WO2020109344A1 - Occular administration device for antisense oligonucleotides - Google Patents
Occular administration device for antisense oligonucleotides Download PDFInfo
- Publication number
- WO2020109344A1 WO2020109344A1 PCT/EP2019/082645 EP2019082645W WO2020109344A1 WO 2020109344 A1 WO2020109344 A1 WO 2020109344A1 EP 2019082645 W EP2019082645 W EP 2019082645W WO 2020109344 A1 WO2020109344 A1 WO 2020109344A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- oligonucleotide
- seq
- nucleosides
- antisense oligonucleotide
- htra1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0048—Eye, e.g. artificial tears
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
Definitions
- the present invention relates to a pre-filled syringe device for ophthalmic administration of antisense oligonucleotides, such as Htral oligonucleotide antagonists.
- AMD age-related macular degeneration
- Nucleic acid therapies have also been investigated in relation to the treatment of disease indications in the eye for a review see Paneda et al., 2012, Ocular Diseases, Chapter 7 Recent advances in Ocular Nucleic-Acid Therapies: The Silent Era, Edited by Adedayo Adio, Publisher.
- WO2018/00205 and PCT/2018/064221 describe antisense oligonucleotides targeting HTRA1 , and their use in treatment of macular degeneration via an intraocular injection of a dosage of from about 10pg - 200 pg.
- the present invention provides a pre-loaded syringe device for the intraocular injection of antisense oligonucleotide therapeutics into the vitreous humor of the eye, and may be used for administering antisense oligonucleotide antagonists of HTRA1 in vivo, such as to patients who are suffering from macular degeneration, such as geographic atrophy.
- the present invention provides a pre-loaded syringe device, for intraocular injection of an antisense oligonucleotide therapeutic, suitably into the vitreous (intravitreal injection), wherein the pre-loaded syringe comprises a unit dose of the antisense oligonucleotide therapeutic.
- the antisense oligonucleotide is suitably in an ophthalmic solution, such as phosphate buffered saline.
- the antisense oligonucleotide is an antagonist of HTRA1 expression - i.e. an antisense oligonucleotide HTRA1 antagonist.
- HTRA1 refers to the human high temperature requirement A serine protease (HTRA1 ):
- HTRA1 antagonist is complementary to and is capable of inhibiting the expression of the human HTRA1 mRNA or pre-mRNA.
- the invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula, TTCtatctacgcaTTG (SEQ ID NO 67), wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides, and cytosine residues are optionally 5-methyl cytosine.
- the antisense oligonucleotide of SEQ ID NO 67 is: T s T s m C s t s a s t s C s t s a s m C s g s C s a s T s T s G (Compound # NO 67,1 ) wherein capital letters represent beta-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, subscript s represents a phosphorothioate internucleoside linkage, and m C represent 5 methyl cytosine beta-D-oxy LNA nucleosides, and m c represents 5 methyl cytosine DNA nucleoside.
- the invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula, CTTCttctatctacgcAT (SEQ ID NO 73), wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides, and cytosine residues are optionally 5-methyl cytosine.
- CTTCttctatctacgcAT SEQ ID NO 73
- the antisense oligonucleotide of SEQ ID NO 73 is m C s T s T s m C s t s t s C s t s a s t s C s t s a s m C s g s C s A s T (Compound # NO 73,1 ), wherein capital letters represent beta-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, subscript s represents a phosphorothioate internucleoside linkage, and m C represent 5 methyl cytosine beta-D-oxy LNA nucleosides, and m c represents 5 methyl cytosine DNA nucleoside.
- the invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula, TACTttaatagcTCAA (SEQ ID NO 86), wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides, and cytosine residues are optionally 5-methyl cytosine.
- TACTttaatagcTCAA SEQ ID NO 86
- the antisense oligonucleotide of SEQ ID NO 86 is T s A s m C s T s t s t s a s a s t s a s g s C s T s m C s A s A (Compound # NO 86,1 ) wherein capital letters represent beta-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, subscript s represents a phosphorothioate internucleoside linkage, and m C represent 5 methyl cytosine beta-D-oxy LNA nucleosides.
- the invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula TATttacctggTTgTT (SEQ ID NO 232, Comp A) wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides.
- the invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula
- a capital letter represents a beta-D-oxy LNA nucleoside unit
- a lower case letter represents a DNA nucleoside unit
- subscript s represents a phosphorothioate
- the invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula AtATttacctgGTTgTT (SEQ. ID NO 233 compound B) wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides.
- the invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula
- the invention provides for a blister pack comprising the pre-filled syringe according to the invention.
- the invention provides for a sterile package comprising (enclosing) the pre-filled syringe according to the invention.
- the sterile package may be a blister pack, and keeps the pre-filled syringe in sterile conditions prior to use.
- the invention provides for a method for treating a patient suffering from macular
- said method comprising the step of administering an ophthalmic solution comprising an effective amount of an antisense oligonucleotide HTRA1 antagonist to the patient, using the pre-filled syringe according to the invention.
- the macular degeneration is selected from the group consisting of wet age related macular degeneration (wAMD), dry age related macular degeneration (dAMD), geographic atrophy, early AMD, and intermediate AMD).
- wAMD wet age related macular degeneration
- dAMD dry age related macular degeneration
- geographic atrophy early AMD, and intermediate AMD.
- Figure 1 shows a view from a side of a syringe 1 comprising a body 2, plunger 4, backstop 6 and a sealing device 8.
- FIG 2 shows a cross section through the syringe 1 of Figure 1 from above.
- the syringe 1 is suitable for use in an ophthalmic injection.
- the syringe 1 comprises a body 2, a stopperlO and a plunger 4.
- the syringe 1 extends along a first axis A.
- the body 2 comprises an outlet 12 at an outlet end 14 and the stopper 10 is arranged within the body 2 such that a front surface 16 of the stopper 10 and the body 2 define a variable volume chamber 18.
- the variable volume chamber 18 contains an injectable medicament 20 comprising an ophthalmic solution comprising a therapeutic antisense oligonucleotide such as an HTRA1 antagonist.
- the injectable fluid 20 can be expelled though the outlet 12 by movement of the stopper 10 towards the outlet end 14 thereby reducing the volume of the variable volume chamber 18.
- the plunger 4 comprises a plunger contact surface 22 at a first end 24 and a rod 26 extending between the plunger contact surface 22 and a rear portion 25.
- the plunger contact surface 22 is arranged to contact the stopper 10, such that the plunger 4can be used to move the stopper 10 towards the outlet end 14 of the body 2.
- Such movement reduces the volume of the variable volume chamber 18 and causes fluid therein to be expelled though the outlet.
- the backstop 6 is attached to the body 2 by coupling to a terminal flange 28 of the body 2.
- the backstop 6 includes sandwich portion 30 which is adapted to substantially sandwich at least some of the terminal flange 28 of the body 2.
- the backstop 6 is adapted to be coupled to the body 2 from the side by leaving one side of the backstop 6 open so that the backstop 6 can be fitted to the syringe 2.
- the body 2 defines a substantially cylindrical bore 36 which has a bore radius.
- the rod 26 comprises a rod shoulder32 directed away from the outlet end 14.
- the rod shoulder 32 extends from to a rod shoulder radius from the first axis A which is such that it is slightly less than the bore radius so that the shoulder fits within the bore 36.
- the backstop 6 includes a backstop shoulder 34 directed towards the outlet end 14.
- the shoulders 32, 34 are configured to cooperate to substantially prevent movement of the rod 26 away from the outlet end 14 when the backstop shoulder 34 and rod shoulder 32 are in contact.
- the backstop shoulder 34 extends from outside the bore radius to a radius less than the rod shoulder radius so that the rod shoulder 32 cannot pass the backstop shoulder 34 by moving along the first axis A.
- the rod shoulder 3 2 is substantially disc, or ring, shaped and the backstop shoulder 34 includes an arc around a rear end 38 of the body 2.
- the backstop 6 also includes two finger projections 40 which extend in opposite directions away from the body 2 substantially perpendicular to the first axis A to facilitate manual handling of the syringe 1 during use.
- Figure 3 shows a perspective view of the plunger 4 of figure 1 showing the plunger contact surface 22 at the first end 24 of the plunger 4.
- the rod 26 extends from the first end 24 to the rear portion 25.
- the rear portion 25 includes a disc shaped flange 42 to facilitate user handling of the device.
- the flange 42 provides a larger surface area for contact by the user than a bare end of the rod 26.
- Figure 4 shows a cross section though a syringe body 2 and rod 26.
- the rod 26 includes four longitudinal ribs 44 and the angle between the ribs is 90°.
- Figure 5 shows a detailed view of a stopper 10 showing a conical shaped front surface 16 and three circumferential ribs 52, 54, 56 around a substantially cylindrical body 58.
- the axial gap between the first rib 52 and the last rib 56 is about 3mm.
- the rear surface 60 of the stopper 10 includes a substantially central recess 62.
- the central recess 62 includes an initial bore 64 having a first diameter.
- a Htral antagonist compound (Compound ID NO 67,1 ).
- the compound may be in the form of a pharmaceutical salt, such as a sodium salt or a potassium salt.
- a Htral antagonist compound (Compound ID NO 86,1 ).
- the compound may be in the form of a pharmaceutical salt, such as a sodium salt or a potassium salt.
- a Htral antagonist compound (Compound ID NO 73,1 ).
- the compound may be in the form of a pharmaceutical salt, such as a sodium salt or a potassium salt.
- Figure 10D Dose response of HTRA1 mRNA level upon treatment of human primary RPE cells with LNA oligonucleotides, , 10 days of treatment. Scrambled is a control oligo with a scrambled sequence not related to the Htral target sequence.
- NHP PK/PD study IVT administration, 25pg/eye.
- D-E) Quantification of HTRA1 protein level in retina and vitreous, respectively, by IP-MS. Dots show data for individual animals. Error bars show standard errors for technical replicates (n 3).
- F-G Reduction in HTRA1 protein level in retina and vitreous, respectively illustrated by western blot.
- FIG. 12A Compounds #15,3 and #17 were administered intravitreally in cynomolgus monkeys, and aqueous humor samples were collected at days 3, 8, 15, and 22 post injection. Proteins from undiluted samples were analyzed by capillary electrophoresis using a Peggy Sue device (Protein Simple). HTRA1 was detected using a custom-made polycolonal rabbit antiserum. Data from animals #J60154 (Vehicle), J60158 (C. Id#15,3), J60162 (C. Id#17) are presented.
- FIG 12B Signal intensities were quantified by comparison to purified recombinant (S328A mutant) HTRA1 protein (Origene, #TP700208). The calibration curve is shown here.
- Figure 12C Top panel: Calculated HTRA1 aqueous humor concentration from individual animal was plotted against time post injection. Bottom panel: average HTRA1 concentration for the vehicle group at each time point was determined and corresponding relative concentration in treated animals calculated. Open circle: individual value, closed circle: group average. % HTRA1 reduction for day 22 is indicated.
- FIG. 13 HTRA1 mRNA plotted against HTRA1 protein levels in aqueous humor (blue diamonds) or in retina (red squares) in cynomolgus monkeys treated with various LNA molecules targeting the HTRA1 transcript. Values are expressed as percentage normalized to PBS controls.
- FIG. 14 Correlation of HTRA1 protein in aqueous humor with (A) HTRA1 protein in retina and (B) HTRA1 mRNA in retina in cynomolgus monkeys treated with various LNA molecules targeting the HTRA1 transcript. Values are expressed as percentage normalized to PBS controls.
- oligonucleotide as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides.
- the oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated.
- the oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.
- Antisense oligonucleotide as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid.
- the antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs.
- the antisense oligonucleotides of the present invention are single stranded.
- single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than 50% across of the full length of the oligonucleotide
- sequence refers to the region of the oligonucleotide which is complementary to the target nucleic acid.
- the term is used interchangeably herein with the term“contiguous nucleobase sequence” and the term“oligonucleotide motif sequence”.
- nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence.
- the oligonucleotide comprises the contiguous nucleotide sequence, such as a F-G-F’ gapmer region, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence.
- the nucleotide linker region may or may not be complementary to the target nucleic acid.
- the contiguous nucleotide sequence is 100% complementary to the target nucleic acid.
- Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides.
- nucleotides such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides).
- Nucleosides and nucleotides may also interchangeably be referred to as“units” or“monomers”.
- modified nucleoside or“nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety.
- the modified nucleoside comprise a modified sugar moiety.
- modified nucleoside may also be used herein interchangeably with the term“nucleoside analogue” or modified“units” or modified“monomers”.
- Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.
- modified internucieoside linkage is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together.
- the oligonucleotides of the invention may therefore comprise modified internucieoside linkages.
- the modified internucieoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage.
- the internucieoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides.
- Modified internucieoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides, such as region F and F’.
- the oligonucleotide comprises one or more internucieoside linkages modified from the natural phosphodiester, such one or more modified internucieoside linkages that is for example more resistant to nuclease attack.
- Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art.
- SVPD snake venom phosphodiesterase
- Internucieoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucieoside linkages.
- At least 50% of the internucieoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages.
- all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof are nuclease resistant internucleoside linkages. It will be recognized that, in some embodiments the nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate, may be phosphodiester.
- a preferred modified internucleoside linkage is phosphorothioate.
- Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture.
- at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.
- all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof are phosphorothioate.
- Nuclease resistant linkages such as phosphorothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers.
- Phosphorothioate linkages may, however, also be useful in non-nuclease recruiting regions and/or affinity enhancing regions such as regions F and F’ for gapmers.
- Gapmer oligonucleotides may, in some embodiments comprise one or more phosphodiester linkages in region F or F’, or both region F and F’, which the internucleoside linkage in region G may be fully phosphorothioate.
- all the internucleoside linkages in the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate linkages.
- nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization.
- pyrimidine e.g. uracil, thymine and cytosine
- nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization.
- nucleobase refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid
- the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5- thiazolo-uracil, 2-thio-uracil, 2’thio-thymine, inosine, diaminopurine, 6-aminopurine, 2- aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.
- a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromour
- the nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function.
- the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine.
- 5-methyl cytosine LNA nucleosides may be used.
- modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages.
- chimeric oligonucleotide is a term that has been used in the literature to describe oligonucleotides with modified nucleosides.
- Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T)/uracil (U).
- G guanine
- A adenine
- T thymine
- U uracil
- oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009)
- % complementary refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to ( i.e . form Watson Crick base pairs with) a contiguous sequence of nucleotides, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid or target sequence).
- a nucleic acid molecule e.g. oligonucleotide
- the percentage is calculated by counting the number of aligned bases that form pairs between the two sequences (when aligned with the target sequence 5’-3’ and the oligonucleotide sequence from 3’-5’), dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch.
- insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence.
- nucleic acid molecule refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g.
- oligonucleotide which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif).
- nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
- hybridizing or“hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex.
- the affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T m ) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions T m is not strictly proportional to the affinity (Mergny and Lacroix, 2003 , Oligonucleotides 13:515-537).
- AG° is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37°C.
- the hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero.
- AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et a!., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements.
- ITC isothermal titration calorimetry
- oligonucleotides of the present invention hybridize to a target nucleic acid with estimated DQ° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length.
- the degree or strength of hybridization is measured by the standard state Gibbs free energy DQ°.
- the oligonucleotides may hybridize to a target nucleic acid with estimated DQ° values below the range of -10 kcal, such as below -15 kcal, such as below - 20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length.
- the oligonucleotides hybridize to a target nucleic acid with an estimated DQ° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or- 16 to -27 kcal such as -18 to -25 kcal.
- the oligonucleotide comprises a contiguous nucleotide region which is complementary to or hybridizes to a sub-sequence of the target nucleic acid molecule.
- target sequence refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the contiguous nucleotide region or sequence of the oligonucleotide of the invention.
- the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide region or sequence of the oligonucleotide of the invention.
- the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention.
- the oligonucleotide of the invention comprises a contiguous nucleotide region which is complementary to the target nucleic acid, such as a target sequence.
- the oligonucleotide comprises a contiguous nucleotide region of at least 10 nucleotides which is complementary to or hybridizes to a target sequence present in the target nucleic acid molecule.
- the contiguous nucleotide region (and therefore the target sequence) comprises of at least 10 contiguous nucleotides, such as 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, contiguous nucleotides, such as from 12-22, such as from 14-18 contiguous nucleotides.
- the target sequence is present within a sequence selected from the group consisting of SEQ ID NO 113, 114, 1 15, 1 16, 1 17 and 118.
- the target nucleic acid is a nucleic acid which encodes mammalian HTRA1 and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence.
- the target may therefore be referred to as an HTRA1 target nucleic acid.
- the target nucleic acid encodes an HTRA1 protein, in particular mammalian HTRA1 , such as human HTRA1 (See for example tables 1 & 2 which provides the mRNA and pre-mRNA sequences for human HTRA1 ).
- the target nucleic acid is selected from the group consisting of SEQ ID NO: 1 or 2 or naturally occurring variants thereof (e.g. sequences encoding a mammalian HTRA1 protein.
- a target cell is a cell which is expressing the HTRA1 target nucleic acid.
- the target nucleic acid is the HTRA1 mRNA, such as the HTRA1 pre-mRNA or HTRA1 mature mRNA.
- the poly A tail of HTRA1 mRNA is typically disregarded for antisense oligonucleotide targeting.
- the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
- the target sequence may be a sub-sequence of the target nucleic acid.
- the oligonucleotide or contiguous nucleotide region is fully complementary to, or only comprises one or two mismatches to an HTRA1 sub-sequence, such as a sequence selected from the group consisting of SEQ ID NO 1 13, 1 14, 115, 116, 117 or 231.
- the target sequence may be a sub-sequence of the target nucleic acid.
- the oligonucleotide or contiguous nucleotide region is fully complementary to, or only comprises one or two mismatches to an HTRA1 sub-sequence, such as a sequence selected from the group consisting of SEQ ID NO 124 - 230. In some embodiments the oligonucleotide or contiguous nucleotide region is fully complementary to, or only comprises one or two mismatches to an HTRA1 sub-sequence SEQ ID NO 231.
- Complementarity to the target or sub-sequence thereof is measured over the length of the oligonucleotide, or contiguous nucleotide region thereof.
- the oligonucleotide of the invention is typically capable of inhibiting the expression of the HTRA1 target nucleic acid in a cell which is expressing the HTRA1 target nucleic acid.
- the contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the HTRA1 target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non
- the target nucleic acid may, in some embodiments, be a RNA or DNA, such as a messenger RNA, such as a mature mRNA or a pre-mRNA.
- the target nucleic acid is a RNA or DNA which encodes mammalian HTRA1 protein, such as human HTRA1 , e.g. the human HTRA1 mRNA sequence, such as that disclosed as SEQ ID NO 1 (NM_002775.4, Gl:190014575). Further information on exemplary target nucleic acids is provided in tables 1 & 2. Table 1. Genome and assembly information for human and Cyno HTRA1.
- Fwd forward strand.
- the genome coordinates provide the pre-mRNA sequence (genomic sequence).
- the NCBI reference provides the mRNA sequence (cDNA sequence).
- naturally occurring variant refers to variants of HTRA1 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.
- the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian HTRA1 target nucleic acid, such as a target nucleic acid selected form the group consisting of SEQ ID NO 1 ,2, 3 & 4.
- a mammalian HTRA1 target nucleic acid such as a target nucleic acid selected form the group consisting of SEQ ID NO 1 ,2, 3 & 4.
- modulation of expression is to be understood as an overall term for an oligonucleotide’s ability to alter the amount of the target nucleic acid or target protein, such as e.g. the level of HTRA1 when compared to the amount of the target HTRA1 before administration of the oligonucleotide.
- modulation of expression may be determined by reference to a control experiment where the oligonucleotide of the invention is not administered.
- One type of modulation is an oligonucleotide’s ability to inhibit, down- regulate, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of HTRA1 , e.g. by degradation of mRNA or blockage of transcription.
- the antisense oligonucleotide of the invention are capable of inhibiting, down-regulating, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of HTRA1.
- a high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (T m ).
- a high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1.5 to +10°C and most preferably between+3 to +8°C per modified nucleoside.
- Numerous high affinity modified nucleosides are known in the art and include for example, many 2’ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr.
- the oligomer of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
- nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
- Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA).
- HNA hexose ring
- LNA ribose ring
- UPA unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons
- Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO201 1/017521 ) or tricyclic nucleic acids (WO2013/154798).
- Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.
- Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2’-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2’, 3’, 4’ or 5’ positions.
