WO2020106755A1 - Inhibitors of gli1 as therapeutic agents - Google Patents
Inhibitors of gli1 as therapeutic agentsInfo
- Publication number
- WO2020106755A1 WO2020106755A1 PCT/US2019/062267 US2019062267W WO2020106755A1 WO 2020106755 A1 WO2020106755 A1 WO 2020106755A1 US 2019062267 W US2019062267 W US 2019062267W WO 2020106755 A1 WO2020106755 A1 WO 2020106755A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alkyl
- chlorophenyl
- optionally substituted
- crc
- tetrahydro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/04—Ortho-condensed systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- This disclosure relates to compounds, pharmaceutical compositions comprising them, and methods of using the compounds and compositions for treating diseases related to glioma-associated oncogene (Gli) expression. More particularly, this disclosure relates to bicyclic compounds and pharmaceutical compositions thereof, methods of inhibiting Gli expression with these compounds, and methods of treating diseases related to Gli expression.
- Gli glioma-associated oncogene
- Hedgehog (Hh) signaling pathway plays a critical role in the initiation, proliferation, invasion, and metastasis of a wide variety of cancers.
- the Hh pathway is also implicated in the regulation and maintenance of cancer stem cells (CSCs), providing a link between the Hh signaling in the regulation of normal stem cells and its role in CSCs maintenance.
- CSCs cancer stem cells
- disorders of myelination can produce significant impairment in sensory, motor and other types of functioning when nerve signals reach their targets slowly, asynchronously, intermittently, or not at all.
- disorders of myelination are also associated with progressive loss of the axons which further contributes to neurological impairment.
- disorders of myelination can be demyelinating, as a result of removal or degradation of myelin already formed; or dysmyelinating, as a result of deficient or defective myelin development or maintenance.
- CNS central nervous system
- PNS peripheral nervous system
- MS multiple sclerosis
- PNS myelination disorders of CNS myelination
- MS multiple sclerosis
- PNS myelination disorders of PNS myelination
- Hh signaling is initiated by the binding of ligand namely Sonic Hedgehog (Shh),
- Ihh Indian Hedgehog
- Dhh Desert Hedgehog
- Patched Ptch
- Canical Shh signaling is mediated by interactions of the Ptch with the G-protein coupled transmembrane co-receptor smoothened (Smo). Binding of Shh to Ptch relieves its inhibition of Smo and thereby activates the Gli family of proteins (also known as zinc finger transcription factors).
- Vertebrates have at least three distinct Gli proteins, GN1 , GN2, and GN3 (glioma- associated oncogene 1 , 2, and 3). Gli proteins participate in the final step of the Hh/Gli signaling pathway, and they regulate several genes, including those that are related to cell cycle control and Hh/Gli signaling. GN1 acts as a transcriptional activator, whereas GN2 and GN3 act as both activators and repressors. The proteins in Gli family share a highly conserved C 2 -H 2 zinc finger domain (having five zinc finger DNA-binding motifs) and recognize consensus Gli-selective sequences that regulate transcription. Of the three Gli proteins, GN1 expression is considered a sensitive readout for, and an indicator of the highest levels of Shh signaling.
- the disclosure provides novel Gli inhibitors useful for treating diseases related to Gli expression.
- one aspect of the disclosure provides a compound of formula (I):
- n is an integer 1 or 2;
- n is an integer 1 or 2;
- p is an integer 0, 1 , or 2;
- R is -OH, -0(C C 6 alkyl), -SH, -S(C C 6 alkyl), -NH 2 , -NH(C C 6 alkyl), or -N(C C 6 alkyl) 2 ;
- Ri is selected from hydrogen, CrC 6 alkyl, CrC 6 haloalkyl, C 3 -C 8 cycloalkyl, heterocyclyl, hydroxy(C C 6 alkyl), alkoxy(CrC 6 alkyl), -OH, and oxetanyl;
- R 2 is C C 6 alkyl
- ring A represents an aryl optionally substituted with one or more R 3 , heteroaryl optionally substituted with one or more R 3 , or C 4 -C 8 cycloalkyl optionally substituted with one or more R 3 ;
- ring B represents an aryl optionally substituted with one or more R 4 , heteroaryl optionally substituted with one or more R 4 , heterocyclyl optionally substituted with one or more R 4 , or C 4 -C 8 cycloalkyl optionally substituted with one or more R 4 ;
- each R 3 is independently selected from halogen, -N0 2 , -CN, C C 6 alkyl optionally
- C C 6 haloalkyl substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(C I -C 6 alkyl), -N(C I -C 6 alkyl) 2 , -OH, CrC 6 alkoxy, CrC 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(C C 6 alkyl), alkoxy(CrC 6 alkoxy), amino(CrC 6 alkyl), -CONH 2 , -CONH(Ci-C e alkyl), -CON(C C 6 alkyl) 2 , -CONH-OH, -C0 2 H, -C0 2 (C C 6 alkyl), -S0 2 R 7 , -S0 2 0R 7 , -S0 2 N(R 7 ) 2 , cyclopropylethynyl, aryl
- each R 4 is independently selected from halogen, -N0 2 , -CN, C C 6 alkyl optionally
- C C 6 haloalkyl substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(CrC 6 alkyl), -N(CrC 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(C C 6 alkyl), -CONH 2 , -CONH(C I -C 6 alkyl), -CON(C C 6 alkyl) 2 , -CONH-OH, -C0 2 H, -C0 2 (C C 6
- each R 5 is independently selected from the group consisting of halogen, -N0 2 , -CN, C C 6 alkyl, CrC 6 haloalkyl, -OH, CrC 6 alkoxy, CrC 6 haloalkoxy, hydroxy(CrC 6 alkoxy), alkoxy(C C 6 alkoxy), -S0 2 R 7 , -S0 2 0R 7 , and -S0 2 N(R 7 ) 2 ;
- each R 6 is independently selected from the group consisting of halogen, -N0 2 , -CN, C C 6 alkyl, C C 6 haloalkyl, -OH, C C 6 alkoxy, and C C 6 haloalkoxy; and
- each R 7 is independently selected from the group consisting of hydrogen, C C 6 alkyl, phenyl, or tolyl.
- the compounds of formula (I) exclude:
- Another aspect of the disclosure provides a pharmaceutical composition including one or more compounds of the disclosure as described herein (e.g., compounds of formula (I)) and a pharmaceutically acceptable carrier, solvent, adjuvant or diluent.
- Another aspect of the disclosure provides a method of treating a neurological disorder, the method including administering to a subject in need of such treatment one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
- the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post- infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies, optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age-associated myelin deficiency, Alzheimer’s Disease, and acquired and inherited neuropathies in the peripheral nervous system.
- the neurological disorder is multiple sclerosis.
- the neurological disorder is Alzheimer’s Disease.
- Another aspect of the disclosure provides a method of treating a non-CNS disease, the method including administering to a subject in need of such treatment one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
- the non-CNS disease is cancer.
- the cancer is characterized by elevated GN1.
- the cancer is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
- the non-CNS disease is cystic kidney disease, chronic liver disease, Hepatitis, C, obstructive pulmonary disease, organ fibrosis (including, e.g., kidney fibrosis, cardiac fibrosis, and pulmonary fibrosis), or rheumatoid arthritis.
- Another aspect of the disclosure provides a method of inhibiting GN1 , the method including administering one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
- Another aspect of the disclosure provides a method of enhancing remeyelination, the method including administering one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
- the methods and compositions described herein can be configured by the person of ordinary skill in the art to meet the desired need.
- the disclosed materials and methods provide improvements in treatment of diseases or disorders associated with GN1 and/or GN2 expression.
- the inventors found that the compounds of the disclosure inhibit GN1 and/or GN2 with low-mM and sub-mM IC 50 .
- the compounds of the disclosure inhibit GN1 and/or GN2 at IC 50 of no more than 10 pM, or no more than 1 pM, or no more than 100 nM, or even no more than 10 nM.
- the compounds of formula (I) exclude:
- the compounds of formula (I) as otherwise described herein are those of isomer form (1-1).
- the compounds of formula (I) as otherwise described herein are those of isomer form (1-2).
- the compounds of formula (I) as otherwise described herein are those wherein m is 2.
- the disclosure provides compounds of formula (I) as otherwise described herein where m is 2, and n is 1 , e.g., the compounds of formula (I-3): (i-3).
- the compounds of formula (I-3) as otherwise described herein are those of isomer form (I-4). (i-4).
- the compounds of formula (I-3) as otherwise described herein are those of isomer form (I-5).
- the disclosure provides compounds of formula (I) as otherwise described herein where both m and n are 2, e.g., the compounds of formula (I-6):
- the compounds of formula (I) as otherwise described herein are those wherein m is 1.
- the disclosure provides compounds of formula (I) as otherwise described herein where both m and n are 1.
- Such compounds are of formula (I-7):
- Another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where p is 0.
- the compounds of formula (l)-(l-7) as otherwise described herein are those wherein p is 1 or 2. In one embodiment, p is 1. In another embodiment p is 2. In one embodiment, the disclosure provides compounds as otherwise described herein where R 2 is C C 3 alkyl. In another embodiment, R 2 is ethyl or methyl. In another embodiment, R 2 is methyl.
- R is -OH, -0(CrC 3 alkyl), -SH, -S(C C 3 alkyl), -NH 2 , -NH(CrC 3 alkyl), or -N(C C 3 alkyl) 2 .
- R is -OH, -0(CH 3 ), -SH, -S(CH 3 ), -NH 2 , -NH(CH 3 ), or -N(CH 3 ) 2 .
- R is -OH, -0(C C 3 alkyl), -SH, or -S(C C 3 alkyl).
- R is -OH, -0(CH 3 ), -SH, or -S(CH 3 ).
- R is -OH, -SH, or -NH 2 . In certain embodiments, R is -OH or -SH.
- R is -OH, -0(CrC 6 alkyl), -NH 2 , -NH(CrC 6 alkyl), or -N(CrC 6 alkyl) 2 .
- R is -OH, -0(CH 3 ), -NH 2 , or -NH(CH 3 ).
- R is -OH or -NH 2 .
- R is -OH or -0(CH 3 ).
- the compounds of formula (l)-(l-7) as otherwise described herein are those wherein R is -OH.
- R ⁇ is selected from hydrogen, C C 3 alkyl, C C 3 haloalkyl, C 3 -C 6 cycloalkyl, heterocyclyl, hydroxy(CrC 3 alkyl), alkoxy(CrC 3 alkyl), -OH, and oxetanyl.
- R ⁇ is selected from hydrogen, C C 6 alkyl, C C 6 haloalkyl, C 3 -C 8 cycloalkyl, heterocyclyl, hydroxy(CrC 6 alkyl), -OH, and oxetanyl.
- R ⁇ is hydrogen or C C 6 alkyl. In certain embodiments of the disclosure, R ⁇ is hydrogen or C C 4 alkyl. In certain embodiments of the disclosure, R ⁇ is hydrogen or C C 3 alkyl. In certain embodiments of the disclosure, R ⁇ is hydrogen, methyl, or ethyl. In certain embodiments of the disclosure, R ⁇ is hydrogen or methyl. In certain embodiments of the disclosure, is hydrogen. In certain embodiments of the disclosure,
- Ri is methyl.
- One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents an aryl optionally substituted with one or more R 3 or heteroaryl optionally substituted with one or more R 3 .
- the compounds of formula (l)-(l-7) as otherwise described herein are those where ring A represents phenyl optionally substituted with one or more R 3 or 6-membered heteroaryl optionally substituted with one or more R 3 .
- One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl optionally substituted with one or more R 3 or pyridinyl optionally substituted with one or more R 3 .
- the compounds of formula (l)-(l-7) as otherwise described herein are those where ring A represents phenyl optionally substituted with one or more R 3 . In certain embodiments of the disclosure, ring A represents phenyl substituted with one or more R 3 . In certain embodiments of the disclosure, ring A represents phenyl optionally substituted with one R 3 .
- One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl substituted with one R 3 .
- One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl substituted with halogen (e.g., chloro or fluoro).
- halogen e.g., chloro or fluoro
- One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents 2-chlorophenyl.
- Another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl (i.e. , unsubstituted phenyl).
- each R 3 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(CrC 6 alkyl), -N(CrC 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(CrC 6 alkyl), -S0 2 R 7 , cyclopropylethynyl, aryl optionally substituted with one or more R 6 , heteroaryl optionally substituted with one or more R 6 , heterocyclyl optionally substituted with one or more R 6 , and C 3 -C 8 cycloalkyl optionally substitute
- each R 3 is independently selected from halogen, CrC 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(C I -C 6 alkyl), -N(C I -C 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(C C 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(CrC 6 alkyl), -S0 2 R 7 , cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C 3 -C 8 cycloalkyl.
- each R 3 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(C C 6 alkyl), -S0 2 R 7 , cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C 3 -C 8 cycloalkyl.
- each R 3 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(CrC 6 alkyl), -N(CrC 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, -S0 2 R 7 , cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C 3 -C 8 cycloalkyl.
- each R 3 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -OH, CrC 6 alkoxy, CrC 6 haloalkoxy, -S0 2 R 7 , cyclopropylethynyl, and heteroaryl. In certain embodiments of the disclosure, each R 3 is independently selected from halogen, C C 6 alkoxy, -S0 2 R 7 , cyclopropylethynyl, and heteroaryl. In certain embodiments of the disclosure, each R 3 is independently selected from halogen, CrC 6 alkoxy, cyclopropylethynyl, and heteroaryl.
- each R 3 is independently selected from halogen, CrC 6 alkoxy, and cyclopropylethynyl.
- the compounds as otherwise described herein are those wherein each R 3 is independently halogen.
- the compounds of formula (I) as otherwise described herein are those wherein m is 2, n is 1 , p is 0, and ring A represents 2-chlorophenyl.
- Such compounds are of formula (I-8), (I-9), or (1-10):
- ring B represents an aryl optionally substituted with one or more R 4 , heteroaryl optionally substituted with one or more R 4 , or heterocyclyl optionally substituted with one or more R 4 .
- ring B represents an aryl optionally substituted with one or more R 4 or heteroaryl optionally substituted with one or more R 4 , heterocyclyl optionally substituted with one or more R 4 .
- ring B represents phenyl, pyridinyl, pyrimidinyl,
- ring B represents phenyl optionally substituted with one or more R 4 .
- ring B represents phenyl optionally substituted with one R 4 .
- each R 4 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(CrC 6 alkyl), -N(CrC 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(C C 6 alkyl), alkoxy(C C 6 alkoxy), amino(CrC 6 alkyl), -S0 2 R 7 , -S0 2 0R 7 , -S0 2 N(R 7 ) 2 , cyclopropylethynyl, aryl optionally substituted with one or more R 6 , heteroaryl optionally substituted with one or more R 6 , heterocyclyl optionally substituted with one or more R 6 , heterocyclyl optionally substituted with
- each R 4 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(C I -C 6 alkyl), -N(C I -C 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), -S0 2 R 7 , cyclopropylethynyl, heteroaryl optionally substituted with one or more R 6 , heterocyclyl optionally substituted with one or more R 6 , C 3 -C 8 cycloalkyl optionally substituted with one or more R 6 , heterocyclyloxy optionally substituted with one or more R 6 , 2-hydroxy-3-methoxypropoxy, and
- each R 4 is independently selected from halogen, C C 6 alkyl, C C 6 haloalkyl, -OH, C C 6 alkoxy, C C 6 haloalkoxy, -SO2R7,
- each R 4 is independently selected from halogen, C C 6 alkyl, -OH, C C 6 alkoxy, -SO2R7, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with R 6 , and cyclopropyl.
- each R 4 is independently selected from halogen, C C 6 alkyl, -OH, C C 6 alkoxy, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with methyl, and cyclopropyl. In certain embodiments of the disclosure, each R 4 is independently selected from halogen, -OH, and C C 6 alkoxy. In some embodiments of the disclosure, each R 4 is independently selected from halogen, methyl, -OH, methoxy, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with methyl, and cyclopropyl.
- each R 4 is independently selected from halogen, methyl, -OH, and methoxy. In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R 4 is independently halogen. In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R 4 is independently chloro or fluoro. In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R 4 is independently chloro.
- One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring B represents phenyl substituted with halogen (e.g., chloro or fluoro).
- halogen e.g., chloro or fluoro
- One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring B represents 2-chlorophenyl.
- the disclosure provides a method of inhibiting Gli1.
- Another aspect of the disclosure provides a method for enhancing remyelination in a subject.
- the disclosure provides a method for enhancing neuroprotection of a central nervous system (CNS) or peripheral nervous system (PNS) neuron in a subject.
- CNS central nervous system
- PNS peripheral nervous system
- Such methods include administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e. , compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein.
- the subject has a neurological disorder characterized by myelin loss or myelin deficiency.
- the term “remyelination” refers to the generation of new myelin sheaths. Remyelination can be monitored by methods which include direct determination of the state of myelin in the subject, e.g., one can measure white matter mass using magnetic resonance imaging (MRI), measure the thickness of myelin fibers using a magnetic resonance spectroscopy (MRS) brain scan, or any other direct measures known in the art (e.g., Positron-Emission Tomography (PET), Diffusion-Weighted Imaging (DW-I, or DW- MRI), Diffusion Tensor Imaging, Magnetization Transfer, etc.).
- MRI magnetic resonance imaging
- MRS magnetic resonance spectroscopy
- Treatment effectiveness can be also monitored by improvements in physiological parameters (such as visual evoked response (VER), brainstem auditory evoked response (BAER), and somatosensory evoked potential (SSEP))and a positive change in neuropsychology (e.g., the status of various abilities such as memory, arithmetic, attention, judgment and reasoning). Certain tests for color blindness can also be helpful in tracking the treatment of demyelinating disorders on the eyes. Whitaker ei al. (1995) Ann. Neurol. 38(4):635-632.
- physiological parameters such as visual evoked response (VER), brainstem auditory evoked response (BAER), and somatosensory evoked potential (SSEP)
- a positive change in neuropsychology e.g., the status of various abilities such as memory, arithmetic, attention, judgment and reasoning.
- the disclosure also provides methods of treating a neurological disorder.
- Such method includes administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e., compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein.
- the neurological disorder is characterized by myelin loss or myelin deficiency.
- neurological disorder characterized by myelin loss or myelin deficiency encompasses any disease associated with the destruction or removal of myelin, the fatty sheath surrounding and insulating nerve fibers, from nerves.
- Non-limiting examples of such disorders include, but are not limited to, multiple sclerosis (MS) (e.g., relapsing/remitting multiple sclerosis, secondary progressive multiple sclerosis, progressive relapsing multiple sclerosis, primary progressive multiple sclerosis, and acute fulminant multiple sclerosis), central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post- infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies (e.g., metachromatic
- leukodystrophy leukodystrophy, Krabbe disease, adrenoleukodystrophy, Pelizaeus-Merzbacher disease, Canavan disease, childhood ataxia with central hypomyelination, Alexander disease, or refsum disease), optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age- associated myelin deficiency, Alzheimer’s Disease, as well as acquired and inherited neuropathies in the peripheral nervous system (e.g., Guillain-Barre syndrome and Charcot Marie Tooth disease).
- the peripheral nervous system e.g., Guillain-Barre syndrome and Charcot Marie Tooth disease
- the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post- infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies, optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age-associated myelin deficiency, Alzheimer’s Disease, and acquired and inherited neuropathies in the peripheral nervous system.
- the neurological disorder is multiple sclerosis.
- the neurological disorder is Alzheimer’s Disease.
- the disclosure also provides methods of treating a non-CNS disease.
- Such method includes administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e. , compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein.
- the non-CNS disease is cancer.
- the cancer is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
- a particularly suitable cancer is a solid tumor.
- solid tumors include, but are not limited to, carcinomas, sarcomas, and astrocytomas.
- the cancer is breast cancer, prostate cancer, lung cancer (e.g., small cell lung carcinoma (SCLC) and non-small-cell lung carcinoma (NSCLC)), gastric cancer, colorectal cancer, cervical cancer, endometrial cancer, ovarian cancer, skin cancer (e.g., basal-cell skin cancer (BCC), squamous-cell skin cancer (SCC), and melanoma), pancreatic cancer, kidney cancer, adrenal gland cancer, sarcoma, thyroid cancer, cholangiocarcinoma, glioblastoma, astrocytoma, oligodendroglioma, high-grade glioma, malignant glioma, glioma, neuroblastoma, medulloblastoma, leukemia or lympho
- lung cancer e.g., small
- ALL lymphoblastic leukemia
- CLL chronic lymphocytic leukemia
- lymphoma lymphoblastic leukemia
- the cancer is characterized by elevated Gli1.
- compounds and compositions of the invention are used to treat a cancer that is characterized by elevated Gli1.
- the cancer with elevated GN1 is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, leukemia, basal-cell carcinoma, glioblastoma, medulloblastoma, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
- the non-CNS disease is cystic kidney disease, chronic liver disease, Hepatitis, C, obstructive pulmonary disease, organ fibrosis (including, e.g., kidney fibrosis, cardiac fibrosis, and pulmonary fibrosis), or rheumatoid arthritis.
- At least a 5% e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70% improvement in one or more symptoms of the disease or disorder of the disclosure as described herein is sufficient to classify the subject as responding to the method of treatment.
- the compounds and compositions of the disclosure as described herein may also be administered in combination with one or more secondary therapeutic agents.
- the method also includes administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e. , compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein and one or more secondary therapeutic agents.
- the secondary therapeutic agent is a Gli 1 inhibitor.
- GN1 inhibitors suitable for use as secondary agents include, but are not limited to, GANT61 , GANT58, genistein, epigallocatechin gallate (EGCG), zerumbone, zerumbone epoxide, staurosporinone, 6-hydroxystaurosporinone, arcyriaflavin C, 5,6- dihydroxyarcyriaflavin A, physalin F, physalin B, NMDA298-1 , JK184, HPI-1 , HPI-4, HPI-3, HPI-4, arsenic trioxide, polyunsaturated fatty acid (such as arachidonic acid), or a siRNA (e.g., siRNA having the sequence selected from the group consisting of
- the secondary therapeutic agent may be a GM1 -binding protein such as kinesin-like protein KIF7, together with serine/threonine-protein kinase (STK3649) or ZIC1.
- GM1 -binding protein such as kinesin-like protein KIF7, together with serine/threonine-protein kinase (STK3649) or ZIC1.
- the secondary therapeutic agent may be an inhibitor for a different pathway or molecular target, such as BEZ235 (PI3K/mTOR dual inhibitor), LY294002 (PI3K inhibitor) or U0126 (MEK1/2 inhibitor).
- BEZ235 PI3K/mTOR dual inhibitor
- LY294002 PI3K inhibitor
- U0126 MEK1/2 inhibitor
- the secondary therapeutic agent may be any one of those described in Lung Cancer. Targets and Therapy (2016) 9: 35-43 (incorporated by reference herein).
