembrolizumab (MK-3475, Merck), nivolumab (BMS-936558, Bristol-Myers Squibb), and pidilizumab (CT-011, Curetech LTD.).
  • Anti-PDl antibodies are commercially available, for example from ABCAMTM
  • BIOLEGENDTM EH12.2H7, RMP1-14
  • Affymetrix Ebioscience J105, J116, MIH4.
  • Programmed cell death 1 ligand 1 (PD-L1, also known as CD274) is a ligand for PD- 1, found on activated T cells, B cells, myeloid cells and macrophages.
  • the complex of PD-1 and PD-L1 inhibits proliferation of CD8 + T cells and reduces the immune response (Topalian et al., 2012, N Engl J Med 366:2443-54; Brahmer et al., 2012, N Eng J Med 366:2455-65).
  • Anti-PDLl antibodies have been used for treatment of non-small cell lung cancer, melanoma, colorectal cancer, renal-cell cancer, pancreatic cancer, gastric cancer, ovarian cancer, breast cancer, and hematologic malignancies (Brahmer et al., 2012, N Eng J Med 366:2455-65; Ott et al., 2013, Clin Cancer Res 19:5300-9; Radvanyi et al., 2013, Clin Cancer Res 19:5541; Menzies & Long, 2013, TherAdv Med Oncol 5:278-85; Berger et al., 2008, Clin Cancer Res 14:13044-51).
  • anti-PDLl antibodies include MDX-1105 (MEDAREX), durvalumab (MEDI4736, MEDIMMUNE) atezolizumab (TECENTRIQTM, MPDL3280A,
  • Anti-PDLl antibodies are also commercially available, for example from AFFYMETRIX EBIOSCIENCE (MIH1).
  • CTLA-4 (CD 152) is a B7/CD28 family member that inhibits T cell functions. It is constitutively expressed by Tregs but can also be upregulated by other T cell subsets, especially CD4 + T cells, upon activation (Chan DV, et al. Genes Immun. 2014 Jan; 15(1):25- 32). Exhausted T cells are also often characterized by the expression of CTLA-4 among other inhibitory receptors. CTLA-4 is mostly located in intracellular vesicles and is only transiently expressed upon activation in the immunological synapse before being rapidly endocytosed (Leung HT, et al. J Biol Chem. 1995 Oct 20; 270(42):25107-14).
  • CTLA-4 mediates immunosuppression by indirectly diminishing signaling through the co-stimulatory receptor CD28. Although both receptors bind CD80 and CD86, CTLA-4 does so with much higher affinity, effectively outcompeting CD28 (Rudd CE, Taylor A, Schneider H Immunol Rev. 2009 May; 229(1): 12-26). CTLA-4 may also remove CD80 and CD86 (including their cytoplasmic domains) from the cell surfaces of antigen-presenting cells via trans-endocytosis (Qureshi OS, et al. Science. 2011 Apr 29; 332(6029):600-3), therefore reducing the availability of these stimulatory receptors to other CD28-expressing T cells. Indeed, this process is one mechanism by which Tregs mediate immune suppression on bystander cells (Wing K, et al. Science. 2008 Oct 10; 322(5899):271-5).
  • CTLA-4 increases the activation threshold of T cells, reducing immune responses to weak antigens such as self- and tumor antigens.
  • the central role that CTLA-4 plays in immunological tolerance is exemplified by experiments in mice that lack the CTLA-4 gene globally or specifically in the Forkhead box P3 (FoxP3) + Treg compartment. These animals develop lymphoproliferative disorders and die at a young age (Wing K, et al. Science. 2008 Oct 10; 322(5899):271-5).
  • polymorphisms within the CTLA-4 gene are associated with autoimmune diseases in humans (Gough SC, et al. Immunol Rev. 2005 Apr; 204(): 102-15).
  • CTLA-4 signaling has been shown to dampen immune responses against infections and tumor cells (Nakamoto N, et al. PLoS Pathog. 2009 Feb; Curran MA, et al. Proc Natl Acad Sci U S A. 2010 Mar 2;
  • An exemplary anti-CTLA-4 antibody is IPILIMUMAB (trade name Yervoy).
  • a checkpoint inhibitor is an RNA interfering agent
  • Tregs also employ a diverse repertoire of suppressive mechanisms, including secretion of suppressive cytokines, cytotoxicity, metabolic disruption, and modulation of antigen-presenting cell (APC) function (Sakaguchi S, Wing K, Miyara M. Regulatory T cells - a brief history and perspective. Eur J Immunol. 2007 Nov; 37 Suppl 1:S116-23).
  • APC antigen-presenting cell
  • IL-6 Trinschek B, et al. Kinetics of IL-6 production defines T effector cell responsiveness to regulatory T cells in multiple sclerosis. PLoS One (2013) 8:e77634; Schneider A, et al. In active relapsing- remitting multiple sclerosis, effector T cell resistance to adaptive T(regs) involves IL-6- mediated signaling. Sci Transl Med (2013) 5:170), TNFa (Wehrens EJ, et al.
  • Anti-tumor necrosis factor a targets protein kinase B/c- Akt-induced resistance of effector cells to suppression in juvenile idiopathic arthritis.
  • Arthritis Rheum (2013) 65:3279—84 IL-15 (Proinflammatory mediator-induced reversal of CD4 + ,CD25 + regulatory T cell-mediated suppression in rheumatoid arthritis van Amelsfort JM, el al. Arthritis Rheum. 2007 Mar; 56(3):732-42), IL-21 (IL-21 counteracts the regulatory T cell-mediated suppression of human CD4 + T lymphocytes.
  • Peluso I el al. J Immunol. 2007 Jan 15; 178(2):732-9
  • IL-Ib Protein kinase B/c- Akt-induced resistance of effector cells to suppression in juvenile idiopathic arthritis.
  • IL-15 Proinflammatory mediator-induced reversal of CD4 + ,CD25 + regulatory T cell-mediated suppression in rheumatoi
  • IL-2 has also long been known to overrule Treg suppression in vitro (Takahashi T, et al., Int Immunol. 1998 Dec; 10(12): 1969-80).
  • a method of treating cancer or abrogating anergic T cell and/or Treg-mediated suppression comprises administration of cytokines to a subject in need thereof.
  • the cytokines comprise: interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IL-15), interleukin-21 (IL- 21), tumor necrosis factor alpha (TNFa) or combinations thereof.
  • TNF receptors 4- IBB, 0X40, GITR, and TNFR2 can induce T cell resistance to Treg suppression, as they provide costimulatory signals similar to CD28 ligation.
  • 4- IBB, 0X40, and TNFR2 signaling induce PI3K/Akt activation via TRAF adaptor proteins.
  • Toll-like receptors 1, 2, 4, 8, and 9, as well as IL-1R, also a member of the TLR family have been shown to induce Treg resistance. Of these, only signaling through TLR2 and TLR9 has been shown to activate the PI3K/Akt pathway via recruitment of adaptor protein MyD88, which in turn recruits and activates PI3K via its Toll/interleukin- 1 receptor domain.
  • Intracellular signaling molecules Cbl-b and SHP-1 act as negative regulators downstream of TCR signaling, and genetic deficiency in either induces Treg resistance.
  • Cbl-b enforces the requirement for CD28 costimulatory signaling by inhibiting the recruitment of PI3K to CD28.
  • TRAF6 also negatively regulates activation of PI3K downstream of CD28 costimulation by an as yet undefined mechanism (Mercadante, E. R., & Lorenz, U. M.
  • the method further comprises administration of: anti-CD25 antibodies, inhibitors of molecules associated with T cell anergy development, Toll-like receptor 2 (TLR2) agonists, 4-1BB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, cytokines or combinations thereof.
  • TLR2 Toll-like receptor 2
  • 4-1BB 4-1BB
  • 0X40 0X40
  • TNFR2 tumor necrosis factor receptor 2
  • cytokines cytokines
  • the method further comprises administering an agonist of a co stimulatory receptor.
  • exemplary agonists include an anti-glucocorticoid-induced tumor necrosis factor receptor (TNFR)-related protein (GITR) antibody, a Toll-like receptor 2 (TLR2) agonists, antibodies to molecules associated with T cell anergy development, an anti- CD27 antibody, an anti-4-lBB antibody, an anti-OX40 antibody, an anti-inducible T-cell co stimulator (ICOS) antibody, and an anti-CD40 antibody, an anti-Toll-like receptor 2 (TLR2) antibody, or any combination thereof.
  • TNFR tumor necrosis factor receptor
  • TLR2 Toll-like receptor 2
  • Toll-like Receptors are an essential line of defense against microbial and viral pathogens.
  • Various pathogen-derived ligands signal through TLRs, which recruit adaptor molecules such as MyD88 to trigger the production of pro-inflammatory mediators (Cohen P. J Cell ScL 2014 Jun 1 : 127(Pt 11)i2383-9Q).
  • the goal of TLR signaling is to sense a pathogenic threat and mount innate and adaptive immune responses.
  • TLR ligands can influence conventional T (Tcon) cells i.e.
  • T lymphocytes that express an ab T cell receptor (TCR), as well as a co-receptor CD4 or CD8, responses via direct receptor activation or indirectly, by inducing antigen presenting cells (APCs) to produce cytokines that affect T cells (Sutmuller RP, el al. Trends Immunol. 2006 Aug; 27(8):387-93).
  • APCs antigen presenting cells
  • DCs mouse dendritic cells
  • CpG TLR4 and 9 agonists, respectively
  • TLR4 and 9 agonists, respectively induced their production of IL-6, contributing to Tcon cell resistance to Treg suppression (Pasare C, Medzhitov R. Science. 2003 Feb 14; 299(5609): 1033-6). While TLR signaling directly affects Tregs there is also evidence that TLR signaling can directly induce Tcon cell resistance to suppression (Sutmuller RP, et al., Trends Immunol. 2006 Aug;
  • TLR engagement acts as a costimulatory signal to T cells and subsequently activates the PI3K/Akt pathway, consistent with a role in inducing Tcon cells to resist Treg suppression (Rahman AH, Taylor DK, Turka LA. Immunol Res. 2009; 45(l):25-36).
  • TNF Receptors Engagement of certain tumor necrosis factor receptors (TNFRs) on T cells provides costimulatory signals that lead to activation, proliferation, differentiation, and survival (Watts THT. NF/TNFR family members in costimulation of T cell responses. Annu Rev Immunol. 2005; 23:23-68.).
  • TNFRs tumor necrosis factor receptors
  • the four TRAF-binding TNFRs have been found to render Tcon cells resistant to Treg suppression (Mercadante, E. R., et al. (2016). Frontiers in immunology, 7, 193).
  • Evidence supports a role, in particular for TRAF2, in activating PI3K/Akt downstream of TNFRs (So T, et al. Front Immunol (2013)
  • TNFRs do not contain PI3K-binding motifs, they utilize TRAF adaptor proteins to activate the PI3K pathway. These TNFRs are constitutively expressed on Tregs and become upregulated on activated Tcon cells. The ligands for these TNFRs are generally expressed on APCs, but can also be induced on other cell types during infection (Stephens GL, et al. J Immunol (2004) 173:5008-20). TNFRs, like TLRs, play an important role during an infectious threat by allowing Tcon cells to become efficiently activated in order to mount a response, unrestrained by Tregs.
  • TNFR ligand expression becomes upregulated during inflammatory conditions and provides costimulatory signals to both Tregs and Tcon cells, with Tcon cells becoming activated, producing IL-2, and resisting Treg suppression.
  • Tregs can assume control of the immune response (Stephens GL, et al. J Immunol (2004) 173:5008-20.10.4049/jimmunol.l73.8.5008).
  • GITR GITR signaling in murine Tcon cells enhanced their proliferation and allowthem to resist Treg-mediated suppression.
  • 4- IBB Signaling through 4- IBB in murine Tcon cells has been shown to induce proliferation and enhance survival, especially in CD8 + T cells (Wang C, et al. Immunol Rev (2009) 229:192-21). Treatment with agonistic 4- IBB antibodies has beneficial effects on CD8 + T cell-mediated viral clearance and antitumor immunity.
  • 4- IBB signaling In vitro studies of 4- IBB signaling have shown a clear role for its CD28-independent costimulation of Tcon cells as well as its ability to induce resistance to Treg-mediated suppression (Choi BK, et al. J Leukoc Biol (2004) 75:785-91; Elpek KG, et al. J Immunol (2007) 179:7295-304; Robertson SJ, et al.
  • 0X40 0X40 signaling provides costimulation for Tcon cells, promoting their survival and development into memory cells (Ishii N, et al. Adv Immunol (2010) 105:63-98).
  • Several studies are in agreement that 0X40 signaling in murine Tcon cells induces resistance to Treg- mediated suppression (Takeda I, et al. J Immunol (2004) 172:3580-9; Piconese S, et al. J Exp Med (2008) 205:825-39; Voo KS, et al. J Immunol (2013) 191:3641-50),
  • TNFR2 TNFR2 Originally characterized by its expression on activated/memory Treg cells, TNFR2 marks potently suppressive Tregs present in peripheral lymphoid tissues as well as in tumors, but can also be induced upon T cell receptor (TCR) activation on Tcon cells (Chen X, et al. J Immunol (2008) 180:6467-71).
  • the method further comprises administering antagonists or inhibitors of molecules associated with T cell anergy development.
  • molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
  • Cbl-b is an E3 ubiquitin ligase that catalyzes the ubiquitylation of target proteins, which can result in their degradation by the proteasome, translocation inside the cell, or alteration in function (Paolino M, Penninger JM. Semin Immunopathol. 2010 Jun; 32(2): 137-48).
  • Cbl-b sets the threshold for weak antigen stimulation (Chiang YJ, et al. Nature. 2000 Jan 13; 403(6766):216-20) and enforces the need for costimulation, or “signal 2,” by regulating CD28 signaling (Li D, et al. J Immunol. 2004 Dec 15;
  • Cbl-b negatively regulates the recruitment of the p85 subunit of PI3K to CD28, thereby enforcing T cell anergy and tolerance when signal 2 is lacking (Fang D, Liu YC. Nat Immunol. 2001 Sep; 2(9):870-5).
  • CD28 signaling Cbl-b itself becomes ubiquitylated and degraded, allowing PI3K recruitment and other downstream signaling required for full T cell activation (Gruber T, et al. Sci Signal. 2009 Jun 23; 2(76):ra30).
  • Cbl-b knockout mice develop systemic autoimmunity due to hyper-proliferation and increased activation of lymphocytes, with T cells that can be activated in the absence of CD28 costimulation (Bachmaier K, et al. Nature. 2000 Jan 13; 403(6766):211-6).
  • TRAF6 belongs to the E3 ubiquitin ligase family and transduces signals downstream of members of the TNFR superfamily, including IL-lR/TLRs (Wu H, Arron JR. Bioessays. 2003 Nov; 25(11): 1096- 105), thereby activating NFKB, NFAT, MAP kinases, and Akt signaling pathways (Yang WL, et al. Science. 2009 Aug 28; 325(5944): 1134-8).
  • a 2006 study demonstrated that TRAF6 KO mice developed multi-organ inflammatory disease characterized by hyper-activated T cells (King CG, et al. Nat Med. 2006 Sep; 12(9): 1088- 92).
  • TRAF6 KO Tregs were normal, the Tcon cells resisted Treg suppression both in vitro and in vivo.
  • Re-expression of TRAF6 via retroviral transduction restored susceptibility of Tcon cells to Treg-mediated suppression (King CG, et al. Nat Med. 2006 Sep; 12(9): 1088- 92).
  • TRAF6 KO T cells could also be activated independently of CD28 costimulation, and showed enhanced Akt activation upon TCR signaling.
  • sensitivity to Tregs could by restored by overexpression of PTEN, an inhibitor of PI3K/Akt.
  • SHP-1 a protein tyrosine phosphatase, negatively regulates TCR signaling by dephosphorylating signaling mediators such as Zap70, Vav, Lck, and SLP76 (Lorenz U. Immunol Rev. 2009 Mar; 228(l):342-59).
  • SHP-1 KO mice develop inflammation in skin and lungs due to myeloid hyper-proliferation (Abram CL, et al. Immunity. 2013 Mar 21;
  • mice 38(3):489-501). These mice also accumulate memory T cells, and T cells are hyper- responsive to TCR stimulation. SHP-1 KO Tregs have an increased suppressive capacity (Iype T, et al. J Immunol. 2010 Nov 15; 185(10):6115-27). Tcon cells deficient in SHP-1 via genetic deletion or pharmacological inhibition can resist Treg suppression in vitro
  • SHP-1 regulates conventional T cell resistance to suppression by regulatory T cells. AAAS Annu. Meet. 2016 Washington, DC (2016)). SHP-1 also negatively regulates activation of STAT3 in response to IL-6 signaling, with SHP-1 -deficient cells being hyper- sensitive to IL-6 (Mauldin IS, Tung KS, Lorenz UM. Blood. 2012 May 10;
  • the methods of treatment inhibit the growth or progression of cancer, e.g., a tumor or a viral-induced tumor, in a subject.
  • the methods described herein inhibit the growth of a tumor by at least 1%, e.g., by at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100%.
  • the methods described herein reduce the size of a tumor by at least 1 mm in diameter, e.g., by at least 2 mm in diameter, by at least 3 mm in diameter, by at least 4 mm in diameter, by at least 5 mm in diameter, by at least 6 mm in diameter, by at least 7 mm in diameter, by at least 8 mm in diameter, by at least 9 mm in diameter, by at least 10 mm in diameter, by at least 11 mm in diameter, by at least 12 mm in diameter, by a least 13 mm in diameter, by at least 14 mm in diameter, by at least 15 mm in diameter, by at least 20 mm in diameter, by at least 25 mm in diameter, by at least 30 mm in diameter, by at least 40 mm in diameter, by at least 50 mm in diameter or more.
  • the subject has had the bulk of the tumor resected.
  • methods of treating cancer can include one or more cancer therapies as part of the treatment regimen.
  • the compositions of the invention embodied herein can be administered with one or more alternative treatment regimens, such as targeted and/or untargeted anti-cancer therapies can be administered.
  • Combination therapies are also contemplated and can comprise, for example, one or more chemotherapeutic agents and radiation, one or more chemotherapeutic agents and immunotherapy, or one or more chemotherapeutic agents, radiation and chemotherapy.
  • cancer therapy refers to a therapy useful in treating cancer.
  • anti-cancer therapeutic agents include, but are not limited to, surgery, chemotherapeutic agents, immunotherapy, growth inhibitory agents, cytotoxic agents, agents used in radiation therapy, anti- angiogenesis agents, apoptotic agents, anti-tubulin agents, and other agents to treat cancer, such as anti-HER-2 antibodies (e.g., HERCEPTINTM), anti-CD20 antibodies, an epidermal growth factor receptor (EGFR) antagonist (e.g., a tyrosine kinase inhibitor), HER1/EGFR inhibitor (e.g., erlotinib (TARCEVATM)), platelet derived growth factor inhibitors (e.g., GLEEVECTM (Imatinib Mesylate)), a COX-2 inhibitor (e.g., celecoxib), interferons, cytokines, antagonists (e.g., neutralizing antibodies) that bind to one or more of the HER-2 antibodies (e.g.
  • the methods of treatment include the administration of one or more chemotherapeutic agents.
  • chemotherapeutic agents include Erlotinib (TARCEVATM, Genentech/OSI Pharm.), Bortezomib (VELCADETM, Millennium Pharm.), Fulvestrant (FASLODEXTM, Astrazeneca), Sutent (SU11248, Pfizer), Letrozole
  • Astrazeneca AG1478, AG1571 (SU 5271; Sugen), alkylating agents such as Thiotepa and CYTOXANTM cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa;
  • ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine;
  • acetogenins especially bullatacin and bullatacinone
  • a camptothecin including the synthetic analogue topotecan
  • bryostatin callystatin
  • CC-1065 including its adozcicsin, carzcicsin and bizcicsin synthetic analogues
  • cryptophycins particularly cryptophycin 1 and cryptophycin 8
  • dolastatin duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide,
  • dynemicin including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, anthramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, ADRIAMYCINTM doxorubicin (including morpholino-doxorubicin,
  • vindesine dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosinc; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., TAXOLTM paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANETM Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), and TAXOTERETM doxetaxel (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZARTM gemcitabine; 6-thioguanine; mercaptopurine;
  • taxoids e.g., TAXOLTM paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.),
  • methotrexate platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; NAVELBINETM vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • platinum analogs such as cisplatin and carboplatin
  • vinblastine platinum
  • ifosfamide mitoxantrone
  • vincristine platinum
  • NAVELBINETM vinorelbine novantrone
  • teniposide edatre
  • chemotherapeutic agent also included in this definition of“chemotherapeutic agent” are: (i) anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen
  • aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, MEGASETM (megestrol acetate), AROMASINTM (exemestane), formestanie, fadrozole, RIVISORTM (vorozole), FEMARATM (letrozole), and ARIMIDEXTM (anastrozole);
  • anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as
  • troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); (iv) aromatase inhibitors; (v) protein kinase inhibitors; (vi) lipid kinase inhibitors; (vii) antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; (viii) ribozymes such as a VEGF expression inhibitor (e.g., ANGIOZYMETM (ribozyme)) and a HER2 expression inhibitor; (ix) vaccines such as gene therapy vaccines, for example,
  • PROLEUKINTM rIL-2 PROLEUKINTM rIL-2; LURTOTECANTM topoisomerase 1 inhibitor; ABARELIXTM rmRH; (x) anti- angiogenic agents such as bevacizumab (AVASTINTM, Genentech); and (xi) pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • chemotherapeutic agents are illustrative, and are not intended to be limiting.
  • radiation therapy is used.
  • the radiation used in radiation therapy can be ionizing radiation.
  • Radiation therapy can also be gamma rays, X-rays, or proton beams.
  • Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125 palladium, iridium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy.
  • the radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source.
  • the radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass.
  • photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine, photosensitizer Pc4, demethoxy- hypocrellin A; and 2BA-2-DMHA.
  • hormone therapy is used.
  • Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (e.g., flutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA)); vitamin D3 analogs; antigestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyproterone acetate).
  • hormonal antagonists e.g., flutamide, bicalu
  • Adoptive cell therapy (including allogeneic and autologous hematopoietic stem cell transplantation (HSCT) and recombinant cell (i.e., CAR T) therapies) is the treatment of choice for many malignant disorders (for reviews of HSCT and adoptive cell therapy approaches, see, Rager & Porter, Ther Adv Hematol (2011) 2(6) 409-428; Roddie & Peggs, Expert Opin. Biol. Ther. (2011) ll(4):473-487; Wang et al. Int. J. Cancer: (2015)136, 1751-1768; and Chang, Y.J. and X.J. Huang, Blood Rev, 2013. 27(1): 55- 62).
  • ACT Adoptive cell therapy
  • Such adoptive cell therapies include, but are not limited to, allogeneic and autologous hematopoietic stem cell transplantation, donor leukocyte (or lymphocyte) infusion (DLI), adoptive transfer of tumor infiltrating lymphocytes, or adoptive transfer of T cells or NK cells (including recombinant cells, i.e., CAR T, CAR NK).
  • a method of stimulating an immune response in a subject comprises isolating immune cells, e.g. T cells; contacting the immune cells with a pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors embodied herein and/or tumor antigens or tumor cells from the subject; reinfusing the immune cells into the subject; thereby, stimulating the immune response in a subject.
  • the immune cells comprise autologous, haplo-identical, haplotype matched or combinations thereof.
  • the immune cells are derived from autologous or allogeneic stem cells.
  • the immune cells comprise NK cells, T cells, stem cell memory T cells, activated NK (aNK) cells, chimeric antigen receptor- NK (CAR-NK) cells, chimeric antigen receptor-T (CAR-T) cells, or combinations thereof.
  • aNK activated NK
  • CAR-NK chimeric antigen receptor- NK
  • CAR-T chimeric antigen receptor-T cells
  • one or more adjuvants are optionally administered with the soluble fusion protein complexes embodied herein.
  • the adoptively transferred immune cells or pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors are administered at least one time per month, e.g., twice per month, once per week, twice per week, once per day, twice per day, every 8 hours, every 4 hours, every 2 hours, or every hour.
  • Suitable modes of administration for the adoptively transferred immune cells include systemic administration, intravenous administration, or local administration. Suitable modes of administration for the
  • compositions include systemic administration, intravenous administration, local administration, subcutaneous administration, intramuscular administration, intratumoral administration, inhalation, and intraperitoneal administration.
  • compositions of the invention can be administered as pharmaceutical
  • a pharmaceutical composition comprises a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
  • a pharmaceutical composition comprises an anti-neuritin inhibitor and a first and second checkpoint inhibitor.
  • the checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1,
  • the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof.
  • the first checkpoint inhibitor is an inhibitor of PD- 1 and the second checkpoint inhibitor is an inhibitor of CTLA4.
  • the neuritin inhibitor comprises: an anti-neuritin specific antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
  • the checkpoint inhibitor comprises: an antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases,
  • oligonucleotides polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides, organic or inorganic molecules, enzymes, interfering RNAs or combinations thereof.
  • compositions of the present invention may be specially formulated, in pharmaceutically acceptable carriers or salts, for parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; intravaginally or intrarectally, for example, as a pessary, cream or foam; or aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound.
  • phrases“pharmaceutically acceptable” is employed herein to refer to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • phrases“pharmaceutically-acceptable carrier” as used herein means a
  • composition or vehicle such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ, or portion of the body, to another organ, or portion of the body.
  • a liquid or solid filler such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be“acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject.
  • materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose, (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar, (14) buffering agents, such as magnesium hydroxide and aluminum hydro
  • pharmaceutically-acceptable salts refers to the relatively non-toxic, inorganic and organic acid addition salts of the agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex encompassed by the invention. These salts can be prepared in situ during the final isolation and purification of the agents, or by separately reacting a purified agent in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed.
  • Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like.
  • the agents useful in the methods of the present invention may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically- acceptable salts with pharmaceutically-acceptable bases.
  • pharmaceutically- acceptable salts refers to the relatively non-toxic, inorganic and organic base addition salts of agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex.
  • salts can likewise be prepared in situ during the final isolation and purification of the agents, or by separately reacting the purified agent in its free acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine.
  • a suitable base such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine.
  • Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like.
  • Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like.
  • kits for the treatment or prevention of a cancer includes a therapeutic or prophylactic composition containing an effective amount of an agent described herein.
  • the kit comprises a sterile container that contains a therapeutic or prophylactic composition; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art.
  • Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
  • an agent of the invention is provided together with instructions for administering the agent to a subject having or at risk of developing a cancer.
  • the instructions will generally include information about the use of the composition for the treatment or prevention of a cancer.
  • the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of a cancer or symptoms thereof; precautions; warnings; indications; counter- indications; overdosage information; adverse reactions; animal pharmacology;
  • the instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container
  • Example 1 The neurotrophic factor Neuritin regulates T cell anergy and T regulatory cell function and is a target for cancer immunotherapy
  • Nml also known as CPG15
  • GPI glycosylphosphatidylinositol
  • Nml plays multiple roles in the processes of neural development, synaptic plasticity, and synaptic maturation 26 29 ⁇ It is also highly conserved across species, with 100% sequence homology in the extracellular region and 98% overall homology between the murine and human protein. While Nrnl has been found in gene expression profile lists of murine Foxp3 + Treg 30 , anergized CD8 cells 31 tumor infiltrating lymphocytes in mouse tumor models and in human Treg infiltrating breast cancer tumor tissue 6 ’ 32 35 , its role in immune system regulation has never been studied.
  • Nml is highly expressed in both anergic T cells and Treg. Deletion of Nml resulted in defective T cell anergy induction, reduced pTreg cell generation and compromised Treg cell suppressive function in vivo. The growth of multiple tumors is highly inhibited in NmT /_ mice coincident with diminished suppression of anti-tumor T cell function in the tumor microenvironment. Furthermore, antibody blockade of Nrnl alone or in combination with anti-CTLA4 and anti-PD-1 significantly reduced tumor progression. These results implicate neuritin as a hitherto unappreciated promoter of immune tolerance and a yet untapped immunotherapy target.
  • mice 61 The Nml _/ mice 61 , Foxp3-DTR-GFP (FDG) 45 mice and TCRD _/ mice were obtained from Jackson laboratory. OTII mice on Thyl.l + background was kindly provided by Dr. Jonathan Powell. Rag2 _/ mice were maintained in our mouse facility. 6.5 TCR transgenic mice specific for HA antigen on B10.D2 background and C3HA mice on B10.D2 background has been described previously 24 .
  • FDG Foxp3-DTR-GFP
  • CD2N neuritin transgenic mice were generated as follows: an EcoRI/Smal fragment containing the Nrnl cDNA (PCR product from Nrnl cDNA clone NM_153529) was cloned into the EcoKUSmal sites between the human CD2 promoter and the CD2 locus control region of the pBS CD2 construct. The construct was then digested with KpnVNotl to remove plasmid backbone. Purified DNA fragment was injected into fertilized C57BL/6 Jax eggs and transgenic mice were generated using standard microinjection techniques at the Johns Hopkins Transgenic Mouse Core Facility. Nml expression driven by the CD2 promoter was confirmed by qRT-PCR and cell surface staining.
  • Nml _/ mice were crossed with FDG mice to generate Nrnl /_ FDG and Nrnl +/ FDG mice. Nml _/ mice were also crossed with OTII mice to generate Nrnl _/ Thyl.l + OTII + mice, Nrnl +/ Thyl.l + OTII mice.
  • mice colonies were maintained in accordance with the guidelines of Johns Hopkins University and the institutional animal care and use committee. Antibodies and Reagents.
  • Single-cell suspension of lymph node (LN) and spleen (Sp) cells were obtained by grinding the tissue through a IOOmM nylon mesh.
  • Purified CD4 + or total CD3 + T cell population was obtained by magnetic bead-based negative selection.
  • cells were incubated with anti-CD45R (B220, clone RA3-6B2), anti-I-A/I-E (Clone M5/114. 15.2), anti- CDl lb(clone Ml/70) and anti-Ly-6G (Clone RB6-8C5) with or without anti-CD8 (clone 53- 6.72).
  • Treg were isolated by sorting from the FDG CD4 + fraction based on the following profile: CD4 + CD25 + GFP + (total Treg) or CD4 + CD25 + GFP + CD62L hlgh (cTreg) and CD4 + CD25 + GFP + CD62L low (eTreg) expression.
  • Treg were enriched from CD4 cells by positive selection. Specifically, enriched CD4 cells from negative selection were incubated with anti-CD25- biotin Ab. Cells were washed and incubated with streptavidin microbeads (Miltenyi), washed and passed over a magnetic column (Miltenyi), and the positive fraction was collected.
  • lxlO 6 HA specific Thyl.U 6.5 CD4 cells from donor mice on a B10.D2 background were transferred into C3HA recipient mice, where HA is expressed as self antigen in the lung; or into wt B10.D2 mice followed by infection with Vac-HA virus (lxlO 6 pfu).
  • HA- reactive T cells were recovered from the lung draining lymph node of C3HA host mice or from wt B10.D2 Vac-HA infected mice at indicated time points by cell sorting. RNA from sorted cells was used for qRT-PCR assay examining Nml expression.
  • Nrnl _/ or Nml +/ OTII mice were transferred into wt C57BL/6 mice and subjected to the same treatment and analysis as in TCRoU hosts.
  • CD45.2 + Nml +/ or Nrnl _/ mice bred to FDG background were transferred into congenic marked CD45.U FDG mice.
  • host mice were treated with DT at lpg/mouse for 3 days. Spleen and lymph nodes were processed on Dayl l.
  • Adoptively transferred CD45.2 + cells were enriched by staining with anti-CD45.2- FITC followed by selection with anti-FITC beads and LS columns (Miltenyi Biotec). Enriched cells were further subject to cell surface staining and activation by PMA and ionomycin in the presence of brefeldin A for 4 hrs at 37°C followed by intracellular cytokine staining.
  • Naive CD4 + T cells from C57BL/6 mice were isolated from pooled lymph nodes and spleens by FACS sorting. 4xl0 5 naive T cells were injected intraperitoneally (i.p.) into lymphopenic Rag2 /_ mice. On the same day or 14-21 days post-naive T cell injection (as indicated), upon the appearance of colitis symptoms, 3-4xl0 5 congenically distinct, Treg freshly isolated from Nrnl +/+ , Nml _/ , or CD2N mice were also injected into separate cohorts of Rag2 _/ recipients. Changes in body weight were assessed weekly, and upon conclusion of the experiment, colons were removed and fixed in 10% formalin.
  • grade 1 minimal scattered mucosal inflammatory cell infiltrates, with or without minimal epithelial hyperplasia
  • grade 2 mild scattered to diffuse inflammatory cell infiltrates, sometimes extending into the submusoca and associated with erosions, with mild to moderate epithelial hyperplasia and mild to moderate mucin depletion from goblet cells
  • grade 3 moderate inflammatory cell infiltrates that were sometimes transmural, with moderate to severe epithelial hyperplasia and mucin depletion
  • grade 4 marked inflammatory cell infiltrates that were often transmural and associated with crypt abscesses and occasional ulceration, with marked epithelial hyperplasia, mucin depletion
  • grade 5 marked transmural inflammation with severe ulceration and loss of intestinal glands.
  • Transferred naive and Treg cell populations were characterized by surface marker and intracellular staining for cytokines and Foxp3.
  • Eeukocytes recovered from recipient lymph node, spleen and gut lamina propria were re-stimulated before surface staining for CD4, CD45.1 and CD45.2.
  • EAE was induced in Nrnl _/ and Nrnl +/ mice or in wt C57BE/6 mice by s.c. injection of 200pg MOG35-55 peptide in an emulsion of complete Freund Adjuvant oil (500 pg M.
  • mice received 400 ng pertussis toxin i.p. on days 0 and 2 after immunization. Clinical signs of EAE were assessed daily according to the standard 5 point scale 63 . Anti-Nrnl Ab or isotype control
  • Primary murine cells were cultured in 10%RPMI and were stimulated by indicated dose of plate bound CD3 and CD28 in a 96-well round bottom plate at lxl0 5 cells /well.
  • 5x10 s to 2xl0 6 cells/ml were activated in 24 well plate with 5pg/ml plate bound anti-CD3, 10011 I/ml IL2 and 4pg/ml anti-CD28 in the presence of 5 pg/mL of exogenous TGF .
  • gcggtgcaaatagcttacctg forward, SEQ ID NO: 1
  • cggtcttgatgttcgtcttgtc reverse, SEQ ID NO:
  • RNAseq analysis At least lOOng total RNA was extracted from sorted cells using an Qiagen RNEASY Kit (QIAGEN) according to the manufacturer’s instructions. Samples were randomly primed and prepared based on the manufacturer’ s recommendation (NEBNext Ultra RNA Library Prep Kit for Illumina). Samples were pooled and sequenced on a HiSeq with a read length configuration of 150 PE. Samples were sequenced and analyzed by Admera Health (South Plainfield, NJ). Sample quality was checked by FastQC vO.10.1. The reads were mapped to the GRCM38 and reported as fragments per kilobase of transcript per million mapped reads units.
  • the heatmap was generated using the Morpheus software from the Broad Institute, Cambridge, MA (broadinstitute.org/morpheus/). Differentially expressed transcripts were identified using the sleuth R package. In addition to a sleuth p- value ⁇ 0.05, expression > 1.0 FPKM was required on average across the samples. GSEA was employed in the context of gene ontology. Enrichment analysis with MSigDB gene sets was computed as the
  • Thl anergy gene set was also generated from upregulated genes in anergized Thl cells comparing to the control activated Thl cells based on the GSE46243 data sets using NCBI GE02R 47 ⁇ Genes overexpressed in anergized Thl cells with Benjamini & Hochberg false discover rate P ⁇ 0.001 were selected into Thl anergy gene set.
  • B16F10 melanoma, EL4 lymphoma, CT26 colon carcinoma and 4T1 breast cancer cell lines were purchased from ATCC and were culture according to ATCC instructions.
  • MC38 was cultured in 10% DMEM.
  • cells were trypsinized, washed and resuspended in PBS at an indicated concentration. While maintaining
  • mice were injected s.c. into the shaved right flanks of age-, sex- matched, female mice of the indicated strains (B16F10 and EL4). 3-4xl0 5 cells were inoculated in CT26, MC38 and 4T1 experiment. Tumor volume was calculated every 2-3 days by the following formula, 0.5xLxW 2 . Length (L) and width (W) measurements were taken perpendicular to one another, with length describing the longer measurement. Measurements were made using a digital caliper. At indicated time points post injection, cohorts of mice were euthanized. For the antibody study, the mice received an i.p.
  • Nrnl is highly expressed in anergic T cells and Treg.
  • a system was used to identify tolerance- associated genes. The gene expression patterns associated with either a T effector/memory response or tolerance induction both triggered by the same antigen but under divergent in vivo conditions were compared 24 .
  • the T effector/memory response or tolerance induction both triggered by the same antigen but under divergent in vivo conditions were compared 24 .
  • effector/memory response was induced by influenza hemagglutinin (HA) antigen-specific TCR transgenic CD4 T cells transferred into WT recipients and activated by HA-expressing vaccinia-HA (Vac-HA) virus.
  • Tolerance induction was achieved by the same TCR transgenic T cells when adoptively transferred into hosts transgenically expressing HA as self antigen (C3-HA mice) 24 .
  • One of the most highly differentially expressed genes upregulated under the in vivo anergy inducing conditions was Nml 26 29 ⁇ Nml expression by in vivo tolerized HA-specific T cells recovered at different time points after transfer was confirmed by qRT-PCR (FIG. 1A). While Nrnl was highly expressed in all time points by cells recovered from C3-HA hosts, it was minimally expressed in T cells recovered from VacHA infected mice (FIG. 1A).
  • Nrnl expression was examined in the classic AE7 in vitro T cell clonal anergy model 36 .
  • stimulation of a Thl cell line with TCR signal alone results in the development of anergy, whereas stimulation with TCR signal in the presence of
  • anti-CD28 results in cell activation and expansion. Nrnl expression was induced under anergy-inducing conditions (stimulation with anti-CD3 alone) within 9 hours with levels peaking after 24 hours. In contrast, in vitro activation (treatment with both anti-CD3 and anti-CD28) failed to significantly enhance Nml expression (FIG. IB).
  • CD4 + CD44 + FR4 CD73- cells recovered from mice under steady state conditions (FIG. 1C). Nml protein expression was also detected by cell surface staining with an anti-Nrnl antibody among CD44 + FR4 hi CD73 hi CD4 cells (FIG. ID).
  • Nrnl is expressed by Foxp3 + Treg.
  • FACS-isolated from murine lymphoid tissues revealed Foxp3 + /CD25 + Tregs indeed express Nrnl, an observation confirmed by flow cytometric staining of surface Nml protein (FIGS. 7A, 7B). Foxp3 + Treg are known to be heterogeneous in vivo.
  • Treg Resting or central Treg
  • cTreg are characterized by expression of high levels of CD62L and lower expression of CD44, primarily localized in secondary lymphoid tissues 37 .
  • Tregs acquire an effector-like phenotype (eTregs), characterized by heightened suppressive potency, high expression of CD44, GITR, ICOS, chemokine receptors, and preferential accumulation at peripheral tissue sites, such as tumor tissues 38 39,4041 .
  • eTregs effector-like phenotype
  • Nml message was highly expressed by induced Treg (iTreg) generated in vitro (FIG. IE). Nml RNA levels are much higher in CD62L low eTreg than CD62L hlgh cTreg under steady state (FIG. IF). Consistent with a link between Nrnl expression and the process of Treg activation, in vitro activation with TCR signal and IL2 resulted in considerable Nml upregulation by purified CD44 low /CD62L hlgh Tregs. Activation of CD44 hlgh /CD62L low Tregs resulted in similarly enhanced Nml levels (FIG. IF).
  • Nrnl is important for the induction of T cell anergy and pTreg development in vivo.
  • T cell anergy refers to a hyporesponsive state induced in Tconv as a result of certain conditions 7 including suppression by Treg during their activation 11 13 .
  • Tconv that are suppressed by Treg can develop anergy and convert to pTreg (a process associated with Foxp3 induction), thereby amplifying“infectious tolerance” 10 14 ’ 42 .
  • anergy among Tconv cells can also be induced upon encounter persistent self antigen in the absence of Treg cells 9 10 ’ 43 .
  • the high expression of Nml in anergic T cells (FIGS.
  • Nrnl _/ mice were obtained. Nml deficiency does not interfere with thymocytes development nor bone marrow B cell development; similar proportions of T and B cells were observed in wild type (WT, Nml +/+ ) and Nrnl _/ mice (data not shown). OVA antigen specific TCR transgenic OTII mice were crossed onto the Nml _/ background to facilitate the observation of antigen specific CD4 cell response in the absence of Nml.
  • OTII TCR transgenic mice Upon crossing with OTII TCR transgenic mice, there was comparable development of OTII CD4 T cells, and comparable reduction of the Foxp3 + Treg population due to TCR transgenic expression (2-4% in OTII transgenic mice vs 10-15% in wt C57BL/6 mice) in both Nml _/ or Nml +/_ offspring.
  • Nrnl The first potential role of Nrnl in CD4 cell anergy development that was analyzed herein, was the susceptibility of CD4 Tconv cells to Treg mediated suppression during antigen specific anergy induction in vivo.
  • the classic soluble intravenous (i.v.) peptide injection anergy-induction model was used 14 .
  • OTII+Nrnl 7 or control OTII+Nml +/_ CD4 Tconv cells, depleted of CD25 hl Treg were cotransferred with wt Treg into TCRa knockout mice (TCRoU) (FIG. 2A).
  • Transferred OTII Tconv cells could be distinguished from co-transferred Treg via distinct congenic markers (OTII Thyl.U; Treg Thyl.2 + ).
  • Reconstituted mice were injected i.v. with soluble OVA peptide every three days for three treatments - a standard protocol to induce anergy 7 14 .
  • a component of anergy induction by soluble i.v. antigen involves Treg mediated suppression operating upon antigen- specific Tconv cells 7 ’ 22 ’ 23 .
  • Mice were harvested on day 13 after adoptive transfer (ADT) and OTII T cell expansion, cytokine production and conversion to pTreg (Foxp3 induction) were examined.
  • Nrnl _/ T cells showed increased expansion evidenced by increased percentage of OTII+Nml 7 cells in the CD4 + population both in lymph node and spleen (FIG. 2B). The total number of OTIRNml 7 cells was also increased compared to OTII Nml +/_ T cells (FIG. 2C). Upon OVA peptide restimulation in vitro, OTII Nml _/ cells produced significantly more IL2 than control OTII Nml +/ cells (FIG. 2D). Moreover, OTII Nml _/ T cell demonstrated significantly reduced conversion to Foxp3 + Treg relative to control (FIG. 2E).
  • a second tolerance system was used to study the role of Nml in anergy induction and the generation of pTreg among polyclonal T cells (to complement the findings made in the monoclonal OTII system described above) in the absence of Treg suppression.
  • Persistent self antigen has been shown to induce tolerance among naive self-Ag specific T cells and to mediate their conversion into pTreg 43 .
  • Transient depletion of Treg in adult mice can result in self-reactive CD4 + T cell responses, followed by recovery of self-tolerance accompanied by reemergence of Treg and reestablishment of anergy among peripheral Tconv cells in 10- 14 days 44 .
  • Nrnl regulates Treg reemergence and the restoration of self-tolerance was used to determine whether Nrnl regulates Treg reemergence and the restoration of self-tolerance.
  • Nml _/ mice were crossed onto a Foxp3DTRgfp (FDG) background where Treg can be deleted by administration of diphtheria toxin (DT) due to the expression of diphtheria toxin receptor (DTR) 45
  • T cells from Nml _/ or Nml +/_ control mice on the FDG background were co-transferred into congenic CD45.1expressing FDG wt hosts as outlined in FIG. 2F. Because all Treg (host and adoptively transferred) in this system express DTR, DT administration after T cell transfer completely eliminates all Treg from the adoptively transferred mice. Because adoptively transferred T cells are congenically distinguished from endogenous T cells, this enabled the evaluation of both cell-intrinsic and cell-extrinsic effects of Nrnl deficiency on anergy induction as well as conversion of Tconv to pTreg.
  • DT was administered the day after T cell transfer to delete Treg from both transferred T cells and endogenous T cells. Mice were harvested 11 days after DT treatment, at the recovery phase from the autoimmune response induced by Treg cell depletion 44 . De novo Foxp3 + Treg generation was consistently reduced among Nrnl 7 cells compared to Nml +/ cells (FIG. 2G). Anergic T cell populations (FR4 hl CD73 hl ) were also reduced (FIG. 2H).
  • Nml _/ T cells have an intrinsic defect in generating Foxp3 + Treg and FR4 hl CD73 hl anergic cells under this self-reactivity model, it was also found that they negatively impacted the generation of endogenous Treg and anergic cells.
  • T cells in the host mice (CD45.1 + ) receiving adoptive transfer of Nml _/ T cells consistently showed reduced generation of Foxp3 + and FR4 hl CD73 hl cells among CD4 cells relative to those receiving Nrnl +/ control T cells (FIGS. 2G, 2H). They also showed higher levels of proliferation as indicated by Ki67 staining and higher levels of Thl generation evidenced by IFNy and Tbet staining (FIGS.
  • Nrnl deficiency not only caused a cell-intrinsic defect in generation of Foxp3 + and FR4 hl CD73 hl anergic T cells, it also resulted in cell extrinsic effects impacting the proinflammatory capacity of wt T cells.
  • CD2-Nml CD2N mice
  • FIG. 8C CD2N mice
  • an elevated level of Nrnl expression was detected by mRNA and surface staining among CD3 + cells from CD2N mice
  • FIG. 8D CD2N mice were also crossed to the FDG background to generate CD2N-FDG mice.
  • CD2N-FDG T cell responses to self-antigen upon transfer into FDG mice were tested as outlined in FIG. 2F.
  • Nrnl expression by Treg supports their in vivo suppressive function. Having demonstrated a role for Nrnl in anergy induction and pTreg conversion, the importance of this molecule in the suppressive function of Tregs, was further explored. Nrnl was found to be highly expressed by Treg and in particular by activated eTreg (FIGS. IE, IF, 1H).
  • Nrnl may also participate in the acquisition of the eTreg phenotype and consequent upregulation of suppressive potency. It was first investigated whether eTreg can be effectively activated and converted to eTreg in the absence of Nml in vitro.
  • CD44 Low /CD62L Hlgh cTreg marked with GFP were sorted from Nml _/ or Nml +/_ mice on the FDG background and activated by anti- CD3 and CD28 in vitro. Indeed, activation of purified Nml _/ cTreg resulted in less efficient generation of CD44 Hlgh /CD62L Low cells compared to the activation of Nml +/ cTreg (FIG.
  • Treg T cell- induced colitis model was used to test the importance of Nml for the control of inflammation by Treg.
  • naive CD62L H 7CD25
  • CD4 + T cells lymphopenic recipient mice
  • Treg isolated from Nml _/ and their littermates Nrnl +/ were transferred into recipient mice cohorts, and their ability to ameliorate colitis was determined.
  • Nrnl +/ Treg prevented further development of colitis, which progressed unabated in control mice not receiving Treg.
  • Treg isolated from Nrnl _/ mice failed to rescue recipients from severe colitis, evidenced by wasting and colon pathology (FIGS. 3B-3D). Additionally, proinflammatory cytokine-producing T cells (IRNg or IL-17) were more prevalent in the gut-draining lymph node and lamina propia of mice receiving Nrnl _/ Treg compared to Nml +/_ Treg recipients (FIGS. 3E, 3F). Tracking the fate of injected Treg revealed that Nrnl deficiency significantly reduced the number of Treg present in these tissues as well as the expression of Foxp3 (FIGS. 3G, 3H).
  • IRNg or IL-17 proinflammatory cytokine-producing T cells
  • Nrnl _/ mice unlike their wt counterparts, failed to control inflammation in this widely used model of multiple sclerosis. Specifically, Nml _/ mice showed no partial recovery during the late stages of disease, when Treg normally accumulate in affected tissues and mediate their suppressive activity 46 (FIG. 31).
  • Nrnl affects anergy and Treg cell signature gene expression.
  • gene expression profiles were compared between Nml _/ and Nrnl +/ T cells under different conditions.
  • an RNAseq analysis of soluble peptide anergized OTII+Nrnl 7 vs OTII+Nml +/ T cells that were cotransferred with wt Treg into TCRa _/ host mice was performed as outlined in FIG. 2A. 868 genes were revealed gene categories related to receptor binding as the most affected category upon loss of Nrnl.
  • Kegg pathway analysis also provided evidence that defects in the T cell receptor signaling pathway and the cytokine- receptor interaction pathways were among the top effects of Nml deletion in anergized T cells (FIGS. 10A, 10B).
  • GSEA Gene set enrichment analysis
  • Nrnl +/_ cells While the gene set enriched in Treg was prominent in Nrnl +/_ cells, it was not in Nrnl _/ cells, consistent with a defect in pTreg cell generation by Nml _/ cells (FIG. 4C).
  • Genes upregulated in Nml +/_ T cells overlapping with the Thl anergy gene set are shown in the heatmap in FIG. 4D.
  • PD-1, Lag3, ICOS and CD73 are all down regulated in Nrnl 7 T cells.
  • SLC9b2, SLC4al, SlOOal and NSMf are also reduced in Nrnl 7 T cells (FIG. 10D).
  • GSEA analysis against NFAT target genes reveal reduced NFAT target gene expression among Nrnl 7 OTII cells (FIG. 4E), providing evidence of reduced or unbalanced NFAT signaling.
  • Treg were also sorted from Nrnl 7 or Nml +/ mice under steady state and subjected them to RNAseq gene expression profile comparison analysis. Consistent with reduced Treg cell suppression function in vivo, GSEA analysis showed reduced expression of Treg cell signature genes (FIG. 4F). NFAT signaling plays a significant role in Treg cell suppression function 50 . Similar to the finding of Nrnl 7 OTII cell gene expression under the anergy setting (FIG. 4E), Nrnl 7 eTreg showed reduced expression of genes in the NFAT target gene set (FIG. 4G).
  • Nrnl 7 vs Nml +/ cells The reduced expression of anergy related signature genes in Nrnl 7 vs Nml +/ cells are consistent with the phenotype of compromised T cell anergy induction.
  • Treg cell expression profile analysis between Nrnl 7 and Nml +/ cells also reveals reduced Treg signature gene expression in the absence of Nrnl expression, explaining the defective suppressive function of Nrnl 7 Tregs in vivo.
  • Nrnl has been shown to modulate NFAT down- regulated and 432 genes were up-regulated in Nrnl 7 OTII cells compared to Nml +/ OTII cells (FIG. 4A).
  • Nrnl 7 down-regulated genes signaling pathway in neurons and NFAT signaling is important for both anergy development and Treg function 50 52 .
  • GSEA analysis reduction in the NFAT target signature genes was found in Nrnl 7 T cells recovered from anergic conditions and in eTreg recovered from Nrnl 7_ mice under steady state.
  • Nrnl deficiency or blockade alone or in combination with CTLA4 and PD1 blockade inhibits tumor growth.
  • Tumor antigen specific T cells can quickly become anergized or convert to a pTreg fate in the cancer setting 5 53 ⁇
  • Treg facilitate the induction of anergy and pTreg cell differentiation within the pool of potential anti-tumor effector T cells during tumor emergence and progression 5 .
  • Nrnl 7 mice and their Nml +/ littermates were challenged with the moderately immunogenic EL4 thymoma and the aggressive, poorly immunogenic B16 melanoma subcutaneously (s.c).
  • Nml The important role for Nml in regulating the anti-cancer immune response was further evidenced by its expression in T cells in the tumor bearing mice.
  • TIFs B16F10 tumor infiltrating lymphocytes
  • Non-Treg CD4 (Foxp3 , gfp ) cells among the TIFs from these mice also show higher Nrnl expression compared to peripheral blood CD4 cells (FIG. 5G), an observation in line with Nrnl expression by multiple suppressor T cell populations.
  • 6.5 T cells specific for HA antigen were adoptively transferred into A20HA B cell lymphoma bearing mice or into wt mice followed by infection with VacHA virus. Nrnl is highly expressed in tumor antigen specific 6.5 T cells isolated from tumor bearing host compared to T cells activated by VacHA infection (FIG. 5H).
  • Treg cell suppression of adaptive immunity can contribute to tumor progression.
  • Rag2 /_ mice were reconstituted with Nml +/+ , CD45.1 + spleen and lymph node cells depleted of CD25 + Treg and co- transferred congenically marked Treg from Nml +/ or Nrnl _/ mice (CD45.1 ) before B16 tumor challenge. Tumors grew much slower in Nml _/ Treg recipients compared to those reconstituted with Nml +/_ controls (FIG. 51).
  • Nrnl _/ Treg effector cells
  • Nml is a promising target for tumor immunotherapy.
  • anti-Nml monoclonal antibody (mAh) treatment of B16F10 tumor bearing mice 5-6 days after implantation results in marked tumor growth inhibition relative to isotype control treatment (FIG. 6A and FIG. 12A). Similar trends were obtained in the MC38 (colon), CT26 (colon) and 4T1 (breast) tumor models (FIGS. 6B-6D and FIGS.
  • TILs from B16F10 tumors revealed an increased CD8/Treg ratio and increased expression of Tbet and effector cytokines production among CD 8 cells in mice treated with anti-Nrnl mAh (FIGS. 6E-6G).
  • triple combination treatment of anti-Nrnl with anti-CTLA4 and anti-PDl may allow comprehensive blockade against the development of anergy and exhaustion among tumor specific T cells, thus achieve further improvement in treatment efficacy.
  • administration of a triple combination of anti-Nml, anti-CTLA4 and anti-PDl mAh to mice with established B16F10 tumors resulted in a significant inhibition of tumor growth (FIGS. 6H, 61 and 13C).
  • Nml as a novel tolerance-promoting factor with a role in the generation and biology of two major suppressor T cell populations. They also clearly implicate Nml to be a high-value target for anti-tumor immunotherapy. Nml blockade results in enhanced CD8 cell tumor infiltration and effector function. Furthermore, combination of anti-Nml with checkpoint inhibition regimens can significantly improve tumor treatment efficacy.
  • Nml was discovered in neurons as an activity induced GPI-anchored membrane protein. It has been shown to promote synapse maturation in neurons 29,54 ⁇ No functional role of Nml in the immune system has been previously reported. Its expression in Treg and anergized Tconv cells, its role in maintaining Treg and anergy- dependent tolerance and the anti-tumor effects resulting from its deletion or functional blockade is characterized here. Indeed, increased Nml expression has been observed on various expression profiling lists, not only in CD4 + anergic and Treg 30 ⁇ 34 ⁇ 55 ⁇ but also in anergic CD 8 cells 31 34 . Any potential role for Nml in the biology of these immunoregulatory cells prior to the findings herein, have gone unexplored.
  • Nrnl in conventional CD4 cells results in compromised anergy induction and pTreg development in a number of different in vivo systems including a model of immune tolerance induced by soluble i.v. antigen and an autoimmune disease model triggered by transient Treg deletion (FIGS. 2A-2K).
  • the defective anergy induction among Nrnl _/ cells was accompanied with reduced expression of anergy and Treg related genes as revealed by GSEA analysis (FIGS. 4B, 4C).
  • loss of Nml in Treg resulted in reduced Treg cell signature gene expression and compromised suppression function in vivo (FIGS. 3A-3J; FIG. 4F).
  • Treg facilitate the induction of anergy, and anergic T cells are prone to develop into pTreg and spread self-antigen-specific suppression 3 .
  • Nml contributes to the maintenance of peripheral tolerance through both T cell anergy and Treg cell suppression.
  • Nrnl may affect T cell function intrinsically or it may act extrinsically affecting neighboring cell function, impacting the establishment of tolerance environment.
  • FIGS. 2E, 2G reduced pTreg generation in the absence of Nml
  • Nrnl may also have a cell-extrinsic effect influencing the establishment of tolerance environment.
  • Nml has been shown to function in the CNS both when it is attached on the cell surface and as a soluble protein 26,29 .
  • Nrnl-Fc fusion protein binding of Nrnl to various cell types including dendritic cells was observed (data not shown).
  • Nml has been shown to increase calcium concentration and NFAT activation in the granule neurons of the cerebellum 51 .
  • Reduced NFAT target gene expression was found in Nml 7 Tconv cells and NrnT /_ Foxp3+ effector Treg (FIGS. 4E, 4G).
  • NFAT also contributes to the activation of the anergic gene expression program in Tconv cells and NFAT1 deletion results in defective anergy induction 52 .
  • NFAT can interact with Foxp3 and facilitate Treg cell suppression function 50 .
  • Dysregulation of calcium mobilization can contribute to reduced NFAT activation and target gene transcription, thus compromising T cell anergy development and Treg cell suppression.
  • Nrnl has been identified in the AMPA-type ionotropic glutamate receptor (AMPAR) complex 54,57 .
  • AMPAR ionotropic glutamate receptor
  • the ionotropic AMPAR can permeate calcium directly or indirectly 58 .
  • Nml may affect calcium mobilization through AMPAR. It remains to be determined how the function of Nrnl is related to AMPAR in the immune system.
  • CTLA-4 and PD- 1 are both immune checkpoint inhibitors that have shown clear clinical efficacy but have different functional mechanisms 59 .
  • CTLA-4 primarily attenuates T cell activation in the priming phase through cell intrinsic and extrinsic mechanisms.
  • PD-1 appears on exhausted T cells and primarily attenuates T cell activity in peripheral tissues 60 .
  • Nrnl as a novel target and our strategy of combination therapy targeting different aspect of tumor specific T cell dysfunction can significantly improve the outcome of tumor therapy.
  • Nml was identified as a novel cell surface molecule with preferential expression by suppressive T cell populations and clear function in T cell mediated immune tolerance in vivo.
  • Nrnl is highly expressed in anergic T cells and Treg, deletion of which affect CD4 T cell anergy development and Treg cell suppression function.
  • Nml blockade can enhance anti-tumor adaptive T cell responses and combination therapy with anti-CTLA4 and anti-PDl greatly enhances treatment efficacy to an aggressive, non-immunogenic murine tumor model.
  • Egr2 early growth response gene 2