- a 2’ sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2’ position (2’ substituted nucleoside) or comprises a 2’ linked biradicle capable of forming a bridge between the 2’ carbon and a second carbon in the ribose ring, such as LNA (2’ - 4’ biradicle bridged) nucleosides.
- the 2’ modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide.
- 2’ substituted modified nucleosides are 2’-0-alkyl-RNA, 2’-0-methyl-RNA, 2’- alkoxy-RNA, 2’-0-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA, and 2’-F-ANA nucleoside.
- 2’ substituted does not include 2’ bridged molecules like LNA.
- LNA Locked Nucleic Acids
- A“LNA nucleoside” is a 2’- modified nucleoside which comprises a biradical linking the C2’ and C4’ of the ribose sugar ring of said nucleoside (also referred to as a“2’- 4’ bridge”), which restricts or locks the conformation of the ribose ring.
- These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.
- BNA bicyclic nucleic acid
- the locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide/complement duplex.
- Non limiting, exemplary LNA nucleosides are disclosed in WO 99/014226, WO
- LNA nucleosides are beta-D-oxy-LNA, 6’-methyl-beta-D-oxy LNA such as (S)-6’-methyl-beta-D-oxy-LNA (ScET) and ENA.
- a particularly advantageous LNA is beta-D-oxy-LNA.
- the RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule.
- WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH.
- an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with
- the antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof may be a gapmer.
- the antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation.
- a gapmer oligonucleotide comprises at least three distinct structural regions a 5’-flank, a gap and a 3’-flank, F-G-F’ in the‘5 -> 3’ orientation.
- The“gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H.
- the gap region is flanked by a 5’ flanking region (F) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3’ flanking region (F’) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides.
- the one or more sugar modified nucleosides in region F and F’ enhance the affinity of the oligonucleotide for the target nucleic acid ( i.e . are affinity enhancing sugar modified nucleosides).
- the one or more sugar modified nucleosides in region F and F’ are 2’ sugar modified nucleosides, such as high affinity 2’ sugar modifications, such as independently selected from LNA and 2’-MOE.
- the 5’ and 3’ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5’ (F) or 3’ (F’) region respectively.
- the flanks may further defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5’ end of the 5’ flank and at the 3’ end of the 3’ flank.
- Regions F-G-F’ form a contiguous nucleotide sequence.
- Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F’.
- the overall length of the gapmer design F-G-F’ may be, for example 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, Such as from 14 to17, such as 16 to18 nucleosides.
- the gapmer oligonucleotide of the present invention can be represented by the following formulae:
- the overall length of the gapmer regions F-G-F’ is at least 12, such as at least 14 nucleotides in length.
- Regions F, G and F’ are further defined below and can be incorporated into the F-G-F’ formula.
- Region G is a region of nucleosides which enables the oligonucleotide to recruit RNaseH, such as human RNase H1 , typically DNA nucleosides.
- RNaseH is a cellular enzyme which recognizes the duplex between DNA and RNA, and enzymatically cleaves the RNA molecule.
- gapmers may have a gap region (G) of at least 5 or 6 contiguous DNA nucleosides, such as 5 - 16 contiguous DNA nucleosides, such as 6 - 15 contiguous DNA nucleosides, such as 7-14 contiguous DNA nucleosides, such as 8 - 12 contiguous DNA nucleotides, such as 8 - 12 contiguous DNA nucleotides in length.
- G gap region
- traditional gapmers have a DNA gap region, there are numerous examples of modified nucleosides which allow for RNaseH recruitment when they are used within the gap region.
- Modified nucleosides which have been reported as being capable of recruiting RNaseH when included within a gap region include, for example, alpha-L-LNA, C4’ alkylated DNA (as described in PCT/EP2009/050349 and Vester et a!., Bioorg. Med. Chem. Lett. 18 (2008) 2296 - 2300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661 ), UNA
- UNA unlocked nucleic acid
- the modified nucleosides used in such gapmers may be nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region, i.e. modifications which allow for RNaseH recruitment).
- the DNA Gap region (G) described herein may optionally contain 1 to 3 sugar modified nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region.
- gapmers with a gap region comprising one or more 3’endo modified nucleosides are referred to as“gap-breaker” or“gap-disrupted” gapmers, see for example WO2013/022984.
- Gap-breaker oligonucleotides retain sufficient region of DNA nucleosides within the gap region to allow for RNaseH recruitment. The ability of gapbreaker
- oligonucleotide design to recruit RNaseH is typically sequence or even compound specific - see Rukov et al. 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487, which discloses“gapbreaker” oligonucleotides which recruit RNaseH which in some instances provide a more specific cleavage of the target RNA.
- Modified nucleosides used within the gap region of gap- breaker oligonucleotides may for example be modified nucleosides which confer a 3’endo confirmation, such 2’ -O-methyl (OMe) or 2’-0-MOE (MOE) nucleosides, or beta-D LNA nucleosides (the bridge between C2’ and C4’ of the ribose sugar ring of a nucleoside is in the beta conformation), such as beta-D-oxy LNA or ScET nucleosides.
- 2’ -O-methyl (OMe) or 2’-0-MOE (MOE) nucleosides or beta-D LNA nucleosides (the bridge between C2’ and C4’ of the ribose sugar ring of a nucleoside is in the beta conformation), such as beta-D-oxy LNA or ScET nucleosides.
- Region F is positioned immediately adjacent to the 5’ DNA nucleoside of region G.
- the 3’ most nucleoside of region F is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.
- Region F’ is positioned immediately adjacent to the 3’ DNA nucleoside of region G.
- the 5’ most nucleoside of region F’ is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.
- Region F is 1 - 8 contiguous nucleotides in length, such as 2-6, such as 3-4 contiguous nucleotides in length.
- the 5’ most nucleoside of region F is a sugar modified nucleoside.
- the two 5’ most nucleoside of region F are sugar modified nucleoside.
- the 5’ most nucleoside of region F is an LNA nucleoside.
- the two 5’ most nucleoside of region F are LNA nucleosides.
- the two 5’ most nucleoside of region F are 2’ substituted nucleoside nucleosides, such as two 3’ MOE nucleosides.
- the 5’ most nucleoside of region F is a 2’ substituted nucleoside, such as a MOE nucleoside.
- Region F’ is 2 - 8 contiguous nucleotides in length, such as 3-6, such as 4-5 contiguous nucleotides in length.
- the 3’ most nucleoside of region F’ is a sugar modified nucleoside.
- the two 3’ most nucleoside of region F’ are sugar modified nucleoside.
- the two 3’ most nucleoside of region F’ are LNA nucleosides.
- the 3’ most nucleoside of region F’ is an LNA nucleoside.
- the two 3’ most nucleoside of region F’ are 2’ substituted nucleoside nucleosides, such as two 3’ MOE nucleosides.
- the 3’ most nucleoside of region F’ is a 2’ substituted nucleoside, such as a MOE nucleoside. It should be noted that when the length of region F or F’ is one, it is advantageously an LNA nucleoside.
- region F and F’ independently consists of or comprises a contiguous sequence of sugar modified nucleosides.
- the sugar modified nucleosides of region F may be independently selected from 2’-0-alkyl-RNA units, 2’-0- methyl-RNA, 2’-amino-DNA units, 2’-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2’-fluoro-ANA units.
- region F and F’ independently comprises both LNA and a 2’ substituted modified nucleosides (mixed wing design).
- region F and F’ consists of only one type of sugar modified nucleosides, such as only MOE or only beta-D-oxy LNA or only ScET. Such designs are also termed uniform flanks or uniform gapmer design.
- all the nucleosides of region F or F’, or F and F’ are LNA
- nucleosides such as independently selected from beta-D-oxy LNA, ENA or ScET
- region F consists of 1-5, such as 2-4, such as 3-4 such as 1 , 2, 3, 4 or 5 contiguous LNA nucleosides. In some embodiments, all the nucleosides of region F and F’ are beta-D-oxy LNA nucleosides.
- all the nucleosides of region F or F’, or F and F’ are 2’ substituted nucleosides, such as OMe or MOE nucleosides.
- region F consists of 1 , 2, 3, 4, 5, 6, 7, or 8 contiguous OMe or MOE nucleosides.
- only one of the flanking regions can consist of 2’ substituted nucleosides, such as OMe or MOE nucleosides.
- the 5’ (F) flanking region that consists 2’ substituted nucleosides, such as OMe or MOE nucleosides whereas the 3’ (F’) flanking region comprises at least one LNA nucleoside, such as beta-D-oxy LNA nucleosides or cET nucleosides.
- the 3’ (F’) flanking region that consists 2’ substituted nucleosides, such as OMe or MOE nucleosides
- the 5’ (F) flanking region comprises at least one LNA nucleoside, such as beta-D-oxy LNA nucleosides or cET nucleosides.
- all the modified nucleosides of region F and F’ are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides, wherein region F or F’, or F and F’ may optionally comprise DNA nucleosides (an alternating flank, see definition of these for more details).
- all the modified nucleosides of region F and F’ are beta-D-oxy LNA nucleosides, wherein region F or F’, or F and F’ may optionally comprise DNA nucleosides (an alternating flank, see definition of these for more details).
- the 5’ most and the 3’ most nucleosides of region F and F’ are LNA nucleosides, such as beta-D-oxy LNA nucleosides or ScET nucleosides.
- the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage.
- the internucleoside linkage between region F’ and region G is a phosphorothioate internucleoside linkage.
- the internucleoside linkages between the nucleosides of region F or F’, F and F’ are phosphorothioate internucleoside linkages.
- An LNA gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of LNA nucleosides.
- a beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of beta-D-oxy LNA nucleosides.
- treatment refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.
- the present invention provides a preloaded syringe (also referred to as pre-filled syringe) comprising (i.e. containing) an ophthalmic solution of an oligonucleotide targeting a mammalian HTRA1 nucleic acid.
- the invention provides for a sealed sterile package comprising the pre-filled syringe of the invention.
- the sterile sealed package protects a sterile environment within the sealed package, ensuring the pre-filled syringe is maintained in a sterile environment prior to use.
- the sealed sterile package may be in the form of a blister pack.
- the present invention provides a sterile vial, for example a sterile glass vial, containing an ophthalmic solution of an oligonucleotide targeting a mammalian HTRA1 nucleic acid.
- the present invention provides a sterile ampule, for example a sterile glass ampule, containing an ophthalmic solution of an oligonucleotide targeting a mammalian HTRA1 nucleic acid.
- the oligonucleotide targeting a mammalian HTRA1 nucleic acid is capable of inhibiting the expression of HTRA1 , and may be used to treat or prevent diseases related to the functioning of the HTRA1.
- the oligonucleotides targeting HTRA1 are antisense
- oligonucleotides i.e. are complementary to their HTRA1 nucleic acid target.
- the oligonucleotide may be in the form of a pharmaceutically acceptable salt, such as a sodium salt or a potassium salt or ammonium salt, for example a sodium salt.
- the antisense oligonucleotides may comprise a contiguous nucleotide sequence of 10 - 30 nucleotides in length with at least 90% complementarity, such as fully complementary to a mammalian HTRA1 nucleic acid, such as SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
- the antisense oligonucleotide may be an LNA antisense oligonucleotides, such as LNA gapmer oligonucleotides, which comprise a contiguous nucleotide sequence of 10 - 30 nucleotides in length with at least 90% complementarity, such as fully complementary to a HTRA1 nucleic acid, such as a sequence selected from the group consisting of SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
- LNA antisense oligonucleotides such as LNA gapmer oligonucleotides, which comprise a contiguous nucleotide sequence of 10 - 30 nucleotides in length with at least 90% complementarity, such as fully complementary to a HTRA1 nucleic acid, such as a sequence selected from the group consisting of SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
- the antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 113.
- the antisense oligonucleotide may be of 10 - 30 nucleotides in length, wherein said antisense oligonucleotide comprises a contiguous nucleotide region of 10 - 30, such as 12 - 22, nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 1 13.
- the reverse complement of SEQ ID NO 113 is shown in SEQ ID NO 119.
- the antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 114.
- the antisense oligonucleotide of 10 - 30 nucleotides in length may comprise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 114.
- the reverse complement of SEQ ID NO 114 is SEQ ID NO 120.
- the antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 115.
- the antisense oligonucleotide of 10 - 30 nucleotides in length may comrpise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 115.
- the reverse complement of SEQ ID NO 115 is shown in SEQ ID NO 121.
- the antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 1 16.
- the antisense oligonucleotide of 10 - 30 nucleotides in length may comprise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 1 16.
- the reverse complement of SEQ ID NO 1 16 is SEQ ID NO 122.
- the antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 1 17.
- the antisense oligonucleotide of 10 - 30 nucleotides in length may comprise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 1 17.
- the reverse complement of SEQ ID NO 1 17 is SEQ ID NO 123.
- the invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 .
- the invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 12 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 .
- the invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 14 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 .
- the invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 15 or 16 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 .
- the invention provides a preloaded syringe device for administration of an antisense oligonucleotide, wherein the contiguous nucleotide sequence of the oligonucleotide comprises or consists of a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs 5 - 1 1 1 .
- the antisense oligonucleotide comprises a contiguous nucleotide region of at least 10, or at least 12, at least 13, or at least 14 or at least 15 or at least 16 contiguous nucleotides present SEQ ID NO 1 18: 5’ CTTCTTCTATCTACGCATTG 3’.
- the reverse complement of SEQ ID NO 1 18 is SEQ ID NO 231 : C AAT G C GT AG AT AG AAG AAG .
- the invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, at least 13, or at least 14 or at least 15 or at least 16 contiguous nucleotides complementary to SEQ ID NO 231 .
- the invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides present SEQ ID NO 67.
- the invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides present SEQ ID NO 86.
- the invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or at least 16 or at least 17 or 18 contiguous nucleotides present SEQ ID NO 73.
- the invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides complementary to SEQ ID NO 186.
- the invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides complementary to SEQ ID NO 205.
- the invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or at least 16 or at least 17 or 18 contiguous nucleotides complementary to SEQ ID NO 192.
- the invention provides for a preloaded syringe device comprising an oligonucleotide comprising or consisting of an oligonucleotide selected from the group consisting of:
- the antisense oligonucleotide of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, such as at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the normal expression level of the target.
- compounds of the invention may be capable of inhibiting expression levels of HTRA1 mRNA by at least 60% or 70% in vitro using ARPE-19 cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of HTRA1 mRNA by at least 60% or 70% in vitro using ARPE-19 cells.
- compounds of the invention may be capable of inhibiting expression levels of HTRA1 protein by at least 50% in vitro using ARPE-19 cells.
- the examples provide assays which may be used to measure HTRA1 RNA or protein inhibition.
- the target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid.
- the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of HTRA1 expression.
- Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2’ modified nucleosides, including LNA, present within the oligonucleotide sequence.
- An aspect of the present invention relates to an antisense oligonucleotide which comprises a contiguous nucleotide region of 10 to 30 nucleotides in length with at least 90%
- HTRA1 target sequence such as fully complementary to an HTRA1 target sequence, e.g. a nucleic acid selected from the group consisting SEQ ID NO 1 , 2, 3 & 4.
- the oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid.
- the oligonucleotide of the invention or a contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.
- the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof is at least 90% complementary, such as fully (or 100%) complementary to a region of a sequence selected from the group consisting of SEQ ID NOs 124- 230.
- the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 13 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 15 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 15 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- 15 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- 16 nucleotides thereof is fully (or 100%) complementary to a sequence selected from the group consisting of SEQ ID NO SEQ ID NO 1 13, 1 14, 1 15, 1 16, 117 and 231.
- the oligonucleotide, or a contiguous nucleotide sequence of at least 16 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or a contiguous nucleotide sequence of at least 16, such as 16, 17 or 18 nucleotides thereof, is at least 90% complementary, such as fully (or 100%) complementary to a region of SEQ ID NO 192.
- the oligonucleotide, or a contiguous nucleotide sequence of at least 16 nucleotides thereof is at least 90% complementary, such as fully (or 100%)
- the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to a sequence selected from the group consisting of a sequence selected from the group consisting of SEQ ID NO SEQ ID NO 113, 1 14, 1 15, 1 16, 1 17 and 231.
- the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to a sequence selected from the group consisting of a sequence selected from the group consisting of SEQ ID NO 124 - 230.
- the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to SEQ ID NO 186.
- the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to SEQ ID NO 192. In some embodiments the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to SEQ ID NO 205.
- oligonucleotide motif sequences can be modified to for example increase nuclease resistance and/or binding affinity to the target nucleic acid. Modifications are described in the definitions and in the Oligonucleotide design” section.
- the oligonucleotide of the invention, or contiguous nucleotide region thereof is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.
- the oligonucleotide, or contiguous nucleotide sequence of at least 12 nucleotides thereof is at least 90% complementary, such as fully (or 100%) complementary to the target nucleic acid sequence.
- the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof has 100% identity to a sequence selected from the group consisting of SEQ ID NOs 5 - 1 11.
- the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof has 100% identity to a sequence selected from the group consisting of SEQ ID NOs 5 - 11 1
- the oligonucleotide, or contiguous nucleotide sequence of at least 16 nucleotides thereof has 100% identity to a sequence selected from the group consisting of SEQ ID NOs 5 - 11 1.
- the oligonucleotide, or contiguous nucleotide region thereof comprises or consists of a sequence selected from SEQ ID NOs 5 - 1 11.
- the oligonucleotide of the invention is selected from the following group (Note the target subsequence is the reverse complement of the oligonucleotide motif):
- internucleoside linkages are at least 80%, such as at least 90% or 100% modified internucleoside linkages, such as phosphorothioate internucleoside linkages.
- all internucleoside linkages of the compounds in the compound design column in the above table are phosphorothioate internucleoside linkages.
- the motif and target subsequence sequences are nucleobase sequences.
- the invention provides the following oligonucleotides:
- the pre-loaded syringe of the invention may comprise a unit dose of the antisense oligonucleotide therapeutic in the form of an ophthalmic solution.
- the pre-loaded syringe may comprise an additional volume of the ophthalmic solution so allow for the volume of the dead space in the syringe and syringe needle (known as dead volume) - the unit dose being present within the extractable volume of the syringe.
- the unit dose is 5pg - 200pg per eye, such 10pg - 100pg per eye, such as 20pg - 50pg per eye.
- the volume of ophthalmic solution administered to each eye is, for example about 25mI - about 10OmI, such as about 50mI.
- Administration is typically via intravitreal injection, such as in an ophthalmic solution comprising a dose of (unit dose).
- the unit dose of the antisense oligonucleotide, such as the HTRA1 oligonucleotide antagonist is 0.005mg - 1 mg per eye, such as about 0.05mg to about 0.1 mg per eye.
- the unit dose is from about O.OOI mg - about 0.2mg per eye, such as about 0.05mg per eye, or about 0.150mg per eye, such as about 0.1 mg per eye.
- the vial or ampule of the invention suitably comprises a unit dose of the antisense oligonucleotide, for example either as an anhydrous powder, or in the form of an ophthalmic solution.
- the anhydrous powder is solubilized in a therapeutically acceptable sterile solvent (such ophthalmically acceptable, e.g. as according to the ophthalmic solution), prior to administration to the eye via e.g. intravitreal injection.
- the vial or ampule typically comprises more than the unit dose of the antisense oligonucleotide.
- An ophthalmic solution is a solution which comprises the antisense oligonucleotide therapeutic, such as the HTRA1 oligonucleotide antagonist dissolved in a solvent which is compatible with administration via injection into the eye, such as an intravitreal injection.
- the solvent is suitably a buffered aqueous solution, such as phosphate buffered saline, e.g. of pH about 7 - about 7.5, such as about 7.4.
- a buffered aqueous solution such as phosphate buffered saline, e.g. of pH about 7 - about 7.5, such as about 7.4.
- the solution is phosphate or Histidine/sucrose buffer solution, pH about 7.4, with NaCI to reach isotonicity (250-350mOsm).
- Other ophthalmic acceptable buffered solutions may be used.
- the ophthalmic solution is sterile, and may be sterilized prior to or during the manufacture of the pre-loaded syringe device.
- the oligonucleotide and ophthalmic solution are manufactured under sterile conditions.
- the concentration of the HTRA1 oligonucleotide antagonist in the ophthalmic solution may for example, be at 0.05mg/ml - 40mg/ml, such as about 1 mg/ml - about 10mg/ml. In some embodiments the concentration of the HTRA1 oligonucleotide antagonist in the ophthalmic solution is up to or is about 1 mg/ml. In some embodiments the concentration of the HTRA1 oligonucleotide antagonist in the ophthalmic solution is up to or is about 10mg/ml.