- the secondary therapeutic agent is an agent that facilitates brain delivery.
- agents include, e.g., an implantable reservoir (Omaya reservoir), functionalized nanocarriers (e.g., nanoparticles coated with transferrin or transferrin receptor [TR] antibodies) and liposomes (e.g., liposomes coated with targeting molecules such as antibodies, Trojan Horses Liposomes [TELL]), antibodies (e.g., antibodies against transferrin receptor [TR] and insulin receptor [HIR], BBB transmigrating Llama single domain antibodies (sdAb)), chimeric peptides (e.g., Angiopeps derived from proteins expressing the Kunitz domain), low-density lipoprotein receptor related proteins 1 and 2 (LRP-1 and 2), diphtheria toxin receptor (DTR), mesenchyme stem cells, etc.
- the secondary therapeutic agent is an agent that limits demyelination or enhances remyelination.
- Some examples include, but are not limited to, Interferon Beta I a (Avonex), Interferon Beta lb (Rebif), glatiramer acetate (Copaxone), mitoxantrone (Novantrone), azathiprine (Imuran), cyclophosphamide (Cytoxan or Neosar), cyclosporine (Sandimmune), ampyra, dimethyl fumarate (BG12), fmgolimod, methotrexate, Cladribine (Leustatin), methylprednisone (Depo-Medrol or Solu-Medrol), prednisone (Deltasone), prednisolone (Delta-Cortef), dexamethasone (Medrol or Decadron), adreno- corticotrophic hormone (ACTH), Cor
- the secondary therapeutic agent is an agent that causes upregulation and/or increases activity of GN2 and/or GN3.
- Some examples include, but are not limited to, Shh agonists and Protein Kinase A inhibitors (PKA inhibitors).
- PKA inhibitors Specific examples of useful Shh agonists and PKA inhibitors are provided, for example, in U.S. Patents Nos. 6,767,888 and 6,683,192, incorporated by reference herein.
- PKA inhibitors may be purchased from commercial sources, such as Enzo Life Sciences (Farmingdale).
- the secondary therapeutic agent is an agonist of Smo
- Smo agonists include, for example, A/-methyl-A/'-(3-pyridinylbenzyl)-/ ⁇ /'- (3-chlorobenzo[b]thiophene-2-carbonyl)-1 ,4-diaminocyclohexane (SAG), and those disclosed in International Patent Publication WO 2003/027234, PNAS (2002) 99(22):14071- 14076, and/or Journal of Biology (2002) 1 :10 (all incorporated by reference herein).
- agonists of Smo cause upregulation and/or activity of GN2 and/or GN3.
- agonists of Smo limit demyelination or enhance remyelination.
- the secondary therapeutic agent is an antagonist of Smo.
- Smo antagonists include, for example, cyclopamine, derivatives of cyclopamine, sonidegib, derivatives of sonidegib, vismodegib, and derivatives of vismodegib, and those described in Future Medicinal Chemistry (2019)11 (6): 489-638 (incorporated by reference herein).
- antagonists of Smo can be used to treat cancer.
- the secondary therapeutic agent maye be a gene editing agent.
- Suitable examples of gene editing agents include, but are not limited to, CRISPR (e.g., an RNA guide strand with an endonuclease that may be, but is not limited to a type I CRISPR endonuclease, a type II CRISPR endonuclease, a type III CRISPR endonuclease, a type IV CRISPR endonuclease, a type V CRISPR endonuclease, a type VI CRISPR endonuclease, CRISPR associated protein 9 (Cas9), Cpf1 , CasX or CasY), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), a NgAgo-based system, and meganucelases.
- CRISPR e.g., an RNA guide strand with an endonuclease that may be,
- the secondary therapeutic agent is an anti-proliferative agent.
- suitable secondary therapeutic agents include, but are not limited to, temozolomide, camptothecin, doxorubicin, daunorubicin, vincristine, paclitaxel,
- neocarzinostatin calicheamicin, cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, lurtotecan, annamycin, docetaxel, tamoxifen, epirubicin, methotrexate, vinblastin, vincristin, topotecan, prednisone, prednisolone, chloroquine, hydroxychloroquine, autophagy inhibitors, and abt-737.
- the compounds and compositions of the disclosure as described herein and the secondary therapeutic agents can be formulated as separate compositions that are given simultaneously or sequentially, or the therapeutic agents can be given as a single composition.
- the secondary therapeutic agent may be administered in an amount below its established half maximal inhibitory concentration (IC 50 ).
- the secondary therapeutic agent may be administered in an amount less than 1% of, e.g., less than 10%, or less than 25%, or less than 50%, or less than 75%, or even less than 90% of the inhibitory concentration (IC 50 ).
- compositions comprising one or more of compounds as described above with respect to formula (I) and an appropriate carrier, solvent, adjuvant, or diluent.
- carrier, solvent, adjuvant, or diluent will depend upon the desired use for the composition, and may range from being suitable or acceptable for veterinary uses to being suitable or acceptable for human use.
- the composition may optionally include one or more secondary therapeutic agents.
- the composition may include one or more secondary anticancer therapeutic agents.
- the compounds described herein may be administered singly, as mixtures of one or more compounds or in mixture or combination with other agents useful for treating such diseases and/or the symptoms associated with such diseases.
- the compounds may also be administered in mixture or in combination with agents useful to treat other disorders or maladies, such as steroids, membrane stabilizers, 5LO inhibitors, leukotriene synthesis and receptor inhibitors, inhibitors of IgE isotype switching or IgE synthesis, IgG isotype switching or IgG synthesis, b-agonists, tryptase inhibitors, aspirin, COX inhibitors, methotrexate, anti-TNF drugs, retuxin, PD4 inhibitors, p38 inhibitors, PDE4 inhibitors, and antihistamines, to name a few.
- the compounds may be administered in the form of compounds perse, or as pharmaceutical compositions comprising a compound.
- compositions comprising the compound(s) may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making levigating, emulsifying, encapsulating, entrapping or lyophilization processes.
- the compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the compounds into preparations which can be used pharmaceutically.
- the compounds may be formulated in the pharmaceutical composition per se, or in the form of a hydrate, solvate, N-oxide or pharmaceutically acceptable salt, as previously described.
- such salts are more soluble in aqueous solutions than the
- salts having lower solubility than the corresponding free acids and bases may also be formed.
- compositions may take a form suitable for virtually any mode of administration, including, for example, topical, ocular, oral, buccal, systemic, nasal, injection, transdermal, rectal, vaginal, etc., or a form suitable for administration by inhalation or insufflation.
- the compound(s) may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
- Systemic formulations include those designed for administration by injection, e.g., subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal oral or pulmonary administration.
- Useful injectable preparations include sterile suspensions, solutions or emulsions of the active compound(s) in aqueous or oily vehicles.
- the compositions may also contain formulating agents, such as suspending, stabilizing and/or dispersing agent.
- formulations for injection may be presented in unit dosage form, e.g., in ampules or in multidose containers, and may contain added preservatives.
- the injectable formulation may be provided in powder form for reconstitution with a suitable vehicle, including but not limited to sterile pyrogen free water, buffer, dextrose solution, etc., before use.
- a suitable vehicle including but not limited to sterile pyrogen free water, buffer, dextrose solution, etc.
- the active compound(s) may be dried by any art-known technique, such as lyophilization, and reconstituted prior to use.
- penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are known in the art.
- the pharmaceutical compositions may take the form of, for example, lozenges, tablets or capsules prepared by conventional means with
- binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
- fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
- lubricants e.g., magnesium stearate, talc or silica
- disintegrants e.g., potato starch or sodium starch glycolate
- wetting agents e.g., sodium lauryl sulfate.
- the tablets may be coated by methods well known in the art with, for example, sugars, films or enteric coatings.
- Liquid preparations for oral administration may take the form of, for example, elixirs, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, cremophoreTM or fractionated vegetable oils); and preservatives (e.g., methyl or
- the preparations may also contain buffer salts, preservatives, flavoring, coloring and sweetening agents as appropriate.
- Preparations for oral administration may be suitably formulated to give controlled release of the compound, as is well known.
- the compositions may take the form of tablets or lozenges formulated in conventional manner.
- the compound(s) may be formulated as solutions (for retention enemas) suppositories or ointments containing conventional suppository bases such as cocoa butter or other glycerides.
- compound(s) can be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, fluorocarbons, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, fluorocarbons, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- the compound(s) may be formulated as a solution, emulsion, suspension, etc. suitable for administration to the eye.
- a variety of vehicles suitable for administering compounds to the eye are known in the art.
- the compound(s) can be formulated as a depot preparation for administration by implantation or intramuscular injection.
- the compound(s) may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, e.g., as a sparingly soluble salt.
- suitable polymeric or hydrophobic materials e.g., as an emulsion in an acceptable oil
- ion exchange resins e.g., as sparingly soluble derivatives, e.g., as a sparingly soluble salt.
- transdermal delivery systems manufactured as an adhesive disc or patch which slowly releases the compound(s) for percutaneous absorption may be used.
- permeation enhancers may be used to facilitate transdermal penetration of the compound(s).
- Liposomes and emulsions are well-known examples of delivery vehicles that may be used to deliver compound(s).
- Certain organic solvents such as dimethyl sulfoxide (DMSO) may also be employed, although usually at the cost of greater toxicity.
- DMSO dimethyl sulfoxide
- compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the compound(s).
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the compound(s) described herein, or compositions thereof will generally be used in an amount effective to achieve the intended result, for example in an amount effective to treat or prevent the particular disease being treated.
- therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated and/or eradication or amelioration of one or more of the symptoms associated with the underlying disorder such that the patient reports an improvement in feeling or condition, notwithstanding that the patient may still be afflicted with the underlying disorder.
- Therapeutic benefit also generally includes halting or slowing the progression of the disease, regardless of whether improvement is realized.
- the amount of compound(s) administered will depend upon a variety of factors, including, for example, the particular indication being treated, the mode of administration, whether the desired benefit is prophylactic or therapeutic, the severity of the indication being treated and the age and weight of the patient, the bioavailability of the particular
- Effective dosages may be estimated initially from in vitro activity and metabolism assays.
- an initial dosage of compound for use in animals may be formulated to achieve a circulating blood or serum concentration of the metabolite active compound that is at or above an IC 50 of the particular compound as measured in as in vitro assay.
- Calculating dosages to achieve such circulating blood or serum concentrations taking into account the bioavailability of the particular compound via the desired route of administration is well within the capabilities of skilled artisans.
- Initial dosages of compound can also be estimated from in vivo data, such as animal models.
- Animal models useful for testing the efficacy of the active metabolites to treat or prevent the various diseases described above are well-known in the art.
- Animal models suitable for testing the bioavailability and/or metabolism of compounds into active metabolites are also well-known.
- Ordinarily skilled artisans can routinely adapt such information to determine dosages of particular compounds suitable for human
- Dosage amounts will typically be in the range of from about 0.0001 mg/kg/day, 0.001 mg/kg/day or 0.01 mg/kg/day to about 100 mg/kg/day, but may be higher or lower, depending upon, among other factors, the activity of the active compound, the bioavailability of the compound, its metabolism kinetics and other pharmacokinetic properties, the mode of administration and various other factors, discussed above. Dosage amount and interval may be adjusted individually to provide plasma levels of the compound(s) and/or active metabolite compound(s) which are sufficient to maintain therapeutic or prophylactic effect.
- the compounds may be administered once per week, several times per week (e.g., every other day), once per day or multiple times per day, depending upon, among other things, the mode of administration, the specific indication being treated and the judgment of the prescribing physician.
- the effective local concentration of co pound(s) and/or active metabolite compound(s) may not be related to plasma concentration. Skilled artisans will be able to optimize effective dosages without undue experimentation.
- alkenyl as used herein, means a straight or branched chain hydrocarbon containing from 2 to 10 carbons, unless otherwise specified, and containing at least one carbon-carbon double bond.
- alkenyl include, but are not limited to, ethenyl, 2-propenyl, 2-methyl-2-propenyl, 3-butenyl, 4-pentenyl, 5-hexenyl, 2-heptenyl, 2- methyl-1-heptenyl, 3-decenyl, and 3,7-dimethylocta-2,6-dienyl.
- alkoxy means an alkyl group, as defined herein, appended to the parent molecular moiety through an oxygen atom.
- Representative examples of alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, tert-butoxy, pentyloxy, and hexyloxy.
- alkyl as used herein, means a straight or branched chain hydrocarbon containing from 1 to 10 carbon atoms unless otherwise specified.
- Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2- dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, and n-decyl.
- an“alkyl” group is a linking group between two other moieties, then it may also be a straight or branched chain; examples include, but are not limited to -CH 2 -, -CH 2 CH 2 -
- alkylene refers to a bivalent alkyl group.
- An "alkylene chain” is a polymethylene group, i.e. , -(CH 2 ) n -, wherein n is a positive integer, preferably from one to six, from one to four, from one to three, from one to two, or from two to three.
- a substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms is replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.
- An alkylene chain also may be substituted at one or more positions with an aliphatic group or a substituted aliphatic group.
- alkynyl as used herein, means a straight or branched chain hydrocarbon group containing from 2 to 10 carbon atoms and containing at least one carbon-carbon triple bond.
- Representative examples of alkynyl include, but are not limited, to acetylenyl, 1- propynyl, 2-propynyl, 3-butynyl, 2-pentynyl, and 1-butynyl.
- aryl means a phenyl (i.e., monocyclic aryl), or a bicyclic ring system containing at least one phenyl ring or an aromatic bicyclic ring containing only carbon atoms in the aromatic bicyclic ring system.
- the bicyclic aryl can be azulenyl, naphthyl, or a phenyl fused to a monocyclic cycloalkyl, a monocyclic cycloalkenyl, or a monocyclic heterocyclyl.
- the bicyclic aryl is attached to the parent molecular moiety through any carbon atom contained within the phenyl portion of the bicyclic system, or any carbon atom with the napthyl or azulenyl ring.
- the fused monocyclic cycloalkyl or monocyclic heterocyclyl portions of the bicyclic aryl are optionally substituted with one or two oxo and/or thioxo groups.
- bicyclic aryls include, but are not limited to, azulenyl, naphthyl, dihydroinden-1-yl, dihydroinden-2-yl, dihydroinden-3-yl, dihydroinden-4- yl, 2,3-dihyd roindol-4-yl, 2,3-dihyd roindol-5-yl, 2,3-dihydroindol-6-yl, 2,3-dihydroindol-7-yl, inden-1-yl, inden-2-yl, inden-3-yl, inden-4-yl, dihydronaphthalen-2-yl, dihydronaphthalen-3-yl, dihydronaphthalen-4-yl, dihydronaphthalen-1-yl, 5,6,7,8-tetrahydronaphthalen-1-yl, 5, 6,7,8- tetrahydronaphthalen-2-y
- the bicyclic aryl is (i) naphthyl a phenyl ring fused to either a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, or a 5 or 6 membered monocyclic heterocyclyl, wherein the fused cycloalkyl, cycloalkenyl, and heterocyclyl groups are optionally substituted with one or two groups which are independently oxo or thioxo.
- cycloalkyl as used herein, means a monocyclic or a bicyclic cycloalkyl ring system.
- Monocyclic ring systems are cyclic hydrocarbon groups containing from 3 to 8 carbon atoms, where such groups can be saturated or unsaturated, but not aromatic. In certain embodiments, cycloalkyl groups are fully saturated. Examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl.
- Bicyclic cycloalkyl ring systems are bridged monocyclic rings or fused bicyclic rings.
- Bridged monocyclic rings contain a monocyclic cycloalkyl ring where two non-adjacent carbon atoms of the monocyclic ring are linked by an alkylene bridge of between one and three additional carbon atoms (/.e., a bridging group of the form -(CH 2 ) W -, where w is 1 , 2, or 3).
- Representative examples of bicyclic ring systems include, but are not limited to, bicyclo[3.1.1]heptane, bicyclo[2.2.1]heptane,
- bicyclo[2.2.2]octane bicyclo[3.2.2]nonane, bicyclo[3.3.1]nonane, and bicyclo[4.2.1]nonane.
- Fused bicyclic cycloalkyl ring systems contain a monocyclic cycloalkyl ring fused to either a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl, or a monocyclic heteroaryl.
- the bridged or fused bicyclic cycloalkyl is attached to the parent molecular moiety through any carbon atom contained within the monocyclic cycloalkyl ring.
- Cycloalkyl groups are optionally substituted with one or two groups which are independently oxo or thioxo.
- the fused bicyclic cycloalkyl is a 5 or 6 membered monocyclic cycloalkyl ring fused to either a phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, a 5 or 6 membered monocyclic heterocyclyl, or a 5 or 6 membered monocyclic heteroaryl, wherein the fused bicyclic cycloalkyl is optionally substituted by one or two groups which are independently oxo or thioxo.
- halo or“halogen” as used herein, means -Cl, -Br, -I or -F.
- haloalkyl and “haloalkoxy” refer to an alkyl or alkoxy group, as the case may be, which is substituted with one or more halogen atoms.
- heteroaryl as used herein, means a monocyclic heteroaryl or a bicyclic ring system containing at least one heteroaromatic ring.
- the monocyclic heteroaryl can be a
- the 5 or 6 membered ring consists of two double bonds and one, two, three or four nitrogen atoms and optionally one oxygen or sulfur atom.
- the 6 membered ring consists of three double bonds and one, two, three or four nitrogen atoms.
- the 5 or 6 membered heteroaryl is connected to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the heteroaryl.
- monocyclic heteroaryl include, but are not limited to, furyl, imidazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, oxazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrazolyl, pyrrolyl, tetrazolyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, and triazinyl.
- the bicyclic heteroaryl consists of a monocyclic heteroaryl fused to a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl, or a monocyclic heteroaryl.
- the fused cycloalkyl or heterocyclyl portion of the bicyclic heteroaryl group is optionally substituted with one or two groups which are independently oxo or thioxo.
- the bicyclic heteroaryl contains a fused cycloalkyl, cycloalkenyl, or heterocyclyl ring
- the bicyclic heteroaryl group is connected to the parent molecular moiety through any carbon or nitrogen atom contained within the monocyclic heteroaryl portion of the bicyclic ring system.
- the bicyclic heteroaryl is a monocyclic heteroaryl fused to a benzo ring
- the bicyclic heteroaryl group is connected to the parent molecular moiety through any carbon atom or nitrogen atom within the bicyclic ring system.
- bicyclic heteroaryl include, but are not limited to, benzimidazolyl, benzofuranyl, benzothienyl, benzoxadiazolyl, benzoxathiadiazolyl, benzothiazolyl, cinnolinyl, 5,6-dihydroquinolin-2-yl, 5,6-dihydroisoquinolin-1-yl, furopyridinyl, indazolyl, indolyl, isoquinolinyl, naphthyridinyl, quinolinyl, purinyl, 5,6,7,8-tetrahydroquinolin- 2-yl, 5,6,7,8-tetrahydroquinolin-3-yl, 5,6,7,8-tetrahydroquinolin-4-yl, 5, 6,7,8- tetrahydroisoquinolin-1-yl, thienopyridinyl, 4,5,6,7-tetrahydrobenzo[c
- the fused bicyclic heteroaryl is a 5 or 6 membered monocyclic heteroaryl ring fused to either a phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or
- heterocyclyl and“heterocycloalkyl” as used herein, mean a monocyclic heterocycle or a bicyclic heterocycle.
- the monocyclic heterocycle is a 3, 4, 5, 6 or 7 membered ring containing at least one heteroatom independently selected from the group consisting of O, N, and S where the ring is saturated or unsaturated, but not aromatic.
- the 3 or 4 membered ring contains 1 heteroatom selected from the group consisting of O, N and S.
- the 5 membered ring can contain zero or one double bond and one, two or three
- heteroatoms selected from the group consisting of O, N and S are selected from the group consisting of O, N and S.
- the 6 or 7 membered ring contains zero, one or two double bonds and one, two or three heteroatoms selected from the group consisting of O, N and S.
- the monocyclic heterocycle is connected to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the monocyclic heterocycle.
- monocyclic heterocycle include, but are not limited to, azetidinyl, azepanyl, aziridinyl, diazepanyl, 1 ,3-dioxanyl, 1 ,3-dioxolanyl, 1 ,3-dithiolanyl, 1 ,3-dithianyl, imidazolinyl, imidazolidinyl, isothiazolinyl, isothiazolidinyl, isoxazolinyl, isoxazolidinyl, morpholinyl, oxadiazolinyl, oxadiazolidinyl, oxazolinyl,
- oxazolidinyl piperazinyl, piperidinyl, pyranyl, pyrazolinyl, pyrazolidinyl, pyrrolinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, thiadiazolinyl, thiadiazolidinyl, thiazolinyl, thiazolidinyl, thiomorpholinyl, 1 ,1-dioxidothiomorpholinyl (thiomorpholine sulfone), thiopyranyl, and trithianyl.
- the bicyclic heterocycle is a monocyclic heterocycle fused to either a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocycle, or a monocyclic heteroaryl.
- the bicyclic heterocycle is connected to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the monocyclic heterocycle portion of the bicyclic ring system.
- bicyclic heterocyclyls include, but are not limited to, 2,3-dihydrobenzofuran-2-yl, 2,3-dihydrobenzofuran-3-yl, indolin-1-yl, indolin-2-yl, indolin-3-yl, 2,3-dihydrobenzothien-2-yl, decahydroquinolinyl, decahydroisoquinolinyl, octahydro-1/-/-indolyl, and octahydrobenzofuranyl.
- Heterocyclyl groups are optionally substituted with one or two groups which are independently oxo or thioxo.
- the bicyclic heterocyclyl is a 5 or 6 membered monocyclic heterocyclyl ring fused to phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, a 5 or 6 membered monocyclic heterocyclyl, or a 5 or 6 membered monocyclic heteroaryl, wherein the bicyclic heterocyclyl is optionally substituted by one or two groups which are independently oxo or thioxo.
- saturated means the referenced chemical structure does not contain any multiple carbon-carbon bonds.
- a saturated cycloalkyl group as defined herein includes cyclohexyl, cyclopropyl, and the like.
- substituted means that a hydrogen radical of the designated moiety is replaced with the radical of a specified substituent, provided that the substitution results in a stable or chemically feasible compound.
- substituted when used in reference to a designated atom, means that attached to the atom is a hydrogen radical, which can be replaced with the radical of a suitable substituent.
- substituents refers to a number of substituents that equals from one to the maximum number of substituents possible based on the number of available bonding sites, provided that the above conditions of stability and chemical feasibility are met.
- an optionally substituted group may have a substituent at each substitutable position of the group, and the substituents may be either the same or different.