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Neuritin (Nml), a conserved GPI- anchored surface molecule important for neurite outgrowth and synapse maturation in neurons, is highly expressed in anergic T cells and Treg, in the periphery and the tumor microenvironment. Compositions for the abrogation of suppression of an antigen specific immune response include neuritin inhibitors and checkpoint inhibitors.

Description

NEURITIN REGULATION OF T CELL ANERGY AND
T REGULATORY CELL FUNCTION
CROSS REFERENCE TO RELATED APPLICATIONS
This Application claims the benefit of U.S. Provisional Application 62/791,663 filed on January 11, 2019. The entire contents of this application is incorporated herein by reference in its entirety.
TECHNICAL FIELD
Compositions for the abrogation of suppression of an antigen specific immune response comprise neuritin inhibitors and checkpoint inhibitors. Methods for treating cancer or other disorders in which an immune response has been suppressed include the administration of these compositions.
BACKGROUND
Immune homeostasis is achieved through both central and peripheral tolerance mechanisms. Thymic central tolerance shapes the peripheral T cell pool by eliminating most high-affinity self-reactive T cells. However, central tolerance is incomplete and thus, a significant number of peripheral CD4+ and CD8+ cells are self-reactive, displaying a broad TCR repertoire h These self-reactive T cells are kept in a quiescent state through peripheral tolerance mechanisms, including“ignorance”, peripheral deletion, induction of T cell anergy and suppression by regulatory T cells (Treg) 2 4. Understanding these tolerance-promoting mechanisms and their restraint of self-reactive T cells is not only important for autoimmune disease prevention and therapy, it also has increasing implications for cancer immunotherapy.
SUMMARY
Embodiments of the invention are directed to compositions which abrogate anergic T cell and T regulatory cell functions, thereby allowing for an effective immune response to antigens. Methods of treating cancer are provided that include the use of these compositions.
In certain embodiments, a method of treating cancer comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell functions.
In certain embodiments, a method of inducing a tumor specific immune response in a subject, comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell functions.
In certain embodiments, a method of abrogating T cell anergy is provided that comprises administering to a subject in need thereof, a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
In additional embodiments, a method of modulating T regulatory (Treg) cell function is provided that comprises administering to a subject in need thereof, a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
In certain embodiments, a method of inducing a tumor specific immune response in a subject, comprises isolating T cells from a biological sample from the subject, culturing the T cells with an effective amount of a neuritin inhibitor and one or more checkpoint inhibitors, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity, adoptively transferring the T cells to the subject thereby, inducing the tumor specific immune response.
In certain embodiments, a method of inducing a tumor specific immune response in a subject, comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity, thereby, inducing the tumor specific immune response. In certain embodiments, a tumor specific antigen is co administered to the subject.
In certain embodiments, a method of stimulating an immune response in a subject comprises isolating immune cells, e.g. T cells; contacting the immune cells with a pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors embodied herein and/or tumor antigens or tumor cells from the subject; reinfusing the immune cells into the subject; thereby, stimulating the immune response in a subject. In certain embodiments, the immune cells comprise autologous, haplo-identical, haplotype matched or combinations thereof. In certain embodiments, the immune cells are derived from autologous or allogeneic stem cells. In certain embodiments, the immune cells comprise NK cells, T cells, stem cell memory T cells, activated NK (aNK) cells, chimeric antigen receptor- NK (CAR-NK) cells, chimeric antigen receptor-T (CAR-T) cells, or combinations thereof. In certain embodiments, one or more adjuvants are optionally administered with the soluble fusion protein complexes embodied herein. The adoptively transferred immune cells or pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors are administered at least one time per month, e.g., twice per month, once per week, twice per week, once per day, twice per day, every 8 hours, every 4 hours, every 2 hours, or every hour. Suitable modes of administration for the adoptively transferred immune cells include systemic administration, intravenous administration, or local administration. Suitable modes of administration for the
pharmaceutical composition include systemic administration, intravenous administration, local administration, subcutaneous administration, intramuscular administration, intratumoral administration, inhalation, and intraperitoneal administration.
In an embodiment, the effective amounts of the adoptively transferred immune cells are between 1 x 104 cells/kg and 1 x 1010 cells/kg.
In some embodiments of the invention, the patient is pretreated or preconditioned to facilitate engraftment or survival of the adoptively transferred cells. Examples of preconditioning include treatment with cyclophosphamide and fludarabine. Additionally, the patient may be treated with agents that promote activation, survival or persistence of the adoptively transferred cells pre- and/or post-cell transfer. Examples of such treatment include use of IL-2, IL-15 or other immunostimulatory agents. Other therapeutic approaches of known in the field of adoptive cell therapy (i.e., including but not limited to allogeneic, autologous, haploidentical, DLI, stem cell, NK92 -based and CAR NK therapies) may also be used in the methods herein.
In certain embodiments, the neuritin inhibitor comprises: an anti-neuritin specific antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
In certain embodiments, one or more checkpoint inhibitors are administered, the checkpoint inhibitors comprising an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof. In certain embodiments, the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof. In certain embodiments, the checkpoint inhibitor comprises: an antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides, organic or inorganic molecules, enzymes, interfering RNAs or
combinations thereof.
In certain embodiments, the present method further comprise administration of: anti- CD25 antibodies, inhibitors of molecules associated with T cell anergy development, Toll like receptor 2 (TLR2) agonists, 4- IBB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, cytokines or combinations thereof.
In certain embodiments, the cytokines comprise: interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IL-15), interleukin-21 (IL- 21), tumor necrosis factor alpha (TNFa) or combinations thereof.
In certain embodiments, molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
In certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors. In certain embodiments, a pharmaceutical composition comprises an anti-neuritin inhibitor and a first and second checkpoint inhibitor. In preferred aspects, the first and second checkpoint inhibitors are distinct agents. In certain embodiments, the checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, and/or TGFR-b or combinations thereof. In certain embodiments, the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof. In certain embodiments, the first checkpoint inhibitor is an inhibitor of PD-1 and the second checkpoint inhibitor is an inhibitor of CTLA4.
In certain embodiments, the pharmaceutical composition is administered intra muscularly, systemically, intratumorally, intraperitoneally or combinations thereof.
Preferably, the methods described herein inhibit the growth or progression of cancer, e.g., a tumor, or a viral infection in a subject. For example, the methods described herein inhibit the growth of a tumor by at least 1%, e.g., by at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100%, relative an untreated control (e.g. tumor cells not treated with a neuritin inhibitor). In other cases, the methods described herein reduce the size of a tumor by at least 1 mm in diameter, e.g., by at least 2 mm in diameter, by at least 3 mm in diameter, by at least 4 mm in diameter, by at least 5 mm in diameter, by at least 6 mm in diameter, by at least 7 mm in diameter, by at least 8 mm in diameter, by at least 9 mm in diameter, by at least 10 mm in diameter, by at least 11 mm in diameter, by at least 12 mm in diameter, by a least 13 mm in diameter, by at least 14 mm in diameter, by at least 15 mm in diameter, by at least 20 mm in diameter, by at least 25 mm in diameter, by at least 30 mm in diameter, by at least 40 mm in diameter, by at least 50 mm in diameter or more, relative to an untreated control (e.g. tumor cells not treated with a neuritin inhibitor). In some cases, the subject has had the bulk of the tumor resected.
The subject is preferably a mammal in need of such treatment, e.g., a subject that has been diagnosed with cancer or a viral infection, or a predisposition thereto, i.e., at risk of developing cancer or a viral infection. The mammal is any mammal, e.g., a human, a primate, a mouse, a rat, a dog, a cat, a horse, as well as livestock or animals grown for food consumption, e.g., cattle, sheep, pigs, chickens, and goats. In a preferred embodiment, the mammal is a human.
Modes of administration include intravenous, systemic, oral, rectal, topical, intraocular, buccal, intravaginal, intracistemal, intracerebroventricular, intratracheal, nasal, transdermal, within/on implants, or parenteral routes. The term“parenteral” includes subcutaneous, intrathecal, intravenous, intramuscular, intraperitoneal, or infusion.
Intravenous or intramuscular routes are not particularly suitable for long-term therapy and prophylaxis. They could, however, be preferred in emergency situations. Compositions comprising a composition of the invention can be added to a physiological fluid, such as blood. Oral administration can be preferred for prophylactic treatment because of the convenience to the patient as well as the dosing schedule. Parenteral modalities
(subcutaneous or intravenous) may be preferable for more acute illness, or for therapy in patients that are unable to tolerate enteral administration due to gastrointestinal intolerance, ileus, or other concomitants of critical illness. Inhaled therapy is also provided.
For example, the composition is administered in a form selected from the group consisting of pills, capsules, tablets, granules, powders, salts, crystals, liquids, serums, syrups, suspensions, gels, creams, pastes, films, patches, and vapors.
In some cases, the methods described herein are used in conjunction with one or more agents or a combination of additional agents, e.g., an anti-cancer agent. Suitable agents include current pharmaceutical and/or surgical therapies for an intended application, such as, for example, cancer. For example, the methods described herein can be used in conjunction with one or more chemotherapeutic or anti-neoplastic agents, e.g., chemotherapy, targeted cancer therapy, cancer vaccine therapy, or immunotherapy. In some cases, the additional chemotherapeutic agent is radiotherapy. In some cases, the chemotherapeutic agent is a cell death-inducing agent. Treatment with immunotherapeutic methods or compositions described herein may be a stand-alone treatment, or may be one component or phase of a combination therapy regime, in which one or more additional therapeutic agents are also used to treat the patient.
Other aspects are described infra.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et a , Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.
The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms “a”,“an” and“the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms“including”,“includes”, “having”,“has”,“with”, or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term
“comprising.”
The term“about” or“approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system.
For example,“about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively,“about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value or range. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude within 5-fold, and also within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term“about” meaning within an acceptable error range for the particular value should be assumed.
As used herein, the term“agent” is meant to encompass any molecule, chemical entity, composition, drug, therapeutic agent, chemotherapeutic agent, or biological agent capable of preventing, ameliorating, or treating a disease or other medical condition. The term includes small molecule compounds, antisense oligonucleotides, siRNA reagents, antibodies, antibody fragments bearing epitope recognition sites, such as Fab, Fab’, F(ab’)2 fragments, Fv fragments, single chain antibodies, antibody mimetics (such as DARPins, affibody molecules, affilins, affitins, anticalins, avimers, fynomers, Kunitz domain peptides and monobodies), peptoids, aptamers; enzymes, peptides organic or inorganic molecules, natural or synthetic compounds and the like. An agent can be assayed in accordance with the methods of the invention at any stage during clinical trials, during pre-trial testing, or following FDA-approval.
As used herein, the term“agonist” refers to an agent that binds to a receptor and activates the receptor to produce a biological response. Whereas an agonist causes an action, an antagonist blocks the action of the agonist, and an inverse agonist causes an action opposite to that of the agonist.
By“ameliorate” is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.
The term“antineoplastic agent” is used herein to refer to agents that have the functional property of inhibiting a development or progression of a neoplasm in a human, particularly a malignant (cancerous) lesion. Inhibition of metastasis is frequently a property of antineoplastic agents.
The terms“cancer” or“tumor” or“hyperproliferative” refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain
characteristic morphological features. In some embodiments, such cells exhibit such characteristics in part or in full due to the expression and activity of immune checkpoint inhibitors, such as PD-1, PD-L1, PD-L2, and/or CTLA-4. Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell. As used herein, the term“cancer” includes premalignant as well as malignant cancers. Cancers include, but are not limited to, B cell cancer, e.g., multiple myeloma, Waldenstrom's macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematologic tissues, and the like. Other non-limiting examples of types of cancers applicable to the methods encompassed by the present invention include human sarcomas and carcinomas, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, colorectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, liver cancer, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, bone cancer, brain tumor, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non- Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease. In some embodiments, cancers are epithelial in nature and include but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, or skin cancer. In other embodiments, the cancer is breast cancer, prostate cancer, lung cancer, or colon cancer. In still other embodiments, the epithelial cancer is non-small-cell lung cancer, nonpapillary renal cell carcinoma, cervical carcinoma, ovarian carcinoma (e.g., serous ovarian carcinoma), or breast carcinoma. The epithelial cancers may be characterized in various other ways including, but not limited to, serous, endometrioid, mucinous, clear cell, Brenner, or undifferentiated.
The term“checkpoint inhibitor” means a group of molecules on the cell surface of CD4+ and/or CD8+ T cells that fine-tune immune responses by down-modulating or inhibiting an anti-tumor immune response. Immune checkpoint proteins are well known in the art and include, without limitation, CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7- H4, B7-H6, 2B4, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-
1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-
2, ILT-4, TIGIT, and A2aR (see, for example, WO 2012/177624).
“Anti-immune checkpoint inhibitor therapy” refers to the use of agents that inhibit immune checkpoint inhibitors. Inhibition of one or more immune checkpoint inhibitors can block or otherwise neutralize inhibitory signaling to thereby upregulate an immune response in order to more efficaciously treat cancer. Exemplary agents useful for inhibiting immune checkpoint inhibitors include antibodies, small molecules, peptides, peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit immune checkpoint proteins, or fragments thereof; as well as RNA interference, antisense, nucleic acid aptamers, etc. that can downregulate the expression and/or activity of immune checkpoint inhibitor nucleic acids, or fragments thereof. Exemplary agents for upregulating an immune response include antibodies against one or more immune checkpoint inhibitor proteins block the interaction between the proteins and its natural receptor(s); a non activating form of one or more immune checkpoint inhibitor proteins (e.g., a dominant negative polypeptide); small molecules or peptides that block the interaction between one or more immune checkpoint inhibitor proteins and its natural receptor(s); fusion proteins (e.g. the extracellular portion of an immune checkpoint inhibition protein fused to the Fe portion of an antibody or immunoglobulin) that bind to its natural receptor(s); nucleic acid molecules that block immune checkpoint inhibitor nucleic acid transcription or translation; and the like. Such agents can directly block the interaction between the one or more immune checkpoint inhibitors and its natural receptor(s) (e.g., antibodies) to prevent inhibitory signaling and upregulate an immune response. Alternatively, agents can indirectly block the interaction between one or more immune checkpoint proteins and its natural receptor(s) to prevent inhibitory signaling and upregulate an immune response. For example, a soluble version of an immune checkpoint protein ligand such as a stabilized extracellular domain can binding to its receptor to indirectly reduce the effective concentration of the receptor to bind to an appropriate ligand. In one embodiment, anti-PD-1 antibodies, anti-PD-Ll antibodies, and anti-CTLA-4 antibodies, either alone or used in combination.
As used herein, the term“cancer therapy” refers to a therapy useful in treating cancer. Examples of anti-cancer therapeutic agents include, but are not limited to, surgery, chemotherapeutic agents, immunotherapy, growth inhibitory agents, cytotoxic agents, agents used in radiation therapy, anti- angiogenesis agents, apoptotic agents, anti-tubulin agents, and other agents to treat cancer, such as anti-HER-2 antibodies (e.g., HERCEPTIN™), anti-CD20 antibodies, an epidermal growth factor receptor (EGFR) antagonist (e.g., a tyrosine kinase inhibitor), HER1/EGFR inhibitor (e.g., erlotinib (TARCEVA™)), platelet derived growth factor inhibitors (e.g., GLEEVEC™ (Imatinib Mesylate)), a COX-2 inhibitor (e.g., celecoxib), interferons, cytokines, antagonists (e.g., neutralizing antibodies) that bind to one or more of the following targets ErbB2, ErbB3, ErbB4, PDGFR-beta, BlyS, APRIL, BCMA or VEGF receptor(s), TRAIL/ Apo2, and other bioactive and organic chemical agents, etc. Combinations thereof are also contemplated for use with the methods described herein.
A“chemotherapeutic agent” is a chemical compound useful in the treatment of cancer.
The term“co-administer” refers to the simultaneous presence of two active agents in the blood of an individual. Active agents that are co- administered can be concurrently or sequentially delivered.
As used herein, the terms“comprising,”“comprise” or“comprised,” and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements— or, as appropriate, equivalents thereof— and that other elements can be included and still fall within the scope/definition of the defined item, composition, apparatus, method, process, system, etc.
As used herein, the phrase“consisting essentially of’ refers to the genera or species of active pharmaceutical agents included in a method or composition, as well as any inactive carrier or excipients for the intended purpose of the methods or compositions.
The term“control” refers to any reference standard suitable to provide a comparison to the expression products in the test sample. In one embodiment, the control comprises obtaining a“control sample” from which expression product levels are detected and compared to the expression product levels from the test sample. Such a control sample may comprise any suitable sample, including but not limited to a sample from a control cancer patient (can be stored sample or previous sample measurement) with a known outcome; normal tissue or cells isolated from a subject, such as a normal patient or the cancer patient, cultured primary cells/tissues isolated from a subject such as a normal subject or the cancer patient, adjacent normal cells/tissues obtained from the same organ or body location of the cancer patient, a tissue or cell sample isolated from a normal subject, or a primary cells/tissues obtained from a depository. In another preferred embodiment, the control may comprise a reference standard expression product level from any suitable source, including but not limited to housekeeping genes, an expression product level range from normal tissue (or other previously analyzed control sample), a previously determined expression product level range within a test sample from a group of patients, or a set of patients with a certain outcome (for example, survival for one, two, three, four years, etc.) or receiving a certain treatment (for example, standard of care cancer therapy). It will be understood by those of skill in the art that such control samples and reference standard expression product levels can be used in combination as controls in the methods of the present invention. In one embodiment, the control may comprise normal or non-cancerous cell/tissue sample. In another preferred embodiment, the control may comprise an expression level for a set of patients, such as a set of cancer patients, or for a set of cancer patients receiving a certain treatment, or for a set of patients with one outcome versus another outcome. In the former case, the specific expression product level of each patient can be assigned to a percentile level of expression, or expressed as either higher or lower than the mean or average of the reference standard expression level. In another preferred embodiment, the control may comprise normal cells, cells from patients treated with combination chemotherapy, and cells from patients having benign cancer. In another embodiment, the control may also comprise a measured value for example, average level of expression of a particular gene in a population compared to the level of expression of a housekeeping gene in the same population. Such a population may comprise normal subjects, cancer patients who have not undergone any treatment (i.e., treatment naive), cancer patients undergoing standard of care therapy, or patients having benign cancer. In another preferred embodiment, the control comprises a ratio transformation of expression product levels, including but not limited to determining a ratio of expression product levels of two genes in the test sample and comparing it to any suitable ratio of the same two genes in a reference standard; determining expression product levels of the two or more genes in the test sample and determining a difference in expression product levels in any suitable control; and determining expression product levels of the two or more genes in the test sample, normalizing their expression to expression of housekeeping genes in the test sample, and comparing to any suitable control. In particularly preferred embodiments, the control comprises a control sample which is of the same lineage and/or type as the test sample. In another embodiment, the control may comprise expression product levels grouped as percentiles within or based on a set of patient samples, such as all patients with cancer. In one embodiment a control expression product level is established wherein higher or lower levels of expression product relative to, for instance, a particular percentile, are used as the basis for predicting outcome. In another preferred embodiment, a control expression product level is established using expression product levels from cancer control patients with a known outcome, and the expression product levels from the test sample are compared to the control expression product level as the basis for predicting outcome. As demonstrated by the data below, the methods of the invention are not limited to use of a specific cut-point in comparing the level of expression product in the test sample to the control.
As used herein, an“effective amount,”“therapeutically effective amount” or “effective dose” is an amount of a composition (e.g., a therapeutic composition or agent) that produces at least one desired therapeutic effect in a subject, such as preventing or treating a target condition or beneficially alleviating a symptom associated with the condition.
As used herein, the term“immune cells” generally includes white blood cells
(leukocytes) which are derived from hematopoietic stem cells (HSC) produced in the bone marrow“Immune cells” includes, e.g., lymphocytes (T cells, B cells, natural killer (NK) cells) and myeloid-derived cells (neutrophil, eosinophil, basophil, monocyte, macrophage, dendritic cells).
The term“immune response” includes T cell mediated and/or B cell mediated immune responses. Exemplary immune responses include T cell responses, e.g., cytokine production and cellular cytotoxicity. In addition, the term immune response includes immune responses that are indirectly effected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., macrophages.
As used herein, the term“in combination” in the context of the administration of a therapy to a subject refers to the use of more than one therapy for therapeutic benefit. The term“in combination” in the context of the administration can also refer to the prophylactic use of a therapy to a subject when used with at least one additional therapy. The use of the term“in combination” does not restrict the order in which the therapies (e.g., a first and second therapy) are administered to a subject. A therapy can be administered prior to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy to a subject which had, has, or is susceptible to cancer. The therapies are administered to a subject in a sequence and within a time interval such that the therapies can act together. In a particular embodiment, the therapies are administered to a subject in a sequence and within a time interval such that they provide an increased benefit than if they were administered otherwise. Any additional therapy can be administered in any order with the other additional therapy.
“Mammal” covers warm blooded mammals that are typically under medical care (e.g., humans and domesticated animals). Examples include feline, canine, equine, bovine, and human, as well as just human.
As used herein,“modulating” refers to an increase or decrease in an adaptive immune system response. In a preferred embodiment, this relates to an increased, up-regulated or enhanced adaptive immune system response. An effective amount of an immunomodulatory agent is an amount that when applied or administered in accordance to the techniques herein is sufficient to modulate, preferably up-regulate, an adaptive immune system response.
“Optional” or“optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
As used in this specification and the appended claims, the term“or” is generally employed in its sense including“and/or” unless the content clearly dictates otherwise.
The terms“patient,”“subject,” and“individual” may be used interchangeably and refer to either a human or a non-human animal. These terms include mammals such as humans, primates, livestock animals (e.g., bovines, porcines), companion animals (e.g., canines, felines) and rodents (e.g., mice and rats). “Pharmaceutical agent,” also referred to as a“drug,” or“therapeutic agent” is used herein to refer to an agent that is administered to a subject to treat a disease, disorder, or other clinically recognized condition that is harmful to the subject, or for prophylactic purposes, and has a clinically significant effect on the body to treat or prevent the disease, disorder, or condition. Therapeutic agents include, without limitation, agents listed in the United States Pharmacopeia (USP), Goodman and Gilman's The Pharmacological Basis of Therapeutics, 12th Ed., McGraw Hill, 2001; Katzung, B. (ed.) Basic and Clinical Pharmacology, McGraw- Hill/ Appleton & Lange; 8th edition (Sep. 21, 2000); Physician's Desk Reference (Thomson Publishing), and/or The Merck Manual of Diagnosis and Therapy, 18th ed. (2006), or the 19th ed (2011), Robert S. Porter, MD., Editor-in-chief and Justin L. Kaplan, MD., Senior Assistant Editor (eds.), Merck Publishing Group, or, in the case of animals, The Merck Veterinary Manual, 10th ed., Cynthia M. Kahn, B.A., M.A. (ed.), Merck Publishing Group, 2010.
As used herein, the terms“preventing” and grammatical variants thereof refer to an approach for preventing the development of, or altering the pathology of, a condition, disease or disorder. Accordingly,“prevention” may refer to prophylactic or preventive measures. For the purposes of this invention, beneficial or desired clinical results include, but are not limited to, prevention or slowing of symptoms, progression or development of a disease, whether detectable or undetectable. A subject (e.g., a human) in need of prevention may thus be a subject not yet afflicted with the disease or disorder in question. The term“prevention” includes slowing the onset of disease relative to the absence of treatment, and is not necessarily meant to imply permanent prevention of the relevant disease, disorder or condition. Thus“preventing” or“prevention” of a condition may in certain contexts refer to reducing the risk of developing the condition, or preventing or delaying the development of symptoms associated with the condition.
The terms“response” or“responsiveness” refers to an anti-cancer response, e.g. in the sense of reduction of tumor size or inhibiting tumor growth. The terms can also refer to an improved prognosis, for example, as reflected by an increased time to recurrence, which is the period to first recurrence censoring for second primary cancer as a first event or death without evidence of recurrence, or an increased overall survival, which is the period from treatment to death from any cause. To respond or to have a response means there is a beneficial endpoint attained when exposed to a stimulus. Alternatively, a negative or detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. It will be appreciated that evaluating the likelihood that a tumor or subject will exhibit a favorable response is equivalent to evaluating the likelihood that the tumor or subject will not exhibit favorable response (i.e., will exhibit a lack of response or be non-responsive).