- the inventors have determined that low concentrations of oligonucleotide, administered in a volume of 25 - 10OmI, are therapeutically efficacious. Furthermore, the use of low
- concentration of antisense oligonucleotide in the ophthalmic solution is compatible with a narrow needle gauge, such as a needle gauge of 27 - 31 , such as 30, to be used due to the low viscosity of the ophthalmic solution of the antisense oligonucelotide.
- the unit dose volume of the ophthalmic solution to be administered to the subject via intravitreal injection is about 25 - about 10OmI, such as about 50mI.
- the syringe device typically comprises additional ophthalmic solution for example to fill the dead-volume within the syringe device.
- the vial or ampule of the invention may comprise the ophthalmic solution.
- the Pre-Filled Syringe also referred to as pre-loaded syringe
- the preloaded syringe device typically comprises a barrel body, a plunger, and a stopper.
- the barrel body contains a sterile ophthalmic solution of the antisense oligonucleotide.
- the present invention provides a pre-filled syringe, the syringe comprising a body, a stopper and a plunger, the body comprising an outlet at an outlet end and the stopper being arranged within the body such that a front surface of the stopper and the body define a variable volume chamber from which a fluid can be expelled though the outlet, the plunger comprising a plunger contact surface at a first end and a rod extending between the plunger contact surface and a rear portion, the plunger contact surface arranged to contact the stopper, such that the plunger can be used to force the stopper towards the outlet end of the body, reducing the volume of the variable volume chamber, characterized in that the fluid comprises an ophthalmic solution comprising an antisense oligonucleotide therapeutic.
- the ophthalmic solution comprises an antisense oligonucleotide HTRA1 antagonist, such as those disclosed herein [e.g. SEQ ID NO 5 - 11 1].
- the syringe is suitable for ophthalmic injections, more particularly intra-vitreal injections, and as such may have a suitably small volume.
- the syringe may also be silicone oil free, or substantially silicone oil free, or may comprise a low level of silicone oil as lubricant. In one embodiment, despite the low silicone oil level, the stopper break loose and slide force is less than 20N.
- the body of the syringe may be a substantially cylindrical shell, or may include a
- the outlet end of the body includes an outlet through which a fluid housed within the variable volume chamber can be expelled as the volume of said chamber is reduced.
- the outlet may comprise a projection from the outlet end through which extends a channel having a smaller diameter than that of the variable volume chamber.
- the outlet may be adapted, for example via a luer lock type connection, for connection to a needle or other accessory such as a sealing device which is able to seal the variable volume chamber, but can be operated, or removed, to unseal the variable volume chamber and allow connection of the syringe to another accessory, such as a needle. Such a connection may be made directly between the syringe and accessory, or via the sealing device.
- the body extends along a first axis from the outlet end to a rear end.
- the body may be made from a plastic material (e.g. a cyclic olefin polymer) or from glass and may include indicia on a surface thereof to act as an injection guide.
- the body may comprise a priming mark. This allows the physician to align a pre-determined part of the stopper (such as the tip of the front surface or one of the circumferential ribs, discussed later) or plunger with the mark, thus expelling excess ophthalmic solution and any air bubbles from the syringe.
- the priming process ensures that an exact, pre-determined dosage is administered to the patient.
- the needle is a hollow needle which is suitable for injection of the ophthalmic solution through the cornea (for intravitreal injection).
- the antisense oligonucleotide of the invention has a lower viscosity, and as such a narrower gauge needle may be used (such as the 27 - 30 gauge). Narrower needles are advantageous in limiting the damage at the injection site and reducing patient discomfort. However, for administration through the cornea the needle should not be so thin as to have insufficient structural integrity.
- the gauge of the needle is suitably 20 - 31 , such as 25 - 31 or 27 - 30.
- the stopper may be made from rubber, silicone or other suitable resiliently deformable material.
- the stopper may be substantially cylindrical and the stopper may include one or more circumferential ribs around an outer surface of the stopper, the stopper and ribs being dimensioned such that the ribs form a substantially fluid tight seal with an internal surface of the syringe body.
- the front surface of the stopper may be any suitable shape, for example substantially planar, substantially conical or of a domed shape.
- the rear surface of the stopper may include a substantially central recess. Such a central recess could be used to connect a plunger to the stopper using a snap fit feature or thread connection in a known manner.
- the stopper may be substantially rotationally symmetric about an axis through the stopper.
- the syringe body is made of or comprises glass, plastic, ceramic or metal. In some embodiments the syringe body is made of or comprises glass.
- the plunger comprises a plunger contact surface and extending from that a rod extends from the plunger contact surface to a rear portion.
- the rear portion may include a user contact portion adapted to be contacted by a user during an injection event.
- the user contact portion may comprise a substantially disc shaped portion, the radius of the disc extending substantially perpendicular to the axis along which the rod extends.
- the user contact portion could be any suitable shape.
- the axis along which the rod extends may be the first axis, or may be substantially parallel with the first axis.
- the syringe may include a backstop arranged at a rear portion of the body.
- the backstop may be removable from the syringe. If the syringe body includes terminal flanges at the end opposite the outlet end the backstop may be configured to substantially sandwich terminal flanges of the body as this prevent movement of the backstop in a direction parallel to the first axis.
- the rod may comprise at least one rod shoulder directed away from the outlet end and the backstop may include a backstop shoulder directed towards the outlet end to cooperate with the rod shoulder to substantially prevent movement of the rod away from the outlet end when the backstop shoulder and rod shoulder are in contact. Restriction of the movement of the rod away from the outlet end can help to maintain sterility during terminal sterilisation operations, or other operations in which the pressure within the variable volume chamber or outside the chamber may change. During such operations any gas trapped within the variable volume chamber, or bubbles that may form in a liquid therein, may change in volume and thereby cause the stopper to move. Movement of the stopper away from the outlet could result in the breaching of a sterility zone created by the stopper.
- sterility zone as used herein is used to refer to the area within the syringe that is sealed by the stopper from access from either end of the syringe. This may be the area between a seal of the stopper, for example a circumferential rib, closest to the outlet and a seal of the stopper, for example a circumferential rib, furthest from the outlet. The distance between these two seals defines the sterility zone of the stopper since the stopper is installed into the syringe barrel in a sterile environment.
- the stopper may comprise at a front circumferential rib and a rear circumferential rib and those ribs may be separated in a direction along the first axis by at least 3 mm, by at least 3.5 mm, by at least 3.75 mm or by 4 mm or more.
- One or more additional ribs (for example 2, 3, 4 or 5 additional ribs, or between 1-10, 2-8, 3-6 or 4-5 additional ribs) may be arranged between the front and rear ribs. In one embodiment there are a total of three circumferential ribs.
- a stopper with such an enhanced sterility zone can also provide protection for the injectable medicament during a terminal sterilisation process. More ribs on the stopper, or a greater distance between the front and rear ribs can reduce the potential exposure of the
- the rod shoulder may be arranged within the external diameter of the rod, or may be arranged outside the external diameter of the rod. By providing a shoulder that extends beyond the external diameter of the rod, but still fits within the body, the shoulder can help to stabilise the movement of the rod within the body by reducing movement of the rod perpendicular to the first axis.
- the rod shoulder may comprise any suitable shoulder forming elements on the rod, but in one embodiment the rod shoulder comprises a substantially disc shaped portion on the rod.
- the variable volume chamber when arranged with the plunger contact surface in contact with the stopper and the variable volume chamber is at its intended maximum volume there is a clearance of no more than about 2 mm between the rod shoulder and backstop shoulder. In some embodiments there is a clearance of less than about 1.5 mm and in some less than about 1 mm. This distance is selected to substantially limit or prevent excessive rearward (away from the outlet end) movement of the stopper.
- variable volume chamber has an internal diameter greater than 5 mm or 6 mm, or less than 3 mm or 4 mm.
- the internal diameter may be between 3 mm and 6 mm, or between 4 mm and 5 mm.
- the syringe is dimensioned so as to have a nominal maximum fill volume of between about 0.1 ml and about 1.5 ml. In certain embodiments the nominal maximum fill volume is between about 0.5 ml and about 1 ml. In some embodiments the nominal maximum fill volume is about 0.2ml to 0.5ml. In certain embodiments the nominal maximum fill volume is about 0.5 ml or about 1 ml, or about 1.5 ml.
- the nominal fill volume comprises the unit dose volume and dead volume and suitably an overfill volume (an excess volume). Suitably the excess volume may be limited to prevent accidental over-dosing.
- the length of the body of the syringe may be less than 70 mm, less than 60 mm or less than 50 mm. In one embodiment the length of the syringe body is between 45 mm and 50 mm.
- the oligonucleotide of the invention may be provided as a suitable pharmaceutical salt, such as a sodium or potassium salt or ammonium salt.
- a suitable pharmaceutical salt such as a sodium or potassium salt or ammonium salt.
- the oligonucleotide of the invention is a sodium salt (suitable for buffered saline ophthalmic solutions).
- the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates and a
- a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium and ammonium salts.
- PBS phosphate-buffered saline
- pharmaceutically acceptable salts include, but are not limited to, sodium and potassium and ammonium salts.
- the pharmaceutically acceptable diluent is sterile phosphate buffered saline.
- the pharmaceutical composition may be in the form of the ophthalmic solution.
- the invention provides methods for treating or preventing a disease, comprising
- an oligonucleotide administered a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease via intraocular injection of the oligonucleotide using the pre-loaded syringe device of the invention.
- the invention also provides an oligonucleotide, or a pharmaceutical composition as described herein, and their use as a medicament.
- the oligonucleotide according to the invention is typically administered in an effective amount (e.g. a unit dose).
- the invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.
- the disease or disorder as referred to herein, is associated with expression of HTRA1.
- disease or disorder may be associated with a mutation in the HTRA1 gene or a gene whose protein product is associated with or interacts with HTRA1. Therefore, in some embodiments, the target nucleic acid is a mutated form of the HTRA1 sequence and in other embodiments, the target nucleic acid is a regulator of the HTRA1 sequence.
- the device and methods of the invention may be employed for treatment or prophylaxis against diseases caused by abnormal levels and/or activity of HTRA1.
- the device and methods of the invention are preferably employed in the treatment of diseases or disorders selected from eye disorders, such as macular degeneration, including age related macular degeneration (AMD), such as dry AMD or wet AMD, and diabetic retinopathy.
- AMD age related macular degeneration
- AMD diabetic retinopathy
- the invention further relates to use of an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of abnormal levels and/or activity of HTRA1.
- the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of diseases or disorders selected from eye disorders, such as macular degeneration, including age related macular degeneration (AMD), such as dry AMD or wet AMD, and diabetic retinopathy.
- AMD age related macular degeneration
- the oligonucleotide conjugates or pharmaceutical compositions in the device of the invention may be for use in the treatment of geographic atrophy or intermediate dAMD.
- intraocular injection such as an intravitreal injection is preferably administration route, such as using the pre-loaded syringe device of the invention.
- the compound of the invention, or pharmaceutically acceptable salt thereof is administered via an intraocular injection in a dose from about 10pg to about 200pg per eye, 10pg to about 100pg per eye, such as about 20pg to about 50 pg per eye.
- the dosage interval i.e. the period of time between consecutive dosings is at least monthly, such as at least bi monthly or at least once every three months.
- the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent.
- the therapeutic agent can for example be the standard of care for the diseases or disorders described above EXAMPLES
- Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.
- Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 pmol scale. At the end of the synthesis, the
- oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16hours at 60 ° C.
- the oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.
- the coupling of b-cyanoethyl- phosphoramidites is performed by using a solution of 0.1 M of the 5’-0-DMT-protected amidite in acetonitrile and DCI (4,5- dicyanoimidazole) in acetonitrile (0.25 M) as activator.
- a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such.
- Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1 ).
- Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1.
- the rest of the reagents are the ones typically used for oligonucleotide synthesis.
- oligonucleotide is isolated.
- the conjugates are introduced via activation of the functional group using standard synthesis methods.
- the crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10m 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.
- Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x T m -buffer (200mM NaCI, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 95°C for 3 min and then allowed to anneal in room temperature for 30 min.
- the duplex melting temperatures (T m ) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20°C to 95°C and then down to 25°C, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex T m .
- Compound A is TsAsTststsa s CsCstsgsgstsTsGsTsT (SEQ I D NO 232) and compound B is
- AstsAsTststsa CsCstsgsGsTsTsgsTsT (SEQ. ID NO 233).
- Capital letters represent LNA nucleosides (beta-D-oxy LNA nucleosides were used), all LNA cytosines are 5-methyl cytosine, lower case letters represent DNA nucleosides, DNA cytosines preceded with a superscript m represent a 5- methyl C-DNA nucleoside. All internucleoside linkages are phosphorothioate internucleoside linkages.
- Example 1 Testing in vitro efficacy of LNA oligonucleotides in U251 cell line at a single concentration.
- HTRA1 LNA oligonucleotides were screened in U251 cell line at 5mM, 6 days of treatment. From this library, we identified a series of active oligonucleotides targeting human HTRA1 pre-mRNA between position 531 13 - 53384 as shown in figure 10A (SEQ ID NO 116 or 1 17).
- Human glioblastoma U251 cell line was purchased from ECACC and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% CO2. For assays, 15000 U251 cells/well were seeded in a 96 multi well plate in starvation media (media recommended by the supplier with the exception of 1 % FBS instead of 10%). Cells were incubated for 24 hours before addition of oligonucleotides dissolved in PBS. Concentration of oligonucleotides: 5 mM. 3-4 days after addition of oligonucleotides, media was removed and new media (without oligonucleotide) was added. 6 days after addition of
- HTRA1 mRNA expression level in the table is shown as % of control (PBS-treated cells).
- Example 2 Testing in vitro efficacy of LNA oligonucleotides in U251 cell line at a single concentration.
- Example 3 Testing in vitro efficacy of LNA oligonucleotides in U251 and ARPE19 cell lines at a single concentration.
- Human retinal pigmented epithelium ARPE19 cell line was purchased by from ATCC and maintained in DMEM-F12 (Sigma, D8437), 10% FBS, 1% pen/strep in a humidified incubator at 37°C with 5% CO2.
- the U251 cell line was described in example 1.
- 2000 U251 or ARPE19 cells/well were seeded in a 96 multi well plate in culture media
- RNA extraction was performed as described in example 1 , cDNA synthesis and qPCR were performed using qScript XLT one-step RT-qPCR ToughMix Low ROX, 95134- 100 (Quanta Biosciences).
- n 1 biological replicate.
- the relative HTRA1 mRNA expression level in the table is shown as % of control (PBS-treated cells).
- Example 4 Testing in vitro potency and efficacy of selected compounds in U251 and ARPE19 cell lines in a dose response curve.
- the U251 and ARPE19 cell lines were described in example 1 and 3, respectively.
- the U251 assay was performed as described in Example 1.
- the ARPE19 assay was performed as follows: 5000 ARPE19 cells/well were seeded in a 96 multi well plate in culture media recommended by the supplier (with the exception of 5% FBS instead of 10%). Cells were incubated for 2 hour before addition of oligonucleotides dissolved in PBS. Concentration of oligonucleotides: from 50mM, half-log dilution, 8 points. 4 days after addition of
- Example 5 Testing in vitro potency and efficacy of selected compounds in U251 and ARPE19 cell lines in a dose response curve.
- Example 6 Testing in vitro potency and efficacy of selected compounds in U251 cell line in a dose response curve.
- Example 7 Testing in vitro potency and efficacy of selected compounds in U251 cell line in a dose response curve.
- ARPE19 cell line was described in example 3.
- ARPE19 cells 24000 cells/well were seeded in 100mI_ in a 96 multi well plate in starvation media (culture media as recommended by the supplier with the exception of 1% FBS instead of 10%). Cells were incubated for 2 hour before addition of oligonucleotides dissolved in PBS. Concentration of oligonucleotides: from 50mM, half-log dilution, 8 points.
- 75mI_ fresh starvation media without oligonucleotides was added to the cells (without removing the old media).
- hpRPE Human primary Retinal Pigmented Epithelium
- MEM Alpha media (Sigma Cat# M-4526) supplemented with N1 supplement (Sigma Cat# N-6530), Glutamine-Penicillin-Streptomycin (Sigma Cat# G- 1 146), Non Essential Amino Acid (NEAA, Sigma Cat# M-7145), Taurine (Sigma Cat# T- 0625), Hydrocortisone (Sigma Cat# H-03966), Triiodo-thyronin (Sigma Cat# T-5516) and Bovine Serum Albumin (BSA, Sigma Cat# A-9647). Cells were cultured in a humidified incubator at 37°C with 5% CO2.
- RNA quality control was performed with the Agilent Bioanalyzer Nano Kit (Agilent; Cat# 5067-1511 ; Lot 1446). Reverse transcription of total RNA into cDNA (cDNA synthesis) was performed using the High Capacity cDNA Reverse Transcription Kit (based on random hexamer
- HTRA1 Hs01016151_m1 and Hs00170197_m1
- housekeeping genes GAPDH, Hs99999905_m1 and PPIA, Hs99999904_m1 , from Life Technologies.
- n 3 biological replicates.
- the residual HTRA1 mRNA expression level is shown in figure 10D and the following table as % of control (PBS).
- WO2018/00205 and PCT/2018/064221 describe the discover and characterization of antisense oligonucleotides targeting HTRA1 , including the following compounds:
- Example 9 Cynomolgus monkey in vivo pharmacokinetics and pharmacodynamics study, 21 days of treatment, intravitreal (IVT) injection, single dose.
- Buprenorphine analgesia was administered prior to, and two days after test compound injection.
- the animals were anesthetized with an intramuscular injection of ketamine and xylazine.
- the test item and negative control (PBS) were administered intravitreally in both eyes of anesthetized animals (50 mI_ per administration) on study day 1 after local application of tetracaine anesthetic.
- the samples were diluted 10-50 fold for oligo content measurements with a hybridization ELISA method.
- a biotinylated LNA-capture probe and a digoxigenin-conjugated LNA-detection probe (both 35nM in 5xSSCT, each complementary to one end of the LNA oligonucleotide to be detected) was mixed with the diluted homogenates or relevant standards, incubated for 30 minutes at RT and then added to a streptavidine-coated ELISA plates (Nunc cat. no. 436014).
- the plates were incubated for 1 hour at RT, washed in 2xSSCT (300mM sodium chloride, 30mM sodium citrate and 0,05% v/v Tween-20, pH 7.0)
- 2xSSCT 300mM sodium chloride, 30mM sodium citrate and 0,05% v/v Tween-20, pH 7.0
- the captured LNA duplexes were detected using an anti-DIG antibodies conjugated with alkaline phosphatase (Roche Applied Science cat. No. 1 1093274910) and an alkaline phosphatase substrate system (Blue Phos substrate, KPL product code 50-88-00).
- the amount of oligo complexes was measured as absorbance at 615 nm on a Biotek reader.
- RNA extraction For RNA extraction, cellular RNA large volume kit (05467535001 , Roche) was used in the MagNA Pure 96 system with the program: Tissue FF standard LV3.1 according to the instructions of the manufacturer, including DNAse treatment. RNA quality control and concentration were measured with an Eon reader (Biotek). The RNA concentration was normalized across samples, and subsequent cDNA synthesis and qPCR was performed in a one-step reaction using qScript XLT one-step RT-qPCR ToughMix Low ROX, 95134-100 (Quanta Biosciences).
- TaqMan primer assays were used in singplex reactions: Htral , Mf01016150_, Mf01016152_m1 and Rh02799527_m1 and housekeeping genes, ARFGAP2, Mf01058488_g1 and Rh01058485_m1 , and ARL1 , Mf02795431_m1 , from Life Technologies.
- the qPCR analyses were run on a ViiA7 machine (Life Technologies).
- IP-MS plate-based immunoprecipitation mass spectrometry
- Retinas were homogenized in 4 volumes (w/v) of RIPA buffer (50 mM Tris-HCI, pH 7.4, 150 mM NaCI, 0.25% deoxycholic acid, 1% NP-40, 1 mM EDTA, Millipore) with protease inhibitors (Complete EDTA-free, Roche) using a Precellys 24 (5500, 15 s, 2 cycles).