- the term "independently selected” means that the same or different values may be selected for multiple instances of a given variable in a single compound.
- unsaturated means the referenced chemical structure contains at least one multiple carbon-carbon bond, but is not aromatic.
- a unsaturated cycloalkyl group as defined herein includes cyclohexenyl, cyclopentenyl, cyclohexadienyl, and the like.
- “Pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio or which have otherwise been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals.
- “Pharmaceutically acceptable salt” refers to both acid and base addition salts.
- “Therapeutically effective amount” refers to that amount of a compound which, when administered to a subject, is sufficient to effect treatment for a disease or disorder described herein.
- the amount of a compound which constitutes a“therapeutically effective amount” will vary depending on the compound, the disorder and its severity, and the age of the subject to be treated, but can be determined routinely by one of ordinary skill in the art.
- “Treating” or“treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, preferably a human, and includes:
- treating as used herein includes inhibiting a disease or disorder. In certain embodiments, treating as used herein includes inhibiting, relieving, ameliorating, or slowing progression of one or more symptoms of the disease or disorder.
- Subject refers to a warm blooded animal such as a mammal, preferably a human, or a human child, which is afflicted with, or has the potential to be afflicted with one or more diseases and disorders described herein.
- any suitable stationary phase can be used, including normal and reversed phases as well as ionic resins.
- Most typically the disclosed compounds are purified via silica gel and/or alumina chromatography. See, e.g., Introduction to Modern Liquid Chromatography, 2nd Edition, ed. L. R. Snyder and J. J. Kirkland, John Wiley and Sons, 1979; and Thin Layer
- the compounds disclosed herein can be made using procedures familiar to the person of ordinary skill in the art and as described herein.
- compounds of structural formula (I) can be prepared according to general procedures (below), and/or analogous synthetic procedures.
- One of skill in the art can adapt the reaction sequences of Examples 1-217 and general procedures to fit the desired target molecule.
- one of skill in the art will use different reagents to affect one or more of the individual steps or to use protected versions of certain of the substituents.
- compounds of the disclosure can be synthesized using different routes altogether.
- Example 1 1-(2-chlorophenyl)-2-(2-(4-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5- c]pyridin-5-yl)ethan-1-ol
- Example 3-S ((S)-1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol; 22.4 mg, 44% yield) as white solid and
- Example 3-R ((R)-1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5- yl)ethan-1-ol; 19.7 mg, 39% yield) as white solid.
- Example 3-R MS (ESI): mass calcd. for C 2 oH 17 CI 2 N 3 0 385.07, m/z found 387.7 [M+H] + .
- Chiral HPLC (CS30_FR12.5.met) Rt 6.37 min.
- Examples 8 and 9 (S)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-ol and (f?)-2-(2-(2-chlorophenyl)-3,4,6,7- tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-ol
- Example 8 (S)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-ol (33.3 mg, 7% yield) as white solid.
- Example 15 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-1-methyl-1 ,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol
- GN1 -mediated transcriptional luciferase reporter assay was performed using Shh- LIGHT2 cells in order to evaluate the effects on activation and inhibition of Gli1-mediated transcription by the compounds of the disclosure. Brief assay procedure is provided below.
- Shh-LIGHT2 cells were harvested from about 80% confluent 10-cm dish using 0.25% Trypsin-EDTA solution. Medium was removed, and cells were washed with 5 ml_ DPBS and aspirated. Then, 1ml_ 0.25% Trypsin-EDTA solution was added to a 10-cm dish. The dish was placed in the incubator for 1-3 minutes, or until cells have detached. 3 ml_ of cell growth medium (DMEM, 10% FBS, 1% PenStrep, 1% sodium pyruvate, and 1% GlutaMax) was added to the 10-cm dish, and the contents were transferred to a conical tube.
- DMEM 10% FBS, 1% PenStrep, 1% sodium pyruvate, and 1% GlutaMax
- the cell assay plate was removed from incubator after cells reached confluency. The culture medium was then manually removed from the cell plates, and the plates were centrifuged at 200 rpm for 30 seconds. In the case of antagonist evaluation, compounds (25 mI_) were added at semilog concentration (1.5 nM - 30 mM final concentration with 0.5% DMSO) in the assay medium (DMEM, 2% FBS, 1% PenStrep, 1% sodium pyruvate, and 1% GlutaMax), then incubated for 30 minutes at 37°C/5% C0 2 .
- Luciferase assay After incubation, the cell assay plate was allowed to acclimate to room temperature. Then, 20 pL of Duo-Glo® Luciferase Reagent (Promega) was added to each well of cell assay plate. The plate was briefly spun down, mixed, and incubated for 30 minutes at room temperature. The cell plate was read using luminometer for firefly luminescence activity. Then, 20 pL of Duo-Glo® Steop&Glo® Reagent (Promega) was added to each well of cell assay plate. The plate was briefly spun down, mixed, and incubated for 30 minutes at room temperature. The cell plate was read using luminometer for Renilla luminescence activity. Ratio of fi refly: Renilla luminescence was calculated for each well. The compound well ratio was normalized to the ratio from a control well.
- IC 50 activity of 1-10 mM is labeled“+”
- IC 50 activity of 0.5-0.99 pM is labeled“++”
- IC 50 activity of 0.1-0.49 pM is labeled“+++”
- IC 50 activity of ⁇ 0.1 pM is labeled“++++”
- IC 50 activity of >10 pM is labeled“ ⁇ ”.
- Embodiment 1 provides a compound of the formula (I) as described above.
- Embodiment 2 provides the compound of embodiment 1 , wherein m is 2, and n is 1.
- Embodiment 3 provides the compound of embodiment 1 , wherein both m and n are 1.
- Embodiment 4 provides the compound of embodiment 1 , wherein both m and n are 2.
- Embodiment 6 provides the compound of any of embodiments 1-5, wherein p is 0.
- Embodiment 7 provides the compound of any of embodiments 1-5, wherein p is 1 or 2.
- Embodiment 8 provides the compound of any of embodiments 1-5, wherein p is 1.
- Embodiment 9 provides the compound of embodiment 7 or 8, wherein R 2 is C C 3 alkyl.
- Embodiment 10 provides the compound of embodiment 7 or 8, wherein R 2 is methyl
- Embodiment 11 provides the compound of any of embodiments 1-10, wherein R is -OH, -0(C C 3 alkyl), -SH, -S(C C 3 alkyl), -NH 2 , -NH(C C 3 alkyl), or -N(C C 3 alkyl) 2 .
- Embodiment 12 provides the compound of any of embodiments 1-10, wherein R is -OH, -0(CH 3 ), -SH, -S(CH 3 ), -NH 2 , -NH(CH 3 ), or -N(CH 3 ) 2 .
- Embodiment 13 provides the compound of embodiment 12, wherein R is -OH, -SH, or -NH 2 .
- Embodiment 14 provides the compound of any of embodiments 1-10, wherein R is -OH, -0(C C 6 alkyl), -NH 2 , -NH(C C 6 alkyl), or -N(C C 6 alkyl) 2 .
- Embodiment 15 provides the compound of embodiment 14, wherein R is -OH, -0(CH 3 ), -NH 2 , or -NH(CH 3 ).
- Embodiment 16 provides the compound of embodiment 14, wherein R is -OH or -NH 2 .
- Embodiment 17 provides the compound of any of embodiments 1-10, wherein R is - OH.
- Embodiment 18 provides the compound of any of embodiments 1-17, wherein R ⁇ is selected from hydrogen, C C 3 alkyl, C C 3 haloalkyl, C 3 -C 6 cycloalkyl, heterocyclyl, hydroxy(C C 3 alkyl), alkoxy(CrC 3 alkyl), -OH, and oxetanyl.
- Embodiment 19 provides the compound of any of embodiments 1-17, wherein R ⁇ is selected from R ⁇ is selected from hydrogen, CrC 6 alkyl, CrC 6 haloalkyl, C 3 -C 8 cycloalkyl, heterocyclyl, hydroxy(C C 6 alkyl), -OH, and oxetanyl.
- Embodiment 20 provides the compound of any of embodiments 1-17, wherein R ⁇ is hydrogen or C C 6 alkyl.
- Embodiment 21 provides the compound of any of embodiments 1-17, wherein R ⁇ is hydrogen or methyl.
- Embodiment 22 provides the compound of any of embodiments 1-17, wherein R ⁇ is hydrogen.
- Embodiment 23 provides the compound of any of embodiments 1-16, wherein R ⁇ is methyl.
- Embodiment 24 provides the compound of any of embodiments 1-23, wherein ring A represents an aryl optionally substituted with one or more R 3 or heteroaryl optionally substituted with one or more R 3 .
- Embodiment 25 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl optionally substituted with one or more R 3 or 6-membered heteroaryl optionally substituted with one or more R 3 .
- Embodiment 26 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl optionally substituted with one or more R 3 or pyridinyl optionally substituted with one or more R 3 .
- Embodiment 27 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl optionally substituted with one or more R 3 ; or wherein ring A represents phenyl substituted with one or more R 3 ; or wherein ring A represents phenyl optionally substituted with one R 3 ; or wherein ring A represents phenyl substituted with one R 3 .
- Embodiment 28 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl.
- Embodiment 29 provides the compound of any of embodiments 1-28, wherein each R 3 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(CI-C 6 alkyl), -N(CI-C 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(C C 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(CrC 6 alkyl), -S0 2 R 7 , cyclopropylethynyl, aryl optionally substituted with one or more R 6 , heteroaryl optionally substituted with one or more R 6 , heterocyclyl optionally substituted with one or more R 6 , and C 3 -C 8 cycloalkyl optionally substituted with
- Embodiment 30 provides the compound of any of embodiments 1-28, wherein each R 3 is independently selected from halogen, CrC 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(CI-C 6 alkyl), -N(CI-C 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(CrC 6 alkyl), -S0 2 R 7 , cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C 3 -C 8 cycloalkyl.
- Embodiment 31 provides the compound of any of embodiments 1-28, wherein each R 3 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(CrC 6 alkyl), -S0 2 R 7 , cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C 3 -C 8 cycloalkyl.
- Embodiment 32 provides the compound of any of embodiments 1-28, wherein each R 3 is independently selected from halogen, CrC 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(C I -C 6 alkyl), -N(C I -C 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, -S0 2 R 7 , cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C 3 -C 8 cycloalkyl.
- Embodiment 33 The compound of any of embodiments 1-28, wherein each R 3 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -OH, CrC 6 alkoxy, CrC 6 haloalkoxy, -S0 2 R 7 , cyclopropylethynyl, and heteroaryl.
- Embodiment 34 provides the compound of any of embodiments 1-28, wherein each R 3 is independently selected from halogen, C C 6 alkoxy, -S0 2 R 7 , cyclopropylethynyl, and heteroaryl.
- Embodiment 35 provides the compound of any of embodiments 1-28, wherein each R 3 is independently selected from halogen, C C 6 alkoxy, cyclopropylethynyl, and heteroaryl; or wherein each R 3 is independently selected from halogen, C C 6 alkoxy, and
- Embodiment 36 provides the compound of any of embodiments 1-28, wherein each R 3 is independently halogen.
- Embodiment 37 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl substituted with halogen (e.g., chloro or fluoro).
- halogen e.g., chloro or fluoro
- Embodiment 38 provides the compound of any of embodiments 1-23, wherein ring A represents 2-chlorophenyl.
- Embodiment 39 provides the compound of any of embodiments 1 and 18-23, wherein m is 2, n is 1 , p is 0, and ring A represents 2-chlorophenyl; e.g., having the formula:
- Embodiment 40 provides the compound of any of embodiments 1-39, wherein ring B represents an aryl optionally substituted with one or more R 4 , heteroaryl optionally substituted with one or more R 4 , or heterocyclyl optionally substituted with one or more R 4 .
- Embodiment 41 provides the compound of any of embodiments 1-39, wherein ring B represents an aryl optionally substituted with one or more R 4 or heteroaryl optionally substituted with one or more R 4 , heterocyclyl optionally substituted with one or more R 4 .
- Embodiment 42 provides the compound of any of embodiments 1-39, wherein ring B represents phenyl, pyridinyl, pyrimidinyl, benzo[d][1 ,3]dioxolyl (e.g., benzo[d][1 ,3]dioxol-4-yl), 2,3-dihydrobenzo[b][1 ,4]dioxinyl (e.g., 2,3-dihydrobenzo[b][1 ,4]dioxin-5-yl), each optionally substituted with one or more R 4 .
- ring B represents phenyl, pyridinyl, pyrimidinyl, benzo[d][1 ,3]dioxolyl (e.g., benzo[d][1 ,3]dioxol-4-yl), 2,3-dihydrobenzo[b][1 ,4]dioxinyl (e
- Embodiment 43 provides the compound of any of embodiments 1-39, wherein ring B represents phenyl optionally substituted with one or more R 4 ; or wherein ring B represents phenyl optionally substituted with one R 4 .
- Embodiment 44 provides the compound of any of embodiments 1-43, wherein each R 4 is independently selected from halogen, C C 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(C C 6 alkyl), -N(C C 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), amino(CrC 6 alkyl), -S0 2 R 7 , -S0 2 0R 7 , -S0 2 N(R 7 ) 2 , cyclopropylethynyl, aryl optionally substituted with one or more R 6 , heteroaryl optionally substituted with one or more R 6 , heterocyclyl optionally substituted with one or more R
- Embodiment 45 provides the compound of any of embodiments 1-43, wherein each R 4 is independently selected from halogen, CrC 6 alkyl optionally substituted with one or more R 5 , C C 6 haloalkyl, -NH 2 , -NH(C C 6 alkyl), -N(C C 6 alkyl) 2 , -OH, C C 6 alkoxy, C C 6 haloalkoxy, hydroxy(CrC 6 alkyl), hydroxy(CrC 6 alkoxy), alkoxy(CrC 6 alkyl), alkoxy(CrC 6 alkoxy), -S0 2 R 7 , cyclopropylethynyl, heteroaryl optionally substituted with one or more R 6 , heterocyclyl optionally substituted with one or more R 6 , C 3 -C 8 cycloalkyl optionally substituted with one or more R 6 , heterocyclyloxy optionally substituted with one or more R 6 , 2-hydroxy-3
- Embodiment 47 provides the compound of any of embodiments 1-43, wherein each R 4 is independently selected from halogen, C C 6 alkyl, C C 6 haloalkyl, -OH, C C 6 alkoxy, C C 6 haloalkoxy, -SO2R7, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with R 6 , and cyclopropyl.
- Embodiment 48 provides the compound of any of embodiments 1-43, wherein each R 4 is independently selected from halogen, C C 6 alkyl, -OH, C C 6 alkoxy, -SO2R7, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with R 6 , and cyclopropyl.
- Embodiment 49 provides the compound of any of embodiments 1-43, wherein each R 4 is independently selected from halogen, C C 6 alkyl, -OH, C C 6 alkoxy,
- each R 4 is independently selected from halogen, -OH, and CrC 6 alkoxy.
- Embodiment 50 provides the compound of any of embodiments 1-43, wherein each R 4 is independently selected from halogen, methyl, -OH, methoxy, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with methyl, and cyclopropyl; or wherein each R 4 is independently selected from halogen, methyl, -OH, and methoxy.
- Embodiment 51 provides the compound of any of embodiments 1-43, wherein each R 4 is independently halogen.
- Embodiment 52 provides the compound of any of embodiments 1-35, wherein ring B represents phenyl substituted with halogen (e.g., chloro or fluoro).
- halogen e.g., chloro or fluoro
- Embodiment 53 provides the compound of any of embodiments 1-35, wherein ring B represents 2-chlorophenyl.
- Embodiment 54 provides the compound of embodiment 1 , which is selected from any of Examples 1 - 23, or a pharmaceutically acceptable salt thereof.
- Embodiment 55 provides a pharmaceutical composition comprising a compound according to any one of embodiments 1-54 and a pharmaceutically acceptable carrier, solvent, adjuvant or diluent.
- Embodiment 56 provides a method of treating neurological disorder, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
- Embodiment 57 provides the method of embodiment 56, wherein the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post-infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies, optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age-associated myelin deficiency, Alzheimer’s Disease, and acquired and inherited neuropathies in the peripheral nervous system.
- the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post-infectious encephalomyelitis, chronic inflammatory
- Embodiment 58 provides the method of embodiment 56, wherein the neurological disorder is Multiple Sclerosis.
- Embodiment 59 provides the method of embodiment 56, wherein the neurological disorder is Alzheimer’s Disease.
- Embodiment 60 provides a method of treating a non-CNS disease, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
- Embodiment 61 provides the method of embodiment 60, wherein the non-CNS disease is cancer.
- Embodiment 62 provides the method of embodiment 61 , wherein the cancer is characterized by elevated Gli1.
- Embodiment 63 provides the method of embodiment 61 , wherein the cancer is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
- the cancer is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma
- Embodiment 64 provides the method of embodiment 60, wherein the non-CNS disease is cystic kidney disease, chronic liver disease, Hepatitis, C, obstructive pulmonary disease, organ fibrosis, or rheumatoid arthritis.
- Embodiment 65 provides a method of inhibiting GN1 , the method comprising administering one or more compounds according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
- Embodiment 66 provides a method for enhancing remeyelination, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
This disclosure relates to compounds (I), pharmaceutical compositions comprising them, and methods of using the compounds and compositions for treating diseases related to glioma-associated oncogene (Gli) expression. More particularly, this disclosure relates to bicyclic compounds and pharmaceutical compositions thereof, methods of inhibiting Gli expression with these compounds, and methods of treating diseases related to Gli expression.
Description
INHIBITORS OF GLI1 AS THERAPEUTIC AGENTS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 62/769,513, filed November 19, 2018, all of which is incorporated by reference in its entirety.
BACKGROUND OF DISCLOSURE
Field of Disclosure
[0002] This disclosure relates to compounds, pharmaceutical compositions comprising them, and methods of using the compounds and compositions for treating diseases related to glioma-associated oncogene (Gli) expression. More particularly, this disclosure relates to bicyclic compounds and pharmaceutical compositions thereof, methods of inhibiting Gli expression with these compounds, and methods of treating diseases related to Gli expression.
Technical Background
[0003] Hedgehog (Hh) signaling pathway plays a critical role in the initiation, proliferation, invasion, and metastasis of a wide variety of cancers. The Hh pathway is also implicated in the regulation and maintenance of cancer stem cells (CSCs), providing a link between the Hh signaling in the regulation of normal stem cells and its role in CSCs maintenance.
[0004] More recently, the involvement of Smo and Gli was also addressed in the context of myelin regeneration. Disorders of myelination can produce significant impairment in sensory, motor and other types of functioning when nerve signals reach their targets slowly, asynchronously, intermittently, or not at all. Disorders of myelination are also associated with progressive loss of the axons which further contributes to neurological impairment. Disorders of myelination can be demyelinating, as a result of removal or degradation of myelin already formed; or dysmyelinating, as a result of deficient or defective myelin development or maintenance. Many disorders affect both central nervous system (CNS) and peripheral nervous system (PNS) myelin. Included among the more common disorders of CNS myelination are multiple sclerosis (MS) and the leukodystrophies, and among disorders of PNS myelination are the Guillain Barre Syndrome, and the Charcot Marie Tooth inherited peripheral neuropathies.
[0005] Hh signaling is initiated by the binding of ligand namely Sonic Hedgehog (Shh),
Indian Hedgehog (Ihh) or Desert Hedgehog (Dhh) to its receptor, Patched (Ptch). Canonical Shh signaling is mediated by interactions of the Ptch with the G-protein coupled
transmembrane co-receptor smoothened (Smo). Binding of Shh to Ptch relieves its inhibition of Smo and thereby activates the Gli family of proteins (also known as zinc finger transcription factors).
[0006] Vertebrates have at least three distinct Gli proteins, GN1 , GN2, and GN3 (glioma- associated oncogene 1 , 2, and 3). Gli proteins participate in the final step of the Hh/Gli signaling pathway, and they regulate several genes, including those that are related to cell cycle control and Hh/Gli signaling. GN1 acts as a transcriptional activator, whereas GN2 and GN3 act as both activators and repressors. The proteins in Gli family share a highly conserved C2-H2 zinc finger domain (having five zinc finger DNA-binding motifs) and recognize consensus Gli-selective sequences that regulate transcription. Of the three Gli proteins, GN1 expression is considered a sensitive readout for, and an indicator of the highest levels of Shh signaling.
SUMMARY OF THE DISCLOSURE
[0007] The disclosure provides novel Gli inhibitors useful for treating diseases related to Gli expression. Thus, one aspect of the disclosure provides a compound of formula (I):
or a pharmaceutically acceptable salt thereof, wherein
m is an integer 1 or 2;
n is an integer 1 or 2;
p is an integer 0, 1 , or 2;
R is -OH, -0(C C6 alkyl), -SH, -S(C C6 alkyl), -NH2, -NH(C C6 alkyl), or -N(C C6 alkyl)2;
Ri is selected from hydrogen, CrC6 alkyl, CrC6 haloalkyl, C3-C8 cycloalkyl, heterocyclyl, hydroxy(C C6 alkyl), alkoxy(CrC6 alkyl), -OH, and oxetanyl;
R2 is C C6 alkyl;
ring A represents an aryl optionally substituted with one or more R3, heteroaryl optionally substituted with one or more R3, or C4-C8 cycloalkyl optionally substituted with one or more R3; and
ring B represents an aryl optionally substituted with one or more R4, heteroaryl optionally substituted with one or more R4, heterocyclyl optionally substituted with one or more R4, or C4-C8 cycloalkyl optionally substituted with one or more R4;
wherein
each R3 is independently selected from halogen, -N02, -CN, C C6 alkyl optionally
substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CI-C6 alkyl), -N(CI-C6
alkyl)2, -OH, CrC6 alkoxy, CrC6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(C C6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -CONH2, -CONH(Ci-Ce alkyl), -CON(C C6 alkyl)2, -CONH-OH, -C02H, -C02(C C6 alkyl), -S02R7, -S020R7, -S02N(R7)2, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, and C3-C8 cycloalkyl optionally substituted with one or more R6;
each R4 is independently selected from halogen, -N02, -CN, C C6 alkyl optionally
substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CrC6 alkyl), -N(CrC6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(C C6 alkyl), -CONH2, -CONH(CI-C6 alkyl), -CON(C C6 alkyl)2, -CONH-OH, -C02H, -C02(C C6
alkyl), -S02R7, -S020R7, -S02N(R7)2, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, C3-C8 cycloalkyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, cycloalkyloxy optionally substituted with one or more R6, 2-hydroxy-3- methoxypropoxy, (2-methoxyethoxy) methyl, and 2-(3-(but-3-yn-1-yl)-3H-diazirin-3- yl)ethoxy; or two R4 groups when attached to the same carbon atom form =0;
each R5 is independently selected from the group consisting of halogen, -N02, -CN, C C6 alkyl, CrC6 haloalkyl, -OH, CrC6 alkoxy, CrC6 haloalkoxy, hydroxy(CrC6 alkoxy), alkoxy(C C6 alkoxy), -S02R7, -S020R7, and -S02N(R7)2;
each R6 is independently selected from the group consisting of halogen, -N02, -CN, C C6 alkyl, C C6 haloalkyl, -OH, C C6 alkoxy, and C C6 haloalkoxy; and
each R7 is independently selected from the group consisting of hydrogen, C C6 alkyl, phenyl, or tolyl.