An“RNA interfering agent” as used herein, is defined as any agent which interferes with or inhibits expression of a target gene by RNA interference (RNAi). Such RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target gene of the invention, or a fragment thereof, short interfering RNA (siRNA), and small molecules which interfere with or inhibit expression of a target nucleic acid by RNA interference (RNAi).“RNA interference (RNAi)” is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target nucleic acid results in the sequence specific degradation or specific post-transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene (see Cobum, G. and Cullen, B. (2002) J. of Virology 76(18):9225), thereby inhibiting expression of the target nucleic acid. In one embodiment, the RNA is double stranded RNA (dsRNA). This process has been described in plants, invertebrates, and mammalian cells. In nature, RNAi is initiated by the dsRNA- specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double- stranded fragments termed siRNAs. siRNAs are incorporated into a protein complex that recognizes and cleaves target mRNAs. RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target nucleic acids. As used herein,“inhibition of target nucleic acid expression” or“inhibition of marker gene expression” includes any decrease in expression or protein activity or level of the target nucleic acid or protein encoded by the target nucleic acid. The decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as compared to the expression of a target nucleic acid or the activity or level of the protein encoded by a target nucleic acid which has not been targeted by an RNA interfering agent.
The term“targeted therapy” refers to administration of agents that selectively interact with a chosen biomolecule to thereby treat cancer, e.g. immunotherapy targeting tumor antigens.
As used herein, the term“therapeutically effective regimen” refers to a regimen for dosing, timing, frequency, and duration of the administration of one or more therapies for the treatment and/or management of cancer or a symptom thereof. In a specific embodiment, the regimen achieves one, two, three, or more of the following results: (1) a stabilization, reduction or elimination in the cancer cell population; (2) a stabilization or reduction in the growth of a tumor or neoplasm; (3) an impairment in the formation of a tumor; (4) eradication, removal, or control of primary, regional and/or metastatic cancer; (5) a reduction in mortality; (6) an increase in disease-free, relapse-free, progression-free, and/or overall survival, duration, or rate; (7) an increase in the response rate, the durability of response, or number of patients who respond or are in remission; (8) a decrease in hospitalization rate, (9) a decrease in hospitalization lengths, (10) the size of the tumor is maintained and does not increase or increases by less than 10%, preferably less than 5%, preferably less than 4%, preferably less than 2%, and (11) an increase in the number of patients in remission.
As used herein,“treating” or“treatment” and grammatical variants thereof refer to an approach for obtaining beneficial or desired clinical results. The term may refer to slowing the onset or rate of development of a condition, disorder or disease, reducing or alleviating symptoms associated with it, generating a complete or partial regression of the condition, or some combination of any of the above. For the purposes of this invention, beneficial or desired clinical results include, but are not limited to, reduction or alleviation of symptoms, diminishment of extent of disease, stabilization (i.e., not worsening) of state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.“Treatment” can also mean prolonging survival relative to expected survival time if not receiving treatment. A subject (e.g., a human) in need of treatment may thus be a subject already afflicted with the disease or disorder in question. The term“treatment” includes inhibition or reduction of an increase in severity of a pathological state or symptoms relative to the absence of treatment, and is not necessarily meant to imply complete cessation of the relevant disease, disorder or condition.
The term“untargeted therapy” refers to administration of agents that do not selectively interact with a chosen biomolecule yet treat cancer. Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. Concentrations, amounts, cell counts, percentages and other numerical values may be presented herein in a range format. It is to be understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited.
Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
BRIEF DESCRIPTION OF THE DRAWINGS
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
FIGS. 1A-1H are a series of graphs and plots demonstrating Nrnl expression in anergic T cells and Treg. FIGS. 1A-1D: Nml expression in anergic CD4 cells. Nml mRNA measurement by qRT-PCR: FIG. 1A among 6.5 T cells recovered from C3HA host and wt host infected with VacHA virus (n>3 per group of mice) at various times after transfer; FIG. IB, among AE7 cells stimulated with plate bound anti-CD3 in the presence (activation) or absence (anergy) of anti-CD28 for the indicated times (O/N = overnight); FIG. 1C, Nml expression among sorted naive T cells (CD4+CD62LhlghCD44lowFoxp3 ), antigen experienced CD4+CD44+Foxp3 -FR4 CD73 T cells and CD4+CD44+Foxp3-FR4hiCD73hi cells. FIG. ID, Detection of Nml expression by anti-Nml antibody staining among CD4+CD44+Foxp3- FR4hiCD73hi cells from wt Nml+/+ and NrnT/_ splenocytes. FIGS. 1E-1H, Nml expression by Treg. FIG. IE, Nml expression measured by qRT-PCR and western blot among CD4+Foxp3+ natural (n)Treg, nTreg activated by treating nTreg with anti-CD3/CD28 in the presence of IL2 (lOOu/ml) for 48hr, induced Tregs (pTreg) generated by activating naive CD4 cells with anti-CD3/CD28 and TGF (5ng/ml) and naive CD4+ T cells. FIG. IF, Nml expression in CD4+CD44low/CD62Lhigh cTreg and CD4+CD44hlgh/CD62Llow eTreg and upon activation respectively. FIG. 1G, Nml message levels in Treg (CD3+CD4+CD8 CD127lowCD25+CD39+) and non-Treg (CD3+/CD4+CD8 CD127+CD25 ) isolated from the peripheral blood of healthy human donors (n=10). Buffy coats were obtained from collected blood by ficoll
centrifugation and from these Tregs and non-Treg CD4+ T cells were sorted by FACS Aria II. FIG. 1H, Expression of neuritin message by cTreg and eTreg isolated from the peripheral blood of healthy human donors. Data are presented as mean +/- SEM. Data are representative of 2-3 independent experiments.
FIGS. 2A-2K are a series of graphs demonstrating that Nrnl deficiency affects CD4 T cells anergy development and pTreg cell conversion in vivo. FIGS. 2A-2C, Susceptibility of Nml7- and Nml+/_ CD4 cells to suppression by Treg and anergy development. FIG. 2A is a schematic representation showing an experimental outline: 2xl06 Thyl.l+ Nml7- or Nml+/_ CD4 OTII T cells were co-transferred with 4-5xl05 Thyl.2+Thyl.l- wt Treg cells into TCRa /_ mice. Cells were recovered on day 13 post transfer. FIG. 2B, Proportions of CD4 cells; and FIG. 2C, OTII cell numbers recovered from recipient lymph node and spleen; FIG. 2D, IF2 secretion from OTII cells upon ex vivo stimulation with OVA peptide. FIG. 2E, Foxp3+ cell percentage among Thyl.l+ Nrnl7- or Nrnl+/ CD4 cells.FIGS.2F-2K, Comparison of Nml7- and Nrnl+/ CD45.2+ T cell response to self-antigen in the absence of Treg cells in CD45.1 wt host. FIG. 2F, Experimental outline: 6xl06 CD45.2+T cells from Nml7- or Nrnl+/ FDG mice was transferred into CD45.1 congenic wt FDG mice on day 0. Host mice were treated with DT at lpg/mouse i.p. for 3 days to delete all Treg cells both from wt host and from transferred Nml7- and Nml+/ T cells. Cells were analyzed on dayl l after transfer. FIG. 2G, Foxp3 percentage and FIG. 2H, CD4+CD44+FR4hlCD73hl cell proportion among adoptive transferred CD45.2+ Nrn l 7- or Nml+/ CD4 cells and wt host CD45.1+ CD4 cells. FIGS. 21, 2J AND 2K, Ki67, IFNy and Tbet staining among wt CD45.1+ CD4 cells from Nrnl7- or Nrnl+/_ hosts mice 11 days after DT treatment. Data are presented as mean +/- SEM. All data are representative of a minimum of 3 independent experiments (N>3mice per group).
FIGS 3A-3J are a series of plots, graphs and photographs of histological stains, demonstrating that loss of Nml affect Treg cell suppression function. FIG. 3 A, Acquisition of eTreg traits by in vitro stimulation of Nml+/_ and Nml7- nTregs. CD62FhlghCD44lowFoxp3+ cTregs sorted from Nml+/_ and Nml7- FDG mice were activated with anti-CD3/CD28 antibodies for 48hr. Representative flow plots of post-activation CD62F and CD44 staining are shown from 3 separate experiment. FIGS. 3B-3H, Examination of Nrnl7- Treg cell suppression function in vivo in a colitis model. FIG. 3B, Mean percentage weight changes (+/-SEM) over time of experimental mice. FIGS. 3C and 3D, Representative H/E stained colon tissue sections and the averaged pathology scores from recipient mice in FIG. 3B are shown. FIG. 3E, The frequencies of cytokine-producing lymphocytes infiltrating the mesenteric lymph node (mLN) and lamina propria (FP) were determined by intracellular cytokine staining (ICS) and FACS. FIG. 3 F, Representative absolute numbers of FP- infiltrating IENg and IL-17 producing leukocytes from the indicated recipient mice are shown. FIG. 3G, Representative flow cytometry analysis of injected Foxp3+/CD45.2+ Tregs frequency among CD4+ LP cells and FIG. 3H, the retention of Foxp3 expression by Tregs (CD45.2+) from Nml+/ (red) and Nrnl_/ mice (blue). The green line indicates an isotype control. FIG. 31 and 3J. The development and resolution of EAE symptoms in Nml_/ mice or in their Nrnl+/ littermates. FIG. 31, Ascending paralysis was scored daily and mean scores (+/-SEM) over time are shown. (n>5 per group) FIG. 3J, Proinflammatory cytokine and Foxp3 expression by the spinal cord-infiltrating CD4+ lymphocytes of Nrnl+/ and Nml_/ mice afflicted with EAE were determined by flow cytometry. Shown are representative findings from at least 3 independent experiments.
FIGS. 4A-4G are a series of graphs and heat maps demonstrating that Nml deficiency disrupts anergy and Treg cell signature gene expression patterns. FIGS. 4A-4E, Whole transcriptome (RNAseq) analysis of genes expressed by Nml_/ vs Nml+/ OTII cells recovered from the peptide induced anergy model outlined in FIG. 2A. FIG. 4A,
Differentially expressed genes (DEGs) in OTII Nrnl_/ vs Nml+/_ cells recovered from host mice subjected to anergy-inducing conditions are presented as a heatmap. FIG. 4B, Results of a Gene Set Enrichment Analysis (GSEA) comparing the gene expression signature previously reported for anergized Thl cells (GEO:GSE46243) to those of Nrnl+/_ and Nrnl_/ T cells in the aforementioned anergy-inducing model. FIG. 4C, GSEA depicting a Treg cell gene profile (GEO: GSE42021) by Nrn 1 +A and Nml7 T cells from FIG. 2A. FIG. 4D, (Left) Heatmap of DEGs enriched in Nrn+/ T cells under anergy-inducing conditions that overlap with Thl anergy gene signature. (Right) Examples of anergy specific gene expression (mean FPKM +/- SEM) are displayed in bar graphs. FIG. 4E, GSEA of NFAT dependent transcription gene set (PID_NFAT_TFPATHWAY) expressed by Nrnl+/ and Nrnl_/ T cells from FIG. 2A. FIGS. 4F, 4G, RNAseq analysis of the gene expression patterns of Tregs isolated from Nrnl_/ or Nml+/ mice. FIG. 4F, GSEA of Treg cell gene signature
(GEO:GSE42021) and FIG. 4G, an NFAT dependent transcription gene set
(PID_NFAT_TFPATHWAY) expression among Nrnl+/ and Nml_/ derived Tregs.
FIGS.5A-5J are a series of graphs and plots demonstrating that Nrnl deficiency affects adaptive anti-tumor response and tumor progression. FIGS. 5A, 5B, Comparison of tumor growth in NmT/_ and Nml+/+ mice. FIG. 5A, EL4 tumor growth; FIG. 5B, B16F10 tumor growth. Mean tumor volume (bolded line) and individual tumor growth were plotted over time (n=4-6 per group). FIGS. 5C-5F, Analysis of TILs in tumor from B 16F10- implanted in NrnL/_ or Nml+/+ mice. FIG. 5C, Frequencies of Foxp3+CD4+ T cells; FIG. 5D, FR4hiCD73hiCD4+ T cells; FIG. 5C, IFNy producing CD4+ cells and FIG. 5F, IFNy producing CD 8 cells among the B16F10 TILs from NrnL/_ or Nrnl+/+ mice were determined by flow cytometry. FIG. 5G, Expression of Nrnl mRNA by Foxp3-expressing Tregs and non-Treg CD4+ cells in s.c. B 16 melanoma. CD4+ T cells were recovered from the tumors and peripheral blood of FDG reporter mice bearing subcutaneous B16 melanomas. Nml expression was assessed by qRT-PCR analysis. FIG. 5H, Measurement of Nrnl expression in in vivo tumor antigen A20HA and VacHA activated 6.5+ T cells. FIGS. 51, 5J, Impact of Nml deficiency in Treg on tumor growth and anti-tumor immunity. Rag2 /_ mice were reconstituted with Treg-depleted CD45.1+ spleen and lymph node cells (2 xlO6) and Tregs from either NmL/_ or Nrnl+/_ mice (CD45.2VCD45.1-, 0.5 x 106). Rag2 /_ mice were subsequently challenged with s.c. B16F10 cells. FIG. 51, Tumor growth as measured in FIG. 5B. FIG. 5J the frequencies of transferred Tregs (CD45.L) and non-Tregs (CD45.1+) in tissues of tumor-bearing recipients were found by flow cytometry. Results from at least 2 trials are presented as mean +/- SEM.
FIGS. 6A-6I are a series of graphs and a scan of a photograph demonstrating that the combination of Nml, CTLA4 and PD1 blockade synergistically inhibits tumor growth. FIGS. 6A-6D, Effect of Nrnl blockade on the growth of multiple tumors. B16F10, MC38, CT26 or 4T1 average tumor growth curve in mice treated with anti-Nrnl Ab or an inert isotype control Ab (mIgG2b) on day 5-6 after tumor implantation. Mean tumor volume (+/- SEM) over time was plotted (n>8 per group, data represent the results of at least two experiments). FIGS. 6E- 6G, Flow cytometric analysis of TILs recovered from anti-Nrnl or isotype control treated B16F10 bearing mice 20 days after tumor inoculation. FIG. 6E, The CD8/CD4Foxp3+ ratio as well as the FIGS. 6F, 6G, frequencies of Tbet expressing and IFNy expressing among CD8 cells among the TILs of anti-Nrnl or control Ab treated mice. FIGS. 6H, 61, Impact of combining anti-Nrnl, anti-CTLA4 and anti-PDl antibody treatments on B16F10 tumor growth. Anti-Nrnl and anti-CTLA4 antibody treatments were initiated 5-6 days after tumor injection. Anti-PDl blockade was administered starting on day 8 after tumor injection. FIG. 6H, Mean tumor volumes (+/- SEM) over time and FIG. 6J, representative tumor sizes 18 days after tumor inoculation. Data representative of at least 3 separate experiments (n>7 per experimental group/trial).
FIG. 7A is a graph and a Western blot and FIG. 7B a plot demonstrating that Nrnl is expressed in Treg cells. FIG. 7A, Nml message and protein levels were measured across immune cell types isolated from Foxp3DTRgfp reporter mice by qRT-PCR and western blot. FIG. 7B, Flow cytometry analysis of surface Nml expression by CD4+Foxp3+CD25+ cells.
FIGS. 8A-8F are a series of graphs and blots demonstrating that Nrnl affects anergy development and pTreg cell conversion. FIGS. 8A, 8B, Induction of anergy in wt B6 host mice. 5xl06 congenically marked Nml_/ or Nml+/_ Thyl.l+ OTII cells were transferred into wt Thyl.2+ B6 mice and subjected to 3 treatment of OVAII peptide (100pg i.v) every three days. Thyl.l+ cells were recovered 13 days after cell transfer. FIG. 8 A, IL2 production by recovered OTII cells upon ex vivo restimulation with OVAII peptide measured by ELISA. FIG. 8B, the frequencies of Foxp3+ cells among recovered Thyl.l+OTII cells determined by flow cytometry. FIG. 8C, Schematic of CD2N Nrnl transgenic mouse design. A transgenic construct expressing Nml under the CD2 promoter was used for pronuclear injection and transgene positive mice were maintained on a C57BL/6 background (referred to as CD2N mice). Nml overexpression was confirmed by qRT-PCR measurement of Nml mRNA levels in Treg (CD4+/CD25+) cells from Nml+/+, Nml+/ , and Nml_/ mice. FIG. 8D. Detection of cell surface Nml expression among CD3+ T cells from CD2N and littermate wt Nml+/+ mice by flow cytometry. FIGS. 8E, 8F, Anergy development and pTreg conversion among CD2N T cells. 6xl06 total T cells from CD45.2+CD2N+ or wt littermate control mice on FDG background were transferred into CD45.1+ FDG hosts and administered DT lug/mouse as indicated in Fig. 2F. Mice were harvested on day 11 post cell transfer and the proportion of FIG. 8E, Foxp3+ and FIG. 8F, FR4hlCD73hl anergic T cells among both transferred cells (ADT) and endogenous (Host) T cells were examined by flow cytometry. FIGS 8A-8C, 8E, and 8F depict mean values +/- S EM .
FIGS. 9A-9F are a series of graphs, blots and histological stain demonstrating that transgenic Nrnl overexpression and monoclonal antibody-mediated blockade of Nml have divergent effects on Treg function in vivo. FIG. 9A, Colitis was induced in Rag2 /_ mice by i.p. injection of 4xl05 naive CD4+ T cells. Weight loss in recipient mice was monitored weekly. After the development of colitis symptoms (2-3 weeks later), 3-5xl05 wt Tregs, CD2N+ Tregs, or no Tregs were transferred to the colitis mice. Wt Treg recipients were either given isotype control antibodies (mIgG2b) or an anti-Nml monoclonal antibody upon Treg transfer (400pg/mouse) and every three days (200ug/mouse) thereafter for the experiment’s duration. FIG. 9F, Representative H&E staining of colon sections from the mice represented in FIG. 9A are shown. FIG. 9C, The absolute numbers of inflammatory cytokine producing leukocyte recovered from the lamina propria (LP) of the indicated recipient mice were found after intracellular cytokine staining. Shown are representative results of 3 experiments. FIG. 9D, Percentages of Foxp3-expressing cells in the original transferred Treg population (CD45.1+) recovered from the LP of recipient mice. Shown are the mean results (+/- SEM) of 3 independent experiments. FIGS. 9E, 9F, Nml functional blockade by antibody results in exacerbated EAE. Disease was induced in a cohort of age/sex matched wt C57BL/6 mice as in FIG. 31. FIG. 9E, Clinical scoring of EAE disease severity in mice given either an anti- Nmlantibody or an isotype control at the time of disease induction. FIG. 9F, Production of proinflammatory cytokines by CNS-infiltrating T cells recovered from mice treated with anti- Nml or isotype control Ab. Shown are the representative findings of at least 3 independent experiments.
FIGS. 10A-10D are a series of graphs and heatmaps demonstrating that Nrnl deficiency impacts gene expression by CD4 cells activated under anergy-inducing condition in vivo. Analysis of RNAseq data from Nrnl_/ or Nml+/ OTII cells recovered from an i.v. peptide driven model of anergy (outlined in FIG. 2A). FIG. 10A, molecular function GO term analysis was carried out using the Molecular Signature Database (MSigDB) based on the DEGs that were enriched in Nml+/ T cells relative to Nrnl_/ T cells recovered from the anergy model. The top 5 terms are shown. FIG. 10B, Top 5 terms identified by GO term analysis with KEGG pathway using DEGs enriched in Nrnl+/_ T cells. FIG. IOC, GSEA of DEGs from Nml+/_ and NrnT/_ cells recovered from anergy condition (FIG. 2A) to a previously reported anergic CD4+ T cell gene set (GSE5960) and a AE7 gene set. FIG. 10D, Representative expression of cation transport and Ca2+ binding related genes by T cells recovered from in vivo anergy-inducing condition (mean FPKM +/- SEM).
FIGS. 11A-11C are a series of graphs and a scan of a photograph demonstrating the effect of genetic modulation of Nml expression on B16F10 tumor progression. FIG. 11A, B16F10 mean tumor volumes per group (+/-SEM) in NmT/_, Nml+/_ and Nml+/+ host mice. FIGS. 11B, llC, B16F10 mean tumor volumes per group (+/- SEM) and representative tumor sizes at 20 days after tumor injection in CD2N mice, wt CD2N littermate controls and NrnT/_ mice. (n>4 per group; data represent of at least 2 trials).
FIGS. 12A-12D are a series of graphs demonstrating the impact of Nml blockade on tumor progression in multiple murine cancer models. FIGS. 4A-4D, The indicated tumor cell lines were implanted s.c. into age-/sex-matched wt C57BL/6 mice. 5 days post implantation. Mice were treated with anti- Nml or an isotype control. Changes in the tumor volumes of individual mice in treatment and control cohorts are shown for FIG. 12A, B16F10; FIG. 12B, MC38; FIG. 12C, CT26 and FIG. 12D, 4T1 tumors. (N>7 mice/group/trial). Data shown are representative at least two independent experiments).
FIGS. 13A-13C are a series of graphs showing results obtained from the treatment of B16F10 tumor-bearing mice with combinedNml blockade and checkpoint inhibition therapy. B16F10 tumor growth under treatment with anti-Nml, anti-CTLA4 and anti-PDl alone or in combination 5 days after tumor inoculation. FIG. 13A, Anti-Nrnl combination therapy with anti-CTLA4. The following experimental groups are included for assessing the efficacy of anti-Nrnl and anti-CTLA4 combination therapy: isotype control (mIgG2b), anti-Nrnl, anti- CTLA4, anti-PDl, anti-Nrnl with anti-CTLA4, and anti-CTLA4 with anti-PDl. Isotype control and anti-Nml were administered 3 times/week i.p.. Anti-CTLA4 and anti-PDl were injected i.p. twice per week. FIG. 13B, Anti-Nml combination therapy with anti-PDl. Anti- PDl was administered 3 days after the initiation of Nml blockade. FIG. 13C, Individual tumor growth curve for tumor bearing mice subjected to triple combination therapy with anti- Nml, anti-CTLA4 mAh and anti-PDl blockade. Anti-Nml and anti-CTLA4 were administered on day5 post tumor establishment, anti-PDl was administered 3 days after the initiation of anti-Nrnl and anti-CTLA4 treatment. Mean tumor volume (bolded line) and individual tumor volume were plotted over time. Data represents 2-3 independent experiments (n>7 per group/trial).
FIG. 14 shows representative flow cytometry gating strategy for analyzing anergic CD4+CD44+FR4hlCD73hl cells, anergic cells, cTreg and eTreg cells.
DETAILED DESCRIPTION
Cancer immunotherapy strategies rely on activating (or reactivating) T cell populations specific for either tumor specific, mutation associated neoantigens; viral antigens (for vims-associated cancers); de -repressed endogenous retroviral antigens; and tumor- associated self-antigens. It has been shown that tumor antigen specific CD4 T cells can become anergized and convert to Treg rapidly after tumor emergence 5. These cells and pre existing Treg cells can accumulate in the tumor microenvironment and are capable of preventing effector T cell infiltration and obstmcting cytotoxic activity at the tumor site5 6. Understanding the precise mechanisms and molecules involved in inducing and maintaining the immune-tolerant state has already and will continue to underpin the success of immunotherapy for autoimmune disease and cancer. Accordingly, embodiments of the invention are directed to compositions which target molecules involved in inducing and maintaining the immune-tolerant state thereby abrogating the suppression of the immune response to a particular tumor.
T cell anergy and T regulatory (Treg) cells
T cell anergy and Treg cell mediated suppression are two complementary peripheral tolerance mechanisms. T cell anergy is historically defined as a state of functional inactivation wherein T cells lose the capacity to respond and produce cytokine upon re encountering cognate antigen7. T cell anergy can be induced in vitro by providing TCR signal in the absence of costimulation 1. In vivo, anergy is observed in CD4+ T cells after systemic, repeated exposure to a soluble antigen (Ag) or superantigen in the absence of infection or adjuvant 8. Adoptive transfer of naive self-Ag-specific CD4+ T cells to mice bearing relevant self-peptide-MHC complexes leads to the development of functional unresponsiveness 9 10· T cell anergy can also develop among conventional T cells subjected to Treg cell mediated suppression 11-14 Treg play a dominant role in peripheral tolerance by suppressing
autoreactive T cell responses against self-antigen and modulating immune activation throughout the life span of normal animals. Most Treg differentiate in the thymus and are referred to as thymic Treg or natural Treg (tTreg or nTreg, respectively), whereas others originate in the periphery from conventional Foxp3(-) CD4+ T cells and are referred to as peripherally induced Treg (pTreg, or iTreg if generated in vitro). Both nTreg and pTreg subsets are marked by the canonical Treg transcription factor Foxp3 and are required for optimal immune homeostasis2 15 16.
Anergic T cells and Treg are functionally related. Although anergic T cells are generally non-proliferative, they are not functionally inert. These cells may function as suppressor cells and anergy development in vivo is often associated with the emergence of pTreg 17-2a Further linking these cell types are observations that deletion of pTreg within the anergic T cell pool largely abrogates its suppressive function 18 19· Thus, anergic T cells may contribute to the establishment of peripheral tolerance partly through induction of or differentiation into pTreg3. On the other hand, target cells suppressed by Treg exhibit anergic cell characteristics, including defective cytokine production. Deletion of molecules affecting T cell anergy development in Foxp3- T cells, such as the Casitas B-cell lymphoma family protein (Cbl-b) also results in resistance to Treg cell mediated suppression21-23. The invention is based in part on the discovery that neuritin (Nml), a conserved GPI- anchored surface molecule important for neurite outgrowth and synapse maturation in neurons, is highly expressed in anergic T cells and T regulatory cells (Treg), in the periphery and the tumor microenvironment. In the examples section, which follows, it is demonstrated Nml deficient CD4 cells exhibit resistance to Treg cell mediated suppression, defective anergy induction, and reduced conversion to peripheral Tregs. Deletion of Nml in Foxp3+ Treg resulted in reduced control of inflammatory colitis and reduced suppression of adaptive anti cancer immune responses. The results indicate that Nml is important in anergy development and Treg mediated suppressive function. Accordingly, growth of multiple tumors was significantly inhibited in Nml deficient mice. Treatment with antibodies to Nml alone and in combination with anti-CTLA4 and anti-PDl significantly inhibited growth of established B16F10 melanoma, a poorly immunogenic tumor.
Accordingly, in certain embodiments, a method of treating cancer comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and T regulatory cell functions.
In certain embodiments, a method of inducing a tumor specific immune response in a subject, comprises administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and T regulatory cell functions.
In certain embodiments, a method of abrogating T cell anergy, comprises
administering to a subject in need thereof, a pharmaceutical composition comprising a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
In certain embodiments, a method of modulating T regulatory (Treg) cell function, comprises administering to a subject in need thereof, a pharmaceutical composition comprising a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
Checkpoint Inhibitors. In certain embodiments, a method of treating cancer, administering one or more checkpoint inhibitors. In certain embodiments, the one or more checkpoint inhibitors comprises an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG- 3, CEACAM-1, CEAC AM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof. In certain embodiments, the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof. In other embodiments, the at least one or more checkpoint inhibitors are administered to the patient prior to, during and/or after administration of the neuritin inhibitors. Examples of checkpoint inhibitors include without limitation, an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3,
CEACAM-1, CEAC AM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4 or TGFR-b.
The duration and/or dose of treatment with checkpoint inhibitor therapies may vary according to the particular anti-immune checkpoint inhibitor agent or combination thereof (e.g., anti-ARGl agents like small molecule inhibitors in combination with inhibitors of PD- 1, PD-L1, PD-L2, CTLA4, and the like). An appropriate treatment time for a particular cancer therapeutic agent will be appreciated by the skilled artisan. For example, dosage concentrations and dosing regimens are configured based upon one or more cancer related factors such as tumor size, tumor volume, cancer stage of a cancer patient or group of cancer patients (such as pre or post metastatic cancer). The invention contemplates the continued assessment of optimal treatment schedules for each cancer therapeutic agent, where the phenotype of the cancer of the subject as determined by the methods of the invention is a factor in determining optimal treatment doses and schedules.
The Programmed Death 1 (PD-1) protein is an inhibitory member of the extended CD28/CTLA-4 family of T cell regulators (Okazaki et al. (2002) Curr Opin Immunol 14: 391779-82; Bennett et al. (2003) J. Immunol. 170:711-8). Other members of the CD28 family include CD28, CTLA-4, ICOS and BTLA. Two cell surface glycoprotein ligands for PD-1 have been identified, Program Death Ligand 1 (PD-L1) and Program Death Ligand 2 (PD- L2). PD-L1 and PD-L2 have been shown to downregulate T cell activation and cytokine secretion upon binding to PD-1 (Freeman et al. (2000) J Exp Med 192:1027-34; Latchman et al. (2001) Nat Immunol 2:261-8; Carter et al. (2002) Eur J Immunol 32:634-43; Ohigashi et al. (2005) Clin Cancer Res 11:2947-53).
PD-L1 (also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7- Hl)) is a 40 kDa type 1 transmembrane protein. PD-L1 binds to its receptor, PD-1, found on activated T cells, B cells, and myeloid cells, to modulate activation or inhibition. Both PD-L1 and PD-L2 are B7 homologs that bind to PD-1, but do not bind to CD28 or CTLA-4 (Blank et al. (2005) Cancer Immunol Immunother. 54:307-14). Binding of PD-L1 with its receptor PD- 1 on T cells delivers a signal that inhibits TCR-mediated activation of IL-2 production and T cell proliferation. The mechanism involves inhibition of ZAP70 phosphorylation and its association with CD3z (Sheppard et al. (2004) FEBS Lett. 574:37-41). PD-1 signaling attenuates PKC-0 activation loop phosphorylation resulting from TCR signaling, necessary for the activation of transcription factors NF-KB and AP-1, and for production of IL-2. PD-L1 also binds to the costimulatory molecule CD80 (B7-1), but not CD86 (B7-2) (Butte et al. (2008) Mol Immunol. 45:3567-72).
Expression of PD-L1 on the cell surface has been shown to be upregulated through IFN-g stimulation. PD-L1 expression has been found in many cancers, including human lung, ovarian and colon carcinoma and various myelomas, and is often associated with poor prognosis (Iwai et al. (2002) PNAS 99:12293-7; Ohigashi et al. (2005) Clin Cancer Res 11:2947-53; Okazaki et al. (2007) Intern. Immun. 19:813-24; Thompson et al. (2006) Cancer Res. 66:3381-5). PD-L1 has been suggested to play a role in tumor immunity by increasing apoptosis of antigen-specific T-cell clones (Dong et al. (2002) Nat Med 8:793-800). It has also been suggested that PD-L1 might be involved in intestinal mucosal inflammation and inhibition of PD-L1 suppresses wasting disease associated with colitis (Kanai et al. (2003) J Immunol 171:4156-63).