- RIPA buffer 50 mM Tris-HCI, pH 7.4, 150 mM NaCI, 0.25% deoxycholic acid, 1% NP-40, 1 mM EDTA, Millipore
- protease inhibitors Complete EDTA-free, Roche
- Vitreous humors (300 pi) were diluted with 5x RIPA buffer (final concentration: 50 mM Tris- HCI, pH 7.4, 150 mM NaCI, 0.25% deoxycholic acid, 1% NP-40, 1 mM EDTA) with protease inhibitors (Complete EDTA-free, Roche) and homogenized using a Precellys 24 (5500, 15 s, 2 cycles). Homogenates were centrifuged (13,000 rpm, 3 min) and the protein contents of the supernatants determined (Pierce BCA protein assay)
- a 96 well plate (Nunc MaxiSorp) was coated with anti-HTRA1 mouse monoclonal antibody (R&D MAB2916, 500 ng/well in 50 pi PBS) and incubated overnight at 4°C.
- the plate was washed twice with PBS (200 mI) and blocked with 3% (w/v) BSA in PBS for 30 min at 20 °C followed by two PBS washes.
- Samples 75 pg retina, 100 pg vitreous in 50 mI PBS) were randomized and added to the plate followed by overnight incubation at 4 °C on a shaker (150 rpm). The plate was then washed twice with PBS and once with water.
- HTRA 1 peptide quantification by targeted mass spectrometry selected reaction monitoring, SRM
- Mass spectrometry analysis was performed on an Ultimate RSLCnano LC coupled to a TSQ Quantiva triple quadrupole mass spectrometer (Thermo Scientific). Samples (20 pL) were injected directly from the 96 well plate used for IP and loaded at 5 pL/min for 6 min onto a Acclaim Pepmap 100 trap column (100 pm x 2 cm, C18, 5 pm, 100 A, Thermo Scientific) in loading buffer (0.5% v/v formic acid, 2% v/v ACN).
- Peptides were then resolved on a PepMap Easy-SPRAY analytical column (75 pm x 15 cm, 3 pm, 100 A, Thermo Scientific) with integrated electrospray emitter heated to 40°C using the following gradient at a flow rate of 250 nL/min: 6 min, 98% buffer A (2% ACN, 0.1% formic acid), 2% buffer B (ACN + 0.1% formic acid); 36 min, 30% buffer B; 41 min, 60% buffer B; 43 min, 80% buffer B; 49 min, 80% buffer B; 50 min, 2% buffer B.
- the TSQ Quantiva was operated in SRM mode with the following parameters: cycle time, 1.5 s; spray voltage, 1800 V; collision gas pressure, 2 mTorr; Q1 and Q3 resolution, 0.7 FWHM; ion transfer tube temperature 300 °C.
- SRM transitions were acquired for the HTRA1 peptide“LHRPPVIVLQR” and an isotope labelled (L-[U-13C, U-15N]R) synthetic version, which was used an internal standard.
- Dissected retina sample in 0.5 Precellyses tubes (CK14_0.5ml, Bertin Technologies) were lysed and homogenized in RIPA lysis buffer (20-188, Milipore) with protease inhibitors (Complete EDTA-free Proteases-lnhibitor Mini, 11 836 170 001 , Roche).
- Vitreous sample were added to a 0.5 Precellyses tubes (CK14_0.5ml, Bertin Technologies) were lysed and homogenized in 1/4x RIPA lysis buffer (20-188, Milipore) with protease inhibitors (Complete EDTA-free Proteases-lnhibitor Mini, 1 1 836 170 001 , Roche).
- Samples (retina 20 pg protein, vitreous 40 pg protein) were analyzed on 4-15% gradient gel (#567-8084 Bio-Rad) under reducing conditions and transferred on Nitrocellulose (#170- 4159 Bio-Rad) using a Trans-Blot Turbo Device from Bio-Rad.
- Rabbit anti human HTRA1 (SF1 ) was a kind gift of Sascha Fauser (University of Cologne), mouse anti human Gapdh (#98795 Sigma-Aldrich).
- Secondary antibody goat anti rabbit 800CW and goat anti mouse 680RD were from Li-Cor
- Samples were processed in technical triplicate, calibration curve in duplicate using a 12 - 230 kDa Separation module. Area under the peak was computed and analyzed using Xlfit (I DBS software).
- Figure 12A shows a visualization of the HTRA1 protein levels in the aqueous humor of monkeys administered with compounds B and #73,1 , with samples taken at days 3, 8, 15, and 22 post-injection.
- Figure 12B provides the calibration curve used in calculating HTRA1 protein levels.
- Figure 12C provides the calculated HTRA1 levels from aqueous humor from individual animal was plotted against time post injection.
- Figure 13 illustrates a direct correlation between the level of HTRA1 protein in the aqueous humor and the level of HTRA1 mRNA in the retina.
- Aqueous humor HTRA1 protein levels may therefore be used as a biomarker for HTRA1 retina mRNA levels or HTRA1 retinal mRNA inhibition.
- Figure 14 illustrates that there is also a correlation between HTRA1 protein levels in retina and the HTRA1 protein levels in aqueous humor, although the correlation was not, in this experiment, as strong as the correlation between HTRA1 mRNA inhibition in the retina and HTRA1 protein levels in the aqueous humor, indicating that aqueous humor HTRA1 protein levels are particularly suited as biomarker for HTRA1 mRNA antagonists.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Ophthalmology & Optometry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Dermatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to a pre-filled syringe device for ophthalmic administration of antisense oligonucleotides, such as Htra1 oligonucleotide antagonists.
Description
OCCULAR ADMINISTRATION DEVICE FOR ANTISENSE OLIGONUCLEOTIDES
FIELD OF INVENTION
The present invention relates to a pre-filled syringe device for ophthalmic administration of antisense oligonucleotides, such as Htral oligonucleotide antagonists.
BACKGROUND
Delivery of drugs to the posterior eye is challenging, owing to anatomical and physiological constrains of the eye. There is an increasing need for managing rapidly progressing posterior eye diseases, such as age-related macular degeneration (AMD), such a
geographic atrophy. Current standard of care for treatment of wetAMD include anti-VEGF therapy, such as ranibizumab and bevacizumab which is administered periodically (e.g. monthly or bimonthly) into the eye via intravitreal injection. US 9,220,631 discloses a small volume pre-filled syringe for ophthalmic injections of VEGF antagonists.
Nucleic acid therapies have also been investigated in relation to the treatment of disease indications in the eye for a review see Paneda et al., 2012, Ocular Diseases, Chapter 7 Recent advances in Ocular Nucleic-Acid Therapies: The Silent Era, Edited by Adedayo Adio, Publisher.
The following publications describe antisense oligonucleotides for ocular application: WO 97/39120; WO 00/08140; WO 00/08141 ; WO 01/52904; Robinson et al 1996 Proc. Natl. Acad. Sci. Vol 93, pp. 4851-4856; Henry et al 2001 , Investigative Ophthalmology & Visual Science, Vol 42 pp 2646-2651 ; Bhisitkul et al 2005 American Medical Association
Opthamology, Vol 123 pp.214-219.
WO2018/00205 and PCT/2018/064221 describe antisense oligonucleotides targeting HTRA1 , and their use in treatment of macular degeneration via an intraocular injection of a dosage of from about 10pg - 200 pg.
OBJECT OF THE INVENTION
The present invention provides a pre-loaded syringe device for the intraocular injection of antisense oligonucleotide therapeutics into the vitreous humor of the eye, and may be used for administering antisense oligonucleotide antagonists of HTRA1 in vivo, such as to patients who are suffering from macular degeneration, such as geographic atrophy.
STATEMENT OF THE INVENTION
The present invention provides a pre-loaded syringe device, for intraocular injection of an antisense oligonucleotide therapeutic, suitably into the vitreous (intravitreal injection), wherein the pre-loaded syringe comprises a unit dose of the antisense oligonucleotide therapeutic. The antisense oligonucleotide is suitably in an ophthalmic solution, such as phosphate buffered saline.
In some embodiments the antisense oligonucleotide is an antagonist of HTRA1 expression - i.e. an antisense oligonucleotide HTRA1 antagonist. HTRA1 , refers to the human high temperature requirement A serine protease (HTRA1 ): Suitably the antisense oligonucleotide HTRA1 antagonist is complementary to and is capable of inhibiting the expression of the human HTRA1 mRNA or pre-mRNA.
The invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula, TTCtatctacgcaTTG (SEQ ID NO 67), wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides, and cytosine residues are optionally 5-methyl cytosine. In some embodiments the antisense oligonucleotide of SEQ ID NO 67 is: TsTs mCstsastsCstsas mCsgsCsasTsTsG (Compound # NO 67,1 ) wherein capital letters represent beta-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, subscript s represents a phosphorothioate internucleoside linkage, and mC represent 5 methyl cytosine beta-D-oxy LNA nucleosides, and mc represents 5 methyl cytosine DNA nucleoside.
The invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula, CTTCttctatctacgcAT (SEQ ID NO 73), wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides, and cytosine residues are optionally 5-methyl cytosine. In some embodiments the antisense oligonucleotide of SEQ ID NO 73 is mCsTsTs mCststsCstsastsCstsas mCsgsCsAsT (Compound # NO 73,1 ), wherein capital letters represent beta-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, subscript s represents a phosphorothioate internucleoside linkage, and mC represent 5 methyl cytosine beta-D-oxy LNA nucleosides, and mc represents 5 methyl cytosine DNA nucleoside.
The invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula, TACTttaatagcTCAA (SEQ ID NO 86), wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides, and
cytosine residues are optionally 5-methyl cytosine. In some embodiments the antisense oligonucleotide of SEQ ID NO 86 is TsAs mCsTststsasastsasgsCsTs mCsAsA (Compound # NO 86,1 ) wherein capital letters represent beta-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, subscript s represents a phosphorothioate internucleoside linkage, and mC represent 5 methyl cytosine beta-D-oxy LNA nucleosides.
The invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula TATttacctggTTgTT (SEQ ID NO 232, Comp A) wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides.
The invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula
TsAsTststsasCsCstsgsgsTsTsgsTsT (Compound A)
Wherein a capital letter represents a beta-D-oxy LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, and subscript s represents a phosphorothioate
internucleoside linkage.
The invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula AtATttacctgGTTgTT (SEQ. ID NO 233 compound B) wherein capital letters are LNA nucleotides, and lower case letters are DNA nucleosides.
The invention provides for a pre-loaded syringe, for intraocular injection of an antisense oligonucleotide HTRA1 antagonist, wherein the antisense oligonucleotide HTRA1 antagonist comprises an antisense oligonucleotide of formula
AstsAsTststsasCsCstsgsGsTsTsgsTsT (compound B) Wherein a capital letter represents a beta-D- oxy LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, and subscript s represents a phosphorothioate internucleoside linkage.
The invention provides for a blister pack comprising the pre-filled syringe according to the invention. The invention provides for a sterile package comprising (enclosing) the pre-filled
syringe according to the invention. The sterile package may be a blister pack, and keeps the pre-filled syringe in sterile conditions prior to use.
The invention provides for a method for treating a patient suffering from macular
degeneration, said method comprising the step of administering an ophthalmic solution comprising an effective amount of an antisense oligonucleotide HTRA1 antagonist to the patient, using the pre-filled syringe according to the invention.
In some embodiments, the macular degeneration is selected from the group consisting of wet age related macular degeneration (wAMD), dry age related macular degeneration (dAMD), geographic atrophy, early AMD, and intermediate AMD).
BRIEF DESCRIPTION OF FIGURES
Figure 1 shows a view from a side of a syringe 1 comprising a body 2, plunger 4, backstop 6 and a sealing device 8.
Figure 2 shows a cross section through the syringe 1 of Figure 1 from above. The syringe 1 is suitable for use in an ophthalmic injection. The syringe 1 comprises a body 2, a stopperlO and a plunger 4. The syringe 1 extends along a first axis A. The body 2 comprises an outlet 12 at an outlet end 14 and the stopper 10 is arranged within the body 2 such that a front surface 16 of the stopper 10 and the body 2 define a variable volume chamber 18. The variable volume chamber 18 contains an injectable medicament 20 comprising an ophthalmic solution comprising a therapeutic antisense oligonucleotide such as an HTRA1 antagonist. The injectable fluid 20 can be expelled though the outlet 12 by movement of the stopper 10 towards the outlet end 14 thereby reducing the volume of the variable volume chamber 18. The plunger 4 comprises a plunger contact surface 22 at a first end 24 and a rod 26 extending between the plunger contact surface 22 and a rear portion 25. The plunger contact surface 22is arranged to contact the stopper 10, such that the plunger 4can be used to move the stopper 10 towards the outlet end 14 of the body 2. Such movement reduces the volume of the variable volume chamber 18 and causes fluid therein to be expelled though the outlet. The backstop 6 is attached to the body 2 by coupling to a terminal flange 28 of the body 2. The backstop 6 includes sandwich portion 30 which is adapted to substantially sandwich at least some of the terminal flange 28 of the body 2. The backstop 6 is adapted to be coupled to the body 2 from the side by leaving one side of the backstop 6 open so that the backstop 6 can be fitted to the syringe 2. The body 2 defines a substantially cylindrical bore 36 which has a bore radius. The rod 26 comprises a rod shoulder32 directed away from the outlet end 14. The rod shoulder 32 extends from to a rod shoulder radius from
the first axis A which is such that it is slightly less than the bore radius so that the shoulder fits within the bore 36. The backstop 6 includes a backstop shoulder 34 directed towards the outlet end 14. The shoulders 32, 34 are configured to cooperate to substantially prevent movement of the rod 26 away from the outlet end 14 when the backstop shoulder 34 and rod shoulder 32 are in contact. The backstop shoulder 34 extends from outside the bore radius to a radius less than the rod shoulder radius so that the rod shoulder 32 cannot pass the backstop shoulder 34 by moving along the first axis A. In this case the rod shoulder 3 2is substantially disc, or ring, shaped and the backstop shoulder 34 includes an arc around a rear end 38 of the body 2. The backstop 6 also includes two finger projections 40 which extend in opposite directions away from the body 2 substantially perpendicular to the first axis A to facilitate manual handling of the syringe 1 during use.
Figure 3 shows a perspective view of the plunger 4 of figure 1 showing the plunger contact surface 22 at the first end 24 of the plunger 4. The rod 26 extends from the first end 24 to the rear portion 25. The rear portion 25 includes a disc shaped flange 42 to facilitate user handling of the device. The flange 42 provides a larger surface area for contact by the user than a bare end of the rod 26.
Figure 4 shows a cross section though a syringe body 2 and rod 26. The rod 26 includes four longitudinal ribs 44 and the angle between the ribs is 90°.
Figure 5 shows a detailed view of a stopper 10 showing a conical shaped front surface 16 and three circumferential ribs 52, 54, 56 around a substantially cylindrical body 58. The axial gap between the first rib 52 and the last rib 56 is about 3mm. The rear surface 60 of the stopper 10 includes a substantially central recess 62. The central recess 62 includes an initial bore 64 having a first diameter. The initial bore 64 leading from the rear surface 60 into the stopper 10 to an inner recess 66 having a second diameter, the second diameter being larger than the first diameter.
Figure 6. A Htral antagonist compound (Compound ID NO 67,1 ). The compound may be in the form of a pharmaceutical salt, such as a sodium salt or a potassium salt.
Figure 7. A Htral antagonist compound (Compound ID NO 86,1 ). The compound may be in the form of a pharmaceutical salt, such as a sodium salt or a potassium salt.
Figure 8. A Htral antagonist compound (Compound ID NO 73,1 ). The compound may be in the form of a pharmaceutical salt, such as a sodium salt or a potassium salt.
Figure 9. A Htral antagonist compound (Compound A)
Figure 10A. A library of n=231 HTRA1 LNA oligonucleotides were screened in U251 cell lines at 5 mM. The residual HTRA1 mRNA expression level was measured by qPCR and is shown as % of control (PBS-treated cells). n=10 oligos located between position 531 13 - 53384 were relatively active.
Figure 10B. A library of n=210 HTRA1 LNA oligonucleotides were screened in U251 cell lines at 5 mM. The residual HTRA1 mRNA expression level was measured by qPCR and is shown as % of control (PBS-treated cells). n=33 oligos located between position 531 13 - 53384 were relatively active.
Figure 10C. A library of n=305 HTRA1 LNA oligonucleotides were screened in U251 and ARPE19 cell lines at 5 and 25 mM, respectively. The residual HTRA1 mRNA expression level was measured by qPCR and is shown as % of control (PBS-treated cells). n=95 oligos located between position 531 13 - 53384 were relatively active in comparison to the rest. Figure 10D. Dose response of HTRA1 mRNA level upon treatment of human primary RPE cells with LNA oligonucleotides, , 10 days of treatment. Scrambled is a control oligo with a scrambled sequence not related to the Htral target sequence.
Figure 11. NHP PK/PD study, IVT administration, 25pg/eye. A) HTRA1 mRNA level measured in the retina by qPCR. B) oligo content in the retina measured by oligo ELISA. C) HTRA1 mRNA level illustrated by ISH. D-E) Quantification of HTRA1 protein level in retina and vitreous, respectively, by IP-MS. Dots show data for individual animals. Error bars show standard errors for technical replicates (n=3). F-G) Reduction in HTRA1 protein level in retina and vitreous, respectively illustrated by western blot.
Figure 12A. Compounds #15,3 and #17 were administered intravitreally in cynomolgus monkeys, and aqueous humor samples were collected at days 3, 8, 15, and 22 post injection. Proteins from undiluted samples were analyzed by capillary electrophoresis using a Peggy Sue device (Protein Simple). HTRA1 was detected using a custom-made polycolonal rabbit antiserum. Data from animals #J60154 (Vehicle), J60158 (C. Id#15,3), J60162 (C. Id#17) are presented.
Figure 12B. Signal intensities were quantified by comparison to purified recombinant (S328A mutant) HTRA1 protein (Origene, #TP700208). The calibration curve is shown here. Figure 12C. Top panel: Calculated HTRA1 aqueous humor concentration from individual animal was plotted against time post injection. Bottom panel: average HTRA1 concentration for the vehicle group at each time point was determined and corresponding relative concentration in treated animals calculated. Open circle: individual value, closed circle: group average. % HTRA1 reduction for day 22 is indicated.
Figure 13. HTRA1 mRNA plotted against HTRA1 protein levels in aqueous humor (blue diamonds) or in retina (red squares) in cynomolgus monkeys treated with various LNA molecules targeting the HTRA1 transcript. Values are expressed as percentage normalized to PBS controls.
Figure 14. Correlation of HTRA1 protein in aqueous humor with (A) HTRA1 protein in retina and (B) HTRA1 mRNA in retina in cynomolgus monkeys treated with various LNA molecules
targeting the HTRA1 transcript. Values are expressed as percentage normalized to PBS controls.
DEFINITIONS
Oligonucleotide
The term“oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.
Antisense oligonucleotides
The term“Antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. It is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than 50% across of the full length of the oligonucleotide
Contiguous Nucleotide Sequence
The term“contiguous nucleotide sequence” refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term“contiguous nucleobase sequence” and the term“oligonucleotide motif sequence”.
In some embodiments all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence, such as a F-G-F’ gapmer region, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. Adventurously, the contiguous nucleotide sequence is 100% complementary to the target nucleic acid.
Nucleotides
Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as“units” or“monomers”.
Modified nucleoside
The term“modified nucleoside” or“nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. In a preferred embodiment the modified nucleoside comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term“nucleoside analogue” or modified“units” or modified“monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.
Modified internucieoside linkages
The term“modified internucieoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. The oligonucleotides of the invention may therefore comprise modified internucieoside linkages. In some embodiments, the modified internucieoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucieoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucieoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides, such as region F and F’.
In an embodiment, the oligonucleotide comprises one or more internucieoside linkages modified from the natural phosphodiester, such one or more modified internucieoside linkages that is for example more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art. Internucieoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucieoside linkages. In some embodiments at least 50% of the internucieoside linkages in the oligonucleotide, or
contiguous nucleotide sequence thereof, are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages. It will be recognized that, in some embodiments the nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate, may be phosphodiester.
A preferred modified internucleoside linkage is phosphorothioate.
Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.
Nuclease resistant linkages, such as phosphorothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers. Phosphorothioate linkages may, however, also be useful in non-nuclease recruiting regions and/or affinity enhancing regions such as regions F and F’ for gapmers. Gapmer oligonucleotides may, in some embodiments comprise one or more phosphodiester linkages in region F or F’, or both region F and F’, which the internucleoside linkage in region G may be fully phosphorothioate.
Advantageously, all the internucleoside linkages in the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate linkages.
Nucleobase
The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid
Chemistry Suppl. 37 1.4.1.