[0008] In certain embodiments of this aspect, the compounds of formula (I) exclude:
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
5-(diethylamino)-2-(5-(2-hydroxy-2-(4-methoxyphenyl)ethyl)-1 -methyl-4, 5,6, 7-tetrahydro-1 H- imidazo[4,5-c]pyridin-2-yl)phenol;
1-(4-bromophenyl)-2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol; or
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)-1-(4- methoxyphenyl)ethan-1-ol.
[0009] Another aspect of the disclosure provides a pharmaceutical composition including one or more compounds of the disclosure as described herein (e.g., compounds of formula (I)) and a pharmaceutically acceptable carrier, solvent, adjuvant or diluent.
[0010] Another aspect of the disclosure provides a method of treating a neurological disorder, the method including administering to a subject in need of such treatment one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
[0011] In certain embodiments of this aspect, the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post- infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies, optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age-associated myelin deficiency, Alzheimer’s Disease, and acquired and inherited neuropathies in the peripheral nervous system. In certain embodiments of this aspect, the neurological disorder is multiple sclerosis. In certain embodiments of this aspect, the neurological disorder is Alzheimer’s Disease.
[0012] Another aspect of the disclosure provides a method of treating a non-CNS disease, the method including administering to a subject in need of such treatment one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
[0013] In certain embodiments of this aspect, the non-CNS disease is cancer. In certain embodiments, the cancer is characterized by elevated GN1. In certain embodiments, the cancer is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
[0014] In certain embodiments of this aspect, the non-CNS disease is cystic kidney disease, chronic liver disease, Hepatitis, C, obstructive pulmonary disease, organ fibrosis (including, e.g., kidney fibrosis, cardiac fibrosis, and pulmonary fibrosis), or rheumatoid arthritis.
[0015] Another aspect of the disclosure provides a method of inhibiting GN1 , the method including administering one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
[0016] Another aspect of the disclosure provides a method of enhancing remeyelination, the method including administering one or more compounds of the disclosure as described herein or a pharmaceutical composition of the disclosure as described herein.
DETAILED DESCRIPTION
[0017] Before the disclosed processes and materials are described, it is to be understood that the aspects described herein are not limited to specific embodiments, and as such can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting.
[0018] In view of the present disclosure, the methods and compositions described herein can be configured by the person of ordinary skill in the art to meet the desired need. In general, the disclosed materials and methods provide improvements in treatment of diseases or disorders associated with GN1 and/or GN2 expression. Specifically, the inventors found that the compounds of the disclosure inhibit GN1 and/or GN2 with low-mM and sub-mM IC50. For example, in certain embodiments, the compounds of the disclosure inhibit GN1 and/or GN2 at IC50 of no more than 10 pM, or no more than 1 pM, or no more than 100 nM, or even no more than 10 nM.
[0019] Accordingly, one aspect of the disclosure provides compounds of formula (I) as provided above.
[0020] In certain embodiments of this aspect, the compounds of formula (I) exclude:
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
5-(diethylamino)-2-(5-(2-hydroxy-2-(4-methoxyphenyl)ethyl)-1 -methyl-4, 5,6, 7-tetrahydro-1 H- imidazo[4,5-c]pyridin-2-yl)phenol;
1-(4-bromophenyl)-2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol; or
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)-1-(4- methoxyphenyl)ethan-1-ol.
[0021] One of skill in the art recognizes that the compounds of formula (I) exist in the isomer form (1-1) and (I-2):
[0022] In some embodiments, the compounds of formula (I) as otherwise described herein are those of isomer form (1-1).
[0023] In some embodiments, the compounds of formula (I) as otherwise described herein are those of isomer form (1-2).
[0024] In some embodiments, the compounds of formula (I) as otherwise described herein are those wherein m is 2. In one embodiment, the disclosure provides compounds of formula (I) as otherwise described herein where m is 2, and n is 1 , e.g., the compounds of formula (I-3):
(i-3).
In some embodiments, the compounds of formula (I-3) as otherwise described herein are those of isomer form (I-4).
(i-4).
In some embodiments, the compounds of formula (I-3) as otherwise described herein are those of isomer form (I-5).
[0025] In one embodiment, the disclosure provides compounds of formula (I) as otherwise described herein where both m and n are 2, e.g., the compounds of formula (I-6):
(R2)P Ri
[0026] In some embodiments, the compounds of formula (I) as otherwise described herein are those wherein m is 1. In one embodiment, the disclosure provides compounds of
formula (I) as otherwise described herein where both m and n are 1. Such compounds are of formula (I-7):
[0027] Another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where p is 0.
[0028] In certain embodiments of the disclosure, the compounds of formula (l)-(l-7) as otherwise described herein are those wherein p is 1 or 2. In one embodiment, p is 1. In another embodiment p is 2. In one embodiment, the disclosure provides compounds as otherwise described herein where R2 is C C3 alkyl. In another embodiment, R2 is ethyl or methyl. In another embodiment, R2 is methyl.
[0029] Another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where R is -OH, -0(CrC3 alkyl), -SH, -S(C C3 alkyl), -NH2, -NH(CrC3 alkyl), or -N(C C3 alkyl)2. In certain embodiments, R is -OH, -0(CH3), -SH, -S(CH3), -NH2, -NH(CH3), or -N(CH3)2. In certain embodiments, R is -OH, -0(C C3 alkyl), -SH, or -S(C C3 alkyl). In certain embodiments, R is -OH, -0(CH3), -SH, or -S(CH3).
In certain embodiments, R is -OH, -SH, or -NH2. In certain embodiments, R is -OH or -SH.
[0030] Another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where R is -OH, -0(CrC6 alkyl), -NH2, -NH(CrC6 alkyl), or -N(CrC6 alkyl)2. In certain embodiments, R is -OH, -0(CH3), -NH2, or -NH(CH3). In certain embodiments, R is -OH or -NH2. In certain embodiments, R is -OH or -0(CH3).
[0031] In certain embodiments of the disclosure, the compounds of formula (l)-(l-7) as otherwise described herein are those wherein R is -OH.
[0032] Another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where R^ is selected from hydrogen, C C3 alkyl, C C3 haloalkyl, C3-C6 cycloalkyl, heterocyclyl, hydroxy(CrC3 alkyl), alkoxy(CrC3 alkyl), -OH, and oxetanyl. Yet another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where R^ is selected from hydrogen, C C6 alkyl, C C6 haloalkyl, C3-C8 cycloalkyl, heterocyclyl, hydroxy(CrC6 alkyl), -OH, and oxetanyl. In certain
embodiments of the disclosure, R^ is hydrogen or C C6 alkyl. In certain embodiments of the disclosure, R^ is hydrogen or C C4 alkyl. In certain embodiments of the disclosure, R^ is hydrogen or C C3 alkyl. In certain embodiments of the disclosure, R^ is hydrogen, methyl, or ethyl. In certain embodiments of the disclosure, R^ is hydrogen or methyl. In certain
embodiments of the disclosure, is hydrogen. In certain embodiments of the disclosure,
Ri is methyl. In certain embodiments of the disclosure,
is hydrogen, methyl, trifluoroethyl, hydroxyethyl, -OH, and oxetanyl. In certain embodiments of the disclosure,
is hydrogen, C C3 alkyl, CrC3 haloalkyl, hydroxy(C C3 alkyl), -OH, and oxetanyl.
[0033] One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents an aryl optionally substituted with one or more R3 or heteroaryl optionally substituted with one or more R3.
[0034] In certain embodiments of the disclosure, the compounds of formula (l)-(l-7) as otherwise described herein are those where ring A represents phenyl optionally substituted with one or more R3 or 6-membered heteroaryl optionally substituted with one or more R3.
[0035] One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl optionally substituted with one or more R3 or pyridinyl optionally substituted with one or more R3.
[0036] In certain embodiments of the disclosure, the compounds of formula (l)-(l-7) as otherwise described herein are those where ring A represents phenyl optionally substituted with one or more R3. In certain embodiments of the disclosure, ring A represents phenyl substituted with one or more R3. In certain embodiments of the disclosure, ring A represents phenyl optionally substituted with one R3.
[0037] One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl substituted with one R3.
[0038] One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl substituted with halogen (e.g., chloro or fluoro).
[0039] One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents 2-chlorophenyl.
[0040] Another embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring A represents phenyl (i.e. , unsubstituted phenyl).
[0041] In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R3 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CrC6 alkyl), -N(CrC6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -S02R7, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, and C3-C8 cycloalkyl
optionally substituted with one or more R6. In certain embodiments of the disclosure, each R3 is independently selected from halogen, CrC6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CI-C6 alkyl), -N(CI-C6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(C C6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -S02R7, cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C3-C8 cycloalkyl. In certain embodiments of the disclosure, each R3 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(C C6 alkyl), -S02R7, cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C3-C8 cycloalkyl. In certain embodiments of the disclosure, each R3 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CrC6 alkyl), -N(CrC6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, -S02R7, cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C3-C8 cycloalkyl. In certain embodiments of the disclosure, each R3 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -OH, CrC6 alkoxy, CrC6 haloalkoxy, -S02R7, cyclopropylethynyl, and heteroaryl. In certain embodiments of the disclosure, each R3 is independently selected from halogen, C C6 alkoxy, -S02R7, cyclopropylethynyl, and heteroaryl. In certain embodiments of the disclosure, each R3 is independently selected from halogen, CrC6 alkoxy, cyclopropylethynyl, and heteroaryl. In certain embodiments of the disclosure, each R3 is independently selected from halogen, CrC6 alkoxy, and cyclopropylethynyl. In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R3 is independently halogen.
[0042] In some embodiments, the compounds of formula (I) as otherwise described herein are those wherein m is 2, n is 1 , p is 0, and ring A represents 2-chlorophenyl. Such compounds are of formula (I-8), (I-9), or (1-10):
[0043] Another embodiment of the disclosure provides compounds of formula (l)-(l-10) as otherwise described herein where ring B represents an aryl optionally substituted with one or more R4, heteroaryl optionally substituted with one or more R4, or heterocyclyl optionally substituted with one or more R4. In some embodiments of the disclosure, ring B represents an aryl optionally substituted with one or more R4 or heteroaryl optionally substituted with one or more R4, heterocyclyl optionally substituted with one or more R4. In certain embodiments of the disclosure, ring B represents phenyl, pyridinyl, pyrimidinyl,
benzo[c][1 ,3]dioxolyl (e.g., benzo[c][1 ,3]dioxol-4-yl), 2,3-dihydrobenzo[b][1 ,4]dioxinyl (e.g., 2,3-dihydrobenzo[b][1 ,4]dioxin-5-yl), each optionally substituted with one or more R4. In some embodiments of the disclosure, ring B represents phenyl optionally substituted with one or more R4. In some embodiments of the disclosure, ring B represents phenyl optionally substituted with one R4.
[0044] In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R4 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CrC6 alkyl), -N(CrC6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(C C6 alkyl), alkoxy(C C6 alkoxy), amino(CrC6 alkyl), -S02R7, -S020R7, -S02N(R7)2, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, C3- C8 cycloalkyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, cycloalkyloxy optionally substituted with one or more R6, 2- hydroxy-3-methoxypropoxy, and (2-methoxyethoxy) methyl; or two R4 groups when attached to the same carbon atom form =0. In certain embodiments of the disclosure, each R4 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CI-C6 alkyl), -N(CI-C6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), -S02R7, cyclopropylethynyl, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, C3-C8 cycloalkyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, 2-hydroxy-3-methoxypropoxy, and (2-methoxyethoxy)methyl; or two R4 groups when attached to the same carbon atom form =0. In certain embodiments of the disclosure, each R4 is independently selected from halogen, C C6 alkyl, C C6 haloalkyl, -OH, C C6 alkoxy,
Ci-C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(C C6 alkoxy), -SO2R7, cyclopropylethynyl, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, 2-hydroxy-3-methoxypropoxy, and (2- methoxyethoxy)methyl; or two R4 groups when attached to the same carbon atom form =0. In certain embodiments of the disclosure, each R4 is independently selected from halogen, C C6 alkyl, C C6 haloalkyl, -OH, C C6 alkoxy, C C6 haloalkoxy, -SO2R7,
cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with R6, and cyclopropyl. In certain embodiments of the disclosure, each R4 is independently selected from halogen, C C6 alkyl, -OH, C C6 alkoxy, -SO2R7, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with R6, and cyclopropyl. In some embodiments of the disclosure, each R4 is independently selected from halogen, C C6 alkyl, -OH, C C6 alkoxy, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with methyl, and cyclopropyl. In certain embodiments of the disclosure, each R4 is independently selected from halogen, -OH, and C C6 alkoxy. In some embodiments of the disclosure, each R4 is independently selected from halogen, methyl, -OH, methoxy, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with methyl, and cyclopropyl. In certain embodiments of the disclosure, each R4 is independently selected from halogen, methyl, -OH, and methoxy. In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R4 is independently halogen. In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R4 is independently chloro or fluoro. In certain embodiments of the disclosure, the compounds as otherwise described herein are those wherein each R4 is independently chloro.
[0045] One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring B represents phenyl substituted with halogen (e.g., chloro or fluoro).
[0046] One embodiment of the disclosure provides compounds of formula (l)-(l-7) as otherwise described herein where ring B represents 2-chlorophenyl.
Therapeutics Applications
[0047] There is a great need in the art to develop novel therapeutics for the treatment of neurological disorders characterized by myelin loss or myelin deficiency. The present disclosure satisfies this and other needs by providing a novel method for enhancing remyelination and neuroprotection.
[0048] Thus, in one aspect, the disclosure provides a method of inhibiting Gli1. Another aspect of the disclosure provides a method for enhancing remyelination in a subject. In a
related aspect, the disclosure provides a method for enhancing neuroprotection of a central nervous system (CNS) or peripheral nervous system (PNS) neuron in a subject. Such methods include administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e. , compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein. In one embodiment, the subject has a neurological disorder characterized by myelin loss or myelin deficiency.
[0049] As used herein, the term "remyelination" refers to the generation of new myelin sheaths. Remyelination can be monitored by methods which include direct determination of the state of myelin in the subject, e.g., one can measure white matter mass using magnetic resonance imaging (MRI), measure the thickness of myelin fibers using a magnetic resonance spectroscopy (MRS) brain scan, or any other direct measures known in the art (e.g., Positron-Emission Tomography (PET), Diffusion-Weighted Imaging (DW-I, or DW- MRI), Diffusion Tensor Imaging, Magnetization Transfer, etc.). Treatment effectiveness can be also monitored by improvements in physiological parameters (such as visual evoked response (VER), brainstem auditory evoked response (BAER), and somatosensory evoked potential (SSEP))and a positive change in neuropsychology (e.g., the status of various abilities such as memory, arithmetic, attention, judgment and reasoning). Certain tests for color blindness can also be helpful in tracking the treatment of demyelinating disorders on the eyes. Whitaker ei al. (1995) Ann. Neurol. 38(4):635-632.
[0050] The disclosure also provides methods of treating a neurological disorder. Such method includes administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e., compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein. In one embodiment, the neurological disorder is characterized by myelin loss or myelin deficiency.
[0051] As used herein, the term "neurological disorder characterized by myelin loss or myelin deficiency" encompasses any disease associated with the destruction or removal of myelin, the fatty sheath surrounding and insulating nerve fibers, from nerves. Non-limiting examples of such disorders include, but are not limited to, multiple sclerosis (MS) (e.g., relapsing/remitting multiple sclerosis, secondary progressive multiple sclerosis, progressive relapsing multiple sclerosis, primary progressive multiple sclerosis, and acute fulminant multiple sclerosis), central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post- infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies (e.g., metachromatic
leukodystrophy, Krabbe disease, adrenoleukodystrophy, Pelizaeus-Merzbacher disease,
Canavan disease, childhood ataxia with central hypomyelination, Alexander disease, or refsum disease), optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age- associated myelin deficiency, Alzheimer’s Disease, as well as acquired and inherited neuropathies in the peripheral nervous system (e.g., Guillain-Barre syndrome and Charcot Marie Tooth disease).
[0052] In certain embodiments of this aspect, the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post- infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies, optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age-associated myelin deficiency, Alzheimer’s Disease, and acquired and inherited neuropathies in the peripheral nervous system. In certain embodiments of this aspect, the neurological disorder is multiple sclerosis. In certain embodiments of this aspect, the neurological disorder is Alzheimer’s Disease.
[0053] The disclosure also provides methods of treating a non-CNS disease. Such method includes administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e. , compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein.
[0054] In certain embodiments, the non-CNS disease is cancer. Many different cancers can be treated with compounds and compositions of the disclosure. In certain embodiments, the cancer is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
[0055] In some embodiments, a particularly suitable cancer is a solid tumor. Examples of solid tumors include, but are not limited to, carcinomas, sarcomas, and astrocytomas. In certain embodiments, the cancer is breast cancer, prostate cancer, lung cancer (e.g., small cell lung carcinoma (SCLC) and non-small-cell lung carcinoma (NSCLC)), gastric cancer, colorectal cancer, cervical cancer, endometrial cancer, ovarian cancer, skin cancer (e.g., basal-cell skin cancer (BCC), squamous-cell skin cancer (SCC), and melanoma), pancreatic cancer, kidney cancer, adrenal gland cancer, sarcoma, thyroid cancer, cholangiocarcinoma, glioblastoma, astrocytoma, oligodendroglioma, high-grade glioma, malignant glioma, glioma, neuroblastoma, medulloblastoma, leukemia or lymphoma. Suitable cancers also include a hematological malignancy, such as leukemia or lymphoma. In certain embodiments, the
cancer is acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute
lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), or lymphoma.
[0056] In certain embodiments, the cancer is characterized by elevated Gli1. In certain embodiments, compounds and compositions of the invention are used to treat a cancer that is characterized by elevated Gli1. In certain embodiments, the cancer with elevated GN1 is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, leukemia, basal-cell carcinoma, glioblastoma, medulloblastoma, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
[0057] In certain embodiments, the non-CNS disease is cystic kidney disease, chronic liver disease, Hepatitis, C, obstructive pulmonary disease, organ fibrosis (including, e.g., kidney fibrosis, cardiac fibrosis, and pulmonary fibrosis), or rheumatoid arthritis.
[0058] In some embodiments of the methods of the disclosure, at least a 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%) improvement in one or more symptoms of the disease or disorder of the disclosure as described herein is sufficient to classify the subject as responding to the method of treatment.
[0059] The compounds and compositions of the disclosure as described herein may also be administered in combination with one or more secondary therapeutic agents. Thus, in certain embodiment, the method also includes administering to a subject in need of such treatment an effective amount of one or more compounds of the disclosure as described herein (i.e. , compounds of formula (I)) or a pharmaceutical composition of the disclosure as described herein and one or more secondary therapeutic agents.
[0060] In certain embodiments, the secondary therapeutic agent is a Gli 1 inhibitor.
Examples of the GN1 inhibitors suitable for use as secondary agents include, but are not limited to, GANT61 , GANT58, genistein, epigallocatechin gallate (EGCG), zerumbone, zerumbone epoxide, staurosporinone, 6-hydroxystaurosporinone, arcyriaflavin C, 5,6- dihydroxyarcyriaflavin A, physalin F, physalin B, NMDA298-1 , JK184, HPI-1 , HPI-4, HPI-3, HPI-4, arsenic trioxide, polyunsaturated fatty acid (such as arachidonic acid), or a siRNA (e.g., siRNA having the sequence selected from the group consisting of
GUCAUUAUCAAAUUUCUCCTT (SEQ ID NO: 1); AGAAGAAAAGAGUGGGCCCTT (SEQ ID NO: 2); UCCGGUGUUUUCUUCAUCCTT (SEQ ID NO: 3); GAGAU CUUCC CUUCA UACCTT (SEQ ID NO: 4), and AACUCCACAGGCAUACAGGAU (SEQ ID NO: 5)). In certain embodiments, the secondary therapeutic agent may be a GM1 -binding protein such as kinesin-like protein KIF7, together with serine/threonine-protein kinase (STK3649) or
ZIC1. In certain embodiments, the secondary therapeutic agent may be an inhibitor for a different pathway or molecular target, such as BEZ235 (PI3K/mTOR dual inhibitor), LY294002 (PI3K inhibitor) or U0126 (MEK1/2 inhibitor). In certain embodiments, the secondary therapeutic agent may be any one of those described in Lung Cancer. Targets and Therapy (2018) 9: 35-43 (incorporated by reference herein).
[0061] In certain embodiments, the secondary therapeutic agent is an agent that facilitates brain delivery. Non-limiting examples of such agents include, e.g., an implantable reservoir (Omaya reservoir), functionalized nanocarriers (e.g., nanoparticles coated with transferrin or transferrin receptor [TR] antibodies) and liposomes (e.g., liposomes coated with targeting molecules such as antibodies, Trojan Horses Liposomes [TELL]), antibodies (e.g., antibodies against transferrin receptor [TR] and insulin receptor [HIR], BBB transmigrating Llama single domain antibodies (sdAb)), chimeric peptides (e.g., Angiopeps derived from proteins expressing the Kunitz domain), low-density lipoprotein receptor related proteins 1 and 2 (LRP-1 and 2), diphtheria toxin receptor (DTR), mesenchyme stem cells, etc.
[0062] In certain embodiments, the secondary therapeutic agent is an agent that limits demyelination or enhances remyelination. Some examples include, but are not limited to, Interferon Beta I a (Avonex), Interferon Beta lb (Rebif), glatiramer acetate (Copaxone), mitoxantrone (Novantrone), azathiprine (Imuran), cyclophosphamide (Cytoxan or Neosar), cyclosporine (Sandimmune), ampyra, dimethyl fumarate (BG12), fmgolimod, methotrexate, Cladribine (Leustatin), methylprednisone (Depo-Medrol or Solu-Medrol), prednisone (Deltasone), prednisolone (Delta-Cortef), dexamethasone (Medrol or Decadron), adreno- corticotrophic hormone (ACTH), Corticotropin (Acthar), anti-integrin specific antibodies, Cytoxan, naltrexone, and the like. Other examples include anti-muscarinic agents, anti- Li NGO therapies, axin/Wnt pathway inhibitors, and agonists for RXR transcription factors (such as 9-cis-retinoic acid).