Studies with checkpoint inhibitor antibodies for cancer therapy have generated unprecedented response rates in cancers previously thought to be resistant to cancer treatment (see, e.g., Ott & Bhardwaj, 2013, Frontiers in Immunology 4:346; Menzies & Long, 2013, Ther Adv Med Oncol 5:278-85; Pardoll, 2012, Nature Reviews 12:252-264). Therapy with antagonistic checkpoint blocking antibodies against CTLA-4, PD-1 and PD-L1 are one of the most promising new avenues of immunotherapy for cancer and other diseases. In contrast to the majority of anti-cancer agents, checkpoint inhibitor do not target tumor cells directly, but rather target lymphocyte receptors or their ligands in order to enhance the endogenous antitumor activity of the immune system. (Pardoll, 2012, Nature Reviews 12:252-264) Because such antibodies act primarily by regulating the immune response to diseased cells, tissues or pathogens, they may be used in combination with other therapeutic modalities, such as antibody-drug conjugates (ADCs), to enhance the anti-tumor effect of the ADCs.
Programmed cell death protein 1 (PD-1, also known as CD279) encodes a cell surface membrane protein of the immunoglobulin superfamily, which is expressed in B cells and NK cells (Shinohara et al., 1995, Genomics 23:704-6; Blank et al., 2007, Cancer Immunol Immunother 56:739-45; Finger et al., 1997, Gene 197:177-87; Pardoll, 2012, Nature Reviews 12:252-264). Anti-PDl antibodies have been used for treatment of melanoma, non- small-cell lung cancer, bladder cancer, prostate cancer, colorectal cancer, head and neck cancer, triple negative breast cancer, leukemia, lymphoma and renal cell cancer (Topalian et al., 2012, N Engl J Med 366:2443-54; Lipson et al., 2013, Clin Cancer Res 19:462-8; Berger et al., 2008, Clin Cancer Res 14:3044-51; Gildener-Leapman el al., 2013, Oral Oncol 49:1089-96;
Menzies & Long, 2013, TherAdv Med Oncol 5:278-85).
Exemplary anti-PDl antibodies include pembrolizumab (MK-3475, Merck), nivolumab (BMS-936558, Bristol-Myers Squibb), and pidilizumab (CT-011, Curetech LTD.). Anti-PDl antibodies are commercially available, for example from ABCAM™
(AB 137132), BIOLEGEND™ (EH12.2H7, RMP1-14) and Affymetrix Ebioscience (J105, J116, MIH4).
Programmed cell death 1 ligand 1 (PD-L1, also known as CD274) is a ligand for PD- 1, found on activated T cells, B cells, myeloid cells and macrophages. The complex of PD-1 and PD-L1 inhibits proliferation of CD8+ T cells and reduces the immune response (Topalian et al., 2012, N Engl J Med 366:2443-54; Brahmer et al., 2012, N Eng J Med 366:2455-65). Anti-PDLl antibodies have been used for treatment of non-small cell lung cancer, melanoma, colorectal cancer, renal-cell cancer, pancreatic cancer, gastric cancer, ovarian cancer, breast cancer, and hematologic malignancies (Brahmer et al., 2012, N Eng J Med 366:2455-65; Ott et al., 2013, Clin Cancer Res 19:5300-9; Radvanyi et al., 2013, Clin Cancer Res 19:5541; Menzies & Long, 2013, TherAdv Med Oncol 5:278-85; Berger et al., 2008, Clin Cancer Res 14:13044-51).
Exemplary anti-PDLl antibodies include MDX-1105 (MEDAREX), durvalumab (MEDI4736, MEDIMMUNE) atezolizumab (TECENTRIQ™, MPDL3280A,
GENENTECH) and BMS-936559 (BRISTOL-MYERS SQUIBB). Anti-PDLl antibodies are also commercially available, for example from AFFYMETRIX EBIOSCIENCE (MIH1).
CTLA-4 (CD 152) is a B7/CD28 family member that inhibits T cell functions. It is constitutively expressed by Tregs but can also be upregulated by other T cell subsets, especially CD4+ T cells, upon activation (Chan DV, et al. Genes Immun. 2014 Jan; 15(1):25- 32). Exhausted T cells are also often characterized by the expression of CTLA-4 among other inhibitory receptors. CTLA-4 is mostly located in intracellular vesicles and is only transiently expressed upon activation in the immunological synapse before being rapidly endocytosed (Leung HT, et al. J Biol Chem. 1995 Oct 20; 270(42):25107-14).
CTLA-4 mediates immunosuppression by indirectly diminishing signaling through the co-stimulatory receptor CD28. Although both receptors bind CD80 and CD86, CTLA-4 does so with much higher affinity, effectively outcompeting CD28 (Rudd CE, Taylor A, Schneider H Immunol Rev. 2009 May; 229(1): 12-26). CTLA-4 may also remove CD80 and CD86 (including their cytoplasmic domains) from the cell surfaces of antigen-presenting cells via trans-endocytosis (Qureshi OS, et al. Science. 2011 Apr 29; 332(6029):600-3), therefore reducing the availability of these stimulatory receptors to other CD28-expressing T cells. Indeed, this process is one mechanism by which Tregs mediate immune suppression on bystander cells (Wing K, et al. Science. 2008 Oct 10; 322(5899):271-5).
By limiting CD28-mediated signaling during antigen presentation, CTLA-4 increases the activation threshold of T cells, reducing immune responses to weak antigens such as self- and tumor antigens. The central role that CTLA-4 plays in immunological tolerance is exemplified by experiments in mice that lack the CTLA-4 gene globally or specifically in the Forkhead box P3 (FoxP3)+ Treg compartment. These animals develop lymphoproliferative disorders and die at a young age (Wing K, et al. Science. 2008 Oct 10; 322(5899):271-5). Similarly, polymorphisms within the CTLA-4 gene are associated with autoimmune diseases in humans (Gough SC, et al. Immunol Rev. 2005 Apr; 204(): 102-15). CTLA-4 signaling has been shown to dampen immune responses against infections and tumor cells (Nakamoto N, et al. PLoS Pathog. 2009 Feb; Curran MA, et al. Proc Natl Acad Sci U S A. 2010 Mar 2;
107(9):4275-80).
An exemplary anti-CTLA-4 antibody is IPILIMUMAB (trade name Yervoy). In certain embodiments, a checkpoint inhibitor is an RNA interfering agent
T Regulatory Cell Mediated Suppression: Tregs also employ a diverse repertoire of suppressive mechanisms, including secretion of suppressive cytokines, cytotoxicity, metabolic disruption, and modulation of antigen-presenting cell (APC) function (Sakaguchi S, Wing K, Miyara M. Regulatory T cells - a brief history and perspective. Eur J Immunol. 2007 Nov; 37 Suppl 1:S116-23).
Numerous cytokines associated with autoimmune disease have been found to induce T cell resistance to Treg suppression in mouse models and human disease: IL-6 (Trinschek B, et al. Kinetics of IL-6 production defines T effector cell responsiveness to regulatory T cells in multiple sclerosis. PLoS One (2013) 8:e77634; Schneider A, et al. In active relapsing- remitting multiple sclerosis, effector T cell resistance to adaptive T(regs) involves IL-6- mediated signaling. Sci Transl Med (2013) 5:170), TNFa (Wehrens EJ, et al. Anti-tumor necrosis factor a targets protein kinase B/c- Akt-induced resistance of effector cells to suppression in juvenile idiopathic arthritis. Arthritis Rheum (2013) 65:3279—84), IL-15 (Proinflammatory mediator-induced reversal of CD4+,CD25+ regulatory T cell-mediated suppression in rheumatoid arthritis van Amelsfort JM, el al. Arthritis Rheum. 2007 Mar; 56(3):732-42), IL-21 (IL-21 counteracts the regulatory T cell-mediated suppression of human CD4+ T lymphocytes. Peluso I, el al. J Immunol. 2007 Jan 15; 178(2):732-9), IL-Ib
(Schenten D, et al. Immunity. 2014 Jan 16; 40(l):78-90), and IL-4 (Pace L, et al. J Immunol. 2006 Apr 1; 176(7):3900-4). Beyond pro-inflammatory cytokines, IL-2 has also long been known to overrule Treg suppression in vitro (Takahashi T, et al., Int Immunol. 1998 Dec; 10(12): 1969-80).
In certain embodiments, a method of treating cancer or abrogating anergic T cell and/or Treg-mediated suppression comprises administration of cytokines to a subject in need thereof. In certain embodiments, the cytokines comprise: interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IL-15), interleukin-21 (IL- 21), tumor necrosis factor alpha (TNFa) or combinations thereof.
Signaling through TNF receptors 4- IBB, 0X40, GITR, and TNFR2 can induce T cell resistance to Treg suppression, as they provide costimulatory signals similar to CD28 ligation. 4- IBB, 0X40, and TNFR2 signaling induce PI3K/Akt activation via TRAF adaptor proteins. Toll-like receptors 1, 2, 4, 8, and 9, as well as IL-1R, also a member of the TLR family, have been shown to induce Treg resistance. Of these, only signaling through TLR2 and TLR9 has been shown to activate the PI3K/Akt pathway via recruitment of adaptor protein MyD88, which in turn recruits and activates PI3K via its Toll/interleukin- 1 receptor domain. Intracellular signaling molecules Cbl-b and SHP-1 act as negative regulators downstream of TCR signaling, and genetic deficiency in either induces Treg resistance. Cbl-b enforces the requirement for CD28 costimulatory signaling by inhibiting the recruitment of PI3K to CD28. TRAF6 also negatively regulates activation of PI3K downstream of CD28 costimulation by an as yet undefined mechanism (Mercadante, E. R., & Lorenz, U. M.
(2016). Breaking Free of Control: How Conventional T Cells Overcome Regulatory T Cell Suppression. Frontiers in immunology, 7, 193. doi:10.3389/fimmu.2016.00193).
Accordingly, in certain embodiments, the method further comprises administration of: anti-CD25 antibodies, inhibitors of molecules associated with T cell anergy development, Toll-like receptor 2 (TLR2) agonists, 4-1BB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, cytokines or combinations thereof.
In some cases, the method further comprises administering an agonist of a co stimulatory receptor. Exemplary agonists include an anti-glucocorticoid-induced tumor necrosis factor receptor (TNFR)-related protein (GITR) antibody, a Toll-like receptor 2 (TLR2) agonists, antibodies to molecules associated with T cell anergy development, an anti- CD27 antibody, an anti-4-lBB antibody, an anti-OX40 antibody, an anti-inducible T-cell co stimulator (ICOS) antibody, and an anti-CD40 antibody, an anti-Toll-like receptor 2 (TLR2) antibody, or any combination thereof.
Toll-like Receptors. Toll-like receptors are an essential line of defense against microbial and viral pathogens. Various pathogen-derived ligands signal through TLRs, which recruit adaptor molecules such as MyD88 to trigger the production of pro-inflammatory mediators (Cohen P. J Cell ScL 2014 Jun 1 : 127(Pt 11)i2383-9Q). The goal of TLR signaling is to sense a pathogenic threat and mount innate and adaptive immune responses. TLR ligands can influence conventional T (Tcon) cells i.e. T lymphocytes that express an ab T cell receptor (TCR), as well as a co-receptor CD4 or CD8, responses via direct receptor activation or indirectly, by inducing antigen presenting cells (APCs) to produce cytokines that affect T cells (Sutmuller RP, el al. Trends Immunol. 2006 Aug; 27(8):387-93). For example, stimulation of mouse dendritic cells (DCs) with LPS or CpG (TLR4 and 9 agonists, respectively) induced their production of IL-6, contributing to Tcon cell resistance to Treg suppression (Pasare C, Medzhitov R. Science. 2003 Feb 14; 299(5609): 1033-6). While TLR signaling directly affects Tregs there is also evidence that TLR signaling can directly induce Tcon cell resistance to suppression (Sutmuller RP, et al., Trends Immunol. 2006 Aug;
27(8):387-93; Jin B, et al., Clin Dev Immunol. 2012, 2012:836485). In general, TLR engagement acts as a costimulatory signal to T cells and subsequently activates the PI3K/Akt pathway, consistent with a role in inducing Tcon cells to resist Treg suppression (Rahman AH, Taylor DK, Turka LA. Immunol Res. 2009; 45(l):25-36).
TNF Receptors. Engagement of certain tumor necrosis factor receptors (TNFRs) on T cells provides costimulatory signals that lead to activation, proliferation, differentiation, and survival (Watts THT. NF/TNFR family members in costimulation of T cell responses. Annu Rev Immunol. 2005; 23:23-68.). In particular, the four TRAF-binding TNFRs have been found to render Tcon cells resistant to Treg suppression (Mercadante, E. R., et al. (2016). Frontiers in immunology, 7, 193). Evidence supports a role, in particular for TRAF2, in activating PI3K/Akt downstream of TNFRs (So T, et al. Front Immunol (2013)
4:139.10.3389/fimmu.2013.00139), thereby possibly allowing Tcon resistance to Treg suppression. While TNFRs do not contain PI3K-binding motifs, they utilize TRAF adaptor proteins to activate the PI3K pathway. These TNFRs are constitutively expressed on Tregs and become upregulated on activated Tcon cells. The ligands for these TNFRs are generally expressed on APCs, but can also be induced on other cell types during infection (Stephens GL, et al. J Immunol (2004) 173:5008-20). TNFRs, like TLRs, play an important role during an infectious threat by allowing Tcon cells to become efficiently activated in order to mount a response, unrestrained by Tregs. It has therefore been proposed that TNFR ligand expression becomes upregulated during inflammatory conditions and provides costimulatory signals to both Tregs and Tcon cells, with Tcon cells becoming activated, producing IL-2, and resisting Treg suppression. As TNFR ligand levels wane and Tcon cells are no longer able to resist suppression, Tregs can assume control of the immune response (Stephens GL, et al. J Immunol (2004) 173:5008-20.10.4049/jimmunol.l73.8.5008).
GITR. GITR signaling in murine Tcon cells enhanced their proliferation and allowthem to resist Treg-mediated suppression.
4- IBB. Signaling through 4- IBB in murine Tcon cells has been shown to induce proliferation and enhance survival, especially in CD8+ T cells (Wang C, et al. Immunol Rev (2009) 229:192-21). Treatment with agonistic 4- IBB antibodies has beneficial effects on CD8+ T cell-mediated viral clearance and antitumor immunity. In vitro studies of 4- IBB signaling have shown a clear role for its CD28-independent costimulation of Tcon cells as well as its ability to induce resistance to Treg-mediated suppression (Choi BK, et al. J Leukoc Biol (2004) 75:785-91; Elpek KG, et al. J Immunol (2007) 179:7295-304; Robertson SJ, et al. J Immunol (2008) 180:5267-74). Likewise, in vivo treatment of mice with anti-4-lBB induced CD8+ T cells to become resistant to Treg-mediated suppression in a chronic viral infection model. 4- IBB regulation of Treg suppressive function remains controversial, but 4- 1BBL is capable of ex vivo expanding Tregs for therapeutic use. Therefore, 4-1BB signaling can induce proliferation of both Tregs and Tcon cells, but directly induces Tcon cells to resist Treg-mediated suppression.
0X40. 0X40 signaling provides costimulation for Tcon cells, promoting their survival and development into memory cells (Ishii N, et al. Adv Immunol (2010) 105:63-98). Several studies are in agreement that 0X40 signaling in murine Tcon cells induces resistance to Treg- mediated suppression (Takeda I, et al. J Immunol (2004) 172:3580-9; Piconese S, et al. J Exp Med (2008) 205:825-39; Voo KS, et al. J Immunol (2013) 191:3641-50),
possibly via PI3K/Akt activation (So T, et al. J Immunol (2011) 186:3547-55; Kshirsagar S,
B et al. Arthritis Rheum (2013) 65(ll):2996-3006). TNFR2. Originally characterized by its expression on activated/memory Treg cells, TNFR2 marks potently suppressive Tregs present in peripheral lymphoid tissues as well as in tumors, but can also be induced upon T cell receptor (TCR) activation on Tcon cells (Chen X, et al. J Immunol (2008) 180:6467-71).
In certain embodiments, the method further comprises administering antagonists or inhibitors of molecules associated with T cell anergy development. In certain embodiments, molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
Cbl-b. Cbl-b is an E3 ubiquitin ligase that catalyzes the ubiquitylation of target proteins, which can result in their degradation by the proteasome, translocation inside the cell, or alteration in function (Paolino M, Penninger JM. Semin Immunopathol. 2010 Jun; 32(2): 137-48). In T cells, Cbl-b sets the threshold for weak antigen stimulation (Chiang YJ, et al. Nature. 2000 Jan 13; 403(6766):216-20) and enforces the need for costimulation, or “signal 2,” by regulating CD28 signaling (Li D, et al. J Immunol. 2004 Dec 15;
173(12):7135-9). Cbl-b negatively regulates the recruitment of the p85 subunit of PI3K to CD28, thereby enforcing T cell anergy and tolerance when signal 2 is lacking (Fang D, Liu YC. Nat Immunol. 2001 Sep; 2(9):870-5). Upon CD28 signaling, Cbl-b itself becomes ubiquitylated and degraded, allowing PI3K recruitment and other downstream signaling required for full T cell activation (Gruber T, et al. Sci Signal. 2009 Jun 23; 2(76):ra30).
Consistent with its negative regulatory functions, Cbl-b knockout (KO) mice develop systemic autoimmunity due to hyper-proliferation and increased activation of lymphocytes, with T cells that can be activated in the absence of CD28 costimulation (Bachmaier K, et al. Nature. 2000 Jan 13; 403(6766):211-6).
TRAF6. TRAF6 belongs to the E3 ubiquitin ligase family and transduces signals downstream of members of the TNFR superfamily, including IL-lR/TLRs (Wu H, Arron JR. Bioessays. 2003 Nov; 25(11): 1096- 105), thereby activating NFKB, NFAT, MAP kinases, and Akt signaling pathways (Yang WL, et al. Science. 2009 Aug 28; 325(5944): 1134-8). A 2006 study demonstrated that TRAF6 KO mice developed multi-organ inflammatory disease characterized by hyper-activated T cells (King CG, et al. Nat Med. 2006 Sep; 12(9): 1088- 92). Using mice in which TRAF6 was specifically deleted in T cells, the group showed that while TRAF6 KO Tregs were normal, the Tcon cells resisted Treg suppression both in vitro and in vivo. Re-expression of TRAF6 via retroviral transduction restored susceptibility of Tcon cells to Treg-mediated suppression (King CG, et al. Nat Med. 2006 Sep; 12(9): 1088- 92). Like Cbl-b KO T cells, TRAF6 KO T cells could also be activated independently of CD28 costimulation, and showed enhanced Akt activation upon TCR signaling. Importantly, sensitivity to Tregs could by restored by overexpression of PTEN, an inhibitor of PI3K/Akt.
SHP-1. SHP-1, a protein tyrosine phosphatase, negatively regulates TCR signaling by dephosphorylating signaling mediators such as Zap70, Vav, Lck, and SLP76 (Lorenz U. Immunol Rev. 2009 Mar; 228(l):342-59). SHP-1 KO mice develop inflammation in skin and lungs due to myeloid hyper-proliferation (Abram CL, et al. Immunity. 2013 Mar 21;
38(3):489-501). These mice also accumulate memory T cells, and T cells are hyper- responsive to TCR stimulation. SHP-1 KO Tregs have an increased suppressive capacity (Iype T, et al. J Immunol. 2010 Nov 15; 185(10):6115-27). Tcon cells deficient in SHP-1 via genetic deletion or pharmacological inhibition can resist Treg suppression in vitro
(Mercadante E, Lorenz UM. SHP- 1 regulates conventional T cell resistance to suppression by regulatory T cells. AAAS Annu. Meet. 2016 Washington, DC (2016)). SHP-1 also negatively regulates activation of STAT3 in response to IL-6 signaling, with SHP-1 -deficient cells being hyper- sensitive to IL-6 (Mauldin IS, Tung KS, Lorenz UM. Blood. 2012 May 10;
119(19):4419-29).
Preferably, the methods of treatment inhibit the growth or progression of cancer, e.g., a tumor or a viral-induced tumor, in a subject. Lor example, the methods described herein inhibit the growth of a tumor by at least 1%, e.g., by at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100%. In other cases, the methods described herein reduce the size of a tumor by at least 1 mm in diameter, e.g., by at least 2 mm in diameter, by at least 3 mm in diameter, by at least 4 mm in diameter, by at least 5 mm in diameter, by at least 6 mm in diameter, by at least 7 mm in diameter, by at least 8 mm in diameter, by at least 9 mm in diameter, by at least 10 mm in diameter, by at least 11 mm in diameter, by at least 12 mm in diameter, by a least 13 mm in diameter, by at least 14 mm in diameter, by at least 15 mm in diameter, by at least 20 mm in diameter, by at least 25 mm in diameter, by at least 30 mm in diameter, by at least 40 mm in diameter, by at least 50 mm in diameter or more. In some cases, the subject has had the bulk of the tumor resected.
Combination Therapies : In certain embodiments, methods of treating cancer can include one or more cancer therapies as part of the treatment regimen. The compositions of the invention embodied herein, can be administered with one or more alternative treatment regimens, such as targeted and/or untargeted anti-cancer therapies can be administered. Combination therapies are also contemplated and can comprise, for example, one or more chemotherapeutic agents and radiation, one or more chemotherapeutic agents and immunotherapy, or one or more chemotherapeutic agents, radiation and chemotherapy.
As used herein, the term“cancer therapy” refers to a therapy useful in treating cancer. Examples of anti-cancer therapeutic agents include, but are not limited to, surgery, chemotherapeutic agents, immunotherapy, growth inhibitory agents, cytotoxic agents, agents used in radiation therapy, anti- angiogenesis agents, apoptotic agents, anti-tubulin agents, and other agents to treat cancer, such as anti-HER-2 antibodies (e.g., HERCEPTIN™), anti-CD20 antibodies, an epidermal growth factor receptor (EGFR) antagonist (e.g., a tyrosine kinase inhibitor), HER1/EGFR inhibitor (e.g., erlotinib (TARCEVA™)), platelet derived growth factor inhibitors (e.g., GLEEVEC™ (Imatinib Mesylate)), a COX-2 inhibitor (e.g., celecoxib), interferons, cytokines, antagonists (e.g., neutralizing antibodies) that bind to one or more of the following targets ErbB2, ErbB3, ErbB4, PDGFR-beta, BlyS, APRIL, BCMA or VEGF receptor(s), TRAIL/ Apo2, and other bioactive and organic chemical agents, etc. Combinations thereof are also contemplated for use with the methods described herein.
In certain embodiments, the methods of treatment include the administration of one or more chemotherapeutic agents. Examples of chemotherapeutic agents include Erlotinib (TARCEVA™, Genentech/OSI Pharm.), Bortezomib (VELCADE™, Millennium Pharm.), Fulvestrant (FASLODEX™, Astrazeneca), Sutent (SU11248, Pfizer), Letrozole
(FEMARA™, Novartis), Imatinib mesylate (GLEEVEC™, Novartis), PTK787/ZK 222584 (Novartis), Oxaliplatin (Eloxatin™, Sanofi), 5-FU (5-fluorouracil), Leucovorin, Rapamycin (Sirolimus, RAPAMUNE™, Wyeth), Lapatinib (GSK572016, GlaxoSmithKline), Lonafamib (SCH 66336), Sorafenib (BAY43-9006, Bayer Labs.), and Gefitinib (IRESSA™,
Astrazeneca), AG1478, AG1571 (SU 5271; Sugen), alkylating agents such as Thiotepa and CYTOXAN™ cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa;
ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine;
acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozcicsin, carzcicsin and bizcicsin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide,
mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gΐ and calicheamicin omega 1 ( Angew Chem. Inti. Ed. Engl. (1994) 33:183-186); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, anthramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, ADRIAMYCIN™ doxorubicin (including morpholino-doxorubicin,
cyanomorpholino-doxorubicin, 2-pyrrolino-doxombicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, strcptonigrin, strcptozocin, tubcrcidin, ubenimcx, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6- mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacytidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside;
aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfomithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK™ polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin;
sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan;
vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosinc; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., TAXOL™ paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE™ Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), and TAXOTERE™ doxetaxel (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZAR™ gemcitabine; 6-thioguanine; mercaptopurine;
methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; NAVELBINE™ vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
Also included in this definition of“chemotherapeutic agent” are: (i) anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen
(including NOLVADEX™ (tamoxifen)), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and FARESTON™ (toremifene); (ii) aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, MEGASE™ (megestrol acetate), AROMASIN™ (exemestane), formestanie, fadrozole, RIVISOR™ (vorozole), FEMARA™ (letrozole), and ARIMIDEX™ (anastrozole); (iii) anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as
troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); (iv) aromatase inhibitors; (v) protein kinase inhibitors; (vi) lipid kinase inhibitors; (vii) antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; (viii) ribozymes such as a VEGF expression inhibitor (e.g., ANGIOZYME™ (ribozyme)) and a HER2 expression inhibitor; (ix) vaccines such as gene therapy vaccines, for example,
ALLOVECTIN™ vaccine, LEUVECTIN™ vaccine, and VAXID™ vaccine;
PROLEUKIN™ rIL-2; LURTOTECAN™ topoisomerase 1 inhibitor; ABARELIX™ rmRH; (x) anti- angiogenic agents such as bevacizumab (AVASTIN™, Genentech); and (xi) pharmaceutically acceptable salts, acids or derivatives of any of the above. The foregoing examples of chemotherapeutic agents are illustrative, and are not intended to be limiting.
In another embodiment, radiation therapy is used. The radiation used in radiation therapy can be ionizing radiation. Radiation therapy can also be gamma rays, X-rays, or proton beams. Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125 palladium, iridium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy. For a general overview of radiation therapy, see Heilman, Chapter 16: Principles of Cancer Management: Radiation Therapy, 6th edition, 2001, DeVita et al., eds., J. B. Lippencott Company, Philadelphia. The radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source. The radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass. Also encompassed is the use of photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine, photosensitizer Pc4, demethoxy- hypocrellin A; and 2BA-2-DMHA.
In another embodiment, hormone therapy is used. Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (e.g., flutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA)); vitamin D3 analogs; antigestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyproterone acetate).
Adoptive cell therapy: Adoptive cell therapy (ACT) (including allogeneic and autologous hematopoietic stem cell transplantation (HSCT) and recombinant cell (i.e., CAR T) therapies) is the treatment of choice for many malignant disorders (for reviews of HSCT and adoptive cell therapy approaches, see, Rager & Porter, Ther Adv Hematol (2011) 2(6) 409-428; Roddie & Peggs, Expert Opin. Biol. Ther. (2011) ll(4):473-487; Wang et al. Int. J. Cancer: (2015)136, 1751-1768; and Chang, Y.J. and X.J. Huang, Blood Rev, 2013. 27(1): 55- 62). Such adoptive cell therapies include, but are not limited to, allogeneic and autologous hematopoietic stem cell transplantation, donor leukocyte (or lymphocyte) infusion (DLI), adoptive transfer of tumor infiltrating lymphocytes, or adoptive transfer of T cells or NK cells (including recombinant cells, i.e., CAR T, CAR NK).
In certain embodiments, a method of stimulating an immune response in a subject comprises isolating immune cells, e.g. T cells; contacting the immune cells with a pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors embodied herein and/or tumor antigens or tumor cells from the subject; reinfusing the immune cells into the subject; thereby, stimulating the immune response in a subject. In certain embodiments, the immune cells comprise autologous, haplo-identical, haplotype matched or combinations thereof. In certain embodiments, the immune cells are derived from autologous or allogeneic stem cells. In certain embodiments, the immune cells comprise NK cells, T cells, stem cell memory T cells, activated NK (aNK) cells, chimeric antigen receptor- NK (CAR-NK) cells, chimeric antigen receptor-T (CAR-T) cells, or combinations thereof. In certain embodiments, one or more adjuvants are optionally administered with the soluble fusion protein complexes embodied herein.
The adoptively transferred immune cells or pharmaceutical composition comprising the neuritin inhibitors and/or checkpoint inhibitors are administered at least one time per month, e.g., twice per month, once per week, twice per week, once per day, twice per day, every 8 hours, every 4 hours, every 2 hours, or every hour. Suitable modes of administration for the adoptively transferred immune cells include systemic administration, intravenous administration, or local administration. Suitable modes of administration for the
pharmaceutical composition include systemic administration, intravenous administration, local administration, subcutaneous administration, intramuscular administration, intratumoral administration, inhalation, and intraperitoneal administration.
Pharmaceutical Compositions
The compositions of the invention can be administered as pharmaceutical
compositions. In certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors. In certain embodiments, a pharmaceutical composition comprises an anti-neuritin inhibitor and a first and second checkpoint inhibitor. In certain embodiments, the checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1,
CEAC AM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof. In certain embodiments, the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof. In certain embodiments, the first checkpoint inhibitor is an inhibitor of PD- 1 and the second checkpoint inhibitor is an inhibitor of CTLA4.
In certain embodiments, the neuritin inhibitor comprises: an anti-neuritin specific antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
In certain embodiments, the checkpoint inhibitor comprises: an antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases,
oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides, organic or inorganic molecules, enzymes, interfering RNAs or combinations thereof.
The pharmaceutical compositions of the present invention may be specially formulated, in pharmaceutically acceptable carriers or salts, for parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; intravaginally or intrarectally, for example, as a pessary, cream or foam; or aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound.
The phrase“pharmaceutically acceptable” is employed herein to refer to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The phrase“pharmaceutically-acceptable carrier” as used herein means a
pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be“acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose, (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar, (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water, (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
The term“pharmaceutically-acceptable salts” refers to the relatively non-toxic, inorganic and organic acid addition salts of the agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex encompassed by the invention. These salts can be prepared in situ during the final isolation and purification of the agents, or by separately reacting a purified agent in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like.
In other cases, the agents useful in the methods of the present invention may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically- acceptable salts with pharmaceutically-acceptable bases. The term“pharmaceutically- acceptable salts” in these instances refers to the relatively non-toxic, inorganic and organic base addition salts of agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex. These salts can likewise be prepared in situ during the final isolation and purification of the agents, or by separately reacting the purified agent in its free acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like.