In some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5- thiazolo-uracil, 2-thio-uracil, 2’thio-thymine, inosine, diaminopurine, 6-aminopurine, 2- aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.
The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.
Modified oligonucleotide
The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages. The term chimeric” oligonucleotide is a term that has been used in the literature to describe oligonucleotides with modified nucleosides.
Complemen tarity
The term“complementarity” describes the capacity for Watson-Crick base-pairing of nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009)
Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1 ).
The term“% complementary” as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to ( i.e . form Watson Crick base pairs with) a contiguous sequence of nucleotides, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid or target sequence). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences (when aligned with the target sequence 5’-3’ and the oligonucleotide sequence from 3’-5’), dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch.
Preferably, insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence.
The term“fully complementary”, refers to 100% complementarity.
Identity
The term“Identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g.
oligonucleotide) which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif). The percentage of identity is thus calculated by counting the number of aligned bases that are identical (a match) between two sequences (e.g. in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the aligned region and multiplying by 100. Therefore, Percentage of Identity = (Matches x 100)/Length of aligned region (e.g. the contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
Hybridization
The term“hybridizing” or“hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions Tm is not strictly proportional to the affinity (Mergny and Lacroix, 2003 , Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by AG°=-RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong
hybridization between the oligonucleotide and target nucleic acid. AG° is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et a!., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. AG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995,
Biochemistry 34:11211-1 1216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated DQ° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy DQ°. The oligonucleotides may hybridize to a target nucleic acid with estimated DQ° values below the range of -10 kcal, such as below -15 kcal, such as below - 20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length.
In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated DQ° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or- 16 to -27 kcal such as -18 to -25 kcal.
Target Sequence
The oligonucleotide comprises a contiguous nucleotide region which is complementary to or hybridizes to a sub-sequence of the target nucleic acid molecule. The term“target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the contiguous nucleotide region or sequence of the oligonucleotide of the invention. In some
embodiments, the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide region or sequence of the oligonucleotide of the invention. In some embodiments the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention. The oligonucleotide of the invention comprises a contiguous nucleotide region which is complementary to the target nucleic acid, such as a target sequence.
The oligonucleotide comprises a contiguous nucleotide region of at least 10 nucleotides which is complementary to or hybridizes to a target sequence present in the target nucleic acid molecule. The contiguous nucleotide region (and therefore the target sequence) comprises of at least 10 contiguous nucleotides, such as 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, contiguous nucleotides, such as from 12-22, such as from 14-18 contiguous nucleotides.
In some embodiments the target sequence is present within a sequence selected from the group consisting of SEQ ID NO 113, 114, 1 15, 1 16, 1 17 and 118.
Target nucleic acid
According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian HTRA1 and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as an HTRA1 target nucleic acid.
Suitably, the target nucleic acid encodes an HTRA1 protein, in particular mammalian HTRA1 , such as human HTRA1 (See for example tables 1 & 2 which provides the mRNA and pre-mRNA sequences for human HTRA1 ).
In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1 or 2 or naturally occurring variants thereof (e.g. sequences encoding a mammalian HTRA1 protein.
A target cell is a cell which is expressing the HTRA1 target nucleic acid. In preferred embodiments the target nucleic acid is the HTRA1 mRNA, such as the HTRA1 pre-mRNA or HTRA1 mature mRNA. The poly A tail of HTRA1 mRNA is typically disregarded for antisense oligonucleotide targeting.
If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
The target sequence may be a sub-sequence of the target nucleic acid. In some
embodiments the oligonucleotide or contiguous nucleotide region is fully complementary to, or only comprises one or two mismatches to an HTRA1 sub-sequence, such as a sequence selected from the group consisting of SEQ ID NO 1 13, 1 14, 115, 116, 117 or 231.
The target sequence may be a sub-sequence of the target nucleic acid. In some
embodiments the oligonucleotide or contiguous nucleotide region is fully complementary to, or only comprises one or two mismatches to an HTRA1 sub-sequence, such as a sequence selected from the group consisting of SEQ ID NO 124 - 230. In some embodiments the oligonucleotide or contiguous nucleotide region is fully complementary to, or only comprises one or two mismatches to an HTRA1 sub-sequence SEQ ID NO 231.
Complementarity to the target or sub-sequence thereof is measured over the length of the oligonucleotide, or contiguous nucleotide region thereof.
For in vivo or in vitro application, the oligonucleotide of the invention is typically capable of inhibiting the expression of the HTRA1 target nucleic acid in a cell which is expressing the HTRA1 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the HTRA1 target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non
complementary terminal nucleotides (e.g. region D). The target nucleic acid may, in some embodiments, be a RNA or DNA, such as a messenger RNA, such as a mature mRNA or a pre-mRNA. In some embodiments the target nucleic acid is a RNA or DNA which encodes mammalian HTRA1 protein, such as human HTRA1 , e.g. the human HTRA1 mRNA sequence, such as that disclosed as SEQ ID NO 1 (NM_002775.4, Gl:190014575). Further information on exemplary target nucleic acids is provided in tables 1 & 2.
Table 1. Genome and assembly information for human and Cyno HTRA1.
Fwd = forward strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence). The NCBI reference provides the mRNA sequence (cDNA sequence).
*The National Center for Biotechnology Information reference sequence database is a comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein. It is hosted at www.ncbi.nlm.nih.gov/refseq.
**ln the NCBI reference sequence there is a stretch of 100 nucleotides from position 126 to position 227 whose identity is not known. In SEQ ID NO 3 & 4, this stretch has been replaced by the nucleotides appearing in both human and Macaca mulatta HTRA1 premRNA sequences in this region.
Table 2. Sequence details for human and Cyno HTRA1.
Naturally occurring variant
The term“naturally occurring variant” refers to variants of HTRA1 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof. In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian HTRA1 target nucleic acid, such as a target nucleic acid selected form the group consisting of SEQ ID NO 1 ,2, 3 & 4.
Modulation of expression
The term“modulation of expression” as used herein is to be understood as an overall term for an oligonucleotide’s ability to alter the amount of the target nucleic acid or target protein, such as e.g. the level of HTRA1 when compared to the amount of the target HTRA1 before administration of the oligonucleotide. Alternatively modulation of expression may be determined by reference to a control experiment where the oligonucleotide of the invention is not administered. One type of modulation is an oligonucleotide’s ability to inhibit, down- regulate, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of HTRA1 , e.g. by degradation of mRNA or blockage of transcription. The antisense oligonucleotide of the invention are capable of inhibiting, down-regulating, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of HTRA1.
High affinity modified nucleosides
A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1.5 to +10°C and most preferably between+3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2’ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr.
Opinion in Drug Development, 2000, 3(2), 293-213).
Sugar modifications
The oligomer of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO201 1/017521 ) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.
Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2’-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2’, 3’, 4’ or 5’ positions.
2’ sugar modified nucleosides.
A 2’ sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2’ position (2’ substituted nucleoside) or comprises a 2’ linked biradicle capable of forming a bridge between the 2’ carbon and a second carbon in the ribose ring, such as LNA (2’ - 4’ biradicle bridged) nucleosides.
Indeed, much focus has been spent on developing 2’ substituted nucleosides, and numerous 2’ substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, the 2’ modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2’ substituted modified nucleosides are 2’-0-alkyl-RNA, 2’-0-methyl-RNA, 2’- alkoxy-RNA, 2’-0-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA, and 2’-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2’ substituted modified nucleosides.
2'-O-M0E 2'-0-AHyi 2'-CHEthylamine
In relation to the present invention 2’ substituted does not include 2’ bridged molecules like LNA.
Locked Nucleic Acids (LNA)
A“LNA nucleoside” is a 2’- modified nucleoside which comprises a biradical linking the C2’ and C4’ of the ribose sugar ring of said nucleoside (also referred to as a“2’- 4’ bridge”), which restricts or locks the conformation of the ribose ring. These nucleosides are also
termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide/complement duplex.
Non limiting, exemplary LNA nucleosides are disclosed in WO 99/014226, WO
00/66604, WO 98/039352 , WO 2004/046160, WO 00/047599, WO 2007/134181 , WO 2010/077578, WO 2010/036698, WO 2007/090071 , WO 2009/006478, WO 2011/156202, WO 2008/154401 , WO 2009/067647, WO 2008/150729, Morita et al., Bioorganic &
Med.Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81 , and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.
Further non limiting, exemplary LNA nucleosides are disclosed in Scheme 1.
Scheme 1 :
Particular LNA nucleosides are beta-D-oxy-LNA, 6’-methyl-beta-D-oxy LNA such as (S)-6’-methyl-beta-D-oxy-LNA (ScET) and ENA.
A particularly advantageous LNA is beta-D-oxy-LNA.
RNase H Activity and Recruitment
The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with
phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613 (hereby incorporated by reference). For use in determining RHase H activity, recombinant human RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland.
Gapmer
The antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof may be a gapmer. The antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions a 5’-flank, a gap and a 3’-flank, F-G-F’ in the‘5 -> 3’ orientation. The“gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5’ flanking region (F) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3’ flanking region (F’) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F’ enhance the affinity of the oligonucleotide for the target nucleic acid ( i.e . are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified nucleosides in region F and F’ are 2’ sugar modified nucleosides, such as high affinity 2’ sugar modifications, such as independently selected from LNA and 2’-MOE.
In a gapmer design, the 5’ and 3’ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5’ (F) or 3’ (F’) region respectively. The flanks may further defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5’ end of the 5’ flank and at the 3’ end of the 3’ flank.
Regions F-G-F’ form a contiguous nucleotide sequence. Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F’.
The overall length of the gapmer design F-G-F’ may be, for example 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, Such as from 14 to17, such as 16 to18 nucleosides.
By way of example, the gapmer oligonucleotide of the present invention can be represented by the following formulae:
F-i-8-G5-i6-F’i-8, such as
F1-8-G7-16-F 2-8
with the proviso that the overall length of the gapmer regions F-G-F’ is at least 12, such as at least 14 nucleotides in length.
Regions F, G and F’ are further defined below and can be incorporated into the F-G-F’ formula.
Gapmer - Region G
Region G (gap region) of the gapmer is a region of nucleosides which enables the oligonucleotide to recruit RNaseH, such as human RNase H1 , typically DNA nucleosides. RNaseH is a cellular enzyme which recognizes the duplex between DNA and RNA, and enzymatically cleaves the RNA molecule. Suitably gapmers may have a gap region (G) of at least 5 or 6 contiguous DNA nucleosides, such as 5 - 16 contiguous DNA nucleosides, such as 6 - 15 contiguous DNA nucleosides, such as 7-14 contiguous DNA nucleosides, such as 8 - 12 contiguous DNA nucleotides, such as 8 - 12 contiguous DNA nucleotides in length. Whilst traditional gapmers have a DNA gap region, there are numerous examples of modified nucleosides which allow for RNaseH recruitment when they are used within the gap region. Modified nucleosides which have been reported as being capable of recruiting RNaseH when included within a gap region include, for example, alpha-L-LNA, C4’ alkylated DNA (as described in PCT/EP2009/050349 and Vester et a!., Bioorg. Med. Chem. Lett. 18 (2008) 2296 - 2300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661 ), UNA
(unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039 incorporated herein by reference). UNA is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked“sugar” residue. The modified nucleosides used in such gapmers may be nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region, i.e. modifications which allow for RNaseH recruitment). In some embodiments the DNA Gap region (G) described herein may optionally contain 1 to 3 sugar modified nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region.
Region G -“Gap-breaker”
Alternatively, there are numerous reports of the insertion of a modified nucleoside which confers a 3’ endo conformation into the gap region of gapmers, whilst retaining some
RNaseH activity. Such gapmers with a gap region comprising one or more 3’endo modified nucleosides are referred to as“gap-breaker” or“gap-disrupted” gapmers, see for example WO2013/022984. Gap-breaker oligonucleotides retain sufficient region of DNA nucleosides within the gap region to allow for RNaseH recruitment. The ability of gapbreaker
oligonucleotide design to recruit RNaseH is typically sequence or even compound specific - see Rukov et al. 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487, which discloses“gapbreaker” oligonucleotides which recruit RNaseH which in some instances provide a more specific cleavage of the target RNA. Modified nucleosides used within the gap region of gap- breaker oligonucleotides may for example be modified nucleosides which confer a 3’endo confirmation, such 2’ -O-methyl (OMe) or 2’-0-MOE (MOE) nucleosides, or beta-D LNA nucleosides (the bridge between C2’ and C4’ of the ribose sugar ring of a nucleoside is in the beta conformation), such as beta-D-oxy LNA or ScET nucleosides.
Gapmer - flanking regions, F and F’
Region F is positioned immediately adjacent to the 5’ DNA nucleoside of region G. The 3’ most nucleoside of region F is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.
Region F’ is positioned immediately adjacent to the 3’ DNA nucleoside of region G. The 5’ most nucleoside of region F’ is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.
Region F is 1 - 8 contiguous nucleotides in length, such as 2-6, such as 3-4 contiguous nucleotides in length. Advantageously the 5’ most nucleoside of region F is a sugar modified nucleoside. In some embodiments the two 5’ most nucleoside of region F are sugar modified nucleoside. In some embodiments the 5’ most nucleoside of region F is an LNA nucleoside. In some embodiments the two 5’ most nucleoside of region F are LNA nucleosides. In some embodiments the two 5’ most nucleoside of region F are 2’ substituted nucleoside nucleosides, such as two 3’ MOE nucleosides. In some embodiments the 5’ most nucleoside of region F is a 2’ substituted nucleoside, such as a MOE nucleoside.
Region F’ is 2 - 8 contiguous nucleotides in length, such as 3-6, such as 4-5 contiguous nucleotides in length. Advantageously, embodiments the 3’ most nucleoside of region F’ is a sugar modified nucleoside. In some embodiments the two 3’ most nucleoside of region F’ are sugar modified nucleoside. In some embodiments the two 3’ most nucleoside of region F’ are LNA nucleosides. In some embodiments the 3’ most nucleoside of region F’ is an LNA nucleoside. In some embodiments the two 3’ most nucleoside of region F’ are 2’ substituted nucleoside nucleosides, such as two 3’ MOE nucleosides. In some embodiments the 3’ most nucleoside of region F’ is a 2’ substituted nucleoside, such as a MOE nucleoside.
It should be noted that when the length of region F or F’ is one, it is advantageously an LNA nucleoside.
In some embodiments, region F and F’ independently consists of or comprises a contiguous sequence of sugar modified nucleosides. In some embodiments, the sugar modified nucleosides of region F may be independently selected from 2’-0-alkyl-RNA units, 2’-0- methyl-RNA, 2’-amino-DNA units, 2’-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2’-fluoro-ANA units.
In some embodiments, region F and F’ independently comprises both LNA and a 2’ substituted modified nucleosides (mixed wing design).
In some embodiments, region F and F’ consists of only one type of sugar modified nucleosides, such as only MOE or only beta-D-oxy LNA or only ScET. Such designs are also termed uniform flanks or uniform gapmer design.
In some embodiments, all the nucleosides of region F or F’, or F and F’ are LNA
nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET
nucleosides. In some embodiments region F consists of 1-5, such as 2-4, such as 3-4 such as 1 , 2, 3, 4 or 5 contiguous LNA nucleosides. In some embodiments, all the nucleosides of region F and F’ are beta-D-oxy LNA nucleosides.
In some embodiments, all the nucleosides of region F or F’, or F and F’ are 2’ substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments region F consists of 1 , 2, 3, 4, 5, 6, 7, or 8 contiguous OMe or MOE nucleosides. In some embodiments only one of the flanking regions can consist of 2’ substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments it is the 5’ (F) flanking region that consists 2’ substituted nucleosides, such as OMe or MOE nucleosides whereas the 3’ (F’) flanking region comprises at least one LNA nucleoside, such as beta-D-oxy LNA nucleosides or cET nucleosides. In some embodiments it is the 3’ (F’) flanking region that consists 2’ substituted nucleosides, such as OMe or MOE nucleosides whereas the 5’ (F) flanking region comprises at least one LNA nucleoside, such as beta-D-oxy LNA nucleosides or cET nucleosides.
In some embodiments, all the modified nucleosides of region F and F’ are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides, wherein region F or F’, or F and F’ may optionally comprise DNA nucleosides (an alternating flank, see definition of these for more details). In some embodiments, all the modified nucleosides of region F and F’ are beta-D-oxy LNA nucleosides, wherein region F or F’, or F and F’ may optionally comprise DNA nucleosides (an alternating flank, see definition of these for more details).
In some embodiments the 5’ most and the 3’ most nucleosides of region F and F’ are LNA nucleosides, such as beta-D-oxy LNA nucleosides or ScET nucleosides.
In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F’ and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkages between the nucleosides of region F or F’, F and F’ are phosphorothioate internucleoside linkages.
LNA Gapmer
An LNA gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of beta-D-oxy LNA nucleosides.
Treatment
The term’treatment’ as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.
DETAILED DESCRIPTION OF THE INVENTION
Htral oligonucleotide antagonists
The present invention provides a preloaded syringe (also referred to as pre-filled syringe) comprising (i.e. containing) an ophthalmic solution of an oligonucleotide targeting a mammalian HTRA1 nucleic acid.
The invention provides for a sealed sterile package comprising the pre-filled syringe of the invention. The sterile sealed package protects a sterile environment within the sealed package, ensuring the pre-filled syringe is maintained in a sterile environment prior to use. The sealed sterile package may be in the form of a blister pack.
The present invention provides a sterile vial, for example a sterile glass vial, containing an ophthalmic solution of an oligonucleotide targeting a mammalian HTRA1 nucleic acid. The present invention provides a sterile ampule, for example a sterile glass ampule, containing an ophthalmic solution of an oligonucleotide targeting a mammalian HTRA1 nucleic acid.
The oligonucleotide targeting a mammalian HTRA1 nucleic acid is capable of inhibiting the expression of HTRA1 , and may be used to treat or prevent diseases related to the functioning of the HTRA1. The oligonucleotides targeting HTRA1 are antisense
oligonucleotides, i.e. are complementary to their HTRA1 nucleic acid target. The
oligonucleotide may be in the form of a pharmaceutically acceptable salt, such as a sodium salt or a potassium salt or ammonium salt, for example a sodium salt.
The antisense oligonucleotides may comprise a contiguous nucleotide sequence of 10 - 30 nucleotides in length with at least 90% complementarity, such as fully complementary to a mammalian HTRA1 nucleic acid, such as SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
The antisense oligonucleotide may be an LNA antisense oligonucleotides, such as LNA gapmer oligonucleotides, which comprise a contiguous nucleotide sequence of 10 - 30 nucleotides in length with at least 90% complementarity, such as fully complementary to a HTRA1 nucleic acid, such as a sequence selected from the group consisting of SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
The antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 113.
The antisense oligonucleotide may be of 10 - 30 nucleotides in length, wherein said antisense oligonucleotide comprises a contiguous nucleotide region of 10 - 30, such as 12 - 22, nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 1 13. The reverse complement of SEQ ID NO 113 is shown in SEQ ID NO 119.
The antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 114.
The antisense oligonucleotide of 10 - 30 nucleotides in length, may comprise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 114. The reverse complement of SEQ ID NO 114 is SEQ ID NO 120.
The antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 115.
The antisense oligonucleotide of 10 - 30 nucleotides in length, may comrpise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 115. The reverse complement of SEQ ID NO 115 is shown in SEQ ID NO 121.
The antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 1 16.
The antisense oligonucleotide of 10 - 30 nucleotides in length, may comprise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 1 16. The reverse complement of SEQ ID NO 1 16 is SEQ ID NO 122.
The antisense oligonucleotide may comprise a contiguous nucleotide region of at 10 - 30, such as 12 - 22, nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 1 17.
The antisense oligonucleotide of 10 - 30 nucleotides in length, may comprise a contiguous nucleotide region of 10 - 30, such as 12 - 22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 1 17. The reverse complement of SEQ ID NO 1 17 is SEQ ID NO 123.
The invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 . The invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 12 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 . The invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 14 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 . The invention provides a preloaded syringe device for administration of an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 15 or 16 contiguous nucleotides present in any one of SEQ ID NOs 5 - 1 1 1 . The invention provides a preloaded syringe device for administration of an antisense oligonucleotide, wherein the contiguous nucleotide sequence of the oligonucleotide comprises or consists of a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs 5 - 1 1 1 .
In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide region of at least 10, or at least 12, at least 13, or at least 14 or at least 15 or at least 16 contiguous nucleotides present SEQ ID NO 1 18: 5’ CTTCTTCTATCTACGCATTG 3’. The reverse complement of SEQ ID NO 1 18 is SEQ ID NO 231 : C AAT G C GT AG AT AG AAG AAG .
The invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, at least 13, or at least 14 or at least 15 or at least 16 contiguous nucleotides complementary to SEQ ID NO 231 .
The invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides present SEQ ID NO 67.
The invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides present SEQ ID NO 86.
The invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or at least 16 or at least 17 or 18 contiguous nucleotides present SEQ ID NO 73.
The invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides complementary to SEQ ID NO 186.
The invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or 16 contiguous nucleotides complementary to SEQ ID NO 205.
The invention provides an antisense oligonucleotide which comprises a contiguous nucleotide region of at least 10, or at least 12, or at least 13, or at least 14 or at least 15 or at least 16 or at least 17 or 18 contiguous nucleotides complementary to SEQ ID NO 192.
The invention provides for a preloaded syringe device comprising an oligonucleotide comprising or consisting of an oligonucleotide selected from the group consisting of:
TsTs mCstsastsCstsas mCsgsCsasTsTsG (SEQ ID NO 67,1 ),
mCsTsTs mCststsCstsastsCstsas mCsgsCsAsT (SEQ ID NO 73,1 ), and
TsAs mCsTststsasastsasgsCsTs mCsAsA (SEQ ID NO 86,1 );
wherein capital letters represent beta-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, subscript s represents a phosphorothioate internucleoside linkage, and mC represent 5 methyl cytosine beta-D-oxy LNA nucleosides, and mc represents 5 methyl cytosine DNA nucleosides.
In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, such as at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the normal expression level of the target. In some embodiments
compounds of the invention may be capable of inhibiting expression levels of HTRA1 mRNA by at least 60% or 70% in vitro using ARPE-19 cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of HTRA1 mRNA by at least 60% or 70% in vitro using ARPE-19 cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of HTRA1 protein by at least 50% in vitro using ARPE-19 cells. Suitably, the examples provide assays which may be used to measure HTRA1 RNA or protein inhibition. The target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of HTRA1 expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2’ modified nucleosides, including LNA, present within the oligonucleotide sequence.
An aspect of the present invention relates to an antisense oligonucleotide which comprises a contiguous nucleotide region of 10 to 30 nucleotides in length with at least 90%
complementarity to HTRA1 target sequence, such as fully complementary to an HTRA1 target sequence, e.g. a nucleic acid selected from the group consisting SEQ ID NO 1 , 2, 3 & 4.
In some embodiments, the oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid.
In some embodiments, the oligonucleotide of the invention, or a contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of a sequence selected from the group consisting of SEQ ID NO 1 19, 120, 121 , 122 or 123.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of a sequence selected from the group consisting of SEQ ID NOs 124- 230.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 186.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 192.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least
12 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 205.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least
13 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 186.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 13 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 192.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least
13 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 205.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least
14 nucleotides thereof, is fully (or 100%) complementary to a sequence selected from the group consisting of SEQ ID NO 113, 114, 115, 116, 117 and 231.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 186.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 192.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 205.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 15 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 186.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 15 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 192.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least
15 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 205.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least
16 nucleotides thereof, is fully (or 100%) complementary to a sequence selected from the group consisting of SEQ ID NO SEQ ID NO 1 13, 1 14, 1 15, 1 16, 117 and 231.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 16 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 186.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 16, such as 16, 17 or 18 nucleotides thereof, is at least 90% complementary, such as fully (or 100%) complementary to a region of SEQ ID NO 192.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 16 nucleotides thereof, is at least 90% complementary, such as fully (or 100%)
complementary to a region of SEQ ID NO 205.
In some embodiments the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to a sequence selected from the group consisting of a sequence selected from the group consisting of SEQ ID NO SEQ ID NO 113, 1 14, 1 15, 1 16, 1 17 and 231.
In some embodiments the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to a sequence selected from the group consisting of a sequence selected from the group consisting of SEQ ID NO 124 - 230.
In some embodiments the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to SEQ ID NO 186.
In some embodiments the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to SEQ ID NO 192.
In some embodiments the oligonucleotide, or contiguous nucleotide region thereof is fully (or 100%) complementary to SEQ ID NO 205.
It is understood that the oligonucleotide motif sequences can be modified to for example increase nuclease resistance and/or binding affinity to the target nucleic acid. Modifications are described in the definitions and in the Oligonucleotide design” section.
In some embodiments, the oligonucleotide of the invention, or contiguous nucleotide region thereof is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide, or contiguous nucleotide sequence of at least 12 nucleotides thereof, is at least 90% complementary, such as fully (or 100%) complementary to the target nucleic acid sequence.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 12 nucleotides thereof, has 100% identity to a sequence selected from the group consisting of SEQ ID NOs 5 - 1 11.
In some embodiments the oligonucleotide, or a contiguous nucleotide sequence of at least 14 nucleotides thereof, has 100% identity to a sequence selected from the group consisting of SEQ ID NOs 5 - 11 1
In some embodiments the oligonucleotide, or contiguous nucleotide sequence of at least 16 nucleotides thereof, has 100% identity to a sequence selected from the group consisting of SEQ ID NOs 5 - 11 1.
In some embodiments the oligonucleotide, or contiguous nucleotide region thereof, comprises or consists of a sequence selected from SEQ ID NOs 5 - 1 11.
In some embodiments the oligonucleotide of the invention is selected from the following group (Note the target subsequence is the reverse complement of the oligonucleotide motif):
or conjugate thereof; wherein for the column entitled compound design, capital letters are LNA nucleosides, lower case letters are DNA nucleosides, cytosine nucleosides are optionally 5 methyl cytosine, and internucleoside linkages are at least 80%, such as at least 90% or 100% modified internucleoside linkages, such as phosphorothioate internucleoside linkages. In some embodiments all internucleoside linkages of the compounds in the compound design column in the above table are phosphorothioate internucleoside linkages. The motif and target subsequence sequences are nucleobase sequences.
The invention provides the following oligonucleotides:
wherein in the compounds of the above table, capital letters represent beta-D-oxy LNA nucleosides, all LNA cytosines are 5-methyl cytosine (as indicated by the superscript m), lower case letters represent DNA nucleosides, superscript m before a lower case c
represents a 5 methyl cytosine DNA nucleoside. All internucleoside linkages are phosphorothioate internucleoside linkages.
Unit dose
It will be understood that the pre-loaded syringe of the invention may comprise a unit dose of the antisense oligonucleotide therapeutic in the form of an ophthalmic solution. Typically, in addition to the unit dose, the pre-loaded syringe may comprise an additional volume of the ophthalmic solution so allow for the volume of the dead space in the syringe and syringe needle (known as dead volume) - the unit dose being present within the extractable volume of the syringe.
In some embodiments the unit dose is 5pg - 200pg per eye, such 10pg - 100pg per eye, such as 20pg - 50pg per eye. In some embodiments, the volume of ophthalmic solution administered to each eye is, for example about 25mI - about 10OmI, such as about 50mI.
Administration is typically via intravitreal injection, such as in an ophthalmic solution comprising a dose of (unit dose). In some embodiments the unit dose of the antisense oligonucleotide, such as the HTRA1 oligonucleotide antagonist is 0.005mg - 1 mg per eye, such as about 0.05mg to about 0.1 mg per eye. In some embodiments the unit dose is from about O.OOI mg - about 0.2mg per eye, such as about 0.05mg per eye, or about 0.150mg per eye, such as about 0.1 mg per eye.
The vial or ampule of the invention suitably comprises a unit dose of the antisense oligonucleotide, for example either as an anhydrous powder, or in the form of an ophthalmic solution. It will be recognized that for administration, the anhydrous powder is solubilized in a therapeutically acceptable sterile solvent (such ophthalmically acceptable, e.g. as according to the ophthalmic solution), prior to administration to the eye via e.g. intravitreal injection. The vial or ampule typically comprises more than the unit dose of the antisense oligonucleotide.
Ophthalmic solution
An ophthalmic solution is a solution which comprises the antisense oligonucleotide therapeutic, such as the HTRA1 oligonucleotide antagonist dissolved in a solvent which is compatible with administration via injection into the eye, such as an intravitreal injection.
The solvent is suitably a buffered aqueous solution, such as phosphate buffered saline, e.g. of pH about 7 - about 7.5, such as about 7.4. In some embodiments, the solution is
phosphate or Histidine/sucrose buffer solution, pH about 7.4, with NaCI to reach isotonicity (250-350mOsm). Other ophthalmic acceptable buffered solutions may be used.
The ophthalmic solution is sterile, and may be sterilized prior to or during the manufacture of the pre-loaded syringe device. In some embodiments the oligonucleotide and ophthalmic solution are manufactured under sterile conditions.
The concentration of the HTRA1 oligonucleotide antagonist in the ophthalmic solution may for example, be at 0.05mg/ml - 40mg/ml, such as about 1 mg/ml - about 10mg/ml. In some embodiments the concentration of the HTRA1 oligonucleotide antagonist in the ophthalmic solution is up to or is about 1 mg/ml. In some embodiments the concentration of the HTRA1 oligonucleotide antagonist in the ophthalmic solution is up to or is about 10mg/ml. The inventors have determined that low concentrations of oligonucleotide, administered in a volume of 25 - 10OmI, are therapeutically efficacious. Furthermore, the use of low
concentration of antisense oligonucleotide in the ophthalmic solution is compatible with a narrow needle gauge, such as a needle gauge of 27 - 31 , such as 30, to be used due to the low viscosity of the ophthalmic solution of the antisense oligonucelotide.
In some embodiments the unit dose volume of the ophthalmic solution to be administered to the subject via intravitreal injection (per eye) is about 25 - about 10OmI, such as about 50mI.
The syringe device typically comprises additional ophthalmic solution for example to fill the dead-volume within the syringe device.
The vial or ampule of the invention may comprise the ophthalmic solution.
The Pre-Filled Syringe (also referred to as pre-loaded syringe)
The preloaded syringe device typically comprises a barrel body, a plunger, and a stopper. The barrel body contains a sterile ophthalmic solution of the antisense oligonucleotide.
In some aspects, the present invention provides a pre-filled syringe, the syringe comprising a body, a stopper and a plunger, the body comprising an outlet at an outlet end and the stopper being arranged within the body such that a front surface of the stopper and the body define a variable volume chamber from which a fluid can be expelled though the outlet, the plunger comprising a plunger contact surface at a first end and a rod extending between the plunger contact surface and a rear portion, the plunger contact surface arranged to contact the stopper, such that the plunger can be used to force the stopper towards the outlet end of
the body, reducing the volume of the variable volume chamber, characterized in that the fluid comprises an ophthalmic solution comprising an antisense oligonucleotide therapeutic.
In one embodiment, the ophthalmic solution comprises an antisense oligonucleotide HTRA1 antagonist, such as those disclosed herein [e.g. SEQ ID NO 5 - 11 1].
The syringe is suitable for ophthalmic injections, more particularly intra-vitreal injections, and as such may have a suitably small volume. The syringe may also be silicone oil free, or substantially silicone oil free, or may comprise a low level of silicone oil as lubricant. In one embodiment, despite the low silicone oil level, the stopper break loose and slide force is less than 20N.
The body of the syringe may be a substantially cylindrical shell, or may include a
substantially cylindrical bore with a non-circular outer shape. The outlet end of the body includes an outlet through which a fluid housed within the variable volume chamber can be expelled as the volume of said chamber is reduced. The outlet may comprise a projection from the outlet end through which extends a channel having a smaller diameter than that of the variable volume chamber. The outlet may be adapted, for example via a luer lock type connection, for connection to a needle or other accessory such as a sealing device which is able to seal the variable volume chamber, but can be operated, or removed, to unseal the variable volume chamber and allow connection of the syringe to another accessory, such as a needle. Such a connection may be made directly between the syringe and accessory, or via the sealing device. The body extends along a first axis from the outlet end to a rear end. The body may be made from a plastic material (e.g. a cyclic olefin polymer) or from glass and may include indicia on a surface thereof to act as an injection guide. In one embodiment the body may comprise a priming mark. This allows the physician to align a pre-determined part of the stopper (such as the tip of the front surface or one of the circumferential ribs, discussed later) or plunger with the mark, thus expelling excess ophthalmic solution and any air bubbles from the syringe. The priming process ensures that an exact, pre-determined dosage is administered to the patient.
The needle is a hollow needle which is suitable for injection of the ophthalmic solution through the cornea (for intravitreal injection). In comparison the antibody therapeutics for IVT administration, the antisense oligonucleotide of the invention has a lower viscosity, and as such a narrower gauge needle may be used (such as the 27 - 30 gauge). Narrower needles are advantageous in limiting the damage at the injection site and reducing patient discomfort. However, for administration through the cornea the needle should not be so thin as to have insufficient structural integrity. The gauge of the needle is suitably 20 - 31 , such as 25 - 31 or 27 - 30.
The stopper may be made from rubber, silicone or other suitable resiliently deformable material. The stopper may be substantially cylindrical and the stopper may include one or more circumferential ribs around an outer surface of the stopper, the stopper and ribs being dimensioned such that the ribs form a substantially fluid tight seal with an internal surface of the syringe body. The front surface of the stopper may be any suitable shape, for example substantially planar, substantially conical or of a domed shape. The rear surface of the stopper may include a substantially central recess. Such a central recess could be used to connect a plunger to the stopper using a snap fit feature or thread connection in a known manner. The stopper may be substantially rotationally symmetric about an axis through the stopper. In some embodiments, the syringe body is made of or comprises glass, plastic, ceramic or metal. In some embodiments the syringe body is made of or comprises glass. The plunger comprises a plunger contact surface and extending from that a rod extends from the plunger contact surface to a rear portion. The rear portion may include a user contact portion adapted to be contacted by a user during an injection event. The user contact portion may comprise a substantially disc shaped portion, the radius of the disc extending substantially perpendicular to the axis along which the rod extends. The user contact portion could be any suitable shape. The axis along which the rod extends may be the first axis, or may be substantially parallel with the first axis.
The syringe may include a backstop arranged at a rear portion of the body. The backstop may be removable from the syringe. If the syringe body includes terminal flanges at the end opposite the outlet end the backstop may be configured to substantially sandwich terminal flanges of the body as this prevent movement of the backstop in a direction parallel to the first axis.
The rod may comprise at least one rod shoulder directed away from the outlet end and the backstop may include a backstop shoulder directed towards the outlet end to cooperate with the rod shoulder to substantially prevent movement of the rod away from the outlet end when the backstop shoulder and rod shoulder are in contact. Restriction of the movement of the rod away from the outlet end can help to maintain sterility during terminal sterilisation operations, or other operations in which the pressure within the variable volume chamber or outside the chamber may change. During such operations any gas trapped within the variable volume chamber, or bubbles that may form in a liquid therein, may change in volume and thereby cause the stopper to move. Movement of the stopper away from the outlet could result in the breaching of a sterility zone created by the stopper. This is particularly important for low volume syringes where there are much lower tolerances in the component sizes and less flexibility in the stopper. The term sterility zone as used herein is used to refer to the area within the syringe that is sealed by the stopper from access from either end of the syringe. This may be the area between a seal of the stopper, for example a
circumferential rib, closest to the outlet and a seal of the stopper, for example a circumferential rib, furthest from the outlet. The distance between these two seals defines the sterility zone of the stopper since the stopper is installed into the syringe barrel in a sterile environment.
To further assist in maintaining sterility during the operations noted above the stopper may comprise at a front circumferential rib and a rear circumferential rib and those ribs may be separated in a direction along the first axis by at least 3 mm, by at least 3.5 mm, by at least 3.75 mm or by 4 mm or more. One or more additional ribs (for example 2, 3, 4 or 5 additional ribs, or between 1-10, 2-8, 3-6 or 4-5 additional ribs) may be arranged between the front and rear ribs. In one embodiment there are a total of three circumferential ribs.
A stopper with such an enhanced sterility zone can also provide protection for the injectable medicament during a terminal sterilisation process. More ribs on the stopper, or a greater distance between the front and rear ribs can reduce the potential exposure of the
medicament to the sterilising agent. However, increasing the number of ribs can increase the friction between the stopper and syringe body, reducing ease of use. While this may be overcome by increasing the siliconisation of the syringe, such an increase in silicone oil levels is particularly undesirable for syringes for ophthalmic use.
The rod shoulder may be arranged within the external diameter of the rod, or may be arranged outside the external diameter of the rod. By providing a shoulder that extends beyond the external diameter of the rod, but still fits within the body, the shoulder can help to stabilise the movement of the rod within the body by reducing movement of the rod perpendicular to the first axis. The rod shoulder may comprise any suitable shoulder forming elements on the rod, but in one embodiment the rod shoulder comprises a substantially disc shaped portion on the rod.
In one embodiment of the syringe, when arranged with the plunger contact surface in contact with the stopper and the variable volume chamber is at its intended maximum volume there is a clearance of no more than about 2 mm between the rod shoulder and backstop shoulder. In some embodiments there is a clearance of less than about 1.5 mm and in some less than about 1 mm. This distance is selected to substantially limit or prevent excessive rearward (away from the outlet end) movement of the stopper.
In one embodiment the variable volume chamber has an internal diameter greater than 5 mm or 6 mm, or less than 3 mm or 4 mm. The internal diameter may be between 3 mm and 6 mm, or between 4 mm and 5 mm.
In another embodiment the syringe is dimensioned so as to have a nominal maximum fill volume of between about 0.1 ml and about 1.5 ml. In certain embodiments the nominal maximum fill volume is between about 0.5 ml and about 1 ml. In some embodiments the
nominal maximum fill volume is about 0.2ml to 0.5ml. In certain embodiments the nominal maximum fill volume is about 0.5 ml or about 1 ml, or about 1.5 ml. The nominal fill volume comprises the unit dose volume and dead volume and suitably an overfill volume (an excess volume). Suitably the excess volume may be limited to prevent accidental over-dosing.
The length of the body of the syringe may be less than 70 mm, less than 60 mm or less than 50 mm. In one embodiment the length of the syringe body is between 45 mm and 50 mm.
Pharmaceutical Salts
For use as a therapeutic, the oligonucleotide of the invention may be provided as a suitable pharmaceutical salt, such as a sodium or potassium salt or ammonium salt. In some embodiments the oligonucleotide of the invention is a sodium salt (suitable for buffered saline ophthalmic solutions).
Pharmaceutical Composition
In a further aspect, the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates and a
pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium and ammonium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. The pharmaceutical composition may be in the form of the ophthalmic solution.
Further Embodiments
The invention provides methods for treating or preventing a disease, comprising
administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease via intraocular injection of the oligonucleotide using the pre-loaded syringe device of the invention.
The invention also provides an oligonucleotide, or a pharmaceutical composition as described herein, and their use as a medicament.
The oligonucleotide according to the invention is typically administered in an effective amount (e.g. a unit dose).
The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.
The disease or disorder, as referred to herein, is associated with expression of HTRA1. In some embodiments disease or disorder may be associated with a mutation in the HTRA1 gene or a gene whose protein product is associated with or interacts with HTRA1. Therefore, in some embodiments, the target nucleic acid is a mutated form of the HTRA1 sequence and in other embodiments, the target nucleic acid is a regulator of the HTRA1 sequence.
The device and methods of the invention may be employed for treatment or prophylaxis against diseases caused by abnormal levels and/or activity of HTRA1.
The device and methods of the invention are preferably employed in the treatment of diseases or disorders selected from eye disorders, such as macular degeneration, including age related macular degeneration (AMD), such as dry AMD or wet AMD, and diabetic retinopathy.
The invention further relates to use of an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of abnormal levels and/or activity of HTRA1.
In one embodiment, the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of diseases or disorders selected from eye disorders, such as macular degeneration, including age related macular degeneration (AMD), such as dry AMD or wet AMD, and diabetic retinopathy. In some embodiments the oligonucleotide conjugates or pharmaceutical compositions in the device of the invention may be for use in the treatment of geographic atrophy or intermediate dAMD.
For use in treating eye disorders, such as macular degeneration, e.g. AMD (wet or dry), intraocular injection, such as an intravitreal injection is preferably administration route, such as using the pre-loaded syringe device of the invention.
In some embodiments, the compound of the invention, or pharmaceutically acceptable salt thereof, is administered via an intraocular injection in a dose from about 10pg to about 200pg per eye, 10pg to about 100pg per eye, such as about 20pg to about 50 pg per eye.
In some embodiments, the dosage interval, i.e. the period of time between consecutive dosings is at least monthly, such as at least bi monthly or at least once every three months.