[0063] In certain embodiments, the secondary therapeutic agent is an agent that causes upregulation and/or increases activity of GN2 and/or GN3. Some examples include, but are not limited to, Shh agonists and Protein Kinase A inhibitors (PKA inhibitors). Specific examples of useful Shh agonists and PKA inhibitors are provided, for example, in U.S. Patents Nos. 6,767,888 and 6,683,192, incorporated by reference herein. PKA inhibitors may be purchased from commercial sources, such as Enzo Life Sciences (Farmingdale).
[0064] In certain embodiments, the secondary therapeutic agent is an agonist of Smo Examples of useful Smo agonists include, for example, A/-methyl-A/'-(3-pyridinylbenzyl)-/\/'- (3-chlorobenzo[b]thiophene-2-carbonyl)-1 ,4-diaminocyclohexane (SAG), and those disclosed in International Patent Publication WO 2003/027234, PNAS (2002) 99(22):14071-
14076, and/or Journal of Biology (2002) 1 :10 (all incorporated by reference herein). In some embodiments, agonists of Smo cause upregulation and/or activity of GN2 and/or GN3. In some embodiments, agonists of Smo limit demyelination or enhance remyelination.
[0065] In certain embodiments, the secondary therapeutic agent is an antagonist of Smo. Non-limiting examples of Smo antagonists include, for example, cyclopamine, derivatives of cyclopamine, sonidegib, derivatives of sonidegib, vismodegib, and derivatives of vismodegib, and those described in Future Medicinal Chemistry (2019)11 (6): 489-638 (incorporated by reference herein). In some embodiments, antagonists of Smo can be used to treat cancer.
[0066] In certain embodiments, the secondary therapeutic agent maye be a gene editing agent. Suitable examples of gene editing agents include, but are not limited to, CRISPR (e.g., an RNA guide strand with an endonuclease that may be, but is not limited to a type I CRISPR endonuclease, a type II CRISPR endonuclease, a type III CRISPR endonuclease, a type IV CRISPR endonuclease, a type V CRISPR endonuclease, a type VI CRISPR endonuclease, CRISPR associated protein 9 (Cas9), Cpf1 , CasX or CasY), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), a NgAgo-based system, and meganucelases.
[0067] In certain embodiments, the secondary therapeutic agent is an anti-proliferative agent. Examples of suitable secondary therapeutic agents include, but are not limited to, temozolomide, camptothecin, doxorubicin, daunorubicin, vincristine, paclitaxel,
neocarzinostatin, calicheamicin, cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, lurtotecan, annamycin, docetaxel, tamoxifen, epirubicin, methotrexate, vinblastin, vincristin, topotecan, prednisone, prednisolone, chloroquine, hydroxychloroquine, autophagy inhibitors, and abt-737.
[0068] When administered as a combination, the compounds and compositions of the disclosure as described herein and the secondary therapeutic agents can be formulated as separate compositions that are given simultaneously or sequentially, or the therapeutic agents can be given as a single composition. In certain embodiments, the secondary therapeutic agent may be administered in an amount below its established half maximal inhibitory concentration (IC50). For example, the secondary therapeutic agent may be administered in an amount less than 1% of, e.g., less than 10%, or less than 25%, or less than 50%, or less than 75%, or even less than 90% of the inhibitory concentration (IC50).
Pharmaceutical Compositions
[0069] In another aspect, the present disclosure provides compositions comprising one or more of compounds as described above with respect to formula (I) and an appropriate carrier, solvent, adjuvant, or diluent. The exact nature of the carrier, solvent, adjuvant, or
diluent will depend upon the desired use for the composition, and may range from being suitable or acceptable for veterinary uses to being suitable or acceptable for human use. The composition may optionally include one or more secondary therapeutic agents. In certain embodiments, the composition may include one or more secondary anticancer therapeutic agents.
[0070] When used to treat or prevent such diseases, the compounds described herein may be administered singly, as mixtures of one or more compounds or in mixture or combination with other agents useful for treating such diseases and/or the symptoms associated with such diseases. The compounds may also be administered in mixture or in combination with agents useful to treat other disorders or maladies, such as steroids, membrane stabilizers, 5LO inhibitors, leukotriene synthesis and receptor inhibitors, inhibitors of IgE isotype switching or IgE synthesis, IgG isotype switching or IgG synthesis, b-agonists, tryptase inhibitors, aspirin, COX inhibitors, methotrexate, anti-TNF drugs, retuxin, PD4 inhibitors, p38 inhibitors, PDE4 inhibitors, and antihistamines, to name a few. The compounds may be administered in the form of compounds perse, or as pharmaceutical compositions comprising a compound.
[0071] Pharmaceutical compositions comprising the compound(s) may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making levigating, emulsifying, encapsulating, entrapping or lyophilization processes. The compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the compounds into preparations which can be used pharmaceutically.
[0072] The compounds may be formulated in the pharmaceutical composition per se, or in the form of a hydrate, solvate, N-oxide or pharmaceutically acceptable salt, as previously described. Typically, such salts are more soluble in aqueous solutions than the
corresponding free acids and bases, but salts having lower solubility than the corresponding free acids and bases may also be formed.
[0073] Pharmaceutical compositions may take a form suitable for virtually any mode of administration, including, for example, topical, ocular, oral, buccal, systemic, nasal, injection, transdermal, rectal, vaginal, etc., or a form suitable for administration by inhalation or insufflation.
[0074] For topical administration, the compound(s) may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art. Systemic formulations include those designed for administration by injection, e.g., subcutaneous, intravenous,
intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal oral or pulmonary administration.
[0075] Useful injectable preparations include sterile suspensions, solutions or emulsions of the active compound(s) in aqueous or oily vehicles. The compositions may also contain formulating agents, such as suspending, stabilizing and/or dispersing agent. The
formulations for injection may be presented in unit dosage form, e.g., in ampules or in multidose containers, and may contain added preservatives. Alternatively, the injectable formulation may be provided in powder form for reconstitution with a suitable vehicle, including but not limited to sterile pyrogen free water, buffer, dextrose solution, etc., before use. To this end, the active compound(s) may be dried by any art-known technique, such as lyophilization, and reconstituted prior to use.
[0076] For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are known in the art.
[0077] For oral administration, the pharmaceutical compositions may take the form of, for example, lozenges, tablets or capsules prepared by conventional means with
pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate). The tablets may be coated by methods well known in the art with, for example, sugars, films or enteric coatings.
[0078] Liquid preparations for oral administration may take the form of, for example, elixirs, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, cremophore™ or fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, preservatives, flavoring, coloring and sweetening agents as appropriate.
[0079] Preparations for oral administration may be suitably formulated to give controlled release of the compound, as is well known. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. For rectal and vaginal routes of administration, the compound(s) may be formulated as solutions (for
retention enemas) suppositories or ointments containing conventional suppository bases such as cocoa butter or other glycerides.
[0080] For nasal administration or administration by inhalation or insufflation, the
compound(s) can be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, fluorocarbons, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges for use in an inhaler or insufflator (for example capsules and cartridges comprised of gelatin) may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[0081] For ocular administration, the compound(s) may be formulated as a solution, emulsion, suspension, etc. suitable for administration to the eye. A variety of vehicles suitable for administering compounds to the eye are known in the art.
[0082] For prolonged delivery, the compound(s) can be formulated as a depot preparation for administration by implantation or intramuscular injection. The compound(s) may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, e.g., as a sparingly soluble salt. Alternatively, transdermal delivery systems manufactured as an adhesive disc or patch which slowly releases the compound(s) for percutaneous absorption may be used. To this end, permeation enhancers may be used to facilitate transdermal penetration of the compound(s).
[0083] Alternatively, other pharmaceutical delivery systems may be employed. Liposomes and emulsions are well-known examples of delivery vehicles that may be used to deliver compound(s). Certain organic solvents such as dimethyl sulfoxide (DMSO) may also be employed, although usually at the cost of greater toxicity.
[0084] The pharmaceutical compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the compound(s). The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.
[0085] The compound(s) described herein, or compositions thereof, will generally be used in an amount effective to achieve the intended result, for example in an amount effective to treat or prevent the particular disease being treated. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated and/or eradication or amelioration of one or more of the symptoms associated with the underlying disorder such
that the patient reports an improvement in feeling or condition, notwithstanding that the patient may still be afflicted with the underlying disorder. Therapeutic benefit also generally includes halting or slowing the progression of the disease, regardless of whether improvement is realized.
[0086] The amount of compound(s) administered will depend upon a variety of factors, including, for example, the particular indication being treated, the mode of administration, whether the desired benefit is prophylactic or therapeutic, the severity of the indication being treated and the age and weight of the patient, the bioavailability of the particular
compound(s) the conversation rate and efficiency into active drug compound under the selected route of administration, etc.
[0087] Determination of an effective dosage of compound(s) for a particular use and mode of administration is well within the capabilities of those skilled in the art. Effective dosages may be estimated initially from in vitro activity and metabolism assays. For example, an initial dosage of compound for use in animals may be formulated to achieve a circulating blood or serum concentration of the metabolite active compound that is at or above an IC50 of the particular compound as measured in as in vitro assay. Calculating dosages to achieve such circulating blood or serum concentrations taking into account the bioavailability of the particular compound via the desired route of administration is well within the capabilities of skilled artisans. Initial dosages of compound can also be estimated from in vivo data, such as animal models. Animal models useful for testing the efficacy of the active metabolites to treat or prevent the various diseases described above are well-known in the art. Animal models suitable for testing the bioavailability and/or metabolism of compounds into active metabolites are also well-known. Ordinarily skilled artisans can routinely adapt such information to determine dosages of particular compounds suitable for human
administration.
[0088] Dosage amounts will typically be in the range of from about 0.0001 mg/kg/day, 0.001 mg/kg/day or 0.01 mg/kg/day to about 100 mg/kg/day, but may be higher or lower, depending upon, among other factors, the activity of the active compound, the bioavailability of the compound, its metabolism kinetics and other pharmacokinetic properties, the mode of administration and various other factors, discussed above. Dosage amount and interval may be adjusted individually to provide plasma levels of the compound(s) and/or active metabolite compound(s) which are sufficient to maintain therapeutic or prophylactic effect. For example, the compounds may be administered once per week, several times per week (e.g., every other day), once per day or multiple times per day, depending upon, among other things, the mode of administration, the specific indication being treated and the judgment of the prescribing physician. In cases of local administration or selective uptake,
such as local topical administration, the effective local concentration of co pound(s) and/or active metabolite compound(s) may not be related to plasma concentration. Skilled artisans will be able to optimize effective dosages without undue experimentation.
Definitions
[0089] The following terms and expressions used herein have the indicated meanings.
[0090] Throughout this specification, unless the context requires otherwise, the word “comprise” and“include” and variations (e.g.,“comprises,”“comprising,”“includes,” “including”) will be understood to imply the inclusion of a stated component, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other integer or step or group of integers or steps.
[0091] As used in the specification and the appended claims, the singular forms“a,”“an” and“the” include plural referents unless the context clearly dictates otherwise.
[0092] Terms used herein may be preceded and/or followed by a single dash,
or a double dash,“=“, to indicate the bond order of the bond between the named substituent and its parent moiety; a single dash indicates a single bond and a double dash indicates a double bond. In the absence of a single or double dash it is understood that a single bond is formed between the substituent and its parent moiety; further, substituents are intended to be read“left to right” (i.e. , the attachment is via the last portion of the name) unless a dash indicates otherwise. For example, CrC6alkoxycarbonyloxy and -OC(0)CrC6alkyl indicate the same functionality; similarly arylalkyl and -alkylaryl indicate the same functionality.
[0093] The term“alkenyl” as used herein, means a straight or branched chain hydrocarbon containing from 2 to 10 carbons, unless otherwise specified, and containing at least one carbon-carbon double bond. Representative examples of alkenyl include, but are not limited to, ethenyl, 2-propenyl, 2-methyl-2-propenyl, 3-butenyl, 4-pentenyl, 5-hexenyl, 2-heptenyl, 2- methyl-1-heptenyl, 3-decenyl, and 3,7-dimethylocta-2,6-dienyl.
[0094] The term“alkoxy” as used herein, means an alkyl group, as defined herein, appended to the parent molecular moiety through an oxygen atom. Representative examples of alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, tert-butoxy, pentyloxy, and hexyloxy.
[0095] The term“alkyl” as used herein, means a straight or branched chain hydrocarbon containing from 1 to 10 carbon atoms unless otherwise specified. Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2- dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, and n-decyl. When an“alkyl”
group is a linking group between two other moieties, then it may also be a straight or branched chain; examples include, but are not limited to -CH2-, -CH2CH2-,
-CH2CH2CHC(CH3)-, and -CH2CH(CH2CH3)CH2-.
[0096] The term "alkylene" refers to a bivalent alkyl group. An "alkylene chain" is a polymethylene group, i.e. , -(CH2)n-, wherein n is a positive integer, preferably from one to six, from one to four, from one to three, from one to two, or from two to three. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms is replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group. An alkylene chain also may be substituted at one or more positions with an aliphatic group or a substituted aliphatic group.
[0097] The term“alkynyl” as used herein, means a straight or branched chain hydrocarbon group containing from 2 to 10 carbon atoms and containing at least one carbon-carbon triple bond. Representative examples of alkynyl include, but are not limited, to acetylenyl, 1- propynyl, 2-propynyl, 3-butynyl, 2-pentynyl, and 1-butynyl.
[0098] The term“aryl,” as used herein, means a phenyl (i.e., monocyclic aryl), or a bicyclic ring system containing at least one phenyl ring or an aromatic bicyclic ring containing only carbon atoms in the aromatic bicyclic ring system. The bicyclic aryl can be azulenyl, naphthyl, or a phenyl fused to a monocyclic cycloalkyl, a monocyclic cycloalkenyl, or a monocyclic heterocyclyl. The bicyclic aryl is attached to the parent molecular moiety through any carbon atom contained within the phenyl portion of the bicyclic system, or any carbon atom with the napthyl or azulenyl ring. The fused monocyclic cycloalkyl or monocyclic heterocyclyl portions of the bicyclic aryl are optionally substituted with one or two oxo and/or thioxo groups. Representative examples of the bicyclic aryls include, but are not limited to, azulenyl, naphthyl, dihydroinden-1-yl, dihydroinden-2-yl, dihydroinden-3-yl, dihydroinden-4- yl, 2,3-dihyd roindol-4-yl, 2,3-dihyd roindol-5-yl, 2,3-dihydroindol-6-yl, 2,3-dihydroindol-7-yl, inden-1-yl, inden-2-yl, inden-3-yl, inden-4-yl, dihydronaphthalen-2-yl, dihydronaphthalen-3-yl, dihydronaphthalen-4-yl, dihydronaphthalen-1-yl, 5,6,7,8-tetrahydronaphthalen-1-yl, 5, 6,7,8- tetrahydronaphthalen-2-yl, 2,3-dihydrobenzofuran-4-yl, 2,3-dihydrobenzofuran-5-yl,
2,3-dihydrobenzofuran-6-yl, 2,3-dihydrobenzofuran-7-yl, benzo[c][1 ,3]dioxol-4-yl,
benzo[c][1 ,3]dioxol-5-yl, 2/-/-chromen-2-on-5-yl, 2/-/-chromen-2-on-6-yl, 2/-/-chromen-2-on-7- yl, 2/-/-chromen-2-on-8-yl, isoindoline-1 ,3-dion-4-yl, isoindoline-1 ,3-dion-5-yl, inden-1-on-4-yl, inden-1-on-5-yl, inden-1-on-6-yl, inden-1-on-7-yl, 2,3-dihydrobenzo[b][1 ,4]dioxan-5-yl, 2,3- dihydrobenzo[b][1 ,4]dioxan-6-yl, 2/-/-benzo[b][1 ,4]oxazin3(4H)-on-5-yl, 2 H- benzo[b][1 ,4]oxazin3(4H)-on-6-yl, 2/-/-benzo[b][1 ,4]oxazin3(4H)-on-7-yl, 2 H- benzo[b][1 ,4]oxazin3(4H)-on-8-yl, benzo[c]oxazin-2(3H)-on-5-yl, benzo[c]oxazin-2(3H)-on-6- yl, benzo[c]oxazin-2(3H)-on-7-yl, benzo[c]oxazin-2(3H)-on-8-yl, quinazolin-4(3H)-on-5-yl,
quinazolin-4(3H)-on-6-yl, quinazolin-4(3H)-on-7-yl, quinazolin-4(3H)-on-8-yl, quinoxalin- 2(1 H)-on-5-yl, quinoxalin-2(1 H)-on-6-yl, quinoxalin-2(1 H)-on-7-yl, quinoxalin-2(1 H)-on-8-yl, benzo[d]thiazol-2(3H)-on-4-yl, benzo[c]thiazol-2(3H)-on-5-yl, benzo[c]thiazol-2(3H)-on-6-yl, and, benzo[c]thiazol-2(3H)-on-7-yl. In certain embodiments, the bicyclic aryl is (i) naphthyl a phenyl ring fused to either a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, or a 5 or 6 membered monocyclic heterocyclyl, wherein the fused cycloalkyl, cycloalkenyl, and heterocyclyl groups are optionally substituted with one or two groups which are independently oxo or thioxo.
[0099] The terms“cyano” and“nitrile” as used herein, mean a -CN group.
[0100] The term“cycloalkyl” as used herein, means a monocyclic or a bicyclic cycloalkyl ring system. Monocyclic ring systems are cyclic hydrocarbon groups containing from 3 to 8 carbon atoms, where such groups can be saturated or unsaturated, but not aromatic. In certain embodiments, cycloalkyl groups are fully saturated. Examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl. Bicyclic cycloalkyl ring systems are bridged monocyclic rings or fused bicyclic rings. Bridged monocyclic rings contain a monocyclic cycloalkyl ring where two non-adjacent carbon atoms of the monocyclic ring are linked by an alkylene bridge of between one and three additional carbon atoms (/.e., a bridging group of the form -(CH2)W-, where w is 1 , 2, or 3). Representative examples of bicyclic ring systems include, but are not limited to, bicyclo[3.1.1]heptane, bicyclo[2.2.1]heptane,
bicyclo[2.2.2]octane, bicyclo[3.2.2]nonane, bicyclo[3.3.1]nonane, and bicyclo[4.2.1]nonane. Fused bicyclic cycloalkyl ring systems contain a monocyclic cycloalkyl ring fused to either a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl, or a monocyclic heteroaryl. The bridged or fused bicyclic cycloalkyl is attached to the parent molecular moiety through any carbon atom contained within the monocyclic cycloalkyl ring. Cycloalkyl groups are optionally substituted with one or two groups which are independently oxo or thioxo. In certain embodiments, the fused bicyclic cycloalkyl is a 5 or 6 membered monocyclic cycloalkyl ring fused to either a phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, a 5 or 6 membered monocyclic heterocyclyl, or a 5 or 6 membered monocyclic heteroaryl, wherein the fused bicyclic cycloalkyl is optionally substituted by one or two groups which are independently oxo or thioxo.
[0101] The term“halo” or“halogen” as used herein, means -Cl, -Br, -I or -F.
[0102] The terms "haloalkyl" and "haloalkoxy" refer to an alkyl or alkoxy group, as the case may be, which is substituted with one or more halogen atoms.
[0103] The term“heteroaryl,” as used herein, means a monocyclic heteroaryl or a bicyclic ring system containing at least one heteroaromatic ring. The monocyclic heteroaryl can be a
5 or 6 membered ring. The 5 membered ring consists of two double bonds and one, two, three or four nitrogen atoms and optionally one oxygen or sulfur atom. The 6 membered ring consists of three double bonds and one, two, three or four nitrogen atoms. The 5 or 6 membered heteroaryl is connected to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the heteroaryl. Representative examples of monocyclic heteroaryl include, but are not limited to, furyl, imidazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, oxazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrazolyl, pyrrolyl, tetrazolyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, and triazinyl. The bicyclic heteroaryl consists of a monocyclic heteroaryl fused to a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl, or a monocyclic heteroaryl. The fused cycloalkyl or heterocyclyl portion of the bicyclic heteroaryl group is optionally substituted with one or two groups which are independently oxo or thioxo. When the bicyclic heteroaryl contains a fused cycloalkyl, cycloalkenyl, or heterocyclyl ring, then the bicyclic heteroaryl group is connected to the parent molecular moiety through any carbon or nitrogen atom contained within the monocyclic heteroaryl portion of the bicyclic ring system. When the bicyclic heteroaryl is a monocyclic heteroaryl fused to a benzo ring, then the bicyclic heteroaryl group is connected to the parent molecular moiety through any carbon atom or nitrogen atom within the bicyclic ring system. Representative examples of bicyclic heteroaryl include, but are not limited to, benzimidazolyl, benzofuranyl, benzothienyl, benzoxadiazolyl, benzoxathiadiazolyl, benzothiazolyl, cinnolinyl, 5,6-dihydroquinolin-2-yl, 5,6-dihydroisoquinolin-1-yl, furopyridinyl, indazolyl, indolyl, isoquinolinyl, naphthyridinyl, quinolinyl, purinyl, 5,6,7,8-tetrahydroquinolin- 2-yl, 5,6,7,8-tetrahydroquinolin-3-yl, 5,6,7,8-tetrahydroquinolin-4-yl, 5, 6,7,8- tetrahydroisoquinolin-1-yl, thienopyridinyl, 4,5,6,7-tetrahydrobenzo[c][1 ,2,5]oxadiazolyl, 2,3- dihydrothieno[3,4-b][1 ,4]dioxan-5-yl, and 6,7-dihydrobenzo[c][1 ,2,5]oxadiazol-4(5H)-onyl. In certain embodiments, the fused bicyclic heteroaryl is a 5 or 6 membered monocyclic heteroaryl ring fused to either a phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or
6 membered monocyclic cycloalkenyl, a 5 or 6 membered monocyclic heterocyclyl, or a 5 or 6 membered monocyclic heteroaryl, wherein the fused cycloalkyl, cycloalkenyl, and heterocyclyl groups are optionally substituted with one or two groups which are
independently oxo or thioxo.