Kits
The invention provides kits for the treatment or prevention of a cancer. In one embodiment, the kit includes a therapeutic or prophylactic composition containing an effective amount of an agent described herein. In some embodiments, the kit comprises a sterile container that contains a therapeutic or prophylactic composition; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
If desired an agent of the invention is provided together with instructions for administering the agent to a subject having or at risk of developing a cancer. The instructions will generally include information about the use of the composition for the treatment or prevention of a cancer. In other embodiments, the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of a cancer or symptoms thereof; precautions; warnings; indications; counter- indications; overdosage information; adverse reactions; animal pharmacology;
clinical studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container
All documents mentioned herein are incorporated herein by reference. All publications and patent documents cited in this application are incorporated by reference for all purposes to the same extent as if each individual publication or patent document were so individually denoted. By their citation of various references in this document, applicants do not admit any particular reference is“prior art” to their invention.
EXAMPLES
The following non-limiting Examples serve to illustrate selected embodiments of the invention. It will be appreciated that variations in proportions and alternatives in elements of the components shown will be apparent to those skilled in the art and are within the scope of embodiments of the present invention.
Example 1: The neurotrophic factor Neuritin regulates T cell anergy and T regulatory cell function and is a target for cancer immunotherapy
In order to further understand the molecular mechanism of tolerance induction and maintenance in self-antigen reactive T cells, a comparative gene expression profiling study was performed between antigen specific T cells activated by self-antigen vs viral infection24. Neuritin (Nml) emerged as a highly differentially expressed gene between anergized vs activated CD4 T cells. Nml, also known as CPG15, was originally discovered as a neurotrophic factor attached to the cell membrane through a glycosylphosphatidylinositol (GPI) anchor 25,26· Nml plays multiple roles in the processes of neural development, synaptic plasticity, and synaptic maturation 26 29· It is also highly conserved across species, with 100% sequence homology in the extracellular region and 98% overall homology between the murine and human protein. While Nrnl has been found in gene expression profile lists of murine Foxp3+ Treg30, anergized CD8 cells31 tumor infiltrating lymphocytes in mouse tumor models and in human Treg infiltrating breast cancer tumor tissue632 35, its role in immune system regulation has never been studied.
Here it was shown, that Nml is highly expressed in both anergic T cells and Treg. Deletion of Nml resulted in defective T cell anergy induction, reduced pTreg cell generation and compromised Treg cell suppressive function in vivo. The growth of multiple tumors is highly inhibited in NmT/_ mice coincident with diminished suppression of anti-tumor T cell function in the tumor microenvironment. Furthermore, antibody blockade of Nrnl alone or in combination with anti-CTLA4 and anti-PD-1 significantly reduced tumor progression. These results implicate neuritin as a hitherto unappreciated promoter of immune tolerance and a yet untapped immunotherapy target.
Materials and Methods
Mice
The Nml_/ mice61, Foxp3-DTR-GFP (FDG)45 mice and TCRD_/ mice were obtained from Jackson laboratory. OTII mice on Thyl.l+ background was kindly provided by Dr. Jonathan Powell. Rag2_/ mice were maintained in our mouse facility. 6.5 TCR transgenic mice specific for HA antigen on B10.D2 background and C3HA mice on B10.D2 background has been described previously 24. CD2N neuritin transgenic mice were generated as follows: an EcoRI/Smal fragment containing the Nrnl cDNA (PCR product from Nrnl cDNA clone NM_153529) was cloned into the EcoKUSmal sites between the human CD2 promoter and the CD2 locus control region of the pBS CD2 construct. The construct was then digested with KpnVNotl to remove plasmid backbone. Purified DNA fragment was injected into fertilized C57BL/6 Jax eggs and transgenic mice were generated using standard microinjection techniques at the Johns Hopkins Transgenic Mouse Core Facility. Nml expression driven by the CD2 promoter was confirmed by qRT-PCR and cell surface staining. Nml_/ mice were crossed with FDG mice to generate Nrnl /_FDG and Nrnl+/ FDG mice. Nml_/ mice were also crossed with OTII mice to generate Nrnl_/ Thyl.l+OTII+ mice, Nrnl+/ Thyl.l+OTII mice.
All mice colonies were maintained in accordance with the guidelines of Johns Hopkins University and the institutional animal care and use committee. Antibodies and Reagents.
The following antibodies were used: Anti-CD3 (17A2), anti-CD4 (RM4-5), anti- CD8a (53-6.7), anti-CD25 (PC61), anti-CD45.1 (A20), anti-CD45.2 (104), anti-CD62L (MEL-14), CD73 (TY/111.8), anti-CD90.1 (OX-7), anti-CD90.2 (30-H12), anti-TCR 5.1,
5.2 (MR9-4), anti-PDl (29F.1A12), anti-IFNy (XMG1.2), anti-IL17A (TC11-18H10.1), anti- TNFa (MP6-XT22), anti-Tbet (4B 10), anti-Ki67 (16A8), anti-IL2(JES6-5H4), were purchased from Biolegend. Anti-CD44 (IM7), CD45 (30-F11), anti-CD69 (H1.2F3), anti BrdU (3D4) were purchased from BD Bioscience. Anti-FOXP3 (FJK-16s) and anti-Eomes (Dan 11 mag) were purchased from eBioscience. The flow cytometry data were collected using BD LSR-II, Fortessa and Celesta (BD Biosciences). Data were analyzed using FlowJo (Tree Star) software.
Mouse monoclonal antibody 1D6 against Nrnl was custom made (A&G
Pharmaceutical). The specificity of 1D6 was confirmed by cell surface staining of Nrnl transfected 293T cells (data not shown). Anti-CTLA4 Ab clone 9H10 and anti-PDl Ab clone J43 were purchased from Bio-X-cell. OVA 323-339 peptide and MOG35-55 peptide were purchased from GeneScript. Incomplete Freund's adjuvant (IF A) and Mycobacterium tuberculosis H37Ra (killed and desiccated) were from Difco. Pertussis toxin was purchased from List Biological Laboratories and diphtheria toxin was obtained from Millipore-Sigma.
T cell isolation and purification.
Single-cell suspension of lymph node (LN) and spleen (Sp) cells were obtained by grinding the tissue through a IOOmM nylon mesh. Purified CD4+ or total CD3+ T cell population was obtained by magnetic bead-based negative selection. In brief, cells were incubated with anti-CD45R (B220, clone RA3-6B2), anti-I-A/I-E (Clone M5/114. 15.2), anti- CDl lb(clone Ml/70) and anti-Ly-6G (Clone RB6-8C5) with or without anti-CD8 (clone 53- 6.72). Cells were washed and incubated with BioMag Goat anti-Rat IgG bead (Qiagen), followed by magnetic depletion of antibody labeled cells and collection of the negative fraction. Naive CD4 cells were sorted from enriched CD4 cell population based on
CD4+CD62LhlghCD44lowCD25 . Treg were isolated by sorting from the FDG CD4+ fraction based on the following profile: CD4+CD25+GFP+ (total Treg) or CD4+CD25+GFP+CD62Lhlgh (cTreg) and CD4+CD25+GFP+CD62Llow (eTreg) expression. Alternatively, Treg were enriched from CD4 cells by positive selection. Specifically, enriched CD4 cells from negative selection were incubated with anti-CD25- biotin Ab. Cells were washed and incubated with streptavidin microbeads (Miltenyi), washed and passed over a magnetic column (Miltenyi), and the positive fraction was collected.
Human peripheral blood was collected in strict accordance with Johns Hopkins University School of Medicine’s Institutional Review Board. In this study, a total of ten healthy adult volunteers (age range, 23 to 47 years) were enrolled. Peripheral blood mononuclear cells were extracted from whole blood through a Ficoll-Paque PLUS (GE Healthcare) gradient. Some were further purified into a predominantly CD4+ population with Dynabeads Untouched CD4 T-cell isolation kit (Invitrogen). Tregs were identified and flow sorted via the following staining profile: CD3+/CD4+/CD87CD25+/CD127low/CD39+. Central and effector Tregs were differentiated by CD45RA and CD25 expression as previously described62.
Self-antigen induced tolerance model.
lxlO6 HA specific Thyl.U 6.5 CD4 cells from donor mice on a B10.D2 background were transferred into C3HA recipient mice, where HA is expressed as self antigen in the lung; or into wt B10.D2 mice followed by infection with Vac-HA virus (lxlO6 pfu). HA- reactive T cells were recovered from the lung draining lymph node of C3HA host mice or from wt B10.D2 Vac-HA infected mice at indicated time points by cell sorting. RNA from sorted cells was used for qRT-PCR assay examining Nml expression.
In vivo peptide induced anergy assay.
4-5xl05 Polyclonal Treg from CD45.U C57BL/6 mice were mixed with 5xl06 thyl.U OTII cells from Nml_/ or Nrnl+/OTII mice and transferred by retro orbital injection into TCRoV mice. 100pg of OVA peptide 323-339 dissolved in PBS was administered i.v. on day 1, 4, 7 after cell transfer. Host mice were harvested on day 13 after cell transfer, cells from lymph node and spleen were further analyzed. Alternatively, 5xl06 thyl.U OTII cells from Nrnl_/ or Nml+/OTII mice were transferred into wt C57BL/6 mice and subjected to the same treatment and analysis as in TCRoU hosts.
Induction of autoimmunity by transient Treg depletion.
6xl06 total T cells from CD45.2+ Nml+/ or Nrnl_/ mice bred to FDG background were transferred into congenic marked CD45.U FDG mice. One day after cell transfer, host mice were treated with DT at lpg/mouse for 3 days. Spleen and lymph nodes were processed on Dayl l. Adoptively transferred CD45.2+ cells were enriched by staining with anti-CD45.2- FITC followed by selection with anti-FITC beads and LS columns (Miltenyi Biotec). Enriched cells were further subject to cell surface staining and activation by PMA and ionomycin in the presence of brefeldin A for 4 hrs at 37°C followed by intracellular cytokine staining.
Assessing Treg function in a T cell-induced colitis model.
Naive CD4+ T cells from C57BL/6 mice were isolated from pooled lymph nodes and spleens by FACS sorting. 4xl05 naive T cells were injected intraperitoneally (i.p.) into lymphopenic Rag2 /_ mice. On the same day or 14-21 days post-naive T cell injection (as indicated), upon the appearance of colitis symptoms, 3-4xl05 congenically distinct, Treg freshly isolated from Nrnl+/+, Nml_/ , or CD2N mice were also injected into separate cohorts of Rag2_/ recipients. Changes in body weight were assessed weekly, and upon conclusion of the experiment, colons were removed and fixed in 10% formalin. Five- micrometer paraffin- embedded sections were cut and stained with haematoxylin and eosin(H&E). The pathology of colon tissue was scored in a blinded fashion, on a scale of 0-5 where a grade of 0 was given when there were no changes observed. Changes associated with other grades were as follows: grade 1, minimal scattered mucosal inflammatory cell infiltrates, with or without minimal epithelial hyperplasia; grade 2, mild scattered to diffuse inflammatory cell infiltrates, sometimes extending into the submusoca and associated with erosions, with mild to moderate epithelial hyperplasia and mild to moderate mucin depletion from goblet cells; grade 3, moderate inflammatory cell infiltrates that were sometimes transmural, with moderate to severe epithelial hyperplasia and mucin depletion; grade 4, marked inflammatory cell infiltrates that were often transmural and associated with crypt abscesses and occasional ulceration, with marked epithelial hyperplasia, mucin depletion; and grade 5, marked transmural inflammation with severe ulceration and loss of intestinal glands. Transferred naive and Treg cell populations were characterized by surface marker and intracellular staining for cytokines and Foxp3. Eeukocytes recovered from recipient lymph node, spleen and gut lamina propria were re-stimulated before surface staining for CD4, CD45.1 and CD45.2.
EAE induction
EAE was induced in Nrnl_/ and Nrnl+/ mice or in wt C57BE/6 mice by s.c. injection of 200pg MOG35-55 peptide in an emulsion of complete Freund Adjuvant oil (500 pg M.
tuberculosis strain H37 Ra per dose) into the flanks. In addition, the mice received 400 ng pertussis toxin i.p. on days 0 and 2 after immunization. Clinical signs of EAE were assessed daily according to the standard 5 point scale63. Anti-Nrnl Ab or isotype control
(200pg/mouse i.p.) was administered every 2 days to the wt mice upon disease induction.
In vitro T cell activation and pTreg skewing
Primary murine cells were cultured in 10%RPMI and were stimulated by indicated dose of plate bound CD3 and CD28 in a 96-well round bottom plate at lxl05cells /well. For pTreg skewing conditions, 5x10s to 2xl06 cells/ml were activated in 24 well plate with 5pg/ml plate bound anti-CD3, 10011 I/ml IL2 and 4pg/ml anti-CD28 in the presence of 5 pg/mL of exogenous TGF .
ELISA
MaxiSorp ELISA plates (ThermoScientific Nunc) were coated with 100 pi of 1 pg/ml anti-mIL2 (BD Pharmingen #554424) at 4°C overnight. Coated plates were blocked with 200m1 of blocking solution (10%FBS in PBS) for lhr at room temperature (RT) followed by incubation of culture supernatant and mIL2 at different concentration as standard. After lhr, plates were washed and incubated with anti -mIL2 -biotin (BD Pharmingen #554426) at RT for lhr. After lhr, plates were incubated with lOOul of horseradish peroxidase -labeled avidin (Vector Laboratory, #A-2004) 1 pg/ml for 30min. After wash, samples were developed using KPL TMB Peroxidase substrate system (Seracare #5120-0047) and read at 405 or 450 nm after addition of stop solution.
Quantitative RT-PCR
Total RNA was extracted from cells using a TRIzol (Ambion) phase separation or with RNAeasy Mini Kit (Qiagen). Complementary DNAs were synthesized from the RNAs with Superscript III (Invitrogen). The primers of murine and human genes were purchased from Applied Biosystems or Integrated DNA Technology (IDT). qPCR was performed using SYBR Green master mix (Life Technologies) and the Applied Biosystems
STEPONEPLUS™ 96-well real-time PCR system. AACt values were normalized to actin RNA (Life Technologies), and relative quantification of gene expression ratio is shown in comparison with the control. Primers used for Nml PCR were as follows:
gcggtgcaaatagcttacctg (forward, SEQ ID NO: 1); cggtcttgatgttcgtcttgtc (reverse, SEQ ID NO:
2).
RNAseq analysis At least lOOng total RNA was extracted from sorted cells using an Qiagen RNEASY Kit (QIAGEN) according to the manufacturer’s instructions. Samples were randomly primed and prepared based on the manufacturer’ s recommendation (NEBNext Ultra RNA Library Prep Kit for Illumina). Samples were pooled and sequenced on a HiSeq with a read length configuration of 150 PE. Samples were sequenced and analyzed by Admera Health (South Plainfield, NJ). Sample quality was checked by FastQC vO.10.1. The reads were mapped to the GRCM38 and reported as fragments per kilobase of transcript per million mapped reads units. The heatmap was generated using the Morpheus software from the Broad Institute, Cambridge, MA (broadinstitute.org/morpheus/). Differentially expressed transcripts were identified using the sleuth R package. In addition to a sleuth p- value <0.05, expression > 1.0 FPKM was required on average across the samples. GSEA was employed in the context of gene ontology. Enrichment analysis with MSigDB gene sets was computed as the
hypergeometric p value for the overlap between the NRN +/ up genes and the gene sets of interest. The following gene sets were downloaded from GEO and used in GSEA analysis: anergy gene set (S AFFORD_T_LYMPHOCYTE_ANERGY) , Treg gene set (GEO:
GSE42021) and NFAT gene set (PID_NFAT_TFPATHWAY). Thl anergy gene set was also generated from upregulated genes in anergized Thl cells comparing to the control activated Thl cells based on the GSE46243 data sets using NCBI GE02R 47 · Genes overexpressed in anergized Thl cells with Benjamini & Hochberg false discover rate P<0.001 were selected into Thl anergy gene set.
Tumor experiments
B16F10 melanoma, EL4 lymphoma, CT26 colon carcinoma and 4T1 breast cancer cell lines were purchased from ATCC and were culture according to ATCC instructions. MC38 was cultured in 10% DMEM. For tumor challenge experiments, cells were trypsinized, washed and resuspended in PBS at an indicated concentration. While maintaining
suspensions on ice, 1-I.5xl05 cells of the specified tumor lines were injected s.c. into the shaved right flanks of age-, sex- matched, female mice of the indicated strains (B16F10 and EL4). 3-4xl05 cells were inoculated in CT26, MC38 and 4T1 experiment. Tumor volume was calculated every 2-3 days by the following formula, 0.5xLxW2. Length (L) and width (W) measurements were taken perpendicular to one another, with length describing the longer measurement. Measurements were made using a digital caliper. At indicated time points post injection, cohorts of mice were euthanized. For the antibody study, the mice received an i.p. injection of mAh to mouse Nml (200ug, three times a week, clone 1D6), mouse CTLA-4 (100mg; twice a week, clone 9H10, BioXcell), mouse PD1 (100mg; twice a week, clone J43, BioXcell) commnencing 5-6 days after tumor inoculation(upon detection of palpable tumor). For combination treatments, checkpoint inhibitors were administered along with anti-Nrnl mAh or initiated 3 days after the start of Nrnl blockade as indicated. Leukocytes infiltrating the tumor, the tumor-draining and non-draining lymph node were characterized by surface and intracellular staining and flow cytometry.
Statistical analysis. All numerical data were processed using Graph Pad Prism 7. Data are expressed as the mean +/- the SD, unless otherwise stated. Unless otherwise stated, statistical comparisons were made using an unpaired students t test where 0.05 was considered significant and a normal distribution was assumed. The p values are represented as follows: * p<0.05; ** p<0.01; *** p<0.001.
Results
Nrnl is highly expressed in anergic T cells and Treg. In order to further explore the molecular mechanisms underlying peripheral tolerance development, previously developed a system was used to identify tolerance- associated genes. The gene expression patterns associated with either a T effector/memory response or tolerance induction both triggered by the same antigen but under divergent in vivo conditions were compared24. The T
effector/memory response was induced by influenza hemagglutinin (HA) antigen-specific TCR transgenic CD4 T cells transferred into WT recipients and activated by HA-expressing vaccinia-HA (Vac-HA) virus. Tolerance induction, on the other hand, was achieved by the same TCR transgenic T cells when adoptively transferred into hosts transgenically expressing HA as self antigen (C3-HA mice) 24. One of the most highly differentially expressed genes upregulated under the in vivo anergy inducing conditions was Nml 26 29· Nml expression by in vivo tolerized HA-specific T cells recovered at different time points after transfer was confirmed by qRT-PCR (FIG. 1A). While Nrnl was highly expressed in all time points by cells recovered from C3-HA hosts, it was minimally expressed in T cells recovered from VacHA infected mice (FIG. 1A).
To further confirm the association of Nml expression with T cell anergy, Nrnl expression was examined in the classic AE7 in vitro T cell clonal anergy model36. In this system, stimulation of a Thl cell line with TCR signal alone (anti-CD3 only) results in the development of anergy, whereas stimulation with TCR signal in the presence of
costimulation signal (anti-CD28) results in cell activation and expansion. Nrnl expression was induced under anergy-inducing conditions (stimulation with anti-CD3 alone) within 9 hours with levels peaking after 24 hours. In contrast, in vitro activation (treatment with both anti-CD3 and anti-CD28) failed to significantly enhance Nml expression (FIG. IB).
Naturally occurring anergic polyclonal CD4+ T cells enriched for self-antigen reactive T cells exist in the healthy host. These cells can be identified by surface coexpression of Folate Receptor 4 (FR4) and the ecto-5’ -nucleotidase CD7318. Nml mRNA expression was found in CD44+FR4HlCD73hl CD4 cells to be much higher than naive CD4 and
CD4+CD44+FR4 CD73- cells recovered from mice under steady state conditions (FIG. 1C). Nml protein expression was also detected by cell surface staining with an anti-Nrnl antibody among CD44+FR4hiCD73hi CD4 cells (FIG. ID).
Regulatory T cells play pivotal roles in maintaining tolerance and executing immune response regulation. In the in vivo system, as well as others, anergic cells develop suppressive activity and induce Foxp3 expression3 18. It was therefore queried whether Nrnl is expressed by Foxp3+ Treg. Examination of Nrnl message and protein levels across a panel of immune cell population FACS-isolated from murine lymphoid tissues revealed Foxp3+/CD25+ Tregs indeed express Nrnl, an observation confirmed by flow cytometric staining of surface Nml protein (FIGS. 7A, 7B). Foxp3+ Treg are known to be heterogeneous in vivo. Resting or central Treg (cTreg) are characterized by expression of high levels of CD62L and lower expression of CD44, primarily localized in secondary lymphoid tissues37. Upon activation, Tregs acquire an effector-like phenotype (eTregs), characterized by heightened suppressive potency, high expression of CD44, GITR, ICOS, chemokine receptors, and preferential accumulation at peripheral tissue sites, such as tumor tissues38 39,4041. While isolated Tregs marked with the resting/cTreg CD62L expressed only modest levels of Nrnl message and protein, treating these cells with anti-CD3/CD28 antibodies and IL2 resulted in robust Nrnl expression (FIG. IE). Moreover, Nml message was highly expressed by induced Treg (iTreg) generated in vitro (FIG. IE). Nml RNA levels are much higher in CD62Llow eTreg than CD62Lhlgh cTreg under steady state (FIG. IF). Consistent with a link between Nrnl expression and the process of Treg activation, in vitro activation with TCR signal and IL2 resulted in considerable Nml upregulation by purified CD44low/CD62Lhlgh Tregs. Activation of CD44hlgh/CD62Llow Tregs resulted in similarly enhanced Nml levels (FIG. IF).
Preferential Nml expression was also observed in human Treg over their conventional, non- Treg (Tconv) counterparts (FIG. 1G). Similar to murine Tregs, higher Nml expression was observed among eTreg isolated from human blood relative to their cTreg counterparts (FIG. 1H). These results confirm Nml to be a factor expressed in both anergized T cells and an activated subset of both murine and human regulatory T cells, providing evidence of a function for this molecule in the shared immunosuppressive role played by these cells.
Nrnl is important for the induction of T cell anergy and pTreg development in vivo. T cell anergy refers to a hyporesponsive state induced in Tconv as a result of certain conditions7 including suppression by Treg during their activation11 13. Tconv that are suppressed by Treg can develop anergy and convert to pTreg (a process associated with Foxp3 induction), thereby amplifying“infectious tolerance”10 1442. Alternatively, anergy among Tconv cells can also be induced upon encounter persistent self antigen in the absence of Treg cells9 10 43. The high expression of Nml in anergic T cells (FIGS. 1 A, IB) suggests a potential function for this molecule in T cell anergy induction and/or maintenance. In order to understand the role of Nml during tolerance and immunity, Nrnl_/ mice were obtained. Nml deficiency does not interfere with thymocytes development nor bone marrow B cell development; similar proportions of T and B cells were observed in wild type (WT, Nml+/+) and Nrnl_/ mice (data not shown). OVA antigen specific TCR transgenic OTII mice were crossed onto the Nml_/ background to facilitate the observation of antigen specific CD4 cell response in the absence of Nml. Upon crossing with OTII TCR transgenic mice, there was comparable development of OTII CD4 T cells, and comparable reduction of the Foxp3+ Treg population due to TCR transgenic expression (2-4% in OTII transgenic mice vs 10-15% in wt C57BL/6 mice) in both Nml_/ or Nml+/_ offspring.
The first potential role of Nrnl in CD4 cell anergy development that was analyzed herein, was the susceptibility of CD4 Tconv cells to Treg mediated suppression during antigen specific anergy induction in vivo. For this analysis, the classic soluble intravenous (i.v.) peptide injection anergy-induction model was used14. Specifically, OTII+Nrnl 7 or control OTII+Nml+/_ CD4 Tconv cells, depleted of CD25hl Treg were cotransferred with wt Treg into TCRa knockout mice (TCRoU) (FIG. 2A). Transferred OTII Tconv cells could be distinguished from co-transferred Treg via distinct congenic markers (OTII Thyl.U; Treg Thyl.2+). Reconstituted mice were injected i.v. with soluble OVA peptide every three days for three treatments - a standard protocol to induce anergy7 14. A component of anergy induction by soluble i.v. antigen involves Treg mediated suppression operating upon antigen- specific Tconv cells7 22 23. Mice were harvested on day 13 after adoptive transfer (ADT) and OTII T cell expansion, cytokine production and conversion to pTreg (Foxp3 induction) were examined. Nrnl_/ T cells showed increased expansion evidenced by increased percentage of OTII+Nml 7 cells in the CD4+ population both in lymph node and spleen (FIG. 2B). The total number of OTIRNml 7 cells was also increased compared to OTII Nml+/_ T cells (FIG. 2C). Upon OVA peptide restimulation in vitro, OTII Nml_/ cells produced significantly more IL2 than control OTII Nml+/ cells (FIG. 2D). Moreover, OTII Nml_/ T cell demonstrated significantly reduced conversion to Foxp3+ Treg relative to control (FIG. 2E). The increased cell expansion and cytokine production in OTII Nrnl_/ T cells supports the notion that there is reduced susceptibility of Tconv to Treg cell mediated suppression in the absence of Nrnl compared to the Nml -proficient T cells. The significant reduction in the generation of Foxp3+ cells among the Nml_/ OTII Tconv relative to Nml -proficient controls reflects diminished conversion of Foxp3 T cells to pTreg. In addition to these experiments with tolerance induced by soluble i.v. antigen, experiments described below (FIG. 2G) testing Tconv cell response to self-antigen further support the notion that Nml deficiency affects conversion of Tconv to pTreg. Similar experiments in which OTII Nml_/ or Nml+/_ T cells were transferred into T cell replete wt mice injected with high dose OVA peptide with the same schedule as in FIG. 2A also demonstrated reduction in Foxp3+ pTreg and increased IL2 production by OTII Nml_/ cells (FIGS. 2A, 2B).
A second tolerance system was used to study the role of Nml in anergy induction and the generation of pTreg among polyclonal T cells (to complement the findings made in the monoclonal OTII system described above) in the absence of Treg suppression. Persistent self antigen has been shown to induce tolerance among naive self-Ag specific T cells and to mediate their conversion into pTreg 43. Transient depletion of Treg in adult mice can result in self-reactive CD4+ T cell responses, followed by recovery of self-tolerance accompanied by reemergence of Treg and reestablishment of anergy among peripheral Tconv cells in 10- 14 days 44. This system was used to determine whether Nrnl regulates Treg reemergence and the restoration of self-tolerance. To this end, Nml_/ mice were crossed onto a Foxp3DTRgfp (FDG) background where Treg can be deleted by administration of diphtheria toxin (DT) due to the expression of diphtheria toxin receptor (DTR) 45
Congenically marked T cells from Nml_/ or Nml+/_ control mice on the FDG background (CD45.2+) were co-transferred into congenic CD45.1expressing FDG wt hosts as outlined in FIG. 2F. Because all Treg (host and adoptively transferred) in this system express DTR, DT administration after T cell transfer completely eliminates all Treg from the adoptively transferred mice. Because adoptively transferred T cells are congenically distinguished from endogenous T cells, this enabled the evaluation of both cell-intrinsic and cell-extrinsic effects of Nrnl deficiency on anergy induction as well as conversion of Tconv to pTreg. DT was administered the day after T cell transfer to delete Treg from both transferred T cells and endogenous T cells. Mice were harvested 11 days after DT treatment, at the recovery phase from the autoimmune response induced by Treg cell depletion44. De novo Foxp3+ Treg generation was consistently reduced among Nrnl 7 cells compared to Nml+/ cells (FIG. 2G). Anergic T cell populations (FR4hlCD73hl) were also reduced (FIG. 2H).
Significantly, in addition to showing that transferred Nml_/ T cells have an intrinsic defect in generating Foxp3+ Treg and FR4hlCD73hl anergic cells under this self-reactivity model, it was also found that they negatively impacted the generation of endogenous Treg and anergic cells. T cells in the host mice (CD45.1+) receiving adoptive transfer of Nml_/ T cells consistently showed reduced generation of Foxp3+ and FR4hlCD73hl cells among CD4 cells relative to those receiving Nrnl+/ control T cells (FIGS. 2G, 2H). They also showed higher levels of proliferation as indicated by Ki67 staining and higher levels of Thl generation evidenced by IFNy and Tbet staining (FIGS. 2I-2K). Thus, Nrnl deficiency not only caused a cell-intrinsic defect in generation of Foxp3+ and FR4hlCD73hl anergic T cells, it also resulted in cell extrinsic effects impacting the proinflammatory capacity of wt T cells.
To further corroborate these observations, autoreactive responses among Nrnl overexpressing T cells were also tested. CD2-Nml (CD2N mice) transgenic mice that constitutively express Nrnl (driven by the CD2 promoter) among T cells were generated. (FIG. 8C). In these mice, an elevated level of Nrnl expression was detected by mRNA and surface staining among CD3+ cells from CD2N mice (FIGS 8C, 8D). CD2N mice were also crossed to the FDG background to generate CD2N-FDG mice. CD2N-FDG T cell responses to self-antigen upon transfer into FDG mice were tested as outlined in FIG. 2F. 11 days post induction of autoimmune responses by in vivo Treg depletion with DT, CD2N CD4 cells exhibited increased pTreg and FR4hlCD73hl anergic cell generation relative to transferred control Nml+/_ T cells, opposite to Nml_/ T cells (FIGS. 2E, 2F).
Nrnl expression by Treg supports their in vivo suppressive function. Having demonstrated a role for Nrnl in anergy induction and pTreg conversion, the importance of this molecule in the suppressive function of Tregs, was further explored. Nrnl was found to be highly expressed by Treg and in particular by activated eTreg (FIGS. IE, IF, 1H).
Enhanced Nrnl expression upon Treg activation provides evidence that Nrnl may also participate in the acquisition of the eTreg phenotype and consequent upregulation of suppressive potency. It was first investigated whether eTreg can be effectively activated and converted to eTreg in the absence of Nml in vitro. CD44Low/CD62LHlgh cTreg marked with GFP were sorted from Nml_/ or Nml+/_ mice on the FDG background and activated by anti- CD3 and CD28 in vitro. Indeed, activation of purified Nml_/ cTreg resulted in less efficient generation of CD44Hlgh/CD62LLow cells compared to the activation of Nml+/ cTreg (FIG.