Combination therapies
In some embodiments the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or disorders described above
EXAMPLES
Materials and methods
Oligonucleotide synthesis
Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.
Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 pmol scale. At the end of the synthesis, the
oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16hours at 60°C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.
Elongation of the oligonucleotide:
The coupling of b-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA- C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), LNA-T) is performed by using a solution of 0.1 M of the 5’-0-DMT-protected amidite in acetonitrile and DCI (4,5- dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1 ). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.
For post solid phase synthesis conjugation a commercially available C6 aminolinker phorphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected
oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.
Purification by RP-HPLC:
The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10m 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.
Abbreviations:
DCI: 4,5-Dicyanoimidazole
DCM: Dichloromethane
DMF: Dimethylformamide
DMT: 4,4’-Dimethoxytrityl
THF: Tetrahydrofurane
Bz: Benzoyl
Ibu: Isobutyryl
RP-HPLC: Reverse phase high performance liquid chromatography
Tm Assay:
Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x Tm-buffer (200mM NaCI, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 95°C for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (Tm) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20°C to 95°C and then down to 25°C, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex Tm.
Oligonucleotides used:
Compound A is TsAsTststsasCsCstsgsgstsTsGsTsT (SEQ I D NO 232) and compound B is
AstsAsTststsasCsCstsgsGsTsTsgsTsT (SEQ. ID NO 233). For Compounds: Capital letters represent LNA nucleosides (beta-D-oxy LNA nucleosides were used), all LNA cytosines are 5-methyl cytosine, lower case letters represent DNA nucleosides, DNA cytosines preceded with a superscript m represent a 5- methyl C-DNA nucleoside. All internucleoside linkages are phosphorothioate internucleoside linkages.
Example 1. Testing in vitro efficacy of LNA oligonucleotides in U251 cell line at a single concentration.
Identification of promising“hot spot” region for HTRA1. A library of n=231 HTRA1 LNA oligonucleotides were screened in U251 cell line at 5mM, 6 days of treatment. From this library, we identified a series of active oligonucleotides targeting human HTRA1 pre-mRNA between position 531 13 - 53384 as shown in figure 10A (SEQ ID NO 116 or 1 17).
Human glioblastoma U251 cell line was purchased from ECACC and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% CO2. For assays,
15000 U251 cells/well were seeded in a 96 multi well plate in starvation media (media recommended by the supplier with the exception of 1 % FBS instead of 10%). Cells were incubated for 24 hours before addition of oligonucleotides dissolved in PBS. Concentration of oligonucleotides: 5 mM. 3-4 days after addition of oligonucleotides, media was removed and new media (without oligonucleotide) was added. 6 days after addition of
oligonucleotides, the cells were harvested. RNA was extracted using the PureLink Pro 96 RNA Purification kit (Ambion, according to the manufacturer’s instructions). cDNA was then synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion, according the manufacturer’s instruction) with 100mM dNTP set PCR Grade (Invitrogen) and DNase/RNase free Water (Gibco). For gene expressions analysis, qPCR was performed using TagMan Fast Advanced Master Mix (2X) (Ambion) in a doublex set up. Following TaqMan primer assays were used for qPCR: HTRA1 , Hs01016151_m1 (FAM-MGB) and house keeping gene, TBP, Hs4326322E (VIC-MGB) from Life
Technologies. n= 2 independent biological replicates. The residual HTRA1 mRNA expression level in the table is shown as % of control (PBS-treated cells).
Example 2.Testing in vitro efficacy of LNA oligonucleotides in U251 cell line at a single concentration.
The“hot spot” region 531 13 - 53384 described in Example 1 was further validated in a new library of n=210 HTRA1 LNA oligonucleotides that were screened in U251 cell line at 5mM. n=33 LNA oligonucleotides were targeting human HTRA1 pre-mRNA between position 531 13 - 53384 and these oligos were relatively active in comparison to the rest as shown in figure 10B.
The assay was performed as described in example 1. n= 2 independent biological replicates. The residual HTRA1 mRNA expression level is shown in the table as % of control (PBS- treated cells).
Example 3. Testing in vitro efficacy of LNA oligonucleotides in U251 and ARPE19 cell lines at a single concentration.
The“hot spot” region 531 13 - 53384 described in Example 1 and 2 was further validated in a new library of n=305 HTRA1 LNA oligonucleotides that were screened in U251 and ARPE19 cell lines at 5mM and 25mM, respectively. n=95 LNA oligonucleotides were targeting human HTRA1 pre-mRNA between position 531 13 - 53384 and these oligos were relatively active in comparison to the rest as shown in figure 10C.
Human retinal pigmented epithelium ARPE19 cell line was purchased by from ATCC and maintained in DMEM-F12 (Sigma, D8437), 10% FBS, 1% pen/strep in a humidified incubator at 37°C with 5% CO2. The U251 cell line was described in example 1. For assays, 2000 U251 or ARPE19 cells/well were seeded in a 96 multi well plate in culture media
recommended by the supplier. Cells were incubated for 2 hours before addition of oligonucleotides dissolved in PBS. Concentration of oligo was 5 and 25mM in U251 and ARPE19 cells, respectively. 4 days after addition of oligonucleotides, the cells were harvested. RNA extraction was performed as described in example 1 , cDNA synthesis and qPCR were performed using qScript XLT one-step RT-qPCR ToughMix Low ROX, 95134- 100 (Quanta Biosciences). Following TaqMan primer assays were used for U251 and ARPE19 cells in a douplex set up: HTRA1 , Hs01016151_m1 (FAM-MGB) and house keeping gene, GAPDH, Hs4310884E (VIC-MGB). All primer sets were purchased from Life
Technologies. n=1 biological replicate. The relative HTRA1 mRNA expression level in the table is shown as % of control (PBS-treated cells).
Example 4. Testing in vitro potency and efficacy of selected compounds in U251 and ARPE19 cell lines in a dose response curve.
The U251 and ARPE19 cell lines were described in example 1 and 3, respectively. The U251 assay was performed as described in Example 1. The ARPE19 assay was performed
as follows: 5000 ARPE19 cells/well were seeded in a 96 multi well plate in culture media recommended by the supplier (with the exception of 5% FBS instead of 10%). Cells were incubated for 2 hour before addition of oligonucleotides dissolved in PBS. Concentration of oligonucleotides: from 50mM, half-log dilution, 8 points. 4 days after addition of
oligonucleotides, the cells were harvested. RNA extraction, cDNA synthesis and qPCR were performed as described in Example 1. n=2 independent biological replicates. The EC50 value and the residual HTRA1 mRNA level at 50mM are shown in the table as % of control (PBS).
Example 5, Testing in vitro potency and efficacy of selected compounds in U251 and ARPE19 cell lines in a dose response curve.
The assays were performed as described in Example 3. Concentration of oligonucleotides: from 50mM, half-log dilution, 8 points. n=2 and n=1 independent biological replicates for U251 and ARPE19, respectively. The EC50 value and the residual HTRA1 mRNA level at 50mM are shown in the table as % of control (PBS).
Example 6. Testing in vitro potency and efficacy of selected compounds in U251 cell line in a dose response curve.
The assay was performed as described in Example 3. Concentration of oligonucleotides: from 50mM, half-log dilution, 8 points. n=2 independent biological replicates.The EC50 value and the residual HTRA1 mRNA level at 50mM are shown in the table as % of control (PBS).
Example 7. Testing in vitro potency and efficacy of selected compounds in U251 cell line in a dose response curve.
The ARPE19 cell line was described in example 3. For assays, ARPE19 cells, 24000 cells/well were seeded in 100mI_ in a 96 multi well plate in starvation media (culture media as recommended by the supplier with the exception of 1% FBS instead of 10%). Cells were incubated for 2 hour before addition of oligonucleotides dissolved in PBS. Concentration of oligonucleotides: from 50mM, half-log dilution, 8 points. At day 4 and 7 after addition of oligonucleotide compounds 75mI_ fresh starvation media without oligonucleotides was added to the cells (without removing the old media). RNA extraction, cDNA synthesis and qPCR were performed as described in Example 3. n=2 independent biological replicates. The EC50 value and the residual HTRA1 mRNA level at 50mM are shown in the table as % of control (PBS).
Example 8.
Testing in vitro efficacy in human primary RPE cells.
Human primary Retinal Pigmented Epithelium (hpRPE) cells were purchased from Sciencell (Cat# 6540). For assays, 5000 hpRPE cells/well were seeded in a Laminin (Laminin 521 , BioLamina Cat# LN521-03) coated 96 multi well plate in culture media (EpiCM, Sciencell Cat# 4101 ). They were expanded with this media for one week and differentiated using the following media for 2 weeks : MEM Alpha media (Sigma Cat# M-4526) supplemented with N1 supplement (Sigma Cat# N-6530), Glutamine-Penicillin-Streptomycin (Sigma Cat# G- 1 146), Non Essential Amino Acid (NEAA, Sigma Cat# M-7145), Taurine (Sigma Cat# T- 0625), Hydrocortisone (Sigma Cat# H-03966), Triiodo-thyronin (Sigma Cat# T-5516) and Bovine Serum Albumin (BSA, Sigma Cat# A-9647). Cells were cultured in a humidified incubator at 37°C with 5% CO2.
On the day of the experiment, cells were incubated for 1 hour with fresh differentiation media before addition of oligonucleotides. These were dissolved in PBS and applied on cells at day 0 and day 4. On day 7, the media was changed, and on day 10 cells were harvested with
50mI of RLT buffer with b-mercapto-ethanol (Qiagen Cat# 79216). The extraction of the RNA was performed according to the user’s manual of the Qiagen RNeasy Mini Kit (Cat# 74104; Lot 151048073) including DNase I treatment (Cat# 79254; Lot 151042674). RNA quality control was performed with the Agilent Bioanalyzer Nano Kit (Agilent; Cat# 5067-1511 ; Lot 1446). Reverse transcription of total RNA into cDNA (cDNA synthesis) was performed using the High Capacity cDNA Reverse Transcription Kit (based on random hexamer
oligonucleotides), according to the manufacturer’s instructions (Thermo Fisher Scientific, Cat# 4368814; Lot 00314158). The measurement of the cDNA samples was carried out in triplicates, in a 384-well plate format on the 7900HT real-time PCR instrument (Thermo Fisher Scientific). The following TaqMan primer assays were used for qPCR: HTRA1 , Hs01016151_m1 and Hs00170197_m1 , housekeeping genes, GAPDH, Hs99999905_m1 and PPIA, Hs99999904_m1 , from Life Technologies. n=3 biological replicates. The residual HTRA1 mRNA expression level is shown in figure 10D and the following table as % of control (PBS).
WO2018/00205 and PCT/2018/064221 describe the discover and characterization of antisense oligonucleotides targeting HTRA1 , including the following compounds:
Compounds and Compound Nomenclature
Example 9. Cynomolgus monkey in vivo pharmacokinetics and pharmacodynamics study, 21 days of treatment, intravitreal (IVT) injection, single dose.
Knock down was observed for 3 HTRA1 LNA oligonucleotides targeting the“hotspot” in human HTRA1 pre-mRNA between position 531 13 - 53384 both at mRNA in the retina and at protein level in the retina and in the vitreous (see figure 1 1 )
Animals
All experiments were performed on Cynomolgus monkeys ( Macaca fascicularis).
Four animals were included in each group of the study, 20 in total.
Compounds and dosing procedures
Buprenorphine analgesia was administered prior to, and two days after test compound injection. The animals were anesthetized with an intramuscular injection of ketamine and xylazine. The test item and negative control (PBS) were administered intravitreally in both eyes of anesthetized animals (50 mI_ per administration) on study day 1 after local application of tetracaine anesthetic.
Euthanasia
At the end of the in-life phase (Day 22) all monkeys were euthanized by intraperitoneal an overdose injection of pentobarbital.
Oligo content measurement and quantification of Htral RNA expression by qPCR
Immediately after euthanasia, eye tissues were quickly and carefully dissected out on ice and stored at -80°C until shipment. Retina sample was lysed in 700 pl_ MagNa Pure 96 LC RNA Isolation Tissue buffer and homogenized by adding 1 stainless steel bead per 2 ml tube 2 x 1 ,5 min using a precellys evolution homogenizer followed by 30 min incubation at RT. The samples were centrifuged, 13000 rpm, 5 min. Half was set aside for bioanalysis and for the other half, RNA extraction was continued directly.
For bioanalysis, the samples were diluted 10-50 fold for oligo content measurements with a hybridization ELISA method. A biotinylated LNA-capture probe and a digoxigenin-conjugated LNA-detection probe (both 35nM in 5xSSCT, each complementary to one end of the LNA oligonucleotide to be detected) was mixed with the diluted homogenates or relevant standards, incubated for 30 minutes at RT and then added to a streptavidine-coated ELISA plates (Nunc cat. no. 436014).
The plates were incubated for 1 hour at RT, washed in 2xSSCT (300mM sodium chloride, 30mM sodium citrate and 0,05% v/v Tween-20, pH 7.0) The captured LNA duplexes were detected using an anti-DIG antibodies conjugated with alkaline phosphatase (Roche Applied Science cat. No. 1 1093274910) and an alkaline phosphatase substrate system (Blue Phos substrate, KPL product code 50-88-00). The amount of oligo complexes was measured as absorbance at 615 nm on a Biotek reader.
For RNA extraction, cellular RNA large volume kit (05467535001 , Roche) was used in the MagNA Pure 96 system with the program: Tissue FF standard LV3.1 according to the instructions of the manufacturer, including DNAse treatment. RNA quality control and concentration were measured with an Eon reader (Biotek). The RNA concentration was normalized across samples, and subsequent cDNA synthesis and qPCR was performed in a one-step reaction using qScript XLT one-step RT-qPCR ToughMix Low ROX, 95134-100 (Quanta Biosciences). The following TaqMan primer assays were used in singplex reactions: Htral , Mf01016150_, Mf01016152_m1 and Rh02799527_m1 and housekeeping genes, ARFGAP2, Mf01058488_g1 and Rh01058485_m1 , and ARL1 , Mf02795431_m1 , from Life Technologies. The qPCR analyses were run on a ViiA7 machine (Life Technologies).
Eyes/group: n=3 eyes. Each eye was treated as an individual sample. The relative Htral mRNA expression level is shown as % of control (PBS).
Histology
Eyeballs were removed and fixed in 10% neutral buffered formalin for 24 hours, trimmed and embedded in paraffin.
For ISH analysis, sections of formalin-fixed, paraffin-embedded cyno retina tissue 4pm thick were processed using the fully automated Ventana Dicovery ULTRA Staining Module (Procedure: mRNA Discovery Ultra Red 4.0 - vO.00.0152) using the RNAscope 2.5 VS Probe- Mmu-HTRA1 , REF 486979, Advanced Cell Diagnostics, Inc.. Chromogen used is Fastred, Hematoxylin II counterstain.
HTRA1 protein quantification using a plate-based immunoprecipitation mass spectrometry (IP-MS) approach
Sample preparation, Retina
Retinas were homogenized in 4 volumes (w/v) of RIPA buffer (50 mM Tris-HCI, pH 7.4, 150 mM NaCI, 0.25% deoxycholic acid, 1% NP-40, 1 mM EDTA, Millipore) with protease inhibitors (Complete EDTA-free, Roche) using a Precellys 24 (5500, 15 s, 2 cycles).
Homogenates were centrifuged (13,000 rpm, 3 min) and the protein contents of the supernatants determined (Pierce BCA protein assay)
Sample preparation, Vitreous
Vitreous humors (300 pi) were diluted with 5x RIPA buffer (final concentration: 50 mM Tris- HCI, pH 7.4, 150 mM NaCI, 0.25% deoxycholic acid, 1% NP-40, 1 mM EDTA) with protease inhibitors (Complete EDTA-free, Roche) and homogenized using a Precellys 24 (5500, 15 s, 2 cycles). Homogenates were centrifuged (13,000 rpm, 3 min) and the protein contents of the supernatants determined (Pierce BCA protein assay)
Plate-based HTRA 1 immunoprecipitation and tryptic digest
A 96 well plate (Nunc MaxiSorp) was coated with anti-HTRA1 mouse monoclonal antibody (R&D MAB2916, 500 ng/well in 50 pi PBS) and incubated overnight at 4°C. The plate was washed twice with PBS (200 mI) and blocked with 3% (w/v) BSA in PBS for 30 min at 20 °C followed by two PBS washes. Samples (75 pg retina, 100 pg vitreous in 50 mI PBS) were randomized and added to the plate followed by overnight incubation at 4 °C on a shaker (150 rpm). The plate was then washed twice with PBS and once with water. 10 mM DTT in 50 mM TEAB (30 mI) were then added to each well followed by incubation for 1 h at 20 °C to reduce cysteine sulfhydryls. 150 mM iodoacetamide in 50 mM TEAB (5 mI) were then added to each well followed by incubation for 30 min at 20 °C in the dark in order to block cysteine sulfhydryls. 10 mI Digestion solution were added to each well (final concentrations: 1.24 ng/pl trypsin, 20 fmol/mI BSA peptides, 26 fmol/mI isotope-labeled HTRA1 peptides, 1 fmol/mI iRT peptides, Biognosys) followed by incubation overnight at 20 °C.
HTRA 1 peptide quantification by targeted mass spectrometry (selected reaction monitoring, SRM)
Mass spectrometry analysis was performed on an Ultimate RSLCnano LC coupled to a TSQ Quantiva triple quadrupole mass spectrometer (Thermo Scientific). Samples (20 pL) were injected directly from the 96 well plate used for IP and loaded at 5 pL/min for 6 min onto a
Acclaim Pepmap 100 trap column (100 pm x 2 cm, C18, 5 pm, 100 A, Thermo Scientific) in loading buffer (0.5% v/v formic acid, 2% v/v ACN). Peptides were then resolved on a PepMap Easy-SPRAY analytical column (75 pm x 15 cm, 3 pm, 100 A, Thermo Scientific) with integrated electrospray emitter heated to 40°C using the following gradient at a flow rate of 250 nL/min: 6 min, 98% buffer A (2% ACN, 0.1% formic acid), 2% buffer B (ACN + 0.1% formic acid); 36 min, 30% buffer B; 41 min, 60% buffer B; 43 min, 80% buffer B; 49 min, 80% buffer B; 50 min, 2% buffer B. The TSQ Quantiva was operated in SRM mode with the following parameters: cycle time, 1.5 s; spray voltage, 1800 V; collision gas pressure, 2 mTorr; Q1 and Q3 resolution, 0.7 FWHM; ion transfer tube temperature 300 °C. SRM transitions were acquired for the HTRA1 peptide“LHRPPVIVLQR” and an isotope labelled (L-[U-13C, U-15N]R) synthetic version, which was used an internal standard.
Data analysis was performed using Skyline version 3.6.
Western blot
Dissected retina sample in 0.5 Precellyses tubes (CK14_0.5ml, Bertin Technologies) were lysed and homogenized in RIPA lysis buffer (20-188, Milipore) with protease inhibitors (Complete EDTA-free Proteases-lnhibitor Mini, 11 836 170 001 , Roche).
Vitreous sample were added to a 0.5 Precellyses tubes (CK14_0.5ml, Bertin Technologies) were lysed and homogenized in 1/4x RIPA lysis buffer (20-188, Milipore) with protease inhibitors (Complete EDTA-free Proteases-lnhibitor Mini, 1 1 836 170 001 , Roche).
Samples (retina 20 pg protein, vitreous 40 pg protein) were analyzed on 4-15% gradient gel (#567-8084 Bio-Rad) under reducing conditions and transferred on Nitrocellulose (#170- 4159 Bio-Rad) using a Trans-Blot Turbo Device from Bio-Rad.
Primary antibodies: Rabbit anti human HTRA1 (SF1 ) was a kind gift of Sascha Fauser (University of Cologne), mouse anti human Gapdh (#98795 Sigma-Aldrich). Secondary antibody: goat anti rabbit 800CW and goat anti mouse 680RD were from Li-Cor
Blot was imaged and analyzed on an Odyssee CLX from Li-Cor.
Example 10 - Cynomolgus monkey in vivo Assessment: HTRA1 protein
determination in aqueous humor and comparison to HTRA1 mRNA and protein inhibition in retina.
Experimental Methodology: See above example. Aqueous humor samples were taken and samples were prepared as according to example 9 vitreous humor samples. Cynomolgus Monkey Aqueous humor samples (AH) were analyzed with a size-based assay on a Analytical Methodology: Capillary Electrophoresis System (Peggy Sue™, Proteinsimple) Samples were thawed on ice and used undiluted. For quantification, recombinant HTRA1- S328A mutant (Origene #TP700208). Preparation was as described by the provider.