[0104] The terms“heterocyclyl” and“heterocycloalkyl” as used herein, mean a monocyclic heterocycle or a bicyclic heterocycle. The monocyclic heterocycle is a 3, 4, 5, 6 or 7 membered ring containing at least one heteroatom independently selected from the group consisting of O, N, and S where the ring is saturated or unsaturated, but not aromatic. The 3
or 4 membered ring contains 1 heteroatom selected from the group consisting of O, N and S. The 5 membered ring can contain zero or one double bond and one, two or three
heteroatoms selected from the group consisting of O, N and S. The 6 or 7 membered ring contains zero, one or two double bonds and one, two or three heteroatoms selected from the group consisting of O, N and S. The monocyclic heterocycle is connected to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the monocyclic heterocycle. Representative examples of monocyclic heterocycle include, but are not limited to, azetidinyl, azepanyl, aziridinyl, diazepanyl, 1 ,3-dioxanyl, 1 ,3-dioxolanyl, 1 ,3-dithiolanyl, 1 ,3-dithianyl, imidazolinyl, imidazolidinyl, isothiazolinyl, isothiazolidinyl, isoxazolinyl, isoxazolidinyl, morpholinyl, oxadiazolinyl, oxadiazolidinyl, oxazolinyl,
oxazolidinyl, piperazinyl, piperidinyl, pyranyl, pyrazolinyl, pyrazolidinyl, pyrrolinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, thiadiazolinyl, thiadiazolidinyl, thiazolinyl, thiazolidinyl, thiomorpholinyl, 1 ,1-dioxidothiomorpholinyl (thiomorpholine sulfone), thiopyranyl, and trithianyl. The bicyclic heterocycle is a monocyclic heterocycle fused to either a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocycle, or a monocyclic heteroaryl. The bicyclic heterocycle is connected to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the monocyclic heterocycle portion of the bicyclic ring system. Representative examples of bicyclic heterocyclyls include, but are not limited to, 2,3-dihydrobenzofuran-2-yl, 2,3-dihydrobenzofuran-3-yl, indolin-1-yl, indolin-2-yl, indolin-3-yl, 2,3-dihydrobenzothien-2-yl, decahydroquinolinyl, decahydroisoquinolinyl, octahydro-1/-/-indolyl, and octahydrobenzofuranyl. Heterocyclyl groups are optionally substituted with one or two groups which are independently oxo or thioxo. In certain embodiments, the bicyclic heterocyclyl is a 5 or 6 membered monocyclic heterocyclyl ring fused to phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, a 5 or 6 membered monocyclic heterocyclyl, or a 5 or 6 membered monocyclic heteroaryl, wherein the bicyclic heterocyclyl is optionally substituted by one or two groups which are independently oxo or thioxo.
[0105] The term“oxo” as used herein means a =0 group.
[0106] The term“saturated” as used herein means the referenced chemical structure does not contain any multiple carbon-carbon bonds. For example, a saturated cycloalkyl group as defined herein includes cyclohexyl, cyclopropyl, and the like.
[0107] The term "substituted", as used herein, means that a hydrogen radical of the designated moiety is replaced with the radical of a specified substituent, provided that the substitution results in a stable or chemically feasible compound. The term "substitutable", when used in reference to a designated atom, means that attached to the atom is a hydrogen radical, which can be replaced with the radical of a suitable substituent.
[0108] The phrase "one or more” substituents, as used herein, refers to a number of substituents that equals from one to the maximum number of substituents possible based on the number of available bonding sites, provided that the above conditions of stability and chemical feasibility are met. Unless otherwise indicated, an optionally substituted group may have a substituent at each substitutable position of the group, and the substituents may be either the same or different. As used herein, the term "independently selected" means that the same or different values may be selected for multiple instances of a given variable in a single compound.
[0109] The term“thioxo” as used herein means a =S group.
[0110] The term“unsaturated” as used herein means the referenced chemical structure contains at least one multiple carbon-carbon bond, but is not aromatic. For example, a unsaturated cycloalkyl group as defined herein includes cyclohexenyl, cyclopentenyl, cyclohexadienyl, and the like.
[0111] It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure. Unless otherwise stated, structures depicted herein are also meant to include all stereochemical forms of the structure; i.e. , the R and S configurations for each asymmetric center. Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the disclosure. Both the R and the S stereochemical isomers, as well as all mixtures thereof, are included within the scope of the disclosure.
[0112]“Pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio or which have otherwise been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals.
[0113]“Pharmaceutically acceptable salt” refers to both acid and base addition salts.
[0114]“Therapeutically effective amount” refers to that amount of a compound which, when administered to a subject, is sufficient to effect treatment for a disease or disorder described herein. The amount of a compound which constitutes a“therapeutically effective amount” will vary depending on the compound, the disorder and its severity, and the age of the subject to be treated, but can be determined routinely by one of ordinary skill in the art.
[0115]“Treating” or“treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, preferably a human, and includes:
i. inhibiting a disease or disorder, i.e., arresting its development;
ii. relieving a disease or disorder, i.e., causing regression of the disorder;
iii. slowing progression of the disorder; and/or
iv. inhibiting, relieving, ameliorating, or slowing progression of one or more symptoms of the disease or disorder.
In certain embodiments, treating as used herein includes inhibiting a disease or disorder. In certain embodiments, treating as used herein includes inhibiting, relieving, ameliorating, or slowing progression of one or more symptoms of the disease or disorder.
[0116]“Subject” refers to a warm blooded animal such as a mammal, preferably a human, or a human child, which is afflicted with, or has the potential to be afflicted with one or more diseases and disorders described herein.
Methods of Preparation
[0117] Many general references providing commonly known chemical synthetic schemes and conditions useful for synthesizing the disclosed compounds are available (see, e.g., Smith and March, March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, Fifth Ed., Wiley-lnterscience, 2001 ; or Vogel, A Textbook of Practical Organic Chemistry, Including Qualitative Organic Analysis, Fourth Ed., New York: Longman, 1978).
[0118] Compounds as described herein can be purified by any of the means known in the art, including chromatographic means, such as HPLC, preparative thin layer
chromatography, flash column chromatography and ion exchange chromatography. Any suitable stationary phase can be used, including normal and reversed phases as well as ionic resins. Most typically the disclosed compounds are purified via silica gel and/or alumina chromatography. See, e.g., Introduction to Modern Liquid Chromatography, 2nd Edition, ed. L. R. Snyder and J. J. Kirkland, John Wiley and Sons, 1979; and Thin Layer
Chromatography, ed E. Stahl, Springer-Verlag, New York, 1969.
[0119] During any of the processes for preparation of the subject compounds, it may be necessary and/or desirable to protect sensitive or reactive groups on any of the molecules concerned. This may be achieved by means of conventional protecting groups as described in standard works, such as J. F. W. McOmie, "Protective Groups in Organic Chemistry,” Plenum Press, London and New York 1973, in T. W. Greene and P. G. M. Wuts, "Protective Groups in Organic Synthesis,” Third edition, Wiley, New York 1999, in "The Peptides";
Volume 3 (editors: E. Gross and J. Meienhofer), Academic Press, London and New York 1981 , in "Methoden der organischen Chemie,” Houben-Weyl, 4.sup.th edition, Vol. 15/1,
Georg Thieme Verlag, Stuttgart 1974, in H.-D. Jakubke and H. Jescheit, "Aminosauren, Peptide, Proteine,” Verlag Chemie, Weinheim, Deerfield Beach, and Basel 1982, and/or in Jochen Lehmann, "Chemie der Kohlenhydrate: Monosaccharide and Derivate,” Georg Thieme Verlag, Stuttgart 1974. The protecting groups may be removed at a convenient subsequent stage using methods known from the art.
[0120] The compounds disclosed herein can be made using procedures familiar to the person of ordinary skill in the art and as described herein. For example, compounds of structural formula (I) can be prepared according to general procedures (below), and/or analogous synthetic procedures. One of skill in the art can adapt the reaction sequences of Examples 1-217 and general procedures to fit the desired target molecule. Of course, in certain situations one of skill in the art will use different reagents to affect one or more of the individual steps or to use protected versions of certain of the substituents. Additionally, one skilled in the art would recognize that compounds of the disclosure can be synthesized using different routes altogether.
EXAMPLES
[0121] The preparation of the compounds of the disclosure is illustrated further by the following examples, which are not to be construed as limiting the disclosure in scope or spirit to the specific procedures and compounds described in them. In all cases, unless otherwise specified, the column chromatography is performed using a silica gel solid phase.
Example 1 : 1-(2-chlorophenyl)-2-(2-(4-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5- c]pyridin-5-yl)ethan-1-ol
[0122] To the solution of 2-bromo-1-(2-chlorophenyl)ethan-1-one (2.33 g, 10 mmol) in methanol (25 mL) was slowly added NaBH4 (0.38 g, 10 mmol) in ice bath. The resulting mixture was stirred at room temperature for 16 hours, evaporated under vacuum and purified by preparative TLC (prep-TLC) (10% ethyl acetate in petroleum ether) resulting in 2-bromo- 1-(2-chlorophenyl)ethan-1-ol (45 mg, 1%) as a yellow oil.
[0123] The mixture of 2-bromo-1-(2-chlorophenyl)ethan-1-ol (45 mg, 0.19 mmol), 2-(4- chlorophenyl)-4,5,6,7-tetrahydro-3/-/-imidazo[4,5-c]pyridine hydrochloride (52 mg, 0.19 mmol) and K2C03 (52 mg, 0.38 mmol) in dimethylformamide (0.5 mL) was stirred at 60 °C for 16 hours. The resulting mixture was evaporated under vacuum and purified by prep-TLC (ethyl acetate) resulting in 1-(2-chlorophenyl)-2-(2-(4-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-
imidazo[4,5-c]pyridin-5-yl)ethan-1-ol (5 mg, 14%) as a white solid. MS (ESI): mass calcd. for C20H19CI2N3O 388.29, m/z found 387.8 [M+H]+. 1 H NMR (400 MHz, CD3OD) d ppm 7.80 (d, J = 10.4 Hz, 2H), 7.70 (d, J = 7.6 Hz, 1 H), 7.46-7.26 (m, 5H), 5.44-5.41 (m, 1 H), 3.87 (q, J = 14.4 Hz, 2H), 3.19-3.07 (m, 2H), 2.93-2.67 (m, 4H).
Example 2: 1-(2-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5- c]pyridin-5-yl)ethan-1-ol
[0124] To a mixture of 2-bromo-1-(2-chlorophenyl)ethan-1-one (233 mg, 1 mmol) and 2-(2- chlorophenyl)-4,5,6,7-tetrahydro-3/-/-imidazo[4,5-c]pyridine (233 mg, 1 mmol) in
dichloromethane (5 ml_) was added triethylamine (303 mg). The resulting solution was stirred at room temperature for 16 hours, concentrated and purified by silica column (0-5% methanol in dichloromethane) to afford 1-(2-chlorophenyl)-2-(2-(2-chlorophenyl)-3, 4,6,7- tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)ethan-1-one (100 mg, 26 % yield) as yellow solid. MS (ESI): mass calcd. for C2oH17Cl2N30 385.07, m/z found 385.8, 387.8 [M+H]+.
[0125] To a solution of 1-(2-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-one (100 mg, 0.26 mmol) in methanol (5 ml_) was added NaBH4 (11 mg, 0.28 mmol) in ice bath. The resulting mixture was stirred at 0 °C to room temperature for 2 hours, concentrated and purified by preparative HPLC (prep-HPLC) to afford 1-(2-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin- 5-yl)ethan-1-ol (30 mg, 29%) as yellow solid. MS (ESI): mass calcd. for q2oH19OI2N3q 387.09, m/z found 387.8 [M+H]+. 1 H NMR (400 MHz, DMSO-d6) d ppm 10.43 (bs, 1 H), 7.69 (m, 1 H), 7.60 (m, 1 H), 7. 46 (m, 1 H), 7. 41 (m, 4 H), 7.39 (m, 1 H), 6.47 (bs, 2H), 5.48 (t, t, J = 6 Hz, 1 H), 4.51 (m, 3H), 3.74 (m, 3H), 3.07 (m, 3H).
Example 3: 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5- c]pyridin-5-yl)ethan-1-ol
[0126] To a mixture of 2-bromo-1-(3-chlorophenyl)ethan-1-one (233 mg, 1 mmol) and 2-(2- chlorophenyl)-4,5,6,7-tetrahydro-3/-/-imidazo[4,5-c]pyridine (233 mg, 1 mmol) in
dichloromethane (5 mL) was added triethylamine (303 mg). The resulting solution was stirred at room temperature for 16 hours, concentrated and purified by silica column (0-5% methanol in dichloromethane) to afford 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3, 4,6,7- tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)ethan-1-one (200 mg, 52 % yield) as yellow solid. MS (ESI): mass calcd. for C2oH17Cl2N30 385.07, m/z found 385.8, 387.8 [M+H]+.
[0127] To a solution of 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-one (200 mg, 0.5 mmol) in methanol (10 mL) was added NaBH4 (22 mg, 0.57 mmol) in ice bath. The resulting mixture was stirred at 0 °C to room temperature for 2 hours, concentrated and purified by prep-HPLC to afford 1-(3- chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)ethan-1- ol (60 mg, 31 %) as white solid. MS (ESI): mass calcd. for ΰ2oH19¾N30 387.09, m/z found 387.7 [M+H]+. 1 H NMR (400 MHz, DMSO-d6) d ppm 12.02 (bs, 1 H), 8.16 (s, 1 H), 7.76 (dd, J = 8, 4 HZ, 1 H), 7.53 (d, J = 8 Hz, 1 H), 7.45 (s, 1 H), 7.40 - 7.35 (m, 4H), 7.31-7.29 (m, 1 H), 4.83 (t, J = 4 Hz, 1 H), 3.60 (s, 2H), 2.90-2.81 (m, 2H), 2.77-2.63 (m, 4H).
[0128] The racemate was separated by prep-supercritical fluid chromatography to afford Example 3-S ((S)-1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol; 22.4 mg, 44% yield) as white solid and Example 3-R ((R)-1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5- yl)ethan-1-ol; 19.7 mg, 39% yield) as white solid. Example 3-S: MS (ESI): mass calcd. for C2OH17CI2N30 385.07, m/z found 387.7 [M+H]+. Chiral HPLC (CS30_FR12.5.met) Rt = 5.47 min. 1 H NMR (400 MHz, CD3OD) d ppm 8.41 (s, 1 H), 7.53 (m, 1 H), 7.53 - 7.45 (m, 2H), 7.44 - 7.32 (m, 5H), 5.1 1 (t, J=7.2Hz, 1 H), 4.20 (s, 2H), 3.45 (t, J = 7.6 Hz, 2H), 3.20 - 3.02 (m, 2H), 2.98 (m, 2 H).. Example 3-R: MS (ESI): mass calcd. for C2oH17CI2N30 385.07, m/z found 387.7 [M+H]+. Chiral HPLC (CS30_FR12.5.met) Rt = 6.37 min. 1 H NMR (400 MHz, CD3OD) d ppm 8.41 (s, 1 H), 7.53 (m, 1 H), 7.53 - 7.45 (m, 2H), 7.44 - 7.32 (m, 5H), 5.11 (t, J=7.2Hz, 1 H), 4.20 (s, 2H), 3.45 (t, J = 7.6 Hz, 2H), 3.20 - 3.02 (m, 2H), 2.98 (m, 2 H).
Examples 4 - 7
[0129] The following compounds are prepared substantially according to the procedures described above:
Examples 8 and 9: (S)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-ol and (f?)-2-(2-(2-chlorophenyl)-3,4,6,7- tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-ol
[0130] A mixture of 1-(3-(chloromethyl)phenyl)ethan-1-one (4.2 g, 25 mmol ), CH3S02Na (5.9 g, 50 mmol) in dimethylformamide (40 ml_) was stirred at room temperature for 15 hours. The reaction solution was diluted with water (200 ml_), and extracted with ethyl acetate (60 ml_x3). The organic phase was washed with brine (60 ml_), dried, concentrated and purified on silica gel column (30: 1 dichloromethane:methanol) to afford 1-(3- ((methylsulfonyl)methyl)phenyl)ethan-1-one (4.2 g, 47% yield) as brown solid. ESI-MS
[M+H]+:212.9
[0131] To a mixture of 1-(3-(( ethylsulfonyl) ethyl)phenyl)ethan-1-one (600 g, 2.83 mmol), triethylamine (572 mg, 5.66 mmol) in tetrahydrofuran (40 ml_) was added TMSOTf (942 mg, 4.25 mmol) at 0 °C under nitrogen atmosphere. The reaction solution was stirred at room temperature for 15 hours. The reaction was diluted with ice water (40 ml_), and extracted with dichloromethane (30 ml_x3). The combined organic phases were
concentrated and purified on silica gel column (5: 1 petroleum ether/ethyl acetate) to afford trimethyl((1-(3-((methylsulfonyl)methyl)phenyl)vinyl)oxy)-silane (600 mg, 74% yield) as light yellow oil. ESI-MS [M +H]+: 284.9
[0132] A mixture of trimethyl((1-(3-((methylsulfonyl)methyl)phenyl)vinyl)oxy)silane (1.5 g, 5 mmol), /V-bromosuccinimide (1.6 g, 6 mmol) in tetrahydrofuran (30 ml_) and water (3 ml_) was stirred at room temperature for 15 hours. The reaction was diluted with ice water (30 ml_), extracted with dichloromethane (30 ml_x3). The combined organic phases were concentrated and purified on silica gel column (1 :1 petroleum ether: ethyl acetate) to afford 2- bromo-1-(3-((methylsulfonyl)methyl)phenyl)-ethan-1-one (1 g, 68% yield) as light yellow oil. ESI-MS [M +H]+: 290.7, 292.7
[0133] A mixture of 2-bromo-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-one (500 mg, 1.72 mmol), 2-(2-chlorophenyl)-4,5,6,7-tetrahydro-3H-imidazo[4,5-c]pyridine (401 mg, 1.72 mmol), K2C03 (474 mg, 3.44 mmol) in CH3CN (20 ml_) was stirred at room temperature for 15 hours. Water (30 ml_) was added, extracted with dichloromethane (30 ml_x3). The combined organic phases were concentrated and purified on silica gel column (3: 1 petroleum etherethyl acetate) to afford 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H-imidazo[4,5- c]pyridin-5-yl)-1-(3-((methylsulfonyl)-methyl)phenyl)ethan-1-one (550 mg, 71 % yield) as yellow solid. ESI-MS [M +H]+: 443.8.
[0134] To a solution of 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5- yl)-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-one (443 mg, 1 mmol) in methanol (20 ml_) was NaBH4 (76 mg, 2 mmol) at 0 °C. The reaction solution was stirred at room temperature for 15 hours. Water (30 ml_) was then added, and the mixture was extracted with
dichloromethane (50 ml_x3). The combined organic phases were concentrated and purified with chiral HPLC to afford Example 8 and Example 9.
[0135] Example 8: (S)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)-1-(3-((methylsulfonyl)methyl)phenyl)ethan-1-ol (33.3 mg, 7% yield) as white solid. ESI- MS [M +H]+: 445.8. 1 H NMR (400 MHz, DMSO-d6) d ppm 1 1.95 (s, 1 H), 7.77 (d, J = 7.1 Hz, 1 H), 7.53 (d, J = 7.5 Hz, 1 H), 7.45 (s, 1 H), 7.38 (dt, J = 14.7, 7.4 Hz, 4H), 7.29 (d, J = 7.1 Hz, 1 H), 5.24 (s, 1 H), 4.82 (s, 1 H), 4.48 (s, 2H), 3.60 (s, 2H), 2.87 (s, 4H), 2.79 - 2.57 (m, 4H).
[0136] Example 9: (R)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)-1-(3-((methylsulfonyl)methyl) phenyl)ethan-1-ol (33.1 mg, 7% yield) as white solid. ESI- MS [M +H]+: 445.8. 1 H NMR (400 MHz, DMSO-d6) d ppm 1 1.96 (s, 1 H), 7.76 (d, J = 7.2 Hz, 1 H), 7.53 (d, J = 7.5 Hz, 1 H), 7.45 (s, 1 H), 7.38 (dt, J = 14.5, 7.4 Hz, 3H), 7.29 (d, J = 7.1 Hz, 1 H), 5.25 (s, 1 H), 4.83 (s, 1 H), 4.48 (s, 2H), 3.62 (s, 2H), 2.87 (s, 5H), 2.79 - 2.56 (m, 4H).
Example 10: 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(3- (methylsulfonyl)phenyl)ethan-1-ol
[0137] A mixture of 3-(methylsulfonyl)benzoic acid (286 mg, 1.14 mmol), (COCI)2 (1.1 ml_, 126 mmol) in dichloromethane (20 ml_) and dimethylformamide (0.5 ml_) was stirred at room temperature for 1 hour. The solvent was removed under vacuum, and dichloromethane (20 ml_) was added, followed by (diazomethyl)trimethylsilane (260 mg, 2.28 mmol). The mixture was stirred at room temperature for 3 hours, and HBr (2 ml_) was added. The mixture was stirred at room temperature for 15 hours, diluted in dichloromethane (60 ml_), washed with water (30 ml_), washed with saturated NaHC03 solution (30 ml_), and washed with brine (30 ml_). The organic phase was dried and concentrated to afford 2-bromo-1-(3- (methylsulfonyl)phenyl)ethan-1-one (1 13 mg, 36% yield) as brown solid. ESI-MS [M +H]+: 276.7, 278.7.
[0138] A mixture of 2-bro o-1-(3-( ethylsulfonyl)phenyl)ethan-1-one1 (500 g, 1.81 mmol), 2-(2-chlorophenyl)-4,5,6,7-tetrahydro-3H-imidazo[4,5-c]pyridine (423 mg, 1.81 mmol), K2C03 (500 mg, 3.62 mmol) in CH3CN (30 ml_) was stirred at room temperature for 15 hours. Water (30 ml_) was added, and the mixture was extracted with dichloromethane (30 ml_x3). The combined organic phases were concentrated and purified on silica gel column (1 : 1 petroleum etherethyl acetate) to afford 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro- 5H-imidazo[4,5-c]pyridin-5-yl)-1-(3-(methylsulfonyl)-phenyl)ethan-1-one (300 mg, 38% yield) as yellow solid. ESI-MS [M +H]+: 429.8
[0139] To a solution of 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)-1-(3-(methylsulfonyl)phenyl)ethan-1-one (150 mg, 0.35 mmol) in methanol (10 ml_) was added NaBH4 (27 mg, 0.7 mmol) and stirred at room temperature for 2 hours. The reaction solution concentrated and purified by prep-HPLC to afford 2-(2-(2-chlorophenyl)-3,4,6,7- tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)-1-(3-(methylsulfonyl)phenyl)ethan-1-ol (35.9 mg, 21 % yield) as white solid. ESI-MS [M +H]+: 431.8. 1 H NMR (400 MHz, DMSO-d6) d ppm
12.13 (s, 1 H), 8.17 (s, 1 H), 7.98 (s, 1 H), 7.82 (d, = 7.7 Hz, 1 H), 7.76 (dd, J = 6.3, 3.8 Hz, 2H), 7.62 (t, J = 7.7 Hz, 1 H), 7.53 (d, J = 7.8 Hz, 1 H), 7.45 - 7.32 (m, 2H), 4.97 (s, 1 H), 3.66 (s, 2H), 2.92 (d, J = 15.9 Hz, 2H), 2.80 (d, J = 14.1 Hz, 2H), 2.66 (s, 2H), 2.51 (s, 3H).