3A). These results provide evidence that Nml expression not only accompanies Treg activation, but may play a role in promoting the acquisition of an activated Treg phenotype.
To understand the impact of Nml deficiency on in vivo Treg function, a T cell- induced colitis model was used to test the importance of Nml for the control of inflammation by Treg. After initiating colitis by injecting naive (CD62LH7CD25 ) CD4+ T cells into lymphopenic recipient (Rag2 /_) mice, Treg isolated from Nml_/ and their littermates Nrnl+/ were transferred into recipient mice cohorts, and their ability to ameliorate colitis was determined. As expected, Nrnl+/ Treg prevented further development of colitis, which progressed unabated in control mice not receiving Treg. Treg isolated from Nrnl_/ mice, however, failed to rescue recipients from severe colitis, evidenced by wasting and colon pathology (FIGS. 3B-3D). Additionally, proinflammatory cytokine-producing T cells (IRNg or IL-17) were more prevalent in the gut-draining lymph node and lamina propia of mice receiving Nrnl_/ Treg compared to Nml+/_ Treg recipients (FIGS. 3E, 3F). Tracking the fate of injected Treg revealed that Nrnl deficiency significantly reduced the number of Treg present in these tissues as well as the expression of Foxp3 (FIGS. 3G, 3H). In separate experiments, injection of wt Nrnl+/+ Treg recipients with anti-Nrnl monoclonal antibody (but not an isotype control) largely recapitulated the effects of Nrnl deficiency in Treg (FIGS. 9A-9D). On the other hand, transfer of Nrnl over-expressing Treg (derived from CD2N mice) resulted in slightly improved recovery and lower levels of colonic inflammatory cytokines relative to transfer of wt Treg (FIGS. 9A-9D). These results support a major role for Nml in promoting the in vivo function of Treg in the face of inflammation.
In parallel with the colonic inflammation model described above, the role of Nml in Treg mitigation of the widely used experimental autoimmune encephalomyelitis (EAE) model was explored. Immunization of mice with Myelin Oligodendrocyte Glycoprotein (MOG) in complete Freund’s adjuvant (CFA) induces autoimmune encephalitis that remits due to Treg dependent suppression of disease-driven MOG- reactive CD4 T cells. Nrnl_/ mice, unlike their wt counterparts, failed to control inflammation in this widely used model of multiple sclerosis. Specifically, Nml_/ mice showed no partial recovery during the late stages of disease, when Treg normally accumulate in affected tissues and mediate their suppressive activity 46 (FIG. 31). This observation evidenced an impaired ability to curtail CNS inflammation in the absence of Nml. Supporting this notion, the brain and spinal cords of Nml_/ mice still harbored significant populations of proinflammatory cytokine-producing leukocytes in contrast to Nml+/ controls, and Foxp3+ T cell frequencies were also reduced in the absence of Nml (FIG. 3J). Similar results were obtained when EAE afflicted wt mice were subjected to antibody mediated Nrnl blockade. Unlike isotype control treatment, anti- Nml antibody injections enhanced the onset of peak disease symptoms, impeded recovery and maintained the inflammatory infiltrate of the spine (FIGS. 9E, 9F), mirroring the effects of genetic Nrnl ablation.
The enhanced inflammation and reduced Foxp3+ cell infiltrates observed upon genetic and antibody mediated Nml ablation in these inflammatory/autoimmune disease models are in line with the finding that Nml is important for the development and function of suppressive T cell population (anergic T cells, Treg cells). Overall, these results underscore the importance of Nrnl function in peripheral tolerance.
Loss of Nrnl affects anergy and Treg cell signature gene expression. In order to gain further insight into the mechanisms underlying the contribution of Nml to anergy induction and Treg suppression, gene expression profiles were compared between Nml_/ and Nrnl+/ T cells under different conditions. To analyze gene expression profiles in Tconv cells under tolerizing conditions, an RNAseq analysis of soluble peptide anergized OTII+Nrnl 7 vs OTII+Nml+/ T cells that were cotransferred with wt Treg into TCRa_/ host mice was performed as outlined in FIG. 2A. 868 genes were revealed gene categories related to receptor binding as the most affected category upon loss of Nrnl. Kegg pathway analysis also provided evidence that defects in the T cell receptor signaling pathway and the cytokine- receptor interaction pathways were among the top effects of Nml deletion in anergized T cells (FIGS. 10A, 10B).
Gene set enrichment analysis (GSEA) revealed that genes upregulated in an anergized Thl clone47 were highly enriched in Nrnl+/_ cells, but not in Nml_/ cells (FIG. 4B), in accordance with the finding that Nml_/ OTII cells are functionally refractory to anergy induction (FIGS. 2A-2K). This deficiency in anergy related gene signature detected in Nrnl_/ T cells was further confirmed by GSEA comparison of previously described CD4 anergy48 and AE7 anergy gene sets49 (FIG. IOC). Furthermore, while the gene set enriched in Treg was prominent in Nrnl+/_ cells, it was not in Nrnl_/ cells, consistent with a defect in pTreg cell generation by Nml_/ cells (FIG. 4C). Genes upregulated in Nml+/_ T cells overlapping with the Thl anergy gene set are shown in the heatmap in FIG. 4D. PD-1, Lag3, ICOS and CD73 are all down regulated in Nrnl 7 T cells. Moreover, several genes related to cation transport and balance, SLC9b2, SLC4al, SlOOal and NSMf are also reduced in Nrnl 7 T cells (FIG. 10D). GSEA analysis against NFAT target genes reveal reduced NFAT target gene expression among Nrnl 7 OTII cells (FIG. 4E), providing evidence of reduced or unbalanced NFAT signaling.
In addition to expression profile analysis of OTII cells recovered after anergy induction in vivo (FIG. 2A), Treg were also sorted from Nrnl 7 or Nml+/ mice under steady state and subjected them to RNAseq gene expression profile comparison analysis. Consistent with reduced Treg cell suppression function in vivo, GSEA analysis showed reduced expression of Treg cell signature genes (FIG. 4F). NFAT signaling plays a significant role in Treg cell suppression function50. Similar to the finding of Nrnl 7 OTII cell gene expression under the anergy setting (FIG. 4E), Nrnl 7 eTreg showed reduced expression of genes in the NFAT target gene set (FIG. 4G).
The reduced expression of anergy related signature genes in Nrnl 7 vs Nml+/ cells are consistent with the phenotype of compromised T cell anergy induction. Treg cell expression profile analysis between Nrnl 7 and Nml+/ cells also reveals reduced Treg signature gene expression in the absence of Nrnl expression, explaining the defective suppressive function of Nrnl 7 Tregs in vivo. Nrnl has been shown to modulate NFAT down- regulated and 432 genes were up-regulated in Nrnl 7 OTII cells compared to Nml+/ OTII cells (FIG. 4A). Gene Ontology (GO) term analysis of Nrnl 7 down-regulated genes signaling pathway in neurons and NFAT signaling is important for both anergy development and Treg function 50 52. By GSEA analysis, reduction in the NFAT target signature genes was found in Nrnl 7 T cells recovered from anergic conditions and in eTreg recovered from Nrnl 7_ mice under steady state.
Nrnl deficiency or blockade, alone or in combination with CTLA4 and PD1 blockade inhibits tumor growth. Tumor antigen specific T cells can quickly become anergized or convert to a pTreg fate in the cancer setting 5 53· Additionally, Treg facilitate the induction of anergy and pTreg cell differentiation within the pool of potential anti-tumor effector T cells during tumor emergence and progression 5. To investigate the potential role of Nml in anti tumor adaptive immune responses, Nrnl 7 mice and their Nml+/ littermates were challenged with the moderately immunogenic EL4 thymoma and the aggressive, poorly immunogenic B16 melanoma subcutaneously (s.c). Strikingly, compared to Nml-competent littermates, EL4 tumors barely grew in Nrnl_/ mice while B 16 tumors grew much more slowly (FIGS. 5A, 5B). Similar result was obtained comparing B16F10 tumor growth in Nml_/ mice to either Nml+/+ or Nrnl+/ controls (FIG. 11A). Analysis of B16 tumor-infiltrating leukocytes (TIFs) revealed a significant reduction in Foxp3+ T cell frequencies, and a slight decrease in FR4hlCD73hl cell population (Figs. 5C, 5D). Significantly increased frequency of cells producing the pro-inflammatory cytokines IFNy was observed in both CD4 and CD8 populations among TIFs from Nml_/ mice compared to Nrnl+/+ controls (FIGS. 5E, 5F), indicative of an enhanced, less restrained anti-tumor response. On the other hand, enhanced B16F10 tumor growth was observed in CD2N mice compared to Nrnl+/+ littermate controls, while tumor growth was significantly inhibited in Nrnl_/ mice (FIGS. 11B, 11C).
The important role for Nml in regulating the anti-cancer immune response was further evidenced by its expression in T cells in the tumor bearing mice. In FDG mice challenged with B16F10 tumor, higher levels of Nrnl expression was observed in Treg recovered from B16F10 tumor infiltrating lymphocytes (TIFs) comparing to Treg from the blood (FIG. 5G). Non-Treg CD4 (Foxp3 , gfp ) cells among the TIFs from these mice also show higher Nrnl expression compared to peripheral blood CD4 cells (FIG. 5G), an observation in line with Nrnl expression by multiple suppressor T cell populations. To further evaluate Nml expression in tumor antigen specific T cells, 6.5 T cells specific for HA antigen were adoptively transferred into A20HA B cell lymphoma bearing mice or into wt mice followed by infection with VacHA virus. Nrnl is highly expressed in tumor antigen specific 6.5 T cells isolated from tumor bearing host compared to T cells activated by VacHA infection (FIG. 5H).
Treg cell suppression of adaptive immunity can contribute to tumor progression. The impact of Treg dysfunction in the absence of Nml during adaptive immune responses toward implanted tumor. Rag2 /_ mice were reconstituted with Nml+/+, CD45.1+ spleen and lymph node cells depleted of CD25+ Treg and co- transferred congenically marked Treg from Nml+/ or Nrnl_/ mice (CD45.1 ) before B16 tumor challenge. Tumors grew much slower in Nml_/ Treg recipients compared to those reconstituted with Nml+/_ controls (FIG. 51). Analyzing cells of the tumor-draining lymph nodes and TIFs of these mice confirmed that, in the presence of Nrnl_/ Treg, effector cells (CD45.1+) expand to a much greater extent, suggesting reduced suppression by Nrnl_/ Treg. Although the Nrnl_/ Treg cell population is not reduced in the tumor draining lymph node, they are greatly reduced among the TIFs (FIG. 5J), indicating a defect in eTreg cell activation within and/or recruitment of these cells to the tumor site.
The unique surface expression pattern of Nml, its functional roles in T cell anergy development and Treg suppression, and the stunted tumor growth observed in NrnT/_ mice all support the notion that Nml is a promising target for tumor immunotherapy. Next, was to evaluate the susceptibility of Nml to therapeutic blockade. Consistent with the findings in Nml 7 mice, anti-Nml monoclonal antibody (mAh) treatment of B16F10 tumor bearing mice 5-6 days after implantation results in marked tumor growth inhibition relative to isotype control treatment (FIG. 6A and FIG. 12A). Similar trends were obtained in the MC38 (colon), CT26 (colon) and 4T1 (breast) tumor models (FIGS. 6B-6D and FIGS. 12B-12D). Analysis of TILs from B16F10 tumors revealed an increased CD8/Treg ratio and increased expression of Tbet and effector cytokines production among CD 8 cells in mice treated with anti-Nrnl mAh (FIGS. 6E-6G).
To determine whether coupling Nml blockade with proven immune checkpoint inhibitor could result in improved anti-tumor efficacy, combinations of anti-Nml mAh were tested with either anti-CTLA4 or anti-PDl blockade. As expected, administration of individual checkpoint inhibitor treatment had little effect on the growth of established .v.o. B 16F10 tumors as did combination of anti-CTLA4/anti-PDl treatment (FIG 13A).
Combination of anti-CTLA4 and anti-Nrnl treatment achieved some improvement in tumor treatment efficacy in the B16F10 model (FIG. 13A). Upon combination treatment of anti- Nml with anti-PDl, there was some limited improvement in treatment efficacy over anti- Nml monotherapies (FIG. 13B). Because CTLA4 and PD1 impact different stages of T cell activation and differentiation, it was reasoned that anti-Nml combination with either anti- CTLA4 or anti-PDl alone may not be sufficient to overcome both anergy and exhaustion issues facing anti-tumor T cell response. However, triple combination treatment of anti-Nrnl with anti-CTLA4 and anti-PDl may allow comprehensive blockade against the development of anergy and exhaustion among tumor specific T cells, thus achieve further improvement in treatment efficacy. Indeed, administration of a triple combination of anti-Nml, anti-CTLA4 and anti-PDl mAh to mice with established B16F10 tumors resulted in a significant inhibition of tumor growth (FIGS. 6H, 61 and 13C).
Taken together, these findings identify Nml as a novel tolerance-promoting factor with a role in the generation and biology of two major suppressor T cell populations. They also clearly implicate Nml to be a high-value target for anti-tumor immunotherapy. Nml blockade results in enhanced CD8 cell tumor infiltration and effector function. Furthermore, combination of anti-Nml with checkpoint inhibition regimens can significantly improve tumor treatment efficacy.
Discussion
Nml was discovered in neurons as an activity induced GPI-anchored membrane protein. It has been shown to promote synapse maturation in neurons 29,54· No functional role of Nml in the immune system has been previously reported. Its expression in Treg and anergized Tconv cells, its role in maintaining Treg and anergy- dependent tolerance and the anti-tumor effects resulting from its deletion or functional blockade is characterized here. Indeed, increased Nml expression has been observed on various expression profiling lists, not only in CD4+ anergic and Treg 30·34·55· but also in anergic CD 8 cells31 34 .Any potential role for Nml in the biology of these immunoregulatory cells prior to the findings herein, have gone unexplored.
It was found herein that deletion of Nrnl in conventional CD4 cells results in compromised anergy induction and pTreg development in a number of different in vivo systems including a model of immune tolerance induced by soluble i.v. antigen and an autoimmune disease model triggered by transient Treg deletion (FIGS. 2A-2K). The defective anergy induction among Nrnl_/ cells was accompanied with reduced expression of anergy and Treg related genes as revealed by GSEA analysis (FIGS. 4B, 4C). Also, loss of Nml in Treg resulted in reduced Treg cell signature gene expression and compromised suppression function in vivo (FIGS. 3A-3J; FIG. 4F). T cell anergy and Treg cell mediated suppression are two important and interrelated mechanisms responsible for maintaining peripheral tolerance. Treg facilitate the induction of anergy, and anergic T cells are prone to develop into pTreg and spread self-antigen-specific suppression3. Nml contributes to the maintenance of peripheral tolerance through both T cell anergy and Treg cell suppression.
The exacerbated inflammatory response upon disease induction in Nml_/ mice further underscores the importance of Nml in peripheral tolerance (FIGS. 3A-3J). As a cell surface molecule, Nrnl may affect T cell function intrinsically or it may act extrinsically affecting neighboring cell function, impacting the establishment of tolerance environment. Using adoptive T cell transfer approaches, reduced pTreg generation in the absence of Nml (FIGS. 2E, 2G) was consistently observed, providing evidence of an intrinsic defect of Nrnl_/ T cells in impairing the process of pTreg cell differentiation. Additionally, enhanced auto- reactivity of wt T cells was observed in the presence of adoptively transferred Nrnl_/ T cells (Figs. 21- 2K), indicating that Nrnl may also have a cell-extrinsic effect influencing the establishment of tolerance environment. Nml has been shown to function in the CNS both when it is attached on the cell surface and as a soluble protein26,29. Using Nrnl-Fc fusion protein, binding of Nrnl to various cell types including dendritic cells was observed (data not shown). These observations provide evidence that Nml may impact the establishment of tolerance intrinsically by affecting the function of Nrnl expressing cells, and extrinsically through binding of Nrnl to other cell types. The identity of Nml’s binding partner(s), signaling pathways and downstream functional implications in the immune system are in need of further investigation.
Nml has been shown to increase calcium concentration and NFAT activation in the granule neurons of the cerebellum 51. Reduced NFAT target gene expression was found in Nml 7 Tconv cells and NrnT/_ Foxp3+ effector Treg (FIGS. 4E, 4G). As part of its central role in T cell activation, NFAT also contributes to the activation of the anergic gene expression program in Tconv cells and NFAT1 deletion results in defective anergy induction52. In Treg, NFAT can interact with Foxp3 and facilitate Treg cell suppression function50. Dysregulation of calcium mobilization can contribute to reduced NFAT activation and target gene transcription, thus compromising T cell anergy development and Treg cell suppression. Nrnl has been identified in the AMPA-type ionotropic glutamate receptor (AMPAR) complex54,57. The ionotropic AMPAR can permeate calcium directly or indirectly58. As a component of AMPAR complex, Nml may affect calcium mobilization through AMPAR. It remains to be determined how the function of Nrnl is related to AMPAR in the immune system.
Treg cell mediated suppression, tumor antigen specific T cell anergy development and pTreg conversion all negatively impact anti-tumor immune response 5·34·53· Through characterizing the unique surface expression patterns and demonstrating the important multifaceted role of Nml in immune tolerance, the present study positions Nml to be a promising target for tumor immunotherapy. Both genetic ablation and Nml functional blockade result in tumor growth inhibition, increased tumor lymphocyte infiltration and enhanced CD8 effector cell response in several tumor models (FIGS. 5A, 5B; FIGS. 6A-6D), confirming the negative role of Nml in adaptive immunity against tumor and encouraging further application of Nml functional blockade treatment in non-immunogenic tumors that have been historically poorly responsive to immunotherapy. Besides anergy development, lack of sufficient tumor antigen specific T cell expansion and development of T cell exhaustion in the face of growing tumor antigen all have significant impacts on the outcome of anti-tumor therapy. In order to achieve a sustained anti-tumor response, Nml blockade can be combined with other agents to target different aspects of the anti-tumor immune response. CTLA-4 and PD- 1 are both immune checkpoint inhibitors that have shown clear clinical efficacy but have different functional mechanisms59. CTLA-4 primarily attenuates T cell activation in the priming phase through cell intrinsic and extrinsic mechanisms. PD-1, on the other hand, appears on exhausted T cells and primarily attenuates T cell activity in peripheral tissues60. The distinct biological roles of these target molecules may allow enhanced effector functions at different stages of anti-tumor immune response. By combining anti-Nrnl with both anti-CTLA4 and anti-PDl blockade, we have achieved significant inhibition of non-immunogenic B16F10 tumor growth (FIGS. 6H, 61; FIG 13C). This result confirms the utility of Nrnl as a novel target and our strategy of combination therapy targeting different aspect of tumor specific T cell dysfunction can significantly improve the outcome of tumor therapy.
In summary, Nml was identified as a novel cell surface molecule with preferential expression by suppressive T cell populations and clear function in T cell mediated immune tolerance in vivo. Nrnl is highly expressed in anergic T cells and Treg, deletion of which affect CD4 T cell anergy development and Treg cell suppression function. Nml blockade can enhance anti-tumor adaptive T cell responses and combination therapy with anti-CTLA4 and anti-PDl greatly enhances treatment efficacy to an aggressive, non-immunogenic murine tumor model. Overall, these results add to the understanding of peripheral tolerance mechanisms and provide an effective new option for anti-cancer immunotherapy.
References:
1. Richards, D.M., et al. The Contained Self-Reactive Peripheral T Cell Repertoire:
Size, Diversity, and Cellular Composition. Journal of immunology ( Baltimore , Md .: 1950) 195, 2067-2079 (2015).
2. Perry, J.S. & Hsieh, C.S. Development of T-cell tolerance utilizes both cell- autonomous and cooperative presentation of self-antigen. Immunol Rev 271, 141-155 (2016).
3. DL, K.L.a.M. Relationship between CD4 Regulatory T Cells and Anergy In Vivo.
Journal of immunology ( Baltimore , Md.: 1950) 198, 2527 (2017).
4. Richards, D.M., Kyewski, B. & Feuerer, M. Re-examining the Nature and Function of Self-Reactive T cells. Trends in immunology 37, 114-125 (2016). 5. Alonso, R., et al. Induction of anergic or regulatory tumor-specific CD4+ T cells in the tumor-draining lymph node. Nature communications 9, 2113 (2018).
6. Plitas, G., et al. Regulatory T Cells Exhibit Distinct Features in Human Breast
Cancer. Immunity 45, 1122-1134 (2016).
7. Chappert, P. & Schwartz, R.H. Induction of T cell anergy: integration of
environmental cues and infectious tolerance. Current opinion in immunology 22, 552- 559 (2010).
8. Kearney, E.R., Pape, K.A., Loh, D.Y. & Jenkins, M.K. Visualization of peptide- specific T cell immunity and peripheral tolerance induction in vivo. Immunity 1, 327- 339 (1994).
9. Adler, A.J., et al. CD4+ T cell tolerance to parenchymal self-antigens requires
presentation by bone marrow-derived antigen-presenting cells. T he Journal of experimental medicine 187, 1555-1564 (1998).
10. Martinez, R.J., et al. Arthritogenic self-reactive CD4+ T cells acquire an
FR4hiCD73hi anergic state in the presence of Foxp3+ regulatory T cells. Journal of immunology ( Baltimore , Md .: 1950) 188, 170-181 (2012).
11. Ermann, J., et al. CD4(+)CD25(+) T cells facilitate the induction of T cell anergy.
Journal of immunology ( Baltimore , Md.: 1950) 167, 4271-4275 (2001).
12. Qiao, M., Thornton, A.M. & Shevach, E.M. CD4+ CD25+ [corrected] regulatory T cells render naive CD4+ CD25- T cells anergic and suppressive. Immunology 120, 447-455 (2007).
13. Schmidt, A., Oberle, N. & Krammer, P.H. Molecular mechanisms of treg-mediated T cell suppression. Frontiers in immunology 3, 51 (2012).
14. Vanasek, T.L., Nandiwada, S.L., Jenkins, M.K. & Mueller, D.L. CD25+Foxp3+ regulatory T cells facilitate CD4+ T cell clonal anergy induction during the recovery from lymphopenia. Journal of immunology ( Baltimore , Md.: 1950) 176, 5880-5889 (2006).
15. Curotto de Lafaille, M.A. & Lafaille, J.J. Natural and adaptive foxp3+ regulatory T cells: more of the same or a division of labor? Immunity 30, 626-635 (2009).
16. Haribhai, D., et al. A requisite role for induced regulatory T cells in tolerance based on expanding antigen receptor diversity. Immunity 35, 109-122 (2011).
17. Gottschalk, R.A., Corse, E. & Allison, J.P. TCR ligand density and affinity determine peripheral induction of Foxp3 in vivo. The Journal of experimental medicine 207, 1701-1711 (2010).
18. Kalekar, L.A., et al. CD4(+) T cell anergy prevents autoimmunity and generates regulatory T cell precursors. Nature immunology 17, 304-314 (2016). 19. Lee, T., Sprouse, M.L., Banerjee, P., Bettini, M. & Bettini, M.L. Ectopic Expression of Self- Antigen Drives Regulatory T Cell Development and Not Deletion of
Autoimmune T Cells. J Immunol 199, 2270-2278 (2017).
20. Chai, J.G., et al. Anergic T cells act as suppressor cells in vitro and in vivo. European journal of immunology 29, 686-692 (1999).
21. Adams, C.O., et al. Cbl-b(-/-) T cells demonstrate in vivo resistance to regulatory T cells but a context-dependent resistance to TGF-beta. Journal of immunology
(Baltimore, Md .: 1950) 185, 2051-2058 (2010).
22. Mercadante, E.R. & Lorenz, U.M. Breaking Free of Control: How Conventional T Cells Overcome Regulatory T Cell Suppression. Frontiers in immunology 7, 193 (2016).
23. Shin, D.S., et al. Regulatory T cells suppress CD4+ T cells through NFAT-dependent transcriptional mechanisms. EMBO reports 15, 991-999 (2014).
24. Huang, C.T., et al. Role of LAG-3 in regulatory T cells. Immunity 21, 503-513 (2004).
25. Zhou, S. & Zhou, J. Neuritin, a neurotrophic factor in nervous system physiology.
Current medicinal chemistry 21, 1212-1219 (2014).
26. Nedivi, E., Wu, G.Y. & Cline, H.T. Promotion of dendritic growth by CPG15, an activity-induced signaling molecule. Science ( New York, N. Y .) 281, 1863-1866 (1998).
27. Javaherian, A. & Cline, H.T. Coordinated motor neuron axon growth and
neuromuscular synaptogenesis are promoted by CPG15 in vivo. Neuron 45, 505-512 (2005).
28. Putz, U., Harwell, C. & Nedivi, E. Soluble CPG15 expressed during early
development rescues cortical progenitors from apoptosis. Nature neuroscience 8, 322- 331 (2005).
29. Cantallops, I., Haas, K. & Cline, H.T. Postsynaptic CPG15 promotes synaptic
maturation and presynaptic axon arbor elaboration in vivo. Nature neuroscience 3, 1004-1011 (2000).
30. Vahl, J.C., et al. Continuous T cell receptor signals maintain a functional regulatory T cell pool. Immunity 41, 722-736 (2014).
31. Schietinger, A., Delrow, J.J., Basom, R.S., Blattman, J.N. & Greenberg, P.D. Rescued tolerant CD8 T cells are preprogrammed to reestablish the tolerant state. Science ( New York, N. Y.) 335, 723-727 (2012).
32. Singer, M., et al. A Distinct Gene Module for Dysfunction Uncoupled from
Activation in Tumor-Infiltrating T Cells. Cell 166, 1500-1511. el509 (2016).
33. Mognol GP , e.a. Exhaustion-associated regulatory regions in CD8+ tumor- infiltrating T cells. - PubMed - NCBI. (2017). 34. Schietinger, A., et al. Tumor-Specific T Cell Dysfunction Is a Dynamic Antigen- Driven Differentiation Program Initiated Early during Tumorigenesis. Immunity 45, 389-401 (2016).
35. Mognol, G.P., et al. Exhaustion-associated regulatory regions in CD8(+) tumor- infiltrating T cells. Proceedings of the National Academy of Sciences of the United States of America 114, E2776-e2785 (2017).
36. Choi, S. & Schwartz, R.H. Molecular mechanisms for adaptive tolerance and other T cell anergy models. Seminars in immunology 19, 140-152 (2007).
37. Smigiel, K.S., et al. CCR7 provides localized access to IL-2 and defines
homeostatically distinct regulatory T cell subsets. The Journal of experimental medicine 211, 121-136 (2014).
38. Luo, C.T., Liao, W., Dadi, S., Toure, A. & Li, M.O. Graded Loxol activity in Treg cells differentiates tumour immunity from spontaneous autoimmunity. Nature 529, 532-536 (2016).
39. Lin, Y.C., et al. Effector/memory but not naive regulatory T cells are responsible for the loss of concomitant tumor immunity. Journal of immunology ( Baltimore , Md .: 7950) 182, 6095-6104 (2009).
40. Grinberg-Bleyer, Y., et al. NL-kappaB c-Rel Is Crucial for the Regulatory T Cell Immune Checkpoint in Cancer. Cell 170, 1096-1108.el013 (2017).
41. Campbell, D.J. Control of Regulatory T Cell Migration, Lunction, and Homeostasis.
Journal of immunology ( Baltimore , Md.: 1950) 195, 2507-2513 (2015).
42. Legoux, L.P., et al. CD4+ T Cell Tolerance to Tissue-Restricted Self Antigens Is Mediated by Antigen-Specific Regulatory T Cells Rather Than Deletion. Immunity 43, 896-908 (2015).
43. Knoechel, B., Lohr, J., Kahn, E., Bluestone, J.A. & Abbas, A.K. Sequential
development of interleukin 2-dependent effector and regulatory T cells in response to endogenous systemic antigen. The Journal of experimental medicine 202, 1375-1386 (2005).
44. Nystrom, S.N., et al. Transient Treg-cell depletion in adult mice results in persistent self-reactive CD4(+) T-cell responses. European journal of immunology 44, 3621- 3631 (2014).
45. Kim, J.M., Rasmussen, J.P. & Rudensky, A.Y. Regulatory T cells prevent
catastrophic autoimmunity throughout the lifespan of mice. Nature immunology 8, 191-197 (2007).
46. McGeachy, M.J., Stephens, L.A. & Anderton, S.M. Natural recovery and protection from autoimmune encephalomyelitis: contribution of CD4+CD25+ regulatory cells within the central nervous system. J Immunol 175, 3025-3032 (2005).
47. Zheng, Y., et al. Egr2-dependent gene expression profiling and ChIP-Seq reveal novel biologic targets in T cell anergy. Mol Immunol 55, 283-291 (2013). 48. Zha, Y., et al. T cell anergy is reversed by active Ras and is regulated by
diacylglycerol kinase-alpha. Nature immunology 7, 1166-1173 (2006).
49. Safford, M., et al. Egr-2 and Egr-3 are negative regulators of T cell activation. Nature immunology 6, 472-480 (2005).
50. Wu, Y., et al. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell 126, 375-387 (2006).
51. Yao, J.J., Zhao, Q.R., Liu, D.D., Chow, C.W. & Mei, Y.A. Neuritin Up-regulates Kv4.2 alpha-Subunit of Potassium Channel Expression and Affects Neuronal Excitability by Regulating the Calcium-Calcineurin-NFATc4 Signaling Pathway. The Journal of biological chemistry 291, 17369-17381 (2016).
52. Macian, F., et al. Transcriptional mechanisms underlying lymphocyte tolerance. Cell 109, 719-731 (2002).
53. Staveley-O'Carroll, K., et al. Induction of antigen-specific T cell anergy: An early event in the course of tumor progression. Proceedings of the National Academy of Sciences of the United States ofAmerica 95, 1178-1183 (1998).
54. Schwenk, J., et al. High-resolution proteomics unravel architecture and molecular diversity of native AMPA receptor complexes. Neuron 74, 621-633 (2012).
55. Hill, J.A., et al. Foxp3 transcription-factor-dependent and -independent regulation of the regulatory T cell transcriptional signature. Immunity 27, 786-800 (2007).
56. Zheng, Y., Zha, Y., Driessens, G., Locke, F. & Gajewski, T.F. Transcriptional
regulator early growth response gene 2 (Egr2) is required for T cell anergy in vitro and in vivo. The Journal of experimental medicine 209, 2157-2163 (2012).
57. Pandya, N.J., et al. Noelinl Affects Lateral Mobility of Synaptic AMPA Receptors.
Cell reports 24, 1218-1230 (2018).
58. Henley, J.M. & Wilkinson, K.A. Synaptic AMPA receptor composition in
development, plasticity and disease. Nature reviews. Neuroscience 17, 337-350 (2016).
59. Wei, S.C., et al. Distinct Cellular Mechanisms Underlie Anti-CTLA-4 and Anti-PD-1 Checkpoint Blockade. Cell 170, 1120- 1133.el 117 (2017).
60. Pardoll, D.M. The blockade of immune checkpoints in cancer immunotherapy. Nature reviews. Cancer 12, 252-264 (2012).
61. Fujino, T., et al. CPG15 regulates synapse stability in the developing and adult brain.
Genes & development 25, 2674-2685 (2011).
62. Miyara, M., et al. Functional delineation and differentiation dynamics of human
CD4+ T cells expressing the FoxP3 transcription factor. Immunity 30, 899-911 (2009). 63. Miller, S.D., Karpus, WJ. & Davidson, T.S. Experimental Autoimmune
Encephalomyelitis in the Mouse. Current protocols in immunology/edited by John E.
Coligan ... let al] CHAPTER, Unit-15.11 (2007).
OTHER EMBODIMENTS
While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