Primary rabbit anti- human HTRA Antibody SF1 was provided by Prof. Dr. Sascha Fauser and used diluted 1 :300. All other reagents were from Proteinsimple.
Samples were processed in technical triplicate, calibration curve in duplicate using a 12 - 230 kDa Separation module. Area under the peak was computed and analyzed using Xlfit (I DBS software).
Results
Note - the compound IDs shown in figures 12 - 14 utilize a different numbering system as the rest of the examples. The above table provides the key to the numbering used figures 12 -14 as compared to that used in the previous examples and elsewhere herein.
Figure 12A shows a visualization of the HTRA1 protein levels in the aqueous humor of monkeys administered with compounds B and #73,1 , with samples taken at days 3, 8, 15, and 22 post-injection. Figure 12B provides the calibration curve used in calculating HTRA1 protein levels. Figure 12C provides the calculated HTRA1 levels from aqueous humor from individual animal was plotted against time post injection.
Figure 13 illustrates a direct correlation between the level of HTRA1 protein in the aqueous humor and the level of HTRA1 mRNA in the retina. Aqueous humor HTRA1 protein levels may therefore be used as a biomarker for HTRA1 retina mRNA levels or HTRA1 retinal mRNA inhibition.
Figure 14 illustrates that there is also a correlation between HTRA1 protein levels in retina and the HTRA1 protein levels in aqueous humor, although the correlation was not, in this experiment, as strong as the correlation between HTRA1 mRNA inhibition in the retina and HTRA1 protein levels in the aqueous humor, indicating that aqueous humor HTRA1 protein levels are particularly suited as biomarker for HTRA1 mRNA antagonists.
Claims
1. A pre-filled syringe comprising a sterile solution (ophthalmic solution) of an antisense oligonucleotide selected from the group selected from TTCtatctacgcaTTG (SEQ ID NO 67), CTT CttctatctacgcAT (SEQ ID NO 73), and TACTttaatagcTCAA (SEQ ID NO 86), wherein capital letters represent a beta-D-oxy LNA nucleosides, LNA C are 5- methyl C, lower case letters are DNA nucleosides, and all internucleoside linkages are phosphorothioate internucleoside linkages, a syringe body and a needle.
2. The pre-filled syringe to claim 1 wherein the antisense oligonucleotide is
TTCtatctacgcaTTG (SEQ ID NO 67)
3. The pre-filled syringe according to claim 1 wherein the antisense oligonucleotide is CTTCttctatctacgcAT (SEQ ID NO 73),
4. The pre-filled syringe according to claim 1 wherein the antisense oligonucleotide is TACTttaatagcTCAA (SEQ ID NO 86)
5. The pre-filled syringe according to any one of claims 1 - 4, wherein the volume of the solution of the antisense oligonucleotide in the pre-filled syringe is between 0.1 -
1 5ml.
6. The pre-filled syringe according to any one of claims 1 - 5, wherein the syringe
comprises a unit dose of 0.005 - 1 mg of the antisense oligonucleotide.
7. The pre-filled syringe according to any one of claims 1 - 6, wherein the concentration of antisense oligonucleotide in the solution is between 0.05mg/ml - 40mg/ml, such as 0.05mg/ml - 10mg/ml.
8. The pre-filled syringe according to any one of claims 1 - 7, wherein the needle of the prefilled syringe has a gauge of the needle is between 20 - 31 , such as 25 - 30.
9. The pre-filled syringe according to any one of claims 1 - 8, wherein the needle of the prefilled syringe has a length of 10 - 25mm, such as about 1 27cm or half an inch.
10. The pre-filled syringe according to any one of claims 1 - 8, wherein the syringe body is made of glass or plastic.
1 1. The pre-filled syringe according to any one of claims 1 - 8, wherein the antisense oligonucleotide is formulated in a phosphate or histidine/sucrose buffer solution, pH7.4, with NaCI to reach isotonicity (250-350mOsm).
12. A sealed sterile package, e.g. a blister pack, comprising the pre-filled syringe
according to any one of claims 1 -11.
13. An antisense oligonucleotide selected from the group selected from
TTCtatctacgcaTTG (SEQ ID NO 67), CTTCttctatctacgcAT (SEQ ID NO 73), and TACTttaatagcTCAA (SEQ ID NO 86), wherein capital letters represent a beta-D-oxy LNA nucleosides, LNA C are 5-methyl C, lower case letters are DNA nucleosides,
and all internucleoside linkages are phosphorothioate internucleoside linkages, for use in the treatment of geographic atrophy, wherein the antisense oligonucleotide is administered to a subject in need of treatment for geographic atrophy using the pre- loaded syringe according to any one of claims 1 - 1 1.
14. A sterile vial, containing an antisense oligonucleotide selected from the group
selected from TTCtatctacgcaTTG (SEQ ID NO 67), CTTCttctatctacgcAT (SEQ ID NO 73), and TACTttaatagcTCAA (SEQ ID NO 86), wherein capital letters represent a beta-D-oxy LNA nucleosides, LNA C are 5-methyl C, lower case letters are DNA nucleosides, and all internucleoside linkages are phosphorothioate internucleoside linkages.
15. The sterile vial according to claim 14, wherein the antisense oligonucleotide is in the form of an anhydrous powder, or is in the form of a sterile solution (ophthalmic solution) of the antisense oligonucleotide, such as the solution defined in claim 1 1.
16. The sterile vial according to claim 14 or 15 wherein the sterile vial comprises a unit dose of the antisense oligonucleotide, such as a unit dose of 0.005mg - 1 mg of the antisense oligonucleotide.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18209226 | 2018-11-29 | ||
| EP18209226.2 | 2018-11-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020109344A1 true WO2020109344A1 (en) | 2020-06-04 |
Family
ID=64559576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2019/082645 Ceased WO2020109344A1 (en) | 2018-11-29 | 2019-11-27 | Occular administration device for antisense oligonucleotides |
Country Status (2)
| Country | Link |
|---|---|
| TW (1) | TW202031896A (en) |
| WO (1) | WO2020109344A1 (en) |
Citations (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997039120A2 (en) | 1996-04-17 | 1997-10-23 | Aronex Pharmaceuticals, Inc. | Antisense inhibitors of vascular endothelial growth factor (vefg/vpf) expression |
| WO1998039352A1 (en) | 1997-03-07 | 1998-09-11 | Takeshi Imanishi | Novel bicyclonucleoside and oligonucleotide analogues |
| WO1999014226A2 (en) | 1997-09-12 | 1999-03-25 | Exiqon A/S | Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues |
| WO2000008140A2 (en) | 1998-08-07 | 2000-02-17 | Aventis Pharma Deutschland Gmbh | Antisense oligonucleotides for the inhibition of vegf expression |
| WO2000008141A2 (en) | 1998-08-07 | 2000-02-17 | Aventis Pharma Deutschland Gmbh | Short oligonucleotides for the inhibition of vegf expression |
| WO2000047599A1 (en) | 1999-02-12 | 2000-08-17 | Sankyo Company, Limited | Novel nucleosides and oligonucleotide analogues |
| WO2000066604A2 (en) | 1999-05-04 | 2000-11-09 | Exiqon A/S | L-ribo-lna analogues |
| WO2001023613A1 (en) | 1999-09-30 | 2001-04-05 | Isis Pharmaceuticals, Inc. | Human rnase h and oligonucleotide compositions thereof |
| WO2001052904A2 (en) | 2000-01-19 | 2001-07-26 | Gill Parkash S | Pharmaceutical compositions and methods of treatment based on vegf antisense oligonucleotides |
| WO2004046160A2 (en) | 2002-11-18 | 2004-06-03 | Santaris Pharma A/S | Amino-lna, thio-lna and alpha-l-oxy-ln |
| WO2007090071A2 (en) | 2006-01-27 | 2007-08-09 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| WO2007134181A2 (en) | 2006-05-11 | 2007-11-22 | Isis Pharmaceuticals, Inc. | 5'-modified bicyclic nucleic acid analogs |
| WO2008150729A2 (en) | 2007-05-30 | 2008-12-11 | Isis Pharmaceuticals, Inc. | N-substituted-aminomethylene bridged bicyclic nucleic acid analogs |
| WO2008154401A2 (en) | 2007-06-08 | 2008-12-18 | Isis Pharmaceuticals, Inc. | Carbocyclic bicyclic nucleic acid analogs |
| WO2009006478A2 (en) | 2007-07-05 | 2009-01-08 | Isis Pharmaceuticals, Inc. | 6-disubstituted bicyclic nucleic acid analogs |
| WO2009006460A1 (en) * | 2007-07-02 | 2009-01-08 | Alcon Research, Ltd. | Rnai-mediated inhibition of htra1 for treatment of macular degeneration |
| WO2009067647A1 (en) | 2007-11-21 | 2009-05-28 | Isis Pharmaceuticals, Inc. | Carbocyclic alpha-l-bicyclic nucleic acid analogs |
| WO2010036698A1 (en) | 2008-09-24 | 2010-04-01 | Isis Pharmaceuticals, Inc. | Substituted alpha-l-bicyclic nucleosides |
| WO2010077578A1 (en) | 2008-12-09 | 2010-07-08 | Isis Pharmaceuticals, Inc. | Bis-modified bicyclic nucleic acid analogs |
| WO2011017521A2 (en) | 2009-08-06 | 2011-02-10 | Isis Pharmaceuticals, Inc. | Bicyclic cyclohexose nucleic acid analogs |
| WO2011097407A1 (en) * | 2010-02-04 | 2011-08-11 | Ico Therapeutics Inc. | Dosing regimens for treating and preventing ocular disorders using c-raf antisense |
| WO2011156202A1 (en) | 2010-06-08 | 2011-12-15 | Isis Pharmaceuticals, Inc. | Substituted 2 '-amino and 2 '-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom |
| WO2013022984A1 (en) | 2011-08-11 | 2013-02-14 | Isis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
| WO2013154798A1 (en) | 2012-04-09 | 2013-10-17 | Isis Pharmaceuticals, Inc. | Tricyclic nucleic acid analogs |
| US9220631B2 (en) | 2012-07-03 | 2015-12-29 | Novartis Ag | Syringe |
| WO2018000205A1 (en) | 2016-06-28 | 2018-01-04 | 深圳狗尾草智能科技有限公司 | Question answering method and system based on multiple intents and multiple skill packets, and robot |
| WO2018002105A1 (en) * | 2016-07-01 | 2018-01-04 | F. Hoffmann-La Roche Ag | Antisense oligonucleotides for modulating htra1 expression |
| WO2018064221A1 (en) | 2016-09-27 | 2018-04-05 | Novelis Inc. | System for and method of threading a metal substrate on a rolling mill |
-
2019
- 2019-11-27 WO PCT/EP2019/082645 patent/WO2020109344A1/en not_active Ceased
- 2019-11-28 TW TW108143361A patent/TW202031896A/en unknown
Patent Citations (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997039120A2 (en) | 1996-04-17 | 1997-10-23 | Aronex Pharmaceuticals, Inc. | Antisense inhibitors of vascular endothelial growth factor (vefg/vpf) expression |
| WO1998039352A1 (en) | 1997-03-07 | 1998-09-11 | Takeshi Imanishi | Novel bicyclonucleoside and oligonucleotide analogues |
| WO1999014226A2 (en) | 1997-09-12 | 1999-03-25 | Exiqon A/S | Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues |
| WO2000008140A2 (en) | 1998-08-07 | 2000-02-17 | Aventis Pharma Deutschland Gmbh | Antisense oligonucleotides for the inhibition of vegf expression |
| WO2000008141A2 (en) | 1998-08-07 | 2000-02-17 | Aventis Pharma Deutschland Gmbh | Short oligonucleotides for the inhibition of vegf expression |
| WO2000047599A1 (en) | 1999-02-12 | 2000-08-17 | Sankyo Company, Limited | Novel nucleosides and oligonucleotide analogues |
| WO2000066604A2 (en) | 1999-05-04 | 2000-11-09 | Exiqon A/S | L-ribo-lna analogues |
| WO2001023613A1 (en) | 1999-09-30 | 2001-04-05 | Isis Pharmaceuticals, Inc. | Human rnase h and oligonucleotide compositions thereof |
| WO2001052904A2 (en) | 2000-01-19 | 2001-07-26 | Gill Parkash S | Pharmaceutical compositions and methods of treatment based on vegf antisense oligonucleotides |
| WO2004046160A2 (en) | 2002-11-18 | 2004-06-03 | Santaris Pharma A/S | Amino-lna, thio-lna and alpha-l-oxy-ln |
| WO2007090071A2 (en) | 2006-01-27 | 2007-08-09 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| WO2007134181A2 (en) | 2006-05-11 | 2007-11-22 | Isis Pharmaceuticals, Inc. | 5'-modified bicyclic nucleic acid analogs |
| WO2008150729A2 (en) | 2007-05-30 | 2008-12-11 | Isis Pharmaceuticals, Inc. | N-substituted-aminomethylene bridged bicyclic nucleic acid analogs |
| WO2008154401A2 (en) | 2007-06-08 | 2008-12-18 | Isis Pharmaceuticals, Inc. | Carbocyclic bicyclic nucleic acid analogs |
| WO2009006460A1 (en) * | 2007-07-02 | 2009-01-08 | Alcon Research, Ltd. | Rnai-mediated inhibition of htra1 for treatment of macular degeneration |
| WO2009006478A2 (en) | 2007-07-05 | 2009-01-08 | Isis Pharmaceuticals, Inc. | 6-disubstituted bicyclic nucleic acid analogs |
| WO2009067647A1 (en) | 2007-11-21 | 2009-05-28 | Isis Pharmaceuticals, Inc. | Carbocyclic alpha-l-bicyclic nucleic acid analogs |
| WO2010036698A1 (en) | 2008-09-24 | 2010-04-01 | Isis Pharmaceuticals, Inc. | Substituted alpha-l-bicyclic nucleosides |
| WO2010077578A1 (en) | 2008-12-09 | 2010-07-08 | Isis Pharmaceuticals, Inc. | Bis-modified bicyclic nucleic acid analogs |
| WO2011017521A2 (en) | 2009-08-06 | 2011-02-10 | Isis Pharmaceuticals, Inc. | Bicyclic cyclohexose nucleic acid analogs |
| WO2011097407A1 (en) * | 2010-02-04 | 2011-08-11 | Ico Therapeutics Inc. | Dosing regimens for treating and preventing ocular disorders using c-raf antisense |
| WO2011156202A1 (en) | 2010-06-08 | 2011-12-15 | Isis Pharmaceuticals, Inc. | Substituted 2 '-amino and 2 '-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom |
| WO2013022984A1 (en) | 2011-08-11 | 2013-02-14 | Isis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
| WO2013154798A1 (en) | 2012-04-09 | 2013-10-17 | Isis Pharmaceuticals, Inc. | Tricyclic nucleic acid analogs |
| US9220631B2 (en) | 2012-07-03 | 2015-12-29 | Novartis Ag | Syringe |
| WO2018000205A1 (en) | 2016-06-28 | 2018-01-04 | 深圳狗尾草智能科技有限公司 | Question answering method and system based on multiple intents and multiple skill packets, and robot |
| WO2018002105A1 (en) * | 2016-07-01 | 2018-01-04 | F. Hoffmann-La Roche Ag | Antisense oligonucleotides for modulating htra1 expression |
| WO2018064221A1 (en) | 2016-09-27 | 2018-04-05 | Novelis Inc. | System for and method of threading a metal substrate on a rolling mill |
Non-Patent Citations (24)
| Title |
|---|
| BERGSTROM, CURRENT PROTOCOLS IN NUCLEIC ACID CHEMISTRY, 2009 |
| BHISITKUL ET AL., AMERICAN MEDICAL ASSOCIATION OPTHAMOLOGY, vol. 123, 2005, pages 214 - 219 |
| BOCHOT A ET AL: "Intravitreal administration of antisense oligonucleotides: Potential of liposomal delivery", PROGRESS IN RETINAL AND EYE RESEARCH, OXFORD, GB, vol. 19, no. 2, 1 March 2000 (2000-03-01), pages 131 - 147, XP002716314, ISSN: 1350-9462, DOI: 10.1016/S1350-9462(99)00014-2 * |
| DELEAVEYDAMHA, CHEMISTRY AND BIOLOGY, vol. 19, 2012, pages 937 |
| FLUITER ET AL., MOL. BIOSYST., vol. 10, 2009, pages 1039 |
| FREIERALTMANN, NUCL. ACID RES., vol. 25, 1997, pages 4429 - 4443 |
| HANSEN ET AL., CHEM. COMM., 1965, pages 36 - 38 |
| HENRY ET AL., INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE, vol. 42, 2001, pages 2646 - 2651 |
| HIRAO ET AL., ACCOUNTS OF CHEMICAL RESEARCH, vol. 45, 2012, pages 2055 |
| HOLDGATE ET AL., DRUG DISCOV TODAY, 2005 |
| MANGOS ET AL., J. AM. CHEM. SOC., vol. 125, 2003, pages 654 - 661 |
| MCTIGUE ET AL., BIOCHEMISTRY, vol. 43, 2004, pages 5388 - 5405 |
| MERGNYLACROIX, OLIGONUCLEOTIDES, vol. 13, 2003, pages 515 - 537 |
| MITSUOKA ET AL., NUCLEIC ACIDS RESEARCH, vol. 37, no. 4, 2009, pages 1225 - 1238 |
| MORITA ET AL., BIOORGANIC & MED.CHEM. LETT., vol. 12, pages 73 - 76 |
| PANEDA ET AL.: "Ocular Nucleic-Acid Therapies: The Silent Era", 2012, article "Ocular Diseases" |
| ROBINSON ET AL., PROC. NATL. ACAD. SCI., vol. 93, 1996, pages 4851 - 4856 |
| RUKOV ET AL., NUCL. ACIDS RES., vol. 43, 2015, pages 8476 - 8487 |
| SANTALUCIA, PROC NATL ACAD SCI USA., vol. 95, 1998, pages 1460 - 1465 |
| SETH ET AL., J. ORG. CHEM., vol. 75, no. 5, 2010, pages 1569 - 81 |
| SUGIMOTO ET AL., BIOCHEMISTRY, vol. 34, 1995, pages 11211 - 11216 |
| UHLMANN, CURR. OPINION IN DRUG DEVELOPMENT, vol. 3, no. 2, 2000, pages 293 - 213 |
| VESTER ET AL., BIOORG. MED. CHEM. LETT., vol. 18, 2008, pages 2296 - 2300 |
| WANSETH, J. MEDICAL CHEMISTRY, vol. 59, 2016, pages 9645 - 9667 |
Also Published As
| Publication number | Publication date |
|---|---|
| TW202031896A (en) | 2020-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7416852B2 (en) | Antisense oligonucleotides for regulating HTRA1 expression | |
| KR102473431B1 (en) | Antisense nucleic acids | |
| WO2020109343A1 (en) | Combination therapy for treatment of macular degeneration | |
| WO2020245233A1 (en) | Antisense oligonucleotides targeting atxn3 | |
| EP3790971A1 (en) | Oligonucleotides for modulating myh7 expression | |
| US20220042022A1 (en) | Antisense oligonucleotides for modulating htra1 expression | |
| EP4083208A1 (en) | Antisense nucleic acid that induces skipping of exon 50 | |
| EP4112083A1 (en) | Antisense nucleic acid inducing skipping of exon 51 | |
| US20200378970A1 (en) | Companion diagnostic for htra1 rna antagonists | |
| TW202031896A (en) | Ocular administration device for lna oligonucleotides | |
| EP4077672A1 (en) | Enhanced oligonucleotides for inhibiting scn9a expression | |
| WO2021231204A1 (en) | Complement component 4 inhibitors for treating neurological diseases, and related compositons, systems and methods of using same | |
| HK40082253A (en) | Antisense nucleic acid inducing skipping of exon 51 | |
| NZ749395A (en) | Antisense oligonucleotides for modulating htra1 expression | |
| HK40021168A (en) | Antisense oligonucleotides for modulating htra1 expression | |
| HK40031713A (en) | Companion diagnostic for htra1 rna antagonists | |
| HK1262526A1 (en) | Antisense oligonucleotides for modulating htra1 expression | |
| HK40031713B (en) | Companion diagnostic for htra1 rna antagonists | |
| HK1262526B (en) | Antisense oligonucleotides for modulating htra1 expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19808817 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19808817 Country of ref document: EP Kind code of ref document: A1 |
