Example 11 : 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(2-(2- hydroxyethoxy)phenyl)ethan-1-ol
[0140] A mixture of 1-(2-hydroxyphenyl)ethan-1-one (10 g, 73.5 mmol), 2-chloroethan-1-ol (21 ml_), K2C03 (20 g, 146 mmol) in DMSO (100 ml_) was heated to 80 °C for 3 hours. The mixture was cooled to room temperature, ice water (50 ml_) was added. The mixture was extracted with dichloromethane (50 ml_x3). The combined organic phases were
concentrated and purified on silica gel (1 :1 petroleum etherethyl acetate) to afford 1-(2-(2- hydroxyethoxy)phenyl)ethan-1-one (10 g, 75% yield ) as yellow oil. ESI-MS [M +H]+: 181.0.
[0141] A mixture of 1-(2-(2-hydroxyethoxy)phenyl)ethan-1-one (8.7 g, 48.3 mmol), TBSCI (10.8 g, 72.5 mmol), imidazole (6.57 g, 96.7 mmol) in dimethylformamide(100 ml_) was stirred at room temperature for 15 hours. The reaction was quenched with water (300 ml_), extracted with dichloromethane (100 ml_x3). The combined organic phases were
concentrated and purified on silica gel column (2:1 petroleum etherethyl acetate) to afford 1- (2-(2-((tert-butyldimethylsilyl)oxy)ethoxy)phenyl)ethan-1-one (9 g, 63% yield) as yellow solid. ESI-MS [M +Na]+: 316.9.
[0142] To a mixture of 1-(2-(2-((tert-butyldimethylsilyl)oxy)ethoxy)phenyl)ethan-1-one (3 g, 10.1 mmol), TEA (2.05 g, 20.2 mmol) in tetrahydrofuran (30 ml_) was added TMSOTf ( 2.92 g, 13.1 mmol) at 0 °C under nitrogen atmosphere. The reaction solution was stirred at room temperature for 15 hours, diluted with ice water (40 ml_), and extracted with dichloromethane (30 ml_x3). The combined organic phases were concentrated and purified on silica gel column (5:1 petroleum etherethyl acetate) to afford the product (2.7 g, 72% yield) as light yellow oil. ESI-MS [M +H]+: 367.0.
[0143] A mixture of tert-butyldimethyl(2-(2-(1-((trimethylsilyl)oxy)vinyl)phenoxy)ethoxy)silane (2.7 g, 7.4 mmol), /V-bromosuccinimide ( 1.3 g, 7.4 mmol) in tetrahydrofuran (30 ml_) and water (3 ml_) was stirred at room temperature for 15 hours, diluted with ice water (30 ml_),
and extracted with dichloromethane (30 ml_x3). The combined organic phases were concentrated and purified on silica gel column (1 : 1 petroleum ether: ethyl acetate) to afford 2- bromo-1-(2-(2-hydroxyethoxy)phenyl)ethan-1-one (1 g, 52 % yield) as light yellow oil. ESI- MS [M +H]+: 258.9, 260.9.
[0144] A mixture of 2-bromo-1-(2-(2-hydroxyethoxy)phenyl)ethan-1-one (500 mg, 1.93 mmol), 2-(2-chlorophenyl)-4,5,6,7-tetrahydro-3H-imidazo[4,5-c]pyridine (451 mg, 1.93mmol), K2C03 (532 mg, 3.86 mmol) in CH3CN (50 ml_) was stirred at room temperature for 15 hours. Water (30 ml_) was added, and the mixture was extracted with dichloromethane (30 ml_x3). The combined organic phases were concentrated and purified on silica gel column (1 : 1 petroleum etherethyl acetate) to afford 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H- imidazo[4,5-c]pyridin-5-yl)-1-(2-(2-hydroxyethoxy)phenyl)ethan-1-one (400 mg, 50% yield) as white solid. ESI-MS [M +H]+: 411.8.
[0145] To a solution of 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5- yl)-1-(2-(2-hydroxyethoxy)phenyl)ethan-1-one (400 mg, 0.97 mmol) in methanol (30 ml) was NaBH4 (73 mg, 1.94 mmol) at 0 °C. The reaction solution was stirred at room temperature for 15 hours. Water (30 ml_) was added, and the mixture was extracted with dichloromethane (50 ml_x3). The combined organic phases were concentrated and purified with chiral HPLC to afford 2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(2-(2- hydroxyethoxy)-phenyl)ethan-1-ol (128 mg, 28 % yield) as white solid. ESI-MS [M +H]+: 413.9. 1 H NMR (400 MHz, DMSO-cfe) d ppm 8.20 (s, 1 H), 7.78 (d, J = 7.3 Hz, 1 H), 7.53 (d, J = 7.4 Hz, 1 H), 7.47 (d, J = 7.4 Hz, 1 H), 7.39 (p, J = 7.3 Hz, 2H), 7.21 (t, J = 7.6 Hz, 1 H), 6.95 (d, J = 7.8 Hz, 2H), 5.23 (s, 1 H), 4.02 (t, J = 4.8 Hz, 2H), 3.76 (s, 3H), 3.00 (s, 2H), 2.83 (s,
1 H), 2.69 (s, 2H), 2.51 (s, 3H).
Examples 12 - 14
[0146] The following compounds are prepared substantially according to the procedures described above:
Example 15: 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-1-methyl-1 ,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol
[0147] A mixture of 2-chlorobenzimidamide (33 g, 214 mmol), tert-butyl 3-bromo-4- oxopiperidine-1-carboxylate (59 g, 214 mmol), K2C03 (35 g, 257 mmol) in CH3CN (30 ml_) was heated to 80 °C for 15 hours. Water (500 ml_) was added, and the mixture was extracted with dichloromethane (500 ml_x3). The combined organic phases were
concentrated and purified on silica gel column (10:1 petroleum ether: ethyl acetate) to afford tert-butyl 2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridine-5-carboxylate (15 g, 21% yield) as white solid. ESI-MS [M +H]+: 333.9.
[0148] To a solution of tert-butyl 2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5H-imidazo[4,5- c]pyridine-5-carboxylate (6.6 g, 19.8 mmol) in tetrahydrofuran (100 ml_) was added KHMDS at 0 °C. The solution was stirred at room temperature for 1 hour, and then cooled to 0 °C. CH3I was added dropwise, and the mixture was stirred at room temperature for 15 hours. Water (100 ml_) was added, and the mixture was extracted with dichloromethane (100 ml_x3). The combined organic phases were concentrated to afford tert-butyl 2-(2- chlorophenyl)-3-methyl-3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridine-5-carboxylate and tert- butyl 2-(2-chlorophenyl)-1-methyl-1 ,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridine-5-carboxylate (6 g, crude ) as gray oil. ESI-MS [M+H]+: 347.9.
[0149] A mixture of tert-butyl 2-(2-chlorophenyl)-3-methyl-3,4,6,7-tetrahydro-5H-imidazo[4,5- c]pyridine-5-carboxylate and tert-butyl 2-(2-chlorophenyl)-1-methyl-1 ,4,6,7-tetrahydro-5H- imidazo[4,5-c]pyridine-5-carboxylate (2 g, 5.7 mmol) in HCI-methanol was stirred at room temperature for 15 hours. The solvent was removed under vacuum, water (30 ml_) was added, and pH adjusted to 12-13 with 1 N NaOH solution. The mixture was extracted with
dichloromethane (100 mL*3), and the organic phase was concentrated and purified by prep- HPLC to afford 2-(2-chlorophenyl)-3-methyl-4,5,6,7-tetrahydro-3H-imidazo[4,5-c]pyridine (160 mg, 11 % yield). ESI-MS [M+H]+: 247.9. 2-(2-chlorophenyl)-1-methyl-4,5,6,7-tetrahydro- 1 H-imidazo[4,5-c]pyridine (700 g, 49% yield). ESI-MS [M +H]+: 247.9.
[0150] A mixture of 2-(2-chlorophenyl)-1 -methyl-4, 5,6, 7-tetrahydro-1 H-imidazo[4, 5- c]pyridine (350 mg, 1.4 mmol), 2-bromo-1-(3-chlorophenyl)ethan-1-one (327 mg, 1.4 mmol) and K2C03 (387 mg, 2.8 mmol) in CH3CN (5 ml_) was stirred at room temperature for 12 hours, concentrated and purified on silica gel column (20: 1 dichloromethane:methanol) to afford 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-1-methyl-1 ,4,6,7-tetrahydro-5H-imidazo[4,5- c]pyridin-5-yl)ethan-1-one (120 mg, 21 % yield) as yellow solid. ESI-MS [M +H]+: 400.0.
[0151] To a solution of 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-1-methyl-1 ,4,6,7-tetrahydro- 5H-imidazo[4,5-c]pyridin-5-yl)ethan-1-one (160 mg, 0.4 mmol) in methanol (5 ml_) was added NaBH4 (16 mg, 0.4 mmol) and stirred at room temperature for 1 hour. The mixture was concentrated and purified by prep-HPLC to afford 1-(3-chlorophenyl)-2-(2-(2- chlorophenyl)-1 -methyl-1 ,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)ethan-1-ol (22 mg, 12.3 yield) as white solid. ESI-MS [M +H]+: 387.8. 1 H NMR (400 MHz, CD3OD) d ppm 8.38 (s, 1 H), 7.67 - 7.46 (m, 5H), 7.44 - 7.28 (m, 3H), 5.11 (s, 1 H), 4.15 (s, 2H), 3.46 (s, 5H),
3.18 (s, 2H), 2.98 (s, 2H).
Example 16: 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3-methyl-3,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol
[0152] A mixture of 2-(2-chlorophenyl)-3-methyl-4,5,6,7-tetrahydro-3H-imidazo[4,5- c]pyridine (300 mg, 1.21 mmol), 2-bromo-1-(3-chlorophenyl)ethan-1-one (283 mg, 1.21 mmol) and K2C03 (334 mg, 2.42 mmol) in CH3CN (5 ml_) was stirred at room temperature for 12 hours. The mixture was concentrated and purified on silica gel column (20: 1
dichloromethane: methanol) to afford 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3-methyl- 3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)ethan-1-one (470 mg, 96% yield) as yellow solid. ESI-MS [M+H]+: 399.8
[0153] To a solution of 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3-methyl-3,4,6,7-tetrahydro- 5H-imidazo[4,5-c]pyridin-5-yl)ethan-1-one (400 mg, 1 mmol) in methanol (5 ml_) was added NaBH4 (38 mg, 1 mmol) and stirred at room temperature for 2 hour. The mixture was concentrated and purified by prep-HPLC to afford 1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-
3-methyl-3,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)ethan-1-ol (40 g, 8.9% yield) as white solid. ESI-MS [M +H]+: 401.8.1H NMR (400 MHz, CD3OD) d ppm 8.33 (s, 1H), 7.80- 7.27 (m, 8H), 5.17 - 50.4 (m, 1H), 4.10 (s, 1H), 3.43 (s, 2H), 3.33 (s, 3H), 3.30 - 3.26 (m, 1H), 3.15-2.99 (m, 2H), 2.95-2.78 (m, 2H).
Examples 17-23
[0154] The following compounds are prepared substantially according to the procedures described above:
Biological Example 1 : GIH-Mediated Transcription Assay
[0155] GN1 -mediated transcriptional luciferase reporter assay was performed using Shh- LIGHT2 cells in order to evaluate the effects on activation and inhibition of Gli1-mediated transcription by the compounds of the disclosure. Brief assay procedure is provided below.
[0156] Preparation of cell assay plates: Shh-LIGHT2 cells were harvested from about 80% confluent 10-cm dish using 0.25% Trypsin-EDTA solution. Medium was removed, and cells were washed with 5 ml_ DPBS and aspirated. Then, 1ml_ 0.25% Trypsin-EDTA solution was added to a 10-cm dish. The dish was placed in the incubator for 1-3 minutes, or until cells have detached. 3 ml_ of cell growth medium (DMEM, 10% FBS, 1% PenStrep, 1% sodium pyruvate, and 1% GlutaMax) was added to the 10-cm dish, and the contents were transferred to a conical tube.
[0157] Cell density was determined, and using the cell growth medium the volume of the suspension was adjusted to achieve a cell concentration of 3.2x105 cells/m L (8000 cells / 25 pl_). 25 mI_ of the Shh-LIGHT2 cell suspension was transferred to each well of a 384-well white-walled microplate (Corning #3570), and the cells were allowed to sit at room temperature for 30 minutes. The plates were incubated at 37°C/5% C02 overnight until they reached confluency on the second day.
[0158] The cell assay plate was removed from incubator after cells reached confluency. The culture medium was then manually removed from the cell plates, and the plates were centrifuged at 200 rpm for 30 seconds. In the case of antagonist evaluation, compounds (25 mI_) were added at semilog concentration (1.5 nM - 30 mM final concentration with 0.5% DMSO) in the assay medium (DMEM, 2% FBS, 1% PenStrep, 1% sodium pyruvate, and 1% GlutaMax), then incubated for 30 minutes at 37°C/5% C02. After 30min incubation of antagonist, cells were stimulated with agonist (purmorphamine, 5 mI_, 1.5 mM final), then incubate for 24 hr at 37°C/5% C02. In the case of angonist evaluation, cells were treated with the compounds in the absence of agonist, then incubated for 24 hr at 37°C/5% C02.
[0159] Luciferase assay: After incubation, the cell assay plate was allowed to acclimate to room temperature. Then, 20 pL of Duo-Glo® Luciferase Reagent (Promega) was added to each well of cell assay plate. The plate was briefly spun down, mixed, and incubated for 30 minutes at room temperature. The cell plate was read using luminometer for firefly luminescence activity. Then, 20 pL of Duo-Glo® Steop&Glo® Reagent (Promega) was
added to each well of cell assay plate. The plate was briefly spun down, mixed, and incubated for 30 minutes at room temperature. The cell plate was read using luminometer for Renilla luminescence activity. Ratio of fi refly: Renilla luminescence was calculated for each well. The compound well ratio was normalized to the ratio from a control well.
[0160] The results of GM-mediated transcription assay for the representative compounds of the disclosure are provided in Table 1. IC50 activity of 1-10 mM is labeled“+”, IC50 activity of 0.5-0.99 pM is labeled“++”, IC50 activity of 0.1-0.49 pM is labeled“+++”, IC50 activity of < 0.1 pM is labeled“++++”, and IC50 activity of >10 pM is labeled“±”.
Table 1.
[0161] Some embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
[0162] Various exemplary embodiments of the disclosure include, but are not limited to the enumerated embodiments listed below, which can be combined in any number and in any combination that is not technically or logically inconsistent.
[0163] Embodiment 1 provides a compound of the formula (I) as described above.
[0164] In embodiment 1-1 , the compound of embodiment 1 is not:
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
5-(diethylamino)-2-(5-(2-hydroxy-2-(4-methoxyphenyl)ethyl)-1-methyl-4,5,6,7-tetrahydro-1/-/- imidazo[4,5-c]pyridin-2-yl)phenol;
1-(4-bromophenyl)-2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol; or
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)-1-(4- methoxyphenyl)ethan-1-ol.
[0165] Embodiment 2 provides the compound of embodiment 1 , wherein m is 2, and n is 1.
[0166] Embodiment 3 provides the compound of embodiment 1 , wherein both m and n are 1.
[0167] Embodiment 4 provides the compound of embodiment 1 , wherein both m and n are 2.
[0169] Embodiment 6 provides the compound of any of embodiments 1-5, wherein p is 0.
[0170] Embodiment 7 provides the compound of any of embodiments 1-5, wherein p is 1 or 2.
[0171] Embodiment 8 provides the compound of any of embodiments 1-5, wherein p is 1.
[0172] Embodiment 9 provides the compound of embodiment 7 or 8, wherein R2 is C C3 alkyl.
[0173] Embodiment 10 provides the compound of embodiment 7 or 8, wherein R2 is methyl
[0174] Embodiment 11 provides the compound of any of embodiments 1-10, wherein R is -OH, -0(C C3 alkyl), -SH, -S(C C3 alkyl), -NH2, -NH(C C3 alkyl), or -N(C C3 alkyl)2.
[0175] Embodiment 12 provides the compound of any of embodiments 1-10, wherein R is -OH, -0(CH3), -SH, -S(CH3), -NH2, -NH(CH3), or -N(CH3)2.
[0176] Embodiment 13 provides the compound of embodiment 12, wherein R is -OH, -SH, or -NH2.
[0177] Embodiment 14 provides the compound of any of embodiments 1-10, wherein R is -OH, -0(C C6 alkyl), -NH2, -NH(C C6 alkyl), or -N(C C6 alkyl)2.
[0178] Embodiment 15 provides the compound of embodiment 14, wherein R is -OH, -0(CH3), -NH2, or -NH(CH3).
[0179] Embodiment 16 provides the compound of embodiment 14, wherein R is -OH or -NH2.
[0180] Embodiment 17 provides the compound of any of embodiments 1-10, wherein R is - OH.
[0181] Embodiment 18 provides the compound of any of embodiments 1-17, wherein R^ is selected from hydrogen, C C3 alkyl, C C3 haloalkyl, C3-C6 cycloalkyl, heterocyclyl, hydroxy(C C3 alkyl), alkoxy(CrC3 alkyl), -OH, and oxetanyl.
[0182] Embodiment 19 provides the compound of any of embodiments 1-17, wherein R^ is selected from R^ is selected from hydrogen, CrC6 alkyl, CrC6 haloalkyl, C3-C8 cycloalkyl, heterocyclyl, hydroxy(C C6 alkyl), -OH, and oxetanyl.
[0183] Embodiment 20 provides the compound of any of embodiments 1-17, wherein R^ is hydrogen or C C6 alkyl.
[0184] Embodiment 21 provides the compound of any of embodiments 1-17, wherein R^ is hydrogen or methyl.
[0185] Embodiment 22 provides the compound of any of embodiments 1-17, wherein R^ is hydrogen.
[0186] Embodiment 23 provides the compound of any of embodiments 1-16, wherein R^ is methyl.
[0187] Embodiment 24 provides the compound of any of embodiments 1-23, wherein ring A represents an aryl optionally substituted with one or more R3 or heteroaryl optionally substituted with one or more R3.
[0188] Embodiment 25 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl optionally substituted with one or more R3 or 6-membered heteroaryl optionally substituted with one or more R3.
[0189] Embodiment 26 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl optionally substituted with one or more R3 or pyridinyl optionally substituted with one or more R3.
[0190] Embodiment 27 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl optionally substituted with one or more R3; or wherein ring A represents phenyl substituted with one or more R3; or wherein ring A represents phenyl optionally substituted with one R3; or wherein ring A represents phenyl substituted with one R3.
[0191] Embodiment 28 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl.
[0192] Embodiment 29 provides the compound of any of embodiments 1-28, wherein each R3 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CI-C6 alkyl), -N(CI-C6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(C C6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -S02R7, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, and C3-C8 cycloalkyl optionally substituted with one or more Re-
10193] Embodiment 30 provides the compound of any of embodiments 1-28, wherein each R3 is independently selected from halogen, CrC6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CI-C6 alkyl), -N(CI-C6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -S02R7, cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C3-C8 cycloalkyl.
[0194] Embodiment 31 provides the compound of any of embodiments 1-28, wherein each R3 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -S02R7, cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C3-C8 cycloalkyl.
[0195] Embodiment 32 provides the compound of any of embodiments 1-28, wherein each R3 is independently selected from halogen, CrC6 alkyl optionally substituted with one or
more R5, C C6 haloalkyl, -NH2, -NH(CI-C6 alkyl), -N(CI-C6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, -S02R7, cyclopropylethynyl, aryl, heteroaryl, heterocyclyl, and C3-C8 cycloalkyl.
[0196] Embodiment 33 The compound of any of embodiments 1-28, wherein each R3 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -OH, CrC6 alkoxy, CrC6 haloalkoxy, -S02R7, cyclopropylethynyl, and heteroaryl.
[0197] Embodiment 34 provides the compound of any of embodiments 1-28, wherein each R3 is independently selected from halogen, C C6 alkoxy, -S02R7, cyclopropylethynyl, and heteroaryl.
[0198] Embodiment 35 provides the compound of any of embodiments 1-28, wherein each R3 is independently selected from halogen, C C6 alkoxy, cyclopropylethynyl, and heteroaryl; or wherein each R3 is independently selected from halogen, C C6 alkoxy, and
cyclopropylethynyl.
[0199] Embodiment 36 provides the compound of any of embodiments 1-28, wherein each R3 is independently halogen.
[0200] Embodiment 37 provides the compound of any of embodiments 1-23, wherein ring A represents phenyl substituted with halogen (e.g., chloro or fluoro).
[0201] Embodiment 38 provides the compound of any of embodiments 1-23, wherein ring A represents 2-chlorophenyl.
[0202] Embodiment 39 provides the compound of any of embodiments 1 and 18-23, wherein m is 2, n is 1 , p is 0, and ring A represents 2-chlorophenyl; e.g., having the formula:
[0203] Embodiment 40 provides the compound of any of embodiments 1-39, wherein ring B represents an aryl optionally substituted with one or more R4, heteroaryl optionally substituted with one or more R4, or heterocyclyl optionally substituted with one or more R4.
[0204] Embodiment 41 provides the compound of any of embodiments 1-39, wherein ring B represents an aryl optionally substituted with one or more R4 or heteroaryl optionally substituted with one or more R4, heterocyclyl optionally substituted with one or more R4.
[0205] Embodiment 42 provides the compound of any of embodiments 1-39, wherein ring B represents phenyl, pyridinyl, pyrimidinyl, benzo[d][1 ,3]dioxolyl (e.g., benzo[d][1 ,3]dioxol-4-yl), 2,3-dihydrobenzo[b][1 ,4]dioxinyl (e.g., 2,3-dihydrobenzo[b][1 ,4]dioxin-5-yl), each optionally substituted with one or more R4.
[0206] Embodiment 43 provides the compound of any of embodiments 1-39, wherein ring B represents phenyl optionally substituted with one or more R4; or wherein ring B represents phenyl optionally substituted with one R4.
[0207] Embodiment 44 provides the compound of any of embodiments 1-43, wherein each R4 is independently selected from halogen, C C6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(C C6 alkyl), -N(C C6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -S02R7, -S020R7, -S02N(R7)2, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, C3-C8 cycloalkyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, cycloalkyloxy optionally substituted with one or more R6, 2-hydroxy-3-methoxypropoxy, and (2-methoxyethoxy)methyl; or two R4 groups when attached to the same carbon atom form =0.