What is claimed:
1. A method of treating cancer comprising:
administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity,
thereby, treating cancer.
2. The method of claim 1, wherein the neuritin inhibitor comprises: an anti-neuritin specific antibody, an siRNA, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
3. The method of claim 1, further comprising administering one or more checkpoint inhibitors.
4. The method of claim 3, wherein the one or more checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof.
5. The method of claim 4, wherein the checkpoint inhibitor comprises an inhibitor of PD-1, PD-L1, CTLA4 or combinations thereof.
6. The method of claim 5, wherein the checkpoint inhibitor is an antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof, organic or inorganic molecules, enzymes, interfering RNAs or combinations thereof.
7. The method of any one of claims 1 through 6 further comprises administration of: anti- CD25 antibodies, inhibitors of molecules associated with T cell anergy development, Toll-like receptor 2 (TLR2) agonists, 4- IBB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, and/or cytokines, or combinations thereof.
8. The method of claim 7, wherein cytokines are administered and comprise: interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IL-15), interleukin-21 (IL-21), tumor necrosis factor alpha (TNFa) or combinations thereof.
9. The method of claim 7, wherein molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
10. A method of inducing a tumor specific immune response in a subject, comprising:
administering to a subject, a therapeutically effective amount of a neuritin inhibitor, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity, thereby,
inducing the tumor specific immune response.
11. The method of claim 10, wherein the neuritin inhibitor comprises: an anti-neuritin specific antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides,
peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
12. The method of claim 10 or 11, further comprising administering one or more checkpoint inhibitors.
13. The method of claim 12, wherein the one or more checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof.
14. The method of claim 13, wherein the checkpoint inhibitor comprises an inhibitor of PD- 1, PD-L1, CTLA4 or combinations thereof.
15. The method of any one of claims 10 through 14, further comprising administering one or more inhibitors of molecules associated with T cell anergy development in Foxp3 T cells.
16. The method of claim 15, wherein molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
17. The method of any one of claims 10 through 16 further comprising administration of: anti-CD25 antibodies, Toll-like receptor 2 (TLR2) agonists, 4- IBB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, cytokines or combinations thereof.
18. The method of claim 17, wherein the cytokines are administered and comprise:
interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IL-15), interleukin-21 (IL-21), tumor necrosis factor alpha (TNFa) or combinations thereof.
19. A pharmaceutical composition comprising a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
20. The pharmaceutical composition of claim 19, wherein the neuritin inhibitor and the one or more checkpoint inhibitors comprise: an antibody or fragments thereof, antisense
oligonucleotide, gene-editing agents, nucleases, small interfering RNA, single chain antibody, Fab fragments, polypeptides, fusion polypeptides, peptides, pep tidomime tics or combinations thereof.
21. The pharmaceutical composition of claim 19, wherein the checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof.
22. A pharmaceutical composition comprising an anti-neuritin inhibitor and a first and second checkpoint inhibitor.
23. The pharmaceutical composition of claim 22, wherein the neuritin inhibitor and the checkpoint inhibitors comprise: an antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides, peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
24. The pharmaceutical composition of claim 22, wherein the checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or any combination thereof.
25. The pharmaceutical composition of claim 22, wherein the first checkpoint inhibitor is an inhibitor of PD-1 and the second checkpoint inhibitor is an inhibitor of CTLA4.
26. The pharmaceutical composition of any one of claims 19 through 25, wherein the composition is administered intra-muscularly, systemically, intraperitoneally or combinations thereof.
27. A method of abrogating T cell anergy, comprising administering to a subject in need thereof, a pharmaceutical composition comprising a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
28. A method of modulating T regulatory (Treg) cell function, comprising administering to a subject in need thereof, a pharmaceutical composition comprising a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors.
29. A method of inducing a tumor specific immune response in a subject, comprising:
administering to a subject, a therapeutically effective amount of a neuritin inhibitor and one or more checkpoint inhibitors, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity, thereby,
inducing the tumor specific immune response.
30. The method of claim 29, wherein the neuritin inhibitor comprises: an anti-neuritin specific antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides,
peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
31. The method of claim 29, wherein the one or more checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof.
32. The method of claim 31, wherein the checkpoint inhibitor comprises an inhibitor of PD- 1, PD-L1, CTLA4 or combinations thereof.
33. The method of any one of claims 29 through 32, further comprising administering one or more inhibitors of molecules associated with T cell anergy development in Foxp3 T cells.
34. The method of claim 33, wherein molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
35. The method of any one of claims 29 through 34, further comprising administration of: anti-CD25 antibodies, Toll-like receptor 2 (TLR2) agonists, 4- IBB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, cytokines or combinations thereof.
36. The method of claim 35, wherein the cytokines are administered and comprise:
interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IL-15), interleukin-21 (IL-21), tumor necrosis factor alpha (TNFa) or combinations thereof.
37. The method of any one of claims 29-36, further comprising administering a tumor specific antigen to the subject.
38. A method of inducing a tumor specific immune response in a subject, comprising:
isolating T cells from a biological sample from the subject,
culturing the T cells with an effective amount of a neuritin inhibitor and one or more checkpoint inhibitors, wherein the neuritin inhibitor abrogates anergic T cell and/or T regulatory cell function or activity,
adoptively transferring the T cells to the subject thereby,
inducing the tumor specific immune response.
39. The method of claim 38, further comprising culturing the T cells with tumor antigen or tumor cells obtained from the subject.
40. The method of claim 38, wherein the neuritin inhibitor comprises: an anti-neuritin specific antibody or fragments thereof, antisense oligonucleotides, an siRNA, gene editing agents, nucleases, oligonucleotides, polynucleotides, small molecules, peptides,
peptidomimetics, natural ligands and derivatives of natural ligands, oligonucleotides or combinations thereof.
41. The method of claim 38, wherein the one or more checkpoint inhibitors comprise an inhibitor of: PD-1, PD-L1, PD-L2, CTLA4, TIM-3, LAG-3, CEACAM-1, CEACAM-5, VISTA, BTLA, TIGIT, LAIR1, CD 160, 2B4, TGFR-b or combinations thereof.
42. The method of claim 41, wherein the checkpoint inhibitor comprises an inhibitor of PD- 1, PD-L1, CTLA4 or combinations thereof.
43. The method of any one of claims 38 through 42, further comprising administering one or more inhibitors of molecules associated with T cell anergy development in Foxp3 T cells.
44. The method of claim 43, wherein molecules associated with T cell anergy development comprise: Cbl-b, TRAF6 or SHP-1.
45. The method of any one of claims 38 through 44, further comprising administration of: anti-CD25 antibodies, Toll-like receptor 2 (TLR2) agonists, 4- IBB agonists, 0X40 agonists, tumor necrosis factor receptor 2 (TNFR2) agonists, cytokines or combinations thereof.
46. The method of claim 45, wherein the cytokines are administered and comprise:
interleukin-2 (IL-2), interleukin- 6 (IL-6), interleukin- 4 (IL-4), interleukin- 7 (IL-7), interleukin- 15 (IE- 15), interleukin-21 (IL-21), tumor necrosis factor alpha (TNFa) or combinations thereof.
PCT/US2020/013151 2019-01-11 2020-01-10 Neuritin regulation of t cell anergy and t regulatory cell function Ceased WO2020146772A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962791663P 2019-01-11 2019-01-11
US62/791,663 2019-01-11

Publications (1)

Publication Number Publication Date
WO2020146772A1 true WO2020146772A1 (en) 2020-07-16

Family

ID=71521182

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/013151 Ceased WO2020146772A1 (en) 2019-01-11 2020-01-10 Neuritin regulation of t cell anergy and t regulatory cell function

Country Status (1)

Country Link
WO (1) WO2020146772A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100040636A1 (en) * 2005-09-09 2010-02-18 The Johns Hopkins University Manipulation of Regulatory T Cell and Dc Function By Targeting Neuritin Gene Using Antibodies, Agonists and Antagonists
WO2018186924A1 (en) * 2017-01-17 2018-10-11 The University Of Chicago Dysfunctional antigen-specific cd8+ t cells in the tumor microenvironment
WO2018191676A1 (en) * 2017-04-13 2018-10-18 Galera Labs, Llc Combination cancer immunotherapy with pentaaza macrocyclic ring complex
US20180312929A1 (en) * 2013-03-15 2018-11-01 The University Of Chicago Methods and compositions related to t-cell activity
US20180312809A1 (en) * 2006-09-13 2018-11-01 The Trustees Of Columbia University In The City Of New York Agents and methods to elicit anti-tumor immune response

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100040636A1 (en) * 2005-09-09 2010-02-18 The Johns Hopkins University Manipulation of Regulatory T Cell and Dc Function By Targeting Neuritin Gene Using Antibodies, Agonists and Antagonists
US20180312809A1 (en) * 2006-09-13 2018-11-01 The Trustees Of Columbia University In The City Of New York Agents and methods to elicit anti-tumor immune response
US20180312929A1 (en) * 2013-03-15 2018-11-01 The University Of Chicago Methods and compositions related to t-cell activity
WO2018186924A1 (en) * 2017-01-17 2018-10-11 The University Of Chicago Dysfunctional antigen-specific cd8+ t cells in the tumor microenvironment
WO2018191676A1 (en) * 2017-04-13 2018-10-18 Galera Labs, Llc Combination cancer immunotherapy with pentaaza macrocyclic ring complex

Similar Documents

Publication Publication Date Title
TWI725966B (en) Combination therapy for cancer
US11207393B2 (en) Regulatory T cell PD-1 modulation for regulating T cell effector immune responses
EP3433365B1 (en) T-cell exhaustion state-specific gene expression regulators and uses thereof
US20200323905A1 (en) Methods and compositions for modulating the immune system
US20240262909A1 (en) Tim-3 modulates anti-tumor immunity by regulating inflammasome activation
WO2019084234A1 (en) Methods and compositions for treating cd33+ cancers and improving in vivo persistence of chimeric antigen receptor t cells
KR20200029544A (en) Immunomodulatory retinoid and rexinoid compounds combined with immunomodulators for cancer immunotherapy
US20250011425A1 (en) Compositions and methods for improved t cells
EP3707164A1 (en) Inhibition of ctla-4 and/or pd-1 for regulation of t cells
US20210355221A1 (en) Targeting the Non-Canonical NFkB Pathway in Cancer Immunotherapy
US20200056174A1 (en) Compositions and methods of treating cancer
Li et al. 34th annual meeting & pre-conference programs of the society for immunotherapy of cancer (SITC 2019): part 2
US20240226165A1 (en) Methods of Producing Improved Immune Cell Populations
Dong et al. NK Receptors Replace CD28 As the Dominant Source of Signal 2 for Cognate Recognition of Cancer Cells by TAA-specific Effector CD8+ T Cells
McGraw The Role of JAML-CXADR Interactions in Antitumor Immunity
Christmas Epigenetic reprogramming of myeloid-derived suppressor cells sensitizes breast and pancreatic cancers to immune checkpoint inhibition
KR20240043774A (en) Universal receptor immune cell therapy
EP4554971A2 (en) Chimeric antigen receptors comprising a tmigd2 costimulatory domain and associated methods of using the same
Plote Inhibition of Urothelial Carcinoma By Type I Interferon Activation of The Innate and Adaptive Immune Response
Valia Emerging Natural Killer Cell Immunotherapy for Acute Myeloid Leukemia
Mbofung Developing Novel Approaches to Improve Response to T Cell Based Cancer Immunotherapy
Pardee Cancer immunotherapy targeting T cell costimulatory molecules
Tsai Identification and Characterization of Regorafenib and NU7441 as Targeted Immunotherapies for Melanoma
Torrejon Castro Interrogating resistance mechanisms to PD-1 blockade therapy
Chacon et al. Clinical Success of Adoptive Cell Transfer Therapy Using Tumor Infiltrating Lymphocytes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20739224

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20739224

Country of ref document: EP

Kind code of ref document: A1