[0208] Embodiment 45 provides the compound of any of embodiments 1-43, wherein each R4 is independently selected from halogen, CrC6 alkyl optionally substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(C C6 alkyl), -N(C C6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), -S02R7, cyclopropylethynyl, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, C3-C8 cycloalkyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, 2-hydroxy-3-methoxypropoxy, and (2-methoxyethoxy)methyl; or two R4 groups when attached to the same carbon atom form =0.
[0209] Embodiment 46 provides the compound of any of embodiments 1-43, wherein each R4 is independently selected from halogen, C C6 alkyl, C C6 haloalkyl, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl),
alkoxy(CrC6 alkoxy), -SO2R7, cyclopropylethynyl, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, 2-hydroxy-3-methoxypropoxy, and (2- methoxyethoxy)methyl; or two R4 groups when attached to the same carbon atom form =0.
[0210] Embodiment 47 provides the compound of any of embodiments 1-43, wherein each R4 is independently selected from halogen, C C6 alkyl, C C6 haloalkyl, -OH, C C6 alkoxy, C C6 haloalkoxy, -SO2R7, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with R6, and cyclopropyl.
[0211] Embodiment 48 provides the compound of any of embodiments 1-43, wherein each R4 is independently selected from halogen, C C6 alkyl, -OH, C C6 alkoxy, -SO2R7, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with R6, and cyclopropyl.
[0212] Embodiment 49 provides the compound of any of embodiments 1-43, wherein each R4 is independently selected from halogen, C C6 alkyl, -OH, C C6 alkoxy,
cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with methyl, and cyclopropyl; or wherein each R4 is independently selected from halogen, -OH, and CrC6 alkoxy.
[0213] Embodiment 50 provides the compound of any of embodiments 1-43, wherein each R4 is independently selected from halogen, methyl, -OH, methoxy, cyclopropylethynyl, oxetanyl, imidazolyl optionally substituted with methyl, and cyclopropyl; or wherein each R4 is independently selected from halogen, methyl, -OH, and methoxy.
[0214] Embodiment 51 provides the compound of any of embodiments 1-43, wherein each R4 is independently halogen.
[0215] Embodiment 52 provides the compound of any of embodiments 1-35, wherein ring B represents phenyl substituted with halogen (e.g., chloro or fluoro).
[0216] Embodiment 53 provides the compound of any of embodiments 1-35, wherein ring B represents 2-chlorophenyl.
[0217] Embodiment 54 provides the compound of embodiment 1 , which is selected from any of Examples 1 - 23, or a pharmaceutically acceptable salt thereof.
[0218] Embodiment 55 provides a pharmaceutical composition comprising a compound according to any one of embodiments 1-54 and a pharmaceutically acceptable carrier, solvent, adjuvant or diluent.
[0219] Embodiment 56 provides a method of treating neurological disorder, the method comprising administering to a subject in need of such treatment one or more compounds
according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
[0220] Embodiment 57 provides the method of embodiment 56, wherein the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post-infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies, optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age-associated myelin deficiency, Alzheimer’s Disease, and acquired and inherited neuropathies in the peripheral nervous system.
[0221] Embodiment 58 provides the method of embodiment 56, wherein the neurological disorder is Multiple Sclerosis.
[0222] Embodiment 59 provides the method of embodiment 56, wherein the neurological disorder is Alzheimer’s Disease.
[0223] Embodiment 60 provides a method of treating a non-CNS disease, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
[0224] Embodiment 61 provides the method of embodiment 60, wherein the non-CNS disease is cancer.
[0225] Embodiment 62 provides the method of embodiment 61 , wherein the cancer is characterized by elevated Gli1.
[0226] Embodiment 63 provides the method of embodiment 61 , wherein the cancer is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
[0227] Embodiment 64 provides the method of embodiment 60, wherein the non-CNS disease is cystic kidney disease, chronic liver disease, Hepatitis, C, obstructive pulmonary disease, organ fibrosis, or rheumatoid arthritis.
[0228] Embodiment 65 provides a method of inhibiting GN1 , the method comprising administering one or more compounds according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
[0229] Embodiment 66 provides a method for enhancing remeyelination, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of embodiments 1-54 or a pharmaceutical composition according to embodiment 55.
[0230] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be incorporated within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated herein by reference for all purposes.
Claims
1. A compound of the formula (I):
or a pharmaceutically acceptable salt thereof, wherein
m is an integer 1 or 2;
n is an integer 1 or 2;
p is an integer 0, 1 , or 2;
R is -OH, -0(C C6 alkyl), -SH, -S(C C6 alkyl), -NH2, -NH(C C6 alkyl), or -N(C C6 alkyl)2;
Ri is selected from hydrogen, CrC6 alkyl, CrC6 haloalkyl, C3-C8 cycloalkyl, heterocyclyl, hydroxy(C C6 alkyl), alkoxy(CrC6 alkyl), -OH, and oxetanyl;
R2 is Ci-C6 alkyl;
ring A represents an aryl optionally substituted with one or more R3, heteroaryl optionally substituted with one or more R3, or C4-C8 cycloalkyl optionally substituted with one or more R3; and
ring B represents an aryl optionally substituted with one or more R4, heteroaryl optionally substituted with one or more R4, heterocyclyl optionally substituted with one or more R4, or C4-C8 cycloalkyl optionally substituted with one or more R4;
wherein
each R3 is independently selected from halogen, -N02, -CN, C C6 alkyl optionally
substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(CrC6 alkyl), -N(CrC6 alkyl)2, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -CONH2, -CONH(C C6 alkyl), -CON(C C6 alkyl)2, -CONH-OH, -C02H, -C02(C C6 alkyl), -S02R7, -S020R7, -S02N(R7)2, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, and C3-C8 cycloalkyl optionally substituted with one or more R6;
each R4 is independently selected from halogen, -N02, -CN, CrC6 alkyl optionally
substituted with one or more R5, C C6 haloalkyl, -NH2, -NH(C C6 alkyl), -N(CI-C6 alkyl)2, -OH, CrC6 alkoxy, CrC6 haloalkoxy, hydroxy(CrC6 alkyl), hydroxy(CrC6 alkoxy), alkoxy(CrC6 alkyl), alkoxy(CrC6 alkoxy), amino(CrC6 alkyl), -CONH2, -CONH(C C6 alkyl), -CON(C C6 alkyl)2, -CONH-OH, -C02H, -C02(C C6
alkyl), -SO2R7, -SO2OR7, -S02N(R7)2, cyclopropylethynyl, aryl optionally substituted with one or more R6, heteroaryl optionally substituted with one or more R6, heterocyclyl optionally substituted with one or more R6, C3-C8 cycloalkyl optionally substituted with one or more R6, heterocyclyloxy optionally substituted with one or more R6, cycloalkyloxy optionally substituted with one or more R6, 2-hydroxy-3- methoxypropoxy, (2-methoxyethoxy) methyl, and 2-(3-(but-3-yn-1-yl)-3H-diazirin-3- yl)ethoxy; or two R4 groups when attached to the same carbon atom form =0;
each R5 is independently selected from the group consisting of halogen, -N02, -CN, C C6 alkyl, C C6 haloalkyl, -OH, C C6 alkoxy, C C6 haloalkoxy, hydroxy(CrC6 alkoxy), alkoxy(C C6 alkoxy), -SO2R7, -S020R7, and -S02N(R7)2;
each R6 is independently selected from the group consisting of halogen, -N02, -CN, C C6 alkyl, C C6 haloalkyl, -OH, C C6 alkoxy, and C C6 haloalkoxy; and
each R7 is independently selected from the group consisting of hydrogen, C C6 alkyl, phenyl, or tolyl;
provided the compound is not:
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- phenylethan-1-ol;
5-(diethylamino)-2-(5-(2-hydroxy-2-(4-methoxyphenyl)ethyl)-1-methyl-4,5,6,7-tetrahydro-1/-/- imidazo[4,5-c]pyridin-2-yl)phenol;
1-(4-bromophenyl)-2-(1-methyl-2-(3,4,5-trimethoxyphenyl)-1 ,4,6,7-tetrahydro-5/-/- imidazo[4,5-c]pyridin-5-yl)ethan-1-ol; or
2-(2-(3,4-dimethoxyphenyl)-1-methyl-1 ,4,6,7-tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl)-1-(4- methoxyphenyl)ethan- 1 -ol .
2. The compound of claim 1 , wherein m is 2, and n is 1 ; or wherein both m and n are 1 ; or wherein both m and n are 2.
4. The compound of any of claims 1-10, wherein R is -OH, -0(C C3 alkyl), -SH, -S(C C3 alkyl), -NH2, -NH(C C3 alkyl), or -N(C C3 alkyl)2; or wherein R is -OH, -0(CH3), -SH, -S(CH3), -NH2, -NH(CH3), or -N(CH3)2; or wherein R is -OH, -SH, or -NH2; or wherein R is -OH, -0(C C6 alkyl), -NH2, -NH(C C6 alkyl), or -N(C C6 alkyl)2.
5. The compound of any of claims 1-10, wherein R is -OH, -0(CH3), -NH2, or -NH(CH3); wherein R is -OH or -NH2; or wherein R is -OH.
6. The compound of any of claims 1-5, wherein
is selected from
is selected from hydrogen, C C6 alkyl, CrC6 haloalkyl, C3-C8 cycloalkyl, heterocyclyl, hydroxy(CrC6 alkyl), -OH, and oxetanyl; or wherein
is hydrogen or CrC6 alkyl; or wherein
is hydrogen or methyl; or wherein
is hydrogen; or wherein
is methyl.
7. The compound of any of claims 1-6, wherein ring A represents an aryl optionally substituted with one or more R3 or heteroaryl optionally substituted with one or more R3; or wherein ring A represents phenyl optionally substituted with one or more R3; or wherein ring A represents phenyl substituted with one or more R3; or wherein ring A represents phenyl optionally substituted with one R3; or wherein ring A represents phenyl substituted with one R3; or wherein ring A represents phenyl; or wherein ring A represents phenyl substituted with halogen (e.g., chloro or fluoro); or wherein ring A represents 2-chlorophenyl
8. The compound of any of claims 1 and 4-6, wherein m is 2, n is 1 , p is 0, and ring A represents 2-chlorophenyl; e.g., having the formula:
9. The compound of any of claims 1-8, wherein ring B represents an aryl optionally substituted with one or more R4 or heteroaryl optionally substituted with one or more R4, heterocyclyl optionally substituted with one or more R4; or wherein ring B represents phenyl, pyridinyl, pyrimidinyl, benzo[d][1 ,3]dioxolyl (e.g., benzo[d][1 ,3]dioxol-4-yl), 2,3- dihydrobenzo[b][1 ,4]dioxinyl (e.g., 2,3-dihydrobenzo[b][1 ,4]dioxin-5-yl), each optionally substituted with one or more R4; or wherein ring B represents phenyl optionally substituted with one or more R4; or wherein ring B represents phenyl optionally substituted with one R4; or wherein ring B represents phenyl substituted with halogen (e.g., chloro or fluoro); or wherein ring B represents 2-chlorophenyl.
10. The compound of claim 1 , which is:
1-(2-chlorophenyl)-2-(2-(4-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)ethan-1-ol;
1-(2-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)ethan-1-ol;
1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5- yl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(2,3- dihydrobenzo[b][1 ,4]dioxin-5-yl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(2,2- difluorobenzo[c(][1 ,3]dioxol-4-yl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(2,5- dimethoxyphenyl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(3,5- dimethoxyphenyl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(3-
((methylsulfonyl)methyl)phenyl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(3-
(methylsulfonyl)phenyl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(2-(2- hydroxyethoxy)phenyl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(4-methylpyrimidin-
2-yl)ethan-1-ol;
1-(3-(2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1- hydroxyethyl)phenoxy)-3-methoxypropan-2-ol;
1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-1 -methyl-1 , 4,6, 7-tetrahydro-5/-/-imidazo[4, 5- c]pyridin-5-yl)ethan- 1 -ol;
1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-3-methyl-3,4,6,7-tetrahydro-5/-/-imidazo[4,5- c]pyridin-5-yl)ethan-1-ol;
1-(3-chlorophenyl)-2-(2-(2-chlorophenyl)-4,6-dihydropyrrolo[3,4-c]imidazol-5(1/-/)-yl)ethan-1- ol;
1-(2-chlorophenyl)-2-(2-(2-chlorophenyl)-4- ethyl-3,4,6,7-tetrahydro-5/-/-i idazo[4,5- c]pyridin-5-yl)ethan-1-ol;
1-(2-chlorophenyl)-2-(2-(2-chlorophenyl)-4,4-di ethyl-3,4,6,7-tetrahydro-5/-/-i idazo[4,5- c]pyridin-5-yl)ethan- 1 -ol;
2-(2-(2-chlorophenyl)-3- ethyl-3,4,6,7-tetrahydro-5/-/-i idazo[4,5-c]pyridin-5-yl)-1-(2,5- di ethoxyphenyl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(3- ethoxyphenyl)ethan- 1 -ol ;
2-(2-(2-chlorophenyl)-3- ethyl-3,4,6,7-tetrahydro-5/-/-i idazo[4,5-c]pyridin-5-yl)-1-(2- ethylpyri idin-4-yl)ethan-1-ol;
2-(2-(2-chlorophenyl)-3-methyl-3,4,6,7-tetrahydro-5/-/-imidazo[4,5-c]pyridin-5-yl)-1-(2-
( ethylsulfonyl)phenyl)ethan-1-ol;
2-(2-(2-chloro-4-cyclopropylphenyl)-3- ethyl-3,4,6,7-tetrahydro-5/-/-i idazo[4,5-c]pyridin-5- yl)-1-(3-chlorophenyl)ethan-1-ol; and
a pharmaceutically acceptable salt thereof.
1 1. A pharmaceutical composition comprising a compound according to any one of claims 1-10 and a pharmaceutically acceptable carrier, solvent, adjuvant or diluent.
12. A method of treating neurological disorder, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of claims 1- 10 or a pharmaceutical composition according to claim 11.
13. The method of claim 12, wherein the neurological disorder is selected from multiple sclerosis, central pontine myelinolysis, acute disseminated encephalomyelitis, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, post-infectious encephalomyelitis, chronic inflammatory demyelinating polyneuropathy, Devic's disease, Balo's concentric sclerosis, the leukodystrophies, optic neuritis, transverse myelitis, cerebral palsy, spinal cord injury, age-associated myelin deficiency, Alzheimer’s Disease, and acquired and inherited neuropathies in the peripheral nervous system; or wherein the neurological disorder is multiple sclerosis; or wherein the neurological disorder is
Alzheimer’s Disease.
14. A method of treating a non-CNS disease, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of claims 1- 10 or a pharmaceutical composition according to claim 11.
15. The method of claim 14, wherein the non-CNS disease is cancer; or wherein the non- CNS disease is cystic kidney disease, chronic liver disease, Hepatitis, C, obstructive pulmonary disease, organ fibrosis, or rheumatoid arthritis; or wherein the non-CNS disease is cancer characterized by elevated GN1 ; or wherein the non-CNS disease is breast cancer, pancreatic cancer, colon cancer, lung cancer, rhabdomyosarcoma, basal-cell carcinoma, glioblastoma, medulloblastoma, leukemia, prostate cancer, skin cancer, lymphoma, esophageal cancer, ovarian cancer, thyroid cancer, osteosarcoma, liver cancer, multiple endocrine neoplasia, gastrointestinal cancer, or mesothelioma.
16. A method of inhibiting GN1 , the method comprising administering one or more compounds according to any one of claims 1-10 or a pharmaceutical composition according to claim 11.
17. A method for enhancing remeyelination, the method comprising administering to a subject in need of such treatment one or more compounds according to any one of claims 1- 10 or a pharmaceutical composition according to claim 11.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862769513P | 2018-11-19 | 2018-11-19 | |
| US62/769,513 | 2018-11-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020106755A1 true WO2020106755A1 (en) | 2020-05-28 |
Family
ID=68848482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/062267 Ceased WO2020106755A1 (en) | 2018-11-19 | 2019-11-19 | Inhibitors of gli1 as therapeutic agents |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2020106755A1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SU1069387A1 (en) * | 1982-07-01 | 1985-11-30 | Институт физико-органической химии и углехимии АН УССР | Dihydrochloride of 5-/beta-(n-anisil)-beta-oxyethyl/2-(3',4')-dimethoxyphenyl-1-methyl-4,5,6,7-tetrahydroimidazo/4,5-c/pyridine possessing spasmolytic effect |
| WO2003027234A2 (en) | 2001-09-26 | 2003-04-03 | Curis, Inc. | Small organic molecule regulators of cell proliferation |
| US6767888B1 (en) | 1997-06-27 | 2004-07-27 | Curis, Inc. | Neuroprotective methods and reagents |
-
2019
- 2019-11-19 WO PCT/US2019/062267 patent/WO2020106755A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SU1069387A1 (en) * | 1982-07-01 | 1985-11-30 | Институт физико-органической химии и углехимии АН УССР | Dihydrochloride of 5-/beta-(n-anisil)-beta-oxyethyl/2-(3',4')-dimethoxyphenyl-1-methyl-4,5,6,7-tetrahydroimidazo/4,5-c/pyridine possessing spasmolytic effect |
| US6767888B1 (en) | 1997-06-27 | 2004-07-27 | Curis, Inc. | Neuroprotective methods and reagents |
| US6683192B2 (en) | 2000-03-30 | 2004-01-27 | Curis, Inc. | Small organic molecule regulators of cell proliferation |
| WO2003027234A2 (en) | 2001-09-26 | 2003-04-03 | Curis, Inc. | Small organic molecule regulators of cell proliferation |
Non-Patent Citations (17)
| Title |
|---|
| "Introduction to Modern Liquid Chromatography", 1979, JOHN WILEY AND SONS |
| "The Peptides", vol. 3, 1981, ACADEMIC PRESS |
| "Thin Layer Chromatography", 1969, SPRINGER-VERLAG |
| FUTURE MEDICINAL CHEMISTRY, vol. 11, no. 6, 2019, pages 489 - 638 |
| H.-D. JAKUBKEH. JESCHEIT: "Aminosauren, Peptide, Proteine", 1982, VERLAG CHEMIE |
| J. F. W. MCOMIE: "Protective Groups in Organic Chemistry", 1973, PLENUM PRESS |
| J. M. HYMAN ET AL: "Small-molecule inhibitors reveal multiple strategies for Hedgehog pathway blockade", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 106, no. 33, 18 August 2009 (2009-08-18), pages 14132 - 14137, XP055022754, ISSN: 0027-8424, DOI: 10.1073/pnas.0907134106 * |
| JOCHEN LEHMANN: "Chemie der Kohlenhydrate: Monosaccharide and Derivate", vol. 15/1, 1974, GEORG THIEME VERLAG |
| JOURNAL OF BIOLOGY, vol. 1, 2002, pages 10 |
| LUNG CANCER:TARGETS AND THERAPY, vol. 9, 2018, pages 35 - 43 |
| M. LAUTH ET AL: "Inhibition of GLI-mediated transcription and tumor cell growth by small-molecule antagonists", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 104, no. 20, 15 May 2007 (2007-05-15), pages 8455 - 8460, XP055218038, ISSN: 0027-8424, DOI: 10.1073/pnas.0609699104 * |
| PNAS, vol. 99, no. 22, 2002, pages 14071 - 14076 |
| SMITHMARCH: "March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure", 2001, WILEY-INTERSCIENCE |
| T. W. GREENEM. WUTS: "Protective Groups in Organic Synthesis", 1999, WILEY |
| VOGEL: "Textbook of Practical Organic Chemistry, Including Qualitative Organic Analysis", 1978, LONGMAN |
| WHITAKER ET AL., ANN. NEUROL., vol. 38, no. 4, 1995, pages 635 - 632 |
| YU. M. YUTILOV ET AL: "Synthesis and biological activity of N(5)-?-oxyethylspinaceamines", PHARMACEUTICAL CHEMISTRY JOURNAL, vol. 23, no. 2, 1 February 1989 (1989-02-01), US, pages 119 - 122, XP055658835, ISSN: 0091-150X, DOI: 10.1007/BF00764457 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7054529B2 (en) | CXCR4 inhibitor and its use | |
| JP6994767B2 (en) | CXCR4 inhibitor and its use | |
| JP2020176136A (en) | Use of dihydropyridophthaladinone inhibitors of poly (ADP-ribose) polymerase (PARP) in the treatment of diseases associated with PTEN deficiency | |
| CA3099155A1 (en) | Anti-cancer nuclear hormone receptor-targeting compounds | |
| MX2011000721A (en) | Pyridazine derivatives as smo inhibitors. | |
| CA3138197A1 (en) | Anti-cancer nuclear hormone receptor-targeting compounds | |
| JP2019536785A (en) | Substituted pyrazole compounds for the treatment of hyperproliferative diseases and their use | |
| AU2008261491B2 (en) | Azaindole-indole coupled derivatives, preparation methods and uses thereof | |
| AU2009279944A1 (en) | Dihydropyridophthalazinone inhibitors of poly(ADP-ribose)polymerase (PARP) | |
| JP2021506838A (en) | Acyclic CXCR4 Inhibitors and Their Use | |
| BR112012018415A2 (en) | compound, composition, methods of preparing a composition and treatment, and, use of a compound. | |
| WO2015184983A1 (en) | Rapamycin derivative, preparation method therefor, and pharmaceutical composition and uses thereof | |
| WO2012166151A1 (en) | Use of dihydropyridophthalazinone inhibitors of poly (adp-ribose) polymerase (parp) in the treatment of myelodysplastic syndrome (mds) and acute myeloid leukaemia (aml) | |
| JP7536243B2 (en) | Inhibitors of MAP kinase interacting serine/threonine-protein kinase 1 (MNK1) and MAP kinase interacting serine/threonine-protein kinase 2 (MNK2), cancer treatment and therapeutic combinations - Patents.com | |
| CN109824693B (en) | BRD4 inhibitor and its application in tumor therapy | |
| TW201529071A (en) | Combination therapy for the treatment of cancer | |
| US12209092B2 (en) | Inhibitors of GLI1 as therapeutic agents | |
| JP2013527248A (en) | Treatment of cancer with wortmannin analogs | |
| EP2606032B1 (en) | Composition and methods for treating glioblastomas | |
| WO2020106755A1 (en) | Inhibitors of gli1 as therapeutic agents | |
| CN102372712B (en) | Imidazodiazine dual inhibitors of PI3K and mTOR | |
| CN103191120B (en) | A kind of pyrimidine derivatives preparation prevent and/or treat and/or adjuvant therapy of tumors medicine in purposes | |
| JP2021526503A (en) | Bexarotene derivatives and their use in the treatment of cancer | |
| WO2024073507A1 (en) | Macrocyclic compounds and uses thereof | |
| CN117957230A (en) | RIP1 kinase inhibitors and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19818431 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19818431 Country of ref document: EP Kind code of ref document: A1 |





























